text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
fig1 illustrates a conventional ds - cdma system 100 with a spreading factor ( sf ) of four ( 4 ). the conventional ds - cdma system 100 is used , for example , in mobile telephones . for a detailed discussion of exemplary ds - cdma systems 100 , see , for example , t . ottosson , “ precoding for minimization of envelope variations in multicode ds - cdma systems ,” wireless personal communications , 13 , 57 - 78 ( 2000 ), incorporated by reference herein . the conventional ds - cdma system 100 shown in fig1 is used for simultaneous transmission of four streams of information , a 0 , a 1 , a 2 and a 3 , that carry information of streams 0 , 1 , 2 , and 3 , respectively . variables a 0 , a 1 , a 2 and a 3 form the vector a =( a 0 , a 1 , a 2 , a 3 ). the vector s is referred to as the output vector that is applied to a communications channel . the vectors c 0 , c 1 , c 2 and c 3 are spreading sequences . generally , each information stream a 0 , a 1 , a 2 and a 3 is multiplied by a corresponding spreading sequence , c 0 , c 1 , c 2 and c 3 , respectively , by corresponding multipliers 110 - 1 through 110 - 4 , and the spread signals are combined at stage 120 prior to application to the channel . fig2 illustrates an exemplary code book a 200 that can be employed by the ds - cdma system 100 of fig1 . thus , the vectors a form the code book a of fig2 . the information bit from the ith information stream is encoded into the sign of the ith entry of a vector a . the logical zeroes ( 0s ) correspond to positive entries of a vector a and logical ones ( 1s ) correspond to negative entries . for example , in order to transmit logical zero in the 0th and 3rd information streams and logical one in the 1st and 2nd streams , the vector a =( a ,− a ,− a , a ) is transmitted . the value a is the amplitude of transmitted signals . typically , the amplitudes of each of the four streams of information , a 0 , a 1 , a 2 and a 3 , is the same . in some implementations of the conventional ds - cdma system 100 , the amplitude of one or more of the four streams of information , a 0 , a 1 , a 2 and a 3 , may be increased to provide a corresponding increase in energy ( and thus protection ) of the stream . for example , the amplitude of stream a 0 , which may be associated with a pilot signal , may be increased to improve the channel estimation . the vectors c 0 , c 1 , c 2 , c 3 are spreading sequences assigned to corresponding information streams . the spreading sequences c 0 , c 1 , c 2 , c 3 are defined as follows : c 0 =( 1 , 1 , 1 , 1 ), c 1 =( 1 , − 1 , 1 , − 1 ), c 2 =( 1 , 1 , − 1 , − 1 ), c 3 =( 1 , − 1 , − 1 , 1 ). it can be seen that these sequences form rows of the well - known hadamard matrix h 4 of dimension four ( see , e . g ., f . j . macwilliams and n . j . a . sloane , the theory of error - correcting codes , north - holland ( 1977 )), as follows : c _ i · c _ j = { 4 , if i = j ; 0 , if i ≠ j ; ( 1 ) where the multiplication · is the inner product of two vectors defined by the following rule : ( x 0 , x 1 , . . . , x n - 1 )·( y 1 , y 2 , . . . , y n - 1 )= x 0 y 0 + x 1 y 1 + . . . x n - 1 y n - 1 . the output vector s =( s 0 , s 1 , s 2 , s 3 ), which is later modulated and then transmitted into the channel , is computed as follows : s = a · h 4 = a 0 c 0 + a 1 c 1 + a 2 c 2 + a 3 c 3 . the multiplication operation a i c i occupies four chips of time . therefore , in any ds - cdma system , such as the ds - cdma system 100 of fig1 , with the spreading factor four , variables a 0 , a 1 , a 2 and a 3 can change their values not faster than every four consecutive chips . thus , the ds - cdma system 100 is a system in which the variables a 1 , a 2 , a 3 take new values every four chips , and the variable a 0 takes a new value only every m chips , where m is an integer divisible by 8 . it is assumed that the 0th stream plays a special role in the system 100 . for example , the 0th stream of a mobile telephone can be used for transmitting voice , while other streams can be used for transmitting data . the voice changes significantly slower compared to data and therefore a 0 has to take a new value only every i consecutive chips . another common and important case is when the 0th stream is used for transmitting a pilot signal . the pilot signal usually remains constant for a long time interval , typically 256 chips , that allows the decoder to accurately estimate the channel fading coefficient . the rate of a ds - cdma system 100 is defined as the average number of information bits transmitted per chip . it is easy to see that the ds - cdma system 100 has the following rate : r a = 3 m 4 + 1 m . ( 2 ) during transmission through an exemplary channel , the vector s is corrupted by additive noise and the vector x = s + z is received , where z is a vector of noise . to recover a value of a i , a despreading procedure is used , which consists of multiplying the received vector x by the vector c i : h i = x · c i =( s + z )· c i =( a 0 c 0 + a 1 c 1 + a 2 c 2 + a 3 c 3 )· c i + zc i . ( 3 ) taking into account the orthogonality property of equation ( 1 ), the following is obtained : finally , the sign of h i is computed and the original bit is reconstructed as â i = sign ( h i ) a . if the channel noise is not very strong , in other words , if entries of the vector z are small numbers , then with a large probability the quantity | z · c i | will be smaller than | 4a i |. therefore , h i will have the same sign as a i , and hence â i will be equal to a i . for example , without loss of generality it can be assumed that a = 1 . let a =( 1 , − 1 , 1 , 1 ) and z =( 2 . 1 , − 1 . 8 , − 1 . 85 , − 1 . 75 ). then , s =( 2 , 2 , − 2 , 2 ) and h =( 2 . 1 , − 1 . 8 , − 1 . 85 , − 1 . 75 ). computing , for instance , h 1 according to equation ( 3 ), h 1 equal to − 3 . 3 and â 1 = a 1 are obtained . since the variable a 0 changes its value only every m chips and since it is spread with the help of the sequence c 0 =( 1 , 1 , 1 , 1 ), the value of a 0 is reconstructed using a different rule . x ( x ) , i = 1 , . . . , m / 4 denotes vectors received from the channel after transmitting m chips . z ( i ) , i = 1 , . . . , m / 4 denotes the corresponding noisy vectors . to determine the value a 0 , compute : h 0 = ∑ i = 1 m / 4 x _ ( i ) · c _ 0 = ∑ i = 1 m / 4 ∑ j = 0 3 x _ j ( i ) = ma + ∑ i = 1 m / 4 ∑ j = 0 3 z _ j ( i ) , and reconstruct â 0 = sign ( h 0 ) a . it can be shown that the probability of decoding error , defined below , is significantly lower for a 0 compared to other values of a i . the bit error probability of a ds - cdma system , such as the ds - cdma system 100 , is defined as follows pr ( â i ≠ a i )= pr ( sign ( â i )≠ sign ( a i )). the energy of a vector of signals x =( x 0 , x 1 . . . , x n - 1 ) is defined as x 0 2 + x 1 2 + . . . + x n - 1 2 . hence , the average energy per chip of an output vector s equals : e av ( s _ ) = 1 4 ( s 0 2 + s 1 2 + s 2 2 + s 3 2 ) . the average energy per chip for the system is defined as the value e ( s ) averaged over all 16 possible vectors s corresponding to vectors from code book a , shown in fig2 . e a = 1 16 ∑ s - e av ( s ) . ( 4 ) e peak ( s _ ) = max 0 ≤ i ≤ 3 { s i 2 } . ( 5 ) the peak to average power ratio of the ds - cdma system 100 equals : papr a = max s - e peak ( s _ ) e a . ( 6 ) thus , the peak to average power ratio will vary . for non - linear amplifiers , which are commonly found in communications devices , such as mobile telephones , different components of the transmitted signal will be amplified differently , creating non - linear distortion . a need therefore exists for a ds - cdma system that provides a reduced peak to average power ratio . let h n be an n dimensional hadamard matrix and y =( y 0 , . . . , y n - 1 ) be a real vector and v = y h n . the parseval rule ( see , e . g ., f . j . macwilliams and n . j . a . sloane , the theory of error - correcting codes , chapter 14 . 3 , corollary 3 ) relates the energy of the vector y , which equals e ( y )= y 0 2 + . . . + y n - 1 2 , to the energy of the vector v , e ( v )= v 0 2 + . . . + v n - 1 2 , by the following equality : if a vector a =( a 0 , a 1 , a 2 , a 3 ) is transmitted , then according to the parseval rule ( equation ( 7 )), the corresponding output vector s will have the following average energy per chip : e av ( s _ ) = 1 4 ( s 0 2 + s 1 2 + s 2 2 + s 3 2 ) = 1 4 4 ( a 0 2 + a 1 2 + a 2 2 + a 3 2 ) = 4 a 2 . ( 8 ) the papr of the ds - cdma system 100 is now estimated . it can be shown that half of the output vectors s =( s 0 , s 1 , s 2 , s 3 ) have the property that three variables of s 0 , s 1 , s 2 , s 3 are zeros and one variable has the absolute value | 4a 2 | for instance , if a =( a , a , − a , − a ) then the corresponding output vector has the form s =( 0 , 0 , 4a , 0 ). the second half of the output vectors have the property that all s 0 , s 1 , s 2 , s 3 variables have the same absolute value | 2a |. for instance , if a =( a , − a , a , a ) then s =( 2a , 2a , − 2a , 2a ). therefore , according to equations ( 6 ), ( 5 ), and ( 9 ), the peak to average power ratio of the ds - cdma system 100 can be expressed as follows : papr a = ( 4 a ) 2 4 a 2 = 4 . fig3 illustrates a ds - cdma system 300 incorporating features of the present invention . the exemplary ds - cdma system 300 provides a spreading factor sf = 8 , with a reduced peak to average power ratio and bit error probability , relative to the conventional ds - cdma system 100 . in various implementations , the ds - cdma system 300 can have the same ( i ) rate , ( ii ) average energy per chip and ( iii ) amplitude , a , of signals transmitted in the 0th stream as the conventional ds - cdma system 100 . in this manner , the rate of the conventional system is maintained without increasing the average power per chip . in addition , the power for signals transmitted in the 0th stream is not changed , thereby resulting in the same bit error probability . since the 0th stream plays a special role in the system it can be important to maintain the bit error probability for the 0th stream , relative to the ds - cdma system 100 . for example , if the 0th stream is used for sending a pilot signal and the amplitude of the signal is reduced , this will result in a less accurate estimate of the channel fading coefficients , which , in turn , leads to failure to decode other streams of information . vectors b =( b 0 , b 1 , b 2 , b 3 , b 4 , b 5 , b 6 , b 7 ) are taken from the code book , defined below in conjunction with fig4 . in the exemplary implementation , only streams 0 , 1 , . . . , 6 carry information and stream 7 plays an auxiliary role . the signs ( polarities ) of the variables b 0 , . . . , b 6 represent values of transmitted bits , in a similar manner to the ds - cdma system 100 . for example , positive entries can correspond to logical 0 and negative entries can correspond to logical 1 . the absolute values | b 0 |, . . . , | b 7 | represent signal amplitudes of transmitted signals . in the ds - cdma system 300 of the present invention , different amplitudes and polarities are chosen for signals from different streams ( such that a desired average energy , e a , is maintained ). the spreading sequences w 0 , w 1 , . . . , w 7 can be expressed as follows : w 0 =( 1 , 1 , 1 , 1 , 1 , 1 , 1 , 1 ,); w 1 =( 1 , − 1 , 1 , − 1 , 1 , − 1 , 1 , − 1 ,); w 2 =( 1 , 1 , − 1 , − 1 , 1 , 1 , − 1 , − 1 ,); w 3 =( 1 , − 1 , − 1 , 1 , 1 , − 1 , − 1 , 1 ,); w 4 =( 1 , 1 , 1 , 1 , − 1 , − 1 , − 1 , − 1 ,); w 5 =( 1 , − 1 , 1 , − 1 , − 1 , 1 , − 1 , 1 ,); w 6 =( 1 , 1 , − 1 , − 1 , − 1 , − 1 , 1 , 1 ,); w 7 =( 1 , − 1 , − 1 , 1 , − 1 , 1 , 1 , − 1 ,). the sequences w 0 , w 1 , . . . , w 7 form rows of the hadamard matrix h 8 of dimension eight ( 8 ) and therefore they are orthogonal . the variables b 1 , . . . , b 6 take new values every eight chips and the variable b 0 takes a new value every m chips . it is noted that during a time interval of 8 chips , the conventional ds - cdma system 100 can transmit 6 bits ( over two cycles ). thus , in order to transmit 6 bits with the ds - cdma system 300 in the same time interval of 8 chips , only six user streams are needed . according to one aspect of the invention , the seventh user stream can be used to maintain performance ( e . g ., to improve the papr ). thus , during m chips the ds - cdma system 300 will transmit bits of information and therefore the rate of the ds - cdma system 300 equals the rate of the conventional ds - cdma system 100 : r b = 6 8 m + 1 m = 3 4 m + 1 m = r a . to be able to transmit seven streams of information , a code book of size 2 7 is needed . instead of defining a code book for the ds - cdma system 300 explicitly , the code book is defined using an algorithm . the matrices g pc and g rm are defined as follows : the matrices g pc and g rm are generator matrices of the single parity check code and the first order reed - muller code of length 8 ( see , e . g . f . j . macwilliams and n . j . sloane , the theory of error - correcting codes , north - holland ( 1977 )). they define properties of a code book b . let a be the signal amplitude used in the conventional ds - cdma system 1100 and c , e and d be signal amplitudes for the ds - cdma system 300 of the present invention . let a binary vector u =( u 0 , u 1 , . . . , u 6 ) take all 2 7 = 128 possible values from ( 0 , 0 , . . . , 0 ) to ( 1 , 1 , . . . , 1 ). for each vector u , the corresponding vector b is defined according to the following code book generation process 400 , shown in fig4 : 1 . compute v = u g pc 2 . compute h = g rm v ⊥ ( here ⊥ indicates the vector transposition ); 3 . if h ⊥ =( 0 , 0 , 0 , 0 ) then assign t = 2 , else assign t = 1 ; 4 . let v i = 1 − 2v i , i = 0 , . . . , 7 ; 5 . form the vector b as follows . if t = 1 then assign b 0 = av 0 and b i = cv i , i = 1 , . . . , 7 , else assign b 0 = av 0 , b i = ev i , i = 1 , . . . , 6 , and b 7 =− dv 7 . for example , let u =( 0 , 1 , 1 , 0 , 0 , 0 , 0 ). then , v =( 0 , 1 , 1 , 0 , 0 , 1 , 1 , 0 ) and further h ⊥ =( 0 , 0 , 0 , 0 ). therefore , t = 2 and b =( a ,− e ,− e , e , e − e ,− e , d ). it can be shown that any vectors u whose entries u 4 , u 5 , u 6 are all zeros will lead to t = 2 . in a further example , let u =( 0 , 1 , 1 , 0 , 0 , 0 , 1 ). then , v =( 0 , 1 , 1 , 0 , 0 , 1 , 0 , 1 ) and further h ⊥ =( 0 , 1 , 0 , 0 ). therefore , t = 1 and b =( a , − c , − c , c , c , − c , c , − c ). it can be shown that any vectors u in which at least one of entries u 4 , u 5 , u 6 is not zero will lead to t = 1 . vectors b that correspond to the case t = 1 are referred to as vectors of the first type and vectors b that correspond to the case t = 2 vectors of the second type . it can be shown that the number of vectors of the first type is 7 · 16 = 112 and the number of vectors of the second type is 16 . the power of a vector of the first type is a 2 + 7c 2 . the power of a vector of the second type is a + 6e 2 + d 2 . the total number of vectors is 2 7 = 128 . hence , the average energy of a vector from the code book equals e vector = 112 ( a 2 + 7 c 2 ) + 16 ( a + 6 ⅇ 2 + d 2 ) 128 . using the parseval rule of equation ( 7 ), the average energy per chip is expressed as follows : e b = 1 8 8 e vector = 112 ( a 2 + 7 c 2 ) + 16 ( a + 6 ⅇ 2 + d 2 ) 128 . ( 10 ) in order to maintain the average energy per chip in the ds - cdma system 300 the same as in the conventional ds - cdma system 100 , the amplitudes e , c , and d must be selected so that e b = e a , where e a is defined in equation ( 8 ). consider the papr of the ds - cdma system 300 of the present invention . it can be shown that for any vector b of the first type , the corresponding output vector s = b h 8 will have one and the same set of absolute values of entries : it is noted that the vectors u that produce vectors b of the first type belong to cosets of the first order reed - muller code with the coset leader of weight two . the same is true for vectors b of the second type . in this case , the set of absolute values of entries of the output vector s = b h is expressed as follows : thus , the papr of the ds - cdma system 300 is expressed as follows : papr b = max { a + 3 c 2 , a - c 2 , a - 5 c 2 , a + 6 e - d , a + d , a - 2 e - d } 112 ( a 2 + 7 c 2 ) + 16 ( a + 6 ⅇ 2 + d 2 ) 128 . ( 11 ) to obtain a system with a small papr , the amplitudes b , c , and e must be selected to provide e b = e a and minimize expression ( 11 ). in one exemplary solution of this optimization problem , the following amplitudes were obtained : it can be shown that under this choice , e b = e a and papr = 2 . 013 . in addition to a small papr , a small bit error probability is also desired . a decoding algorithm will be described in the next section . it is noted that for minimizing the bit error probability , different approaches are used for channels with low and with high signal to noise ratios ( snr ). in a channel with a high signal to noise ratio , a code book with a large minimum distance will have smaller bit error probability . the minimum distance of code book b is defined as follows : d ( b )= min { dist ( x , y )=( x 0 − y 0 ) 2 +( x 1 − y 1 ) 2 + . . . +( x 7 − y 1 ) 2 : x , y ∈ b }. will have the minimum pairwise distance , say d 1 , among all pairs of vectors of the first type . similarly , the vectors of the following form : will have the minimum pairwise distance , say d 2 , among all pairs of vectors of the second type . will have the minimum pairwise distance , say d 3 , among all pairs of vectors one of which is a vector of the first type and another is the vector of the second type . as previously indicated , for achieving small bit error probability in a channel with large snr , the minimum distance of the code book must be maximized . this can be done by changing values for the constant amplitudes c , d , and e , which increases the papr of the system . assume that a papr equal to 2 . 2 is desired . it can be shown that the minimum of distances d 2 and d 3 will define the minimum distance of the code book , while the distance d 1 is always much larger than d 2 and d 3 . thus , an optimal choice of the constant amplitudes c , d , and e is one that provides d 2 ≈ d 3 under the condition that papr b ≈ 2 . 2 and e a = e b . for example , if c = 0 . 611617844 · a , e = 0 . 63 d 3 a , and d = 1 . 813520605 d 3 a are selected , then a ds - cdma system is obtained with papr ≈ 2 . 2009 and d1 ≈ 2 . 992 · a 2 , d2 ≈ 2 . 987 · a 2 , d3 ≈ 3 . 1752 · a 2 . fig5 is a plot 500 illustrating the relative decoding performance ( bit error probability versus signal - to - noise ratio ) of the conventional ds - cdma system 100 and the ds - cdma system 300 of the present invention , in the presence of an additive white gaussian noisy ( awgn ) channel . according to another aspect of the invention , two different code books are employed based on whether the channel exhibits low or high signal to noise ratios ( snr ), distinguished by a specified threshold . thus , to minimize the bit error probability , different approaches are used for channels with low and with high signal to noise ratios ( snr ). in a channel with a high signal to noise ratio , a code book with a large minimum distance will have smaller bit error probability . for example , as shown in fig5 , for a snr above 2 , the codebook associated with the ds - cdma system 300 of fig3 will exhibit a better bit error probability . for reconstruction of the variable b , we use exactly the same procedure as in system a . since in systems b and c we keep the same amplitude for signals transmitted in the 0th stream as in system a the probability of error remains also the same . for reconstruction information from other streams in systems b and c we can also use the same procedure of despreading as in system a . however , since signal amplitudes for streams 1 , 2 , . . . , 7 are lower than in system a the bit error probability will increase . for this reason , in addition to despreading , a posteriori probability ( app ) decoding of the received vector can be used . it is again assumed that a vector b =( b 0 , b 1 , . . . , b 7 ). is transmitted . the output vector s _ = ∑ i = 0 7 b i w _ i is transmitted through a noisy channel and the vector x = s + z is received . without loss of generality , it is assumed that the channel is an additive white gaussian noisy ( awgn ) channel . in other words , it is assumed that the density function f ( z i ) of any element of the vector z can be expressed as : f ( z i ) = 1 2 π σ 2 ⅇ z i 2 2 σ 2 , fig6 is a flow chart describing an exemplary decoding process 600 . as shown in fig6 , the exemplary decoding process 600 performs as follows : 2 . for all b =( b 0 , b 1 , . . . b 7 ) from b compute p ( b _ ) = exp ( ( y 0 - b 0 ) 2 + ( y 1 - b 1 ) 2 + … + ( y 7 - b 7 ) 2 ) 2 σ 2 ) t i ( 0 ) = ∑ b _ = ( b 0 , … , b 7 ) : b i = 1 p ( b _ ) , t i ( 1 ) = ∑ b _ = ( b 0 , … , b 7 ) : b i = - 1 p ( b _ ) , t i = ln t i ( 0 ) t i ( 1 ) b ^ i = { 1 , if t i & gt ; 0 ; - 1 , if t i & lt ; 0 . using standard arguments ( see , e . g ., l . r . bahl et al ., “ optimal decoding of linear codes for minimizing symbol error rate ,” ieee trans . inform . theory , 20 , 284 - 87 ( 1974 )), it can be shown that : t i = pr ( sign ( b i ) = 1 | x _ ) pr ( sign ( b i ) = - 1 | x _ ) . in other words , t i is the log likelihood ratio of the ith bit . the algorithm 600 requires about 1000 operations over real numbers . it is to be understood that the embodiments and variations shown and described herein are merely illustrative of the principles of this invention and that various modifications may be implemented by those skilled in the art without departing from the scope and spirit of the invention . | 7 |
referring now to the drawings , particularly to fig1 , there is shown a radar system 1 according to the present invention which may be employed in automotive vehicles to detect or track a target object present in a frontal detectable range . the radar system 1 is designed as a fmcw ( frequency modulated continuous wave ) type of millimeter - wave radar which transmits a frequency - modulated radar wave in a millimeter band , receives a return thereof , and identifies a target such as a preceding vehicle or a roadside object to produce information about the target . the radar system 1 includes an oscillator 10 , an amplifier 12 , a divider ( also called a splitter ) 14 , an amplifier 15 , a transmitter antenna 16 , and a receiver antenna assembly 20 . the oscillator 10 produces a high - frequency signal in a millimeter band ( e . g ., 76 . 5 ghz ) and changes an oscillating frequency as a function of the level of a modulation signal m . the amplifier 12 amplifies the high - frequency signal , as produced by the oscillator 10 . the divider 14 splits in power the output of the amplifier 12 into a transmit signal ss and a local signal l . the amplifier 15 amplifies the transmit signal ss . the transmitter antenna 16 outputs the output of the amplifier 15 in the form of a radar wave . the receiver antenna assembly 20 is made up of n (= an integer more than one ) antennas ( which will also be referred to as receiver antennas or channels ch 1 to chn below ) each of which receives an echo of the radar wave from an object . the radar system 1 also includes a receiver switch 21 , an amplifier 22 , a mixer 23 , a filer 24 , an a / d converter 25 , and a signal processing unit 26 . the receiver switch 21 works to select one of the receiver antennas ch 1 to chn in sequence and transmit a signal sr , as received by the selected one of the receiver antennas ch 1 to chn , to the amplifier 22 . the amplifier 22 amplifies the received signal sr and outputs it to the mixer 23 . the mixer 23 mixes the received signal sr with the local signal l to produce the so - called beat signal bt . the filter 24 removes unwanted components from the beat signal bt . the a / d converter 25 samples an output of the filter 24 and converts it into a digital form . the signal processing unit 26 controls the sampling of the beat signal bt through the a / d converter 25 and produces information on the target which has reflected the radar wave transmitted from the transmitter antenna 16 . basically , component parts of the radar system 1 other than the signal processing unit 26 are divided into two sections a and b . specifically , the first section a includes the amplifier 15 and the transmitter antenna 16 . the section b includes the other component parts . the signal processing unit 26 controls supplies of electric power to the sections a and b separately . the section a serves as a transmitter along with the signal processing unit 26 . the section b serves as a receiver along with the signal processing unit 26 . when the radar system 1 is activated , the oscillator 10 oscillates at a frequency , as specified by the modulation signal m . the amplifier 12 amplifies the high - frequency signal , as produced by the oscillator 10 . the divider 14 splits in power the high - frequency signal , as amplified by the amplifier 12 , into the transmit signal ss and the local signal l . the transmit signal ss is then amplified by the amplifier 15 and outputted from the transmitter antenna 16 in the form of the radar wave . a return of the radar wave from the target object is received by all the receiver antennas ch 1 to chn each of which will also be generally referred to as a receiver antenna or a receiver channel chi ( i = 1 to n ). the signal sr , as received by the receiver antenna chi selected by the receiver switch 21 , is amplified by the amplifier 22 and then sent to the mixer 23 . the mixer 23 mixes the received signal sr with the local signal l , as transmitted from the divider 14 , to create the beat signal bt . the beat signal bt is filtered by the filter 24 , sampled by the a / d converter 25 , and then outputted to the signal processing unit 26 . the signal processing unit 26 produces the modulation signal m whose level changes in the form of a triangular wave to create an fmcw radar wave which is frequency - modulated to have a frequency increasing and decreasing , i . e ., sweeping upward and downward cyclically in a linear fashion or whose level is kept constant to create a cw radar wave having a fixed frequency . note that period of time for which the frequency of the radar wave sweeps upward and downward and ranges thereof will also be referred to as modulated frequency - rising and - falling times and ranges below . the signal processing unit 26 is operable to stop supplying the electric power to the section a to disable the transmitter function of the radar system 1 while enabling the receiver function thereof . the signal processing unit 26 is implemented by a typical microcomputer made up of a cpu , a rom , a ram , etc . and equipped with an arithmetic processing unit such as a dsp to perform the fast fourier transform ( fft ) on radar data acquired through the a / d converter 25 . the rom stores therein programs to be executed by the cpu and parameters for use in executing the programs . specifically , the cpu performs a measurement operation to collect data required to detect the target object tracked by the radar system 1 , an object information producing operation to produce information about the target object , and a threshold determining operation to determine a peak detecting threshold ( s ) for use in extracting a given signal component ( s ) from the radar wave reflected from the target object . the parameters used in executing such operations include defaults of the peak detecting thresholds , an offset ( s ), and a strong reflection threshold ( s ), as will be described later in detail . fig2 is a flowchart of a measurement program to be executed by the signal processing unit 26 at a given interval ( e . g ., 100 ms ) after the signal processing unit 26 is powered on , and a given initialization process is performed . the initialization process is to reset a mode switch flag f to zero and a channel specifying parameter i to one which will be described below in detail . after entering the program , the routine proceeds to step s 110 wherein the electric power is supplied to both the sections a and b of the radar system 1 to activate the transmitter and the receiver . the routine proceeds to step s 120 wherein an object detection mode is entered to transmit the fmcw radar wave through the transmitter antenna 16 and receive an echo of the fmcw radar wave . the beat signal bt ( which will also be referred to as a first beat signal below ) is produced by the signal sr ( i . e ., an echo of the fmcw radar wave ) received by each of the receiver antennas ch 1 to chn . specifically , the object detection mode is to output the modulation signal m whose level changes in the form of a triangular wave for producing the fmcw radar wave p times ( p is an integer more than one ) at a time interval that is greater than or equal to the amount of time ( i . e ., a round trip time ) required by the radar wave to travel to and return from a maximum detectable distance ( i . e ., the farthest end of the radar range ). the receiver antennas ch 1 to chn are also switched from one to another in sequence in a frequency - modulation cycle which corresponds to a period of time that is the sum of the modulated frequency - rising and - falling times so that the a / d converter 25 samples the beat signal bt a given number of times ( e . g ., 256 samples per channel in each of the modulated frequency - rising and - falling times ). the routine proceeds to step s 130 wherein it is determined whether the mode switch flag f is set to zero or not . if a yes answer is obtained ( f = 0 ), then the routine proceeds to step s 140 wherein a cw noise measurement mode is entered to transmit the cw radar wave through the transmitter antenna 16 and sample the resulting beat signal bt ( which will also be referred to as a second beat signal below ), as produced by the signal sr received by one of the receiver antennas chn ( i . e ., the receiver antenna chi ) which is specified by the channel specifying parameter i . specifically , the cw noise measurement mode is to output the modulation signal m whose level is kept constant to create the cw radar wave , continue to select only one of the receiver antennas ch 1 to chn , as specified by the channel specifying parameter i , for half the frequency - modulation cycle ( i . e ., a duration of one cycle of the cw radar wave ), and samples the beat signal bt a given number of times ( e . g . 256 times ) through the a / d converter 25 . the routine proceeds to step 150 wherein the supply of electric power to the sections a and b is cut to disable the transmitter function and the receiver function of the radar system 1 . the routine proceeds to step s 160 wherein the mode switch flag f is set to zero . the routine then terminates . if a no answer is obtained in step s 130 meaning that the mode switch flag f is not zero , then the routine proceeds to step s 170 wherein the supply of electric power to the section a is cut to disable the transmitter function of the radar system 1 . the routine proceeds to step s 180 wherein a receiver noise measurement mode is entered to deactivate the transmitter function to transmit no radar wave , but acquire the resulting beat signal bt ( which will also be referred to as a third beat signal below ), as produced by the signal sr , as derived when one of the receiver antennas chn ( i . e ., the receiver antenna chi ) which is specified by the channel specifying parameter i is in connection with the amplifier 22 . specifically , the receiver noise measurement mode is , like in the cw noise measurement mode , to output the modulation signal m whose level is kept constant to create the cw radar wave , keep the connection of one of the receiver antennas ch 1 to chn , as specified by the channel specifying parameter i with the amplifier 22 as it is for one cycle of the cw radar wave , and samples the beat signal bt a given number of times ( e . g . 256 times ) through the a / d converter 25 . the routine proceeds to step s 190 wherein the supply of electric power to the section b is cut to disable the receiver function of the radar system 1 . the routine proceeds to step s 200 wherein the channel specifying parameter i is updated or incremented . specifically , when the channel specifying parameter i is not n ( i . e ., i ≠ n ), it is incremented by one ( i . e ., i ← i + 1 ). when the channel specifying parameter i reaches n , it is reset to one ( i . e ., i ← 1 ). in other words , the program of fig2 is executed for all the receiver antennas ch 1 to chn . the routine proceeds to step s 210 wherein the mode switch flag f is set to zero . the routine then terminates . fig3 is a time chart which demonstrates the operation of the radar system 1 in the object detection mode . when the mode switch flag f is zero , the cw noise measurement mode is entered following the object detection mode . alternatively , when the mode switch flag f is one , the receiver noise measurement mode is entered following the object detection mode . specifically , the radar operation is , as can be seen from fig3 , executed in every measurement cycle . the cw noise measurement operation and the receiver noise measurement operation are performed alternately . in the object detection mode , the fmcw radar wave is transmitted from the transmitter antenna 16 for p cycles ( i . e ., p frequency - modulation cycles ). note that p = 3 in the example of fig3 . a given number of data samples ( e . g ., 256 samples ) of the beat signal bt are taken through each of all the receiver antennas ch 1 to chn in each of the modulated frequency - rising and - falling ranges of the radar wave . a total of p sets of the data samples ( e . g ., 3 × 256 samples ) for each of the receiver antennas ch 1 to chn in each of the modulated frequency - rising and - falling ranges are derived through the a / d converter 25 and stored . in each of the cw noise measurement mode and the receiver noise measurement mode , a given number of data samples ( e . g ., 256 samples ) of the beat signal bt are taken through one of the receiver antennas ch 1 to chn ( i . e ., the receiver channel chi ). the receiver channel chi is changed from one to another of the receiver antennas ch 1 to chn each time each of the cw noise measurement operation and the receiver noise measurement operation is executed . the radar system 1 also serves as an object information producing apparatus in an object information producing mode . specifically , the object information producing mode is to perform the frequency analysis ( i . e ., the fft ) on the data samples of the first beat signal , acquired through each of the receiver channels ch 1 to chn in the object detection mode in each of the modulated frequency - rising and - falling ranges of the radar wave . p frequency - analyzed results , as derived in each of the modulated frequency - rising and - falling ranges , are averaged to create an averaged frequency spectrum . a peak frequency component ( s ) whose power is greater than the peak detecting threshold , as will be described later in detail , is extracted from the averaged frequency spectrum . using such extracted component , the object information about the distance to , the relative speed of , and the azimuth of the target object from which the peak frequency component has arisen is then calculated . this type of object information producing operation may be achieved in a typical manner known in the field of the fmcw radars , and explanation thereof in detail will be omitted here . fig4 is a flowchart of a threshold determining program to be initiated each time the cw noise measurement in step s 140 or the receiver noise measurement in step s 180 is completed . note that the peak detecting threshold ( s ) used in this program is reset in the above initialization process to the default . after entering the program , the routine proceeds to step s 310 wherein the data samples of the second beat signal or the third beat signal , as derived in the cw noise measurement mode or the receiver noise measurement mode of operation of the radar system 1 , are frequency - analyzed by the fft and then stored as a cw noise spectrum or a receiver noise spectrum . the routine proceeds to step s 320 wherein it is determined whether what has been obtained in step s 310 is the cw noise spectrum or not . this determination may be achieved by checking the mode switch flag f . when the mode switch flag f is one , it represents that the cw noise measurement has been made immediately before the mode switch flag f is set to one . it is , therefore , determined in step s 320 that what has been obtained in step s 310 in this program execution cycle is the cw noise spectrum . if a yes answer is obtained in step s 320 meaning that the cw noise spectrum has been derived , then the routine proceeds to step s 385 wherein there is a frequency component having a peak ( i . e ., the peak frequency component ) which is greater in power than a strong reflection threshold in the cw noise spectrum or not . if a no answer is obtained meaning that there is not peak frequency component , then the routine terminates . alternatively , if a yes answer is obtained , then the routine proceeds to step s 390 wherein the mode switch flag f is set to zero . the cw noise spectrum , as derived in step s 310 , is discarded . the routine then terminates . when the mode switch flag f is set to zero in step s 390 , it will cause the cw noise measurement operation to be performed following the objection detection mode in the subsequent measurement cycle . afterwards , when this program is initiated again , the cw noise spectrum for the same receiver channel chi will be derived . alternatively , if a no answer is obtained in step s 320 meaning that what has been obtained in step s 310 is the receiver noise spectrum , that is , that both the cw noise spectrum and the receiver noise spectrum have already been derived through the same receiver channel chi , then the routine proceeds to step s 330 . in step s 330 , an area of the receiver noise spectrum , as derived in step s 310 in this program execution cycle , where frequency components are lower in frequency than a given border frequency ( e . g ., 75 khz ) is extracted as a low - frequency region . similarly , an area of the cw noise spectrum , as derived on the previous program execution cycle , where frequency components are higher in frequency than the given border frequency ( e . g ., 75 khz ) is extracted as a high - frequency region . the low - frequency region and the high - frequency region are combined and stored as an actual noise shape data for one of the receiver channels ch 1 to chn through which the data samples have been derived and frequency - analyzed or fast fourier - transformed in step 310 in this program execution cycle , in other words , which has been selected in step s 180 . the routine proceeds to step s 340 wherein it is determined whether the actual noise shape data have been collected for all the receiver channels ch 1 to chn or not . if a no answer is obtained , then the routine terminates . alternatively , if a yes answer is obtained , then the routine proceeds to step s 350 wherein all sets of the actual noise shape data , as acquired through all the receiver channels ch 1 to chn , are averaged with respect to each frequency ( e . g ., each frequency bin ) to derive channel - averaged noise shape data . the routine proceeds to step s 360 wherein it is determined whether the number of the channel - averaged noise shape data , as derived in step s 340 , reaches a given value or not . if a no answer is obtained , then the routine terminates . alternatively , if a yes answer is obtained , then the routine proceeds to step s 370 wherein an average ( i . e ., a moving - average ) of a given number of latest ones of the channel - averaged noise shape data is calculated with respect to each frequency ( e . g ., each frequency bin ) to derive a noise reference value . the routine proceeds to step s 380 wherein offsets which are given for the peak detecting thresholds is added to some of the noise reference values lying in the high - frequency region to produce a high - frequency spectrum . 1 / f noises are added to some of the noise reference values which lie in the low - frequency region and then adjusted in signal level so that signals levels thereof may continue successively to those in the high - frequency region across the border frequency , thereby producing a low - frequency spectrum . the high - frequency spectrum and the low - frequency spectrum are combined to derive updated values of the peak detecting thresholds . the peak detecting thresholds are set to the defaults until the number of the channel - averaged noise shape data , as derived in step s 340 , is determined to have reach the given value . afterwards , the values , as calculated in the above manner , are used as the peak detecting thresholds . the peak detecting thresholds are updated each time the channel - averaged noise shape data are calculated , in other words , every n measurement cycles . fig5 ( a ), 5 ( b ), and 5 ( c ) demonstrate how to determine the peak detecting thresholds in the manner , as described above . fig5 ( a ) illustrates an example of the receiver noise spectrum , as made by fast fourier - transforming the data samples acquired in the receiver noise measurement operation . fig5 ( b ) illustrates an example of the cw noise spectrum , as made by fast fourier - transforming the data samples acquired in the cw noise measurement operation . fig5 ( c ) illustrates an example of the peak detecting thresholds . a high - frequency range of the peak detecting thresholds is defined by the high - frequency region of the cw noise spectrum where there is no peak frequency components . a low - frequency range of the peak detecting thresholds is defined using the low - frequency region of the receiver noise spectrum . this is because the cw noise spectrum usually includes noises transmitted directly from the transmitter antenna 16 ( i . e ., the leakage noises ) as well as noises generated in the receiver itself ( e . g ., the receiver noises ), but the low - frequency region thereof cannot be used to determine the peak detecting thresholds because the peak frequency component ( s ) usually appear , while the receiver noise spectrum has no peaks over the entire range thereof , but it does not reflect the leakage noises in determining the peak detecting threshold ( s ). the averaged values of the frequency components in the high - frequency region of the cw noise spectrum , i . e ., the noise reference values in the high - frequency region represent averaged values of receiver noises containing the leakage noises . in the high - frequency region , the peak detecting values are , therefore , derived by adding the offsets which are so selected as to be greater than a variation in random noise to the noise reference values ( see a first distribution in fig5 ( c )). the averaged values of the frequency components in the low - frequency region of the receiver noise spectrum , i . e ., the noise reference values in the low - frequency region represent averaged values of receiver noises not containing the leakage noises . the 1 / f noises are , therefore , added to the noise reference values to estimate the waveform of the receiver noise spectrum containing the leakage noises and then adjusted in signal level so that the signals levels thereof may continue successively to those in the high - frequency region through the border frequency , thereby producing values each of which is raised by the sum of the 1 / f noise and the receiver noise as the peak detecting thresholds ( see a second distribution in fig5 ( c )). when there is a peak frequency component which is much greater in level within the low - frequency region of the cw noise spectrum ( see a broken line in fig5 ( b )), it means that phase noises broadens a base portion ( which will also referred to as a lower skirt below ) of the large peak frequency component , which will also raise the noise floor in the high - frequency region of the cw noise spectrum . accordingly , when there is a peak frequency component in the low - frequency region of one of the cw noise spectrums which has a power greater than the strong reflection threshold and which would affect the frequency components in the high - frequency region , the one of the cw noise spectrums is excluded from calculation of the channel - averaged noise shape data ( i . e ., the noise reference values ). testing which is to be performed on the radar system 1 at the factory to determine the offsets and the strong reflection thresholds will be described below with reference to fig6 . the testing is made with the radar system 1 placed in an echo - free environment , e . g ., an anechoic chamber where there is no reflection of a radar wave transmitted from the radar system 1 . the data samples , as created by performing the object detection operation in step s 120 and the cw noise measurement operation in step s 140 a required number of times , are used in determining the offsets and the strong reflection thresholds . the testing is made by the signal processing unit 26 , but the data samples may alternatively be loaded into an external signal processing unit or computer to calculate the offsets and the strong reflection thresholds . referring to the program of fig6 , the routine first proceeds to step s 410 wherein the data samples , as acquired through each of the receiver channels ch 1 to chn in the object detection mode , are fast fourier - transformed in each of the modulated frequency - rising and - falling ranges of the radar wave , thereby producing a plurality of frequency spectrums as fmcw noise spectrums . the routine proceeds to step s 420 wherein the data samples , as acquired through each of the receiver channels ch 1 to chn , are fast fourier - transformed , thereby producing a plurality of cw noise spectrums . the routine proceeds to step s 430 wherein maximum values ( i . e ., peak levels ) in the respective fmcw noise spectrums , as derived in step s 410 , at the respective frequencies ( e . g ., bins ) are extracted through , for example , a peak hold circuit to evaluate a maximum noise spectrum . the routine proceeds to step s 440 wherein averaged values of the respective frequency components in the respective cw noise spectrums , as derived in step s 420 , are calculated to make an averaged noise spectrum . the routine proceeds to step s 450 wherein a difference between the maximum noise spectrum , as derived in step s 430 , and the averaged noise spectrum , as derived in step s 440 , ( i . e ., a difference between each of the peak levels and a corresponding one of the averaged values ) is , as illustrated in fig7 , calculated with respect to each frequency ( i . e ., each bin ). the differences , as derived for the respective frequencies , are determined as the offsets for use in determining the peak detecting thresholds and stored in the rom of the signal processing unit 26 . only a maximum of the offsets may be calculated and used for all the frequency components . fig8 ( a ) illustrates an example of a relation between the strong reflection thresholds and the peak frequency components . in the illustrated frequency spectrum , the peak frequency components each include the lower skirt arising from the phase noises . here , half a width of the lower skirt at a noise permissible value ndbm ( i . e ., a distance between a vertical center line of the peak frequency component and an intersection of the noise permissible value ndbm and a higher - frequency edge of the lower skirt ) is defined as the size of the lower skirt . the peak levels of the peak frequency components with the size of the lower skirt identical with a given permissible value ( e . g ., 25 khz in fig8 ( a )) are calculated at respective frequencies ( i . e ., bins ) in the manner , as taught in a paper discussed below , as the strong reflection thresholds . in order to avoid the adverse effects of the peak frequency components whose peak levels are lower than the strong reflection thresholds on the noise floor in the high - frequency region of the cw noise spectrum , the border frequency is preferably so determined as to be greater than a cw upper limit component , as calculated from a predetermined upper limit of a relative speed between the target object and the radar system 1 , by the above permissible value ( i . e ., 25 khz ). in the radar system 1 , when the upper limit of the relative speed is 300 km / h , the frequency of the cw upper limit component is 43 khz . the sum of 50 kh ( i . e ., the frequency of the cw upper limit component plus a margin ) and the permissible value ( i . e ., 25 khz ) is defined as the border frequency (= 75 khz ). the peak frequency components , as appearing on the frequency spectrum ( see fig8 ( b )) arising from the fmcw radar wave , is equivalent to one which has the same peak value , but is lower than the frequency of the cw upper limit component on the frequency spectrum ( see fig8 ( c )) arising from the cw radar wave . the size of the lower skirt of the peak frequency components is logically estimated by evaluating the waveform of a fast fourier - transformed ( fft ) beat signal ( i . e ., the waveform of the peak frequency components ) resulting from an echo from a target object located at a given distance from the radar system 1 using a phase noise cancelation equation , as taught in , for example , the paper “ the influence of transmitter phase noise on fmcw radar performance ”, by patrick d l beasley , 3 rd european radar conference , the whole contents of which are incorporated herein by reference . as apparent from the above discussion , the radar system 1 works to determine the peak detecting thresholds for use in extracting the peak frequency components by adding the offsets , as derived in view of a variation in noise , to the averages of the actually measured frequency components in the high - frequency region of the cw noise spectrum which is higher than the border frequency and on which the leakage noises as well as the receiver noises reflect and also by estimating the waveform of a noise spectrum in the low - frequency region of the receiver noise spectrum from the actually measured frequency components in the received signal noise spectrum and the 1 / f noise spectrum and adjusting the levels of the noise components in the low - frequency region so as to continue to those in the high - frequency region . consequently , the radar system 1 is operable to determine the peak detecting thresholds on which the effects of the noises are reflected over the entire frequency band within which the peak frequency components need to be detected in the object detection mode , thus resulting in increased accuracy in acquiring the peak frequency components or information about the target object which has reflected the radar wave . when there is the peak frequency component whose power is greater than the strong reflection threshold in one of the cw noise spectrums , data derived from that cw noise spectrum is not used in determining the peak detecting thresholds , thus preventing the peak detecting thresholds from having undesirably great values due to the effects of the peak frequency component of a very large power whose lower skirt extends into the high - frequency region of the cw noise spectrum . while the present invention has been disclosed in terms of the preferred embodiment in order to facilitate better understanding thereof , it should be appreciated that the invention can be embodied in various ways without departing from the principle of the invention . therefore , the invention should be understood to include all possible embodiments and modifications to the shown embodiments which can be embodied without departing from the principle of the invention as set forth in the appended claims . for instance , the cw noise measurement operation and the receiver noise measurement operation are performed in different ones of the measurement cycles , but they may alternatively be performed sequentially in the same measurement cycle . each of the cw noise measurement operation and the receiver noise measurement operation is performed in one of the measurement cycles to derive the data samples through only one of the receiver channels ch 1 to chn , but may be made to produce the data samples through some or all of the receiver channels ch 1 to chn . in the case where a variation in noise of the received signal sr is small or a temperature - dependent drift thereof is small , a pre - calculated determined single received signal noise spectrum or a plurality of received signal noise spectrums pre - calculated for the respective receiver channels ch 1 to chn may be used without performing the receiver noise measurement operation . in the case where the received signal noise spectrums change at substantially a constant rate with a change in ambient temperature , one received signal noise spectrum may be corrected by that rate and the ambient temperature to determine the peak detecting thresholds without creating a plurality of receiver noise spectrums . the radar system 1 adds the offsets to the noise reference values lying in the high - frequency region , but may alternatively be designed to add the offsets to the received noise shape data or the channel - averaged noise shape data . the programs in fig2 , 4 , and 6 may be stored in a computer readable storage medium ( e . g ., a non - transitory medium ). the medium may be , for example but not limited to , an electric , magnetic , optical , infrared or semiconductor system , device or transmission medium . the programs in the storage medium may be installed in a computer and executed to realize the radar system 1 . | 6 |
fig1 illustrates the prior art described in the above - referenced patent . in this case the implant communicates directly with the components of the vehicle system . an electronic implant 110 contains a transmitter , and a vehicle 120 contains a receiver . in this system , no distinction is made concerning whether the wearer of the implant 110 is moved in the vehicle as the driver or the passenger . thus , it would be possible for the driver assistant system to be unintentionally or erroneously influenced by the implant of a passenger . furthermore , the entire vehicle must also meet the requirements for a medical product system with regard to development , registration , and product life cycle . nonreactive operation of the electronic implant is very difficult to achieve when the vehicle system malfunctions . fig2 illustrates the implementation according to one or more embodiments of the invention of a safe implant - vehicle communication . in this case the electronic implant 210 communicates bidirectionally , in a band preferred for the implant communication ( mics or ism ), with a control device 220 which at the same time constitutes a vehicle key . the vehicle key 220 always simultaneously functions as a relay station for a vehicle 230 when the vehicle has been started with this key 220 . the vehicle key 220 ( i . e ., the control device ), as a relay station for the communication with the implant 210 , contains the necessary safety devices , for example a firewall , to ensure operation of the implant which is nonreactive to malfunctions of the vehicle . the communication between the vehicle key 220 and the vehicle 230 takes place on a second communication channel which is basically independent of the implant communication . in this implementation according to the invention , it is necessary to classify only the electronic implant and the relay station as medical products . fig3 illustrates an implementation of the nonreactive communication with the vehicle . the control device 310 illustrated here is designed as a relay station , and has a first communication module 320 which operates in the mics band , for example , and which is connected to a first antenna 330 . this communication unit is used solely for communication between the electronic implant and the relay station . the control device 310 also includes a second communication module 340 which operates in the ism or meds band , for example , and which is configured with a corresponding antenna 350 for communication with the vehicle electronics system . the ism band is currently already used in the vehicle for access control ( keyless go ). a security server 360 ensures that the implant communication is independent from the vehicle communication . this security server 360 may be designed as a simple command interpreter or as a relatively complex firewall , and has an interface 370 which allows maintenance of the security server in the medical product system . the illustrated relay station may be implemented either as a mobile device associated with the patient or as a system installed in the vehicle . in the design in the vehicle , this unit is installed in such a way that it may be easily removed by the medical product manufacturer for maintenance purposes so that the maintenance interface 370 is accessible . on the other hand , the maintenance interface 370 is not accessible for vehicle maintenance , thus basically ruling out a reaction as the result of measures of vehicle maintenance . fig4 illustrates the prior art once again ( compare to fig1 ). based on physiological parameters of the patient 410 , an electronic implant 420 deduces the need for making a direct intervention in the driving operations of a vehicle 430 . in this case the intervention itself is always predetermined ( for example , braking to a stop ), and may also optionally involve feedback to the therapeutic control system of the implant . thus , for example , it is provided that a cardioversion treatment is delayed until the vehicle comes to a stop . none of the known approaches provides for influencing the vehicle on an individual patient basis and as a function of the driving situation . fig5 illustrates the approach according to one or more embodiments of the invention . the electronic implant 520 first derives one or more physiological data items of detected parameters of the patient 510 which describe the physiological state , and signals these physiological data to a configurable classification unit 530 . this classification unit 530 may , for example , be configured on an individual patient basis by a medical practitioner 550 in such a way that this classification unit 530 forms a suitability index which describes a driving fitness state of a patient as a function of the physiological data from the implant 520 , and signals same to a vehicle or driver assistance system 540 , i . e ., a vehicle control system . the driver assistance system 540 used here forms a machine control system within the meaning of the claims , and in contrast to the prior art receives from the classification unit not a direct driving instruction , but , rather , in the form of the suitability index receives only information concerning the driving fitness state of the patient . the driver assistance system 540 then derives an appropriate influence of the driving , based on the driver fitness information and other relevant driving information ( speed , distance sensors , yaw rate , etc .). in the present case the safety system is basically divided into a medical product system 560 and the vehicle system , so that the responsibility for the description and classification of the driving fitness state lies with the medical product manufacturer and the medical practitioner , whereas the responsibility for influencing the vehicle itself lies with the vehicle manufacturers and their suppliers . fig6 shows a block diagram of the safety system according to the invention . the safety system includes an electronic implant 610 which , preferably in the mics or ism band , transmits diagnostic or therapeutic information in the form of physiological data to a classification unit 620 . in this system the classification unit 620 is a component of a control device as a relay station between the implant and the vehicle , but optionally may also be a component of the electronic implant . the information from the implant may be assigned on an individual patient basis to various driving fitness descriptions via an interface 625 which is accessible to the medical practitioner . this driving fitness description is then transmitted , via an interface which is preferred in the automotive sector , to the vehicle system 630 , where it may be used as additional information for driver assistance systems . fig7 shows one possible classification individually prepared for a patient a . this patient a 710 has received a single - chamber icd implant since he has met the criteria for primary prophylaxis . in addition , the medical practitioner is aware that the patient suffers from paroxysmal atrial fibrillation without tachycardia transition , and hemodynamic consequences . slow ventricular tachycardia has also been documented , which over prolonged periods may cause dizziness in the patient . the implant 720 , an implantable cardioverter / defibrillator ( icd ), is able to classify the cardiological states of the patient and automatically provide treatment as needed . the following are activated for this patient : a class for diagnosing atrial fibrillation ( afib ), which does not result in treatment by the icd ; a class for detecting typical slow ventricular tachycardia ( vt1 ), which includes painless atp treatment ; and a class for recognizing ventricular fibrillation ( vf ), using automatic defibrillation shock therapy with up to 8 shocks in succession . the attending medical practitioner has stored the driving fitness of the patient in the classification unit 730 as follows : for atrial fibrillation the driving fitness is not restricted . for slow ventricular tachycardia the driving fitness is restricted ( i . e ., at least for the 10 minutes following vt detection ), and driving fitness is no longer indicated for the ventricular fibrillation class . this information concerning the driving fitness is relayed to the driver assistance system 740 , which is part of a machine control system or vehicle electronics system of the vehicle . in the event of limited driving fitness , the system indicates to the driver that the vehicle must be switched off immediately , but does not actively intervene in the driving operations . in the event that driving fitness is no longer present , the driver assistance system takes control of the vehicle with the objective of safely stopping the vehicle , depending on the driving situation . however , for this purpose all other sensor information from the vehicle is included , so that the vehicle response is adapted to the instantaneous driving situation ( for example , staying in the lane and relatively gradual braking of the vehicle during fast expressway driving versus quick stopping in slow inner - city traffic ). fig8 illustrates one possible classification individually prepared for a patient b . this patient b 810 has received a triple - chamber icd ( crt - d ) implant since he has met the criteria for cardiac resynchronization therapy due to pronounced cardiac insufficiency . at the same time , atrial fibrillation ablation was performed to treat atrial fibrillation with tachycardia transition . the implant 820 , an icd , is able to classify the cardiological states of the patient and automatically provide treatment as needed . the following are activated for this patient : a class for diagnosing atrial fibrillation ( afib ), which does not result in treatment by the icd ; two classes for detecting ventricular tachycardia ( vt1 , vt2 ), which include painless atp treatment and shock therapy ; and a class for recognizing ventricular fibrillation ( vf ), using automatic defibrillation shock therapy with up to 8 shocks in succession . the attending medical practitioner has stored the driving fitness of the patient in the classification unit 830 as follows : for atrial fibrillation the driving fitness is conditionally restricted , since this condition may result in loss of effective resynchronization , and therefore after 15 - 20 minutes dizziness or momentary loss of consciousness cannot be ruled out . driving fitness is no longer indicated for the ventricular fibrillation class . this information concerning the driving fitness is relayed to the driver assistance system 840 . in the event of limited driving fitness , the system indicates to the driver that the vehicle must be switched off immediately , but does not actively intervene in the driving operations . in the event that driving fitness is no longer present , the driver assistance system takes control of the vehicle with the objective of safely stopping the vehicle , depending on the driving situation . however , for this purpose all other sensor information from the vehicle is included , so that the vehicle response is adapted to the instantaneous driving situation ( for example , staying in the lane and relatively gradual braking of the vehicle during fast expressway driving versus quick stopping in slow inner - city traffic ). it will be apparent to those skilled in the art that numerous modifications and variations of the described examples and embodiments are possible in light of the above teaching . the disclosed examples and embodiments are presented for purposes of illustration only . other alternate embodiments may include some or all of the features disclosed herein . therefore , it is the intent to cover all such modifications and alternate embodiments as may come within the true scope of this invention . | 0 |
a preferred embodiment of the present invention will be described in detail below with reference to the accompanying drawings . as illustrated in fig1 and 2 , a vehicle body 12 employs a vehicle body side structure according to the present embodiment . a side body 13 includes a side sill 17 forming an end portion of a floor ( underbody ) 16 of a vehicle interior 15 , a front pillar 18 rising from the side sill 17 , a center pillar 21 , and a rear pillar 22 and supports a roof 23 . the vehicle body 12 has a front door opening portion 25 formed by the front pillar 18 and the center pillar 21 and a rear door opening portion 26 formed by the center pillar 21 and the rear pillar 22 . to the front door opening portion 25 , a front door 28 and a . front door opening seal 31 are mounted . to the rear door opening portion 26 , a rear door 32 and a rear door opening seal 33 are mounted . in the side body 13 according to the embodiment , a door seal cover 34 is mounted to the center pillar 21 to cover a coupling recessed portion 35 ( refer to fig9 as well ). next , a structure of the vehicle body side structure according to the embodiment will be described . as illustrated in fig2 , an outer panel 37 forming an outer face 36 of the center pillar 21 supporting the roof 23 of the vehicle body 12 is formed by connecting an outer lower member 42 to an outer upper member 41 . the side body 13 includes the coupling recessed portion 35 where the outer lower member 42 is connected to the outer upper member 41 and the door seal cover 34 for covering the coupling recessed portion 35 . as illustrated in fig3 to 7 , the door seal cover 34 has a u - shaped section and includes a body portion 43 having a u - shaped central portion ( fig7 ), a u - shaped upper lip 44 extending upward from the body portion 43 , and a u - shaped lower lip 45 extending downward from the body portion 43 . as illustrated in fig7 , the upper lip 44 and the lower lip 45 respectively have tip end portions 46 and 47 to be laid on the outer upper member 41 and the outer lower member 42 . tip ends ( a front upper tip end 57 , a front lower tip end 58 , a rear upper tip end 61 , and a rear lower tip end 62 ) of seal close contact face portions 51 ( a front upper seal close contact face portion 52 , a front lower seal close contact face portion 53 ) ( fig7 ) and seal close contact face portions 54 ( a rear upper seal close contact face portion 55 and a rear lower seal close contact face portion 56 ) to be in close contact with door - side seal members 48 and 49 ( fig3 and 4 ) of the doors ( the front door 28 , the rear door 32 ) of the side body 13 are formed to have thicknesses without steps to prevent the door - side seal members 48 and 49 from separating from the outer upper member 41 and the outer lower member 42 ( see fig5 ). remaining tip ends 64 , 65 , and 66 illustrated in fig7 have thicknesses t ( e . g ., 0 . 5 mm ) to form steps as illustrated in fig6 . as illustrated in fig7 and 9 , the seal close contact face portions 51 and 54 are illustrated with dotted patterns . as illustrated in fig3 , the outer panel 37 has a u - shaped section , as illustrated in fig5 , thicknesses of the upper lip 44 and the lower lip 45 gradually reduce from the body portion 43 toward the tip ends 46 and 47 . the remaining tip ends 64 , 65 , and 66 illustrated in fig7 have gradually changing tip end thickness portions 67 , 71 , 72 , and 73 having thicknesses gradually increasing in directions ( directions of arrows a1 to a4 ) away from the tip ends ( the front upper tip end 57 , the front lower tip end 58 , the rear upper tip end 61 , and the rear lower tip end 62 ) of the seal close contact face portions 51 ( the front upper seal close contact face portion 52 and the front lower seal close contact face portion 53 ) and the seal close contact face portions 54 ( the rear upper seal close contact . face portion 55 and the rear lower seal close contact face portion 56 ) and constant tip end thickness portions 74 , 75 , and 76 continuous with the gradually changing tip end thickness portions 67 , 71 , 72 , and 73 and having constant thicknesses . in fig7 , the gradually changing tip end thickness portions 67 , 71 , 72 , and 73 are illustrated with vertical striped patterns . the door seal cover 34 has a front end 77 and a rear end 78 continuous with a tip end 46 of the upper lip 44 and continuous with a tip end 47 of the lower lip 45 and the front end 77 and the rear end 78 are covered with respective door opening seals ( a front door opening seal 31 and a rear door opening seal 33 ) provided to a front door opening edge 81 ( fig2 , 3 , and 4 ) and a rear door opening edge 82 of the side body 13 ( fig3 and 4 ). the front door opening seal 31 and the rear door opening seal 33 covering the front end 77 and the rear end 78 extend in a vertical direction of the side body 13 . as illustrated in fig7 and 8 , the upper lip 44 and the lower lip 45 have seal outer wall thickness adjusting areas 83 , 84 , 85 , and 86 ( illustrated with vertical hatching ) continuous with the seal close contact face portions 51 ( the front upper seal close contact face portion 52 and the front lower seal close contact face portion 53 ) and the seal close contact face portions 54 ( the rear upper seal close contact face portion 55 and the rear lower seal close contact face portion 56 ). the seal outer wall thickness adjusting areas 83 , 84 , 85 , and 86 have gradually changing wall thickness portions 91 , 92 , 93 , and 94 ( illustrated with vertical hatching ) having wail thicknesses gradually increasing in directions ( directions of arrows a1 to a4 ) away from the seal close contact face portions 51 ( the front upper seal close contact face portion 52 and the front lower seal close contact face portion 53 ) and the seal close contact face portions 54 ( the rear upper seal close contact face portion 55 and the rear lower seal close contact face portion 56 ) and toward the body portion 43 and intermediate gradually changing wall thickness portions 95 , 96 , and 97 ( illustrated with horizontal hatching ) continuous with the gradually changing wall thickness portions 91 , 92 , 93 , and 94 and having wall thicknesses gradually increasing toward the body portion 43 . the gradually changing wall thickness portions 91 , 92 , 93 , and 94 ( illustrated with the vertical hatching ) have boundary portions 98 with the seal close contact face portions 51 and 54 and the boundary portions 98 form triangular areas ( illustrated with the vertical hatching ) substantially orthogonal to the tip ends 46 and 47 . next , the outer panel 37 of the center pillar 21 and the door seal cover 34 will be described in detail . as illustrated in fig3 and 4 , the center pillar 21 includes the outer panel 37 and an inner panel 101 and these panels 37 and 101 form a closed sectional shape . the inner panel 101 has a hat - shaped section with flanges 102 and the flanges 102 are coupled to the outer panel 37 with an opening 103 facing the outer panel 37 . the outer panel 37 has a hat - shaped section with a flange 105 . the outer panel 37 includes a body wall portion 106 , a front wall portion 107 continuous with the body wall portion 106 , a rear wall portion 108 continuous with the body wall portion 106 , and the flange 105 . the flange 105 includes a front flange 105 a and a rear flange 105 b . the front flange 105 a has the front door opening edge 81 of the front door opening portion 25 and the front door opening seal 31 is mounted to the front flange 105 a . the front door opening seal 31 has a grasping portion 111 at the front door opening edge 81 and a bulging close contact portion 112 formed to be continuous with the grasping portion 111 and comes in close contact with the front door 28 . the bulging close contact portion 112 comes in contact with the front end 77 of the door seal cover 34 mounted to the outer panel 37 in such a manner as to hide the front end 77 . the rear flange 105 b has the rear door opening edge 82 of the rear door opening portion 26 and the rear door opening seal 33 is mounted to the rear flange 105 b . the rear door opening seal 33 has a grasping portion 114 at the rear door opening edge 82 and a bulging close contact portion 115 formed to he continuous with the grasping portion 114 and comes in close contact with the rear door 32 . the bulging close contact portion 115 comes in contact with the rear end 78 of the door seal cover 34 mounted to the outer panel 37 in such a manner as to hide the rear end 78 . as is already described , the outer panel 37 has the outer upper member 41 from which the outer lower member 42 continues . as illustrated in fig3 to 6 , the outer upper member 41 has an upper joint portion 117 deformed by deforming a lower portion of the outer upper member 41 toward the vehicle interior ( arrow a6 ). at the upper joint portion 117 , the body wall portion 106 is deformed distance a toward the vehicle interior ( arrow a6 ). the outer lower member 42 has a lower joint portion 118 formed by deforming an upper portion of the outer lower member 42 toward the vehicle interior ( arrow a6 ). at the lower joint portion 118 , the body wall portion 106 is deformed distance 3 toward the vehicle interior ( arrow a6 ). by laying the upper joint , portion 117 on the lower joint , portion 118 and coupling them , the coupling recessed portion 35 is formed . the door seal cover 34 is stuck to the upper joint , portion 117 of the coupling recessed portion 35 by using double - sided tape 121 . as illustrated in fig5 to 8 , the door seal cover 34 includes the body portion 43 , the upper lip 44 , and the lower lip 45 . the upper lip 44 and the lower lip 45 are substantially symmetric about a center ( a center line 122 of fig7 ) of the body portion 43 . as illustrated in fig7 , the upper lip 44 includes the front upper seal close contact face portion 52 , the rear upper seal close contact face portion 55 , the gradually changing wall thickness portions 91 , 92 , 93 , and 94 ( vertical hatching ), and the intermediate gradually changing wall thickness portions 95 , 96 , and 97 ( horizontal hatching ). the gradually changing wall thickness portions 91 , 92 , 93 , and 94 form the triangular areas . the intermediate gradually changing wall thickness portions 95 and 97 form the substantially triangular areas . the intermediate gradually changing wall thickness portion 96 has a triangular area and forms an area formed by combining the triangular shapes and the rectangular shape . the front upper seal close contact face portion 52 and the rear upper seal close contact face portion 55 have thicknesses gradually increasing toward the body portion 43 . for example , the thickness gradually increases from the tip end 57 having such a thickness as to be able to secure watertightness which is an extremely small thickness ( substantially close to 0 mm ) to the body portion 43 having a thickness of 2 mm ( fig5 ). a boundary portion 124 between the gradually changing wall thickness portion 92 and the intermediate gradually changing wall thickness portion 96 has a thickness gradually increasing toward the body portion 43 . for example , the thickness gradually increases from the tip end 46 of the intermediate gradually changing wall thickness portion 96 having a thickness of 0 . 5 mm to the body portion 43 having a thickness of 2 mm . boundary portions 125 , 126 , and 127 between the gradually changing wall thickness portions 91 , 93 , and 94 and the intermediate gradually changing wall thickness portions 95 , 96 , and 97 have thicknesses gradually increasing from 0 . 5 mm to the body portion 43 having the thickness of 2 mm similarly to the boundary portion 124 . the intermediate gradually changing wall thickness portions 95 , 96 , and 97 have thicknesses changing from the tip end 46 having the thickness of 0 . 5 mm to the body portion 43 having the thickness of 2 mm . the lower lip 45 has the same structure as the upper lip 44 . next , a mounting procedure of the door seal cover 34 will be briefly described and a function of the door seal cover 34 will be described . as illustrated in fig9 , when the door seal cover 34 is mounted to the outer panel 37 of the vehicle body pillar 21 in a direction of an arrow b1 , the tip ends ( the remaining tip ends ( 34 and 66 ) near the front end 77 and the rear end 78 of the door seal cover 34 are not entangled in directions of arrows b2 and b3 . in other words , because only the tip ends ( the front upper tip end 57 , the front lower tip end 58 , the rear upper tip end 61 , and the rear lower tip end 62 ) of the seal close contact face portions 51 ( the front upper seal close contact face portion 52 and the front lower seal close contact face portion 53 ) and the seal close contact face portions 54 ( the rear upper seal close contact face portion 55 and the rear lower seal close contact face portion 56 ) illustrated in fig7 have thicknesses ( e . g ., thicknesses of 0 . 1 mm ) without steps and the other portions ( the gradually changing wall thickness portions 91 , 92 , 93 , and 94 and the intermediate gradually changing wall thickness portions 95 , 96 , and 97 ) illustrated in fig7 are formed to he thick - walled , the tip ends ( the remaining tip ends 64 and 66 ) are not deformed and entangled when the door seal cover 34 comes in contact with the outer panel 37 . furthermore , because the other portions ( the gradually changing wall thickness portions 91 , 92 , 93 , and 94 and the intermediate gradually changing wall thickness portions 95 , 96 , and 97 ) illustrated in fig7 are thick - walled , the door seal cover 34 can be maintained in the u - shape , which facilitates a mounting operation for mounting the door seal cover 34 to the outer panel 37 , having the u - shaped section , of the vehicle body pillar 21 . the remaining tip ends 64 , 65 , and 66 illustrated in fig7 include the gradually changing tip end thickness portions 67 , 71 , 72 , and 73 having the thicknesses gradually increasing in the directions away from the tip ends ( the front upper tip end 57 , the front lower tip end 58 , the rear upper tip end 61 , and the rear lower tip end 62 ) of the seal close contact face portions 51 and 54 and the constant tip end thickness portions 74 , 75 , and 76 continuous with the gradually changing tip end thickness portions 67 , 71 , 72 , and 73 and having constant thicknesses . therefore , the thicknesses of the tip ends 46 and 47 of the door seal cover change smoothly from the tip ends ( the front upper tip end 57 , the front lower tip end 58 , the rear upper tip end 61 , and the rear lower tip end 62 ) having the thicknesses without steps to the constant tip end thickness portions 74 , 75 , and 76 and the thicknesses of the tip ends 46 and 47 look uniform , which improves appearances of the tip ends 46 and 47 and areas around the tip ends 46 and 47 . the vehicle body side structure according to the invention is suitable for use on automobiles . 12 . . . vehicle body , 13 . . . vehicle body side portion , 21 . . . vehicle body pillar , 23 . . . roof , 28 front door , 31 . . . door opening seal ( front door opening seal ), 32 . . . rear door , 33 door opening seal ( rear door opening seal ), 34 . . . door seal cover , 35 coupling recessed portion , 36 outer face of vehicle body pillar , 37 outer panel , 41 . . . outer upper member , 42 . . . outer lower member , body portion , 44 . . . upper lip , 45 . . . lower lip , 46 . . . tip end of upper lip , 47 . . . tip end of lower lip , 48 , 49 . . . door - side seal member , 51 , 54 . . . seal close contact face portion . . . 57 tip end of seal close contact face portion ( front upper tip end ), 58 . . . tip end of seal close contact face portion ( front lower tip end ), 61 . . . tip end of seal close contact face portion ( rear upper tip end ), 62 . . . tip end of seal close contact face portion ( rear lower tip end ), 64 , 65 , 66 . . . remaining tip end , 67 , 71 , 72 , 73 gradually changing tip end thickness portion , 74 , 75 , 76 . . . constant tip end thickness portion , 77 . . . front end , 78 . . . rear end , 81 . . . front door opening edge , 82 . . . rear door opening edge , 83 , 84 , 85 , 86 . . . seal outer wall thickness adjusting area , 91 , 92 , 93 , 94 . . . gradually changing wail thickness portion , 95 , 96 , 97 . . . intermediate gradually changing wall thickness portion , 98 . . . boundary portion | 1 |
described herein are a method for milling a material , a system for forming microparticles and a milling chamber . a method , system and new milling chamber are provided which are able to provide microparticles of an average particle size of about 10 to about 40 microns and as small as about 20 microns . the method allows for formation of particles in smaller sizes that were hitherto unable to be formed , and provides a method for milling particles that did not previously lend themselves to milling due to the glass transition temperature of the material . as shown in fig1 , in the block flow representation of a preferred embodiment of the method for forming microparticles , the method includes a step 22 of introducing a material to be milled into a milling chamber , such as by feeding , and particularly through a pressurizing inlet with a pressurizing gas as in step 24 into the milling area of a milling chamber . as used herein , “ introducing ” of materials is meant in the broadest sense and can include , for example , placing , inserting , feeding , or otherwise inserting materials into the chamber . it will be understood , based on this disclosure , that the method of milling may be used on a wide variety of materials , with a particular focus on being able to mill things into small , microparticle sizes on materials that have previously not been susceptible to conventional milling techniques . it is particularly useful for materials that are difficult to break or fracture using conventional milling , including particles that do not benefit from , for example , cryogenic pretreatment to embrittle the material to assist in milling . thus , materials such as polymers that have negative glass transition temperatures can typically be made brittle through a liquid cryogenic pre - cooling to facilitate milling . the present method can also be used to grind materials , such as polymers , that have a positive glass transition temperature , where pretreatment through liquid cooling has not been shown to have an effect and which other existing milling technologies have not been able to mill . thus , novel microparticle - sized materials can be provided by the method for use , for example , in the chemical , pharmaceutical , food and cosmetics industries . the materials that can be milled may include various materials that can be milled using high - pressure liquid nitrogen , including , but not limited to , various polymeric materials such as plastics and elastomers and combinations thereof . exemplary materials that can be milled using the method herein include various polymers , such as , for example , silicones , polyolefins , polyvinyls , polyesters , polyacrylates , polyamides , polycarbonates , polybutadienes , polystyrenes , polyimides , polyethers , polyetheramides , polyetherimides , polyarylenes , polyarylene ethers , polyurethanes , polyester polyols , polyether polyols , fluoropolymers , perfluoropolymers , superabsorbent polymers , polyacrylonitriles , poly ( acrylonitrile - butadiene - styrenes ) polyvinylpyrrolidone , epoxy polymers , and copolymers , mixtures , graft polymers , alloys and blends of the various above - noted polymers ( and monomers forming the various polymers ) thereof . in addition , other exemplary materials that can be milled according to the method herein include waxes , molecular sieves , pharmaceutical compounds , fats , starches , carbohydrates , polysaccharides , surfactants , and epoxies . elastomers may also be milled including polyolefinic rubbers ( ethylene - propylene - diene rubber ( epdm ), ethylene , propylene rubber ( epr ), etc . ), polyurethane rubbers , polystyrene rubbers , polyamide rubbers , polybutadiene rubber , neoprene , polychloroprene rubber , natural rubber , fluoroelastomers , perfluoroelastomers , and other vulcanized and cross - linked polymers providing elastomeric ( at least partial recovery upon stretching ) properties , as well as copolymers , blends , mixtures and variations thereof . the milling chamber is shown in fig3 - 5 . as best shown in fig5 , the milling chamber has an outer wall 12 , and an inner wall 14 defining a milling area 16 . the material to be milled is fed into the milling area from a source 20 of the material to be milled in a step 22 of the method herein . in one embodiment , the material to be milled may already be in small sizes , e . g ., particles , pellets and the like . the nature of the material shape is not limited , however , in one embodiment , the method may be practiced generally with a reasonably uniform ( e . g ., commercial ) feedstock . experimental feedstock or variable size feedstock is also contemplated in this disclosure . the feed material may be of varied sizes and inlet feed orifice size chosen accordingly . in one preferred embodiment , the feed material is in a unit on the order of magnitude of about 0 . 0001 cm to an order of about 1 cm as measured in largest diameter . in yet a further embodiment , the feed material is about 0 . 001 to about 0 . 5 cm in the largest dimension . it should be understood by one of ordinary skill in the art , that one can vary the feed inlet orifice to accommodate varying size particles . in one embodiment herein , the average particle size is from about 30 % to about 60 %, and in yet a further embodiment , it is about 40 % to 50 % of the inner diameter of the orifice of the inlet for the feed material into the milling chamber to provide smooth flow of the material and a relatively constant feed rate . the disclosure should not be deemed limited however , but the relation of orifice size and feed particle size in view of the general concept described herein . the material may be introduced in varying ways into the milling area of the milling chamber . the materials may be introduced by plug flow or under pressure , it may also , if desired be heated or cooled prior to pretreatment for differing effects , although preheating or precooling are not necessary to achieve the benefits of the method . in one particular embodiment , the material is injected into the chamber under pressure using a pressurized gas 18 , which may be dry of moisture , such as pressurized nitrogen . however , other gasses may work and the pressure may be varied from slight to moderate to high depending on variations in the process . in a particular , preferred embodiment , the material may be fed to the milling area of the chamber through a high pressure valve as a pressurizing inlet as in step 24 , such as a venturi 26 which combines the material particles to be fed and a pressurized gas to inject the material into the chamber under pressure . however , other pressurizing nozzles or valves may also be used as are known in the art or to be developed , such as injectors , pusher nozzles , or other gas feed jets , including dual flow turbulent nozzles . in a particular embodiment herein , the material feed gas is dry so as to not introduce moisture into the milling chamber that may freeze and plug the mill due to the use of high - pressure liquid nitrogen as described below . as a result , in such embodiment it is recommended to use dry nitrogen pressurized feed gas . if a pressurized gas is used to introduce the feed material to be milled , it may be fed at varying pressures depending on the feed rate and pressure desired for introducing the feed material . in one particular embodiment the material enters at a pressure of at least about 85 psig to about 120 psig , but higher pressures are also within the scope of the disclosure . the method also includes as in fig1 and 2 , in a step 11 , introducing a stream of nitrogen from one or more inlet gas jets as in step 11 a into a milling area 16 of a milling chamber , generally referred to herein as 10 as in fig2 . the stream of nitrogen 30 may enter the milling area 16 of the milling chamber 10 through an inlet gas jet 28 , wherein the nitrogen stream 30 is fed at a very high pressure of about 45 , 000 psig ( 310 mpa ) to about 55 , 000 psig ( 379 mpa ). the stream of nitrogen 30 is most preferably at a very high pressure , and is most preferably a stream of high pressure liquid nitrogen at a pressure of about 45 , 000 psig ( 310 mpa ) to about 55 , 000 psig ( 379 mpa ) and a temperature of about − 140 ° c . to about − 151 ° c ., with a preferred pressure approaching 55 , 000 psig ( 379 mpa ) and a temperature at about 146 ° c . in one particular embodiment herein , the milling chamber includes more than one inlet gas jets and more than one corresponding stream of nitrogen in order to provide good milling action . in a more particular embodiment , there are four such inlet gas jets and four streams of nitrogen . however other configurations and varying numbers of jets may be used within the broader scope of the disclosure . the inlet gas jets are preferably equidistantly spaced around the wall of the milling chamber such that the stream ( s ) of nitrogen strike incoming particles at varying locations throughout the chamber . in one particular embodiment , as shown in fig5 , a concentric circle c is shown , which is concentric with the inner wall , which also has a circular cross - sectional configuration as shown . the circle c has various tangents t which also correspond to the streams of nitrogen 30 . for example , a stream of nitrogen 30 may be fed at a location 38 and at an angle α . the angle α is defined by the inner wall and the stream of gas that enters the chamber so as to form tangent t with the concentric circle c . in this embodiment , the concentric circle c circumscribes about 60 % to about 85 % of the cross - sectional area of the chamber , as measured longitudinally across the chamber , and preferably about 70 % to about 75 % of the cross - sectional area of the chamber . the gas jet introduces gas into the chamber at the situs of the inner wall 14 of the milling chamber , which inner wall defines the milling area 16 . after the material to be milled and the stream of nitrogen enter the milling area of the milling chamber , the material is contacted with the stream of nitrogen as in step 32 as in fig1 so as to form milled microparticles of the material as in step 34 . the stream of nitrogen is at a sufficiently high pressure that it is able to cut the feed material particles into microparticles . as used herein “ cutting ” of the particles includes actions such as direct cutting , slicing , dicing and the like to separate the particle by a cutting action . in an embodiment using high - pressure liquid nitrogen as a cutting agent , the particles are cut almost as though they were laser cut as they pass through the streams of nitrogen . the disclosure herein provides a unique method of micro - sizing particles , including particles of materials not previously susceptible to formation at such a micro - sized level using conventional grinding or impact bombardment techniques available with conventional milling . after the microparticles are formed , they are removed from the milling area as in step 36 of fig1 . in particularly preferred embodiments , the microparticles as formed have an average particle size , as measured in the longest dimension of the particle , of about 10 to about 40 microns , and most particularly of about 20 microns or less . this level of microparticulation allows for splitting of some single particles , for example , into on the order of one million particles and for an increase in available particle surface area of about 10 , 000 percent . the method and system described herein provide for size reduction of tough or hard particles difficult to break or fracture using conventional milling methods as well as for cutting of particles that are not otherwise benefited by cryogenic pretreatments preceding conventional milling . materials with both negative and positive glass transition temperatures may be cut into microparticles using the method , system and milling chamber described herein . in one further , particular embodiment , the method further includes collecting the milled microparticles removed from the chamber along with the spent nitrogen gas and venting the gas 42 as in fig2 , and filtering and collecting the microparticles in a suitable filtration / collection device 44 as a product 46 of the method as in step 40 . a system is also described herein for forming microparticles from a material to be milled , wherein the system is shown in schematic form as system 48 in fig2 . the system includes a high - pressure nitrogen source 50 , preferably a source of high - pressure liquid nitrogen , having an outlet 52 . the high pressure nitrogen source should include a nitrogen source 54 and compressor 56 capable of delivering nitrogen at pressures of about 45 , 000 psig ( 310 mpa ) to about 55 , 000 psig ( 379 mpa ), and preferably providing a stream of high pressure liquid nitrogen at a pressure of about 45 , 000 psig ( 310 mpa ) to about 55 , 000 psig ( 379 mpa ) and a temperature of about − 140 ° c . to about − 151 ° c ., with a preferred temperature at about 146 ° c . in a preferred embodiment , the high pressure liquid nitrogen enters the milling area and converts to gas at an expansion ratio of about 700 : 1 which violent expansion allows for circulation of particles and centrifugal classification . larger particles are thrown toward the outside of the milling area , while smaller particles are dragged to the center as the gas feed escapes carrying a mixture of smaller particles and venting gas from the milling area . a suitable high - pressure nitrogen source includes high - pressure liquid nitrogen as delivered through a high - pressure liquid nitrogen compressor capable of achieving the above - noted desired feed pressures and temperatures . suitable compressors are described in u . s . patent publications nos . us 2006 - 0053165 a1 and us 2006 - 0049274 a1 , each of which are incorporated herein by reference in relevant part . the system 48 also further includes a feeder 58 for providing a feed of the material to be milled . the feeder 58 introduces the material to be milled into a milling chamber , such as milling chamber 10 , which includes an outer wall 12 , an inner wall 14 defining a milling area 16 as shown in fig5 . the milling chamber in the system 48 also includes one or more inlet gas jet ( s ) 28 capable of providing flow between the outlet 52 of the high - pressure nitrogen source 50 and the milling area 16 , wherein the inlet gas jet ( s ) 28 may be in flow communication directly or indirectly between outlet 52 of the high - pressure nitrogen source 50 and the milling area 16 . in one embodiment herein , the outlet 52 of the high - pressure nitrogen source 50 is further able to provide flow through a chiller 64 for further chilling high - pressure liquid nitrogen prior to entering the milling area 16 through the inlet gas jet ( s ) 28 . in one embodiment , the outlet 52 of the high - pressure nitrogen source 50 is able to provide direct or indirect flow communication to the chiller 64 . milling chambers can vary in size with respect to the milling area 16 . applicants have carried out the process using both 4 inch ( 10 . 16 cm ) and 8 inch ( 20 . 32 cm ) jet pulverizer micron - master ™ jet pulverizer ™ jet mills , from jet pulverizer co ., moorestown , n . j ., fitted with the high pressure liquid nitrogen inlet gas jets and connected to a high pressure liquid nitrogen source . however , other jet mills of varying size may be used within the scope of the disclosure . in a particularly preferred embodiment herein , the milling chamber 10 has at least four inlet gas jets 28 , although this may be varied as noted above . the selection , placement and number of inlet gas jets 28 may be varied , depending on the milling and cutting effect desired as well as the size of the milling chamber . larger chambers can accommodate more and varied arrangements of inlet gas jets 28 , and one skilled in the art will understand based on this disclosure that the milling chamber may be varied to include different cutting and microparticulation effects . the inlet gas jets 28 each can be varied as well in inlet size based on the desired liquid nitrogen expansion effect and the size of the milling chamber &# 39 ; s milling area 16 . the jet size ( inlet ) may be varied , and is preferably about 0 . 001 inch ( 0 . 00254 cm ) to about 0 . 1 inch ( 0 . 254 cm ). the inlets may be formed using microdrilling or boring of a crystal , or similar hard material , which may be mounted within a holder capable of sustaining it in place , such as through threads , snap - fit , inset , locking and / or mating connectors and the like . this high pressure liquid nitrogen feed into such a small inlet , create “ supply whips ” which enable gas expansion desired to create from about 50 to about 1000 standard cubic feet per minute or more and should be adjusted to be workable in the size of milling area . the milling area must be able to accommodate the gas pressure expansion . the milling chamber also has a feed inlet 60 that is capable of providing flow between the feeder 58 and the milling area 16 so as to provide material to be milled to the milling area 16 . in one embodiment , the feed inlet 60 provides flow communication directly or indirectly between the feeder 58 and the milling area 16 . introducing , such as by feeding , of raw material to the process should be reasonably constant for optimal operation . a vibrating trough feeder or similar feeding mechanism works well for pelletized feed . for introducing , such as by feeding , powder material , augers or screw conveyors may be used . the feeder is not limited , but developing a steady and accurate feed rate is most preferred . the milling chamber has an outlet 62 through which milled microparticles 46 may be removed from the milling area 16 . in one embodiment herein , the outlet 62 of the milling chamber 10 may be capable of providing flow of milled material to a filtering device and collector 44 as shown in fig2 , which may include a baghouse dust collector or single or multiple collection bags and receiving chambers as shown in fig3 and 4 , where two such bags and chambers are provided . such flow may be through direct or indirect flow communication between the outlet 62 of the milling chamber and the filtering device and collector 44 . a milling chamber is provided herein for forming milled microparticles , having an outer wall 12 and an inner wall 14 that defines a milling area 16 . the chamber includes at least one inlet gas jet 28 configured to introduce a stream of high - pressure nitrogen 30 into the milling area 16 . the chamber further includes a feed inlet 60 capable of providing a material to be milled to the milling area 16 , wherein the material to be milled is from a source 20 of such material . the feed inlet 60 may provide direct or indirect flow communication between the material to be milled and the milling area 16 . the milling chamber further has an outlet 62 through which milled microparticles 46 may be removed from the milling area 16 . in a particular embodiment herein , ground product may be discharged into , for example , a cotton filter bag having a filtration area . the ratio of air to cloth based on the filtration area is preferably from about 2 : 1 to about 7 : 1 , and preferably about 3 : 1 . in a particular embodiment as noted elsewhere herein , the inner wall 14 of the chamber 10 has the inlet gas jet 28 at a location 38 . the inlet gas jet ( s ) are configured in this embodiment so as to introduce a stream of nitrogen 30 into the milling area 16 at an angle α defined by the inner wall and the stream of nitrogen which enters the chamber so as to form tangent t to concentric circle c , which concentric circle c is concentric with the inner wall and has various tangents t . the stream of nitrogen 30 is preferably fed a location 38 . the concentric circle c in this embodiment circumscribes about 60 % to about 85 % of the cross - sectional area of the chamber , as measured longitudinally across the chamber , and in a more particularly preferred embodiment circumscribes about 70 % to about 75 % of the cross - sectional area of the chamber . it will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof . it is understood , therefore , that this disclosure is not limited to the particular embodiments disclosed , but it is intended to cover modifications within the spirit and scope of the present disclosure as described herein . | 1 |
fig1 shows a triangular prism concentrator ( tpc ) array photovoltaic device 100 . a description of the physical relationships between various components of the device 100 is included here in fig1 - 8 to aid in the understanding of the device 100 before describing in further detail an apparatus and method for electrically connecting cells in a photovoltaic ( pv ) device . fig2 , 3 and 4 break out and enlarge components of device 100 . a variety of methods for forming a useful , patterned electrically conductive layer to electrically connect photovoltaic cells to for the photovoltaic device are described . one embodiment of the photovoltaic device of the present invention is illustrated in fig1 . fig1 shows a triangular prism concentrator ( tpc ) array photovoltaic device 100 . a brief description of the physical relationships between various components of the device 100 is included here to aid in the understanding of the device 100 before being described in greater detail . the description also references fig2 , 3 and 4 which break out and enlarge components of device 100 illustrated in fig1 . the device 100 is made up of a front glass 110 with a flat front surface 210 and a back surface formed to create multiple triangular prisms 220 . the flat front surface 210 acts as a second side of each triangular prism 320 , as is described in detail below . photovoltaic cells 120 are arrayed along a first side 310 of each of the prisms of the front glass 110 . a second side 320 of each of the triangular prisms 220 is formed by the flat front surface 210 of the front glass 110 . a reflective surface ( reflectors ) 130 is added to a third side 330 of each triangular prism 220 . the reflectors 130 may be formed by coating the third side 330 of each triangular prism 220 with a reflective material . a rigid frame 140 surrounds the device providing mechanical stiffness and offering a surface for bolting to rails mounted on a roof . in some preferred embodiments , the front glass 110 is a molded or extruded clear material having an index of refraction greater than one and preferably between 1 . 48 and 1 . 52 . in some preferred embodiments the front glass 110 is made of uv - enhanced polymethylmethacrylate acrylic ( pmma ). in some embodiments , the pmma used in the front glass 110 is atoglas vh plexiglas produced by atofina chemicals , inc ., philadelphia , pa . however , in other embodiments the front glass 110 can be fabricated from materials such as glass or polycarbonate plastic , which are substituted for pmma . in some preferred embodiments the third side 330 of each prism 220 is coated with aluminum deposited by vacuum metallization to achieve a reflectance on the order of 95 % to form the reflectors 130 . however , the reflectors 130 may be made of any materials that can be formed into this shape and made to be highly reflective and conductive such as other metals , etc . fig3 is a detailed perspective view of the triangular prism concentrator array showing additional details of the prism assembly 100 . an optical coupling gel 350 is used . the optical coupling gel 350 is a thixotropic gel with an index of refraction approximately equal to that of the material comprising front glass 110 . the optical coupling gel 350 is sandwiched between photovoltaic cell 120 and the first side of each triangular prism 220 of the front glass 110 . the optical coupling gel 350 is used in part as an adhesive to hold pv cell 120 in place , as well as an optical coupler , thereby eliminating any air gaps between pv cell 120 and the first side of each triangular prism 310 of the front glass 110 . in some preferred embodiments the optical coupling gel is lightspan sl - 1246 optical coupling gel ( thixotropic ) from lightspan , llc , 14 kendrick road , unit # 2 , wareham , mass . in other embodiments , sylgard 184 silicone rubber from the dow chemical company , 901 loveridge road , pittsburg , california or the nye optical ock451 curable adhesive from nye optical company , 10309 centinella drive , la mesa , calif ., can be used as the optical coupling gel 350 . in other preferred embodiments the optical coupling gel can be replaced by ethelyne vinyl acetate ( eva ) which is available from multiple vendors . the pv cells 120 are electrically connected to each other by electrical interconnection means 360 . in preferred embodiments the pv cells 120 have two electrical connections on their back surface ( facing away from front glass 110 ). the entire back of device 100 is sealed with an encapsulant film 370 . in some embodiments this encapsulant film is a polymer sheet like eva , etfe , or tedlar ™, in other embodiments encapsulant film 370 may be applied in vapor or liquid form and may be either a polymer , epoxy , glass , or silicon nitride , or any other material capable of sealing out moisture , withstanding temperatures of approximately 50 degrees celsius and protecting the back of device 100 from abrasions . in fig4 , as described above , the device 100 includes the front glass 110 with the flat front surface 210 , 320 and back surfaces 310 and 330 formed to create multiple triangular prisms 220 . photovoltaic cells 120 are arrayed along the first side 310 of each of the prisms 220 . the thixotropic clear gel 350 fills the space between the cell 120 and the prism 220 . the third side 330 of each of the triangular prisms 220 is coated with a reflective and conductive film to form reflector 130 , as described herein . this film is both reflective and electrically conductive and extends to contact a back positive terminal 410 of each pv cell 120 to a back negative terminal 420 of the adjacent pv cell 120 forming an in - series electrical connection between the pv cells 120 to create the desired output voltage for the device 100 , e . g ., 18 volts . back positive terminal 410 of each cell is separated from back negative terminal 420 of the same cell by a gap in the electrically conductive layer 430 . turning to fig5 , in some embodiments , the pv cells 120 , gel 350 , and front glass 110 are first assembled together prior to the creation of reflector 130 . in some preferred embodiments a masking material layer 510 is then placed so as to cover the space between the electrical contacts on the back of each of the pv cells 120 to prevent undesirable electrical connections being created in the next step , creating the gap in the electrically conductive layer 430 . in the next step , the reflector 130 , which is both reflective and electrically conductive , is then deposited on the entire back side of the assembly from a reflective material source 520 . in some preferred embodiments the reflector is made primarily of aluminum . in some other preferred embodiments the reflector is made primarily of silver . then the mask and overlying portions of the reflector 130 are removed , leaving both a reflective layer 130 and the desired electrical connections between each of the pv cells 120 . in some alternative embodiments , the reflective and conductive material forming the reflective layer 130 is deposited first , then a protective positive masking layer 510 is deposited over the reflective layer 130 . finally those portions of the reflective layer 130 that are unprotected by the masking layer are etched away with chemicals , plasma or other known removing means to break undesirable electrical connections such as those between the back positive terminal 410 and back negative terminal 420 initially formed when the reflective layer was deposited . in some alternative embodiments the masking layer is also removed before the pv device 100 is complete . in all cases , forming the final reflective and conductive surfaces 130 are achieved by processes well known in the relevant arts . in other alternative embodiments , the reflective and conductive material forming the reflective layer 130 is deposited in the desired pattern by directly writing or applying the reflective layer 130 in the desired pattern . in some embodiments this is accomplished by ink jet - like , electrostaticly - controlled , technology for depositing materials onto a surface , in this case , the pv cells 120 . turning to fig6 - 8 , in some preferred embodiments a process for forming the finished reflective and conductive layer 130 is shown in greater detail . in fig6 , the masking layer 510 is shown for use with the triangular prism concentrator array photovoltaic device 100 . the masking layer 510 is formed by means , and made of materials , well known in the relevant arts . for example , the mask layer may be made from any suitable plastic . the masking layer is formed and placed onto the back surface of the pv array 100 , closest to the first ( 310 ) and third ( 330 ) sides and furthest from the second ( 320 ) sides . in some preferred embodiments employing a liftoff method , the masking layer is what ultimately prevents the reflective and conductive coating in the next step from becoming attached to certain portions of the pv array 100 where improper electrical connections would otherwise form . in this sense the mask can be considered a negative mask because the reflective and conductive layer 130 is not deposited between the pv array 130 and the masking layer 510 . in other embodiments a positive mask may be used as is known in the relevant arts . in fig7 , the masking layer 510 is shown placed onto the pv cells 120 , the pv cells 120 are attached to the multiple triangular prisms on concentrator back surface 220 . with the masking layer 510 in place , in some preferred embodiments the reflective and conductive layer 130 is then deposited onto the pv array 100 and mask 510 . the reflective and conductive layer 130 is preferably made of aluminum or silver . while aluminum or silver are preferred materials , it is envisioned that the reflective layer can also be made of many other metals , combinations of metals , or any materials that are or can be made reflective , conductive and can withstand the operating temperatures of the pv device 100 , such as − 20 to 100 degrees centigrade . the reflective and conductive layer 130 can be deposited onto the pv array 100 by a variety of methods known in the relevant arts . in some preferred embodiments the deposition is performed by the process of vapor deposition in which the assembly is placed in a vacuum chamber and an aluminum or silver filament 520 is heated to vaporize the aluminum or silver which then coats all exposed surfaces that are not masked . in some alternative embodiments the reflective and conductive layer 130 is deposited by sputtering , electroplating , electroless chemical plating or spray coating . the present invention is not limited to any particular method creating the reflective and conductive layer 130 and other known methods for depositing a thin layer of reflective and conductive material may be used as well . turning to fig8 , following the metal deposition step , the masking material 510 is removed leaving the electrically conductive and optically reflective layer 130 deposited on the desired portions of multiple triangular prisms on concentrator back surface 220 , more specifically , the first side 310 and third side 330 , in a pattern to form a series electrical connection between the pv cells 120 of the device 100 . other patterns corresponding to particular electrical connections , and hence particular voltages , can also be used . an electrically insulating backcoating is then applied to the surfaces previously covered by the mask 510 and reflective and conductive layer 130 . in some preferred embodiments the backcoating may be eva in a liquid two - part catalytic solution which is allowed to cure or in sheet form which is laminated to the pv array using a standard vacuum laminating process . other known insulating coatings and other known techniques for applying all these coatings are envisioned by the present invention which is not limited to any particular coating or method of application . it is understood that the forms of the invention shown and described in the detailed description and the drawings are to be taken merely as examples . it is intended that the following claims be interpreted broadly to embrace all the variations of the example embodiments disclosed herein . thus the scope of the invention should be determined by the appended claims and their legal equivalents , rather than by the examples given . | 7 |
the array sensor of the present invention has recognized that extremely small particles can be directly imaged on a semiconductor pixel sensor array . suitable pixel sensor arrays are ccd arrays and cmos arrays with pixel sizes generally less than about 5 microns square . as used herein , the term “ extremely small particles ” means particles having a size on the order of magnitude as a pixel size . further , the term “ directly imaged ” means that a selected characteristic of the small particles is detected by the array pixels without any optical devices between the array surface and the small particles . various light sources and configurations can be used for providing collimated illumination of samples located on the detection array . sources include : light emitting diodes , laser diodes , other lasers , small discharge lamps ( for uv and other wavelengths ), and incandescent lamps . possible configurations include 1 ) different wavelengths of light for illumination and / or excitation , 2 ) different intensities of the illumination light , 3 ) pulsed illumination , 4 ) multiple illumination wavelengths which might be pulsed on and off in an ordered sequence , and 5 ) polarized illumination . detecting images of micro - particles with direct imaging on the detector array is accomplished with some or all of the following optical processes : absorption ( i . e . shadowing ), scattering of light ( diffraction and refraction ), and emission of light from excitation by the illumination wavelength ( i . e . fluorescence , phosphorescence , or other types of delayed emission ). in absorption measurements there is usually one or more optimum wavelengths to use for the best absorption signal ; thus , one should use an appropriate wavelength for detection of absorption signals . scattering signals will change with wavelength for a given particle size , but it is not as sensitive as the absorption . therefore scattering measurements are often usually at a convenient wavelength . however if the scattered light shows up as a background problem one might want to select an illumination wavelength that minimizes the scatter signal . fluorescence , phosphorescence and other forms of delayed emission are similar to absorption in that they are optimally excited at certain wavelengths . finally , using polarized illumination along with a crossed polarizer ( thin film type ) between the sample and the detection array can provide significant improvements in discrimination for detecting desired objects . the sensor array herein takes into account that diffraction effects can limit the ability of such extremely small particles to form an image on the pixel sensors . thus , the surface of the sensor array must be configured so that the extremely small particles directly contact the active surface of the sensor and are not elevated by surface coatings and the like more than a distance where the pixel amplitude is no longer affected by the presence of the particles . this distance will vary depending upon the type of illumination and the optical process that is employed ( e . g . absorption , scattering of light , or delayed light emission ) and can be readily determined by routine experimentation . thus , the direct - contact array sensor according to the present invention is a sensor that has a rapid response , is extremely small , requires low electrical power , is inexpensive , and may be disposable . as shown pictorially in fig1 , extremely small particles 10 , 12 , which may be biological particles , are placed in direct contact with the active light detecting surface 14 of the sensor pixels 16 . fig2 a and 2b pictorially illustrate a biological particle 18 , such as e . coli , bacillus subtilis , bacillus anthracis , or the like , having a length of 4 - 5 microns , placed in direct contact with a pixel array 20 with pixel sizes of about 2 microns with a corresponding pixel output map , or readout 22 from the sensor array . such extremely small particles ( bacteria , cells , pollen , and the like ) in such close proximity to the surface of the sensor array form shadows on the sensor array surface when illuminated from above by collimated light in the ultra - violet , visible , and infra - red wavelength range . the size and shape of the resulting video image is determined by the number of shadowed pixels of the sensor array . current ccd technology provides pixel sizes of about 2 microns square . cmos technology provides pixel sizes of about a single micron square . thus , the image of any extremely small particle of a size a single micron or greater can be obtained and the size measured to within a single micron . additionally , using an appropriate sensor array , fluorescence occurring in or on a biological particle can be detected and located to a resolution of about a single micron . clearly , the resolution will improve as sensor arrays advance to much smaller pixel sizes . fig3 is a side view of a typical array system according to the present invention . extremely small particles 22 are placed in direct contact with the surface of sensor array 24 , which is supported by array carrier 26 . the surface is illuminated by a collimated light 28 of a selected wavelength and the illuminated surface of array 24 produces a charge in the illuminated pixels and generates an output signal to a video viewing system 30 to visualize the extremely small particles on the surface . video viewing system 30 may be a dedicated computer monitor of any conventional type or may be a general purpose or hand - held computer that is programmed to provide a video image of the output from the sensor array . fig4 a and 4b illustrate one exemplary application of the above invention . a biological specimen 32 is placed in direct contact with the sensing surface of sensor array 34 in the presence of a culture medium and biological specimen 32 is directly imaged , as seen in fig4 a . the growth kinetic may be directly observed on a cell - by - cell basis by monitoring the individual pixel intensities of the growing culture 36 , as seen in fig4 b . the foregoing description of the invention has been presented for purposes of illustration and description and is not intended to be exhaustive or to limit the invention to the precise form disclosed , and obviously many modifications and variations are possible in light of the above teaching . the embodiments were chosen and described in order to best explain the principles of the invention and its practical application to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto . | 6 |
the present invention will now be described in detail with reference to a preferred embodiment thereof as illustrated in the accompanying drawings . referring to the drawings and first to fig1 there is illustrated the general arrangement of a cruise control apparatus for a vehicle constructed in accordance with the present invention . the cruise control apparatus as illustrated includes a cruise control setting switch 1 which is adapted to be operated by an operator so as to start cruise control , a brake switch 2 which is operatively connected with a brake pedal 3 in such a manner that it is turned off to interrupt the electrical power supply to an actuator 9 ( described in detail later ) when the brake pedal 3 is stepped on , and a stop lamp switch 4 which is also operatively connected with the brake pedal 3 in such a manner that it is operated to release cruise control and light a tail lamp ( not shown ) when the brake pedal 3 is stepped on . the switches 1 , 2 and 4 have one end commonly coupled to a source of electricity . a speed sensor 5 for sensing the speed of the vehicle includes a rotary member 5a with four magnetic poles and a reed switch 5b having one end grounded , the rotary member 5a being operatively connected with a transmission through a metering cable for rotation around its central axis so that the sensor 5 outputs a signal composed of a series of pulses with a frequency proportional to the speed at which the vehicle is running . a control unit 8 in the form of a microcomputer has a power supply terminal coupled to a source of electricity 6 through a power switch 7 in the form of a main switch . the microcomputer 8 has an input circuit 8a connected to receive the outputs of the cruise control setting switch 1 , the brake switch 2 , the stop lamp switch 4 and the speed sensor 5 , a rom 8b having a control program stored therein for executing an operational process as illustrated in fig2 a ram 8c serving as a working memory , a cpu 8d connected to the input circuit 8a for processing the output signals therefrom and effecting certain calculations and generating output signals , and an output circuit 8e connected to receive the output signals of the cpu 8d for outputting control signals to the exterior . a throttle actuator 9 , in the form of a well - known motor - driven type throttle actuator , receives the output signals of the output circuit 8e and in response thereto drivingly adjusts the opening degree of a throttle valve 11 disposed in an intake manifold 10 of an internal combustion engine . the throttle actuator 9 is operatively connected with an accelerator pedal ( not shown ) and includes a motor ( not shown ). the throttle actuator 9 has an arm or link 9a in the shape of a sector which is mounted at its center on a rotary shaft operatively connected with the output shaft of the motor for rotation therewith . the sector - shaped link 9a is connected at its peripheral point radially spaced from the center thereof with a rod 9b at its one end . the rod 9b is in turn connected at its other end with the throttle valve 11 in such a manner that the throttle valve 11 is forced to move in the closing or opening direction as the motor drives the sector - shaped link 9a to rotate in one or the other rotational direction . though not illustrated , a clutch in the form of an electromagnetic clutch is housed in the actuator 9 at a location between the link 9a and the unillustrated motor for making and breaking the operative connection therebetween . the operation of the clutch is controlled by an electromagnetic clutch signal scr which is outputted from the output circuit 8e of the microcomputer 8 . the operation of the above - described embodiment will next be described with reference to fig1 and 2 . first , the operator turns on the main switch 7 so that power is supplied from the source of electricity 6 to the microcomputer 8 . thus , the microcomputer 8 starts to operate and process the output signal of the speed sensor 5 , which is in the form of a series of pulses having a frequency proportional to the speed of the vehicle vs . the microcomputer 8 calculates the frequency of the output pulses of the speed sensor 5 and calculates the speed of the vehicle based on the frequency thus calculated . the microcomputer 8 determines , based on on or off signals from the brake switch 2 and the stop lamp switch 4 , whether the operations of these switches are normal . if the answer is &# 34 ; no &# 34 ; and if the measured or calculated speed of the vehicle is greater than a predetermined level and continues for a time longer than a predetermined period , the microcomputer 8 operates to inhibit the setting of cruise control , but if otherwise , it makes the cruise control apparatus in a condition ready for cruise control where setting of cruise control is permitted . in this connection , it is to be noted that the normal or abnormal operations of the brake switch 2 and the stop lamp switch 4 are determined as follows : ______________________________________condition brake sw 2 stop lamp sw 4 results______________________________________a on off normal ( brake released ) b off on normal ( brake applied ) c on on abnormald off off abnormal______________________________________ if the setting of cruise control is permitted , when the operator turns on the cruise control setting switch 1 , an on signal is inputted from the setting switch 1 to the microcomputer 8 so that the speed vs at which the vehicle is running at that time is stored in the ram 8c as a target speed vr and at the same time cruise control is started . the microcomputer 8 compares the actual speed vs of the vehicle sensed by the speed sensor 5 with the target speed vr and outputs a control signal from the output port 8e to the throttle actuator 9 whereby the actuator 9 is operated to properly adjust the opening degree of the throttle valve 11 so as to make the vehicle travel at the target speed vr . specifically , if the actual speed vs is less than the target speed vr , the microcomputer 8 generates a throttle opening drive signal so so as to increase the opening degree of the throttle valve 11 by a predetermined amount , whereas if the actual speed vs is greater than the target speed vr , the microcomputer 8 issues a throttle closing drive signal sc so as to decrease the opening degree of the throttle valve 11 by a predetermined amount . as a result , the vehicle is automatically controlled to travel at a predetermined constant speed without the need of operator &# 39 ; s accelerator pedal operation . during the time when the vehicle is travelling under such cruise control , when the operator steps on the brake pedal 3 , the stop lamp switch 4 in the form of a normally open type switch is turned on to send a cruise control release signal to the microcomputer 8 , whereby the microcomputer 8 acts to release ( disengage ) the unillustrated electromagnetic clutch in the throttle actuator 9 . at the same time , the brake switch 2 in the form of a normally closed type switch is turned off to interrupt the power supply to the throttle actuator 9 . thereafter , the opening degree of the throttle valve 9 is manually controlled by operator &# 39 ; s accelerator pedal operation so as to adjust the speed of the vehicle . on the other hand , the microcomputer 8 operates in the manner as shown in the flowchart of fig2 . specifically , in step 100 , initial setting is effected , and in step 101 the speed vs of the vehicle is calculated based on the period between the adjacent pulses of the output signal of the speed sensor 5 , the period being calculated by an interrupt routine which is executed every time the output signal in the form of a series of pulses of the speed sensor 5 rises . then , in step 102 , it is determined whether the stop lamp switch 4 is turned on or off . if the answer is &# 34 ; off &# 34 ;, the control process proceeds to step 103 where it is further determined whether the brake switch 2 is turned on or off . on the other hand , if the answer is &# 34 ; on &# 34 ; in step 102 , the control process proceeds to step 104 where it is determined whether the brake switch 2 is turned on or off . in step 103 , if it is determined that the brake switch 2 is &# 34 ; on &# 34 ;, both the stop lamp switch 4 and the brake switch 2 are normal , and thus the control process proceeds to step 105 where a cruise control flag in the ram 8c is set to &# 34 ; 1 &# 34 ; for permitting the setting of cruise control . thereafter , in step 105a , a counter in the microcomputer 8 is cleared , and then the control process proceeds to step 111 . on the contrary , in step 103 , if it is determined that the brake switch 2 is &# 34 ; off &# 34 ;, the control process proceeds to step 106 . returning to step 104 , if it is determined that the brake switch 2 is &# 34 ; on &# 34 ;, the control process proceeds to step 106 , but if &# 34 ; off &# 34 ;, to step 110 . here , in the case where the control process proceeds from step 101 to step 110 , the setting of cruise control is inhibited since there is the possibility that the brake pedal 3 will be released and both switches 2 and 4 returned to normal . if it is determined that the brake switch 2 is &# 34 ; on &# 34 ; in step 104 , there is an abnormality in the operation of either one of the brake switch 2 and the stop lamp switch 4 then , in step 106 it is determined whether the speed vs calculated in step 101 is equal to or greater than a predetermined speed level v 1 . if the answer is &# 34 ; yes &# 34 ;, the counting of the counter is halted in step 107 and then the control process proceeds to step 108 where it is determined whether the counted value of the counter is equal to or greater than a predetermined value , i . e ., it is determined whether a predetermined time has elapsed . if the answer is &# 34 ; yes &# 34 ;, then in step 109 the cruise control flag in the ram 8c is set to &# 34 ; 0 &# 34 ; for the purpose of inhibiting the setting of cruise control , and thereafter the control process proceeds to step 111 . on the other hand , if the answer is &# 34 ; no &# 34 ; in step 108 , the control process proceeds to step 111 . returning to step 106 , if the answer is &# 34 ; no &# 34 ;, then in step 110 the counter is cleared and the control process proceeds to step 111 . in step 111 , it is determined whether the flag set in the ram 8c is &# 34 ; 1 &# 34 ; or &# 34 ; 0 &# 34 ;. if the answer is &# 34 ; 1 &# 34 ; ( i . e ., the setting of cruise control is permitted ), the control process proceeds to step 112 where cruise control processing is effected , that is , cruise control is set when a cruise control setting signal is inputted from the cruise control setting switch 1 to the cpu 8d through the input circuit 8a in cases where the vehicle is travelling without any cruise control . in this connection , however , if the vehicle has already been under cruise control , nothing is done in step 112 . after step 112 or if the answer is &# 34 ; 0 &# 34 ; in step 111 ( i . e ., the setting of cruise control is inhibited ), the control process proceeds to step 113 where it waits a predetermined time and then returns to step 101 . thereafter , the same operational steps as described above are repeated . here , it is to be noted that the setting of cruise control as effected in step 112 is well known and has already been briefly described with reference to fig1 and therefore a detailed explanation thereof is omitted . in the above - described embodiment , the throttle actuator 9 is implemented as a motor - driven actuator , but any known type of actuator such as a vacuum - operated actuator having two electromagnetic valves for introducing an engine intake pressure and the atmospheric pressure , may be employed with the same results . | 1 |
fig1 is a schematic diagram illustrating an example of a configuration of a communication system according to a first exemplary embodiment . a communication system 7 has a configuration in which communication devices 1 to 4 and a communication target device 5 are connected to each other by a network 6 , so as to enable communication . as an example , the communication devices 1 to 4 may be a multifunction machine which includes functions of printing , scanning , fax , and the like , and may be a communication device communicating with the communication target device 5 in order to perform the function . each of the communication devices 1 to 4 includes an electronic component such as a central processing unit ( cpu ) or a flash memory , in the main body . the electronic component has a function for processing information . the communication devices 2 to 4 are assumed to be products which have the same configuration as that in this exemplary embodiment . however , it is not necessary that the communication devices 2 to 4 have completely the same configuration as that of the communication device 1 . the communication devices 2 to 4 may have a built - in os , a product model , a manufacturer , and the like which are different from those of the communication device 1 . the communication target device 5 is a device such as a server , which has a communication function . the communication target device 5 includes electronic components such as a cpu and a flash memory , in a main body . the electronic components have a function for processing information . the network 6 is a communication network which allows high - speed communication . for example , as the network 6 , a wired or wireless communication network such as an intranet and a local area network ( lan ) is provided . the communication devices 1 to 4 are assumed to generate image information by scanning an original document using , so - called “ scan to smb ”, and to transmit the generated image information to a shared folder which is formed in a memory of the communication target device 5 , through the network 6 . it is assumed that errors such as authentication failure or character corruption occur between the communication device 1 and the communication target device 5 . on the above assumption , the communication device 1 refers to setting values of the communication devices 2 to 4 , and attempts to solve an error occurring between the communication device 1 and the communication target device 5 . here , in this exemplary embodiment , “ an error ” occurring , between the communication device 1 and the communication target device 5 means an error occurring due to a setting of a communication protocol in the communication device 1 and the communication target device 5 . as the error occurring due to the setting of the communication protocol , as described above , for example , failure of authentication , occurrence of character corruption , and the like are exemplified . as an example of failure of authentication , a case where a transmission side and a reception side have different settings in an authentication method from each other , a case where settings of a domain name for authentication are different from each other , and thus the authentication fails , and the like are exemplified . as an example of the occurrence of character corruption , regarding a character code of a file name which is transmitted , a case in which since the character code of the transmission side is set as “ euc - jp ” and the character code of the reception side is set as “ utf - 8 ”, difference in separation , matching , or the like of characters occurs , and thus , character corruption in a file name occurs on the reception side is exemplified . in this exemplary embodiment , the “ setting of communication ” is assumed to designate an item which is not automatically set , not a setting item which is automatically set by communication on the communication protocol between the communication device 1 and the communication target device 5 . however , regarding the setting item which is automatically set by communication on the communication protocol , an error may also occur in a setting situation of the entirety he network to which a device other than the communication device 1 and the communication target device 5 is connected . thus , the “ setting of communication ” may include the setting item which is automatically set . fig2 is a block diagram illustrating a configuration example of the communication device 1 according to the first exemplary embodiment . the communication device 1 includes a controller 10 , a memory 11 , a communication unit 12 , a display 13 , an operation unit 14 , and a function unit 15 . the controller 10 is configured from a cpu and the like . the controller 10 controls the units and executes various programs . the memory 11 is configured from a recording medium such as a flash memory , and stores information . the communication unit 12 performs communication with an external device through a network . the display 13 is configured from a liquid crystal display ( lcd ) and the like , and displays a letter or an image . the operation unit 14 is configured from a button , a touchpad , and the like , and receives an input operation . the function unit 15 performs functions of printing , scanning , fax , and the like . the controller 10 executes as communication program 110 ( which will be described later ) so as to perform functions as a function execution unit 100 , a communication history recording unit 101 , an error handling unit 102 , an external - device setting - acquiring unit 103 , an external - device communication history confirmation unit 104 , a setting value determination unit 105 , and a setting - change notification unit 106 . the function execution unit 100 causes the function unit 15 to perform a function of printing , scanning , fax , or the like . “ scan to smb ” as an example of the function is performed by the function execution unit 100 . communication is performed through the communication unit 12 . the communication history recording unit 101 records a communication result obtained when the function unit 15 performs the function of “ scan to smb ”, and communicates with the communication target device 5 through the communication unit 12 . the communication history recording twit 101 records the communication result as communication history information 111 . particularly , in a case where an error occurs , the communication history recording unit 101 records an error code indicating the type of the error . the error handling unit 102 refers to the error handling information 112 regarding a predetermined coping method for an error code , and selects the corresponding coping method so as to handle the error . the external - device setting - acquiring unit 103 inquires a setting value of the coping method selected by the error handling unit 102 , of the communication devices 2 to 4 . the external - device setting - acquiring unit 103 acquires setting values from the communication devices 2 to 4 . the external - device communication history confirmation unit 104 performs inquiry for the communication devices 2 to 4 , and confirms communication history of the communication devices 2 to 4 . particularly , the external - device communication history confirmation unit 104 confirms whether errors do not occur in the communication devices 2 to 4 with the setting values acquired by the external - device setting - acquiring unit 103 . the setting value determination unit 105 determines a setting value for the coping method selected by the error handling unit 102 , based on he setting values which are acquired by the external - device setting - acquiring unit 103 . the setting value determination unit 105 determines the setting value in accordance with details confirmed by the external - device communication history confirmation unit 104 . in a case where the setting value in the communication is changed to the setting value determined by the setting value determination unit 105 , the setting - change notification unit 106 notifies an external manager of details of the change . the memory 11 stores the communication program 110 for operating the controller 10 as the above - described units 100 to 106 , the communication history information 111 , the error handling information 112 , and the like . next , an action in the exemplary embodiment will be described . fig6 is a flowchart illustrating an example of an operation of the communication device 1 . firstly if the operation unit 14 receives an operation , the function execution unit 100 causes the function unit 15 to perform “ scan to smb ”. the function unit 15 scans an original document so as to generate image information . the function unit 15 communicates with the communication target device 5 through the communication unit 12 , in order to transmit the generated image information to the shared folder of the communication target device 5 ( s 1 ). then , the communication history recording unit 101 causes the function unit 15 to perform the function of “ scan to smb ”. the communication history recording unit 101 records a communication result obtained when communication with the communication target device 5 is performed through the communication unit 12 , as the communication history information 111 ( s 2 ). particularly , in a case where an error occurs , as illustrated in the following fig3 , the communication history recording unit 101 records an error code indicating the type of the error . fig3 is a schematic diagram illustrating an example of a configuration of the communication history information 111 . communication history information 111 a is an example of the communication history information 111 . the communication history information includes date and time of communication , an operation type of an operation of the communication device , the communication result , the error code indicating the type of an error which is recorded in a case where the error occurs , communication partner , and a user name of a user who uses the communication device 1 . the above example describes a case where an error having an error code of “ e - prn - 002 ” occurs and thus communication is abnormally ended when a user “ guest ” operates the communication device 1 to perform scanning for “ scan to smb ”, and communication is performed so as to transmit image information generated by the scanning to “ pc - 1 ” indicating the communication target device 5 . then , in a case where such an error occurs in the communication ( s 3 ; yes ), the error handling unit 102 refers to the error handling information 112 illustrated in the following fig4 , and selects the corresponding coping method so as to handle the error ( s 4 ). fig4 is a schematic diagram illustrating an example of a configuration of the error handling information 112 . error handling information 112 a includes an error code , a coping method indicating details of coping , a coping target , and a change timing for changing the setting value . in the example illustrated in fig3 , the error code is “ e - prn - 002 ”. thus the error handling unit 102 refers to the error handling information 112 a , and selects a coping method of “ increasing a communication timeout time ” for a coping target of “ multifunction machine ” ( which instructs the communication device 1 ) as the coping method . since the change timing is “ immediately ”, the selected coping method is immediately performed . then , the external - device setting - acquiring unit 103 inquires a setting value of the coping method selected by the error handling unit 102 , of the communication devices 2 to 4 . the external - device setting - acquiring unit 103 acquires setting values from the communication devices 2 to 4 ( s 5 ). fig5 is a schematic diagram illustrating an example of the setting value acquired by the external - device setting - acquiring unit 103 . a setting value 103 a includes a device name of an external device and a communication timeout time serving as an example of a setting value . the above example describes a case where a setting value of a device name “ mfp - 1 ” indicating the communication device 1 before changing is “ 10 ” seconds , but each of setting values of device names “ mfp - 2 ” to “ mfp - 4 ” indicating the communication devices 2 to 4 is “ 60 ” seconds . then , the external - device communication history confirmation unit 104 performs an inquiry for the communication devices 2 to 4 , and confirms communication history of each of the communication devices 2 to 4 ( s 6 ). particularly , the external - device communication history confirmation unit 104 confirms whether an error does not occur in the communication devices 2 to 4 with the setting values of “ 60 ” seconds acquired by the external - device setting - acquiring unit 103 . the setting value determination unit 105 determines a setting value for the coping method selected by the error handling unit 102 , based on the setting values which are acquired by the external - device setting - acquiring unit 103 . that is , since the setting values of the device names “ mfp - 2 ” to “ mfp - 4 ” which indicate external devices other than the device name “ mfp - 1 ” indicating the communication device 1 is “ 60 ” seconds , the setting value determination unit 105 extends the communication timeout time from “ 10 ” seconds up to “ 60 ” seconds . when the external device communication history confirmation unit 104 confirms that an error does not occur with the setting value of “ 60 ” seconds in the communication devices 2 to 4 , the setting value determination unit 105 determines the setting value to be “ 60 ” seconds ( s 7 ). then , the setting - change notification unit 106 notifies a terminal used by an outside manager , of a message indicating that the communication timeout time is changed to the setting value of “ 60 ” seconds determined by the setting value determination unit 105 ( s 8 ). according to the above - described first exemplary embodiment , in a case where an error occurs in communication with the communication target device 5 , the setting value of the communication device 1 can be changed based on the setting values of the other communication devices 2 to 4 which are connected to the network 6 . thus , it is possible to handle the error without a need for an operation of a manager . even in a situation , for example , where the communication device 1 is newly added to the communication system 7 , the communication device 1 can be set so as to match with the settings of the other communication devices 2 to 4 , without setting by a manager . since confirmation of whether no error occurs is performed with reference to the communication history of each of the communication devices 2 to 4 , reliability of the setting value of the communication device 1 is improved . a second exemplary embodiment is different from the first exemplary embodiment in that the communication device 1 performs an inquiry for the other communication devices 2 to 4 , but a server device is newly disposed , and the communication device 1 performs an inquiry for the server device so as to handle an error . components common with those in the first exemplary embodiment are denoted by the common reference signs . fig7 is a schematic diagram illustrating an example of a configuration of a communication system according to the second exemplary embodiment . a communication system 7 a has a structure in which communication devices 1 a to 4 a , a communication target device 5 , and a server device 8 are connected to each other through a network 6 , so as to enable communication with each other . as an example , the communication devices 1 a to 4 a may be a multifunction machine which includes functions of printing , scanning , fax , and the like , and may be a communication device communicating with the communication target device 5 in order to perform the function . the communication device 1 includes an electronic component such as a central processing unit ( cpu ) or a flash memory , in the main body . the electronic component has a function for processing information . the server device 8 communicates with the communication devices 1 a to 4 a . the server device 8 includes an electronic component ( such as a central processing unit ( cpu ) or a flash memory ) which has a function filer processing information , in the main body . fig8 is a block diagram illustrating a configuration example of the communication device 1 a according to the second exemplary embodiment . a controller 10 of the communication device 1 a executes a communication program 110 a ( which will be described later ) so as to perform functions as a function execution unit 100 , a communication history recording unit 101 , an inquiry transmission unit 107 , a handling - method reception unit 108 , and the like . the inquiry transmission unit 107 inquires a coping method corresponding to an error code , and a setting value appropriate for the coping method , of the server device 8 . the handling - method reception unit 108 receives a coping method corresponding to the error code , and a setting value appropriate for the coping method , from the server device 8 . the memory 11 stores the communication program 110 a for operating the controller 10 as the above - described units 100 , 101 , 107 , and 108 , communication history information 111 , and the like . fig9 is a block diagram illustrating a configuration example of the server device 8 according to the second exemplary embodiment . the server device 8 includes a controller 80 , a memory 81 , and a communication unit 82 . the controller 80 is configured from a cpu and the like . the controller 80 controls the units and executes various programs . the memory 81 is configured from a recording medium such as a flash memory , and stores information . the communication unit 82 performs communication with an external device through a network . the controller 80 executes a communication program 810 ( which will be described later ) so as to perform functions as an inquiry acceptance unit 800 , an error handling unit 801 , an external - device setting - acquiring unit 802 , an external - device communication history confirmation unit 803 , a setting value determination unit 804 , and the like . the inquiry acceptance unit 800 receives an inquiry of a coping method corresponding to an error code , and a setting value appropriate for the coping method from the communication device 1 a . the error handling unit 801 refers error handling information 811 regarding a predetermined coping method for an error code , and selects , the corresponding coping method so as to , handle the error . the external - device setting - acquiring unit 802 inquires a setting value of the coping method selected by the error handling unit 801 , of the communication devices 2 a to 4 a . the external - device setting - acquiring unit 802 acquires setting values from the communication devices 2 a to 4 a . the external - device communication history confirmation unit 803 performs inquiry for the communication devices 2 a to 4 a , and confirms communication history of each of the communication devices 2 a to 4 a . particularly , the external - device communication history confirmation unit 803 confirms that an error occurs with the setting value acquired by the external - device setting - acquiring unit 802 , in the communication devices 2 a to 4 a . as an example of confirming whether an error does not occur with the setting value acquired by the external - device setting - acquiring unit 802 , in the communication devices 2 a to 4 a , for example , the following methods are exemplified . as a first method , the communication device 1 a confirms a time when the setting value is set , from the communication history confirmed by the external - device communication history confirmation unit 803 . the communication device 1 a determines whether or not an error having the same error code as that of an error which occurs this time in the communication device 1 a occurs in the communication subsequent to the time when the setting value is set . as a second method , the communication device 1 a performs an inquiry for the communication devices 2 a to 4 a . when a setting time of the setting value is previously recorded in the communication history of each of the devices 2 a to 4 a , and an inquiry of the communication history from the communication device 1 a occurs , each of the communication devices 2 a to 4 a acquires an error code matching with an error code of the error which occurs this time in the communication device 1 a . each of the communication devices 2 a to 4 a determines whether or not an error having the acquired error code occurs in the communication subsequent to the setting time of the setting value at which an acquisition request is received . each of the communication devices 2 a to 4 a transmits a result of the determination as a response , to the communication device 1 a . the setting value determination unit 804 determines a setting value of the coping method selected by the error handling unit 801 , based on the setting values acquired by the external - device setting - acquiring unit 802 . the setting value determination unit 804 determines the setting value in accordance with details confirmed by the external - device communication history confirmation unit 803 . the memory 81 stores the communication program 810 of operating the controller 80 as the above - described units 800 to 804 , error handling information 811 , communication history information 812 , handling setting - value information 813 , and the like . next , an action in the exemplary embodiment will be described . fig1 is a flowchart illustrating an example of an operation of the communication system . firstly , if the operation unit 14 receives an operation , the function execution unit 100 causes the function unit 15 to perform “ scan to smb ”. the function unit 15 scans an original document so as to generate image information . the function unit 15 communicates with the communication target device 5 through the communication unit 12 , in order to transmit the generated image information to the shared folder of the communication target device 5 ( s 11 ). then , the communication history recording unit 101 causes the function unit 15 to perform the function of “ scan to smb ”. the communication history recording unit 101 records a communication result obtained when communication with the communication target device 5 is performed through the communication unit 12 , as the communication history information 111 ( s 12 ). particularly , in a case when an error occurs , similar to the first exemplary embodiment , the communication history recording unit 101 records an error code indicating the type of the error . in the example of the second exemplary embodiment , it is set that an error having an error code of “ e - prn - 001 ” and thus communication is abnormally ended when the communication device 1 a performs scanning , for “ scan to smb ”, image information generated by the scanning is transmitted to the communication target device 5 . then , in a case where such an error occurs in the communication ( s 13 ; yes ), the inquiry transmission unit 107 inquires a coping method corresponding to the error code of “ e - prn - 001 ”, and a setting value appropriate for the copping method , of the server device 8 ( s 14 ). then , the inquiry acceptance unit 800 of the server device 8 receives the inquiry of the coping method corresponding to the error code and of the setting value appropriate for the coping method , from the communication device 1 a ( s 21 ). the error handling unit 801 refers the error handling information 811 having the same details as those of the error handling information 112 illustrated in fig4 , and selects the corresponding coping method ( s 22 ). in the above - described example , the error code is “ e - prn - 001 ”. thus , the error handling unit 801 refers to the error handling information 811 , and selects a coping method of “ increasing the simultaneous communication capable number ” for a coping target of “ multifunction machine ” ( which instructs the communication device as the coping method . since the change timing is “ during low operation ”, the selected coping method is performed when the communication device 1 a is in a state during a low operation . then , the external - device setting - acquiring unit 802 inquires a setting value of the coping method selected by the error handling unit 801 , of the communication devices 2 a to 4 a . the external - device setting - acquiring unit 802 acquires setting values from the communication devices 2 a to 4 a ( s 23 ). fig1 is a schematic diagram illustrating an example of the setting value acquired by the external - device setting - acquiring unit 802 . a setting value 802 a includes a device name of an external device and the simultaneous communication capable number , which functions as an example of a setting value . the setting value 802 a may be regularly acquired by the external - device setting - acquiring unit 802 . the frequency of acquiring the setting value 802 a may be random , and for example , the setting value may be acquired once per day . the above example describes a case where a setting value of a device name “ mfp - 1 ” indicating the communication device 1 a before changing is “ 2 ”, but each of setting values of device names “ mfp - 2 ” to “ mfp - 4 ” indicating the communication devices 2 a to 4 a is “ 5 ”. then , the external - device communication history confirmation unit 803 performs an inquiry for the communication devices 2 a to 4 a . the external - device communication history confirmation unit 803 confirms communication history of each of the communication devices 2 a to 4 a , and stores the confirmed communication history in the memory 81 , as the communication history information 812 . the external - device communication history confirmation unit 803 performs description like “ the number of times of occurrence of e - prn - 001 ” in fig1 , for comparison ( s 6 ). particularly the external - device communication history confirmation unit 803 confirms whether an error does not occur in the communication devices 2 a to 4 a with the setting values of “ 5 ” acquired by the external - device setting - acquiring unit 802 . the setting value determination unit 804 determines a setting value of the coping method selected by the error handling unit 801 , based on the setting values acquired by the external - device setting - acquiring unit 802 . fig1 is a schematic diagram illustrating a configuration of a handling setting value determined by the error handling unit 801 . that is , as illustrated in fig1 , since the setting values of the device names “ mfp - 2 ” to “ mfp - 4 ” which indicate external devices other than the device name “ mfp - 1 ” indicating the communication device 1 is “ 5 ”, but “ the number of times of occurrence of an error of e - prn - 001 ” in “ mfp - 3 ” is 2 , as illustrated in fig1 , the error handling unit 801 determines , for example , “ 6 ” as the setting value ( s 25 ), and stores the determined value in the memory 81 , as the handling setting value 813 a . the setting value determination unit 804 transmits the error handling method of “ increasing the simultaneous communication capable number ”, and “ 6 ” as the simultaneous communication capable number which is the determined setting value , in a response to the inquiry from the communication device 1 a ( s 26 ). then , the handling - method reception unit 108 of the communication device 1 a receives the coping method corresponding to the error code , and the setting value appropriate for the coping method , from the server device 8 ( s 15 ). the handling - method reception unit 108 applies the received coping method and setting value to the setting value of the function execution unit 100 . according to the above - described second exemplary embodiment , since the server device 8 determines the coping method and the setting value for an error , a target for which the communication device 1 a performs an inquiry may he only the server device 8 , and thus it is possible to reduce the number of procedures required for the inquiry , in addition to the advantages of the first exemplary embodiment . in a case where the server device 8 acquires the setting values of the communication devices 1 a to 4 a regularly , even if only an error code of the communication device 1 a is received , the coping method and the setting value for the error can be determined . thus , the number of procedures required for a response is reduced . the present invention is not limited to the above exemplary embodiments , and various modifications can be made in a range without departing from the gist of the present invention . for example , the communication devices 1 to 4 ( 1 a to 4 a ) may store history of details of a change as change history information , in a case where the setting is changed . fig1 is a schematic diagram illustrating a configuration of the change history information . change history information 113 is information stored in the memory 11 by each of the communication devices 1 to 4 ( 1 a to 4 a ). the change history information 113 includes a coping date and time when the setting value is changed for an error , an error code indicating the type of the error , setting information of the changed setting value , the setting value , and information regarding the main executing agent who performs the change . in the example illustrated in fig1 , a message indicating that “ a manager ” sets “ memory setting ” to be “ an hdd spool ”, and a message indicating that “ mfp ” which indicates the communication device 1 changes “ the communication timeout time ” to “ 60 ” seconds for an error code of “ e - prn - 002 ” are recorded . recording the change history information 113 allows recognition of whether the change of the setting value is automatically performed by the communication device 1 ( 1 a ) or performed by a manager . if necessary , management of , for example , restoring the setting value is easily performed . the functions of the units 100 to 108 and 800 to 804 of the controller 10 are realized by a program in the aforementioned exemplary embodiments . all or some of the units may be realized by hardware such as asic . the program used in the aforementioned exemplary embodiments may be stored in a recording medium such as a cd - rom and be provided . the steps described in the aforementioned exemplary embodiment may be replaced , deleted , and added in the range without changing the gist of the present invention . the foregoing description of the exemplary embodiments of the present invention has been provided for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise forms disclosed . obviously , many modifications and variations will be apparent to practitioners skilled in the art . the embodiments were chosen and described in order to best explain the principles of the invention , and its practical applications , thereby enabling others skilled in the art to understand the invention for various embodiments and with the various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the following claims and their equivalents . | 7 |
u . s . provisional patent application serial no . 60 / 302 , 600 , filed jun . 29 , 2001 , u . s . provisional patent application serial no . 60 / 365 , 996 , filed mar . 19 , 2002 , and u . s . provisional patent application serial no . 60 / 365 , 489 , filed mar . 18 , 2002 , u . s . patent application ser . no . 09 / 896 , 189 , filed jun . 29 , 2002 , u . s . patent application ser . no . 09 / 897 , 160 , filed jun . 29 , 2002 , u . s . patent application ser . no . 09 / 896 , 983 , filed jun . 29 , 2002 , u . s . patent application ser . no . 09 / 897 , 158 , filed jun . 29 , 2002 , and u . s . patent application ser . no . 09 / 896 , 797 , filed jun . 29 , 2002 , are all incorporated by reference herein in their entirety . [ 0016 ] fig1 shows one example of a laser array constructed in accordance with the invention . the laser array is made up of either many discrete lasers , multiple individual lasers each having two or more active regions , or some combination thereof ( interchangeably referred to herein as “ lasers ” or “ laser elements ”). depending upon the particular application in which the pump laser is to be used , the lasers will have a wavelength of 968 nm , 980 nm , 14380 nm , “ 14xx ” nm , or some combination thereof . as shown in fig1 the lasers are coupled to a fiber by a lens array . the lens array is enlarged to illustrate how it couples light from the array &# 39 ; s individual laser elements into the optical fiber . as shown in fig1 for purposes of example , the array is a 13 × 13 array of lasers ( i . e . 169 laser elements ) with each being capable of outputting at least { fraction ( 1 / 169 )} th of the output required of a pumping laser . of course , depending upon the particular implementation , the size of the array can be increased or decreased to meet specific requirements of the intended application and the lasers used . additionally , for coupling the laser output to the fiber , lens arrays of different sizes or types ( including single and compound lens arrays ) can be used depending upon the particular application , either alone or in conjunction with other optical elements . for example , if an extremely large laser array is used , for example a 100 × 100 array , a larger lens array , a combination of lenses and arrays or additional elements such as faceplates , collimators , waveguides , etc . may be needed to properly focus the beam onto the optical fiber . [ 0019 ] fig2 shows one variant of the invention involving a lens array approach . each laser element in the array releases a light beam that passes through a corresponding lens element in the lens array . the lens array directs the beams toward the opening of the optical fiber . depending upon the lenses and fiber , the light goes directly into the fiber or goes from the lens array through one or more lenses . the lens then focuses the light into a single beam that travels down the optical fiber . although the fig2 shows only one bi - convex lens to focus the beams from the laser elements into the fiber , multiple lenses can be used for large arrays . additionally , in some cases the light may need to be focussed more narrowly , for example , if the optical fiber is a single mode fiber ( i . e . it is extremely small ). in such cases , more lenses or a more complex arrangement of elements can be used . [ 0021 ] fig3 shows an alternate variant of the invention . in this variant , each laser element of the laser array emits a light beam into a diffractive optical element ( doe ). the doe defracts the light toward a first tier of bi - convex lenses . the layer of bi - convex lenses collect light from the doe array and focuses the light toward one or more additional lenses on a tier between the first tier and the optical fiber . a lens , near the fiber , focuses the incidental light from the laser array into the optical fiber . although fig3 shows two tiers of lenses , additional tiers can be added ( with or without other elements ) for different applications . in addition , the diffraction gradient could , in fact , be made up of multiple tiers depending upon , for example , the wavelength of emitted light , the size of the laser array , etc . . . . [ 0023 ] fig4 shows experimental measurements made by a vertical cavity surface emitting pumping laser , constructed according to the teachings of the invention , with 32 laser elements each having wavelengths of 968 nm . as the current to the lasers increases from 0 to 10 ma the output voltage of the laser increases from 1 . 25v to nearly 3v . the output power increases from 0 mw to nearly 6 . 25 mw . the conversion efficiency of the laser array varies from 0 % to 30 % as the laser current is increased . maximum efficiency is achieved at approximately 3 . 5 ma . [ 0024 ] fig5 is a pump power analysis table for several different sized arrays according to the teaching of the invention . for each array size , the coupling efficiency was about 70 %. as expected , the output power is larger for arrays containing more elements . specifically , the power increases linearly with respect to the number of laser elements in the array . for example , with 72 lasers the power is 0 . 504 mw while with 1024 lasers , the power is 7 . 168 mw . as shown in fig5 although increasing the number of laser elements means that the size of the optical component chip and / or die must be increased , increasing the size of the array from 144 lasers , which has a size of 1 . 5 mm × 1 . 5 mm , to 576 lasers ( a 4 × increase in number of lasers ) does not increase the optical component chip size at all and only increases the die size to 3 mm × 3 mm ( an increase of only 1 . 5 mm per side ). similarly , an increase to 1024 lasers from 144 lasers adds 880 lasers but increases the optical component chip size by only 0 . 5 mm per side while increasing the die size by only 2 . 5 mm per side to accommodate the 880 additional connection points . thus , an extremely large array can be constructed within a small area . although the table only lists four array sizes , it illustrates an advantage achievable at low cost , namely scalability since the number of laser elements can be readily increased to thousands of laser elements . another advantage achievable in some implementations is compact size . this is accomplished by integrating the lasers into a custom - made integrated circuit (“ ic ”) using wafer scale technology , for example using a technique described in the incorporated by reference , commonly assigned , united states patent applications entitled “ opto - electronic device integration ”, ser . nos . 09 / 896 , 189 , 09 / 897 , 160 , 09 / 896 , 983 , 09 / 897 , 158 . the ic is scalable and can be built with thousands of array elements for different applications . the cost of mass producing the laser array future modifications and / or variations of the design are low relative to the cost of pumping lasers in the prior art . another advantage of this invention is that it can be used for different applications or with different devices . for example , although 980 nm lasers were used for the experimental data of fig4 this invention can be used with lasers of different wavelengths including lasers having the typical 968 nm , 980 nm , 1480 nm , or 14xx nm wavelengths , to identify a few . moreover , the ability to change the output power of the entire array by adjusting the power level of the individual laser elements by small incremental amounts means that the array can readily be used in systems that require different amounts of signal boast . another advantage achievable by applying the teachings of the invention is longer device life . there are at least three different mechanisms for ensuring a long lifetime for the pumping lasers . the first mechanism is passive in that , with laser arrays according to the invention , if a single laser or , in the case of a very large array even a significant number of lasers , fails to operate properly , the overall power of the array will not be significantly affected . for example , if one laser element in an array of 1024 fails , the total output power decreases by only 0 . 098 %. for many applications the reduction in power is too small to adversely affect performance . moreover , since increasing the size of the array corresponds to a decrease in individual power to each laser element , the affect of an element failing decreases for larger arrays . therefore , the efficiency of the passive mechanism increases as larger arrays are used . the second mechanism used by this invention to achieve a long lifetime is redundancy . redundancy is achieved by providing each laser with at least one backup such as shown in the commonly assigned u . s . patent application ser . no . 09 / 896 , 797 entitled “ redundant optical device array ” the entire disclosure of which is incorporated herein by reference . the lasers are integrated onto an integrated circuit ( ic ) with the ability to automatically switch to backup devices if necessary . if a laser fails , the backup can be manually or automatically turned on to take the place of the original . this prevents the total output power of the laser array from decreasing as the device progresses through its life cycle . for example , a 144 - element laser array could be configured to have 72 operating elements and 72 backups . if a laser element ceases to function , its backup element can be used in its place and adds to the power of the remaining lasers to achieve the same total output power as the original 72 lasers . the same array could also be configured to have 136 operating elements and only 12 backups for applications where the life cycle is expected to be significantly shorter than the mean time between failures (“ mtbf ”) associated with 12 lasers failing . the third mechanism used to ensure a long lifetime is achieved by altering the output power of the laser elements . for this mechanism , the array is configured so that if a laser element fails , the power to the remaining laser elements will be increased to make up the difference . by using a large array , if an element fails , the fractional increase in power to the remaining functioning elements is small and does not put a strain on the remaining laser elements . for example , if one laser fails in an array of 72 , the power to the remaining 71 lasers need only be increased by { fraction ( 1 / 72 )} of the total power before the failure . another advantageous aspect is manufacturing yield . in accordance with the present invention , because most variants will have identical lasers , the incremental cost of manufacturing a laser array having 1000 lasers instead of 100 ( 10 × as many ) is minimal . as a result , one can readily manufacture an array that is large enough so that the presence of any laser that is defective , does not work or operates in an anomalous or detrimental fashion will have little to no effect on yield . building upon the above , it should be appreciated that , by adding a few additional elements in a straightforward manner , the array can be made to function in an intelligent manner . for example , in some implementations the array is constructed to also include one or more photodetectors that are used for feedback purposes . depending upon the particular implementation , the photodetectors are used to measure or sample the overall output power of the pump laser . in this manner , if the output power deviates from the desired level by more than a specified amount , the laser drive circuitry can be signaled to cause a change in the output of the individual lasers to compensate for the fluctuation . similarly , in some implementations , one or more temperature sensors can be incorporated into the array to allow for laser output fluctuations or drift caused by temperature changes . in those implementations , as temperature changes affect pump laser output power , adjusting the individual lasers as described above makes it possible to compensate . it is expected that , for some implementations , control and compensation will occur using some form of programmed control . for example , in the simplest cases , a state machine can be used . in other more complex cases , programmed intelligence in the form of a computer , microprocessor , etc . ( all hereafter interchangeably referred to as a “ processor ”) will be used . in the case of a processor , a program is used to process whatever feedback is available , for example , feedback from one or more photodetectors , temperature sensors , etc . and determine what changes , if any , need to be made . depending upon the particular implementation , this may involve conversion formulas , the use of look up tables or both . if a change needs to be made , the processor , operating under program control will send the appropriate signals to the drive circuitry for the lasers to bring about the desired change . in more sophisticated implementations , the processor may also be configured to control individual lasers . in this manner , compensation can be controlled on a more granular scale . in addition , this type of arrangement also allows for compensation through bringing individual lasers on and off line , either alone or in conjunction with the controlling of individual laser output as described herein . it should therefore be understood that the above description is only representative of illustrative embodiments . for the convenience of the reader , the above description has focused on a representative sample of all possible embodiments , a sample that teaches the principles of the invention . the description has not attempted to exhaustively enumerate all possible variations . that alternate embodiments may not have been presented for a specific portion of the invention , or that further undescribed alternate embodiments may be available for a portion , is not to be considered a disclaimer of those alternate embodiments . one of ordinary skill will appreciate that many of those undescribed embodiments incorporate the same principles of the invention and others are equivalent . | 6 |
a system and process made and practiced according to this invention treats meg - water streams so that the meg can be re - used in the gas production pipeline system . more particularly , the system and process are designed for the simultaneous removal of divalent cations and sulfate from meg - water streams through the addition of alkalinity and barium ions . divalent cations may include , but are not limited to , calcium , magnesium , iron , strontium , and barium . depending upon the concentration of divalent ions in the meg - water stream , its ph , and other factors , the alkalinity may be a sodium carbonate solution , a sodium hydroxide solution , a potassium carbonate solution , a potassium hydroxide solution , or a combination of the above . referring to fig1 , a system for removing divalent ions from a meg - water stream includes a chemical treatment tank 5 to receive the incoming meg - water stream 10 , which contains calcium , magnesium , and sulfate ions . the chemical treatment tank 5 also receives a barium chloride solution through a barium chloride injection line 20 , a sodium carbonate solution through a sodium carbonate injection line 30 , and a sodium hydroxide solution through a sodium hydroxide injection line 40 . the weight percentage of barium chloride in the barium chloride solution may be approximately 20 percent at 25 ° c ., the weight percentage of sodium carbonate in the sodium carbonate solution may be approximately 20 percent at 25 ° c ., and the weight percentage of sodium hydroxide in the sodium hydroxide solution may be approximately 47 percent at 25 ° c . potassium carbonate may be used as an alternative to sodium carbonate , and potassium hydroxide may be used as an alternative to sodium hydroxide . after mixing , the meg - water stream is carried away from the chemical treatment tank 5 by an exit line 50 . the meg - water stream may be pumped by a mixing pump 55 through recycle lines 60 , 80 to the chemical treatment tank 5 . alternatively , the meg - water stream may be pumped through line 70 to a solids removal system 75 , where the precipitated solids are removed and sent for disposal 90 . solids removal systems such as filters and centrifuges are well - known in the art , and any suitable system may be used with the invention . the filtrate or centrate from the solids removal system 75 exits the system through line 100 . from there , it may be recycled through line 120 to the chemical treatment tank 5 or sent through line 110 to the filtrate tank 115 . the meg - water stream from the filtrate tank 115 is then sent through exit line 130 to downstream equipment for additional treatment . the precipitation of divalent ions and sulfate may occur simultaneously or sequentially . for simultaneous precipitation , the meg - water stream 10 enters the chemical treatment tank 5 . barium chloride , sodium carbonate , and sodium hydroxide solutions are added to the chemical treatment tank 5 through lines 20 , 30 , and 40 , respectively , at individual rates determined by the flow and characteristics of the meg - water stream 10 . the resulting mixture exits the chemical treatment tank 5 through line 50 and is recycled back to the tank 5 through lines 60 and 80 until the precipitation reactions are complete . the meg - water stream 10 is then routed to the solids removal system 75 through line 70 . the solids are sent for disposal 90 , while the filtrate or centrate exits the solids removal system 75 through line 100 . the filtrate or centrate is then routed to the filtrate tank 115 through line 110 and subsequently on to meg regeneration . for sequential precipitation , the meg - water stream 10 enters the chemical treatment tank 5 . a barium chloride solution is added to the chemical treatment tank 5 through line 20 at a rate determined by the flow and characteristics of the meg - water stream . the resulting mixture exits the chemical treatment tank 5 through line 50 and is recycled back to the tank 5 through lines 60 and 80 until the precipitation reaction for barium sulfate is complete . the stream is then routed to the solids removal system 75 through line 70 . the barium sulfate solids are sent for disposal 90 , while the filtrate or centrate exits the solids removal system 75 through line 100 and is routed to the chemical treatment tank 5 through line 120 . the process is repeated a second time for the addition of a sodium carbonate solution through line 30 , which results in the precipitation of the calcium ions as calcium carbonate , and the addition of a sodium hydroxide solution through line 40 , which results in the precipitation of the magnesium ions as magnesium hydroxide . alternatively , the process is repeated a second time for the addition of a sodium carbonate solution through line 30 , which results in the precipitation of the calcium ions as calcium carbonate , and a third time for the addition of a sodium hydroxide solution through line 40 , which results in the precipitation of the magnesium ions as magnesium hydroxide . the individual rates of addition for the sodium carbonate and sodium hydroxide solutions are determined by the flow and characteristics of the meg - water stream 10 . after all the solids have been separated for disposal 90 by the solids removal system 75 , the remaining filtrate or centrate is routed to the filtrate tank 115 through line 110 for further processing . the equipment used to test the simultaneous precipitation of magnesium , calcium , and sulfate ions is shown in fig2 . the equipment includes a double - skinned 5 l glass reaction vessel with a stirrer . the reaction vessel is connected to a hot oil circulator bath which allows the temperature of the reaction vessel to be adjusted between − 10 ° c . and 150 ° c . the reaction vessel is fitted with a ph probe ( hamilton polilyte plus arc 425 ), dissolved oxygen probe ( hamilton oxygold g arc 425 ), electrical conductivity probe ( hamilton conducell 4usf arc pg425 ), redox probe ( hamilton polilyte plus orp arc 425 ), and a thermocouple ( not shown ) to measure liquid temperature during the progression of the test . a small flow of nitrogen ( 100 ml / min ) was passed through the vapor space above the liquid inventory . liquids were added to the reaction vessel through nozzles located at the top of the vessel . all samples were taken through a drain point at the base of the reaction vessel . sequential addition of bacl 2 , na 2 co 3 and naoh a first experimental test solution as shown in table 1 was loaded into the reaction vessel . the test solution was heated to 30 ° c . when a first sample was taken for analyses ( sample 1 , approximately 30 grams ). dissolved cations ( na + , k + , mg 2 + , ca 2 + , fe 2 + , sr 2 + , ba 2 + ) were measured using inductively - coupled plasma optical emission spectroscopy ( icp - oes ). dissolved anions ( cl − , br − , so 4 2 − ) were measured using ion chromatography ( ic ). the test solution was then heated to 61 . 5 ° c . and a second sample was taken ( sample 2 , approximately 30 grams ). 20 . 79 grams of 20 wt % barium chloride solution ( 20 wt % bacl 2 in water , equivalent to 4 . 158 grams of barium chloride , 20 . 0 mmoles ) were then added to the reaction vessel . the resulting solution was allowed to mix for fifteen minutes and a third sample was taken ( sample 3 , approximately 30 grams ). 90 . 93 grams of 20 wt % sodium carbonate solution ( 20 wt % na 2 co 3 in water , equivalent to 18 . 19 grams of sodium carbonate , 171 . 6 mmoles ) were added to the reaction vessel and a fourth sample was taken ( sample 4 ). a further 10 grams of 20 wt % sodium carbonate solution were added to elevate the solution ph to 9 . 5 and a fifth sample was taken ( sample 5 ). the total amount of sodium carbonate added to the first experimental test solution was 20 . 19 grams or 190 . 4 mmoles . 3 . 20 grams of 50 wt % sodium hydroxide solution ( 50 wt % naoh in water , containing 1 . 6 g of sodium hydroxide , 40 mmoles ) were added to the reaction vessel , which elevated the ph of the first experimental test solution to 10 . 0 , and a sixth sample was taken ( sample 6 ). finally , an additional 8 . 56 grams of 50 wt % sodium hydroxide solution were added to the reaction vessel to elevate the ph to 10 . 59 and a seventh sample was taken ( sample 7 ). the total amount of sodium hydroxide added to the first experimental test solution was 5 . 88 grams or 147 . 0 mmoles . analytical results for samples 1 - 7 are shown in fig3 and table 2 . as shown in table 2 and fig3 , there was little precipitation from the first experimental test solution on original mixing ( sample 1 ) and when the solution temperature was increased to 60 ° c . ( sample 2 ). sample 3 shows that the addition of barium chloride ( 4 . 16 grams , 20 . 0 mmoles ) resulted in almost quantitative removal of the sulfate anions in the test solution , with sulfate concentrations falling from 467 mg / l to 10 mg / l ( 97 . 9 % removal ). the measured barium concentration increased from & lt ; 0 . 1 mg / kg to 32 mg / kg . this corresponds to removal of 95 . 3 % of the barium added as barium chloride . however , calcium and magnesium levels before and after the addition of barium chloride were unchanged . the addition of alkalinity ( as sodium carbonate and sodium hydroxide ) resulted in quantitative removal of the calcium . at a ph of 9 . 0 ( sample 4 ), the measured calcium concentration decreased from 1 , 470 mg / kg to 6 . 4 mg / kg . calcium concentrations continued to decrease as the ph increased . the final calcium concentration , measured at a ph of 10 . 6 ( sample 7 ), was 0 . 1 mg / kg , which corresponds to 99 . 99 % calcium removal . the barium present after the addition of barium chloride ( 31 . 7 mg / kg in sample 3 ) also precipitated as the ph increased . the final barium concentration ( sample 7 ), was 0 . 22 mg / kg , which corresponds to 99 . 97 % barium removal . because magnesium is more soluble in alkaline carbonate solutions than both calcium and barium , a higher ph is required to precipitate magnesium from the test solution . at a ph of 9 . 0 ( sample 4 ), the measured magnesium concentration was 35 mg / kg , which corresponds to precipitation of 69 % of the magnesium originally present in the solution . as the ph increased to 10 . 0 , the magnesium concentration decreased to 11 mg / kg , which corresponds to 90 . 4 % magnesium precipitation ( sample 6 ). at a ph of 10 . 6 , the magnesium concentration was 0 . 3 mg / kg , which corresponds to 99 . 7 % magnesium removal ( sample 7 ). it can be seen from tables 2 and 3 that sulfate precipitation occurs at low ph when barium chloride is added and that the sulfate remains in the solid phase at ph up to 10 . 0 . however , some re - dissolution of the sulfate occurs at higher ph . as an example , measured sulfate levels varied from 15 mg / l to 31 mg / l over the ph range of 9 . 0 to 10 . 0 , which corresponds to sulfate precipitation of 94 % to 97 %. at a ph of 10 . 6 , the measured sulfate level was 60 mg / l , which corresponds to sulfate precipitation of only 87 %. fig5 , which plots the precipitation of magnesium , calcium , barium , and sulfate ions against the ph of the test solution , further illustrates that the precipitation efficiency of sulfate decreases at higher ph . effective ph monitoring and control is therefore required in order to optimize the precipitation of divalent cations and sulfate . simultaneous addition of bacl 2 , na 2 co 3 and naoh a second experimental test solution was prepared as per table 4 . the second experimental test solution was heated at atmospheric pressure to 60 ° c . with continuous stirring . the barium chloride , sodium carbonate , and sodium hydroxide solutions were then added in 25 % aliquots at 2 . 5 - minute intervals and samples were taken as shown in table 8 below . the addition of the barium chloride , sodium carbonate , and sodium hydroxide solutions to the second experimental test solution shown in table 4 results in a solution containing 653 ppm of barium . the analytical results for samples 1 - 9 are shown in table 9 and illustrated in fig6 . table 10 precipitation efficiency sample # — 1 2 3 4 5 6 7 8 9 mg % precipitated — 3 . 1 18 . 8 56 . 3 98 . 1 96 . 3 94 . 7 95 . 9 96 . 3 ca % precipitated — 31 . 8 57 . 5 88 . 1 99 . 9 99 . 8 99 . 8 99 . 8 99 . 8 ba [ 1 ] % precipitated — 100 . 0 100 . 0 100 . 0 100 . 0 99 . 9 99 . 7 99 . 9 99 . 8 so 4 % precipitated — 53 . 4 73 . 4 88 . 4 94 . 6 91 . 1 94 . 6 [ 1 ] the barium precipitated refers to the barium which was added to the test solution . the calcium and magnesium removal efficiencies refer to the calcium and magnesium originally present in the test solution . as shown in the referenced tables and figures , the quantitative removal of sulfate , magnesium , and calcium ions can be achieved in twenty to twenty - five minutes at 60 ° c . by the addition of stoichiometric quantities of barium , hydroxide , and carbonate , respectively . simulated results were obtained employing oli stream analyzer ™ software ( oli systems , inc ., cedar knolls , n . j .). a solution without bicarbonate ( first model test solution , table 11 ) was modeled for divalent cation and sulfate removal . barium chloride , sodium carbonate , and sodium hydroxide were added to the test solutions in order to precipitate the sulfate , calcium , and magnesium , respectively , according to the reactions shown below : the addition of barium chloride to the first model test solution is shown in table 13 . it can be seen that sulfate is removed almost quantitatively at ba : so 4 = 1 : 1 mol : mol . the solution after addition of barium chloride to achieve ba 2 + : so 4 2 − of 1 : 1 mol : mol was mixed with sodium carbonate ( solution 6 . 5 ., above ). the results are shown in table 14 . table 14 shows that calcium precipitates from solution as the sodium carbonate is added and near quantitative calcium removal is achieved at co 3 2 − : ca 2 + = 1 . 1 : 1 mol : mol ( solution 7 . 6 . above , 99 . 9 % calcium precipitation ). no re - dissolution of barium carbonate is predicted . the solution after addition of barium chloride to achieve ba 2 + : so 4 2 − of 1 : 1 mol : mol and sodium carbonate addition at co 3 2 − : ca 2 + at 1 . 1 : 1 mol : mol was mixed with sodium hydroxide . the results are shown in table 15 . table 15 shows that calcium precipitation is unaffected by the addition of the sodium hydroxide solution but that barium sulfate is somewhat soluble at an elevated ph , falling from 97 . 6 % precipitation at a ph of 9 . 18 to 95 . 1 % precipitation at a ph of 10 . 02 . excessive addition of hydroxide should therefore be avoided to minimize re - dissolution of barium sulfates . in practice , the amounts of barium chloride , sodium carbonate , and sodium hydroxide will depend on the concentrations of sulfate , calcium , and magnesium ions present in the meg - water stream . for example , a lower efficiency for magnesium removal may be acceptable to the operator if the concentration of magnesium ions in the meg - water stream is also low . the addition of barium chloride to the second model test solution is shown in table 16 . table 16 shows that near - quantitative sulfate removal is achieved at ba 2 + : so 4 2 − at 1 . 2 : 1 mol : mol . barium precipitation at this ba 2 + : so 4 2 − ratio falls from 100 % since the barium is present in excess . it should be noted that some calcium precipitation is observed under the starting conditions due to the conversion of calcium bicarbonate to calcium carbonate as per the reaction below : ca 2 + ( aq )+ 2hco 3 − ( aq )→ caco 3 ( s )+ co 2 ( aq )+ h 2 o table 17 addition of na 2 co 3 to second model test solution after addition of bacl 2 sample id 10 . 1 . 10 . 2 . 10 . 3 . 10 . 4 . 10 . 5 . 10 . 6 . ba 2 + : so 4 2 − ( mol : mol ) 1 . 200 1 . 200 1 . 200 1 . 200 1 . 200 1 . 200 added co 3 2 − : ca 2 + ( mol : mol ) 0 . 000 0 . 483 0 . 725 0 . 967 1 . 047 1 . 128 ph 6 . 031 6 . 211 6 . 407 7 . 181 8 . 044 8 . 737 mg precipitated — — — — — — ca precipitated 9 . 4 % 56 . 8 % 79 . 7 % 98 . 3 % 99 . 8 % 99 . 9 % ba precipitated 82 . 9 % 83 . 0 % 83 . 1 % 83 . 1 % 82 . 9 % 98 . 1 % so 4 precipitated 99 . 4 % 99 . 6 % 99 . 7 % 99 . 7 % 99 . 5 % 97 . 3 % co 3 precipitated 38 . 7 % 78 . 1 % 82 . 3 % 81 . 2 % 77 . 3 % 72 . 9 % table 18 addition of naoh to second model test solution after addition of bacl 2 and na 2 co 3 sample id 11 . 1 . 11 . 2 . 11 . 3 . 11 . 4 . 11 . 5 . ba 2 + : so 4 2 − ( mol : mol ) 1 . 200 1 . 200 1 . 200 1 . 200 1 . 200 added co 3 2 − : ca 2 + 1 . 047 1 . 047 1 . 047 1 . 047 1 . 047 ( mol : mol ) oh − : mg 2 + ( mol : mol ) 0 . 000 2 . 380 3 . 570 4 . 760 7 . 140 ph 8 . 044 9 . 533 9 . 778 9 . 911 10 . 154 mg precipitated 0 . 0 % 0 . 0 % 31 . 4 % 43 . 1 % 76 . 1 % ca precipitated 99 . 8 % 100 . 0 % 100 . 0 % 100 . 0 % 100 . 0 % ba precipitated 82 . 9 % 99 . 2 % 99 . 4 % 99 . 5 % 99 . 6 % so 4 precipitated 99 . 5 % 92 . 8 % 90 . 2 % 87 . 8 % 84 . 1 % co 3 precipitated 77 . 3 % 77 . 4 % 78 . 5 % 78 . 6 % 78 . 7 % it should be noted that the barium chloride and sodium carbonate solutions should not be pre - mixed before addition to meg - water streams since precipitation of barium carbonate may occur as shown by the reaction below : however , in the presence of calcium ions and sulfate ions ( i . e ., in the chemical treatment tank ), barium sulfate and calcium carbonate will be the preferred solid precipitants . an advantage of the present invention is that it removes divalent cations and sulfate from meg - water streams in order to improve the efficiency of meg reclamation or meg regeneration . the present invention also minimizes the formation of scale inside pipelines and process equipment , thereby improving equipment availability . other advantages are that the present invention reduces the need for the use of clean - in - place systems and scale inhibitors and reduces the amount of time that the process equipment must be taken off - line for cleaning . while preferred embodiments of a system and process for removing divalent ions from meg - water streams have been described in detail , a person of ordinary skill in the art understands that certain changes can be made in the arrangement of process steps and type of components used in the system and process without departing from the scope of the following claims . | 1 |
fig1 illustrates a drive system for an electric vehicle including a power transmission device according to a first exemplary embodiment of the present invention . the drive system includes an electric motor 1 and a transmission 2 . further , a power transmission device 3 is disposed between the electric motor 1 and the transmission 2 . in the drive system , a rotation of the electric motor 1 is configured to be decelerated by the transmission 2 , and the decelerated rotation is configured to be transmitted to right and left axles 5 and 4 . wheels ( not illustrated in the drawings ) are coupled to the right and left axles 5 and 4 . the transmission 2 includes an input shaft 11 , an input gear 12 , an intermediate shaft 13 , a reduction gear 14 , an intermediate gear 15 , an output gear 16 and a differential device 17 . further , the input gear 12 and the reduction gear 14 compose a first reduction mechanism 21 , whereas the intermediate shaft 13 , the intermediate gear 15 and the output gear 16 compose a second reduction mechanism 22 . the input shaft 11 is formed in a tubular shape ; and both ends thereof are rotatably supported by a housing 2 a of the transmission 2 through a pair of bearings . the input shaft 11 has a spline hole formed on a motor - side part of the inner peripheral surface thereof . the input gear 12 is integrally formed with the input shaft 11 . the intermediate shaft 13 is formed in a tubular shape , and both ends thereof are rotatably supported by the housing 2 a of the transmission 2 through a pair of bearings . the reduction gear 14 and the intermediate gear 15 are disposed to be rotated in synchronization with the intermediate shaft 13 . specifically , the reduction gear 14 is spline - coupled to the intermediate shaft 13 , whereas the intermediate gear 15 is disposed on the outer peripheral part of the intermediate shaft 13 while being integrally formed with the intermediate shaft 13 . the reduction gear 14 is meshed with the input gear 12 . the intermediate gear 15 is meshed with the output gear 16 . the differential device 17 includes a case 24 and a differential gear mechanism 25 accommodated inside the case 24 . the output gear 16 is fixed to the case 24 . further , the right and left axles 5 and 4 are coupled to the differential gear mechanism 25 . fig2 illustrates an enlarged view of the power transmission device 3 . the power transmission device 3 includes a damper mechanism 31 and a torque limiter 32 . the damper mechanism 31 has a heretofore known structure and includes a spline hub 34 as an input portion , a pair of plates 35 disposed on both sides of the flange of the spline hub 34 , and a plurality of torsion springs 36 elastically coupling the spline hub 34 and the pair of plates 35 in a rotational direction . it should be noted that a hysteresis torque generating mechanism 37 for absorbing vibrations is disposed between the spline hub 34 and the pair of plates 35 . the torque limiter 32 includes a tubular case 38 , a coupling member 39 as an output portion , and a torque limiting portion 40 disposed between the case 38 and the coupling member 39 . the motor - side end of the tubular case 38 is bent to the inner peripheral side , and the bent part is coupled to one of the pair of plates 35 of the damper mechanism 31 . the coupling member 39 is rotatably supported by an output shaft la of a motor 1 through a bearing . the coupling member 39 has a shaft part 39 a and a flange part 39 b formed on the tip end of the shaft part 39 a . the shaft part 39 a has a spline shaft formed on the outer periphery thereof , and the spline shaft is spline - coupled to the spline hole of the input shaft 11 of the transmission 2 . the torque limiting portion 40 includes a plurality of clutch plates 42 a and 42 b , a backing plate 43 , a pressure plate 44 and a cone spring 45 . regarding the plural clutch plates 42 a and 42 b , the drive - side plates 42 a are engaged with the case 38 , whereas the driven - side plates 42 b are engaged with the flange part 39 b of the coupling member 39 . the cone spring 45 is set in a compressed state between the pressure plate 44 and the bent part of the case 38 . accordingly , when a torque , which is greater than or equal to a torque set by a pressing load of the cone spring 45 and the clutch plates 42 a and 42 b , is inputted into the torque limiting portion 40 , the torque limiting portion 40 is configured to slip and the torque is not transmitted to either the transmission - 2 side or the motor side . in the device as described above , the rotation of the motor 1 is configured to be transmitted to the transmission 2 through the damper mechanism 31 and the torque limiter 32 . in the transmission 2 , the rotation of the motor 1 is configured to be decelerated by the first reduction mechanism 21 and the second reduction mechanism 22 , and the decelerated rotation is configured to be inputted into the differential device 17 . in the differential device 17 , a torque is distributed and transmitted to the respective axles 4 and 5 in accordance with loads acting on respective drive wheels . in the drive system of the first exemplary embodiment , the power transmission device 3 , including the damper mechanism 31 and the torque limiter 32 , is disposed between the motor 1 and the transmission 2 . hence , occurrence of cogging of the motor 1 can be inhibited , and damage of respective components can be prevented by limiting excessive torque transmission to the respective components . further , the power transmission device 3 is disposed in the input part of the drive system . hence , a torque to be transmitted becomes relatively small , and the capacity of the torque limiter 32 can be reduced . yet further , due to a reason similar to the above , the damper mechanism 31 can be compactly formed . fig3 illustrates a drive system to which a power transmission device 103 according to a second exemplary embodiment of the present invention is applied . the drive system includes the electric motor 1 and a transmission 102 . further , the power transmission device 103 is disposed inside the transmission 102 . in the drive system , the rotation of the electric motor 1 is configured to be decelerated by the transmission 102 , and the decelerated rotation is configured to be transmitted to the right and left axles 5 and 4 . in the second exemplary embodiment , the same reference signs are assigned to elements similar to those in the first exemplary embodiment , and explanation will not be made for the elements similar to those in the first exemplary embodiment . the transmission 102 includes an input shaft 111 , an input gear 112 , an intermediate shaft 113 , a reduction gear 114 , an intermediate gear 115 , the output gear 16 and the differential device 17 . the input gear 112 and the reduction gear 114 compose a first reduction mechanism 121 , whereas the intermediate shaft 113 , the intermediate gear 115 and the output gear 16 compose a second reduction mechanism 122 . the input shaft 111 is formed in a tubular shape , and both ends thereof are rotatably supported by a housing 102 a of the transmission 102 through a pair of bearings . the inner peripheral part of the input shaft 111 and the output shaft la of the motor 1 are spline - coupled . the input gear 112 is disposed on the outer peripheral part of the input shaft 111 , while being integrally formed with the input shaft 111 . the intermediate shaft 113 is formed in a tubular shape , and both ends thereof are rotatably supported by the housing 102 a of the transmission 102 through a pair of bearings . the reduction gear 114 is disposed on one end part of the intermediate shaft 113 , while being integrally formed with the intermediate shaft 113 . the intermediate gear 115 is disposed laterally adjacent to the reduction gear 114 . the intermediate gear 115 is supported by the intermediate shaft 113 , while being rotatable relatively thereto . the reduction gear 114 is meshed with the input gear 112 . the intermediate gear 115 is meshed with the output gear 16 . the power transmission device 103 is disposed on the opposite side of the reduction gear 114 with respect to the intermediate gear 115 . the power transmission device 103 has a basic structure similar to that in the first exemplary embodiment , and includes the damper mechanism 31 and the torque limiter 32 . the spline hub 34 of the damper mechanism 31 is spline - coupled to the intermediate shaft 113 . further , the output side ( the driven - side plates 42 b included in the plural clutch plates ) of the torque limiter 32 is engaged with a flange 130 fixed to the lateral surface of the intermediate gear 15 . the flange 130 has a disc - shaped main body 130 a having an aperture in the center part thereof , and a tubular part 130 b formed on an end of the outer periphery of the main body 130 a to axially extend therefrom . the inner peripheral part of the main body 130 a is fixed to the lateral surface of the intermediate gear 115 . further , the tubular part 130 b has a plurality of teeth formed on the outer periphery thereof , and the teeth are engaged with the inner peripheral parts of the driven - side plates 42 b included in the plural clutch plates . in the device as described above , the rotation of the motor 1 is configured to be decelerated by the first reduction mechanism 121 of the transmission 102 , and the decelerated rotation is configured to be inputted into the damper mechanism 31 of the power transmission device 103 . further , the rotation is transmitted to the second reduction mechanism 122 through the torque limiter 32 , and is further inputted into the differential device 17 . in the differential device 17 , a torque is distributed and transmitted to the respective axles 4 and 5 in accordance with loads acting on the respective drive wheels . similar to the first exemplary embodiment , the drive system of the second exemplary embodiment can inhibit occurrence of cogging of the motor 1 , and can prevent damage of the respective components by limiting excessive torque transmission to the respective components . further , the power transmission device 103 is mounted onto the intermediate shaft 113 to which the rotation decelerated by the first reduction mechanism 121 is transmitted . hence , a torque to be transmitted becomes large , but the rotation speed becomes relatively low . thus , strengths of the respective components can be lowered , and cost reduction and weight reduction are enabled . in an electric vehicle , the rotation speed of the motor 1 tends to be higher than the rotation speed of the engine . therefore , the second exemplary embodiment is especially effective in that the rotation speed of the power transmission device 103 becomes low . fig4 illustrates a drive system to which a power transmission device 203 according to a third exemplary embodiment of the present invention is applied . the drive system includes the electric motor 1 and a transmission 202 . further , the power transmission device 203 is disposed inside the transmission 202 . in the drive system , the rotation of the electric motor 1 is configured to be decelerated by the transmission 202 , and the decelerated rotation is configured to be transmitted to the right and left axles 5 and 4 . in the third exemplary embodiment , the same reference signs are assigned to elements similar to those in the first and second exemplary embodiments , and explanation will not be made for the elements similar to those in the first and second exemplary embodiments . the transmission 202 includes an input shaft 211 , an input gear 212 , an intermediate shaft 213 , a reduction gear 214 , an intermediate gear 215 , the output gear 16 and the differential device 17 . the input gear 212 and the reduction gear 214 compose a first reduction mechanism 221 , whereas the intermediate shaft 213 , the intermediate gear 215 and the output gear 16 compose a second reduction mechanism 222 . the specific shapes of the respective members in the third exemplary embodiment are different from those of the corresponding members in the second exemplary embodiment . however , the other structures in the third exemplary embodiment are basically the same as those in the second exemplary embodiment , although the arrangement of the power transmission device 203 in the third exemplary embodiment is only different from that of the power transmission device in the second exemplary embodiment . in short , in the third exemplary embodiment , the reduction gear 214 and the intermediate gear 215 are disposed on both ends of the intermediate shaft 213 , while the power transmission device 203 is disposed between these gears 214 and 215 . the power transmission device 203 has a structure similar to that in the aforementioned respective exemplary embodiments , and includes the damper mechanism 31 and the torque limiter 32 . a path for transmitting power is configured similarly to that in the second exemplary embodiment . power is inputted from the intermediate shaft 213 to the spline hub of the damper mechanism 31 , and is then outputted from the output portion ( the driven - side plates ) of the torque limiter 32 to a tubular member 230 fixed to the intermediate gear 215 . the tubular member 230 has a fixation part 230 a fixed to a reduction gear 214 side lateral surface of the intermediate gear 215 , and a tubular engaging part 230 b axially extending from the outer periphery of the fixation part 230 a . further , the tubular engaging part 230 b has a plurality of teeth formed on the outer periphery thereof , and the teeth are engaged with the inner peripheries of the driven - side clutch plates of the torque limiter 32 . the power transmission path of the aforementioned device is similar to that in the second exemplary embodiment . specifically , the rotation of the motor 1 is configured to be decelerated by the first reduction mechanism 221 of the transmission 202 , and the decelerated rotation is configured to be inputted into the damper mechanism 31 of the power transmission device 203 . further , the rotation is configured to be transmitted to the second reduction mechanism 222 through the torque limiter 32 , and is further inputted into the differential device 17 . in the differential device 17 , a torque is distributed and transmitted to the respective axles 4 and 5 in accordance with loads acting on the respective drive wheels . the drive system of the third exemplary embodiment can also achieve advantages effects similar to those achieved by the drive system of the second exemplary embodiment . in short , occurrence of cogging of the motor 1 can be inhibited , while damage of the respective components can be prevented by limiting excessive torque transmission to the respective components . further , the rotation speed of the power transmission device 203 becomes low . thus , the component strengths of the respective components can be lowered , and cost reduction and weight reduction are enabled . fig5 illustrates a drive system to which a power transmission device 303 according to a fourth exemplary embodiment of the present invention is applied . the drive system includes the electric motor 1 and a transmission 302 . further , the power transmission device 303 is disposed inside the transmission 302 . in the drive system , the rotation of the electric motor 1 is configured to be decelerated by the transmission 302 , and the decelerated rotation is configured to be transmitted to the right and left axles 5 and 4 . in the fourth exemplary embodiment , the same reference signs are assigned to elements similar to those in the aforementioned respective exemplary embodiments , and explanation will not be made for the elements similar to those in the aforementioned respective exemplary embodiments . the transmission 302 includes an input shaft 311 , an input gear 312 , an intermediate shaft 313 , a reduction gear 314 , an intermediate gear 315 , an output gear 316 and the differential device 17 . the input gear 312 and the reduction gear 314 compose a first reduction mechanism 321 , whereas the intermediate shaft 313 , the intermediate gear 315 and a part of the power transmission device 303 compose a second reduction mechanism 322 . the input shaft 311 is formed in a tubular shape , and both ends thereof are rotatably supported by a housing 302 a of the transmission 302 through a pair of bearings . the inner peripheral part of the input shaft 311 and the output shaft la of the motor 1 are spline - coupled . the input gear 312 and the input shaft 311 are integrally formed . the intermediate shaft 313 is formed in a tubular shape , and both ends thereof are rotatably supported by the housing 302 a of the transmission 302 through a pair of bearings . the reduction gear 314 is disposed on one end part of the intermediate shaft 313 , while being integrally formed with the intermediate shaft 313 . the reduction gear 314 is meshed with the input gear 312 . the intermediate gear 315 is disposed on the other end part of the intermediate shaft 313 . the intermediate gear 315 is spline - coupled to the intermediate shaft 313 . the power transmission device 303 includes a damper mechanism 331 and a torque limiter 332 . the damper mechanism 331 includes a spline hub 334 as an input portion , a pair of plates 335 disposed on the both sides of the flange of the spline hub 334 , and a plurality of torsion springs 336 elastically coupling the spline hub 334 and the pair of plates 335 in the rotational direction . the inner peripheral part of the spline hub 334 is rotatably supported by the case 24 of the differential device 17 through a bearing . further , the spline hub 334 has a hub gear 334 a on the outer peripheral part thereof , and the hub gear 334 a is meshed with the intermediate gear 315 . it should be noted that a hysteresis torque generating mechanism for absorbing vibrations is disposed between the spline hub 334 and the pair of the plates 335 . the torque limiter 332 has a structure similar to the structures of the torque limiters in the respective exemplary embodiments . the torque limiter 332 includes a tubular case , a torque limiting portion having a plurality of clutch plates , and so forth . further , the driven - side plates included in the plural clutch plates are meshed with the output gear 316 fixed to the case of the differential device 17 . in the device as described above , the rotation of the motor 1 is configured to be decelerated by the first reduction mechanism 321 of the transmission 302 , and the decelerated rotation is configured to be inputted into the damper mechanism 331 of the power transmission device 303 through the intermediate gear 315 and the hub gear 334 a . further , the rotation is configured to be inputted into the output gear 316 and the differential device 17 through the torque limiter 332 . in the differential device 17 , a torque is distributed and transmitted to the respective axles 4 and 5 in accordance with loads acting on the respective drive wheels . similarly to the drive systems of the aforementioned respective exemplary embodiments , the drive system of the fourth exemplary embodiment can inhibit occurrence of cogging of the motor 1 , and can prevent damage of the respective components by limiting excessive torque transmission to the respective components . further , the power transmission device 303 is herein disposed downstream of the first and second reduction mechanism 321 and 322 in the power transmission flow . therefore , the rotation speed of the power transmission device 303 becomes low . thus , the component strengths of the respective components can be lowered , and cost reduction and weight reduction are enabled . other exemplary embodiment the present invention is not limited to the exemplary embodiments as described above , and a variety of changes or modifications can be made without departing from the scope of the present invention . in the power transmission device of the present invention , at least either of the damper mechanism and the torque limiter is disposed in the drive train disposed between the electric motor and the drive wheels . therefore , where the damper mechanism is provided , it is possible to inhibit occurrence of cogging . where the torque limiter is provided , it is possible to prevent damage of respective components attributed to an excessive torque transmitted thereto . | 5 |
referring to fig2 a cross - sectional view is shown of the expansion volume 98 of a thermal cycle engine , shown for illustrative purposes as a stirling cycle engine designated generally by numeral 96 , and of the corresponding thermal control structures . heater head 100 is substantially a cylinder having one closed end 120 ( otherwise referred to as the cylinder head ) and an open end 118 . closed end 120 is disposed in a combustion chamber 122 defined by an inner combustor structure 110 . hot combustion gases in combustion chamber 122 are in direct thermal contact with heater head 100 and thermal energy is transferred by conduction from the combustion gases to the heater head and from the heater head to the working fluid of the thermal engine , typically helium . other gases such as nitrogen , for example , may be used within the scope of the present invention , with a preferable working fluid having high thermal conductivity and low viscosity . non - combustible gases are also preferred . heat is transferred from the combustion gases to the heater head as the combustion gases flow along the outside surface of closed end 120 within a gas flow channel 113 . expansion volume 98 is surrounded on its sides by expansion cylinder liner 115 , disposed , in turn , inside heater head 100 and typically supported by the heater head . the expansion piston 121 travels along the interior of expansion cylinder liner 115 . as the expansion piston travels toward closed end 120 of heater head 100 , the working fluid within the heater head is displaced and caused to flow through flow channels defined by the outer surface of the expansion cylinder liner 115 and the inner surface of heater head 100 . as the working fluid is displaced from expansion cylinder 115 by the expansion piston , working fluid is further heated in passage over the inner pin array 124 and driven through regenerator chamber 132 . a regenerator 134 is used in a stirling cycle machine , as discussed above , to add and remove heat from the working fluid during different phases of the stirling cycle . the regenerator used in a stirling cycle machine must be capable of high heat transfer rates which typically suggests a high heat transfer area and low flow resistance to the working fluid . low flow resistance also contributes to the overall efficiency of the engine by reducing the energy required to pump the working fluid . additionally , regenerator 134 must be fabricated in such a manner as to resist spalling or fragmentation because fragments may be entrained in the working fluid and transported to the compression or expansion cylinders and result in damage to the piston seals . one regenerator design uses several hundred stacked metal screens while exhibiting a high heat transfer surface , low flow resistance and low spalling , metal screens may suffer the disadvantage that their cutting and handling may generate small metal fragments that must be removed before assembling the regenerator . additionally , stainless steel woven wire mesh contributes appreciably to the cost of the stirling cycle engine . in accordance with an embodiment of the invention , a three dimensional random fiber network , such as stainless steel wool or ceramic fiber , for example , may be used as the regenerator , as now described with reference to fig3 a . stainless steel wool regenerator 200 advantageously provides a large surface area to volume ratio , thereby providing favorable heat transfer rates at low fluid flow friction in a compact form . additionally , cumbersome manufacturing steps of cutting , cleaning and assembling large numbers of screens are advantageously eliminated . the low mechanical strength of steel wool and the tendency of steel wool to spall may both be overcome as now described . in accordance with an embodiment of the invention , the individual steel wires 202 , 204 are “ cross - linked ” into a unitary 3d wire matrix . the starting material for the regenerator may be fibrilose and of random fiber form such as either steel or nickel wool . the composition of the fiber may be a glass or a ceramic or a metal such as steel , copper , or other high temperature materials . the diameter of the fiber is preferably in the range from 10 micrometers to 1 millimeter depending on the size of the regenerator and the properties of the metal . the starting material is placed into a form corresponding to the final shape of the regenerator which is depicted in cross - section in fig3 b . inner canister cylindrical wall 220 , outer canister cylindrical wall 222 , and regenerator network 200 are shown . the density of the regenerator is controlled by the amount of starting material placed in the form . the form may be porous to allow fluids to pass through the form . in an alternate embodiment of the invention , unsintered steel wool is employed as regenerator network 200 . regenerator network 200 is then retained within the regenerator canister by regenerator retaining screens 224 or other filter , thereby comprising a “ basket ” which may advantageously capture steel wool fragments . in one embodiment of the invention , applicable to starting material that is electrically conducting , the starting material is placed in a porous form and placed in an electrolyte bath . the starting material may be a metal , such as stainless steel , for example . an electrical connection is made with the starting material thereby forming an electrode . cross - linking of the individual fibers in the starting material is accomplished by electrically depositing a second material 206 onto the starting material . the selection of the starting material will depend on such factors as the particular deposition technique chosen and the chemical compatibility of the first and second materials , as known to one of ordinary skill in the electrochemical art . during deposition , the second material will build up on the starting material and form bridges 208 between the individual fibers of the starting material in places where the individual fibers are in close proximity to each other . the deposition is continued until the bridges have grown to a sufficient size to hold the two individual fibers rigidly in place . the deposition duration depends on the particular deposition process and is easily determined by one of ordinary skill in the art . after the deposition is completed , the regenerator is removed from the bath and the form and is cleaned . in another embodiment of the invention , the starting material is placed in a form that may be porous or not . the form containing the starting material is placed in a furnace and is partially sintered into a unitary piece . the selection of the sintering temperature and sintering time is easily determined by one of ordinary skill in the sintering art . in another embodiment of the invention , the starting material is placed in a porous form . the form containing the starting material is placed in a chemical bath and a second material , such as nickel , is chemically deposited to form bridges between the individual fibers . in another embodiment of the invention , the starting material is a silica glass fiber which is placed into a porous form . the glass fiber and form is dipped in a solution of tetraethylorthosilicate ( teos ) and ethanol so that the fiber is completely wetted by the solution . the fiber and form are removed from the solution and allowed to drain in a humid atmosphere . the solution will form meniscoidal shapes bridging fibers in close proximity to each other . the humidity of the atmosphere will start the hydrolysis - condensation reaction that converts the teos to silica forming a cross link between the two fibers . the fiber and form may be heat treated at a temperature less than 1000 ° c ., most preferably less than 600 ° c ., to remove the reactant products and form a silica bridge between the fibers . in another embodiment of the invention , a ceramic slurry is deposited onto a reticulated foam having the shape of the regenerator . the slurry is dried on the reticulated foam and heat treated to burn off the foam and sinter the ceramic . the ceramic may be composed of an oxide ceramic such as cordierite , alumina , or zirconia . the composition of the ceramic slurry and the heat treatment profile is easily specified by one of ordinary skill in the ceramic processing art . in yet other embodiments of the invention , knit or woven wire is employed in fabrication of a regenerator as now described with reference to fig4 a . in accordance with these embodiments , knit or woven wire tube 201 is flattened by rollers 202 into tape 204 , in which form it is wound about mandrel 206 into annular layers 208 . stainless steel is advantageously used for knit wire tube 201 because of its ability to withstand elevated temperature operation , and the diameter of the wire used is typically in the range of 1 - 2 mils , however other materials and gauges may be used within the scope of the present invention . alternatively , a plurality , typically 5 - 10 , of the stainless steel wires may be loosely wound into a multi - filament thread prior to knitting into a wire tube . this process advantageously strengthens the resulting tube 201 . when mandrel 206 is removed , annular assembly 210 may be used as a regenerator in a thermal cycle engine . still another embodiment of the invention is now described with reference to fig4 b - 4 e . knit or woven wire tube 201 , shown in its right cylindrical form in fig4 b , is shown scored and partially compressed in fig4 c . alternatively , the scoring may be at an angle 214 with respect to the central axis 212 of the tube , as shown in fig4 d . tube 201 is then axially compressed along central axis 212 to form the bellows form 216 shown in fig4 e that is then disposed as a regenerator within the regenerator volume 132 ( shown in fig2 ) of a stirling cycle engine . the devices and methods described herein may be applied in other applications besides the stirling engine in terms of which the invention has been described . the described embodiments of the invention are intended to be merely exemplary and numerous variations and modifications will be apparent to those skilled in the art . all such variations and modifications are intended to be within the scope of the present invention as defined in the appended claims . | 5 |
fig1 illustrates a conventional magnetorheological ( mr ) damper 100 known in the art . the conventional mr damper 100 generally includes a pair of electrical wires 11 , a bearing and seal unit 12 , a cylinder housing mr material or fluid 13 , an electromagnet 14 , a diaphragm 15 , an accumulator 16 , a piston 17 , an upper connection support 18 , and a lower connection support 19 . the bearing and seal unit 12 guides the movement of the piston 17 and prevents the leakage of the mr material 13 . by applying different current inputs to the electromagnet 14 through a pair of electrical wires 11 , the mr material 13 may be reversibly changed from a free - flowing , linear viscous fluid to a semi - solid with adjustable / controllable yield stress such that the yield force and rheological damping of the damper can be changed accordingly . such or similar conventional dampers are generally known in the field . see , for example , u . s . pat . no . 6 , 394 , 239 , entitled “ controllable medium device and apparatus utilizing same ” and filed by david j . carlson on oct . 29 , 1997 ; u . s . pat . no . 6 , 378 , 631 entitled “ apparatus for recovering core samples at in situ conditions ” and filed by aumann et al . on jun . 30 , 2000 ; u . s . pat . no . 6 , 158 , 470 entitled “ two - way magnetorheological fluid valve assembly and devices utilizing same ” and filed by ivers et al . on feb . 11 , 2000 ; u . s . pat . no . 6 , 131 , 709 entitled “ adjustable valve and vibration damper utilizing same ” and filed by jolly et al . on nov . 25 , 1997 ; u . s . pat . no . 6 , 095 , 486 entitled “ two - way magnetorheological fluid valve assembly and devices utilizing same ” and filed by ivers et al . on mar . 5 , 1997 ; u . s . pat . no . 5 , 878 , 851 entitled “ controllable vibration apparatus ” and filed by carlson et al . on jul . 2 , 1999 ; u . s . pat . no . 5 , 398 , 917 entitled “ magnetorheological fluid devices ” and filed by carlson et al . feb . 7 , 1994 : u . s . pat . no . 5 , 284 , 330 entitled “ magnetorheological fluid devices ” and filed by carlson et al . on jun . 18 , 1992 ; u . s . pat . no . 5 , 277 , 281 entitled “ magnetorheological fluid dampers ” and filed by carlson et al . on jun . 18 , 1992 . all these references are herein incorporated by reference . fig2 illustrates an exemplary mr damper embodiment 200 of the present invention . similar to the conventional mr damper 100 of fig1 , the mr damper 200 also includes a pair of electrical wires 11 , a bearing and seal unit 12 , a cylinder housing mr material or fluid 13 , an electromagnet 14 , a diaphragm 15 , an accumulator 16 , and a piston 17 . the mr damper 200 further includes a first piezoelectric sensor 28 and a second piezoelectric sensor 29 for measuring the external forces exerted on the damper due to structural vibrations . the piezoelectric sensors 28 and 29 are , respectively , attached to the lower part 38 of the upper connection support 18 and the lower part 39 of the lower connection support 19 in this invention by substituting part of the upper connection support 18 and lower connection support 19 of the conventional damper 100 shown in fig1 . these locations may essentially assure the mr damper 200 that its embedded piezoelectric sensors 28 and 29 are : 1 ) capable of producing strong output signals in proportional to the external forces ( i . e ., good mechanical coupling and linearity ); 2 ) sensitive to the variances in the external forces ; and 3 ) ease of installation . the piezoelectric sensors 28 and 29 sense the variances in the external forces exerted on the damper due to structural vibrations and generate electrical signals in accordance with the variances in the external forces imposed onto their electroded surfaces ( i . e ., the pressures ; to be described in fig8 ), which signals can be used to assist adjusting / controlling the current inputs to the electromagnet 14 so as to adjust / control the magnetic field applied to the damper and hence the resulting yield force and rheological damping of the damper . since the piezoelectric sensors 28 and 29 are capable of monitoring real - time variances in the external forces ( or pressures ), real - time adjustment / control of the yield force and rheological damping of the damper can also be achieved . as understood in the art , the piezoelectric sensors 28 and 29 can be all the same except that their sizes may be different . as also understood in the art , mr dampers with a single sensor can be developed by solely using either piezoelectric sensor 28 or piezoelectric sensor 29 of fig2 . however , the duel - sensor design shown in fig2 provides a more accurate and reliable measurement of structural vibrations as compared with the single - sensor designs . in fig3 , sensor components of a first exemplary sensor are shown and include two wafer electrodes 31 and 32 mounted on either side of a piezoelectric wafer 30 . for simplicity of description , wafer electrode 31 is set as the positive , while electrode 32 is set as the negative . insulating wafer 33 is mounted between the electrode 31 and the neighboring surface 40 of the lower part of a connection support that , referring to fig2 , corresponds to the lower part 38 of the upper connection support 18 or the lower part 39 of the lower connection support 19 . these sensor components are sandwiched centrally in a stack 35 under the mechanical pressure by using a threaded shaft 41 protruding from a new connection support 42 to a shaft hole 43 opened in the lower part ( 38 or 39 ) of a connection support ( 38 or 39 ). the preloading pressure is large enough so that the piezoelectric wafer 30 remains in compression during operation . the threaded shaft 41 should be insulated from the wafer electrodes 31 and 32 and piezoelectric wafer 30 . electrical wires ( not shown ) are connected in use to the wafer electrodes 31 and 32 to deliver electrical charges ( and hence voltages ) generated from the piezoelectric wafer 30 , through a signal conditioning unit 24 , and a data acquisition unit 25 . the results can be recorded and processed using a personal computer 26 and displayed on a monitor 27 . this enables the external forces ( or pressures ) to be monitored in the operation of the damper . in addition , as understood in the art , real - time adjustment / control of the yield force and rheological damping can also be achieved by using said results to adjust / control the current inputs to the electromagnet 14 . in fig4 , a stack 36 including another two piezoelectric wafers 30 and two wafer electrodes 31 and 32 are added to the sensor shown in fig3 . the piezoelectric wafers and the wafer electrodes are placed in alternating order . by connecting all the positive wafer electrodes together as one node , and all the negative ones as another , the charges generated from the two nodes representing the effect of all the three piezoelectric wafers can be obtained to monitor the external forces exerted on the damper . in such a way , the sensitivity of the sensor can be enhanced . similarly , by adding more stacks 36 , five , seven , and more piezoelectric wafers can be deployed to enhance the sensor sensitivity . in fig5 , two piezoelectric wafers 30 are deployed with three wafer electrodes ( two 32 and one 31 ) in an alternating order to form the stack 37 . the charges generated from the positive wafer electrode 31 and the two negative wafer electrodes 32 can be obtained for monitoring the external forces exerted on the damper . in this case of deploying two piezoelectric wafers , the insulating wafer 33 as in the stack 35 ( of fig3 and 4 ) may not be necessary in that one of the piezoelectric wafers also functions as an insulating wafer . in fig6 , by adding a stack 36 ( the same as in fig4 ) to the stack 37 , four piezoelectric wafers can be deployed . similarly , by adding more stacks 36 , six , eight , and more piezoelectric wafers can be deployed in monitoring the external forces with improved sensor sensitivity . the piezoelectric wafer 30 can be any suitable piezoelectric material including piezoelectric ceramics , polymers , and composites due to their effectiveness over a large frequency range , simplicity , reliability , compactness , and light weight . in fig7 , a piezoelectric ceramic element and four piezoelectric ceramic / polymer composite elements with different configurations : namely , the 0 - 3 , 1 - 3 , radial 2 - 2 , and parallel 2 - 2 configurations , are presented in this invention . usually piezoelectric ceramic sensors have sharp resonances and high sensitivity within a narrow bandwidth . signals with frequencies within their resonances will be greatly amplified and artifacts may be created . as ceramics are hard and brittle , it is difficult to produce ceramic sensors with large element size and complex shape and damage caused by mechanical shock or vibration is more serious . piezoelectric polymer sensors , however , have wider bandwidth , and all signals will be received with more or less equal sensitivity over a wide range of frequency . they can be fabricated into complex shapes and are more resilient to mechanical stress as they are more flexible . their major drawbacks are lower sensitivity and less temperature stability . piezoelectric composite sensors , on the other hand , can be tailored to combine the desired properties of ceramics and polymers and may be most suitable for this sensor . in fig8 , different electrode patterns for the wafer 30 are presented by the forms of an “ active ” area 51 and an “ inactive ” area 50 . according to the relative position of the “ active ” and “ inactive ” areas , whole - face ( fig8 a ), inner ( fig8 b ), in - between ( fig8 c ), and outer ( fig5 d ) electrode patterns are clarified . such electrode patterns can be used for the wafer 30 of any kind of material among ceramics , polymers , and composites as mentioned before . in fig9 , two test results show that the quasi - sinusoidal ( fig9 a ) and square ( fig9 b ) forces exerted on the damper including both the amplitude and phase can be finely monitored by measuring the charges generated from the piezoelectric sensor ( s ) ( 28 and / or 29 ) and displayed on the monitor 27 of fig3 as voltages . whereas all the described wafers are cylindrical , embodiments of the invention can be provided with other shaped wafers including irregular and rectangular cross - sectioned uniform or composite wafers . | 5 |
[ 0024 ] fig1 is a perspective view of one embodiment of the electromechanical switch 10 of the present invention where switch 10 has been split open to show its internal construction . fig4 is a top plan view of the electromechanical switch 10 in fig1 . fig5 is a cross - sectional view of switch 10 taken along section line 5 - 5 shown in fig4 . switch 10 is fabricated on a silicon wafer substrate 25 , and includes a moveable beam 12 that moves within a cavity 14 to contact a conductive metal bridge 13 . deposited on top of substrate 25 is a superstrate 23 which supports conductive bridge 13 . fig2 ( a ) is a bottom view of a thermally - actuated embodiment of switch 10 , illustrated without the mechanical support layers , i . e ., substrate 25 and superstrate 23 , being shown for ease in understanding the operation of switch 10 . as shown in fig2 ( a ), switch 10 includes an n - shaped polysilicon heater 20 and two traces 22 that are formed in a first metal layer ( not shown as before etching ). traces 22 provide power to heater 20 through connections 21 . above traces 22 are metal traces 11 and 9 which are deposited as part of a second level of metallization ( also not shown as before etching ). traces 11 and 9 form microwave wave guides . coplanar waveguides are preferred because the ground planes 11 are formed in the same plane as the signal plane 9 . deposited between these conducting layers are dielectric layers 17 , 18 and 19 , which function as insulating layers . layer 17 is a field oxide layer , while layer 18 is an insulating layer between the first polysilicon layer and the first metal layer . layer 19 is an insulating layer between the first metal layer and the second metal layer . layer 15 is an insulating layer that covers the second metal layer . fig5 shows a cross - sectional view of device formed using a one polysilicon layer and two metal layer cmos process . the number of interconnection layers , i . e ., metal layers , can be increased for more complex designs , such as modern cmos processes that produce tens of millions of transistors in small areas which require as many as ten metal interconnection layers . moving beam 12 of mems switch 10 is formed using a thin - film deposited during ic fabrication . moving beam 12 is a released layer , which , along with polysilicon heater 20 , is fully released , except on one side . deposited over second metal layer 11 and beam 12 is a dielectric layer 15 which functions as an insulating layer . directly above beam 12 is a conductive bridge 13 formed using a third layer metallization 33 ( see fig6 ( g )), which is deposited as a part of the fabrication sequence described in fig6 ( a ) to 6 ( i ). conductive bridge 13 is electrically connected to ground plane 11 through a plurality of cuts 16 in insulating layer 15 . bridge 13 is connected to ground plane 11 to achieve a shunt switching function , i . e ., the signal line 40 is connected and disconnected to ground plane 11 through bridge 13 . beam 12 is mechanically free to move in a vertical direction . because of internal mechanical stresses , beam 12 is typically curved away from the surface of the silicon wafer 25 towards bridge 13 . however , when beam 12 is heated by applying voltage across the polysilicon heater 20 embedded in beam 12 , the curvature of beam 12 changes . data depicting the deflection of a cantilever beam , such as beam 12 , is shown in fig3 . the data shown in fig3 were taken using a non - contact interferometer system ( not shown ) at ambient room temperature and pressure . curvature of a cantilever beam ultimately depends on the temperature profile along the beam . temperature measurements taken along beam 12 show that the temperature profile along such beam is not constant . the temperature profile changes , depending on many factors , including local heat generation , local curvature ( which is not constant ), and ambient pressure ( unforced air convection ). similarly , local heat generation along beam 12 depends on the local temperature and local grain structure in polysilicon heater 20 . despite the fact that the starting grain structure is fairly uniform across polysilicon heater 20 , this uniformity is eventually lost . nonlinear resistance behavior of polysilicon features is well - known for un - suspended polysilicon structures , but there are very few studies on suspended polysilicon structures , so more studies are needed to understand all important factors in determining the profile of a thermally - actuated beam . however , it is well - known that , once heat is generated , the tip of a cantilever , such as beam 12 , can be controlled over large distances . the fundamental effect that causes the change in the curvature of beam 12 is known as a bi - morph effect . it is the result of differences in thermal expansion coefficients between two materials . as shown in fig4 a cantilever , such as beam 12 , might contain many conducting ( typically metal ) and insulating layers ( typically oxide ). if a commonly available ic process is used , the metal layers would be aluminum , while the insulation layers would be silicon dioxide . as beam 12 is heated , the metal pieces expand much faster than the insulating layers , thereby decreasing the beam curvature . thus , the basis for the operation of microwave switch 10 is a bi - morph effect . the height of the air - bridge 13 is chosen , such that for a particular cantilever beam design ( length , width , combinations of thin - films ), in an un - powered state ( electrically on - state ), the tip of beam 12 would contact metal bridge 13 , so that the signal - line ( not shown ) is connected to ground plane 11 . for example , for a 200 μm long beam , the data for which is shown in fig3 the height of bridge 13 can be chosen to be 25 μm or less . although it is possible to have metal - to - metal contact in this configuration , simply by increasing the contact area at the tip of beam 12 , because of sticktion issues , in an unpowered state , the tip of beam 12 is designed to have metal - to - dielectric contact . ( see the fig5 the parts of 15 remaining on top of 9 will touch the bridge 13 . in metal - to - metal contact there won &# 39 ; t be such dielectric pieces on top above 9 .) in addition , because of manufacturability issues , it is preferred to have bridge heights of less than 15 μm . the basic consideration involves the determination of tolerable power dissipation at the powered state ( electrically off - state , no connection between signal line and ground plane ). the amount of actuation is determined by the power dissipation ( equivalently generated heat ) and the length of beam 12 . using the same power , larger deflections can be obtained at the tip of longer beams , such as beam 12 . another issue , which must be considered for the design of switch 10 is the on - state and off - state capacitance ratio of switch 10 . it is desirable to have high capacitance ratios , for example 100 : 1 , to assure lower loss in the on - state and high - isolation in the off - state . on - state capacitance can be increased by increasing the contact area , increasing the dielectric constant of the material between metal layers in contact areas and decreasing the thickness of the dielectric layer . as discussed above , if desired , it is possible to design the contact area ( 15 in fig4 shows the contact area ) between beam 12 and bridge 13 to have metal - to - metal contact . on the other hand , off - state capacitance depends on the separation of contact surfaces and the area of contact surface . it is preferable to have as much separation as possible in the off - state , but the amount of separation is limited by available power , length of beam and fabrication limits . switch 10 can also be used as a tunable capacitor . switch 10 provides a capacitance with a huge capacitance ratio . however , it should be pointed out that the cantilever architecture is more suitable for the binary operation of a switch , rather than the more demanding continuous operation of a tunable capacitor . a thermally actuated fixed - fixed beam is better for tunable capacitor applications . [ 0034 ] fig2 b and 2 c show the preferred embodiment of a series tunable capacitor 40 of the present invention , but without mechanical supports being illustrated . a polysilicon heater 41 is employed at the backside of the lower plate 42 , as shown in fig2 ( c ). the connections 43 to polysilicon heater 41 are formed using a first metal layer ( again 43 is a part of the first metal layer ). the variable capacitance is obtained between the second metal layer ( top surface 44 of lower plate 42 ) and the third metal layer ( 45 shows the third metal layer ), which forms the upper plate 45 . upper plate 45 is fixed , but lower plate on beam 42 can be actuated by using a bi - morph effect and polysilicon heater 41 buried within lower plate 42 . it should be noted that fixed - fixed beams can potentially buckle in both direction , i . e ., into silicon or away from silicon . but , it has also been found that if a field - oxide layer is used , a very large percentage of fixed - fixed beams buckle away from silicon . a field - oxide layer ( shown as 17 in fig5 ) is a relatively thick thermally grown silicon dioxide layer which is under large compressive stress . if a field - oxide layer is incorporated into the beam structure of capacitor 40 , it would lie directly on the surface ( not shown ) of silicon wafer 25 . therefore , once the beam 42 is released , it would be the bottom layer , i . e ., field oxide layer 17 underneath beam 42 . if this layer is omitted , special precautions must be taken to assure the buckling direction of beam 42 . in this case , the desired direction is away from surface of silicon wafer 25 , or towards the upper plate 45 . inclusion of a field - oxide layer has some undesired effects as well . since it is so thick and significantly increases the stiffness of beam 42 , it also increases the power levels necessary to achieve desired capacitance ratio . when beam 42 buckles , it has a well - known raised cosine profile , but since it is not an ideal fixed - fixed beam , the real beam profile is fairly difficult to predict . this is especially true if beam 42 is much wider than polysilicon heater 41 . the high frequency connection 46 to lower plate 42 can be changed from a straight connection , as shown fig2 ( b ) to connections to the edges . this would increase the reflection , but the thermo - electro - mechanical problem would become more manageable by simply assuming an ideal fixed - fixed beam . the preferred capacitive embodiment of the present invention shown in fig2 ( b ) and 2 ( c ) uses a coplanar configuration . ground planes 47 are formed using a second metal layer ( not shown ). upper electrode 45 is fully supported by a mechanical support layer 48 , and has a single electrical contact 49 to signal line of the output port ( see fig2 ( b ). the capacitance of capacitor 40 is varied by changing the power dissipation in lower plate 42 , whose maximum deflection decreases in response to increased heat from heater 41 . the capacitance density also changes with the location of lower plate 42 , since upper plate 45 remains flat as lower plate 42 develops a raised - cosine shape . the capacitance per unit length ( measured in vertical direction to heater direction ) is calculated in closed form . maximum to minimum capacitance ratios higher than 10 : 1 and a quality factor of more than 50 can be achieved with this architecture . although the switch and variable capacitor embodiments of the present invention shown in fig2 ( a ) to 2 ( c ) use thermal actuation , the present invention can also be implemented using electrostatic actuation . with electrostatic actuation , the third metal layer is kept fixed , while the moveable membrane is formed using layers available in a semiconductor process alone . a preferred embodiment of an electrostatically actuated shunt switch 50 according to the invention is shown in fig2 ( d ). the construction of the electrostatically actuated shunt switch 50 is generally the same as switch 10 shown in fig1 and 2 ( a ), except as explained below . a moveable beam 50 consists of at least three metal pieces , 51 , 52 , 53 , formed on the second metal layer encapsulated in a membrane formed by inter - layer dielectric films . metal pieces 51 and 52 are used for electrostatic actuation . they are connected to a voltage source ( not shown ) which is an integrated circuit located elsewhere on wafer 25 . metal piece 53 closes a gap 62 between two signal strips 60 and 61 directly above metal piece 53 , once beam 50 is pulled - up by electrostatic actuation . ideally , there is no dielectric on the surface of metal piece 53 so as to allow metal - to - metal contact between metal piece 53 and signal strips 60 and 61 . to minimize sticktion , it is possible to add a thin layer of dielectric cover on metal piece 53 . all three metal pieces , 51 , 52 and 53 are typically encapsulated in dielectric films ( typically oxide ), but to allow free vertical motion of beam 50 , metal piece 53 is isolated from an overlaying dielectric film membrane 56 by cuts in such film shown by openings 54 . additional etch - holes 55 in dielectric membrane 56 are added to facilitate the formation of a cavity 57 . a microwave waveguide is formed on third metal layer by using metal pieces , 58 , 59 , 60 , and 61 . here again , such pieces form a coplanar waveguide configuration including ground planes 58 and 59 and signal planes 60 and 61 . with gap 62 between signal planes 60 and 61 , a signal cannot be transmitted . ground planes 58 and 59 act as upper electrodes for electrostatic actuation . so , when a transmission through signal planes 60 and 61 is desired , beam 50 is pulled up by applying a voltage higher than the threshold voltage of the switch . ground planes 58 and 59 are connected to circuit vias 63 and 64 . these vias are formed as a part of third metal layer right above contact pads 64 . hence , circuit vias 63 and 64 are electrically connected to integrated circuits elsewhere on the wafer . finally , ground planes 58 and 59 and signal planes 60 and 61 are supported by the mechanical support layer 23 . fig6 ( a ) through 6 ( i ) illustrate a preferred fabrication process for making the preferred embodiment of switch 10 of the present invention . this preferred process is based on semiconductor thin film deposition and photolithography processes , which are well known prior art . other fabrication sequences which are obvious to those skilled in the art are also within the scope of the present invention . the preferred embodiment of the electromechanical switch is fabricated using a semiconductor process in which a polysilicon layer , a first metal layer , and a second metal layer are deposited on a silicon wafer . by convention , in semiconductor processes , the layers are named according to their order of deposition . the first metal layer is the closest to the silicon substrate among metal layers , although it may be deposited on top of multiple layers of polysilicon . all the conductive layers are separated by insulating layers . [ 0045 ] fig6 ( a ) shows a cross - sectional view of a completed semiconductor chip 26 . for thermal actuation at least one polysilicon layer 20 is needed , but other , resistive layers , which are typically used to form resistors , can be used as well . in cmos processing , substrate 25 is silicon , but with proper process changes at substrate at etch step , it is possible to fabricate similar devices on gaas , sic or other exotic substrate materials as well . another important consideration is the use of vias 27 ( ie ., cuts in insulating layers ) in a given process technology . to increase yield , the ic design rules set by a given foundry may be very restrictive . it is essential to have the capability of dielectric stacked vias , which can directly expose substrate material for the fabrication sequence to be useful . although there are several foundries allowing such via formations , typically , ic stacked vias are discouraged to improve the planarity of layers . if such vias are not allowed in an ic process , an additional masking layer is necessary to cut through the insulating layers 15 , 17 , 18 and 19 shown in fig6 ( a ). in fig6 ( b ), a thick sacrificial layer 30 is patterned in area 14 ( see fig5 ), that defines the cavity which allows free movement of beam 12 . the thickness of sacrificial layer 30 is determined by design requirements and fabrication limits . photoresist , polymers and even metals can be used as sacrificial layer 30 . it is preferable to use photosensitive materials which can be removed easily layer , therefore photoresists , especially thick varieties such as az 4600 series , az 9600 series , and shipley 220 series can be used to achieve 3 - 20 μm thick features with fairly good aspect ratio . since aspect ratio is not critical for this application , resist and regular contact lithography would also be acceptable for this step . [ 0048 ] fig6 ( c ) shows the next step of forming the mold necessary for electroplating . for this step , a seed layer 31 is deposited . since gold is the preferred third metallization layer , seed layer 31 includes an adhesion and gold layer . a thin layer ( 100 - 300 a ) of chromium or titanium can be used for this purpose . if desired , a stack of cr / gold / cr can be used to minimize any step coverage issues . preferably , gold thickness is 1000 a - 3000 a . both of these materials 31 can be deposited using either evaporation or sputtering . proper sputter clean - up should then be performed to remove native oxide in exposed surfaces of second level metal pads prior to seed layer deposition . this greatly improves contact resistance and repeatability . as shown in fig6 ( d ), once seed layer 31 is deposited , a second layer of thick resist is used to form a mold 32 for subsequent gold plating . again , the same variety of resists can be used to form mold 32 . minimum features should be larger than 5 μm at this step . resist thickness should be more than the cavity height , to minimize lithography problems . uniform resist thickness is hard to achieve by spin casting , but it is not necessary anyway . for 5 μm thick gold deposition , it would be preferable to have resist thickness of more than 5 μm . to lower cost , this sequence does not include any chemical - mechanical - polishing ( cmp ) step after gold deposition . it is also important not to overplate structures . in fig6 ( e ), about 5 & gt ; m thick gold is electroplated on wafer 25 through the exposed areas to form metal conductive bridge 13 . this can be done using many available non - cyanide based gold plating solutions . the step shown in fig6 ( f ) consists of three minor steps . first , resist mold 32 is stripped , and then seed layer 31 is partially removed , since seed layer 31 can not be removed under bridge 13 . preferably , both of these steps are done using dry etching systems . if cavity 14 is defined using another resist layer , it is important to assure that it is well covered during the resist mold 32 strip operation . oxygen plasma is can be used to ash resist mold 32 . similarly , sputter etch can be used to strip metal seed layer 31 . finally , a superstrate 23 is deposited on top of switch 10 , as shown in fig4 and 5 . several different materials can be used for this purpose . polyimides , such as epo - tek 600 or dupont &# 39 ; s pyralin , can be screen - printed on this area . several good alternatives are emerging from high density interconnect ( hdi ) area , especially photoimageable versions of sequentially build - up microvia organic substrates are very promising . examples of such substrates include dupont &# 39 ; s dry film vialux 81 , vantico &# 39 ; s liquid probelec 81 , enthone &# 39 ; s liquid envision pdd 9015 , macdermid &# 39 ; s liquid macuvia - c , shipley royal &# 39 ; s aspire multiposit 2000 and dynavia 2000 . most of these materials have glass transition temperatures less than 200 ° c . for better coverage , liquid ones are preferable , but it has been observed that steps as high as 20 μm can be covered very easily by dry film varieties as well . typically , the thickness of these films can vary between 10 to 100 μm in a single coat . if the cavity cannot be stabilized mechanically in a single coat , as many coats as needed must be applied over the cavity area . typically , for a cavity height of & lt ; 20 μm , superstrate 23 height of 50 to 100 μm is enough . finally , bcb ( benzocyclobutene )- based polymers such as dow chemical &# 39 ; s cyclotene family can be used for this purpose as well . compared to microvia dielectrics , bcb has lower loss at high frequencies (& gt ; 1 ghz ) and also lower dielectric constant (˜ 2 . 7 ), but typically the film thickness is less than 10 μm per coat . therefore , it would require more processing . in fig6 ( g ), the backside 36 of substrate 25 is patterned to form a mask 35 by using front to back alignment to expose only the part of substrate 25 , which needs to be removed from back 36 . the front side of substrate 25 is also spray coated to minimize any interactions to with the etchant , such as xef2 . [ 0054 ] fig6 ( h ) shows selective removal of silicon substrate 25 from area 24 using mask 35 . for silicon substrates , numerous etching techniques can be employed . the preferred approach is the use of pulsed xef2 etch because of it is very high selectivity to silicon . xef2 is an isotropic etchant . the etch surface gets rougher and less predictable as the etch goes on , therefore thinner substrates are preferable at this step . for substrates other than silicon , the etch technique must be changed accordingly . finally , fig6 ( i ) is a cross - sectional view of electromechanical switch 10 after removal of the sacrificial film 30 which defines air - cavity 14 . once the silicon of substrate 25 is completely removed in the designated area 24 , beam 12 is released by removing the photoresist 30 that fills cavity 14 . this can be done using a standard wet resist stripper application , followed by an oxygen plasma application to completely clean cavity 14 . as cantilever beam 12 is released , it curves or buckles in cavity 14 so as to touch the third metal layer , bridge 13 . while the invention has been described in the context of a preferred embodiment , it will be apparent to those skilled in the art that numerous modifications may be made without departing from the true scope of the invention , leading to numerous alternative embodiments . accordingly , it is intended by the appended claims to cover all modifications of the invention , which fall within the scope of the invention . | 7 |
a detailed description of the inventive body of work is provided below . while several embodiments are described , it should be understood that the inventive body of work is not limited to any one embodiment , but instead encompasses numerous alternatives , modifications , and equivalents . in addition , while numerous specific details are set forth in the following description in order to provide a thorough understanding of the inventive body of work , some embodiments can be practiced without some or all of these details . moreover , for the purpose of clarity , certain technical material that is known in the related art has not been described in detail in order to avoid unnecessarily obscuring the inventive body of work . in the text which follows a reference to a “ beamformer ” is a reference to a spatial filter that operates on the output of an array of sensors in order to enhance the amplitude of a coherent wavefront relative to background noise and directional interference . in the text which follows an abbreviation “ doa ” is used as an acronym for “ direction of arrival ”. in the text which follows reference to “ beamformer - coefficient ” is intended as a reference to adaptive beamforming algorithms with real - value coefficients . fig1 illustrates a block diagram of a system 100 for processing and updating the coefficients of a beamformer so as to detect and enhance desired speech sources from multiple talkers from different directions in the presence of noise . the system 100 includes a microphone array 102 , a beamformer - coefficient processing module 104 , and a beamformer 106 . the beamformer - coefficient processing module 104 uses the signal from the microphone array 102 to detect the presence of speech and non - speech sources from various directions , and then computes coefficients to enhance desired speech sources . the beamformer module 106 is updated with the coefficients computed by module 104 to enhance the desired speech sources . fig2 illustrates a more detailed block diagram of the beamformer - coefficient processing module 104 . the processing module 104 includes a speech detector 104 aa , a speech - detector delay alignment 104 ab , a speech doa processor 104 ac , a non - speech detector 104 ad , a non - speech detector delay alignment 104 ae , a non - speech doa processor 104 af , a beamformer mask processor 104 ag , and a beamformer coefficient processor 104 ah . the speech detector 104 aa detects if the incoming signal from the microphone array 102 is speech ; if it is speech it then the speech doa processor 104 ac computes the direction and magnitude of the speech source . the processor 104 ac also stores the doas and magnitudes of the recent speech sources that are then passed on to the beamformer mask processor 104 ag . the speech detector 104 aa can also have a more detailed classifier to classify if the speech signal is from a male or female speaker , or whether it came from a certain individual . the non - speech detector 104 ad detects if the incoming signal from the microphone array 102 is not speech ; if it is not speech , the non - speech doa processor 104 af computes the direction of the speech source . the processor 104 af also stores the doas and magnitudes of the recent non - speech sources that are then passed on to the beamformer mask processor 104 ag . the non - speech detector 104 ad can also have a classifier to classify the non - speech signals in greater detail , such as from different appliances , electronic audio systems , and various types of transients and noise . the beamformer mask processor 104 ag takes in the recently detected speech and non - speech sources from modules 104 ac and 104 af , respectively . depending upon the application , the beamformer mask processor 104 ag may select certain desired speech sources while suppressing the other speech and non - speech sources . in other application , it may also be possible that the processor 104 ag may select certain types of non - speech sources while suppressing the other non - speech sources and speech sources . depending upon the application , the beamformer mask processor 104 ag may use several criteria to select the speech or non - speech sources ; one criteria is to select signals that are greater than a prescribed threshold with doa lying between prescribed angular bounds . the output of the mask processor 104 ag is a beamformer - response mask that is then passed on to the beamformer coefficient processor 104 ah . the beamformer coefficient processor 104 ah uses the beamformer mask from the beamformer mask processor 104 ag and computes the beamformer coefficients so that the beamformer response closely replicates the beamformer mask . fig3 illustrates a more detailed alternate realization of the block diagram of the beamformer - coefficient processing module 104 . in the realization , the estimation module 104 includes an acoustic activity detector 104 ba , an acoustic - activity - detector delay alignment 104 bb , a speech detector 104 bc , a speech - detector delay alignment 104 bd , a speech doa processor 104 be , a magnitude - profile processor across different directions 104 bf , a beamformer mask processor 104 bg , and a beamformer - coefficient processor 104 bh . the acoustic activity detector 104 ba ensures that the computation of the beamformer coefficients is carried out only when the acoustic signal at the microphones is at a certain level above the background noise . the speech detector 104 bc detects if the incoming signal from the microphone array 102 is speech ; if it is speech it then the speech doa processor 104 be computes the direction and magnitude of the speech source . the processor 104 be also stores the doas and magnitudes of the recent speech sources that are then passed on to the beamformer mask processor 104 bg . the speech detector 104 bc may also have a more detailed classifier to classify if the speech signal is from a male or female speaker , or whether it came from a certain individual . the magnitude - profile processor 104 bf scans the acoustic signal across different directions and creates an acoustic - magnitude profile across different directions . the profile is then passed on to the beamformer mask processor 104 bg . the beamformer mask processor 104 bg takes in the recently detected speech sources from the speech doa processor 104 be and the acoustic magnitude profile from the magnitude - profile processor 104 bf . depending upon the application , the beamformer mask processor 104 ag may select certain desired speech sources while suppressing the other speech and non - speech sources . the beamformer coefficient processor 104 bh uses the beamformer mask from the beamformer mask processor 104 bg and computes the beamformer coefficients so that the beamformer response closely replicates the beamformer mask . fig4 illustrates a block diagram of a simple implementation of an acoustic activity detector 104 ba that includes a smooth energy processor 104 baa , a background noise estimator 104 bab , and decision logic 104 bac . the decision logic 104 bac uses the outputs of the smooth energy processor 104 baa and the background noise processor 104 bab to decide if the acoustic signal is above the estimated background noise level . for more precise detection of the acoustic activity , subband - based methods where the energy is detected across each subband using frequency - domain or wavelet - transform based analysis can also be used . in another implementation , a beamformer may also be incorporated within the acoustic activity detector 104 ba so that only acoustic signals from preferred spatial directions are analyzed . fig5 illustrates a speech detector 104 bc that includes a summer 104 bca , a single channel noise remover 104 bcb , and a speech detection model 104 bcc . the summer 104 bca combines the signal from the microphone array to a single channel signal and passes it on to the single - channel noise remover 104 bcb . the summer 104 bca may also be replaced by a beamformer so that only signals from preferred spatial directions are selected for analysis . the cleaned output from the single - channel noise remover 104 bcb is then passed to a speech detection module 104 bcc . the speech detection module 104 bcc detects whether the input signal is speech . if speech , it outputs a true value and if not a false value . the speech detection module 104 bcc may incorporate more detailed detectors that detect whether the speech signal corresponds to a male or a female speaker or to a particular individual . fig6 illustrates a flowchart of the acoustic - magnitude profile processor 104 bf to obtain the magnitude profile across various directions . in the flowchart , the beamformer is uploaded with coefficients that are pre - computed to focus in a certain direction . then , after a prescribed interval the beamformer is update with a new set of coefficients that gradually shifts the direction of focus by a small prescribed angle . in this way , by gradually varying the beamformer angular focus across prescribed directions , the beamformer scans for acoustic signals within the indoor environment . the magnitudes of the acoustic signal scanned across the different directions are stored in a vector , mvec . a temporal leaky average of mvec is then taken to obtain a smooth profile of the magnitude of the acoustic signal across the various directions , which is stored in the vector msmvec . fig7 illustrates a typical desired beamformer mask , m d ( θ , ω ), across the frequency and angular directions is shown . as can be seen , the mask has two angular passbands , with frequency band lying between flow and fhigh . the next step is to obtain a beamformer that has a magnitude response that closely replicates the mask . one new method is to optimally combine pre - computed beamformers . in the method , perfect ( or near perfect ) linear phase beamformer for different directions are constructed ; if m i ( θ , ω ) is the magnitude response of the pre - computed beamformer for look - direction d ( i ), then the corresponding linear - phase beamformer response is given by a linear combination of the various linear - phase beamformers with different magnitude response is given by and c i are the weights . one way to obtain the weights , c i , is to minimize the least - square error between m ( θ , ω ) and the beamformer mask m d ( θ , ω ); i . e ., minimize σ i | m ( θ i , ω i )− m d ( θ i , ω i )| 2 , θ i ∈ θ and ω i ∈ ω ifm is a vector containing the magnitude responses of the beamformer we have parameters k and l are the length of the rows and columns of a . using matrix notation the optimization problem can be expressed as m d =[ m d ( θ 1 , ω 1 ), . . . , m d ( θ k , ω k )] t a closed formed solution of the optimal weights , c opt , for the optimization problem is given by although the foregoing has been described in some detail for purposes of clarity , it will be apparent that certain changes and modifications may be made without departing from the principles thereof . it should be noted that there are many alternative ways of implementing both the processes and apparatuses described herein . accordingly , the present embodiments are to be considered as illustrative and not restrictive , and the inventive body of work is not to be limited to the details given herein , which may be modified within the scope and equivalents of the appended claims . | 6 |
in accordance with the principles of the present invention , an electrical device incorporates a magnetic ti layer as an interconnect layer in an integrated circuit and includes at least one electrode in electrical contact with the edge of the magnetic ti layer . in the present description , a topological insulator , in two or three dimensions , is a material having insulating energy gaps in the bulk and gapless edge or surface states on the sample boundary that are protected by time - reversal symmetry . that is , a topological insulator is a material with a bulk insulating gap and a conducting surface state protected from any time reversal invariant perturbation . in the present description , gapless edge or surface states refer to an edge or surface states having a zero bandgap . in other words , a topological insulator is a material that behaves as an insulator in its interior while permitting the movement of charges on its boundary . furthermore , the surface states of a topological insulator have a widely tunable bandgap depending on the thickness of the topological insulator layer . in particular , when the thickness of the topological insulator is large enough , the surface states are gapless or have negligible band gap , that is the bandgap is zero . when the thickness of the topological insulator is small enough , the surface states become gapped or have appreciable energy band gap due to the finite size effect of the thin film . that is , the thin film topological insulator behaves as a semiconductor material with a continuous tunable bandgap . the thin films of topological insulators , when doped with transition metal elements , will form magnetically ordered insulators . the magnetic elements will introduce exchange coupling in the topological insulator . that is to make the topological insulators spin polarized . the exchange coupling induced by magnetic order competes with the semiconductor bandgap induced by the finite size effect . when the exchange coupling is larger than the semiconductor bandgap , it could give rise to a topologically nontrivial electronic structure characterized by a finite chern number and gapless chiral edge states , with quantized hall conductance e 2 / h . that is , the thin film topological insulator behaves as a semiconductor material while permitting the movement of charges on its edges . a chiral edge state refers to an edge state that carries current uni - directionally . the chiral edge state of the qah effect in magnetic ti is dissipationless . in the sense that , it carries current uni - directionally at the sample edges and it will not be backscattered even in the presence of impurities . known materials for forming a topological insulator layer include : hgte , bi x sb 1 − x , sb 2 te 3 , bi 2 te 3 , bi 2 se 3 , tlbite 2 and tlbise 2 . a topological insulator can also be formed using selected tenary heusler compounds or selected chalcogenides , such as ge 1 bi 4 te 7 , ge 2 bi 2 te 5 , and ge 1 bi 2 te 4 . other materials or compounds for forming a topological insulator are possible . the electrical device of the present invention can be constructed using any topological insulator materials , currently known or to be developed . method for forming such ti materials is well known . various transition metal elements can be doped into topological insulators described above , and form magnetically ordered insulators . the transition metal elements include : titanium ( ti ), vanadium ( v ), chromium ( cr ), manganese ( mn ), iron ( fe ), cobalt ( co ), nickel ( ni ), iridium ( ir ), europium ( eu ), gadolinium ( gd ). the doping concentration can be as large as 30 %, relative to the bulk ti material . for example , sb 2 — x cr x te 3 , x doping can tuned to be 0 . 6 . other transition metal elements doped in topological insulators for forming magnetically ordered insulators are possible , currently known or to be found . such methods for doping are well known . by tuning the doping concentration of transition metal elements in topological insulators , the exchange coupling between the local moments of the transition metal elements and topological insulators can be controlled . more doping density of transition metal elements in topological insulators will induce larger exchange coupling . by varying the exchange coupling in the sub - layers of the topological insulator as the insulator is grown ( in a vacuum chamber ), by varying the magnetic doping during growth , the number of chiral edge states can be well tuned . the thickness of the magnetic topological insulator ( a thin film ) also determines the number of conducting edge layers . each conducing edge is a separate conducting channel that may conduct a signal in parallel . accordingly , the qah effect with higher chern number will be realized by the selective magnetic doping . that is , the qah effect with higher chern number has large number of chiral edge states ( more than 1 ), and the number of edge states is the chern number . these chiral edge states carry current uni - directionally at edges of the thin film . referring to fig1 , for a typical magnetic topological insulator bi 2 − y cr y ( se x te 1 − x ) 3 , the cr content ( magnetic doping density ) can be varied , as well as the se / te ratio . in this system , tunable magnetic ordering and topological properties are well suited for realization of higher chern number qah effect . as shown in fig1 , a large exchange field and large thickness of topological insulator will give rise to higher chern number qah effect , thus large number of chiral edge states . the electrical device having chiral interconnects formed by a magnetic topological insulator and its performance characteristics will now be described . the following description is illustrative only of the applications in which a magnetic topological insulator can be used . according to moore &# 39 ; s law , the number of transistors in integrated circuits doubles approximately every two years . if the trend continues , atomic length scales will be reached around 2015 . besides transistors , one also needs to scale the copper interconnect — another major component in integrated circuits . scaled wires have higher resistance and capacitance , and therefore reduced bandwidth , higher delays and higher power dissipation . such problems offset the performance benefits of transistor scaling . the hope of significant technological improvements involves addressing quantum effects directly . current scientific development is to use the optical interconnect , and it is a way of communication by optical cables . however , transforming optical signal to electric signal adds complexity and expense . harnessing the quantum nature of matter — such as the quantum phase and spin of the electron — rather than trying to combat it offers the prospect of unprecedented device performance , well beyond that allowed by classical principles . according to embodiments of the present invention , an inside - multiple - channel - dissipationless chiral edge state interconnect device is formed using a magnetic topological insulator layer . the magnetic topological insulator layer is grown on the integrated circuit wafer in a vacuum chamber , using photolithographic techniques to define the shapes and locations of the magnetic topological insulator layer in the integrated circuit . growing topological insulators for scientific analysis is known , and it would be well within the skills of those in the field of growing topological insulator layers to grow the present inventive layers in selected locations on an integrated circuit wafer . hundreds of papers have been written detailing methods to form tis ( even if only referring to the material chemical composition ) and experiments performed on the tis . one needing a ti material without having a fabrication facility can easily request a suitable facility , such as a university identified in the various papers , to grow the ti material . as one example out of many , the paper entitled , quasi - particle scattering and protected nature of topological states in a parent topological insulator bi 2 se 3 , by s . r . park et al , published dec . 19 , 2009 , states : “ single crystals were grown by a self flux technique , following the previously reported recipe .” the “ recipe ” is from the paper entitled “ p - type bi 2 se 3 for topological insulator and low temperature thermoelectric applications ,” by y . s . hor , phys . rev . b 79 , 195208 ( 2009 ). the term “ recipe ” denotes a formula that leads the reader through the steps to form the ti material . the y . s . hor paper provides a detailed description of a method to form the bi 2 se 3 ti material , and the fact that the s . r . park team was able to fabricate the ti material using the “ recipe ” in the y . s . hor paper illustrates that anyone wanting to make a ti material need only follow the directions provided in published papers . similarly , the paper entitled , topological insulator bi 2 se 3 thin films grown on double - layer graphene by molecular beam epitaxy , by can - li song et al ., applied physics letters , vol . 97 , issue 14 , october 2010 , describes forming bi 2 se 3 . the paper entitled , intrinsic topological insulator bi2te3 thin films on si and their thickness limit , by yao - yi li , shou - cheng zhang ( a present co - inventor from stanford university ), et al ., adv . mater . 2010 , 22 , 4002 - 4007 , also describes steps for forming the ti material on a silicon substrate using molecular beam epitaxy . similarly , the paper entitled , growth dynamics and thickness - dependent electronic structure of topological insulator bi2te3 thin films on si , by yao - yi li , shou - cheng zhang ( a present co - inventor from stanford university ), et al ., arxiv : 0912 . 5054 [ cond - mat . mes - hall ], dec . 27 , 2009 , also describes steps for forming the ti material on a silicon substrate using molecular beam epitaxy . the paper entitled , “ anomalous transport in an n - type topological insulator ultrathin bi 2 se 3 film , by t . hirahara , phy . rev . b 82 , 155309 ( 2010 ), also provides a very detailed recipe for forming the thin bi 2 se 3 film suitable for our invention . the paper entitled , “ quintuple - layer epitaxy of high - quality bi 2 se 3 thin films for topological insulator ,” by guanhua zhang et al , describes another recipe for fabricating thin films of the bi 2 se 3 suitable for our invention . all these papers are incorporated by reference to identify the state of the art in fabricating ti materials . these papers also reference other papers for additionally describing methods of forming and doping ti materials . the pertinent person skilled in the present field of forming ti materials has a phd in physics or material science and is thoroughly familiar with techniques for epitaxially growing thin films . such a person will be able to form the materials and structures of the present invention without undue experimentation . basically , the ti material bi 2 se 3 or bi 2 te3 is grown , layer by layer , on an si substrate in a vacuum chamber by molecular beam epitaxy using evaporated bi and se or te . preferably , the ti layers are grown over an si substrate to allow other circuit elements to be formed in the same substrate . forming the 2 - d or 3 - d layers of the ti material on an ic for conducting 2 - way current between two circuits would only entail the magnetic doping steps described herein and the process steps of masking and etching that are generally used to pattern conductors in an ic . the ic circuits may be any type of circuit , such as a high speed memory circuit or a communications circuit . magnetic doping of the ti material during formation is also well - known and described in some of the above papers . the high chern number qah effect can be realized in such a magnetic topological insulator . such an interconnect dramatically lowers dissipation along the channel by avoiding random scattering . however , the contact resistance between the metal electrode ( connecting the ti edge to a conventional circuit in the ic ) and the ti material still limits the performance of the device . by using the present invention , the multiple chiral edge channels lower the contact resistance , significantly improving the device performance . fig2 is a graph comparing the resistance of the copper , single channel and two channels quantized anomalous hall effect interconnects . as seen , the resistance of a copper wire increases linearly with length , while the single edge and double edge resistances do not substantially increase with length . as more edges are connected in parallel , the resistance reduces . fig2 does not address contact resistance between an electrode and the conductors , and the present invention is directed to reducing such contact resistance . as mentioned above , the 2 - d topological insulator ( ti ) described above , containing the magnetic dopants , exhibits insignificant resistance along its edges . the ti is grown in layers called quintuple layers , as discussed above . each quintuple layer is only about only one nanometer thick . each edge of the ti has many separate conduction paths ( substantially electrically insulated from one another ) by varying the magnetic dopant density ( e . g ., between 0 - 30 %) in the layers while the ti is grown . the number of layers depends on the thickness of ti . the variation of the magnetic doping as the ti layers are grown determines the number of conducting edge channels that will be connected in parallel by the metal electrode . by forming the ti as a thin ( less than 1 micron ) and narrow ( less than 1 micron ) conductor between two circuits , with metal electrodes contacting each edge of the ti layers , an extremely low loss interconnect is formed . each edge may conduct a separate current signal , since the major surfaces of the ti interconnect have the properties of an insulator . the metal electrodes may be standard metal electrodes used in integrated circuits ( ics ), such as copper , gold , platinum , silver , aluminum , etc . the metal may be sputtered on and patterned using conventional photolithographic techniques . since one edge of the ti interconnect has several chiral edge states , namely several separate conductors in parallel , the overall contact resistance between the metal electrode and the edge is very low , since the contact resistances to the many sub - edges , making up a single edge of the ti , are electrically connected in parallel by the electrode . fig3 is a schematic view of a small portion of an ic 20 . a first circuit 22 and second circuit 24 are shown connected to a very thin ( less than 1 micron ) and narrow ( less than 1 micron ) 2 - d ti 26 . in one embodiment , the ti 26 is formed of a plurality of layers and is magnetically doped , as described above . fig4 is a side view of the ti 26 showing the various layers 26 a - 26 x , acting as stacked conductors in parallel . the ti 26 may be formed to a width of a fraction of a micron , or the narrowest width possible using state of the art processes , without any adverse effect on conductivity , since the conductance is only along the edges within a few nanometers of the surface . the circuit 22 is shown having an input terminal 28 and an output terminal 30 , where the output terminal 30 generates a positive current flowing toward the right . similarly , the circuit 24 is shown having an input terminal 32 and an output terminal 34 , where the output terminal 34 generates a positive current flowing toward the left . the electrically isolated currents may flow in any direction , but importantly there is no interference between the two current paths . since the ti 26 does not need a physical gap between the two edges , the ti 26 can be made much narrower than two metal wires separated by a gap . further , the resistance of the edge conduction is less than that of a wire . conventional metal electrodes 36 - 39 are shown formed at and around the corners of the ti 26 to contact the edges of the ti 26 layers and connect them in parallel . the length of the ti 26 is any length necessary to connect the two circuits 22 and 24 . any length of metal wire ( trace ) can connect the ti electrodes 36 - 39 to the circuit 22 / 24 terminals . using the ti 26 is particularly beneficial for relatively long runs in an ic where very low resistance is desirable . due to its very low resistance , very low power signals may be conducted without significant dissipation , allowing for faster speeds than had conventional metal wires been used . the ti 26 may be further connected to other circuits . the ti 26 , in its configuration of fig3 , is referred to as an autobahn interconnect since traffic ( current ) simultaneously flows in two opposite directions separated by a divider ( the center insulation portion of the ti 26 ). further information about topological insulators used as interconnects in an ic may be found in the u . s . application ser . no . 13 / 312 , 942 , now us publication 2012 / 0138887 by one of the present co - inventors , shoucheng zhang , incorporated herein by reference . while particular embodiments of the present invention have been shown and described , it will be obvious to those skilled in the art that changes and modifications may be made without departing from this invention in its broader aspects and , therefore , the appended claims are to encompass within their scope all such changes and modifications as fall within the true spirit and scope of this invention . | 7 |
firstly , referring to fig1 showing the hair dressing device in elevation exhibiting the following features : hair dressing device 10 mainly triangular in shape with rounded edges allows the person &# 39 ; s hair 16 to be wrapped around the hair dressing device 10 in such a fashion as to simulate a french twist hair style in order to enhance the look of the hair ; top of hair dressing device 10a is concave in the center to permit curled top of person &# 39 ; s hair 16c to be placed within the crevice ; right side of hair dressing device 10b is gradually sloped towards the left side of hair dressing device 10c as moving from top of hair dressing device 10a to bottom of hair dressing device 10d ; left side of hair dressing device 10c maintains a vertical posture moving from top of hair dressing device 10a to bottom of hair dressing device 10d ; bottom of hair dressing device 10d ends in a rounded point ; center area of hair dressing device 10e is convex moving from the right side of hair dressing device 10b to the left side of hair dressing device 10c ; hair dressing device tabs 12 are placed next to the back of the person &# 39 ; s hair 16 so that the hair dressing device holding bobby pins 14d secure the hair dressing device 10 to the person &# 39 ; s hair 16 close to the rear of the person &# 39 ; s head ; hair dressing device upper tab 12a is placed next to the back of the person &# 39 ; s hair 16 so that the hair dressing device holding bobby pins 14d secure the hair dressing device 10 to the person &# 39 ; s hair 16 close to the rear of the person &# 39 ; s head ; and hair dressing device lower tab 12b is placed next to the back of the person &# 39 ; s hair 16 so that the hair dressing device holding bobby pins 14d secure the hair dressing device 10 to the person &# 39 ; s hair 16 close to the rear of the person &# 39 ; s head . now , referring to fig2 being a rear view of the person &# 39 ; s head and hair prior to using the hair dressing device exhibiting the following features : person &# 39 ; s hair 16 is brushed in such a manner as to allow use of the hair dressing device 10 . now , referring to fig3 being a rear view of the person &# 39 ; s head and hair brushed and pinned in preparation for the hair dressing device exhibiting the following features : placement bobby pins 14 holds the person &# 39 ; s hair secured to head 16a giving the person &# 39 ; s hair not secured to head 16b the proper position to allow use of the hair dressing device 10 ; upper hair placement bobby pins 14a holds the upper area of the person &# 39 ; s hair secured to head 16a giving the person &# 39 ; s hair not secured to head 16b the proper position to allow use of the hair dressing device 10 ; middle hair placement bobby pins 14b holds the middle area of the person &# 39 ; s hair secured to head 16a giving the person &# 39 ; s hair not secured to head 16b the proper position to allow use of the hair dressing device 10 ; lower hair placement bobby pins 14c holds the lower area of the person &# 39 ; s hair secured to head 16a giving the person &# 39 ; s hair not secured to head 16b the proper position to allow use of the hair dressing device 10 ; hair dressing device holding bobby pins 14d are placed vertically through the hair dressing device upper tab 12a and the hair dressing device lower tab 12b to secure the hair dressing device 10 to the person &# 39 ; s hair not secured to head 16b ; person &# 39 ; s hair 16 is brushed in such a manner as to allow use of the hair dressing device 10 ; person &# 39 ; s hair secured to head 16a in a cross - wise fashion in such a manner as to allow use of the hair dressing device 10 ; and person &# 39 ; s hair not secured to head 16b brushed in such a manner as to allow use of the hair dressing device 10 . now , referring to fig4 being a rear view of the person &# 39 ; s head and hair showing proper placement of the hair dressing device exhibiting the following features : hair dressing device 10 mainly triangular in shape with rounded edges allows the person &# 39 ; s hair 16 to be wrapped around the hair dressing device 10 in such a fashion as to simulate a french twist hair style in order to enhance the look of the hair ; top of hair dressing device 10a is concave in the center to permit curled top of person &# 39 ; s hair 16c to be placed within the crevice ; right side of hair dressing device 10b is gradually sloped towards the left side of hair dressing device 10c as moving from top of hair dressing device 10a to bottom of hair dressing device 10d ; left side of hair dressing device 10c maintains a vertical posture moving from top of hair dressing device 10a to bottom of hair dressing device 10d ; bottom of hair dressing device 10d ends in a rounded point ; center area of hair dressing device 10e is convex moving from the right side of hair dressing device 10b to the left side of hair dressing device 10c ; hair dressing device holding bobby pins 14d are placed vertically through the hair dressing device upper tab 12a and the hair dressing device lower tab 12b to secure the hair dressing device 10 to the person &# 39 ; s hair not secured to head 16b ; bendable insert 18 enclosed in the hair dressing device 10 giving flexibility and support : and comb - like protrusions 20 for the person &# 39 ; s hair not secured to head 16b to flow around the hair dressing device 10 to maintain the style . now , referring to fig5 being a rear view of the person &# 39 ; s head and hair with the person &# 39 ; s hair wrapped around the hair dressing device exhibiting the following features : hair dressing device 10 mainly triangular in shape with rounded edges allows the person &# 39 ; s hair 16 to be wrapped around the hair dressing device 10 in such a fashion as to simulate a french twist hair style in order to enhance the look of the hair ; top of hair dressing device 10a is concave in the center to permit curled top of person &# 39 ; s hair 16c to be placed within the crevice ; right side of hair dressing device 10b is gradually sloped towards the left side of hair dressing device 10c as moving from top of hair dressing device 10a to bottom of hair dressing device 10d ; left side of hair dressing device 10c maintains a vertical posture moving from top of hair dressing device 10a to bottom of hair dressing device 10d ; bottom of hair dressing device 10d ends in a rounded point ; center area of hair dressing device 10e is convex moving from the right side of hair dressing device 10b to the left side of hair dressing device 10c ; person &# 39 ; s hair 16 is brushed in such a manner as to allow use of the hair dressing device 10 ; person &# 39 ; s hair secured to head 16a in a cross - wise fashion in such a manner as to allow use of the hair dressing device 10 ; person &# 39 ; s hair not secured to head 16b brushed in such a manner as to allow use of the hair dressing device 10 ; curled top of person &# 39 ; s hair 16c to fit into top of hair dressing device 10a ; bendable insert 18 enclosed in the hair dressing device 10 giving flexibility and support ; and comb - like protrusions 20 for the person &# 39 ; s hair not secured to head 16b to flow around the hair dressing device 10 to maintain the style . now , referring to fig6 showing a cross - section view along lines 6 -- 6 in fig5 exhibiting the following features : hair dressing device 10 mainly triangular in shape with rounded edges allows the person &# 39 ; s hair 16 to be wrapped around the hair dressing device 10 in such a fashion as to simulate a french twist hair style in order to enhance the look of the hair ; right side of hair dressing device 10b is gradually sloped towards the left side of hair dressing device 10c as moving from top of hair dressing device 10a to bottom of hair dressing device 10d ; left side of hair dressing device 10c maintains a vertical posture moving from top of hair dressing device 10a to bottom of hair dressing device 10d ; hair dressing device lower tab 12b is placed next to the back of the person &# 39 ; s hair 16 so that the hair dressing device holding bobby pins 14d secure the hair dressing device 10 to the person &# 39 ; s hair 16 close to the rear of the person &# 39 ; s head left tab attachment 12aa for securing hair dressing device lower tab 12b to hair dressing device 10 ; right tab attachment 12ab for securing hair dressing device lower tab 12b to hair dressing device 10 ; person &# 39 ; s hair 16 is brushed in such a manner as to allow use of the hair dressing device 10 ; hair dressing device holding bobby pins 14d are placed vertically through the hair dressing device upper tab 12a and the hair dressing device lower tab 12b to secure the hair dressing device 10 to the person &# 39 ; s hair not secured to head 16b ; person &# 39 ; s hair secured to head 16a in a cross - wise fashion in such a manner as to allow use of the hair dressing device 10 ; person &# 39 ; s hair not secured to head 16b brushed in such a manner as to allow use of the hair dressing device 10 ; bendable insert 18 enclosed in the hair dressing device 10 giving rigidity , flexibility and support ; and comb - like protrusions 20 for the person &# 39 ; s hair not secured to head 16b to flow around the hair dressing device 10 to maintain the style . now , referring to fig7 is a plan view looking down on the finished hair construction exhibiting the following features : person &# 39 ; s hair secured to head 16a in a cross - wise fashion in such a manner as to allow use of the hair dressing device 10 ; person &# 39 ; s hair not secured to head 16b brushed in such a manner as to allow use of the hair dressing device 10 ; and curled top of person &# 39 ; s hair 16c to fit into top of hair dressing device 10a . the foundation for a hair dressing shall be manufactured individually and in combination from a group of materials consisting of plastic , plastic composites , closed - cell foam material , open - cell foam material , foam rubber , polyurethane , and polyethylene . the hair dressing device shall be formed of a surface finish capable of entangling with said person &# 39 ; s hair holding said device to said hair . the hair dressing device tabs shall be constructed from a group of materials individually or in combination including : plastic , plastic composites , fabric , elastic strips and rubber . the comb - like protrusions being constructed shall be manufactured from a group of materials individually or in combination including : plastic , plastic composites , wood , carbon - graphite , metal , metal alloys , and fiberglass . the foundation insert being constructed shall be manufactured from a group of materials individually or in combination including : plastic , plastic composites , metal , metal alloys , and fiberglass . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of constructions differing from the type described above . while the invention has been illustrated and described as embodied in a foundation for a hair dressing , it is not intended to be limited to the details shown , since it will be understood that various omissions , modifications , substitutions and changes in the forms and details of the device illustrated and in its operation can be made by those skilled in the art without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention . | 0 |
a preferred embodiment of the online sales promotion system of the present invention will now be explained in detail . fig1 shows an overall block diagram of an online sales promotion system according to a first embodiment of the present invention . this system includes a user terminal 1 , an e - commerce business and catalog business 2 , a cart server 3 , and a proxy 4 being interconnected by the internet 5 . the e - commerce business 2 and catalog business 2 ( hereinafter “ business ”) sell products on web sites on the internet 5 , and are affiliated with the supplier of the cart server 3 ( hereinafter “ cart business ”). the cart server 3 provides carts to users . by drag - and - dropping an icon for a product displayed on a business web site , a user can place that product in his own cart . the user terminal 1 is connected to the internet 5 via the proxy 4 . it displays web pages using a browser . the cart server 3 is connected to the back end of this proxy 4 . when the user terminal 1 accesses the web site of the business 2 , the proxy 4 rewrites the access information so that the cart contents and the web page are displayed by the browser . fig2 is a block diagram showing the constitution and function of the cart server 3 and the proxy 4 . fig3 is a block diagram showing in detail the functions of part of the cart server 3 . as shown in the drawings , the cart server 3 has a plurality of carts 31 . the cart server 3 also stores data needed for operating carts 31 in a cart database 32 , a store database 33 , an item database 34 and a fee - charging database 35 . in addition to the above databases , the cart server 3 has a control module 36 and a publishing module 37 . the control module 36 identifies a user cart that accesses a web site , and instructs that cart to supply content to the user terminal 1 . the publishing module 37 analyzes the contents of each cart and supplies the results to the user , businesses and the like . each cart 31 stores predetermined information , and furthermore has an output processing unit 313 , a settlement information control unit 132 , an event extraction unit 133 , a fee - charging information extraction unit 134 , an incentive extraction unit 135 and a communications interface 312 as seen in fig3 . the information stored in carts will be discussed below . the output processing unit 313 converts the contents of a cart into an html file for display on the browser and into an xml file to send to the business 2 . the output processing unit 313 also rewrites the cart contents based on instructions from the user . the output processing unit 313 also receives external information from the business 2 and holds this in the cart . the settlement information control unit 132 stores settlement information , which will be discussed below , and based on this information performs settlement processing . the event extraction unit 133 and the fee - charging information extraction unit 134 charge fees to the business 2 that has fulfilled predetermined conditions . the incentive extraction unit 135 awards bonuses to users who have fulfilled predetermined conditions . the communications interface 312 sends and receives data between the cart and the business 2 , and between the cart and the proxy 4 . as seen in fig2 , in addition to the standard functions , the proxy 4 is provided with a rewrite module 41 . the rewrite module 41 processes data so that the contents of the user &# 39 ; s cart and the accessed web site are both displayed on the browser . the proxy 4 is different from the so - called web proxy , that is , the proxy provided on firewalls for the purpose of preventing external web access ; rather , it is a proxy provided for the working of the present invention . each cart in the cart server 3 has an identification number ( hereinafter “ cart id ”), managed by the settlement information control unit 132 . fig4 a shows a conceptual drawing of the information stored in the cart database 32 . in the cart database 32 , the cart id and the cart owner are correlated and stored . in this fig4 a , email addresses are used as the information for identifying cart owners . other information that can be used includes the user identification information unique to this system . fig4 b is a conceptual drawing showing the information stored in the store database 33 . stored in the store database 33 are the names of the e - commerce businesses and catalog businesses that have contracted with the cart business (“ name ” tag in the figure ), the identification number of each business 2 ( hereinafter “ store id ”) (“ store sid ” tag in the figure ), the address of the icon representing each business 2 (“ icon ” tag in the figure ), and the communication address of each business 2 (“ address ” tag in the figure ). as will be discussed later , this communication address is used to determine the address to which to send the contents of a cart . for example , in fig4 b , the business specified by the store id “ 0123 ” is akachanya , and the communication address for akachanya is http :// akachan - ya . com . fig5 a is a conceptual drawing showing the information stored in the item database 34 . stored in the item database 34 is a list of the products that can be placed in a cart . specifically , for each product , the identification number (“ item id ” tag in the figure , hereinafter “ item id ”), product name (“ name ” tag in the figure ), and the address of the icon representing the product (“ icon ” tag in the figure ) are listed . a user can place products in the item database 34 in his cart . each business 2 correlates its products with an item id beforehand . fig5 b is a conceptual drawing showing the information stored in the fee - charging database 35 . stored in the fee - charging database 35 are the store id , cart id , fee amount , date , and bank account to be debited . for example , accumulated fees are calculated each month for each business 2 , and the corresponding amount is debited from a bank account of each business 2 . fig6 through 11 will be used to explain the information stored in each cart . fig6 is a conceptual drawing showing the information stored in a settlement information list . the settlement information list is stored in the settlement information control unit 132 of a cart , as shown in fig3 . stored in the settlement information list is information relating to the credit card of the cart owner . in this example , credit id (“ credit id ” tag in the figure ) in the form of consecutive numbers and such , credit card member number (“ number ” tag in the figure ), user name (“ holder ” tag in the figure ), expiration date (“ valid through ” tag in the figure ) and credit card type (“ description ” tag in the figure ) are listed . in this figure , the user taro fuji has two types of credit cards , a mastercard and a jcb card . fig7 is a conceptual drawing showing the information stored in the permission list 136 , shown in fig3 . the permission list 136 lists the businesses ( hereinafter “ designated businesses ”) that the owner of the cart has permitted to see the contents of his cart . specifically , the store id (“ store sid ” tag in the figure ) and the addresses to which the contents of the cart are to be sent (“ address ” tag in the figure ) are listed . in this figure , “ akachanya ,” “ ningyo - no satsukido ” and “ gift honpo ” are listed as businesses in the permission list 136 . fig8 a and 8b are conceptual drawings showing the information stored in the candidate product list 137 seen in fig3 . this list includes the item id (“ item id ” tag in the figure ) of products which the user is unsure about whether to purchase or intends to purchase , price , if available (“ price ” tag in figure ), business name (“ store ” tag in the figure ), and product name . in fig8 a “ giant bear ” and “ 12 , 000 yen ” are listed on the candidate product list 137 . in fig8 b , “ giant bear ,” “ 10 , 000 yen ” and “ kuma honpo ” are listed on the candidate product list 137 . when a product icon from an e - commerce business web site has been drag - and - dropped into a cart , the price listed on the web site and the business name on the web site appear on this list . however , when a product has been selected from the web site of a catalog business , the price and business name are not definite at this point and thus , they do not appear on this list . this allows businesses that have been notified of the candidate product list to learn which business ′ product the user has selected . a business can therefore provide the user with different advertisements , depending upon whether the user has selected its product or the product of a competitor . fig9 is a conceptual drawing of the information stored in the purchased product list 138 , shown in fig3 . this list includes , for the products placed in a cart , the item id of purchased products (“ item ” tag in the figure ), the purchase price (“ price ” tag in the figure ) and the business name (“ store sid ” tag in the figure ). fig9 shows both the candidate product list 137 and the purchased product list 138 . the purchased product list 138 states that a doll with item id “ 5235 ” was purchased at the business “ sanjusando ” for a price of “ 18 , 000 yen .” when a user gives instructions to select and purchase any product on the candidate product list 137 , that product is moved from the candidate product list 137 to the purchased product list 138 . fig1 is a conceptual drawing showing the information stored in the external information list 139 , shown in fig3 . stored in this list is information provided by designated businesses relating to products in a cart . specifically , this list stores the identification number of the external information ( hereinafter “ ad id ,” “ ad aid ” tag in the figure ), store id and business name (“ store ” tag in the figure ) and item id and product name (“ item ” tag in the figure ) and the contents of the external information ( equivalent to additional information , “ ad_body ” tag in the figure ). in this example , the ad id “ 222123 ” shows that an advertisement “ 20 % off sale now going on at ningyo - no satsukido ” is being provided by “ ningyo - no satsukido ” with store id “ 0564 ” regarding the “ dolls ( 2 )” with item id “ 5235 .” fig1 a and 11b are conceptual drawings showing the information stored in the fee - charging information list 310 , shown in fig3 . in order to collect service fees corresponding to advertising fees from a designated business , the fees charged to each business are stored beforehand on this list . specifically , the fee - charging information list 310 stores business name , fee amount , and fee payer information . fee payer information is , for example , the number of the bank account to be debited . fig1 a and 11b show that different fees have been established for each business . the cart storage unit 311 in fig3 stores cart name , category list , cart category and gift flag . the user chooses the cart name that he wishes . the category storage unit 311 stores the pre - prepared category list ( not shown ), and stores the designated category as the cart category . the gift flag is for indicating whether the cart is locked or not . if the cart is locked , the cart storage unit 311 also includes predetermined lock contents . when a predetermined transmission event occurs , such as a change to the permission list 136 or a change to the products in a cart , the cart contents are sent to the designated businesses . fig1 is a conceptual diagram showing the contents of a cart sent to a business . as the figure shows , the above information is compiled in xml format and the cart contents are converted into an xml file . this file contains the following information : the presentation address (“ address href ” tag in the figure ) that a business uses when presenting external information to a cart . the generated xml files are transmitted to the respective transmission addresses listed on the permission list . it should be noted that adjustments can be made to the items to be delivered to each business . for example , all the items shown in fig1 may be delivered to one business , but to another business , the permission_list tag portion , for example , may be excluded ; in other words , a working form of the present invention is possible such that the permission list is not delivered . the flow of processing performed by this online sales promotion system will be explained in detail while referring to the figures . fig1 a and 13b broadly show the flow of the overall online sales promotion system . fig1 a shows the cart display processing , and fig1 b shows the reception of external information processing flow . an explanation will first be given of the cart display processing shown fig1 a . in this example , when a browser on the user terminal 1 accesses a web site , the user cart as well as the web site are displayed . when the user indicates a url and requests access (# 1 ), the proxy 4 obtains information of the designated web site from a www server (# 2 ) . next , the proxy 4 requests the cart owned by the user from the cart server 3 (# 3 ) and acquires the cart (# 4 ). the proxy 4 supplies the browser with the web site information and the cart contents (# 5 ). when changes are made to the cart contents (# 6 ), those changes are sent from the proxy 4 to the cart server 3 (# 7 ), and the cart contents are rewritten . then , the new cart contents are supplied to the user terminal 1 via the proxy 4 (# 8 ; # 9 ), thereby updating the cart display on the user terminal 1 . next , the reception processing of external information will be explained ( fig1 b ). at a predetermined timing , notification of the cart contents is given to a designated business (# 21 ). this may occur , for example , when the permission list 136 is updated or the candidate product list 137 is changed . the designated business provides external information such as advertisements to the cart regarding which notification was given (# 22 ). the provided external information is held in the cart , notification of the contents of which has been made to the designated business (# 23 ). next the flow of processing performed by the cart server 3 will be explained , using a specific example . fig1 shows a flow chart outlining the main processing performed by the cart server 3 having the functions described above . in the main processing , the cart server 3 performs the presentation of cart contents , changes thereto and notification thereof to designated businesses , as well as the receipt of external information . steps s 1 , s 2 : the cart server 3 determines whether or not there is a cart 31 for a user attempting to access a web site ( s 1 ); if there is , the existing cart contents are provided to the user terminal 1 ( s 2 ). if that user has a plurality of carts , all the carts may be provided , or only the cart of accessed businesses that are designated businesses may be provided . there is no need to provide a cart each time a user accesses a web site . for example , it is fine to provide a cart only when a user accesses the web site of a predetermined business registered in the store database 33 . in such a case , the cart server 3 determines whether or not the accessed site is the site of said predetermined business . step s 3 : if a user does not have a cart , the control module 36 of the cart server 3 performs predetermined initialization processing to create a new cart . for example , the control module initializes predetermined storage regions such as the permission list 136 , the candidate product list 137 , the purchased product list 138 and the external information list 139 . it also gives the cart a cart id and updates the cart database . then it provides an empty cart to the user terminal 1 . an empty cart is displayed at the user terminal 1 . it should be noted that there is no need to always create a new cart when a user does not have a cart . for example , it is fine to provide a new cart only when a user accesses the web site of a predetermined business registered on the store database 33 . steps s 4 , s 5 , s 6 : when a user changes the products on the candidate product list 137 ( s 4 ), the output processing unit 313 updates the candidate product list 137 and transmits the new cart contents to designated businesses ( s 5 ). this happens , for example , when a user adds new product to the candidate products , or when he purchases a candidate product , or when he deletes a candidate product . the output processing unit 313 of each cart monitors for changes of cart contents , and when the candidate product list 137 is updated , transmits an xml document ( an example is shown in fig1 ) describing the new cart contents to designated businesses . this is sent to the transmission address of each designated business listed on the permission list 136 . the transmitted contents are stored in a memory device or the like that each business manages for itself . the output processing unit 313 also provides the new cart contents to the user terminal 1 via the proxy 4 when the candidate product list 137 is updated ( s 6 ). this causes the browser to display the new cart contents . it should be noted that while the cart contents to be sent to designated businesses are not necessarily restricted to xml format , an example is shown here in an xml format , which makes it easy for designated businesses to process and use the cart contents . a cart business and businesses registered in the store database need to reach an agreement beforehand regarding the tags of the xml to be transmitted and received and the contents of the data contained in each tag . a designated business looks at the cart contents that have been transmitted , creates external information such as advertising , and sends this to the cart server . this created external information may be standard advertising prepared for a product , or it may be advertising customized for each user . for example , when its own product has been selected a business may send a thank you message , and when a competitor &# 39 ; s product has been selected a business may send advertising emphasizing the superiority of its own product . steps s 7 , s 8 , s 9 : when external information such as an advertisement is sent from a business ( s 7 ), the output processing unit 313 of the cart to which that information was transmitted receives the external information via the communications interface 312 . next , the output processing unit 313 determines whether to hold the external information . the business is to send along with the external information , information identifying the business , such as store id and cart id . the output processing unit 313 can use the cart id and store id to determine whether the business is a designated business for that cart . if it is a designated business ( s 8 ), the output processing unit 313 holds that external information in the external information list 139 and updates the display of the cart contents ( s 9 ). while this is not shown in the figure , the new external information can be sent to designated businesses . steps s 10 , s 11 , s 12 : if the user adds a designated business to the permission list 136 , or deletes one therefrom ( s 10 ), the output processing unit 313 updates the permission list 136 . pursuant to this , the output processing unit 313 sends the cart contents to the designated businesses ( s 11 ), and supplies the new cart contents to the user ( s 12 ). if a designated business is deleted from the permission list 136 ( s 10 ), the deleted business is notified that it has been deleted from the permission list 136 . the former designated business , having received this notification , performs such processing as deleting that cart from the list of parties to which external information is provided , which the business itself administers . if a new business is added to the permission list 136 , a transmission address for sending cart contents to that business must be written to the permission list 136 . this address may be automatically generated by the cart based on a predetermined method , or it may be received from the business . in either case , the method of giving the transmission address must be determined beforehand by the business and the cart business . this is because the transmission address is an address for identifying a storage region that the business administers itself . steps s 13 , s 14 , s 15 , s 16 : when a user selects any of the candidate products and gives instruction for purchase ( s 13 ), the output processing unit 313 updates the candidate product list 137 and the purchased product list 138 ( s 14 ), and sends the new cart contents to designated businesses ( s 15 ). the output processing unit 313 also provides the user with the new cart contents ( s 16 ). the settlement information control unit 132 receives instructions from the user about which credit card to use in the settlement , and performs settlement processing according to instructions . by including the purchased product list 138 in the cart contents and sending the list 38 to designated businesses , designated businesses can avoid sending unnecessary advertisements concerning a purchased product , and can turn its marketing strategy , for example , toward advertising related products that the user might be interested in purchasing . steps s 17 , s 18 , s 19 , s 20 : when a user changes a cart name or category ( s 17 ), the output processing unit 313 establishes the cart name and category in the cart storage unit 311 ( s 18 ). next , the new cart contents are sent to a designated business ( s 19 ) and the new contents are provided to the user ( s 20 ). steps s 21 , s 22 , s 23 , s 24 : when a user “ taro ” designates another user , for example , “ jiro ,” and makes a gift of a cart , that cart is locked . specifically , for example , this means that the prospective products to be purchased in the cart cannot be changed , that an upper limit purchase amount is established , and that the number of articles that can be purchased is set . furthermore , the settlement information established by the previous owner of the cart , “ taro ,” is fixed , and the new owner , “ jiro ,” cannot see this information . in order to make possible the determination of whether or not a cart is locked , the gift flag region of each cart storage unit 311 is used . if the gift flag is on , that cart is deemed to be locked , and the output processing unit 313 will not accept any changes to predetermined information . after this , the control module 36 of the cart server 3 converts the user name in the cart database 32 to the designated other user name ( s 23 ), and the new cart contents are sent to designated businesses ( s 24 ). when the user “ jiro ” to whom the cart has been given designates and purchases a product , the settlement is carried out using the credit card of “ taro ,” the party that sent the gift . as long as the cart is displayed , the cart server 3 will repeat the processing of the above steps s 4 through s 24 , updating the cart contents , sending the same to designated businesses , and updating the display . in the processing shown in fig1 , the cart contents are sent to designated businesses when there has been a change to the cart contents ; however , this may be done at other times as well . for example , this can be done at a predetermined interval , when there have been instructions from a designated business , or when there have been instructions from the user . in addition to the main processing described above , it is preferable that the cart server 3 perform the processing below . the event extraction unit 133 extracts predetermined events from the cart and notifies designated businesses thereof . for example , when the number of candidate products reaches or falls below a predetermined number , or when the number of designated businesses reaches or falls below a certain number , the designated businesses are notified . in these cases , because it is anticipated that the user has a clearer idea of what he wants to purchase and that the time of purchase is nearing , this is valuable information for the designated businesses . the fee - charging information extraction unit 134 extracts events for which designated businesses should be charged a fee , and updates the fee - charging database 35 . examples of these events include when a designated business has provided external information to a cart , when external information has been provided to a user , when a candidate product has been purchased from a designated business . when these predetermined events occur , the fee - charging information extraction unit 134 refers to the fee - charging information list 310 , determines the amount to be charged and writes the charge amount in the entry for the pertinent businesses in the fee - charging database 35 . the fees are stored for each business in the fee - charging database 35 , and , for example , every month , the accumulated amounts are calculated and the resulting amount is debited from each business &# 39 ; s bank account designated for debiting . the incentive extraction unit 135 extracts events for which a user should be awarded bonuses , and awards incentives such as discounts on purchases and presents to users . examples of such events include when a designated business is newly added to the permission list 136 , when the number of designated businesses reaches or exceeds a predetermined number , when a product is purchased from a designated business . when such events occur , the incentive extraction unit 135 awards predetermined incentives to the user . in this embodiment , the incentive condition is that when a product is purchased from a business on the permission list 136 , a predetermined discount is given on the purchase of the product . this is to encourage the addition of businesses to the permission list 136 . the cart server 3 can use the publishing module 37 to analyze the contents of a cart , and provide the analysis results to the user and businesses . for example , information on the range of actual prices at which products have sold , the most common price , the highest price , the lowest price , and the ranks of businesses that have sold that product can be provided . the potential analysis is not limited to this ; to meet the needs of users and businesses , a wide variety of information can be analyzed , and the results of that analysis can be provided . the analysis results can , for example , be used by a user to determine whether or not the price proposed by a designated business is appropriate or not . additionally , a business will be able to obtain such information as the price at which competitors are selling a product , the price at which a product is actually selling , what the popular products are , etc . next , an explanation will be given of the processing performed by the proxy 4 , referring again to fig1 a . in order to simplify the explanation , an example will be used in which the processing displays a cart when a browser on the user terminal 1 has accessed a web site , and the web site and cart are displayed in separate windows . the proxy 4 , when the user has accessed a web site (# 1 ), acquires web site information from the www server (# 2 ) and acquires the user &# 39 ; s cart from the cart server 3 (# 3 , # 4 ). next , the proxy 4 processes the data so that both the acquired cart contents and the accessed web site are displayed simultaneously by the browser . specifically , the proxy 4 sends multi - framed data to the browser so that the web site and cart are displayed in separate frames (# 5 ). as shown , for example , in fig2 , a web site 201 and cart contents 202 are displayed by the user &# 39 ; s browser in multiple frames . next , the functions of the online sales promotion system relating to this embodiment will be explained using screen examples . fig1 a and 15b are examples of displays of cart contents . a cart name 151 , a cart category 152 , a permission list display 153 , a candidate product list display 154 and an external information list display 155 are shown . in fig1 a , the permission list display 153 and the candidate product list display 154 are displayed as text . the price displayed on the candidate product list display 154 is the price displayed on the web site of the e - commerce business or the catalog business . for example , the “ giant bear , 10 , 000 yen , kuma honpo ” on the candidate product list display 154 is the result of the user drag - and - dropping the 10 , 000 yen giant bear displayed on the kuma honpo web site into a cart . in fig1 a , the advertising that is external information is displayed in a balloon 155 for each product on the candidate product list 137 . this balloon 155 , for example , is displayed when the cursor is placed over a product displayed on the screen . also , the “ update button ” 156 of the permission list 136 and the “ purchase button ” 157 for candidate products are displayed . when a user activates the update button 156 , the update window , shown in fig1 c of the permission list 136 is displayed , and the permission list 136 can be updated . when the user selects a candidate product and activates the purchase button 157 , the settlement for the selected product is performed . in fig1 b , the permission list display 153 and the candidate product list display 154 are displayed as icons . the external information list display 155 is displayed below the candidate product list 137 in a separate window . in the permission list 136 update window shown in fig1 c , stores registered in the store database 33 are displayed in the “ store list .” by designating any business from the “ store list ” and activating the “ add button ,” a user registers that business as a “ cart recipient ” ( i . e ., on the permission list 136 ). also , by designating any business from the “ cart recipient ” list and activating the “ delete button ,” a user can remove a business from the permission list 136 . fig1 a and 16b are different examples of the display of cart contents . in fig1 a , both the permission list display 153 and the candidate product list display 154 are displayed as icons , and furthermore , the permission list display 153 is displayed in the form of a map . when the map displays the actual location of a store , it is easy for a user to understand where a business is actually located . even when the map displays a virtual city space , it is easy for a user to visually grasp the characteristics of a business listed on the permission list display 153 as seen from the user &# 39 ; s point of view . a map may display the layout of city space in a virtual space and / or make divisions in the virtual space categorized by type of store in the virtual space , or it may be city space laid out in a manner preferred by the user . in fig1 b , the permission list display 163 and the candidate product list display 154 are displayed mixed together . fig1 a is an example of a screen displayed when a cart name is changed . fig1 b is an example of a screen when a cart category is changed . for example , when the cart name and category name in the screen shots shown in fig1 a , 15 b , 16 a and 16 b are clicked , these windows are displayed . a user can choose any cart name that he wishes . the category name is selected from among such names on a predetermined category list . activating the arrow button in the field for inputting category name causes a pull - down menu for the category list to be displayed . fig1 a and 18b are examples in which candidate products and purchased products are displayed in a manner such that they are distinguishable . in fig1 a , a “ purchased ” mark appears next to the purchased items “ dolls , 2 .” in this figure , the manufacturer &# 39 ; s warranty is provided as external information . in fig1 b , purchased items are indicated by having the icons for those items covered with shading . in this figure , the manufacturer &# 39 ; s warranty is displayed in a separate frame . fig1 a and 19b show examples in which external information other than advertising is provided . in both figures , comments are displayed from a different user who purchased the same product . in fig1 a these comments are displayed in a balloon , and in fig1 b , in a separate frame . in such a manner , businesses can use the information they choose in order to encourage a user to make a purchase ; no particular restriction is placed on this information , which can also be receipts , manuals , and the like . fig2 a and 20b are examples of screens that can be shown when a cart is sent to another person as a gift . in fig2 a , a web site 201 for the store takatoriya and three frames for a cart 202 are displayed . this screen is an example in which , when a user has accessed the takatoriya web site , both the web site and the contents of the user &# 39 ; s cart are displayed on the same screen by the proxy 4 . to give a more detailed explanation , fig2 a shows a cart before transfer , in a case where two of the three gifts in the end - of - year gift corner have been selected as prospective gifts . premium nori and the laundry detergent pack have been selected . if , in this state , a send button 203 is activated , a screen ( not shown in figure ) for designating , for example , the gift recipient and the credit card to be used for settlement appears . the user can designate the gift recipient and the type of credit card . fig2 b is an example of a screen to be displayed to the user who is the recipient of the cart . the two products selected by the sender are displayed as candidate products . in addition , an advertisement that has come from the supplier of one of the products is shown . when the user selects the laundry detergent pack and activates a decision button 204 , settlement will be performed using the credit card designated by the sender . fig2 a and 21b show examples of screens in which the schedule column for one day forms a cart . at the very bottom of the window in this screen example , a permission list 211 is displayed . a user , by inputting “?→” after a set of characters , writes a request to the schedule column . in the example of fig2 a , the user is requesting an early morning seat on the bullet train and lodgings for that date . businesses on the permission list 211 see this cart and make proposals for lodgings and bullet train tickets . fig2 b is an example of a screen in which a proposal from a business is displayed . in this figure , the proposal and the business making the proposal are displayed in the portion of the schedule regarding which the request was made . a user can select proposals one by one , or he can purchase a set of proposals all at once . when the desired product in this screen is selected and a purchase button 212 is activated , the screen shown in fig2 appears . fig2 shows an example of a screen after a user has purchased lodgings and transportation tickets . the purchased products are displayed in a position in the schedule corresponding to those products . fig2 shows an example of a screen in which a cart is used for an online auction . when a buyer places into a single cart a plurality of products that he desires , the seller of that plurality of products can propose a discount to the user for purchasing more than one item . in such a case , the permission list 136 is fixed by the owner of the auction site . fig2 is an example of the display of analysis information provided by the cart server 3 . in this figure , number of units sold , lowest price , highest price , most common price , and store rankings are displayed for each article . information relating to products registered on the candidate product list may be extracted from the created analysis information , and distributed to users ′ carts as external information . this makes it possible for a user to objectively determine whether current proposals from businesses are beneficial to him , thus heightening a user &# 39 ; s desire to make a purchase . next , figures will be used to explain an online sales promotion system relating to a second embodiment of the present invention . fig2 is an overall block diagram of an online sales promotion system relating to the second embodiment . in this embodiment , no cart server 3 is provided , but a cart client having similar functions to the cart server 3 is provided at each user terminal 1 . it is also conceivable that instead of loading a cart client at the user terminal 1 , the functions of the cart client can be packaged as a plug - in to the www . in such a case , the cart client functions would be downloaded together with web pages . for example , if a user accesses a web site corresponding to an online shopping cart , while the user is viewing that web site , an online shopping cart will be continuously displayed as part of those pages . even if the user leaves the web site , when he returns to the site , the cart will reappear with the contents that it had prior to the user &# 39 ; s leaving . fig2 is an example of a screen displayed when a user accesses a web page that has a cart client packaged as a plug - in . as with fig2 , the web page and the cart contents are displayed in multiple frames . ( a ) when a new cart is created in the above embodiments , predetermined default values may be set up for the permission list , cart name and cart category . predetermined default values may also be set for the candidate product list , the purchased product list , the external information list , and the permission list . ( b ) in the above embodiments , the cart contents and the web page are displayed in separate frames , but other display formations may be used . for example , it is possible to display these in the form of banner ads embedded in web pages . ( c ) in the above embodiments , the ad ids are not displayed , but these may be displayed as part of the cart contents . for example , a user can give notification of an ad id and make an inquiry to a business regarding an id . ( d ) the recording media on which a program that executes that above methods of the present invention are included in the present invention . these media include , but are not limited to , computer - readable and writable floppy diskettes , hard disks , semiconductor memory , cd - roms , dvds , and mo disks . by using this invention , a user can show to businesses the user designated contents of a cart , and can receive additional information , such as advertisements , from those businesses . the user can receive information from businesses he trusts about products in which he is interested . businesses can know in what products a user is interested , thus , they are able to employ more effective marketing strategies . while only selected embodiments have been chosen to illustrate the present invention , to those skilled in the art it will be apparent from this disclosure that various changes and modifications can be made herein without departing from the scope of the invention as defined in the appended claims . furthermore , the foregoing description of the embodiments set forth in the present invention is provided for illustration only , and not for the purpose of limiting the invention as defined by the appended claims and their equivalents . | 6 |
although specific embodiments of the present invention will now be described with reference to the drawings , it should be understood that such embodiments are by way of example only and merely illustrative of but a small number of the many possible specific embodiments which can represent applications of the principles of the present invention . various changes and modifications obvious to one skilled in the art to which the present invention pertains are deemed to be within the spirit , scope and contemplation of the present invention as further defined in the appended claims . referring to fig2 through 6 , there is illustrated the present invention portable target 490 for use with a soccer goal . specifically , the present invention comprises a flexible frame 500 . a preferred embodiment of the flexible frame 500 is to be generally square or rectangular in shape having an upper wall 510 with a top edge 512 , a parallel lower wall 520 with a bottom edge 522 , a first longitudinal side wall 530 with a first lengthwise side 532 , and a second longitudinal side wall 540 with a second lengthwise side 542 which enclose the interior target 600 which can either be rectangular , square , circular , oval or any other desired shape . the preferred material for the target frame 500 is a flexible fabric material although it is within the spirit and scope of the present invention for the target frame 500 to be made of any other portable light weight but strong material . the frame 500 contains an interior channel on either lengthwise side . referring to fig4 , first side wall 530 contains an interior lengthwise channel 700 which extends from the top edge 512 of upper wall 510 to the bottom edge 522 of lower wall 520 with the channel 700 extending through the entire vertical length “ l1 ” of the first longitudinal section 530 . similarly , there is a parallel oppositely disposed second interior channel 800 which extends from the top edge 512 of the upper wall 512 to the bottom edge 522 of the lower wall 520 with the channel 800 extending through the entire vertical length “ l1 ” of the second longitudinal section 520 . by way of example , the exterior dimensions of the frame 500 can be a height or length “ l1 ” of approximately 41 inches and a width “ w1 ” of approximately 36 inches . the interior target can have a height or length “ l2 ” of approximately 29 inches and a width of approximately 27½ inches . this is assuming that the soccer goalpost itself has a horizontal width “ w3 ” of approximately 24 feet and has a height “ h1 ” of approximately 8 feet . received within each channel 700 and 800 is a connecting rod 900 . referring to fig6 and 7 , to facilitate portability of the target and its connecting rods , the connecting rod 900 is preferably made in at least two separate sections such as a first section 910 and a second section 920 which can be interconnected by mating fastening members . by way of example , first section 910 can have a threads 902 at one distal end 904 and the second section 920 can have a connecting member 924 having internal female threads 926 to receive the threads 902 from first section 910 so that the two sections of the connecting rod 900 can be rotatably affixed together . connected at the proximal end 906 of first connecting rod section 910 is a flexible connecting member 908 which receives a curved hook retaining member 940 . at its proximal end 930 the hook retaining member 940 is retained onto the connecting member 908 by rivets or other affixation means . the hook retaining member 940 comprises a generally arc shaped section 950 which terminates in a rounded transverse tip 960 . the curved retaining hook 940 has an interior retaining opening 970 which is surrounded for approximately three quarters of its circumference by arc shaped section 950 . an opening 980 between transverse tip 960 and proximal end 930 leads to interior retaining opening 970 . this illustration assumes that the top horizontal crossbar 110 of the soccer goalpost is round . it will be appreciated that the top horizontal crossbar 110 of the soccer goalpost can have any cross - sectional shape which includes round , square , rectangular etc . therefore , the hook retaining member 940 will have a section 950 which has a shape which conforms to the cross - sectional shape of the top horizontal crossbar 110 of the soccer goalpost . one key aspect of the present invention is the design of the hook member 940 . currently , the hook is made of metal which is thin enough to allow it to bend ( flexible ) to expand when needed to be pulled or snapped over the top horizontal crossbar 110 of the soccer goalpost 100 when in use or released or pushed off the top crossbar after use , whether the crossbar is round , square or even rectangular . soccer goal posts are manufactured with round bars , square bars and even rectangular bars . furthermore , the diameter of the bars being used to construct the soccer goals are varying dimensions . therefore , the interior section 950 of the hook 940 will have a diameter that conforms to the cross - sectional shape of the horizontal crossbar so that it can be snapped in place over the horizontal crossbar . the transverse lip 960 on the end of the hook of the flexibility of the metal together allow the target to be used on types and sizes of soccer goals . as illustrated in fig4 , a first connecting rod 900 has its bottom end 922 resting adjacent lower edge 522 and extends the entire length “ l1 ” of channel 700 . an interior lengthwise wall 534 encloses the length of channel 700 so that first connecting rod 900 rests within channel 700 between first side wall 932 and interior lengthwise wall 934 . the channel 700 has a top opening 710 extending out of top edge 512 so that the distal end 906 of rod section 910 extends out of the opening 710 so that hook retaining member 940 is positioned above top end 512 of top edge 510 of frame 500 . as illustrated in fig4 , a second identical connecting rod 900 has its bottom end 922 resting adjacent lower edge 522 and extends the entire length “ l1 ” of channel 800 . an interior lengthwise wall 544 encloses the length of channel 800 so that second identical connecting rod 900 rests within channel 800 between second side wall 942 and interior lengthwise wall 944 . the channel 800 has a top opening 810 extending out of top edge 512 so that the distal end 906 of rod section 910 extends out of the opening 810 so that hook retaining member 940 is positioned above top end 512 of top edge 510 of frame 500 . the flexible material of the frame 500 is sufficient tight so that the connecting rods 900 are retained by a press fit within the respective channels 700 and 800 of frame 500 . it is also within the spirit and scope of the present invention to have additional fastening members at the top of connecting rod 900 to fasten the connecting rods to the frame 500 . the entire apparatus in illustrated in place on a soccer goal in fig1 . the soccer goal 100 comprises a first vertical post 120 , a second vertical post 130 and an upper horizontal crossbar 110 . horizontal crossbar 100 has a first end 112 and a second end 114 . first vertical post 120 has a top end 122 and a bottom end 124 . second vertical post 130 has a top end 132 and a bottom end 134 . the soccer goal 100 also includes a first transverse bottom wall 126 having a front end 125 and a rear end 127 . the soccer goal 100 also includes a second transverse bottom wall 136 having a front end 125 and a rear end 137 . the soccer goal 100 also includes a lower horizontal wall 116 having a first end 115 and a second end 117 . top horizontal crossbar 110 is connected at its first end 112 to the top end 122 of first vertical post 120 and connected at its second end 114 to the top end 132 of second vertical post 130 . lower horizontal wall 116 is connected at its first end 115 to rear end 127 of first transverse bottom wall 126 and connected at its second end 117 to the rear end 137 of second transverse bottom wall 136 . the first vertical post 120 is connected at its bottom end 124 to front end 125 of first transverse bottom wall 126 and second vertical post 130 is connected at its bottom end 134 to the front end 135 of second transverse bottom wall 136 . the soccer net 150 is retained by top horizontal crossbar 110 , first vertical post 110 , first transverse bottom wall 126 , second vertical post 130 , second transverse bottom wall 136 , and lower horizontal wall 116 . a goalie 200 is shown in position in front of the soccer goal 100 . the present invention portable target 490 is removably affixed to the top crossbar 110 of the soccer goal 100 by an individual standing on the ground and lifting the frame 500 of the portable target 490 so that the curved hook sections 540 of each of the connecting rods 900 extends above the upper crossbar 110 and the rounded transverse tip 960 of each of the curved hook second 540 is placed over the top horizontal crossbar 110 . entry into the interior retaining opening 570 is gained by passing opening 580 over top horizontal crossbar 110 with the rounded transverse tip 960 facilitating passage of the opening 970 over the top horizontal cross - bar 100 so that the horizontal crossbar rests within interior retaining opening 970 of each curved hook section 940 of each retaining rod 900 . in fig1 , the curved hook sections 940 are oriented so that the rounded transverse tip faces the front of the soccer goal 100 . it is also within the spirit and scope of the present invention for the target 490 to be orientated in the opposite way so that the rounded transverse tip 960 faces the rear of the soccer goal 100 . once the rounded tips 960 come in contact with the top horizontal crossbar 110 of the soccer goal 100 , it is easy to slip the curved hook sections 940 over the top of the top horizontal crossbar 110 and have them remain in place . the rounded interior 970 of each curved connecting hook 940 easily accommodates the top crossbar 110 of the soccer goal 100 . the benefit of the present invention is that an individual does not have to stand on a ladder or any other elevated structure but can stand on the ground and lift the portable target 490 so that the connecting hooks 940 of the connecting rods 900 rise over the top crossbar 110 and then the target 490 is lowered so that the connecting hooks 940 can be lowered over the top horizontal crossbar of the soccer goal 100 and rest in place . the present invention enables even a child in addition to an adult to easily place and remove the soccer goal over the horizontal crossbar of a soccer net . therefore , this target can be used by children and adults of all ages . even a child can easily assemble the target and then hold the target from the bottom of the poles and lift it into place over any size goal without any assistance and when finished , be able to push the target off the crossbar and disassemble the target and place it back into a carrying bag . a further benefit of the present invention is that the targets 490 can be located in the upper right quadrant and the upper left quadrant of a soccer goal 100 so that the interior target 600 is presented at these locations which are the most difficult locations for a goalie to defend . by being able to quickly and removably affix the target 490 in this manner , practice can be done at any time even immediately before a game since the target 490 can be quickly removed right before the game starts . the individual practices kicking a soccer ball through the interior target 600 . in fig1 targets 490 are illustrated in both the upper right quadrant and the upper left quadrant . in general , only one target 490 is used and positioned at either of these locations . however , it is within the spirit and scope of the present invention for the present invention to have two or more targets in use at the same time . the target 490 can be located at any location on the top horizontal crossbar . of course the present invention is not intended to be restricted to any particular form or arrangement , or any specific embodiment , or any specific use , disclosed herein ; since the same may be modified in various particulars or relations without departing from the spirit or scope of the claimed invention hereinabove shown and described of which the apparatus or method shown is intended only for illustration and disclosure of an operative embodiment and not to show all of the various forms or modifications in which this invention might be embodied or operated . | 0 |
fig1 shows an exposure system 10 which uses a glass plate 11 resting on two rulers 12 . the weight of the glass plate will cause the glass plate 11 to bend when placed on the rulers 12 . the deformation of the glass plate caused by the weight is easy to calculate and can be corrected for . the glass plate 11 is provided with a pattern arranged on the downwards pointing surface 13 resting on the rulers 12 . a light source 14 emits light 15 onto the glass plate 11 and the pattern arranged on the surface 13 of the glass plate 11 will produce a copy of the pattern on a substrate 16 . the substrate 16 could be a tft intended for a tv monitor . normally , the pattern is transferred to the substrate 16 in a one - to - one relationship . other necessary optics is not shown in fig1 , since the purpose of the figure is to describe the function principals , rather than a complete exposure system . fig2 shows a pattern generating apparatus 20 , which also could be used as a measuring apparatus , including means to write a pattern 21 , e . g . mirrors directing a laser beam from a laser , and means 22 to measure the height h z between the apparatus 20 and a glass plate 11 with the surface 13 on which the pattern is to be written is placed upwards on a support 23 , so called stage . the pattern writing means 21 may be translated over the entire surface of the stage , which movement may be implemented in a number of ways . fig2 illustrates one way where the stage is provided with means to move it in relation to the pattern writing means 21 in the x direction , and where the pattern writing means 21 is attached to a sliding support 24 arranged on a beam 25 to move the pattern writing means in the y direction . other possible ways to implement the translation of the pattern writing means is to provide the means to move the stage in both x and y direction with a non - moving pattern writing means , or the pattern writing means could be provided with means to move in both x and y direction with a non - moving stage . the apparatus 20 is also provided with an angled foot plate 26 arranged a constant distance above the surface 13 of the glass plate 11 by means of an air cushion 27 . the foot plate 26 and the pattern writing means 21 are attached to the sliding support 24 via a flexible attachment 28 , to allow the distance between the sliding support 24 and the pattern writing means / foot plate to vary dependent on the roughness of the surface 13 of the glass plate 11 . the varying distance in the z direction , i . e . the height h z , may be measured to calculate the roughness of the surface 13 in the z direction . the size of the foot plate that is parallel to the surface 13 of the glass plate 11 has an opening for a laser beam from the pattern writing means 21 and is preferably rather large , e . g . 5 mm on each side , since the purpose of the measurement is to detect deviations in height over a relatively large distance . the air cushion beneath foot plate will act as an auto focus device for the pattern generating apparatus due to the constant distance between the foot plate and the glass plate . the invention should however not be limited to this kind of pattern generating apparatus using an air cushion as an auto focus device , but other types of systems that will provide focus for the system could be used . the essential part is that the apparatus 20 is provided with means to measure the height h z between the apparatus and the surface 13 of the glass plate 11 and thereby the variation in height when the pattern writing means 21 is moved in relationship to the stage 23 , and thus the surface 13 . an essential part of the invention is to determine a reference surface against which the difference in height h z is calculated . this difference is denoted h , as is illustrated in connection with fig3 . the reference surface could have any desired shape as long as the shape of the reference surface is maintained unchanged . preferably , the shape of the reference surface is a flat plane . if it were possible , it may have been desirable to use the “ free ” ( non gravity ) form , i . e . the centre line of the plate as a reference surface , which is rather difficult to achieve in practise . the bottom surface of the plate is not a good alternative for a reference surface since a stepper or an aligner use the top surface as a reference . on the other hand if the top surface would be used as a reference surface , there is an additional need to know the bottom shape of the plate and the shape of the support . the shape of the support may be obtained , but it is very difficult to achieve knowledge of the bottom surface in practice . the top surface may however be measured without the knowledge of the bottom surface . a large glass plate that is placed on a three - foot will be deformed due to the weight of the plate , but a deformation function for a perfect plate may be calculated if the thickness of the plate , the material of the plate and the configuration of the three - foot are known . a measurement of the non - perfect glass plate , when placed on the three - foot , will generate a measurement of the deformed plate . the shape of top surface is then calculated by subtraction the calculated deformation function for a perfect plate from the measurement of the deformed plate . the top surface of a glass plate is normally much more even , i . e . less variation in height in relation to the centre line , compared to the bottom surface , and the best compromise should therefore be to make the top surface of the plate to be the reference surface . it should however be noted that it is not evident that the top surface is the best choice due to the deformation of the glass plate during the following step in the exposure system , as shown in fig1 . if the top surface 13 of the glass plate exhibits variations close to the position where it rests on the rulers 12 , the pattern on the surface 13 will be distorted in a vicinity of the rulers 12 . it should however be noted that any surface may be used as reference surface , although the top side is preferred . fig3 illustrates the plate bending effect for a glass plate 11 having a thickness t . a reference surface 30 is determined , in this example the reference surface is flat , and the glass plate is divided into several measurement points 31 and the height h z is measured at each measurement point by the means 22 shown in fig2 . the height h between the reference plane 30 and the deformed surface 13 of the glass plane 11 can easily be calculated by subtracting the height of the reference surface 30 at the measurement point from the height h z measured for the surface 13 of the glass plate 11 by the apparatus 20 . a local offset d ( as a function of x and y ) is thereafter calculated for each measurement point and depends on three variables : the thickness of the glass plate ( t ), the distance between adjacent measurement points ( p ) and the measured height ( h ) between the reference surface 30 and the surface 13 of the glass plate 11 . the local offset should be interpreted as the position deviation from the position where a pattern should be written in relationship to the reference surface , as described in connection with fig4 - 6 . the pitch p on the surface of the plate differs from the nominal pitch p nom on the reference surface . the distance between adjacent measurement points should not exceed a predetermined distance , which is dependent on the required accuracy for the measurement to get a reasonable good result from the measurement . an example of maximum distance between adjacent measurement points is 50 mm if the thickness of the glass plate 11 is around 10 mm and the glass plate material is quartz . the distance between adjacent measurement points also vary dependent on the thickness of the glass plate to obtain the same measurement accuracy . the variations in thickness of the glass plate is may be around 10 - 15 μm , but could be larger . the measurement points could be randomly distributed across the surface 13 , but are preferably arranged in a grid structure with a predetermined distance between each point , i . e . pitch , that is not necessarily the same in the x and y direction . the local offset is a function of the gradient in x and y direction at each measurement point and could be calculated using very simple expressions . an angle α may be calculated from the measured height h provided the distance p between two adjacent measurement points 31 a is known . furthermore the local offset d may be calculated provided a is small using the formula : it should however be noted that the formula for calculating the local offset d above , only is a non - limiting example of a calculation to determine the offset d . the gradient in each measurement point could be directly measured by the system and the local offset is proportional to the gradient and the thickness of the plate . as previously mentioned above , fig3 illustrates the bending effect in one dimension , but the local offset d is a 2 - dimensional function of the derivative in each measurement point ( dx and dy ). as a non - limiting example we assume that the distance between two adjacent points 31 is 40 mm , the thickness of the glass plate is 10 mm , and that the measured height h is 1 μm , which will result in a one - dimensional local offset d of 125 nm . fig4 a and 4 b illustrate the plate bending effect a glass plate 41 with a flat top surface 43 and a shaped bottom surface 42 and the introduction of a reference surface 44 , which is flat in this example , when supported by a flat support 45 . when the glass plate 41 is arranged on the flat support 45 , the shape of the top surface 43 is changed and the bottom surface 42 will generally follow the flat support 45 . the result of this is that the pattern generated , illustrated by the dots 46 on the top surface , has to be expanded to obtain a correct reference surface . fig5 a and 5 b illustrate the plate bending effect a glass plate 51 with a shaped top surface 53 and a flat bottom surface 52 and the introduction of a reference surface 44 , which is flat in this example , when arranged on a flat support 45 . when the glass plate 51 is arranged on the flat support 45 , the shape of the top surface 43 is unchanged and the bottom surface 42 will follow the flat support 45 . the pattern generated , illustrated by the dots 55 on the top surface , has to be expanded to obtain a correct reference surface , since the top surface will be flattened out when positioned in the exposure equipment as described in fig1 , at least in the vicinity of the rulers 12 . the part of the glass plate positioned right between the rulers 12 will be deformed . furthermore the rulers will deform the pattern on the glass plate unless the shape of the rulers 12 is in accordance with the shape of the reference surface . fig6 a and 6 b illustrate the plate bending effect a glass plate 61 with a flat top surface 43 and a flat bottom surface 52 and the introduction of a reference surface 44 , which is flat in this example , when arranged on a shaped support 62 . when the glass plate 61 is arranged on the shaped support 62 , the shape of the top surface 43 is changed and the bottom surface 42 will generally follow the shaped support 62 . the pattern generated , illustrated by the dots 64 on the top surface , has to be expanded to obtain a correct reference surface , since the top surface will be flattened out when positioned in the exposure equipment as described in fig1 . fig4 a - 4 b , 5 a - 5 b and 6 a - 6 b illustrate extreme conditions and in reality all three variations are present during the process of writing a pattern on a glass plate . the overall error is however much smaller since all errors from the bottom surface , support surface and contamination , see fig8 a and 9 b , are eliminated or at least reduced . fig7 a shows measured x - y coordinates of a reference glass plate and compensated x - y coordinates of the same reference glass plate using a calculated correction function according to the present invention . fig7 b shows the measured height h ( z correction data ) obtained at the same time as the x and y coordinates for marks depicted on the surface of the reference glass plate . fig7 c shows the difference between the measurements without compensation and the measurements with compensation . the size of the glass plate is in this example 800 × 800 mm , and the distance between each dashed line 70 in fig7 a is 50 mm , and the scale of the deviation of the two plotted charts are 500 nm between each dashed line 70 . the grey lines 71 correspond to the measured deviation of the x and y coordinate on the reference glass plate . the black lines 72 correspond to the compensated x and y coordinates of the same reference glass plate using the z correction effect based on the measured height h shown in fig7 b . the minimum height is − 20 . 705 μm and the maximum height is + 16 . 664 μm compared to the determined reference surface and the height h is depicted as a function 73 . the distance between the lines in x and y direction is the same as in fig7 a , i . e . 50 mm , and the distance between the lines in z direction is 2 μm . fig7 c clearly illustrates the deviations between the two functions in fig7 a . when comparing the measured height h in fig7 b with the deviation in fig7 c it is easy to see the relationship between the derivative of the height and the local offset . when the derivative of the height is zero , as in position 74 , then the local offset d is zero . when the derivative of the height is high , as in position 75 , then the local offset d is large . a transition from a low h value to high h value corresponds to that the glass plate has a “ negative ” bend , as illustrated in fig3 , and vice versa . the calculated local offset , i . e . the difference between the grey and the black lines is largest when the change of the derivative of the height h in x and y direction is the highest . fig8 shows a three - dimensional measurement 80 of a glass plate with two present particles , placed between the plate and the support , having a height of 16 μm and 6 μm , respectively . the measurement was performed using a grid structure and the distance between the measurement points was set to 50 mm and the thickness of the plate was 10 mm . the scale in z direction was set to 2 μm per division . the presence of the large particle causes the x and y measurement illustrated in fig9 a to deviate more than 500 nm . fig9 a shows measured x - y coordinates of the glass plate illustrated in fig8 , and fig9 b shows the compensated x - y coordinates of the same glass plate using the correction function calculated from the measured deviating height measurement in fig8 . the effect of particles will be greatly reduced on the final image generated on the glass plate as is illustrated in fig9 b . although a glass plate has been used as an illustrative example in the patent application , the scope of the claims should not be limited to a plate made of glass . furthermore , the pattern generating apparatus could of course include correction functions for any repeatable error , e . g . errors present in substrates for the manufacturing of tft - arrays that are introduced in the substrates during the manufacture of the substrates , as well as repeatable errors introduced in the manufacturing process in the aligner , or stepper as previously mentioned . the method may naturally be implemented into a computer program for performing the measurements , and calculating the local offset for each measurement point . | 6 |
the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . like numbers refer to like elements throughout . in the figures , certain regions or components may be exaggerated for clarity . generally described , the present invention is directed to power exhaust stacks for computers . the power exhaust stacks are configured to be visually dominant and visible during use of the computer to emphasize the power available in the operating system of the computer . preferably , the power exhaust stacks are mountable to the top of computer casing or housing to direct the hot air out of the top of the computer housing ( to a certain extent taking advantage of the fact that hot air rises ). alternatively , the power exhaust stacks can be mounted proximate the top of the housing , such as on upper portions of the side walls . in any event , the power exhaust stacks can be combined with one or more proximately - positioned exhaust fans to provide power exhaust systems for one or more of oem ( original equipment manufacturers ) and after - market users . turning now to fig1 one embodiment of a computer 10 having a power exhaust stack 15 mounted onto a computer housing 20 is shown . the computer housing 20 is preferably a “ tower style ” personal computer housing . as such , it includes at least one wall which , together with an overlying ceiling defines an enclosure space for holding the electronic components of the computer . this computer housing can be rectangular , triangulated , cylindrical , oval , or otherwise configured . as shown in fig1 - 3 , the computer housing 20 is substantially rectangular and includes four upstanding walls 22 , 23 , 24 , 25 and a ceiling 21 or top overlying the four walls . as shown , the four walls include a front wall 22 , rear wall 25 , and two opposing side walls 23 , 24 . the front wall 22 typically includes the cd and floppy / hard disc drives 22 a , 22 b located thereon . of course , other drives , ports , or operating buttons can also be located as desired on this surface . as shown in fig3 the rear wall 25 holds the power port 25 a and other connector ports 25 b . it can also include one or more exhaust fans 26 mounted thereon to assist in the ventilation or exhaust of the heat from the computer housing 20 . the computer housing 20 can also include air intake fans positioned to help increase air circulation ( not shown ). preferably , the computer housing 20 includes at one least air inlet port 20 p therein ( either with or without an associated intake fan ). as shown , in fig1 the computer housing 20 includes at least one air inlet port 20 p formed in lower portions of opposing side walls 23 , 24 of the computer housing . as is shown in fig2 in a preferred embodiment , there are at least two corresponding air inlet ports 20 p on each of the side walls 23 , 24 ( the opposing side wall 24 being configured substantially the same as the side wall 23 shown in fig2 ). as shown , the four inlet ports 20 p have about a 1 . 0 inch to a 1 . 5 inch diameter . of course , other aperture configurations , shapes , and arrangements as well as numbers of air inlet ports ( lesser or greater ) can also be employed . for example , as shown in fig1 b and 11c , a single elongated air inlet port 20 p can be employed . filters 20 f to filter or inhibit the intake of particulate matter and / or dust into the computer housing 20 can also be employed . the filters 20 f can be positioned to overlay the opening in the inlet port such as via attachment to an inner surface of the side walls or the outer surface of the side walls 23 , 24 proximate to the air inlet ports 20 p . in a preferred embodiment , they are formed in an externally accessible grommet 20 g to define a filter assembly 20 a which can be easily inserted and removed from the exterior of the housing 20 to replace or clean the filter 20 f at desired intervals . for unitary body grommets , the 20 f is typically attached to an exterior surface prior to assembly to the housing to allow the grommet 20 g to be popped into the air inlet port from the outside of the housing without obstruction or interference therefrom ( the inside portion of the grommet yields as it slides into position over the port ). as shown in fig2 and 5a , the grommet 20 g is configured and sized to securely reside on the circumference of the air inlet port 20 p . the filter 20 f can be configured as a fine metal mesh filter which is preferably configured to allow sufficient amounts of air to be drawn into the housing during operation while inhibiting the migration or introduction of dust , hair , or other particulate matter or larger sized foreign objects into the computer housing 20 . it is preferred that the filter be configured as a micron rated filter to inhibit micron - sized matter from entering the computer . preferably , as shown in fig1 and 4 , the power exhaust stack 15 is a tubular member which is mounted to the top or ceiling 21 of the computer housing 20 . although shown with a substantially circular or round cross - section , the power exhaust stack tubular member can be otherwise configured , such as with a rectangular , oval , square , or other external and / or internal shape ( s ) which provides an inner hollow portion which defines at least one air flow channel 35 therein . as such , the power exhaust stack 15 defines the air flow channel 35 which directs air out from the ceiling 21 ( and above and away from ) the computer housing 20 . as shown in fig4 in this embodiment , the power exhaust stack 15 extends upwardly from the ceiling 21 and has a profile when viewed from the side which rises a distance up from the ceiling 21 and arcuately turns to direct the air flow channel 35 toward the rear of the computer housing 20 . as is also shown in fig4 the computer 10 includes an exhaust fan 30 which is mounted such that it is proximate to the air flow channel 35 . preferably , as shown , the exhaust fan 30 is mounted onto the ceiling 21 . as shown in fig5 a , for computer housings 20 which have an underlying skeleton cage 20 sk to which the outer side walls 23 , 24 and ceiling 21 are attached , the exhaust fan 30 can be mounted to the top of the skeleton cage 20 sk such that , after assembly , it is proximate to an opening 21 o formed in the ceiling 21 and positioned to be in fluid communication with the air flow channel 35 of the power exhaust stack 15 . as shown in fig5 a ( and available in certain conventional computer models ), the skeleton cage 20 sk includes upper mounting prongs 21 k onto which the ceiling which has matable portions ( shown in dotted line as elements 21 m in fig5 c - 5 d ) formed on the inside of the downwardly extending inner sidewalls 21 w slides into and locks to thereby secure the ceiling to skeleton cage 20 sk . [ 0053 ] fig5 a also shows that , in this embodiment , the exhaust fan 30 is configured to mount to the top of the skeleton cage 20 sk such that it extends a distance upwardly and out of the ceiling 21 of the housing . a seal 60 surrounds the perimeter of the fan 30 and attaches the exhaust stack 15 to the computer housing in a substantially air - tight manner . fig5 c - 5 e illustrate an assembly sequence for the embodiment of the invention shown in fig5 a . as shown in fig5 c , the exhaust fan 30 is separated such that fan blades 31 ( shown as a lightweight plastic integral blade assembly ) are removed from the shaft 32 held on the fan body 30 b . the fan body 30 b is mounted to the top of the skeleton cage 20 sk such that the fan shaft 32 is oriented upwardly and aligned with the opening in the ceiling 21 o . the ceiling 21 is then pushed downward and then over to laterally slide such that inner sidewall mating portions 21 m engage and mate with the mounting protrusions 21 sk to lock into position . by removing the fan blades 31 , the shaft 32 is narrow enough ( even if it extends a distance above the ceiling ) within the opening 21 o to provide sufficient clearance to allow the ceiling 21 to be manipulated thereabout . if one were to leave the fan blade 32 mounted to the fan body in this embodiment , the upper portion of the fan would block the lateral movement within the closed perimeter of the circular opening needed to allow the sliding engagement with the skeleton cage . as shown in fig5 e , once the ceiling 21 is locked into position , the fan blades 32 can be reattached ( either before or after the seal 60 is mounted to the ceiling ) but preferably before the stack is mounted thereon . the seal is preferably adhesively secured to the top of the ceiling 21 , thus , once secured to the housing remains in place . to gain entry to the housing subsequent to the assembly , one can remove the power exhaust stack 15 , and pry the fan blades 32 of the shaft 31 to be able to slide the ceiling 21 off the mounting portions 21 sk . in any event , as shown in fig4 the exhaust fan 30 is mounted proximate to the ceiling 21 such that it is in fluid communication with the first end portion 15 f of the power exhaust stack 15 . during operation , as shown in fig5 b , ambient air enters the air inlet ports 20 p and travels up through the housing ( through the second tier 20 t in housings 20 having dual tiers , as shown ). the air is then drawn up by action of the exhaust fan on top of the housing 20 . the exhaust fan 30 then directs air out from the computer housing 20 through the power exhaust stack 15 . preferably , for single power exhaust fan configurations , the exhaust fan 30 is configured to operate at a rate of about 30 - 80 cubic feet of air per minute ( cfm ), and more preferably from about 50 - 70 cfm . in operation , the power exhaust stack 15 and exhaust fan 30 can generate an audible “ whoosh ”, particularly at initial activation , as the air is forced up and out of the computer housing 20 which audibly affirms the power of the device . as shown in fig3 the power exhaust stack and exhaust fan are supplemental to a conventional air exhaust system 26 , and can be run concurrent with operation of the computer , or can be intermittently , or selectively , operated , such as only when using problematic heat generating components like during the playing of action and / or graphic - intense games . a computer program icon representing the supplemental power exhaust system can be loaded onto the desktop such as found on a windows ® or macintosh ® based computer operating system for user selectable software controlled operation . of course , heat sensors can be located within the housing at suitable locations to measure and represent the heat profile therein . for example , one or more sensors can be located proximate the graphics board ( s ), motherboard , or microprocessor in the housing . accordingly , feedback to a controller indicating operating temperatures have exceeded recommended levels can act to automatically activate the power exhaust system . alternatively , or additionally , a “ software ” trigger can be operably associated with pre - identified or computer programs coded and “ tagged ” as high energy software applications to activate the power exhaust system upon active selection of the tagged software program . alternatively , the device can be manually activated and disabled as desired . turning again to preferred configurations , the instant invention can also employ one or more exhaust filters which can be located ( preferably proximate the second end portion 15 s of the power exhaust stack 15 ) in the power exhaust stack 15 so that it extends across the flow channel 35 ( not shown ). as the air exits the air flow channel 35 , this filter is not concerned so much with the intake of dust , but rather the introduction of foreign objects such as toys , coins , or children &# 39 ; s hands . as such , a larger mesh filter configuration can be employed . in addition , it is preferred that the exhaust filters be recessed a short distance from the second end portion 15 s of the stack so as to not to interfere with the exterior appearance of the stack , while also reducing the distance a foreign object can readily enter into the exhaust stack . similarly , the computer 10 can also or alternatively include a cap or lid 40 hinged or pivotably mounted to an end portion of the power exhaust stack 15 , such as shown in fig7 a . the cap 40 is preferably configured as a light - weight component to reduce the interference with the flow of air in the air flow channel . the hinge 45 is preferably biased to open upon application of a low magnitude pressure due to air exiting the computer housing through the air flow channel so as to not unduly restrict the flow of air therefrom . of course , as shown in fig7 b , chimney - cap 41 stationary type arrangements can also be employed , these position the cap 41 a fixed distance away from the end of the stack via intermediate short stand - offs 42 and the air vents between the exit of the air flow channel 35 e and the chimney cap 41 . that is , the cap 41 is fixed spatially separated a distance from the second end portion of the power exhaust stack by mechanical attachment to spacers or standoff &# 39 ; s 42 located around the perimeter thereof ( this embodiment can be particularly suitable for linearly extending stack configurations ). of course , in either case , exhaust filters can also be used therewith ( not shown ). as shown throughout , the power exhaust stack 15 is preferably configured to provide an aesthetic visually dominant appearance which provides a focal point for the computer housing 20 symbolic of the operating capability or power of the system itself . as shown in fig1 and 2 , the ceiling has a length and a width ; the length direction “ l ” extends between the front and rear walls 22 , 25 of the computer housing 20 while the “ w ” width direction extends between the two opposing side walls 23 , 24 . as shown in this embodiment , the power exhaust stack 15 is preferably a single tubular shaped section which has a substantially round cross - section and a diameter sized at about at least 25 - 30 % the length of the ceiling . as is also shown for this embodiment , the power exhaust stack 15 is mounted proximate the rear wall 25 of the computer . preferably , the exhaust stack ( s ) are sized with an air flow channel 35 having a diameter of at least about 4 inches , and more preferably about 4 . 5 inches . as shown in the embodiment of fig1 it is more preferred that the exhaust stack air flow channel 35 has a diameter which is substantially equal to the width of the ceiling 21 . in keeping with the above , it is also preferred that the power exhaust stack be configured with an externally reflective surface such as a metallic or chrome - like coating , plating , or deposition formed over a plastic or resin or fiber - reinforced resin substrate . of course , the substrate should be selected to withstand temperatures associated with the exhausted air . it is more preferred that power exhaust stack be configured from chrome . the chrome or chrome - like appearance of the external surface yields an automotive themed hot rod “ souped - up ” aesthetic appearance . similarly , the computer housing 20 can be provided in colors representing hot - rod colors ( such as candy apple red , bright or canary yellow , metallic primary colors , or other similar “ muscle ” colors ). alternatively , or in addition , the computer housing can be ornamented with lightning bolts , flames , and other power - invoking or “ muscle ” images . other power exhaust stack configurations can also be employed . for example , as shown in fig8 the power exhaust stack 15 can be configured as a plurality of aligned power exhaust stacks 15 . fig6 and 7a illustrate yet another embodiment : a generally vertically - extending stack 150 ( i . e ., it extends upwardly from the housing ceiling 21 to direct the air upwardly out of the exhaust stack ). fig6 also shows an inclined top perimeter surface 150 s . fig7 a and 7b illustrate that the top perimeter surface can be substantially planar . as noted above ( for any embodiment described herein although not required ), but particularly for the power exhaust stack 150 , an exhaust filter and / or cap 40 , 41 can be attached thereto . [ 0062 ] fig9 a illustrates a power exhaust stack 250 representative of an air foil design . as shown , the exhaust stack 250 includes an air foil section which extends upwardly from the housing ceiling and includes at least one air flow channel 35 therein . the exhaust stack 250 includes opposing first and second end portions 250 f , 250 s . the first end portion 250 f is configured to overlie the ceiling 21 adjacent the front wall 22 and preferably extends substantially coincident with the ceiling ( covering substantially the entire width and at least a partial distance along the length of the ceiling 21 ). the power exhaust stack air foil section 250 has a profile which is curvilinear such that it rises at the first end portion 250 f and then substantially horizontally extends toward the rear wall 25 to direct the air flow channel ( s ) 35 upwardly out and away from the computer housing 20 and outwardly toward the rear of the computer housing 20 . [ 0063 ] fig9 b is a partial cutaway view of the power stack configuration of fig9 a , illustrating a plurality of exhaust fans 30 ( shown as four ) mounted at different positions along the length of the air flow channel 35 . in this embodiment , the fans 30 are mounted at an angle from the horizontal direction such that each extends across a portion of the air flow channel . of course , as shown in fig1 , they can alternatively be mounted to extend horizontally across the top of the computer housing . the air foil section 250 can be formed as a matable two piece component ( split lengthwise ) which can allow for easier assembly of the fans across portions and along the length of the air flow channel not shown ). the fans 30 shown in fig9 b can be mounted onto structural ribbing which can be attached to the internal walls of the air flow channel at the appropriate angles to orient the fan in the desired direction and at a desired position . the ribbing can be adhesively secured , brazed , welded , or attached by other means as is know to those of skill in the art . preferably , the fans are mounted and spatially separated a sufficient distance to direct air out of the rear of the air flow channel . a plurality of equally rated fans can be used ( preferably 10 - 30 cfm ), or alternatively staggered and different rated fans can be employed . for example , a 30 cfm fan can be located either or both at the front and / or rear end of the air foil section with two lesser rated fans positioned intermediate thereof . [ 0064 ] fig9 c illustrates that the power exhaust stack air foil section 250 can form the ceiling 21 of the housing itself . indeed , in this embodiment , the air foil section sides 251 are configured to slidably attach to the mounts 21 sk disposed on the upper portion of the skeletal frame ( shown in fig5 a ) to overlay or attach to the sidewalls and define the lower enclosure space for the computer components . as shown in fig1 , the power exhaust stack 250 can end short of the entire length of the computer housing 20 ( shown for example at length l 1 with a longer length l 2 represented in dotted line ). additionally , as shown in fig1 , a plurality of power exhaust fans 30 can be positioned along the length of the air flow channel 35 . the exhaust fans 30 can each vent into a single air flow channel 35 ( as shown ) or can alternatively vent into an individually formed air channel within the power exhaust stack ( not shown ). fig1 a - 11 e illustrate yet another embodiment of a power exhaust stack 350 according to the present invention . in this embodiment , the power exhaust stack 350 is configured to resemble one or a bundle of cylindrical tubes resembling an exhaust manifold or exhaust pipe arrangement ( such as are found on motorcycles ). as shown in fig1 a - 11 d , the power exhaust stack 350 includes at least one tubular member in fluid communication with at least one power exhaust fan 30 . the power exhaust stack 350 ( and preferably the exhaust fan 30 ) is mounted on an upper portion of at least one side wall 23 , 24 proximate the ceiling 21 . the computer housing 20 may include one power exhaust fan 30 and stack 350 arranged on one of the side walls 23 . the computer housing 20 may alternatively include symmetrically positioned power exhaust stacks 350 , with one tube 351 , 352 ( or one tube bundle 353 ) located on each opposing side wall 23 , 24 as shown . preferably , one or both of which may include a power exhaust fan 30 in fluid communication therewith . ( in operation , one of the power stacks may merely act as an aesthetic balance element , they may be arranged in a master - slave set - up , or they may operate selectively or individually ). [ 0067 ] fig1 e illustrates two tubes positioned on the housing sidewall so as to be aligned to extend from approximately the same forward portion of the sidewall . of course , the tubes can be alternatively arranged so as one is more forward , or each are spatially separated to extend from different regions of the housing sidewalls ( although preferably from the top to help exhaust the hot air therefrom ). exhaust fan arrangements for power exhaust stacks 350 with tube bundles 353 , can be such that a selected number ( one , two , or all of the tubes ) can be mounted in the computer so that they are in fluid communication with one exhaust fan 30 or each tube can operate with an ( typically smaller rated ) individual exhaust fan . thus , one or more of the tubes 351 , 352 may be non - functional as exhaust channels or may be operative from a shared exhaust fan arrangement or an individual exhaust fan arrangement . as shown in fig1 d , looking from the top view , the profile of the tubular section ( s ) extends outwardly from a forward portion of the respective side wall 23 , 24 and turns to extend generally horizontally along the length of the computer housing 20 to direct the air flow channel 35 along the length of the computer housing 20 to exit toward the rear wall 25 . for “ header ” arrangements , as is common with automotive “ headers ”, each of the pipes can be configured with the same length along the length of the housing even though each subsequent pipe has a shorter horizontal length with respect to the mounting on the housing ( not shown ). that is , the header configuration can include a first pipe having a first substantially horizontally extending configuration and a first length extending from the front portion of the housing . a second pipe can be set back a distance along the length of the sidewall of the housing body and can have a second configuration ( different from the first ) with an additional amount of vertical length and a shorter horizontal length ( defining the same overall length as the first length ) each of the pipes then terminating at a common exhaust point , junction or body . [ 0070 ] fig1 illustrates an example of power exhaust stack 15 modification hardware which was used to modify a personal computer as well as templates which can make the modification easier for subsequent users ( i e ., a modification kit ). as shown an exhaust fan 30 was mounted to the skeleton frame 20 sk . a suitable exhaust fan is manufactured by droan manufacturing co . and is rated at 70 cfm . the exhaust fan 30 was positioned on top of the skeleton frame 20 sk because of internal clearance issues and then threaded with screws 31 to attach same thereto ( see also fig4 ). a 4 . 5 inch opening 21 o was formed in the ceiling 21 corresponding to the diameter size of the power exhaust stack 15 ( which has the air flow channel 35 which fits over the exhaust fan 30 ). a sealing means 60 such as an o . d . axle installed seal wheel seal grit guard was used to assemble the exhaust stack 15 onto the ceiling over the exhaust fan 30 . a suitable wheel seal is a guardian hp axle installed seal manufactured by stemco of longview , tex . [ 0071 ] fig4 illustrates the assembled configuration with the exhaust stack 15 press fit against the wheel seal 60 which is attached to the ceiling 21 ( via an outdoor or durable adhesive such as outdoor goop ™). of course , other attachment means and components can also be employed as will be appreciated by those of skill in the art . preferably , the juncture of the exhaust stack 15 at the ceiling or housing portion is such that a substantially air tight seal is formed so that exhaust air is more efficiently forced out of the stack . and an outdoor adhesive used to join same . two one - inch openings 20 p were formed in each of the opposing side walls 23 , 24 and grommets 20 g were positioned in same to protect potentially exposed rough edges thereat . a lockable extension cord 50 ( fig5 b and 12 ) was routed in the housing 20 to connect the power hook up to the exhaust fan . the lockable power cord 50 allows the power to be locked on or off . [ 0072 ] fig1 illustrates a computer modification kit 100 that can allow users to modify existing computers . as shown , the kit 100 includes at least one template 75 with visual indicia ( such as center markings , edge markings , aperture openings , marked units ) representing at least one exhaust opening size ( multiple templates or templates with multiple sized opening choices can also be provided ). the template 75 can be overlaid onto the ceiling 21 ( or for side - mounted stacks , side wall openings ) and the proper opening corresponding to the selected exhaust stack formed into the computer . the kit 100 can also include the power exhaust stack 15 , the sealing or mounting means 60 , a plurality of grommet / filter assemblies 20 g / 20 f , a power cord 50 , and an exhaust fan 30 . the kit can additionally include a second template 175 corresponding to air inlet port openings much like the template discussed above . the computer housing with power exhaust stack of the present invention can also be customized to bear ornamental features or company logos according to a user &# 39 ; s needs . for example , surface ornamentation , as well as “ hood ” ornaments or symbols can be applied to one or more of the stack itself or the housing . the foregoing is illustrative of the present invention and is not to be construed as limiting thereof . although a few exemplary embodiments of this invention have been described , those skilled in the art will readily appreciate that many modifications are possible in the exemplary embodiments without materially departing from the novel teachings and advantages of this invention . accordingly , all such modifications are intended to be included within the scope of this invention as defined in the claims . therefore , it is to be understood that the foregoing is illustrative of the present invention and is not to be construed as limited to the specific embodiments disclosed , and that modifications to the disclosed embodiments , as well as other embodiments , are intended to be included within the scope of the appended claims . the invention is defined by the following claims , with equivalents of the claims to be included therein . | 6 |
[ 0035 ] fig4 a and 4b are diagrams showing the construction of a non - contact ic card according to one preferred embodiment of the invention , wherein fig4 a is a side section 1 view of the non - contact ic card and fig4 b is a top sectional view of the non - contact ic card . in fig4 a and 4b , numeral 4 designates a substrate , and one turn - loop - antenna pattern 1 is provided on the surface of the substrate 4 . the loop antenna pattern 1 has a width of 3 to 15 mm and a thickness of not more than 0 . 5 mm . numeral 5 designates a laminated tape surrounding the whole assembly . a capacitor 2 is connected to the terminal of the one turn loop antenna pattern 1 , and a resonance circuit is constituted by the parasitic inductance of the loop antenna pattern 1 and the capacitance of the capacitor 2 to increase the voltage generated in the one turn - loop antenna pattern 1 . an electronic circuit 3 is connected the loop antenna pattern 1 . this construction permits an electric power used within the electronic circuit 3 to be supplied from the loop antenna pattern 1 and , at the same time , signals to be transmitted and received . the substrate 4 mounted with the loop antenna pattern 1 , the capacitor 2 , and the electronic circuit 3 is sandwiched between upper and lower decorative sheets . the ic card has a dimension of 86 mm in length l 1 , 54 mm in width w 1 , and 0 . 76 mm in thickness t 1 . this dimension is in accordance with iso standards [ 0040 ] fig5 is a block diagram showing an electrical equivalent circuit of a non - contact ic card according to one preferred embodiment of the invention . in fig5 numeral 12 designates a one turn - loop antenna pattern which corresponds to the loop antenna pattern 1 shown in fig4 a and 4b . numeral 13 designates a capacitor which corresponds to the capacitor 2 shown in fig4 a and 4b . in fig5 numeral 3 designates an electronic circuit which corresponds to the electronic circuit 3 shown in fig4 a and 4b . as shown in fig5 the capacitor 13 is connected to the terminal of the loop antenna pattern 12 to increase the voltage generated in the loop antenna pattern 12 . the electronic circuit 3 is connected behind the capacitor 13 . the electronic circuit 3 comprises : a rectification circuit 6 for taking an electric power out of an electric wave received by the loop antenna pattern 12 ; and a power supply circuit 7 for stabilizing the voltage . the electronic circuit 3 further comprises : a detection circuit 8 for detecting a received signal ; a modulation circuit 9 for demodulating a detected signal ; cpu 10 for giving an instruction of signal processing or transmitted data upon receipt of a signal from the demodulation circuit 9 ; and a modulation circuit 11 for modulating a signal from cpu 10 . the electronic circuit 3 may be constituted by one - chip semiconductor integrated circuit . figs , 6 a and 6 b are diagrams showing another mounting example of a non - contact ic card according to one preferred embodiment of the invention , wherein fig6 a is a top sectional view and fig6 b is a side sectional view . also in the non - contact tc card shown in fig6 a and 6b , the outside dimension is 86 mm in length l 2 , 54 mm in width w 2 , and 0 . 76 mm in thickness t 2 . in fig6 a and 9b , numeral 17 designates a flexible substrate , and a loop antenna pattern 14 having a patten width l 3 of 10 mm and a thickness of 0 . 25 mm is provided in a open - turn loop form on the flexible substrate 17 . this pattern may be lade of gold , silver , or copper , the material may be properly selected by taking into consideration cost and applications . a resonance capacitor 15 is provided on the surface of the flexible substrate 17 remote from the loop antenna pattern 14 and is connected to the terminal of the loop antenna pattern 14 . the capacitance of the resonance capacitor 15 is determined so as to satisfy the following equation : wherein c represents the capacitance of the resonance capacitor 15 , l represents the inductance of the one turn - antenna pattern 14 , and f represents the frequency of a carrier transmitted to the non - contact ic card . the electronic circuit 16 is mounted on the substrate in its side where the resonance capacitor 15 has been formed , and the electronic circuit 16 is connected to the loop antenna pattern 14 . [ 0052 ] fig7 is an exploded perspective view of another mounting example the non - contact ic card according to the one preferred embodiment of the invention . as shown in fig7 a flexible substrate 17 , a one turn - loop antenna pattern 14 mounted on the flexible substrate 17 , a resonance capacitor 15 , and an electronic circuit 16 is sandwiched between decorative sheets 18 . this decorative sheet maybe constituted , for example , by a plastic film . [ 0054 ] fig8 is a diagram showing the relationship between the voltage generated in an antenna of an ic card and the distance of a transmitter from the ic card . in fig8 a curve c 3 shows the results in a structure , used in the conventional ic card , comprising a fine pattern having a line width of not more than 1 mm turned by several times to several tens of times in a loop form . a curve c 2 shows the results on the construction according to one preferred embodiment of the invention using one turn - antenna pattern having a dimension of 3 to 15 mm in pattern width and not more than 0 . 5 mm in thickness . a curve c 1 shows the results on a structure wherein a resonance capacitor 2 or a resonance capacitor 15 has been provided on the above antenna pattern . the results shown in fig8 are for the case where the non - contact ic card receives a frequency of carrier of ten - odd mhz . in the antenna circuit of the conventional non - contact ic card , the voltage generated in the antenna at a frequency of a carrier of ten - odd mhz is small ( the curve c 3 in the drawing ). on the other hand , the one turn - antenna pattern having a dimension of 3 to 15 mm in pattern width and not more than 0 . 5 mm in thickness according to the one preferred embodiment of the invention can withdraw a large voltage ( the curve c 2 in the drawing ). further , resonance using the resonance capacitor 15 enables a larger voltage to be withdrawn ( the curve c 3 in the drawing ). as described above , according to the invention , the adoption of a one turn - loop antenna pattern can prevent power loss caused by a plurality of resonances due to parasitic capacitance between adjacent patterns , skin effect , and proximity effect . therefore , even when the non - contact ic card using a carrier frequency of ten - odd mhz is away from the transmitter , a large amount of electric power can be advantageously taken out within the ic card . an antenna pattern having a dimension of 3 to 15 mm in width and not more than 0 . 5 mm in thickness can advantageously provide the above effect and , in addition , enables the preparation of non - contact ic cards in accordance with iso standards . the invention has been described in detail with particular reference to preferred embodiments , but it will be understood that variations and modifications can be effected within the scope of the invention as set forth in the appended claims . | 6 |
in acidizing of a carbonate reservoir , reducing the reaction rate between the injected acid and the rock can be beneficial to the well productivity . a lower reaction rate allows the acid to dissolve rock deeper inside the formation , resulting in an extended effective wellbore diameter and longer wormholes . this applies to both matrix acidizing and fracture acidizing . as mentioned above , hydrochloric acid ( hcl ) is the most commonly used acid for carbonate acidizing due to its low cost and high dissolving power of carbonate rocks . however , the reaction rate of hcl with carbonate rock is very high . therefore , hcl frequently needs to be retarded by gelling , emulsifying , or adding surfactants . near the wellbore , the total surface area available for production fluid to flow into the well is significantly less than that far away from the wellbore inside the reservoir . as a consequence , the pressure gradient increases dramatically . the ideal stimulation should therefore ideally create a wide channel near the wellbore for reducing the pressure gradient in addition to providing a deep penetrating live or active acid system . retarded acid systems as known can provide deep penetration but only through relatively narrow channels . to generate wide channels near wellbore capable of reducing the pressure gradient , a high reaction rate is preferred . this means that an ideal stimulation fluid for acidizing in carbonate reservoirs is ideally highly reactive when initially contacting the formation , and then turning into a less reactive composition as it penetrates deeper into the reservoir . several tests to be described below show that such ideal behavior can be expected to a certain extent from the compositions as proposed by the present invention . fig1 compares the reaction between the mixture of 15 % hydrochloric acid ( hcl ) and 15 % maleic acid ( mea ) and that of pure hcl based on a similar overall dissolving capacity for calcium carbonate . the mixture with its measured points indicated as solid squares takes 120 minutes to complete while approximately the same amount of calcium carbonate is dissolved in less than 30 minutes using 20 % hcl ( solid circles ). the mixture preserves the early high reaction rate for wide channel creation and the total amount of dissolved calcium carbonate . however the time before it is becomes inactive or spent is longer than that of the pure hcl . a similar delay is exhibited by a mixture of hcl and the precursor of maleic acid , maleic anhydrate ( mah ). a comparison of pure 7 . 5 % hcl ( solid triangles ), a 15 % mixture of equal parts of hcl and mea ( solid diamonds ) and a 15 % mixture of equal parts of hcl and mah ( solid squares ) is shown in fig2 . again , all acids are approximately equal in the total amount of dissolved carbonate as indicated in the abscissa , but the two mixtures display a slower rise and remain reactive for a longer time period . in fig3 , the carbonate dissolving properties of four different carboxylic acid mixtures are compared . each acid is a mixture of 10 % by weight of the organic acid and 10 % by weight of hcl . the graphs show that maleic acid ( top curve ) is the most effective composition followed by lactic acid , whereas the two bottom curves of citric acid and acetic acid , respectively , have a lower total reactivity and dissolve less carbonates . the advantageous properties of the compositions in accordance with the invention can be further demonstrated by comparing the solubility of the reaction products which are formed in the reaction of the acids with the formation rock . the table 1 below lists the solubility of reaction products of various acids with carbonate rock at different temperatures . in a typical acid treatment of a carbonate reservoir , first a cleaning fluid is pumped from the surface down a well to clean up the exposed surface of the rock and well tubulars . the cleaning is followed with a treatment fluid as per the present invention . the well may then be shut in and allowed to stand for a period of time for the slower acid reaction or acid reactions to run their course . a post - flush fluid , typically a brine solution or an oil , such as diesel , may be injected last . the exact volume and composition of the treatment fluid is determined by the conditions encountered in the treated formation . the lower limit of the concentration of treatment acid is determined by the amount of substance required to obtain a reasonable change of permeability in the treated formation . the upper limit , if not determined by cost constraints , may be determined by the amount which can be pumped while remaining below the fracturing pressure of the reservoir . the amount of substance required to be dissolved is determined by the initial permeability of the formation . for a high permeability formation , it is preferred to attempt to create channel profiles with long sections of wide channels starting from the wellbore extending into short sections of narrow channels . therefore , a higher fraction of a highly reactive acid like hcl is preferred in the mixture . for a low permeability formation , it is preferred to render profiles with short sections of wide channels starting from the wellbore extending into long sections of narrow channels . therefore , a higher fraction of low reaction rate acid and / or precursor of this acid such as the maleic acid is preferred in the mixture for these types of formations . the typical concentration of the high reaction rate acid component is 3 wt . % to 28 % wt . %, and the typical concentration of the low reaction rate acid component and / or precursor is 1 wt . % to 40 wt . %. | 2 |
the following description is intended to be illustrative only and not limiting . referring to fig1 eight lead (&# 34 ; 8l &# 34 ;) soic integrated circuit package configuration (&# 34 ; icp configuration &# 34 ;) 100 includes a 0 . 091 × 0 . 158 inches ( 2 . 31 × 4 . 01 mm ) semiconductor integrated circuit die 102 downset mounted on a 0 . 1 × 0 . 166 inches ( 2 . 54 × 4 . 22 mm ) die pad 104 using conventional mounting techniques and materials within the confines of plastic encapsulant 140 . lead posts 106 , 108 , 110 , 112 , 114 , 116 , and 118 are located along two sides of the integrated circuit 102 also within the confines of plastic encapsulant 140 . leads 120 , 122 , 124 , 126 , 128 , 130 , 132 , and 134 extend external to the plastic encapsulant perimeter 136 to provide external interconnection sites . lead posts 106 , 108 , 110 , 112 , 114 , 116 , and 118 and leads 120 122 , 124 , 126 , 128 , 130 , 132 , and 134 may be any conductive material suitable for icp configurations such as aluminum , copper , gold , and other metals and alloys . separate circuit 138 is a planar structure , i . e . having no bottom vertical interconnections , mounted on lead post 108 , which serves as a die pad for circuit 138 , with conventional assembly techniques using conductive epoxy , soldering material , eutectic materials and methods , or any other suitable materials and methods . the circuit 138 may be mounted to lead post 108 at any time during the assembly process of icp configuration 100 prior to encapsulation and interconnection of circuit 138 to sites in accordance with specific circuit design and layout . the circuit 138 represents a generic circuit which may be , for example , an integrated circuit die such as a diode or temperature protection circuitry , other esd protection circuitry , a discrete electrical device , integrated circuit dice , a small packaged integrated circuit , or any semiconductor device not specifically mentioned . circuit 138 may , for example , be connected , through electrical interconnections ( not shown in fig1 ), to integrated circuit die 102 , and / or another separate circuit device ( not shown ), and / or a circuit or device ( not shown ) external to icp configuration 100 . although fig2 and 3 illustrate circuit 138 as a two terminal device , circuit 138 may include other terminals as necessitated by the particular circuit . in fig1 the lead posts 106 , 108 , 110 , 112 , 114 , 116 , and 118 are 0 . 014 inches ( 0 . 36 mm ) wide . assuming for illustrative purposes that circuit 138 is a diode , the 0 . 010 × 0 . 020 inch ( 0 . 254 × 0 . 508 mm ) circuit 138 is attached to 0 . 014 × 0 . 050 ( 0 . 36 × 1 . 27 mm ) lead post 108 . the 0 . 091 × 0 . 158 inch ( 2 . 31 × 4 . 01 mm ) integrated circuit die 102 is attached to a 0 . 100 × 0 . 166 inch ( 2 . 54 × 4 . 22 mm ) pad 104 . the leads 120 , 122 , 124 , 126 , 128 , 130 , 132 , and 134 are 0 . 016 inches ( 0 . 406 mm ) wide . although specific dimensions and structural configurations have been given , it will be understood by one of ordinary skill in the art after reading this description that other dimensions and structural configurations may be used for example , a die pad may be mounted on lead post 108 prior to circuit 138 attachment . icp configuration 100 with circuit 138 incorporates the low cost assembly techniques of mounting and interconnecting two separate circuits ( circuit 138 and integrated circuit die 102 ) within a single icp configuration while avoiding monolithic approach and external approach problems . additionally , fig1 - 13 show several separate circuit placements and various interconnections which illustratively demonstrate versatility aspects of the intra - package separate circuits configuration . referring to fig2 wires 202 and 204 interconnect circuit 138 and lead posts 108 and 110 , respectively . wires 206 and 208 interconnect lead posts 108 and 110 , respectively , to integrated circuit die 102 . wires 210 , 212 , 214 , 216 , 218 , 220 , and 222 interconnect lead post 106 to various integrated circuit die 102 locations such as those shown in fig2 . although specific wire interconnection terminal points are shown , it will be understood by one of ordinary skill in the art in light of this description that circuit 138 may be connected to additional and / or alternative sites as required by specific circuit designs . for example , circuit 138 may be electrically connected , through at least one of the leads 120 , 122 , 124 , 126 , 128 , 130 , 132 , and 134 and / or through another separate circuit ( not shown ) mounted within plastic encapsulant 140 , to a circuit or device external ( not shown ) to icp configuration 100 without being electrically connected to integrated circuit die 102 . additionally , although a specific circuit 138 mounting location is shown , it will be understood by one of ordinary skill in the art in light of this description that circuit 138 may be mounted to additional and / or alternative sites , for example lead posts 128 , 130 , 132 , or 134 or tie bars 142 or 144 , as desired to accommodate specific designs . the wire interconnections of fig2 and the following figures are made by conventional stitch wire bonding or any other suitable method unless otherwise indicated . fig3 illustrates a close - up cross - sectional side view through line 3 -- 3 on fig2 of the separate circuit device 138 placement and wire interconnections to lead posts 110 and 108 . the height of circuit 138 is 0 . 010 inches ( 0 . 254 mm ), and the loop height of wire interconnections 202 and 204 is 0 . 012 inches ( 0 . 305 mm ) measured from the top plane of circuit 138 . although specific loop heights are given , other loop heights may be suitable for other packages . a 0 . 029 inch ( 0 . 737 mm ) lateral separation exists between interconnection sites 302 and 304 , and a 0 . 025 inch ( 0 . 635 mm ) lateral separation exists between interconnection sites 306 and 308 . fig4 illustrates a cross - sectional front view through line 4 -- 4 of fig2 of icp configuration 100 showing circuit 138 and wire interconnections 202 and 206 between circuit 138 and lead post 108 and from lead post 108 to integrated circuit die 102 , respectively . fig5 illustrates a cross - sectional rear view through line 5 -- 5 of fig2 of icp configuration 100 showing the circuit 138 and interconnection placements of wires 202 and 206 . referring to fig6 a partial cross - sectional view of 8l soic icp configuration 600 is illustrated having multiple lead post mounted separate circuits 602 and 604 utilizing alternative connection schemes . separate circuits 602 and 604 represent circuits such as those represented by separate circuit 138 . icp configuration 600 includes leads 632 , 634 , 636 , and 638 extending from plastic encapsulant 640 . icp configuration 600 also includes circuits 602 and 604 mounted on lead posts 608 and 610 , respectively . the two circuits 602 and 604 are mounted separately from integrated circuit dice 605 and 606 , mounted on die pads 642 and 644 , respectively . conventional assembly techniques mount circuits 602 and 604 using conductive epoxy , soldering material , eutectic materials and methods , or any other suitable materials and methods . fig6 also illustrates wire interconnections between circuit 602 and lead post 614 and icp configuration 606 using wires 614 and 616 , respectively . wires 618 and 620 connect circuit 604 to lead posts 622 and 610 , respectively . lead posts 622 and 610 are connected to integrated circuit die 605 with wires 628 and 630 , respectively . lead posts 612 and 608 are connected to integrated circuit die 606 with wires 624 and 626 , respectively . icp configuration 600 exhibits the advantages of icp configuration 100 and additionally provides added functional capability and versatility with circuits 602 and 604 within a common plastic encapsulant 640 . in fig7 soic icp configuration 700 includes separate circuit 702 . separate circuits 702 and 704 are &# 34 ; flip chip &# 34 ; bonded , i . e . electrically interconnected via backside contacts using , for example , conventional bonding materials . separate circuit 702 is vertically interconnected by flip chip bonding with bottom conductive contacts 714 and 716 to lead posts 706 and 708 , respectively . separate circuit 704 is vertically interconnected by flip chip bonding with bottom conductive contacts 718 and 720 to lead posts 710 and 712 , respectively . the conductive contacts 714 , 716 , 718 , and 720 are made of metal or other suitable conductive material . conventionally , circuits are flip chip mounted on a continuous surface . however , flip chip bonded separate circuits 702 and 704 bridge between two discontinuous surfaces , lead posts 706 and 708 and lead posts 710 and 712 , respectively . fig8 illustrates a close - up cross - sectional view of circuit 702 through line 8 -- 8 in fig7 . as shown in fig8 circuit 702 is attached between lead posts 706 and 708 with conductive materials 802 and 804 . the conductive materials 802 and 804 are , for example conductive epoxy , soldering material , eutectic materials , or any other suitable materials and methods . respective lead posts are preferably separated by a minimum gap distance to provide electrical isolation between the respective lead posts . for example , a minimum gap distance of approximately 0 . 005 inch ( 0 . 127 mm ) is suitable for an 8l soic package . the gap between lead posts 706 and 708 prevents unnecessary mechanical strain on circuit 702 and allows adequate contact surface area between conductive contacts 714 and 716 and lead posts 706 and 708 , respectively . conductive materials such as conductive materials 802 and 804 also attach circuit 704 to lead posts 710 and 712 . in addition , for circuits having more than two terminals , other vertical interconnections may be made with additional bottom conductive material . as an alternative , circuits 702 and 704 may be attached as a planar structure with interconnections provided by wire bonding or other suitable methods and materials . in another alternative , circuits 702 and 704 use a combination of vertical interconnections and wire interconnections . referring to fig7 wire 730 interconnects lead post 706 to integrated circuit die 725 , mounted on die pad 732 , and wires 722 and 724 interconnect two separate interconnection sites on integrated circuit die 726 , mounted on die pad 734 . the vertical interconnections of circuits 702 and 704 result in a low profile circuit and eliminate wire connections between circuit 702 and lead posts 706 and 708 and between circuit 704 and lead posts 710 and 712 . icp configuration 700 also exhibits the additional advantages of icp configuration 600 discussed above . in fig9 a partial cross - sectional view of a general surface mount device icp configuration 900 is illustrated . icp configuration 900 includes a semiconductor integrated circuit die 902 mounted on die pad 920 with conventional techniques and materials within the confines of plastic encapsulant 904 . fig9 includes separate circuit 906 vertically interconnected between lead posts 908 and 910 using vertical interconnection assembly techniques and materials as discussed above in conjunction with circuit 702 ( fig7 and 8 ). vertical interconnection between metal strip 912 and lead post 910 and 914 , and vertical interconnection between metal strip 916 and lead post 914 and 918 is accomplished using conductive epoxy , soldering material , eutectic materials and methods , or with other suitable assembly materials and techniques . the metal strips may be any metal , for example , aluminum , copper , gold , or metal alloys . icp configuration 900 offers a low profile separate circuit 906 interconnection between lead posts 908 and 910 and low profile interconnections between lead posts 910 , 914 , and 918 via metal strips 912 and 916 . additionally , icp configuration 900 offers the advantages discussed above with icp configuration 100 . referring to fig1 , a partial cross - sectional view of a general surface mount device icp configuration 1000 is illustrated . icp configuration 1000 is identical to icp configuration 900 excepting that metal strips 912 and 918 ( fig9 ) have been replaced with a common lead post 1002 . corrugations 1005 and 1006 reinforce grippage of plastic encapsulant 1004 to lead post 1002 . in addition to improved plastic encapsulant 1004 grippage , icp configuration 1000 offers the advantages discussed with icp configuration 900 . referring to fig1 , a cross - sectional view of soic icp configuration 1100 is illustrated . the configuration of die pad 1110 allows lead post 1104 to extend proximate to lead posts 1106 and 1108 thereby allowing attachment of separate circuit 1102 to lead posts 1104 , 1106 , and 1108 . circuit 1102 may be vertically interconnected to lead posts 1104 , 1106 , and 1108 , a planar structure with wire interconnections using assembly techniques and materials discussed above , or interconnected using a combination of vertical interconnection , planar structures , and wire interconnection . circuit 1102 and lead posts 1104 , 1106 , and 1108 may be connected to integrated circuits dice 1112 and / or 1114 using the wire interconnection assembly techniques and materials discussed above or by flip chip bonding . icp configuration 1100 may be utilized when the die pad 1110 size allows for proximately locating three or more leads . extending lead post 1104 eliminates the processing steps associated with the addition of metal strips and wire interconnections . other advantages discussed in conjunction with icp configuration 1000 are applicable to icp configuration 1100 . the die pad 1110 configuration may be variously dimensioned to accommodate virtually any lead post arrangement allowing separate circuit bridging between multiple lead posts and sets of multiple lead posts . referring to fig1 , a cross - sectional view of soic icp configuration 1200 is illustrated . fig1 illustrates placement of a die pad extension in an unused region between lead posts . the die pad extension provides an additional circuit mounting platform for additional separate circuits . icp configuration 1200 includes die pad 1202 with a 0 . 028 × 0 . 016 inch ( 0 . 711 × 0 . 406 mm ) die pad extension 1204 of a size suitable to accommodate separate circuit 1206 within plastic encapsulant 1226 . die pad extension 1204 is preferably formed as a co - planar , integral part of die pad 1202 . after reading this disclosure , it will be understood by one of ordinary skill in the art that well - known methods may be used to fabricate die pad extension 1204 . lead post 1216 is preferably separated from die pad extension 1204 by at least 0 . 005 inches ( 0 . 127 mm ) to provide electrical isolation . circuit 1206 is interconnected ( not shown ) to integrated circuit 1228 and / or lead posts 1208 , 1210 , 1214 , 1216 , 1218 , 1220 , 1222 , and / or 1224 with metal strips or wire interconnections using assembly techniques and materials discussed above . circuit 1206 may be attached to die pad extension 1204 using suitable conventional materials and techniques . additionally , circuit 1206 may be electrically connected or electrically isolated from die pad extension 1204 . bond wires 1230 and 1232 interconnect separate circuit 1206 to integrated circuit die 1228 and lead post 1214 , respectively . icp configuration 1200 offers the advantages discussed above in conjunction with a separate circuit enclosed within a common plastic encapsulant . additionally , low profile advantages can be achieved through the utilization of low profile interconnections . furthermore , icp configuration 1200 also offers the versatile interconnectability options . referring to fig1 , a cross - sectional view of soic icp configuration 1300 is illustrated . icp configuration 1300 includes 0 . 100 × 0 . 078 ( 2 . 54 × 1 . 98 mm ) inch die pad 1302 with a die pad extension 1304 of a size suitable to accommodate separate circuit 1306 , and 0 . 100 × 0 . 078 inch ( 2 . 54 × 1 . 98 mm ) die pad 1308 with a die pad extension 1310 of a size suitable to accommodate separate circuit 1312 within plastic encapsulant 1334 . bond wires 1336 and 1338 interconnect circuit 1306 to 0 . 092 × 0 . 072 inch ( 2 . 34 × 1 . 83 mm ) integrated circuit 1314 and lead post 1320 , respectively using assembly techniques and materials discussed above . bond wires 1340 and 1342 interconnect circuit 1312 to 0 . 092 × 0 . 072 inch ( 2 . 34 × 1 . 83 mm ) integrated circuit 1316 and lead post 1322 , respectively using assembly techniques and materials discussed above . circuits 1306 and 1312 may be attached to die pad extensions 1304 and 1310 , respectively , using suitable conventional materials and techniques . additionally , circuits 1306 and 1312 may be electrically connected or electrically isolated from die pad extensions 1304 and 1310 , respectively . icp configuration 1300 offers the advantages discussed above in conjunction with a separate circuits enclosed within a common plastic encapsulant . additionally , low profile and versatile interconnectability advantages can be achieved as discussed above with icp configuration 1200 . while the invention has been described with respect to the embodiments and variations set forth above , these embodiments and variations are illustrative and the invention is not to be considered limited in scope to these embodiments and variations . for example , while fig1 , 4 , 5 , and 9 - 12 each illustrate one separate circuit and fig6 - 8 illustrate two separate circuits , additional separate circuits may be incorporated into the respective icp configurations to provide desired functions . also , although integrated circuits are discussed in conjunction with fig1 - 13 , any semiconductor device , integrated or otherwise , may be used in conjunction with intra - package separate circuits . additionally , although specific interconnection sites are illustrated in fig1 - 13 , respectively , it will be understood by one of ordinary skill in the art after reading this description that other interconnection sites useful with specific circuits may be utilized . also , the separate circuits may be connected , through electrical interconnections , to circuits within the same package and / or to circuits external to the package . furthermore , a combination of metal strip , wire bond interconnections , and vertical interconnections may be used as well as other interconnection methods and materials . moreover , additional integrated circuits may be mounted within a single housing and coupled to one or more separate circuits . in fig1 and 13 , icp configurations 1200 and 1300 may incorporate additional die pad extensions in unused portions of the respective icp configuration for additional separate circuits . die pad extensions and lead posts may also be used in combination as mounting platforms for separate circuits . additionally , separate circuit devices may have multiple terminal sites on one or a combination surfaces . although soic particular in this description or packages , for example , dip , pdip , zip , tssop , soj , sop , tsop , and other ic packages are suitable as well . also , although plastic encapsulants have been discussed , other encapsulant materials may be utilized as well . moreover , dimensions specified herein are illustrative and other dimensions may be used . accordingly , various other embodiments and modifications and improvements not described herein may be within the spirit and scope of the present invention , as defined by the following claims . | 7 |
the present invention is closed loop control system , which acts to align a second pattern that is being generated with a first pattern . the closed loop system operates dynamically , meaning that it operates during and integral with the pattern forming process . as a result , no additional alignment overhead is required . various pattern forming means exist that are compatible with this invention . the preferred embodiment describes a process whereby a substrate having a patterned first layer is coated with sensitive materials 4 , as shown in fig1 . a pattern is formed in this second coated layer . one means of forming this pattern is through laser ablation . alternately , the pattern can be formed through modification of a material coupled with a subsequent step . for example , one could sinter a material and wash off the not sintered components of the second layer . or , one could polymerize a material and wash off the non - polymerized components of the second layer . in addition , pattern formation approaches that are additive are also compatible with this invention . rather than applying a second layer that is to be patterned , one can apply the pattern directly . suitable additive processes include ink jet , gravure and laser thermal transfer . finally , when considering the various pattern forming approaches , combinations of the subtractive and additive techniques may be used . since the ability to locate a patterned feature , for example , by ink jet may not meet the applications requirements , one can pattern by ink jet and then trim by ablation . the operation of the preferred embodiment is consistent with any of the aforementioned pattern forming approaches . the system components are described below and shown in fig1 . both the second pattern ( not shown ) and the first pattern 20 are generated via a maskless lithographic process using a multi - channel laser printhead 1 which imparts patterns of light 2 onto a substrate 3 . substrate 3 includes a support 21 , a first pattern 20 and sensitive materials 4 which are sensitive to the wavelength or range of wavelengths of the patterning light from the multi - channel printhead . the patterns of light are emitted from the modulator 10 , which receives drive signals 18 from the modulator driver electronics 9 . the modulator driver electronics 9 receives image data 16 from electronics called the image data path 5 . image data 16 is representative of the second pattern that is to be produced in register to that of the first pattern 20 . the image data path 5 has several functions . it is responsible for gating image data 16 to the modulator driver electronics 9 . it is also responsible for determining when to gate this data to the modulator driver electronics 9 . finally , it computes and sends a cross - scan control signal 28 to the cross - scan correction controller 12 . the image data path 5 monitors the current region 14 of the substrate 3 as detected by the alignment detection system 15 . the current region 14 is defined as the area of the substrate 3 , which is just about to be patterned . the alignment detection system 15 captures an electrical signal , which indicates the changes in reflectivity of the surface as the multi - channel laser printhead 1 and substrate 3 move relative to one another . the image data path 5 also processes the current motion control system position 26 provided by the motion control system 7 and the pending image data 16 . the current position acts as a region of interest indicator and can be used as an enable signal to filter out spurious noise . once in the region of interest the detection of features on the substrate 3 triggers a synchronization signal . based upon this information , the image data path 5 adjusts the gating of the pending image data 16 to the modulator driver electronics 9 . the adjustment of the gating of the data is referred to as in - scan control . cross - scan control is adjusted in this system by the cross - scan controller 12 . the image data path 5 computes the misalignment between the pending image data 16 for the current motion control system position 26 and the current region 14 to generate an error signal that represents the correction that needs to be applied in order to counter the misalignment in the cross - scan direction . the image data path 5 sends the cross - scan control signal 28 to the cross - scan controller 12 . the image data path 5 has information that exists within the image file which details process information 8 . this process information 8 is critically important in interpreting the output from the alignment detection system . further , the image data path can send process information 8 to the alignment detection system , prompting adjustment of illumination wavelengths , magnitude , gain of electronic circuitry and the like , in order to optimize the detection process for a specific layer or combination of layers on a substrate 3 . process information 8 includes information such as the characteristics of the coated materials , which have been placed on the substrate 3 , as well as information concerning the first pattern 20 on the substrate 3 , which is currently expected to be within the view of the alignment detection system 15 . further , the process information 8 can include information concerning the complex topology formed by multiple first patterns that are superimposed upon one another . the modulator 10 is responsible for altering the pattern of light 2 that is emitted from the multi - channel laser printhead 1 . a wide array of modulation modalities is known in the art . in general one may divide these into reflective / diffractive and transmissive and would include tir and dmd devices for example . in all cases control of the individual channels is possible through appropriate modulator driver electronics . the comparative process described above is a spatially intermittent process . there will typically be specific areas within a pattern that will best lend themselves to processing . these are referred to as capture windows . these areas may be parts of the functional pattern of the device that is being manufactured , or they may be additional alignment marks . the location of these areas may be predefined . when they are predefined , data identifying their location is embedded in the process information 8 . as the image data path 5 transfers the image data 16 to the modulator driver board 9 , the image data path 5 recognizes the process information 8 that indicates that the system is approaching or is in a capture window . in this embodiment , the image data path 5 uses this information to trigger the comparative process . alternately , when the image data path 5 recognizes the process information 8 the image data path 5 could send a signal to the alignment detection system 15 to trigger the detection process . alignment correction refers to shifting of alignment in the cross - scan and in - scan directions . in - scan correction is accomplished through timing correction . in this specific embodiment the cross - scan correction is accomplished by sending a cross - scan control signal 28 to the cross - scan correction controller 12 to rotate an optical element 13 such that due to refraction the pattern emitted by the printhead is offset by a known amount in the cross - scan direction . note that the alignment detection system 15 transmits the sensing and detecting beam 58 through the optical element 13 such that the movement of the optical element 13 will impact the alignment detection system 15 sensing . also in this specific embodiment , the in - scan correction is accomplished by the image data path 5 through changes in head load timing . fig2 shows the components of the alignment detection system 15 . these components include the substrate 3 with first pattern 20 , the mask 22 , mask pattern 23 , photodetector 24 . the illumination source and detector electronics are not shown . as either the substrate 3 is moved past the multi - channel laser printhead 1 or the multi - channel laser printhead 1 is moved past the substrate 3 , the pattern on the substrate 3 will create a modulation of signal at the detector based upon how the first pattern 20 on the substrate 3 matches with the mask pattern 23 . the use of a vertical slit and angled slits in the mask pattern 23 provides the ability to detect both in - scan and cross - scan misalignment . fig3 shows the overlay of the first pattern image 62 with a mask pattern 23 onto a sensor area 60 in a system with no cross - scan errors . fig4 and 5 show the creation of the alignment detection output signal 11 for this system with no cross - scan error , also known as a nominal case system . in fig4 , the first pattern image 62 has just fully intersected with the mask pattern 64 , and the waveform shown below the sensor area shows that the alignment detection signal 11 has increased to a peak value and is marked as time a . as shown in fig5 , as relative movement occurs between the first pattern image 62 and the mask pattern 64 , a second peak in the alignment detection output signal 15 is generated and marked as time b . the amount of time between the occurrences of a and b is indicative of the cross - scan error . it should be clear from these figures that cross - scan error can be characterized in terms of the distance traveled between the two events , a and b . in a similar manner , fig6 and 7 illustrate the generation of the alignment detection signal 11 for a system with a negative cross - scan error . fig8 and 9 illustrate the generation of the alignment detection signal 11 for a system with a positive cross - scan error . fig1 shows representative timing differences for a system with negative , nominal , and positive cross - scan errors . details of simplified signal processing are shown in fig1 . this figure shows the in - scan and cross - scan synch inputs sent by the image data path 5 . the third input is the alignment detection signal 11 . the location of the first maximum a of the alignment detection signal 15 is measured with respect to the location of the in - scan synch pulse generated by the image data path 5 . the positional difference between these two points is the in - scan error . the positional difference from the in - scan synch pulse and the cross - scan synch pulse indicates the predicted time or distance needed to traverse from the first pulse to the second pulse on the alignment detection signal 11 . this is called the synch delta . as cross - scan error increases , the time or distance required to reach the actual second maximum on the alignment detector output is increased , as shown in fig1 . capturing the elapsed time or distance from the first maximum a to the second maximum b is the actual delta . the cross - scan error signal is the difference between the synch delta minus the actual delta . in this embodiment the laser light is 808 nm and the modulator is a tir transmissive device . the material coated onto the substrate 3 , meant to act as a resist , is laser ablative resist that is sensitive to the ir . the channel size is 5 microns and the exposed line widths and gaps that can be produced are as small as 2 microns . systems that operate in the uv would utilize a uv source and a diffractive modulator and would be capable of smaller channel sizes and feature sizes . the detection system would utilize a sensing beam generated by a laser source at a wavelength different from that of the writing beam . it should be noted that this embodiment has been described as part of a maskless lithographic system . however , the ability to detect and dynamically compensate for misalignments between a current and first pattern may be applied to many other areas , which require precision alignment of patterns . in a further embodiment , the alignment detection system 15 can be a camera and high - speed image processing which performs image matching with the expected image region . in such a system the sensing illumination would be diffuse lighting at a range of wavelengths that differ substantially from that of the writing beam . the camera and high - speed image processing is advantaged in that it would enable the determination of rotation . there is an optical design challenge associated with passing writing wavelengths and different sensing wavelengths for a detection system . one means of working around the optical issues associated with designing an optical system , which transmits writing light at 808 nm and sensing light at a different wavelength , is to place the sensing subsystem outside of the writing path . the drawback associated with this alternative is that the sensing optical path is physically displaced from the writing path . there is no direct link between the two paths , other than precision physical mounting . physical shifts between the two paths would need to be calibrated on a regular basis in order to ensure that the two were sufficiently linked . further , the sensing system could not function as part of a closed loop system , whereby it would detect the changes made by the optical element and thus enable low steady state error . one means of linking the two systems is to include use of one channel or an additional channel associated with the multi - channel laser printhead as a pointer , which instructs the sensing system where the writing beam has been directed . this pointer would be used by the sensing system to establish the physical relationship between the writing and sensing systems . use of an additional channel at the same wavelength as the writing beam is possible as long as the energy in this beam is below patterning threshold . or alternately , the process of connecting the sensing system with that of the writing system will need to occur in a non - imaging area of the substrate . if , however , an additional channel is provided that is of a non - patterning wavelength , then the linkage between the camera and the multi channel laser printhead 1 can occur continuously . use of a different wavelength avoids the risk of patterning artifacts , but requires a more complex optical design . in a still further embodiment , a pure edge detection scheme may be employed , utilizing coherent illumination that is focused to a small spot . such an arrangement is similar to that of typical the auto - focus systems . one such system shown in fig1 . typical auto focus detection systems utilizing the dual half aperture approach will provide an analog signal proportional to the height of the reflecting surface . in this system , a laser source 76 sends light to the surface of the substrate 3 through a beam splitter 78 . the light reflected from the surface of the substrate 3 , passes through the beam splitter 78 and continues through the dual wedges 74 and optics 72 , to impinge upon a quad photodetector 70 . the dual half aperture focus error detection method creates a differential signal by utilizing both halves of the optical aperture for focus detection . each half of the optical aperture is sent to either the upper or lower bi - cell of photodetector 70 through the dual wedges 74 that refract one side high and one side low . when the substrate is moved in or out from the best focus position , the spot formed on the two bi - cells that form photodetector 70 , change in equal and opposite directions . adding the signals from the two opposing sides of each bi - cell produces a signal that is twice that of the half aperture approach . by taking the difference of the sum of the other two opposing sides of the bi - cells any common noise that is riding on the signals from all the cells is removed . the result is a cleaner signal that more closely represents the true error signal for focus . the difference signal is typically normalized for consistency . the design for such a system has been described in u . s . pat . no . 5 , 406 , 541 ( kay ). such a detector signal would appear as shown in fig1 . the individual intensity of the sensors in an auto focus system such as that in fig1 can also be monitored for changes that would indicate an edge has scattered light . fig1 shows the signals generated in response to passing over an edge . in this embodiment , a distinct pulse would be generated when the small spot traversed a change in elevation on the substrate . this functions effectively as an edge detection system . in a still further embodiment , an interferometer can be used to detect changes in topology as the multi - channel laser printhead 1 with interferometer is scanned along the patterned layer surface . this system is depicted in fig1 . in this system , coherent light is directed to the patterned layer from a laser source 29 . part of the illumination passes through a beam splitter 31 and impinges upon a substrate 3 . the rest of the illumination is deflected to a mirror 30 . the reflected light from both the mirror 30 and the substrate 3 is directed to the sensor 32 . the sensor 32 receives this combined light energy which creates an interference pattern . this interference pattern is detected by the sensor 32 , which is typically a photo - detector or a ccd . in a still further embodiment , optical coherence tomography ( oct ) or low coherence interferometry , is a form of interferometry that is used to detect surface topology . a basic system diagram is depicted in fig1 . in optical coherence tomography ( oct ) a low coherence light source 34 for the interferometer has a short coherence length . examples of low coherence light sources include super luminescent diodes , lasers with extremely short pulses on the order of femtoseconds and also white light sources . the system includes two arms , a sample arm 54 which includes the substrate 3 . the second arm is a reference arm 56 , which includes a reference mirror 40 . the light from the low coherence source 34 is collimated by a collimation lens 36 and is directed to the two arms by a beam splitter 38 . the reflected beams are combined at the beam splitter 38 , acted upon by beam reducer 44 and impinge upon a photodetector 52 . photodetector 52 detects a fluctuating signal that is the result of the interference of the two beams that is directly related to the surface topology of the substrate 3 . interference only occurs when the mirror 42 in the reference arm is in a specific axial position . scanning mirror 46 scans the substrate through the objective lens 48 . if the position of the reference arm mirror is closely monitored then a signal can be generated when the axial position of the mirror indicates a specific surface change ( within the region of interest ). grazing incidence interferometry can also be used for detection of surface topographies . fig1 shows a laser beam from laser source impinging on holographic diffraction grating 61 and creating two beams of roughly equal intensity . the first order beam is separated from the zero order beam by a low angle . the first order beam grazes off of substrate 3 at a shallow angle and some of the light reflects and diffracts . the light that combines with the reference beam at the second holographic grating 63 will form an interference pattern containing the image of the relief pattern from the substrate 3 . a sensor / video camera 65 can detect the pattern . in a still further embodiment , this invention is suited for adaptive control application . since it is possible to detect patterns just after they have been created , the system could employ two detectors ; one to aid in locating the pattern point and one to inspect the pattern that has been created . data can be stored from the second detection system that can be used to enhance the next detection process . it can also be used to better calibrate the correction provided by the first sensor and correction system . it can also be used as in process inspection . in a still further embodiment , the control algorithms employed by the image data path 5 , limit the rate of change of the in - scan control and cross - scan control signal 28 . such a rate limiting control algorithm is often referred to as servo loop . this limitation on the rate of change of the control signals is used to prevent undesirable patterning artifacts . in a still further embodiment , the control algorithms employed by the image data path , does not limit the rate of change of the in - scan cross - scan control signal 28 . this type of control is appropriate where abrupt resynchronization is preferred . in a still further embodiment , the control algorithms employed may be either rate limiting or non - limiting or a combination thereof . the image data path 5 utilizes process information 8 to determine an adaptive control algorithm . in a still further embodiment , the substrate can be illuminated with an incoherent source of light and have the image of the substrate projected onto a detector . if the layers on the substrate have sufficient contrast between them then the features in the layers can be discriminated within the image . the detector could be an area array , line sensor , or single sensor . the invention has been described in detail with particular reference to certain preferred embodiments thereof , but it will be understood that variations and modifications can be effected within the scope of the invention . | 6 |
fig1 is a schematic illustration of the radio system 1 which comprises a central radio base station 2 and a plurality of independent subscriber stations 3 . the radio system 1 is of full - duplex design , i . e . each subscriber station 3 can transmit and receive user data , as can the radio base station 2 . in this context , the transmission direction 4 from the radio base station 2 to a subscriber station 3 is designated as downlink , and the transmission direction 5 from the subscriber stations 3 to the radio base station 2 is designated as uplink . in the downlink , the user data for each subscriber station 3 must be specially coded so that the subscriber station 3 can detect and pass on the data intended for it . the coding is carried out in ds - cdma modulators 6 , each subscriber station 3 being assigned at least one ds - cdma modulator 6 in the radio base station 2 . the signals which are coded in this way are fed to a summation element 7 and broadcast via a transmitter 8 with associated transmission antenna 9 . fig3 illustrates by way of example a spread function sp which in the example illustrated is a pulse sequence with half the period length t chip . the actual user signal d with the half period length t bit is gated with the spread function sp with a logic operation so that a coded user signal cd is produced . it can be seen that the coded user signal cd represents the output signal of an x - or gate with the two input variables sp and d . in fig4 a , the horizontal antenna characteristic of the transmission antenna 9 with an aperture x · y o is illustrated by way of example , x being the ratio of the downlink transmission capacity with respect to the uplink transmission capacity . overall , the reception antenna of the radio base station 2 must have the same aperture x · y o , but the latter is segmented or partitioned with the ratio x , which is illustrated graphically for x = 3 in fig4 b . fig5 illustrates the reception branch of the radio base station 2 . said branch comprises ds - cdma demodulators 10 , a switching matrix 11 , a controller 12 , an evaluation unit 13 , a digital reception bus 14 , a receiver 15 and reception antennas 16 . the reception antennas 16 together have the same horizontal antenna characteristic as the transmission antenna 9 . given three reception antennas 16 , each reception antenna 16 has , for example , an aperture of 120 20 so that the radio base station 2 is completely covered horizontally . each reception antenna 16 is connected to a receiver 15 . each receiver 15 comprises an input amplifier , a downconverter and a digitizer . at the output end , each receiver 15 is connected to the evaluation unit 13 and to the switching matrix 11 via the digital bus 14 . the switching matrix 11 is controlled by means of the controller 12 and is connected at the output end to the ds - cdma demodulators 10 . the number of ds - cdma demodulators 10 corresponds here to the number of simultaneously active subscriber stations 3 . in the uplink mode , each reception antenna 16 then receives signals from subscriber stations 3 which broadcast within its reception characteristic , it being possible for signals to be received from a subscriber station 3 by a plurality of reception antennas 16 . these signals which are conditioned by the receivers 15 are then fed to the evaluation unit 13 . the evaluation unit 13 then determines successively for each individual subscriber station 3 the reception antenna 16 with which the signal from the subscriber station 3 was received best . the results are then transferred from the evaluation unit 13 to the controller 12 which then actuates the switching matrix 11 in accordance with the results so that each ds - csma demodulator 10 is assigned the reception antenna 16 which is best for it . since no user data must be lost as a result of the selection of the best reception branch , the reception can be started in parallel until the selection has been made . however , the selection is preferably already made before the reception of the actual user data . for this purpose , before the start of the transmission of user data , each subscriber station 3 transmits a significant test frequency which can then be evaluated . the division of the reception characteristic on a segment basis can be implemented by means of various measures . firstly , separate transmission and reception antennas may be used , the reception antennas then being designed as x - separate antennas . fig6 illustrates an embodiment with x - separate antennas 16 which are also simultaneously used as transmission antennas . in this embodiment , all the x antennas 16 are operated in parallel in the transmission mode , the uniformly distributed supply of power being ensured by means of a power divider 17 . the switch - over between transmission mode and reception mode is carried out here by means of a tx - rx switch module 18 which is arranged between the power carrier 17 and the reception antenna 16 . in the example illustrated , the tx - rx switch module 18 is set to transmission mode , i . e . the reception antennas 16 are connected to the outputs of the power dividers . the state which is illustrated by broken lines corresponds to the reception mode in which the reception antennas 16 are connected to the receivers 15 ( not illustrated here ). furthermore , beam - controlled antennas or smart antennas can also be used . it is possible to change the radiation characteristic with these antennas . here , the directional information is superimposed by means of a baseband weighting and suitable interconnection of the individual reception branches . as a result , it is ultimately possible to improve the technical complexity of the antennas while simultaneously increasing the variety and flexibility with which certain antenna patterns can be set . as already stated , the evaluation of the reception quality is preferably realized by means of a test sequence before the actual transmission of user data . it is particularly convenient that the test sequence can be realized in a time - division duplex mode . since the interference level with a large number of parallel transmissions may be too high to acquire reliable information on it , the delay time between transmission and reception is lengthened somewhat and used for a subscriber station 3 which is attempting to set up a link ( incoming or outgoing ) to initially transmit a test sequence . this test sequence is evaluated in all the x - reception branches , for example by means of a matched filter . by reference to the reception result , precisely that branch which has supplied the best results is selected for the reception . depending on the number and traffic characteristics of the subscriber stations 3 , suitable measures must be taken to avoid collisions as a result of parallel transmissions of the test frequency by different subscriber stations 3 , or to minimize their effects . this can be achieved , for example , by polling methods and the transmission of subscriber - specific acknowledgments . fig7 a illustrates such a cycle for the radio base station 2 . in the time period t 1 , the radio base station 2 receives data d 1 from the subscriber stations 3 . in the time period t 2 , the delay time , a test sequence 19 is transmitted from the radio base station 2 , one test sequence 19 which is significant for a specific subscriber station 3 or a group of subscriber stations 3 being preferably transmitted per cycle . then , in the time period t 3 , the transmission of user data d 2 to the subscriber stations 3 takes place . in the subsequent delay time t 4 , the radio base station 2 then receives a test sequence 20 from one subscriber station , or the subscriber stations 3 , before the cycle begins again . in fig7 b , such a cycle is illustrated for a subscriber station 3 . in the time period t 5 , the subscriber station 3 transmits data d 1 to the radio base station 2 . in the delay time t 6 , the test sequence 19 of the radio base station 2 is received and then subsequently , in the time period t 7 , the user data d 2 which are transmitted by the radio base station 2 are received . in the subsequent delay time t 8 , the test sequence 20 is then transmitted to the radio base station 2 , and data d 1 are transmitted subsequent to that . the primary function of the test sequence 20 is to determine the best reception branch in the radio base station 2 for transmissions from a specific subscriber station 3 . however , by means of the test sequences 19 , 20 it is also possible to synchronize the subscriber stations 3 in order to compensate differences in transit time between the individual subscriber stations 3 . the method and the device can preferably be implemented in wireless local loop systems , since in these the stationary nature of the subscriber stations 3 and the existence of a service channel which controls the subscriber - dependent access to the radio channel are advantageously utilized . the various features of novelty which characterize the invention are pointed out with particularity in the claims annexed to and forming a part of the disclosure . for a better understanding of the invention , its operating advantages , and specific objects attained by its use , reference should be had to the drawing and descriptive matter in which there are illustrated and described preferred embodiments of the invention . | 7 |
the embodiment of fig1 shows an electromagnetic valve which is normally closed in its basic position , valve housing 1 of which is exemplarily configured in the type of a cartridge . the central portion of the valve housing 1 is designed as a thin - walled valve sleeve 2 which is closed from the outside by a cylinder - shaped magnet core 3 in the form of a closure plug . below the magnet core 3 , there is an annular spring element 4 which loosely abuts on the outside edge of the concavely shaped end surface of the piston - type magnet armature 5 . the thickness of the spring element 4 corresponds to the necessary rate of strength so that in the electromagnetically non - excited switching position of the valve , as shown in the drawings , the distance between the end surface of the magnet armature and the convex end surface of the magnet core is defined by the thickness of the spring element 4 and by the operative air slot which corresponds to the possible magnet armature stroke x . inside a stepped bore , the magnet armature 5 receives a spring 6 with a linear course of the characteristic curve which extends as a helical spring with its coil end through the opening in the spring element 4 onto the end surface of the magnet core 3 . consequently , magnet armature 5 is urged by the effect of spring 6 with the tappet - shaped valve closure member 7 against a valve seat 8 in the valve housing 1 , with the result that a pressure fluid channel 9 which penetrates the valve housing 1 in the horizontal and vertical directions is interrupted in the valve &# 39 ; s basic position . the tappet - shaped valve closure member 7 is fixed in the stepped bore of the magnet armature 5 , preferably by means of a press fit , and centered at its end portion close to the valve seat 8 in a guide sleeve 10 which is jammed in the valve housing 1 concentrically relative to the valve seat 8 . by way of a valve coil 11 fitted to the valve housing 1 and a yoke ring 12 that partly encloses the valve coil 11 , the magnetic circuit can be closed by energizing the valve coil 11 so that the magnet armature 5 moves in the direction of the magnet core 3 . thereby , the spring element 4 is elastically deformed and moves into abutment on the magnet core 3 where it abuts with its full surface on the illustrated inclined end surfaces of the magnet core 3 and the magnet armature 5 . a spring force of the spring element 4 that is opposed to the movement of the magnet armature 5 will act so that the magnet armature 5 is automatically braked before it can urge the spring element 4 with its full surface against the end surface of the magnet core 3 , which permits reducing , among others , the switching noise of the electromagnet . besides , the preloading force of the spring element 4 effects a quickest possible resetting of the magnet armature 5 out of the end position on the magnet core 3 after the electromagnetic excitation is completed because the resetting tendency of the spring element 4 counteracts the retaining force that is induced by remanence . it must be taken into consideration in this respect that the resetting force of the spring 6 ( which is always necessary in an electromagnet valve to return the magnet armature 5 to the basic position when the excitation discontinues , on the one hand , and which previously also served to overcome the residual magnetism , on the other hand ) can be reduced considerably due to the arrangement and use of the spring element 4 according to the present invention . it is advantageous that the effect of the magnetic force is automatically boosted during the electromagnetic excitation , while the residual magnetism after termination of the excitation is reliably overcome by the force effect of the spring element 4 which is active only in the last part of the valve stroke , i . e ., only when the magnet armature 5 approaches the magnet core 3 . designing the spring element 4 as a particularly flat spring washer which is supported on inclined end surfaces or designing the spring as a cup spring , favorably , permits achieving a progressive spring characteristic curve which allows an analog or proportional operation of the electromagnet valve by way of the actual design of the electromagnet valve as a two - position valve . more specifically , the progressive spring element 4 causes a linearization of the magnet armature force . to illustrate the present invention , the enlarged view of the magnet core portion and the magnet armature portion according to fig2 shall be referred to hereinbelow which depicts the two end positions of the magnet armature 5 in a joint view by making reference to the normally closed electromagnet valve according to fig1 . in consideration of the explanations given with respect to fig1 magnet armature 5 can be clearly seen in detail in fig2 on the right side of the valve &# 39 ; s longitudinal axis in an electromagnetically non - excited switching position in which the plate - shaped spring element 4 merely abuts on the outside edge of the concavely shaped end surface of the magnet armature so that the spring element 4 , in the area of the opening that contains spring 6 , is remote from the convexly shaped end surface of the magnet core 3 . the air slot between the top edge of the spring element 4 and the end surface of the magnet core 3 thus corresponds to the maximum magnet armature stroke x which is bridged by the magnet armature 5 in the electromagnetically excited valve switching position illustrated on the left side of the valve &# 39 ; s longitudinal axis . in the left half of the view , the spring element 4 is hence elastically biassed and abuts with its full surface on the inclined end surfaces of the magnet armature 5 and the magnet core 3 , and the thickness of the magnetic spring element 4 does not inhibit the magnetic flux , it rather bridges it in a favorable fashion . different from the descriptions in fig1 and 2 , fig3 shows an application of the idea underlying this invention for an electromagnetically non - excited , normally open electromagnet valve . based on the already described design of the valve housing 1 with valve seat 8 integrated therein , with pressure fluid channel 9 and guide sleeve 10 according to the illustration explained in fig1 the magnet core 3 configured as a hollow cylinder is inserted into the bottom end portion of valve sleeve 2 which is secured to the magnet core 3 by means of an outside calked portion of the valve housing . the tappet - shaped portion of valve closure member 7 consequently extends through the magnet core 3 in the direction of the closed area of valve sleeve 2 until into magnet armature 5 . the end surface of armature 5 is convexly shaped in the direction of the pair of spring elements 4 , shown exemplarily , and the end surface of magnet core 3 disposed beneath the spring elements 4 has a concave shape . a spring 6 arranged in the through - bore of the magnet core 3 maintains the magnet armature 5 in abutment on the valve dome in the electromagnetically non - excited basic position , whereby the valve closure member 7 establishes an unhindered pressure fluid passage by way of pressure fluid channel 9 . in this valve position , the spring elements 4 which are combined to form a spring assembly abut loosely on the projecting outside edge of the end surface of the magnet core so that a sufficiently large axial distance between magnet armature 5 and magnet core 3 remains to execute the valve stroke similarly to the explanation of the electromagnet valve according to fig1 . as has already been mentioned , spring element 4 can be composed of the series arrangement of several individual spring washers which , in the electromagnetically energized valve closing position , are compressed elastically between the end surfaces of the magnet armature 5 and the magnet core 3 with almost full surfaces , to ensure a reliable closing of the valve closure member 7 . different from the embodiments according to fig1 to 3 referred to hereinabove , fig4 discloses using a curved spring element 4 in the shape of a cup spring , as mentioned already hereinabove , which additionally simplifies the manufacture of magnet armature 5 and magnet core 3 because now plane , i . e ., horizontally extending end surfaces on the magnet armature 5 and magnet core 3 , instead of the inclined end surfaces , face the spring element 4 . in the practice , however , the manufacture of a cup spring is more sophisticated and less precise than the manufacture of the flat plate - type washer described hereinabove . reference is made to the above - mentioned fig1 to 3 with regard to the functioning and further technical details of the subject matter of fig4 . attention should also be paid that for a proper functioning , the electromagnet valves according to fig1 to 4 must be acted upon hydraulically from the direction of the pressure fluid channel 9 that opens vertically into the valve housing 1 so that the inlet - side pressure fluid always prevails at the end surface of the valve closure member 7 , irrespective of whether the valve closure member 7 adopts the open or closed position . consequently , the pressure fluid leaves the valve housing 1 exclusively through the pressure fluid channel 9 which extends crossly out of valve housing 1 . summarizing , it can be pointed out with respect to the examples described above that the use of the plate - shaped , relatively stiff spring element 4 that conducts the magnetic flux is considered as essential feature of the present invention . said spring element , in the initially non - excited magnetic circuit , is ineffective and will be elastically compressed by the magnet armature 5 and urged with approximately its full surface against the magnet core 3 only when it is electromagnetically energized at the end of the maximum performable valve stroke . because the preferably ferritic spring element 4 is no obstacle for the magnetic circuit when the spring element 4 abuts with its full surface on the magnet core 3 in the electromagnetically energized end position of the magnet armature 5 , the working stroke x corresponds quasi to the air slot being bridged by the magnet armature 5 , that means , a residual air slot , as known from the state of the art , weakening the magnetic circuit does not exist . additionally , after completion of the electromagnetic excitation , the spring element 4 due to its elastic preload applies a resetting force to the magnet armature 5 which counteracts the residual magnetism and , thus , prevents the undesirable sticking of the magnet armature . thus , the present invention brings about an effective rise in the magnetic force at the beginning of the excitation of the magnet armature 5 because the working stroke x now corresponds to the air slot that must be bridged . irrespective of the embodiment of the above - mentioned electromagnet valves which is chosen in the individual case , it principally applies that the spring force of the spring element 4 is at least as great as the magnet force induced by remanence . besides , the present invention is to be interpreted so that the necessary valve coil current for operating the electromagnet valve can be reduced by the spring element 4 which conducts the magnetic flux and the possible force reduction of spring 6 . | 5 |
in the following detailed description , reference is made to the accompanying drawings which form a part hereof , and in which is shown by way of illustration specific embodiments in which the invention may be practiced . these embodiments are described in detail sufficient to enable those skilled in the art to practice the invention , and it is to be understood that other embodiments may be utilized and that structural , logical and mechanical changes may be made without departing from the spirit and scope of the present invention . the following detailed description is , therefore , not to be taken in a limiting sense , and the scope of the present invention is defined by the appended claims . illustrated in fig1 - 3 is an embodiment of an led light fixture ( 20 ). the fixture base ( 22 ) consists of an elongated stanchion with a generally crescent shaped cross section . the semi - enclosed side of the fixture base ( 22 ) is referred to as the bezel side ( 24 ) which is opposite from the back side ( 26 ). the back side ( 26 ) includes a flat section referred to as back plate ( 34 ). the depression running the length of the bezel side ( 24 ) is referred to as trough ( 28 ). in the preferred embodiment fixture ( 20 ), the fixture base ( 22 ) consists of extruded aluminum because the material is light , easily fabricated , economical , and has the added benefit of sinking and evenly distributing heat generated by the light emitting diodes or “ leds ” ( 42 ). it is anticipated the fixture base ( 22 ) could alternately be fabricated from other materials including but not limited to other metals , alloys , plastics , glass reinforced resins , carbon filaments , or ceramics . the fixture base ( 22 ) is illustrated in the drawings as being six foot in length just for the purpose of example and the invention is not so limited . it is anticipated the fixture base ( 22 ) could be of any length appropriate to the industrial lighting application . it is also anticipated that a number of fixture base ( 22 ) members could be combined in a single led lighting fixture ( 20 ). as illustrated in fig1 , six bezels ( 54 ) are retained by the fixture base ( 22 ) on the bezel side ( 24 ), each bezel ( 54 ) includes three integrated lenses ( 60 ). this configuration of bezels ( 54 ) and lenses ( 60 ) is merely illustrative and not limiting , as it is anticipated that the number of bezels ( 54 ) or the number of lenses ( 60 ) per bezel ( 54 ) could vary according to the needs of application , manufacture or cost . in the embodiments illustrated the bezel ( 54 ) and lens ( 60 ) are formed from a single piece of transparent material , including but not limited to ; acrylic , polycarbonate , butyrate crystal or glass . the type and orientation of the lens ( 60 ) would be specific to the bezel ( 54 ) although it is anticipated that the lens ( 60 ) could be a separate insert within the bezel ( 54 ). attached to the back side ( 26 ) of the fixture base ( 22 ), are two mounting clips ( 38 ). the mounting clip ( 38 ) can be placed anywhere along the back side ( 26 ) of the fixture base ( 22 ) by gripping the opposing mounting flanges ( 36 ) which are formed by the sides of the back plate ( 34 ) of the fixture base ( 22 ). the mounting clip ( 38 ) provides a intermediate mounting element between the led lighting fixture ( 20 ) and other mounting apparatus including but not limited to such elements as lines , cables , plates , flanges , rails , stanchions , joists , etcetera , for the purposes of positioning the led lighting fixture ( 20 ). the mounting clip ( 38 ) employs a pair of opposed , spring biased , tabs to engage the mounting flange ( 36 ) and encompass a section of the back plate ( 34 ). at each end of the led lighting fixture ( 20 ) an end cap ( 48 ) is included to retain the led lighting fixture &# 39 ; s ( 20 ) component parts . the length of the fixture base ( 22 ) and the design of the bezels ( 54 ) are calculated to place the led ( 42 ) in relation to the lens ( 60 ) so as to produce a light output pattern ( 70 ) that could be characterized by a specific illumination footprint ( 72 ). the end cap ( 48 ) would serve to secure the bezels ( 54 ) to the fixture base ( 22 ) to achieve the led ( 42 ) lens ( 60 ) relationship . as seen in fig1 , the end cap ( 48 ) may include an aperture to allow throughput of the electrical conductors ( 46 ); alternately the end cap ( 48 ) may not include such an aperture . the end cap ( 48 ) is held in place by a fastener ( 50 ). fig2 illustrates two different types of fasteners , the first is the use of a pair of self threading screw fasteners ( 50 ), the other is a tension biased caliper fastener ( 50 ) that would allow a quick tool - less access to the bezel ( 54 ) or the printed circuit board ( 40 ). the fasteners ( 50 ) illustrated are typical self threading metal screws but the invention is not so limited . it is anticipated that a wide variety of fastening devices could be employed , including but not limited to biased clips , rivets , hooked members , threaded connectors , tension clasps , staples , quick release fastener ( 51 ), etcetera . an end cap ( 48 ) employing a hand operated , quick release fastener ( 51 ) allows for quick and easy bezel ( 54 ) replacement without the need for tools . the fasteners ( 50 ) engage fastener revivers ( 32 ) which are a part of the fixture base ( 22 ). in the illustrated embodiment the fastener receivers ( 32 ) take the form of crescent shaped cavities of the extrusion into which a self threading screw type fastener ( 50 ) could engage its threads . as evident to those skilled in the art reciprocal design elements of the fixture base ( 22 ) could be employed for any of the other fastener types formerly anticipated . fig2 is an exploded view of the embodiment demonstrated in fig1 . this view affords a view of the printed circuit board “ pcb ” ( 40 ) onto which the led ( 42 ) is mounted . the led ( 42 ) in this embodiment is a “ high intensity light emitting diode ” that has a volume of light appropriate to the area to be illuminated . in the drawing there are three leds ( 42 ) mounted to six individual pcbs ( 40 ) but this configuration is only illustrated as an example . it is anticipated that a single pcb ( 40 ) could run the full length of the fixture base ( 22 ) including all eighteen leds ( 42 ) or that the ratio of leds ( 42 ) to pcbs ( 40 ) is one to one . this configuration of pcbs ( 40 ) and leds ( 42 ) is merely illustrative and not limiting , as it is anticipated that the number of pcbs ( 40 ) or the number of leds ( 42 ) per pcb ( 40 ) could vary . noticeable in the illustrations is the consistency of leds ( 42 ) with the number lenses ( 60 ) but this too , is just and example of an efficient and easily manufactured embodiment as it is anticipated that clusters of leds ( 42 ) could be mounted in relation to a single lens ( 60 ) to produce the same desired effect . in the illustrated embodiment the pcbs ( 40 ) are electrically connected to one another by pcb connector clips ( 44 ). the pcb connector clips ( 44 ) include a number of electrical conductive conduits to pass electricity from pcb ( 40 ) to pcb ( 40 ) in a series or parallel scheme . the clips may also provide a mechanical means to hold the pcbs ( 40 ) to each other and retain the pcb ( 40 ), and therefore the leds ( 42 ), in the proper orientation with respect to the lens ( 60 ). at the either end of the fixture base ( 22 ) the pcb ( 40 ) can be connected to either a power source , or to another led lighting fixture ( 20 ) through the agency of electrical conductors ( 46 ). since the electrical conductors ( 46 ) are not limited to providing power from the power source , some of the electrical conductors ( 46 ) could include control circuitry for direct remote control or control via an interactive system , such as motion sensors , timers , microprocessor input or via networked signals . fig2 also shows a choice of fasteners ( 50 ) one choice includes a standard set of screw type fasteners ( 50 ), the other is a quick release fastener ( 51 ) which comprises a pair of gripping fingers that engage both fastener receivers ( 32 ) within the fixture base ( 22 ) incorporated with a tension biased hinge which would allow a tool - less quick release from the channels of the fastener receivers ( 32 ). it may be desirable in some applications to include a bezel gasket ( 52 ) between the end cap ( 48 ) and bezel ( 54 ) to compress the bezels ( 54 ) against one another to prevent open gaps into the interior of the led lighting fixture ( 20 ) where dust , fumes , vapors and debris may enter . fig3 is a cross section of the led lighting fixture ( 20 ) at the intersection of a bilateral lens ( 66 ) and an led ( 42 ). this view better illustrates the system for retaining the bezel ( 54 ) within the trough ( 28 ) of the fixture base ( 22 ) through the agency of bezel flanges ( 30 ) integrated into the cross sectional extrusion of the fixture base ( 22 ). the pair of bezel flanges ( 30 ) forms a double falcate shape or channel into which the sides of the bezel ( 54 ) may be inserted . in fig3 the mounting clip ( 38 ) shown includes a pair of tension clips with tabs ( 78 ) that engage , mounting flange ( 36 ) integrated into the length of the fixture base ( 22 ). a pair of bias leaves ( 80 ) also provide constant tension against the back plate ( 34 ) assuring a fixed grip at all times . this design allows the mounting clip ( 38 ) to be fixed to any portion of the length of the fixture base ( 22 ). the bezel ( 54 ) shown in fig3 is at the midpoint of a bilateral lens ( 66 ). the bezel face ( 56 ) defines the exterior or bezel side ( 24 ) of the led lighting fixture ( 20 ). the opposite face , generally disposed to the interior of the led lighting fixture ( 20 ) is referred to as the bezel interior ( 58 ). the bezel interior ( 58 ) side of the bilateral lens ( 66 ) demonstrates the topography that produce the light output pattern ( 70 ) that defines the illumination footprint ( 72 ). the pcb ( 40 ) fits in a cavity formed within the bezel interior ( 58 ) and the fixture base ( 22 ). in the illustrated embodiment the part of the fixture base ( 22 ) contacting the pcb ( 40 ) is the material constituting the fastener receiver ( 32 ) but it is anticipated that other design elements of the fixture base ( 22 ) could provide a suitable retention means . fig4 a demonstrates the bezel interior ( 58 ) of a bezel ( 54 ) integrated with three round lenses ( 62 ). the round lens ( 62 ) redirects much of the light radiating omni - directionally from the led ( 42 ) to focusing the majority of the light output pattern ( 70 ) perpendicular to the bezel face ( 56 ) to provide a generally round illumination footprint ( 72 ). fig4 b is a plan view of a led lighting fixture ( 20 ) wherein the bezel ( 54 ) on the far right end has been integrated with round lenses ( 62 ). the light output pattern ( 70 ) from each individual led ( 42 ) and lens ( 60 ) is generally equally radiant in all directions but the use of three led ( 42 ) and lens ( 60 ) combinations produces a slightly oval illumination footprint ( 72 ). fig5 a demonstrates the bezel interior ( 58 ) of a bezel ( 54 ) integrated with three cat - eye lenses ( 64 ). the cat - eye lens ( 64 ) redirects much of the light radiating omni - directionally from the led ( 42 ) in a linear light output pattern ( 70 ) resembling a bilaterally flattened cone or triangular shape from the bezel face ( 56 ) to provide a significantly elongated elliptical illumination footprint ( 72 ). fig5 b is a plan view of a led lighting fixture ( 20 ) wherein the bezel ( 54 ) on the far right end has been integrated with cat - eye lenses ( 64 ). the light output pattern ( 70 ) from each individual led ( 42 ) and lens ( 64 ) forms an elongated ellipse oriented along the length of the led lighting fixture ( 20 ) but the use of three led ( 42 ) and lens ( 64 ) combinations produces an even more elongated oval illumination footprint ( 72 ). the bezel ( 54 ) on the far left end of the led lighting fixture ( 20 ) also utilizes three cat - eye lenses ( 64 ) but the lenticular topography of the cat - eye lenses ( 64 ) has been rotated 90 ° thereby reorienting the elongated ellipse from extending parallel to the length of the led lighting fixture ( 20 ) to extending perpendicular to the length of the led lighting fixture ( 20 ). the illumination footprint ( 72 ) thus produced from this light output pattern ( 70 ) is closer in shape to a rectangle . it is anticipated that the lenses ( 64 ) integrated into the bezel ( 54 ) could be oriented in any direction producing a variety of illumination footprints ( 72 ). fig6 a demonstrates the bezel interior ( 58 ) of a bezel ( 54 ) integrated with three bilateral lenses ( 66 ). the bilateral lens ( 66 ) redirects much of the light radiating omni - directionally from the led ( 42 ) in a light output pattern ( 70 ) resembling pair of focused crescents , wherein the central bilaterally flattened cone , similar to the output of the cat - eye lens ( 64 ), receives much less light that the remaining section of the cone , formed by the round lens ( 62 ). this light output pattern ( 70 ) creates a generally rectilinear illumination footprint ( 72 ) but also provides a larger majority of light when used to provide light along a vertical axis . fig6 b is a plan view of a led lighting fixture ( 20 ) wherein the bezel ( 54 ) on the top end has been integrated with bilateral lenses ( 66 ). the light output pattern ( 70 ) from each individual led ( 42 ) and lens ( 66 ) forms an ellipse oriented along the length of the led lighting fixture ( 20 ). the use of three led ( 42 ) and lens ( 66 ) combinations produces a slightly wider illumination footprint ( 72 ). the bezel ( 54 ) on the bottom end of the led lighting fixture ( 20 ) also utilizes three bilateral lenses ( 66 ) but the lenticular topography has been rotated 90 ° thereby reorienting the ellipse from extending parallel to the length of the led lighting fixture ( 20 ) to extending perpendicular to the length of the led lighting fixture ( 20 ). the illumination footprint ( 72 ) thus produced from this light output pattern ( 70 ) is generally square . fig6 c is a profile view demonstrating the advantage of the bilateral lens ( 66 ), wherein it is necessary to provide a light output pattern that provides lighting to the sides so that vertical surfaces , such as palette racks ( 5 ), shelves or machinery sides ( 15 ) of vertically oriented manufacturing machinery ( 11 ), requires more light than the floor ( 3 ) to maintain the same ambient luminosity . fig7 a demonstrates the bezel interior ( 58 ) of a bezel ( 54 ) integrated with three composite lenses ( 68 ). the composite lens ( 68 ) is a combination of the lenticular effects of one half of the round lens ( 62 ) on one half of the lens ( 68 ) and the lenticular effects of one half of the bilateral lens ( 66 ) on the other half . this composite lens ( 68 ) redirects much of the light radiating omni - directionally from the led ( 42 ) in a generally circular shape in one direction and in a concentrated crescent to in the opposite direction providing a light output pattern ( 70 ) composite to the dichotomous effects of the round lens ( 62 ) and the bilateral lens ( 66 ) resulting in an illumination footprint resembling a capital “ d ”. it is anticipated that different types of lenses ( 60 ) or their constituent lenticular effects could be combined in multiple combinations to produce a plurality of composite lenses ( 68 ) that would each produce particular light output patterns ( 70 ) and illumination footprints ( 72 ). fig7 b is a plan view of a led lighting fixture ( 20 ) wherein the bezel ( 54 ) on the far right end has been integrated with composite lenses ( 68 ). the light output pattern ( 70 ) from each individual led ( 42 ) and lens ( 68 ) is generally “ d ” shaped . the use of three led ( 42 ) and lens ( 68 ) in combination produces a taller or narrow “ d ” shape . illumination footprint ( 72 ) of the bezel ( 54 ) on the far left side , wherein the composite lenses ( 68 ) have been rotated 90 ° produces a shorter or wider “ d ” shape . it is anticipated that a wide variety of lenses ( 60 ) using a plurality of lenticular effects , either singularly or in combination , could produce a profusion of light output patterns ( 70 ) producing an almost countless number of illumination footprints ( 72 ). the four lenses ( 60 ) expressed in this specification merely represent an group of examples used to illustrate the concept of the use of custom light output patterns ( 70 ) to light those parts of a building interior that require light for operation while not wasting light on those areas that are not required to be illuminated in the course of their operation . fig8 is a schematic diagram of a unique illumination footprint ( 72 ) formed by various light output patterns ( 70 ) created by utilizing a number of bezels ( 54 ) including a variety of lenses ( 60 ). the top most light output pattern ( 70 a ) is produced with round lenses ( 62 ). the second light output pattern ( 70 b ) down from the top is produced using unilateral lenses ( 68 ) wherein the round lens ( 62 ) half is oriented to the right and the bilateral lens ( 66 ) half is oriented to the left . the third light output pattern ( 70 c ) down from the top is produced using bilateral lenses ( 66 ) wherein the concentrated light is projected perpendicular to the length of the led lighting fixture ( 20 ). the forth light output pattern ( 70 d ) down from the top is produced using round lenses ( 62 ) exactly like the light output pattern ( 71 a ) at the top . the fifth light output pattern ( 70 e ) down from the top is produced with cat - eye lenses ( 64 ) which have their elongated ellipse oriented perpendicular to the length of the led lighting fixture ( 20 ). the bottom most light output pattern ( 70 f ) is produced with cat - eye lenses ( 64 ) which have their elongated ellipse oriented parallel to the length of the led lighting fixture ( 20 ). fig9 is a plan view of a warehouse / manufacturing area where the interior area ( 1 ) utilizes a number of led lighting fixtures ( 20 ) with customized illumination footprints ( 72 ). the illumination footprints ( 72 ), in heavy lines , are customized for the pallet racks ( 5 ) and manufacturing machinery ( 11 ) over which they are mounted . the distribution of light to working areas or surfaces requiring light for optimal operation are all covered and adequately illuminated . the amount of light falling on the rack tops ( 7 ) or machinery tops ( 13 ) is kept to a minimum making the lighting more efficient . it should be appreciated from the foregoing description and the many variations and options disclosed that , except when mutually exclusive , the features of the various embodiments described herein may be combined with features of other embodiments as desired while remaining within the intended scope of the disclosure . it is to be understood that the above description is intended to be illustrative , and not restrictive . many other embodiments and combinations of elements will be apparent to those skilled in the art upon reviewing the above description and accompanying drawings . the scope of the invention should , therefore , be determined with reference to the appended claims , along with the full scope of equivalents to which such claims are entitled . | 5 |
the present invention may be embodied in a number of different example configurations , and several examples of vehicle heating and cooling systems constructed in accordance with , and embodying , the principles of the present invention will be described separately below . referring initially to fig1 of the drawing , depicted at 20 therein is an example dc heating and cooling system 20 adapted to operate in conjunction with a structure system 22 . the structure system 22 comprises a cabin 30 , ducting 32 , and a dc power system 34 having one or more batteries 36 . the structure system 20 may be , as examples , a vehicle such as a car , truck , or boat or a remote structure such as a cabin or shipping container . the cabin 30 defines the area of the structure system 22 to be heated and / or cooled . the ducting 32 allows the flow of heated and / or cooled air through the cabin 30 . the cabin 30 and the ducting 32 will be defined by the characteristics of the structure system 22 , are not per se part of the present invention , and will not be described herein in detail . the dc power system 34 will take many forms and will be defined by the nature of the structure system 22 . for example , if the structure system 22 is a car , truck , or boat , the dc power system 34 will typically include a conventional alternator connected to an internal combustion engine , and the alternator is configured to charge the battery or batteries 36 when the internal combustion engine is operating . if the structure is a remote cabin or possibly a shipping container , the dc power system 34 may include or be connected to a solar power system and / or generator , and the solar power system and / or generator are configured to charge the battery or batteries 36 . in any case , the dc power system 34 will typically be the sole source of power to the structure system 22 , and the present invention is of particular significance when utility ac power is not available to the structure system 22 . while the principles of the present invention may be used when a utility ac power signal is available to the structure system 22 , ac power powered heating and cooling systems may be more effective in the event that utility ac power is available . fig1 further shows that the example heating and cooling system 20 depicted therein conventionally comprises a compressor 40 , a condenser 42 , an evaporator 44 , and an accumulator 46 connected by a conduit system 48 to define a conventional refrigeration system . in addition , the example heating and cooling system 20 further comprises a drier 50 , a metering device 52 , a condenser fan 54 , and an evaporator blower 56 . the conduit system 48 defines a liquid line 60 extending between the condenser 42 and the evaporator 44 , a suction line 62 extending between the evaporator 44 and compressor 40 , and a discharge line 64 extending between the compressor 40 and the condenser 42 . the drier 50 and metering device 52 are arranged in the liquid line 60 . the accumulator 46 is arranged in the suction line 62 . when the system operates , the dc power supply 34 is connected to the compressor 40 , the condenser fan 54 , and the evaporator blower 56 . the compressor 40 forces refrigerant through the conduit system 48 in a conventional refrigeration cycle . at the same time , the condenser fan 54 forces air to flow over the condenser 42 , resulting in warm air 70 flowing into the ducting 32 . the evaporator blower 56 causes air to flow over the evaporator 44 , resulting in cold air 72 flowing into the ducting 32 . the ducting 32 operates in a conventional manner to allow the warm air 70 or the cold air 72 to flow into the cabin 30 as desired . because the example dc heating and cooling system 22 operates based on a dc voltage supplied by the battery 36 of the power supply 34 , the size and operating characteristics of the compressor 40 are typically limited and the compressor 40 may not operate effectively over the entire range of operating parameters of the example dc heating and cooling system 22 . because the characteristics of the example dc heating and cooling system 22 are typically fixed , the compressor 40 will not operate with optimum efficiency under at least some of the operating parameters of the example dc heating and cooling system 22 . turning now to fig2 of the drawing , depicted therein is a first example dc heating and cooling system 20 a that may be used in place of the dc heating and cooling system 20 with the structure system 22 as depicted in fig1 and described above . the first example dc heating and cooling system 20 a comprises a compressor 120 , a condenser 122 , an evaporator system 124 , and a variable accumulator 126 . a conduit system 128 is configured such that refrigerant fluid flows from the compressor 120 to the condenser 122 , from the condenser 122 to the evaporator system 124 , from the evaporator system 124 to the variable accumulator 126 , and back to the compressor 120 . the example compressor 220 and condenser 222 are or may be conventional . fig2 illustrates that the evaporator system 124 comprises a primary coil 130 , a secondary coil 132 , a primary metering device 134 , a secondary metering device 136 , a first valve 140 , and , optionally , a second valve 142 . a drier 144 is arranged upstream of the evaporator system 124 . the valves 140 and 142 are operable to allow or prevent refrigerant fluid from flowing from the condenser 122 through the secondary metering device 136 and secondary coil 132 . the evaporator system 124 may thus be operated in a first configuration in which the valves 140 and 142 are configured to allow refrigerant fluid to flow only through the primary coil 130 and in a second configuration in which the valves 140 and 142 are configured to allow refrigerant fluid to flow through both the primary coil 130 and the secondary coil 132 . fig2 further illustrates that the example variable accumulator 126 comprises an accumulator assembly 150 and an actuator assembly 152 . the accumulator assembly 150 comprises a housing 160 and a piston 162 comprising a head portion 164 and a shaft portion 166 . the head portion 164 is arranged within the housing 160 to define a sealed accumulator chamber 168 . the shaft portion 166 extends from the housing 160 and engages the actuator assembly 152 . the actuator assembly 152 is capable of moving the piston 162 relative to the housing 160 such that a volume of the actuator chamber 168 may be varied between a first volume ( solid lines in fig2 ) and a second volume ( broken lines in fig2 ). the actuator assembly 162 may be a screw actuator , pneumatic or hydraulic actuator , or any other actuator cable of causing linear displacement of the piston 162 as shown by a comparison of the solid and dotted lines in fig2 . the first example dc heating and cooling system 20 a further optionally comprises a control system comprising a controller 170 and first and second sensors 172 and 174 . the first and second sensors 172 and 174 measure and / or quantify characteristics of the refrigerant fluid , and the example first and second sensors 172 and 174 measure the temperature and pressure , respectively , of the refrigerant fluid . additional sensors such may be connected to the controller 170 to measure ancillary characteristics of the dc heating and cooling system 20 a such as outside temperature and cabin temperature . further , the controller 170 may optionally be connected to user input devices such as a control panel or thermostat . the example conduit system 128 defines a liquid line 180 , a suction line 182 , and a discharge line 184 . the example sensor 172 and 174 are arranged in the suction line 182 but may be arranged at other locations as appropriate . the use of the example evaporator system 124 and the example variable accumulator 126 effectively allow the characteristics of the first example dc heating and cooling system 20 a to be varied during operation thereof . in the first example dc heating and cooling system 20 a , the example controller 170 implements logic that operates the valves 140 and / or 142 and actuator 152 to alter the characteristics of the first example dc heating and cooling system 20 a to optimize the performance of the compressor 120 and thus the entire dc heating and cooling system 20 a . turning now to fig3 of the drawing , depicted therein is a second example dc heating and cooling system 20 b that may be used in place of the dc heating and cooling system 20 with the structure system 22 as depicted in fig2 and described above . the second example dc heating and cooling system 20 a comprises a compressor 220 , a condenser 222 , an evaporator system 224 , and an accumulator 226 . a conduit system 228 is configured such that refrigerant fluid flows from the compressor 220 to the condenser 222 , from the condenser 222 to the evaporator system 224 , from the evaporator system 224 to the variable accumulator 226 , and back to the compressor 220 . the example compressor 220 , condenser 222 , and accumulator 226 are or may be conventional . fig3 illustrates that the evaporator system 224 comprises a primary coil 230 , a secondary coil 232 , a primary metering device 234 , a secondary metering device 236 , a first valve 240 , and , optionally , a second valve 242 . a drier 244 is arranged upstream of the evaporator system 224 . the valves 240 and 242 are operable to allow or prevent refrigerant fluid from flowing from the condenser 222 through the secondary metering device 236 and secondary coil 232 . the evaporator system 224 may thus be operated in a first configuration in which the valves 240 and 242 are configured to allow refrigerant fluid to flow only through the primary coil 230 and in a second configuration in which the valves 240 and 242 are configured to allow refrigerant fluid to flow through both the primary coil 230 and the secondary coil 232 . the second example dc heating and cooling system 20 b further optionally comprises a control system comprising a controller 270 and first and second sensors 272 and 274 . the first and second sensors 272 and 274 measure and / or quantify characteristics of the refrigerant fluid , and the example first and second sensors 272 and 274 measure the temperature and pressure , respectively , of the refrigerant fluid . additional sensors such may be connected to the controller 270 to measure ancillary characteristics of the dc heating and cooling system 20 b such as outside temperature and cabin temperature . further , the controller 270 may optionally be connected to user input devices such as a control panel or thermostat . the example conduit system 228 defines a liquid line 280 , a suction line 282 , and a discharge line 284 . the example sensor 272 and 274 are arranged in the suction line 282 but may be arranged at other locations as appropriate . the use of the example evaporator system 224 effectively allow the characteristics of the second example dc heating and cooling system 20 b to be varied during operation thereof . in the second example dc heating and cooling system 20 b , the example controller 270 implements logic that operates the valves 240 and / or 242 to alter the characteristics of the second example dc heating and cooling system 20 b to optimize the performance of the compressor 220 and thus the entire dc heating and cooling system 20 b . turning now to fig4 of the drawing , depicted therein is a third example dc heating and cooling system 20 c that may be used in place of the dc heating and cooling system 20 with the structure system 22 as depicted in fig4 and described above . the third example dc heating and cooling system 20 c comprises a compressor 320 , a condenser 322 , an evaporator 324 , and a variable accumulator 326 . a conduit system 328 is configured such that refrigerant fluid flows from the compressor 320 to the condenser 322 , from the condenser 322 to the evaporator system 324 , from the evaporator system 324 to the variable accumulator 326 , and back to the compressor 320 . the example compressor 220 , condenser 222 and evaporator 324 are or may be conventional . fig4 illustrates that the evaporator 324 comprises a coil 330 and is connected to a metering device 332 and a drier 340 . fig4 further illustrates that the example variable accumulator 326 comprises an accumulator assembly 350 and an actuator assembly 352 . the accumulator assembly 350 comprises a housing 360 and a piston 362 comprising a head portion 364 and a shaft portion 366 . the head portion 364 is arranged within the housing 360 to define a sealed accumulator chamber 368 . the shaft portion 366 extends from the housing 360 and engages the actuator assembly 352 . the actuator assembly 352 is capable of moving the piston 362 relative to the housing 360 such that a volume of the actuator chamber 368 may be varied between a first volume ( solid lines in fig4 ) and a second volume ( broken lines in fig4 ). the actuator assembly 362 may be a screw actuator , pneumatic or hydraulic actuator , or any other actuator cable of causing linear displacement of the piston 362 as shown by a comparison of the solid and dotted lines in fig4 . the third example dc heating and cooling system 20 c further optionally comprises a control system comprising a controller 370 and first and second sensors 372 and 374 . the first and second sensors 372 and 374 measure and / or quantify characteristics of the refrigerant fluid , and the example first and second sensors 372 and 374 measure the temperature and pressure , respectively , of the refrigerant fluid . additional sensors such may be connected to the controller 370 to measure ancillary characteristics of the dc heating and cooling system 20 c such as outside temperature and cabin temperature . further , the controller 370 may optionally be connected to user input devices such as a control panel or thermostat . the example conduit system 328 defines a liquid line 380 , a suction line 382 , and a discharge line 384 . the example sensor 372 and 374 are arranged in the suction line 382 but may be arranged at other locations as appropriate . the use of the evaporator system 324 and variable accumulator effectively allow the characteristics of the third example dc heating and cooling system 20 c to be varied during operation thereof . in the third example dc heating and cooling system 20 c , the example controller 370 implements logic that operates the valves 340 and / or 342 and actuator 352 to alter the characteristics of the third example dc heating and cooling system 20 c to optimize the performance of the compressor 320 and thus the entire dc heating and cooling system 20 c . a multi - mode evaporator system such as the example evaporator systems 124 and 224 and / or the variable accumulator such as the example variable accumulator systems 126 and 326 may be used as part of any heating and cooling system configured to operate using dc power . as examples , the multi - mode evaporator and variable accumulator of the present invention may be used as the evaporator and / or accumulator of the dc heating and cooling systems depicted and described in the applicant &# 39 ; s co - pending u . s . provisional patent application ser . no . 61 / 950 , 719 , and the contents of the &# 39 ; 719 provisional application are incorporated herein by reference . | 5 |
in the figures , identical reference numerals relate to identical or functionally equivalent components unless otherwise indicated . fig2 shows a schematic block diagram of an embodiment of an apparatus according to the invention for the transmission of data ds , r 1 , r 2 and energy vs 1 , vs 2 via network nodes 2 - 4 of a specific network 1 . the network nodes 2 - 4 are coupled to a respective number of terminals 5 - 10 . without loss of generality , the respective network nodes 2 - 4 are in each case coupled to two terminals 5 - 10 in the embodiment in fig2 . for example , network node 2 is coupled to terminals 5 and 6 . the bus 11 for coupling of network nodes 2 - 4 is equipped with a transmission line 12 and a receiving line 13 . the transmission line 12 and the receiving line 13 preferably each take the form of a twin - core cable . the bus 11 couples the network nodes 2 - 4 in a daisy - chain arrangement . the transmission line 12 and the receiving line 13 are preferably looped through the network nodes 2 - 4 . to amplify the signals on the transmission line 12 and the receiving line 13 , the respective network node 2 - 4 is preferably equipped with an amplification device 15 - 20 . further , a bus control device 14 is provided to control the bus 11 . the bus control device 14 is integrated , in particular , in the central control device of the aircraft . the bus control device 14 is further equipped with a first means 21 set up to transmit data r 1 , r 2 defined according to the specific network 1 as data - voltage signals ds via the transmission line 12 and the receiving line 13 . the first means 21 is here set up , in particular , to transmit , via the bus 11 , first frames r 1 , for example cids frames , with safety - relevant data d 1 , and second frames r 2 with non - safety - relevant data d 2 , for example ip data packets or tcp / ip data packets , defined according to the specific network 1 , for example the ethernet network , as data - voltage signals ds in a predetermined sequence . the predetermined sequence of the first frames r 1 and the second frames r 2 may be , for example , an alternating sequence . the respective time interval zs 1 - zs 2 between two respective first frames r 1 transmitted via the transmission line 12 and between two respective first frames r 1 transmitted via the receiving line 13 is set as a function of a specific sampling rate of the bus 11 through the coupled terminals 5 - 10 . within the respective time interval zs 1 - zs 2 , at least one respective second frame r 2 is transmitted via the transmission line 12 and via the receiving line 13 in addition to a respective first frame r 1 . the network nodes 2 - 4 are preferably also set up for a transmission of this kind . the bus control device 14 further comprises a second means 22 . the second means 22 is set up to load the data - voltage signals ds on the transmission line 12 with first supply - voltage signals vs 1 suitable for supplying voltage to the devices of a first aircraft system . the bus control device 14 further comprises a third means 28 . the third means 28 is set up to load the data - voltage signals ds on the receiving line 13 with second supply - voltage signals vs 2 suitable for supplying voltage to the devices of a second aircraft system . the first aircraft system here exhibits , in particular , a higher safety rating than the second aircraft system . for example , the first aircraft system takes the form of a cabin management system ( cids system ) of the aircraft , and the second aircraft system takes the form of a reading lamp system with reading lamps in the cabin of the aircraft . at least the second means 22 and the third means 28 , and preferably the first means , the second means and the third means 21 , 22 , 28 , are supplied by an emergency voltage ns from an emergency power - supply device 23 of the aircraft . in particular , the second means 22 provides the first supply - voltage signals vs 1 in a manner such that they are suitable for supplying voltage to the amplification devices 15 - 20 of the network nodes 2 - 4 and to a specific selection of coupled terminals 5 - 10 associated with the first aircraft system . here , the second means 22 superposes preferably the data - voltage signals ds supplied by the first means 21 on the first voltage - supply signals vs 1 to create first modulated voltage signals ms 1 , and couples these first modulated voltage signals ms 1 into the transmission line 12 . in analogous fashion , the third means 28 superposes the data - voltage signals ds provided by the first means 21 on the second supply - voltage signals vs 2 to create second modulated voltage signals ms 2 , and couples these second modulated voltage signals ms 2 into the receiving line 13 . to this end , fig3 a shows a schematic graph for creation of the first modulated voltage signals ms 1 from the data - voltage signals ds and the first supply - voltage signals vs 1 . analogously , fig3 b shows the creation of the second modulated voltage signals ms 2 from the data - voltage signals ds and the second supply - voltage signals vs 2 . furthermore , fig4 shows a schematic block diagram of an embodiment of a network node 2 according to fig2 . the network node 2 shown by way of example in fig4 is equipped with a decoupling device 24 and a coupling device 25 . the decoupling device 24 is equipped with a first decoupling means 24 a and a second decoupling means 24 b ( see in this connection fig5 ). the first decoupling means 24 a is set up to decouple the first supply - voltage signals vs 1 from the first modulated voltage signals ms 1 transmitted via the transmission line 12 . the second decoupling means 24 b is further set up to decouple the second supply - voltage signals vs 2 from the second modulated voltage signals ms 2 transmitted via the receiving line 13 . the respective network node 2 - 4 is further equipped with a coupling device 25 comprising a first coupling means 25 a and a second coupling means 25 b . the first coupling means 25 a is preferably set up to couple the first supply - voltage signals vs 1 decoupled by the first decoupling means 24 a into the transmission line 12 for transmission to the respective downstream network nodes 3 , 4 . the second coupling means 25 b is further set up to couple the second supply - voltage signals vs 2 decoupled by the second decoupling means 24 b into the receiving line 13 for transmission to the respective downstream network nodes 3 , 4 . in addition , fig4 shows that the network node 2 is equipped with a power - supply device 27 via which the network node 2 is supplied with the on - board voltage bs . here , the decoupling device 24 , the coupling device 25 , the switch device 26 , a terminal 5 of the first aircraft system and a terminal 6 of the second aircraft system are supplied with the on - board voltage bs by the power - supply device 27 via a respective power - supply line . the power supply for the decoupling device 24 and the coupling device 25 thus takes a redundant form , namely via the first supply - voltage signal vs 1 and the on - board voltage bs . the network node 2 is further equipped with a switch device 26 or a switch . the switch device 26 is disposed between the decoupling device 24 and the coupling device 25 . the switch device 26 here passes a respective first frame r 1 to the relevant addressed terminal 5 as a function of the second element g 2 of the address tuple at . fig5 shows a schematic block diagram of a second embodiment of an apparatus for transmission of data and energy via devices of a specific network 1 according to the invention . according to the embodiment shown in fig5 , the devices 2 , 5 coupled via the bus 11 take the form of a network node 2 and a terminal 5 . in order to couple the modulated voltage signals ms 1 , ms 2 into the transmission line 12 and into the receiving line 13 respectively , the network node 2 is equipped with the coupling device 25 . without loss of generality , the network node 2 may , for the purpose of coupling a plurality of terminals 5 , comprise a corresponding plurality of coupling devices 25 . correspondingly , the respective terminal 5 is equipped with a decoupling device 24 for decoupling the first supply - voltage signal vs 1 ( by decoupling means 24 a ) and the second supply - voltage signal vs 2 ( by decoupling means 24 b ) respectively . the relevant first decoupling means 24 a is further suitable for supplying the decoupled first supply - voltage signal vs 1 to the components or devices 30 of the first aircraft system . analogously , the second decoupling means 24 b is set up for supplying the decoupled second supply - voltage signal vs 2 to the components or devices 31 of the second aircraft system . the devices 30 , 31 of the first aircraft system and of the second aircraft system are further coupled to the decoupling device 24 by means of a data line 32 for transmission of the data signals ds . fig6 shows a schematic flowchart of an embodiment of a method for transmitting data ds , r 1 , r 2 and energy vs 1 , vs 2 via devices 2 - 10 , for example network nodes 2 - 4 , of a specific network 1 , for example an ethernet network . the method according to the invention is described below in relation to the block diagram shown in fig6 , with reference to fig2 to 4 and 7 to 10 . here , fig7 and 8 show schematic block diagrams of embodiments of , respectively , a first frame r 1 and a second frame r 2 according to the invention . further , fig9 shows a schematic block diagram of an embodiment of an address tuple at of the first frame r 1 according to fig7 . in addition , fig1 shows a schematic block diagram of an embodiment of a time sequence for the transmission of the first frame r 1 and the second frame r 2 via the bus 11 according to the invention . the embodiment shown in fig1 is here based on the embodiment shown in fig2 with the three network nodes 2 - 4 . the example addresses of the address fields f 3 of the first frames r 1 and of the address fields e 2 of the second frames r 2 are based on the reference numerals 2 - 4 of the individual network nodes shown in fig2 and the reference numerals 5 - 10 of the individual , coupled terminals 5 - 10 shown in fig2 . for example , the first frame r 1 of the first time slot zs 1 is intended for the terminal 5 coupled to the network node 2 . details in this regard are described with reference to the method according to the invention as shown in fig6 , which comprises the following steps s 1 - s 4 : at least two devices 2 - 10 are coupled by a bus 11 with a transmission line 12 and a receiving line 13 . for example , referring to fig2 , the network nodes 2 - 4 are coupled to a respective number of coupled terminals 5 - 10 by means of the bus 11 ( data bus ) in a daisy - chain arrangement . the transmission via the transmission line 12 and via the receiving line 13 of data r 1 , r 2 , defined according to the specific network 1 , as data - voltage signals ds is controlled . here , provision is preferably made for control of the transmission via the bus 11 , in a predetermined sequence , of first frames r 1 with safety - relevant data d 1 and second frames r 2 with non - safety - relevant data d 2 , defined according to the specific network 1 , as the data - voltage signals ds , for the setting of a respective time interval zs 1 - zs 2 between two respective first frames r 1 transmitted via the transmission line 12 and between two respective first frames r 1 transmitted via the receiving line 13 as a function of a specific sampling rate of the bus 11 through the coupled terminals 5 - 10 , and for control of the transmission of at least one respective second frame r 2 via the transmission line 12 and via the receiving line 13 within the respective time interval zs 1 - zs 2 . the first frames r 1 take the form of for example cids frames . with reference to fig7 , the respective first frame r 1 may be composed of the following fields f 1 - f 5 : a first field f 1 with an ethernet preamble ep ; a second field f 2 with audio data ad , in particular audio broadcasting data ; a third field f 3 with an address a 1 indicating at least the respective terminal 5 - 10 of the respective network node 2 - 4 ; a fourth field f 4 with the safety - relevant data d 1 ; and a fifth field f 5 with an ethernet checksum ec , such as an ethernet crc . with reference to fig9 , the address a 1 of the third field f 3 of the first frame r 1 takes the form of an address tuple at , wherein a first element g 1 of the address tuple at addresses the respective network node 2 - 4 , and a second element g 2 of the address tuple at addresses the respective terminal 5 - 10 of the respective network node 2 . this type of exemplary addressing is also used in fig1 — as already mentioned above — so that the field f 3 of the first frame r 1 in the time slot zs 1 addresses the terminal 5 that is coupled to the network node 2 . with reference to fig8 , the respective second frame r 2 is preferably composed of the following fields e 1 - e 4 : a first field e 1 with an ethernet preamble ep ; a second field e 2 with an address a 2 indicating at least a respective network node 2 - 4 ; a third field e 3 with an ip data packet 1 p ; and a fourth field e 4 with an ethernet checksum ec , such as an ethernet crc . the respective time interval zs 1 - zs 2 preferably takes the form of a time slot zs 1 - zs 2 corresponding to a reciprocal of the sampling rate of the audio data through the coupled terminals 5 - 10 . the respective time slot zs 1 - zs 2 further exhibits a first partial time slot t 1 ( see fig1 ) for the transmission of precisely one first frame r 1 and a second partial time slot t 2 ( see fig1 ) for the transmission of at least one second frame r 2 . the respective first frames r 1 are preferably transmitted via the transmission line 12 and the receiving line 13 of the bus 11 in the respective first partial time slot t 1 by means of a static , deterministic time - slot procedure . conversely , the respective second frames r 2 are preferably transmitted in the respective second partial time slot t 2 by means of a best - effort procedure . with reference to fig1 , within the respective predetermined time slot zs 1 - zs 2 of the cycle z with a specific number of time slots zs 1 - zs 2 , precisely one specific terminal 5 - 10 can receive one first frame r 1 via the transmission line 12 and transmit precisely one first frame r 1 via the receiving line 13 . within a cycle z with a number n2 of time slots zs 1 - zs 2 , the bus control device 14 preferably transmits , via the transmission line 12 , respectively at least one first frame r 1 to the respective terminal 5 - 10 addressed by the second element g 2 of the address tuple at of the fourth field f 4 of the first frame r 1 , in a respective time slot zs 1 - zs 2 of the cycle z . the network node 2 - 4 , in particular in the respective time slot zs 1 - zs 2 of the cycle z , is authorised , following transmission of the respective first frame r 1 of the terminal 5 - 10 addressed by the second element g 2 of the address tuple at of the first frame r 1 received in the respective time slot zs 1 - zs 2 , to transmit , via the receiving line 12 , using the best - effort procedure , one or more second frames r 2 . furthermore , the bus control device 14 transmits the respective second frame r 2 in a broadcast mode via the bus 11 , wherein the coupled network nodes 2 - 4 each receive the second frames r 2 , extract the ip packet ip of the second frame r 2 and pass the ip packet ip to the respective terminal 5 - 10 addressed by the ip address of the ip packet ip if the addressed terminal 5 - 10 is coupled to the respective network node 2 - 4 . the authorisation of the respective network node 2 - 4 to transmit the second frames r 2 via the receiving line 13 within the respective cycle z is preferably regulated by setting a number of first frames r 1 to be transmitted to these respective network nodes 2 - 4 . the data - voltage signals ds are loaded on the transmission line 12 with first supply - voltage signals vs 1 suitable for supplying power to the devices of a first aircraft system . the data - voltage signals ds are loaded on the receiving line 13 with second supply - voltage signals vs 2 suitable for supplying power to the devices of a second aircraft system . although the present invention has been described here with reference to preferred embodiments , it is not restricted thereto , but can be modified in diverse ways . | 7 |
fig3 illustrates a method according to an advantageous embodiment of the invention . fig3 illustrates events during setting up of a connection . in the beginning , the set up procedure is started by e . g . the user of a mobile station , who requests 100 a new service . this new service could be , for example , a packet data connection for browsing the internet , in which case the mm entity taking care of the setting up of the mm connection on the ms side is the packet data controlling mm entity of the ms . in the next step 105 , the mm entity of the mobile station controlling the requested service checks , whether a rrc level connection is already established . if no rrc level connection is established at this point , the mm connection is the first mm connection , and can be established in the normal way continuing at step 115 . if a rrc level connection is already established , the new mm connection to be set up is the second mm connection at that time . consequently , the mm entity includes an indication of the existence of the rrc connection into the mm setup information to be sent to the network . for example , this could be realized by adding a new parameter into one of the setup messages . in the next step 115 , the mm entity of the ms sends the needed mm setup information messages to the network , which messages are received by the corresponding mm entity at the network side at step 120 . the mm entity at the network side checks in step 125 , if an indication of the existence of a rrc connection is included in the received mm messages . if no such indication is found , the setting up of the connection continues normally . if such an indication is found , the mm entity at the network side informs 130 corresponding mm entity in the ms about those events , which in the case of only one mm protocol being used would be implicitly signalled by rrc level events . for example , such an event could be the successful establishment of the mm level connection . the step of informing 130 could in such a case be an explicit acknowledgment of the establishment of the mm connection , for example by sending a cm service accept message . the step of informing may take place at a later point during the setting up of the mm connection or for example after the setting up of the connection . fig4 illustrates another example of a method according to an advantageous embodiment of the invention . this example shows events during releasing of a connection . such events could take place , for example , when connections between a mobile station and a cn element are released . in the first step 205 , a core network element releases the connections between itself and the rnc , i . e . the iu interface connections . in the next step 210 , the rrc protocol control entity in the rnc checks , if any other iu connections to another cn element remain . if iu connections to other cn elements remains , there is at least one other mm protocol active , in which case the rrc entity in the rnc indicates 215 to the ms , that the released iu connections were released . the informing may be realized for example by sending a specific message to the ms , such as for example a rrc status message . the receiving of the message indicates to the mm entity of the ms that it can enter 225 the idle state . if no other iu connections were found to remain at step 210 , in which case there was only one active mm protocol , the rrc entity releases rrc connections in step 220 , which implicitly indicates to the mm entity of the ms that it can enter 225 the idle state . fig5 illustrates a still further example of a method according to an advantageous embodiment of the invention . in this example , the ms has active connections to one cn element , for example speech connections to a msc , during which the ms performs a location area ( la ) update to an idle mm entity , such as the mm entity of a sgsn . in step 250 , the ms performs the location area update , during which among other procedural steps , an iu connection is created between the rnc and the sgsn . after the la update is performed , the packet connection mm entity enters 255 the waiting for network command state , from which according to prior art it should enter the idle state as a response to releasing of rrc connections . in the next step 205 , the sgsn releases the connections between itself and the rnc , i . e . the iu interface connections . in the next step 210 , the rrc protocol control entity in the rnc checks , if any other iu connections to another cn element remain . if iu connections to other cn elements remain , there is at least one other mm protocol active , in which case the rrc entity in the rnc indicates 215 to the ms , that the released iu connections were released . the informing may be realized for example by sending a specific message to the ms . the receiving of the message indicates to the mm entity of the ms that it can enter 225 the idle state . if no other iu connections were found to remain at step 210 , in which case there was only one active mm protocol , the rrc entity releases rrc connections in step 220 , which implicitly indicates to the mm entity of the ms that it can enter 225 the idle state . in a further advantageous example , a method substantially similar to that illustrated in fig5 is used with a detach procedure . the invention clarifies the use of the single radio signalling bearer , i . e . the rrc connection in cases , where more than one separate mm protocols are executed . the invention allows the use of rrc level events for implicitly giving signals to the mm level even in the case of more than one separate mm protocols being used . therefore , even the present gsm mobile stations which support the use of only one mm protocol are able to communicate with a gsm - type radio access network of the umts system in the conventional way , even though the radio access network supports the simultaneous use of speech and packet data services , and consequently the use of two mm protocols . although in the previous examples the setting up and releasing of connections were described separately in separate examples , the invention is not limited to those examples . in some embodiments of the invention , signalling according to the invention is used in both setting up and releasing of a connection . for example , a packet data connection can be set up , used , and released while speech connections are active . in such an embodiment , signalling methods according to the invention can be used in the setting up and in the releasing of the packet data connection . in view of the foregoing description it will be evident to a person skilled in the art that various modifications may be made within the scope of the invention . while a preferred embodiment of the invention has been described in detail , it should be apparent that many modifications and variations thereto are possible , all of which fall within the true spirit and scope of the invention . | 7 |
fig2 shows schematically a longitudinal section of the region between the combustion equipment and the high pressure turbine of a gas turbine engine , a labyrinth seal 24 being located between a combustor rear inner case 34 and a rim cover plate 28 . fig3 shows schematically a closer view of the labyrinth seal 24 of fig2 . the rim cover plate 28 is positioned between the combustor rear inner casing 34 and a high pressure turbine disc 30 to protect the high pressure turbine disc 30 , to which high pressure turbine blades 32 are attached . the rim cover plate 28 rotates about the axis of the gas turbine engine . the combustor rear inner case 34 is static , and has high pressure nozzle guide vanes 31 extending therefrom . in operation , cooling combustion feed air from the high pressure compressor enters the combustion equipment of the engine at specified locations . in particular , air flow c ( dashed arrowed line ) from the high pressure compressor enters the combustor rear inner case 34 . this air flow c passes through the labyrinth seal 24 to regulate the temperature of the rim of the high pressure turbine disc 30 by purging the air surrounding the rim and preventing ingestion of hot working gas . the labyrinth seal 24 has an abradable honeycomb lining 38 which is attached to the combustor rear inner case 34 . the sealing surface of the abradable lining 38 is formed as a series of steps 40 . the honeycomb cells have metal foil walls and are aligned with their length direction extending across the thickness of the lining . the skilled person is familiar with the use of honeycomb abradable linings in labyrinth seal applications . fins 46 project from the rim cover plate 28 and abut the abradable lining 38 . the arrangement of the steps 40 and the fins 46 is such that each fin 46 abuts a respective step 40 to form a labyrinthal path 48 for the flow of air between the lining 38 and the fins 46 . the labyrinthal path 48 produces resistance to the flow of air d through the seal . in operation , the abutment of the fins 46 to the steps 40 is such that the fins 46 rub into the steps 40 . the comparatively soft nature of the abradable material means that this rubbing removes material primarily from the abradable lining 38 rather than the fins , creating a tight seal without causing damage to the gas turbine components . a plurality of circumferentially spaced bypass passages 36 extend through the abradable lining 38 . the entrances 42 to the bypass passages 36 are on the combustion equipment side of the labyrinth seal 24 , and the exits 44 are on the high pressure turbine side of the labyrinth seal 24 . the passages 36 are separate from and do not interfere with the labyrinthal path 48 . the bypass passages 36 provide a route for a further , metered , independent flow of air e through the labyrinth seal 24 . the bypass passages preferably extend through the abradable lining from the entrance 42 at a downstream end 42 a of the abradable lining to an exit 44 on an upstream end 44 a of the abradable lining to bypass the seal fins . advantageously , in operation the majority of the air flow through the labyrinth seal 24 can be through the bypass passages 36 . thus the air flow e can provide most of the air necessary to regulate the temperature of the high pressure turbine disc 30 . as there is therefore a reduced requirement for the air flow d through the labyrinthal path 48 , the fins 46 and the steps 40 of the abradable lining 38 can operate in close abutment , thereby improving the efficiency of the engine by reducing air leakage through the seal and maximising feed pressure to the blade 32 . the abradable lining 38 extends circumferentially around the combustor rear inner case 34 , and fig4 shows a section of the abradable lining 38 viewed along the axial direction from the exit side of the seal 24 . the exits 44 from three of the circumferentially spaced bypass passages 36 are visible . fig5 shows the same section of the abradable lining 38 but viewed from a position radially inside the lining . fig6 shows the same section of the abradable lining 38 in a perspective view from the exit side of the seal 24 . as best shown in fig5 the bypass passages 36 are angled relative to the axis of rotation to impart swirl on the air flow e as it exits the passages 36 , the swirl being in the same direction as the direction of rotation of the high pressure turbine disc 30 . the swirl has the effect of reducing windage losses , which in turn reduces heat pickup and increases efficiency . the angling also allows the flow , where necessary , to be directed to specific regions of the high pressure turbine disc 30 or the high pressure turbine blade 32 . this can be significant if there is a risk of localised overheating . the bypass passages 36 are formed in the honeycomb lining 38 before assembly to the gas turbine engine 10 , using electro chemical or electro discharge machining . the bypass passages 36 are lined with respective sleeves 50 , although only one such sleeve is shown in fig4 , 5 and 6 . the sleeve 50 extends from the entrance 42 to the exit 44 of the bypass passage , and can be formed as a smooth cylindrical metal tube . the outside diameter of the tube is dimensioned to fit securely in the bypass passage 36 . the inner diameter of the tube is dimensioned to provide a length to diameter ratio which best improves aerodynamic efficiency . advantageously , the sleeve prevents air escaping from the passage into the cells 52 of the honeycomb . the sleeve 50 of the bypass passage 36 can be inserted into the bypass passage , and then affixed using brazing or welding . if brazing is used , the sleeve can be inserted and brazed to the abradable lining 38 at the same time as the abradable lining 38 is brazed to the combustor rear inner case 34 of the gas turbine engine 10 . if welding is used , the abradable lining can first be brazed to the combustor rear inner case 34 , and then the sleeve 50 can be inserted into the bypass passage 36 and welded to the abradable lining 38 . while the invention has been described in conjunction with the exemplary embodiments described above , many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure . accordingly , the exemplary embodiments of the invention set forth above are considered to be illustrative and not limiting . various changes to the described embodiments may be made without departing from the spirit and scope of the invention . | 5 |
in fig1 a pressure differential delay valve 10 is shown with a valve body or wall structure 12 having a side wall 14 and a bottom wall 16 where body 12 defines an enclosure , an input port 18 , and an output port 20 . the enclosure is divided into three chambers . a separating plate or member 22 is mounted in the body enclosure , and in cooperation with body 12 defines an output chamber 24 . a diaphragm or pneumatic operator 26 mounted in the body enclosure in conjunction with body 12 defines third chamber 28 . diaphragm operator 26 , separating plate 22 and valve body 12 define an input chamber 30 positioned between chambers 24 and 28 in the body enclosure . separating plate 22 defines a centrally located port 32 , which communicates between input chamber 30 and output chamber 24 . mounted in separating plate 22 are a fixed orifice 34 and an umbrella valve arrangement 36 ; orifice 34 and valve 36 communicate between input chamber 30 and output chamber 24 . fixed orifice 34 communicates between input chamber 30 and output chamber 24 to allow a controlled rate of change of pressure between chambers 30 and 24 . mounted in diaphragm operator 26 is a second fixed orifice 38 communicating between input chamber 30 and third chamber 28 and allowing a controlled rate of pressure change . affixed on either side of diaphragm operator 26 are mounting plates 40 and 42 in chambers 28 and 30 , respectively . connected to mounting plate 42 is a stem 44 with a sealing or seal device 46 mounted on its opposite end . stem 44 extends through chamber 30 and port 32 , and stem 44 in its movement displaces seal 46 to open port 32 or to sealingly engage and close port 32 . stem 44 is operable by diaphragm operator 26 . stem 44 , diaphragm operator 26 , and seal 46 are shown in their port - closing position in fig1 . a bias spring 48 , mounted between separating plate 22 and mounting plate 42 in chamber 30 , maintains seal 46 in a closed position in the illustrated valve position . the bias force of spring 48 may be selected at any predetermined value down to two inches of mercury or larger . port 18 , which opens from input chamber 30 in sidewall 14 has a connecting element 50 affixed therein for communication between a vacuum source 54 and chamber 30 . similarly , port 20 which opens from output chamber 24 in bottom wall 16 has a connecting element 52 affixed therein for communication between chamber 24 and a controlled device or element 56 , generally a vacuum motor or dashpot . the differential pressure delay valve 10 is responsive to a vacuum condition , such as , in this case , a pressure condition below atmospheric pressure . the terms &# 34 ; input vacuum &# 34 ; and &# 34 ; output vacuum &# 34 ; refer to the condition in the input chamber 30 and the output chamber 24 , respectively . vacuum source 54 can be an internal combustion engine manifold vacuum or a vacuum pump . in the case where manifold vacuum from an automobile engine is used the valve will track the changing vacuum conditions such that the following conditions will prevail : ( 1 ) input vacuum conditions will equal output vacuum conditions at vacuum changes greater than the bias force of bias spring 48 ; and , ( 2 ) at differential vacuums greater than the force of bias spring 48 , valve 10 allows input to equal output immediately and only allows a delay for the portion of the differential in vacuum levels less than the bias force of spring 48 . in fig1 delay valve 10 is shown with stem 44 urging seal 46 against separating plate 22 , thereby sealing port 32 . diaphragm operator 26 with mounting plates 40 and 42 maintains seal 46 in this closed position by bias spring 48 at vacuum differential levels between chambers 30 and 28 less than the bias force of spring 48 . the pressure or vacuum level of input chamber 30 is continuously allowed to communicate at a controlled rate to third chamber 28 through second fixed orifice 38 . as a vacuum as previously described is introduced to chamber 30 , it can communicate to chambers 24 and 28 through fixed orifices 34 and 38 , respectively . however , the rate of this pressure communication is relatively slow by design . the vacuum depression , that is , the pressure decrease from atmospheric pressure , in chamber 30 can get larger at a rate of increase that is greater than the rate of pressure equalization between chambers 28 and 30 . as a result the differential between the pressure ( a force ) in chambers 30 and 28 can increase until this force is sufficient to overcome the predetermined bias force of bias spring 48 to open port 32 . there is also a differential pressure between chambers 30 and 24 which follows the pressure differential between chambers 30 and 28 , but there is no fixed relationship between these two pressure differentials . when the pressure differential between chambers 30 and 28 is great enough diaphragm operator 26 flexes toward chamber 30 , depressing stem 44 and moving sealing device 46 away from port 32 to allow immediate communication between chambers 30 and 24 . this direct communication immediately balances the vacuum levels in chambers 30 and 24 . bias spring 48 brings valve 10 to the illustrated position when the differential vacuum between chambers 30 and 28 is less than the bias force . the remaining slight differential between chambers 30 and , 24 and 28 is then allowed to slowly dissipate and balance through fixed orifices 34 and 38 , respectively . the vacuum level in input chamber 30 is allowed to immediately communicate to output chamber 24 when there are sudden large changes in the vacuum input level . at rates of input vacuum increase in chamber 30 less than the rate of vacuum equalization between chambers 30 and 28 through orifice 38 the vacuum differential between chambers 30 and 24 will only communicate through orifice 34 . immediate communication between chambers 30 and 24 also occurs upon a sudden increase in pressure in the input chamber . this sudden pressure increase is communicated through umbrella valve 36 from chamber 30 through chamber 24 . during a sudden pressure increase diaphragm operator 26 maintains its position and seals port 32 with seal 46 . thus the output vacuum level will not be greater than the input vacuum level , and for any vacuum differential between input and output above the bias spring 48 force , there will be an immediate balancing response by valve 10 . the final incremental vacuum difference less than the bias spring force is allowed to slowly balance from chamber 30 through the orifices 34 and 38 to chambers 24 and 28 , respectively . in the case of an automobile dashpot controller , the following problem is thereby resolved : at a false start , that is , sudden acceleration and then sudden deceleration , the change in vacuum level is communicated immediately from the manifold vacuum , through the input chamber , to the output chamber and thereby to the dashpot to reduce the throttle opening and engine rpm &# 39 ; s . this reduction in engine rpm &# 39 ; s results in fuel savings and gives the driver immediate control of the engine with a lower idle rate . fig2 illustrates an alternative embodiment of a differential delay valve 110 that is responsive to a change in pressure above atmospheric or above any reference pressure . delay valve 110 is shown with a valve body 112 with a sidewall 114 and a bottom wall 116 , where valve body 112 defines an enclosure which is divided into three chambers . a separating plate 118 is mounted in the body enclosure and , in cooperation with body 112 , defines an output chamber 120 . a diaphragm operator 122 is mounted in the enclosure and , with valve body 112 , defines a third chamber 124 . the volume between diaphragm operator 122 and separating plate 118 in the enclosure is an input chamber 126 . separating plate 118 defines a centrally located port 128 communicating between chambers 126 and 120 . mounted in separating plate 118 are a fixed orifice 130 and an umbrella valve 132 which relieves a high pressure from output chamber 120 to input chamber 126 . mounted in the diaphragm operator 122 is a fixed orifice 134 communicating between input chamber 126 and third chamber 124 . mounted on either side of diaphragm operator 122 are mounting plates 136 and 138 in chambers 124 and 126 , respectively . a stem 140 is affixed to mounting plate 138 and is operable by diaphragm 122 . affixed to or near the end of stem 140 in chamber 126 is a sealing device 142 operable with tube 140 and engageable with separating plate 118 to seal port 128 when valve 110 is in the position shown in fig2 . a bias spring 144 is positioned between mounting plate 136 and valve body 122 in chamber 124 to maintain sealing device 142 in the closed position . sidewall 114 defines an input port 146 with a fitting 148 affixed therein to communicate between a controlling or monitored pressure source 154 and input chamber 126 of valve 110 . bottom wall 116 defines an output port 150 with a fitting 152 positioned therein to communicate between a pressure controlled device or element 156 and output chamber 120 of valve 110 . the closed position of valve 110 in fig2 is shown wherein sealing device 142 engages separating plate 118 to block communication between chambers 126 and 120 through port 128 . diaphragm operator 122 , stem 140 and seal 143 are maintained in their illustrated positions to close port 128 by bias spring 144 . a pressure imposed in chamber 126 through port 146 from a source 154 would dissipate to output chamber 120 through fixed orifice 130 , and to chamber 124 through fixed orifice 134 . when the pressure in input chamber 126 is such that the pressure differential between third chamber 124 and input chamber 126 is greater than the bias force of spring 140 then diaphragm operator 122 will move to open port 132 and thereby immediately equalize the pressure in chamber 126 and 120 . diaphragm operator 122 will close port 128 with seal 142 when the bias force of spring 144 is greater than the pressure differential between chambers 126 and 124 . the pressure differential between chambers 126 and 124 is dissipated at a controlled rate through fixed orifice 134 . a sudden increase in pressure in chamber 120 above that in chamber 126 would be rapidly balanced through umbrella valve 132 . fixed orifices 34 and 38 of fig1 and fixed orifices 130 and 134 of fig2 are apertures which may have a porous plug inserted therein to operate as a fixed orifice . in fig3 a porous plug 31 is illustrated as retained in a fixed orifice such as orifice 34 or 38 of fig1 and orifices 130 or 134 of fig2 . those skilled in the art will recognize that certain variations can be made in the illustrated embodiments . while only specific embodiments of the invention have been described and shown , it is apparent that various alterations and modifications can be made therein . it is , therefore , the intention in the appended claims to cover all such modifications and alterations as may fall within the true scope and spirit of the invention . | 5 |
reference will now be made in detail to some embodiments of the invention , examples of which are illustrated in the accompanying drawings . fig1 is a diagram of an image capture device 10 in accordance with one novel aspect . image capture device 10 may , for example , be a digital camera or a mobile communication device that includes digital camera functionality . image capture device 10 includes a sensor portion 11 and a color correction portion 12 . color correction portion 12 receives pixel information from the sensor portion and performs color correction on the pixel information by determining a color phase of the pixel information , and then by using the color phase to control a color phase rotation operation , a chrominance scaling operation , and a luminance scaling operation . in the illustrated example , sensor portion 11 includes an image sensor and analog front end / timing generator ( afe - tg ) 13 , a bayer - to - rgb conversion circuit 14 , and an rgb - to - ycbcr conversion circuit 15 . the image sensor and afe / tg circuitry captures an image and outputs corresponding bayer data . bayer - to - rgb conversion circuit 14 converts the bayer data into sets of tristimulus rgb pixel values . one set of rgb pixel values includes a red ( r ) pixel value , a green ( g ) pixel value , and a blue ( b ) pixel value . there is one such set of rgb pixel values for each pixel . operation of the image capture device 10 of fig1 is described in connection with one such set of rgb pixel values being supplied to the rgb - to - ycbcr conversion circuit 15 . the rgb - to - ycbcr conversion circuit 15 converts the set of rgb pixel values into a first set 26 of pixel values in the ycbcr color space . this first set 26 of pixel values involves a first y 1 luminance value , a first cb 1 chrominance value , and a first cr 1 chrominance value . the first cb 1 chrominance value and the first cr 1 chrominance value are supplied to a polarization block 16 . polarization block 16 converts the first cb 1 chrominance value and the first cr 1 chrominance value into a corresponding phase angle phi ( φ ). fig1 is an illustration of the conversion operation performed by polarization block 16 . the pair of first cb 1 and cr 1 chrominance values corresponds to a point in the x - y plane illustrated in fig1 . the phase angle phi from the origin is the arctangent of cr 1 / cb 1 . the phase angle phi is represented as a ten bit number on parallel bus 17 . values in the range of from 0 to 1024 represent corresponding values in the range of from zero degrees to 360 degrees . the phase angle phi is supplied in parallel to a color phase adjust circuit 18 , a chrominance adjust circuit 19 , and a luminance adjust circuit 20 . a function block 21 within color phase adjust circuit 18 converts the phase angle phi into a corresponding phase difference value δ ( φ ). fig1 is a diagram that illustrates the correspondence between the phase angle phi ( φ ) supplied to function block 21 and the phase difference value δ ( φ ) output from function block 21 . in the diagram of fig1 , the incoming phase angle phi ( φ ) is represented on the x - axis . the resulting phase difference δ ( φ ) is represented on the y - axis . depending on the value of the incoming phase angle phi , the output phase difference value ranges between a high value of approximately + 25 degrees and a low value of approximately − 15 degrees . in the illustrated example , the function that converts the incoming phase angle phi ( φ ) into the phase difference value appears as a stepped sinusoidal function . returning to fig1 , the phase difference value δ ( φ ) is supplied to a color phase rotation block 22 of the color phase adjust circuit 18 . color phase rotation block 22 performs a color phase rotation operation that is controlled by the phase difference value δ ( φ ). color phase rotation block 22 receives the first cb 1 chrominance value and the first cr 1 chrominance value and generates an intermediate cb i chrominance value and an intermediate cr i chrominance value . fig1 illustrates how an incoming first cb 1 chrominance value is converted into an intermediate cb i chrominance value depending on the magnitude of the phase difference value . similarly , the diagram illustrates how an incoming first cr 1 chrominance value is converted into an intermediate cr i chrominance value depending on the magnitude of the phase difference value . the amount of color phase rotation at each phase angle phi can be preset by adjusting how the function of fig1 converts the phase angle phi into the phase difference value . for example , if the function of fig1 generates a phase difference value of zero for a particular phase angle phi , then there is no color phase rotation performed for the phase angle phi . as seen in fig1 , no color phase rotation is performed for phase angles φ of 0 and 512 . as illustrated in fig1 , the phase angle phi φ is also supplied to the chrominance adjust circuit 19 . a gain determination block 23 receives the phase angle phi value and converts it into a corresponding gain value s_gain . fig1 illustrates how an incoming phase angle phi is converted into a corresponding s - gain value . the incoming phase phi is represented on the x - axis . the resulting s_gain value is represented on the y - axis . the values of the s - gain values output from gain determination block 23 range from approximately twenty percent to approximately negative twenty percent . the function that converts the incoming phase angle phi into an s - gain value has the appearance of a stepped sinusoidal wave . returning to fig1 , the s - gain value output from gain determination block 23 is supplied to a chrominance gain block 24 . the chrominance gain block 24 receives the intermediate cr i chrominance and intermediate cb i chrominance values and scales them in accordance with the value of s - gain . fig1 illustrates how an incoming intermediate cb i chrominance value is scaled to generate an output second cb 2 chrominance value depending on the value of s_gain . similarly , the figure illustrates how an incoming intermediate cr i chrominance value is scaled to generate an output second cr 2 chrominance value depending on the value of s_gain . the second chrominance values are designated in the figure with superscript values of two . the second cb 2 and cr 2 chrominance values are output from the chrominance adjust circuit 19 and form two values of a set 25 of color corrected pixel values . as illustrated in fig1 , the phase angle phi is also supplied to the luminance adjust circuit 20 . a gain determination block 26 receives the phase angle phi value and converts it into a corresponding gain value b_gain . fig1 illustrates how an incoming phase angle phi is converted into a corresponding b - gain value . the incoming phase phi is represented on the x - axis . the resulting b_gain value is represented on the y - axis . the values of the b - gain values output from gain determination block 26 range from approximately positive twenty percent to approximately negative twenty percent . the function that converts the incoming phase angle phi into a b - gain value has the appearance of a stepped sinusoidal wave . returning to fig1 , the b - gain value output from gain determination block 26 is supplied to a luminance gain block 27 . the luminance gain block 27 receives the first y 1 luminance value that is being output by rgb - to - ycbcr conversion circuit 15 . luminance gain block 27 scales the first y 1 luminance value depending on the b - gain value . fig1 illustrates how the first y 1 luminance value is scaled to generate a second y 2 luminance value depending on the value of b - gain . the second y 2 luminance value is designated in the figure with a two superscript . the second y 2 luminance value as output from luminance gain block 27 is the y 2 luminance value of the second set 25 of color corrected pixel values . although the present invention has been described in connection with certain specific embodiments for instructional purposes , the present invention is not limited thereto . intermediate cb i and cr i can be input to the chrominance adjust circuit 19 and / or to the luminance adjust circuit 20 through an additional polarization circuit . in one embodiment , the bayer - to - rgb conversion circuit 14 , the rgb - to - ycbcr conversion circuit 15 and the color correction portion 12 are all disposed on a single digital image processing integrated circuit . polarization block 16 may output a number other than a phase angle that is nonetheless indicative of a relationship between the first cb 1 chrominance value and the first cr 1 chrominance value . block 16 may , for example , output a simple ratio of the two first chrominance values . in one embodiment , no block 16 is provided , but rather the two first cb 1 and cr 1 chrominance values are supplied directly to lookup blocks 21 , 23 and 26 . the lookup blocks 21 , 23 and 26 use the two first cb 1 and cr 1 chrominance values to lookup a phase difference value , an s_gain value , and a b_gain value , respectively . the chrominance scaling and color phase rotation operations can be performed in either order . although lookup table ( lut ) memories are described above as implementations of blocks 21 , 23 and 26 , other circuitry for converting one number into another number other than lut memories can be used . for example , portions of arithmetic logic can perform simple arithmetic operations in order to generate the desired phase difference value , s_gain value , and b_gain value . in one embodiment , an integrated circuit embodying the color correction circuitry described above has an interface for receiving image data from one or more image sensors that do not output bayer format data , but rather output image data in rgb format or in another color space format . the interface on the integrated circuit is configurable to receive image data from a selectable one of these different image sensors . in one embodiment , a user of a digital camera can select one of a plurality of light condition settings . alternatively , the camera can put itself into one of the light condition settings . for each different light condition setting , the function of phase angle implemented by block 21 is different . a different lookup table memory may , for example , be consulted depending on the light condition setting . a single sram ( static random access memory ) lookup table memory may be loaded with different data depending on the light condition setting such that a single lookup table memory can be used for block 21 . also , the function of phase angle implemented by blocks 23 and / or 26 can also be made to be different depending on the light condition setting of the camera . there may , for example , be three or more such light condition settings . the spectrum characteristics of a sensor ( ccd or cmos ) may vary depending on the manufacturer of the sensor . in one advantageous aspect , the sram lookup table memories are loaded with different data depending on the type of sensor used ( for example , ccd or cmos ) in order to compensate for differences between these types of sensors so that any one of multiple different sensors can be used in conjunction with the same type of color correction integrated circuit in a digital camera . accordingly , various modifications , adaptations , and combinations of various features of the described embodiments can be practiced without departing from the scope of the invention as set forth in the claims . | 6 |
it is to be understood that the invention may assume various alternative orientations and step sequences , except where expressly specified to the contrary . it is also to be understood that the specific devices and processes illustrated in the attached drawings , and described in the following specification are simply exemplary embodiments of the inventive concepts defined herein . hence , specific dimensions , directions or other physical characteristics relating to the embodiments disclosed are not to be considered as limiting . fig1 illustrates a schematic of the modular electronic differential control system 2 . within the differential casing 10 is found a connector 12 that electrically connects the actuator 14 and sensor 16 to the control housing 18 . as is known in the art , the actuator 14 , within the context of a differential , converts electrical current into mechanical force . electrical current is conducted through a coil of wire 20 that is wound around the pole piece 22 . the flow of electrical current creates a magnetic field that draws the actuator plunger 24 toward the pole piece 22 . each end of the coil of wire 20 is attached to its own individual connector conductor wire 26 . typically , a spring ( not shown ) is placed to act on the plunger 24 in a way to hold it away from the pole piece 22 when current is not flowing through the coil of wire 20 . in applications with actuators 14 in a differential the plunger 24 is attached to a face gear ( not shown ) arranged in a dog clutch configuration ( not shown ) as is known in the art so as to allow clutch engagement and disengagement control through coil current control . the position sensor 16 provides a signal that is indicative of the plunger 24 position relative to the pole piece 22 . in one embodiment of the invention , the plunger 24 is made of ferromagnetic material , or has a ferromagnetic attachment . in another embodiment of the invention , the position sensor 16 is a hall type sensor ( magnetic field detector ), but any suitable sensor 16 capable of sensing the position of the plunger 24 can be used in accordance with the invention . in embodiments with a hall type sensor , the sensor 16 is positioned between a magnet 28 and the plunger 24 . the output of the sensor 16 changes states when the plunger 24 moves to a position , relative to the sensor 16 , that permits magnetic flux to flow from the plunger 24 to the magnet 28 . the sensor 16 and magnet 28 are molded into the encapsulation 30 of the actuator coil 20 . in one embodiment , the encapsulation 30 is a plastic material , but any insulating material capable of protecting the sensor 16 from the environment can be used without going beyond the scope of the invention . conducting wires 26 that carry the signals to / from the sensor 16 and coil 20 exit the encapsulation 30 and connect to the pins / receptacles ( not shown ) housed within the electrical connector 12 . the electrical connector 12 joins with to the control housing 18 on the interior 36 of the differential casing 10 . the connector 12 can be mechanically attached or detached , lending to the modular nature of the control system 2 described herein , from the control housing 18 as needed . when attached , the connector 12 should be designed in such a way to also provide electrical connectivity between the conducting wires 26 and the conducting bars 32 residing in the control housing 18 . in one embodiment of the invention , the control housing 18 is made from a molded plastic , but any suitable material known in the art can be used without departing from the scope of the invention . the electrical signals of the actuator 14 and sensor 16 conduct through wires 26 , into the electrical connector 12 , and through to conducting bars 32 that are molded in to the controller housing 18 . the conducting bars 32 are usually made of metal , but can be made of any conducting material as known in the art . likewise , signals to / from the vehicle can be conducted through conductor bars 32 ′. the control housing 18 and conducting bars 32 , 32 ′ are formed in a manner that realizes a standard vehicle connector ( not shown ). a port 34 for a standard vehicle connector is shown in fig1 . in one embodiment of the invention , intact conducting bars 32 carry signal to / from the standard vehicle connector to / from the electrical connector 12 in the interior of the differential casing 10 . in this situation , the electrical signals travelling along the conducting bars 32 are not processed locally at the differential . this embodiment is not specifically shown in fig1 , but can easily be deduced by having a continuous electrical communication through 32 , 38 and 32 ′. in an alternative embodiment , the conductor bars 32 are not intact and are cut in such a way as to leave vertical portions 38 , as shown in fig1 , upon which a printed circuit board ( pcb ) 40 is lowered and then attached so as to provide electrical connectivity between the pcb 40 and the conducting bars 32 , 32 ′. in this embodiment , the pcb 40 allows for local processing of signals to / from the actuator 14 and sensor 16 . the pcb 40 can provide processing , sensor interfacing , or coil drive capabilities . the pcb 40 is part of the electronic control system 2 and that receives signals and power from the vehicle , processes them and controls the actuator 14 in a manner that is defined by a control strategy . the pcb 40 also provides processing for signals back to the vehicle in a way that is determined by the control strategy . in either alternative embodiment described above , a cover 42 can be situated on the control housing 18 so as to provide electrical insulation and seal the components housed in the control housing 18 from the environment . another embodiment , not specifically shown in fig1 , but easily deduced , allows for a potting or encapsulation to be placed in the control housing 18 . any material known in the art can be used as long as it provides the necessary electrical insulation and sealingly protects the components housed in the control housing 18 from the environment . in the embodiment shown , the pcb 40 is shown attached to both control bars 32 continuing on to the interior of the differential and control bars 32 ′ continuing on to the standard vehicle connector . the control housing 18 is shown with a cover 42 . the control housing 18 and cover 42 may be unitary . the cover 42 and control housing 18 may be in contact with the exterior 44 of the differential casing 10 . the control housing 18 may also be in contact with the differential casing 10 . the control housing 18 can extend through an opening 46 in the differential casing 10 . in alternative embodiments , the controller 2 is attached to the axle housing ( not shown ) instead of differential casing 10 . the general concept is the same , however and may be used in designs where the actuator 14 for the differential is external to the differential casing 10 . one issue arising from having the controller 2 in such close proximity to the differential is heat build - up . differentials are composed of moving parts and generate a lot of heat and are generally bathed in oil to reduce heat generated by friction as well as to help dissipate any heat that is generated . aside from differentials and axles creating hot environments , the controller 2 itself has at least one heat generating component 100 , as shown in fig2 and 3 . the heat generating component 100 is usually a transistor . in specific embodiments , these are field effect transistors . in order to aid in the extra heat generated by the heat generating component 100 , the controller 2 should have a heat transfer mechanism which can transfer heat from the heat generating component 100 . the first portion of the heat transfer mechanism shown in both fig2 and 3 are thermal vias 106 built into the pcb 40 . these thermal vias 106 are in conductive contact with a thermally conductive tape 102 . the thermally conductive tape 102 is in conductive contact with a heat transfer device 104 or 108 . the embodiment shown in fig2 allows for heat passing through the heat transfer mechanism ( combination of 102 , 104 , and 106 ) to the differential casing 10 ( or in further embodiments , the axle housing ( not shown )). in fig3 , the heat transfer mechanism ( combination of 102 , 108 , and 106 ) allows for heat to transfer to the fluid surrounding the differential casing 10 or , in alternative embodiments ) the axle housing ( not shown ). this fluid can be either a gas or liquid and is most preferably ambient air or oil used in lubrication of the differential or axle . fig2 a and fig3 a show magnifications of the area encircled in fig2 and 3 , respectively . in accordance with the provisions of the patent statutes , the present invention has been described in what is considered to represent its preferred embodiments . however , it should be noted that the invention can be practiced otherwise than as specifically illustrated and described without departing from its spirit or scope . | 5 |
as indicated above , human protein huifrg 68 . 1 and functional variants thereof are now envisaged as therapeutically useful agents , more particularly for use as an anti - viral , anti - tumour or immunomodulatory agent . a variant of huifrg 68 . 1 protein for this purpose may be a naturally occurring variant , either an allelic variant or species variant , which has substantially the same functional activity as huifrg 68 . 1 protein and is also upregulated in response to administration of ifn - α . alternatively , a variant of huifrg 68 . 1 protein for therapeutic use may comprise a sequence which varies from seq . id . no . 2 or from seq . id . no . 4 but which is a non - natural mutant . the term “ functional variant ” refers to a polypeptide which has the same essential character or basic function of huifrg 68 . 1 protein . the essential character of huifrg 68 . 1 protein may be deemed to be as an immunomodulatory peptide . a functional variant polypeptide may show additionally or alternatively anti - viral activity and / or anti - tumour activity . desired anti - viral activity may , for example , be tested or monitored as follows . a sequence encoding a variant to be tested is cloned into a retroviral vector such as a retroviral vector derived from the moloney murine leulkemia virus ( momulv ) containing the viral packaging signal ψ , and a drug - resistance marker . a pantropic packaging cell line containing the viral gag , and pol , genes is then co - transfected with the recombinant retroviral vector and a plasmid , pvsv - g , containing the vesicular stomatitis virus envelope glycoprotein in order to produce high - titre infectious replication incompetent virus ( burns et al ., proc . natl . acad . sci . usa 84 , 5232 - 5236 ). the infectious recombinant virus is then used to transfect interferon sensitive fibroblasts or lymphoblastoid cells and cell lines that stably express the variant protein are then selected and tested for resistance to virus infection in a standard interferon bio - assay ( tovey et al ., nature , 271 , 622 - 625 , 1978 ). growth inhibition using a standard proliferation assay ( mosmann , t ., j . immunol . methods , 65 , 55 - 63 , 1983 ) and expression of mhc class i and class ii antigens using standard techniques may also be determined . a desired functional variant of huifrg 68 . 1 may consist essentially of the sequence of seq . id . no . 2 or of seq . id . no . 4 . a functional variant of seq . id . no . 2 or of seq . id . no . 4 may be a polypeptide which has a least 60 % to 70 % identity , preferably at least 80 % or at least 90 % and particularly preferably at least 95 %, at least 97 % or at least 99 % identity with the amino acid sequence of seq . id . no . 2 or of seq . id . no . 4 over a region of at least 20 , preferably at least 30 , for instance at least 100 contiguous amino acids or over the full length of seq . id . no . 2 or of seq . d . no . 4 . methods of measuring protein identity are well known in the art . amino acid substitutions may be made , for example from 1 , 2 or 3 to 10 , 20 or 30 substitutions . conservative substitutions may be made , for example according to the following table . amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other . aliphatic non - polar gap ilv polar - uncharged cstm nq polar - charged de kr aromatic hfwy variant polypeptide sequences for therapeutic use in accordance with the invention may be shorter polypeptide sequences , for example , a peptide of at least 20 amino acids or up to 50 , 60 , 70 , 80 , 100 , 150 or 200 amino acids in length is considered to fall within the scope of the invention provided it retains appropriate biological activity of huifrg 68 . 1 protein . in particular , but not exclusively , this aspect - of the invention encompasses the situation when the variant is a fragment of a complete natural naturally - occurring protein sequence . also encompassed by the invention are modified forms of huifrg 68 . 1 protein and fragments thereof which can be used to raise anti - huifrg 68 . 1 protein antibodies . such variants will comprise an epitope of the huifrg 68 . 1 protein . polypeptides of the invention may be chemically modified , e . g . post - translationally modified . for example , they may be glycosylated and / or comprise modified amino acid residues . they may also be modified by the addition of a sequence at the n - terminus and / or c - terminus , for example by provision of histidine residues or a t7 tag to assist their purification or by the addition of a signal sequence to promote insertion into the cell membrane . such modified polypeptides fall within the scope of the term “ polypeptide ” of the invention . a polypeptide of the invention may be labelled with a revealing label . the revealing label may be any suitable label which allows the polypeptide to be detected . suitable labels include radioisotopes such as 125 i , 35 s or enzymes , antibodies , polynucleotides and linkers such as biotin . labelled polypeptides of the invention may be used in assays . in such assays it may be preferred to provide the polypeptide attached to a solid support . the present invention also relates to such labelled and / or immobilised polypeptides packaged in the form of a kit in a container . the kit may optionally contain other suitable reagent ( s ), control ( s ) or instructions and the like . the polypeptides of the invention may be made synthetically or by recombinant means . such polypeptides of the invention may be modified to include non - naturally occurring amino acids , e . g . d amino acids . variant polypeptides of the invention may have modifications to increase stability in vitro and / or in vivo . when the polypeptides are produced by synthetic means , such modifications may be introduced during production . the polypeptides may also be modified following either synthetic or recombinant production . a number of side chain modifications are known in the protein modification art and may be present in polypeptides of the invention . such modifications include , for example , modifications of amino acids by reductive alkylation by reaction with an aldehyde followed by reduction with nabh 4 , amidination with methylacetimidate or acylation with acetic anhydride . polypeptides of the invention will be in substantially isolated form . it will be understood that the polypeptides may be mixed with carriers or diluents which will not interfere with the intended purpose of the polypeptide and still be regarded as substantially isolated . a polypeptide of the invention may also be in substantially purified form , in which case it will generally comprise the polypeptide in a preparation in which more than 90 %, for example more than 95 %, 98 % or 99 %, by weight of polypeptide in the preparation is a polypeptide of the invention . the invention also includes isolated nucleotide sequences that encode huifrg 68 . 1 protein or a variant thereof as well as isolated nucleotide sequences which are complementary thereto . the nucleotide sequence may be dna or rna , single or double stranded , including genomic dna , synthetic dna or cdna . preferably the nucleotide sequence is a dna sequence and most preferably , a cdna sequence . as indicated above , such a polynucleotide will typically include a sequence comprising : ( a ) the nucleic acid of seq . id . no . 1 or seq . id . no . 3 or the coding sequence thereof and / or a sequence complementary thereto ; ( b ) a sequence which hybridises , e . g . under stringent conditions , to a sequence complementary to a sequence as defined in ( a ); ( c ) a sequence which is degenerate as a result of the genetic code to a sequence as defined in ( a ) or ( b ); ( d ) a sequence having at least 60 % identity to a sequence as defined in ( a ), ( b ) or ( c ). polynucleotides comprising an appropriate coding sequence can be isolated from human cells or synthesised according to methods well known in the art , as described by way of example in sambrook et al . ( 1989 ) molecular cloning : a laboratory manual , 2 nd edition , cold spring harbor laboratory press . polynucleotides of the invention may include within them synthetic or modified nucleotides . a number of different types of modification to polynucleotides are known in the art . these include methylphosphonate and phosphothioate backbones , addition of acridine or polylysine chains at the 3 ′ and / or 5 ′ ends of the molecule . such modifications may be carried out in order to enhance the in vivo activity or lifespan of polynucleotides of the invention . typically a polynucleotide of the invention will include a sequence of nucleotides , which may preferably be a contiguous sequence of nucleotides , which is capable of hybridising under selective conditions to the coding sequence or the complement of the coding sequence of seq . id . no . 1 or seq . id . no . 3 . such hybridisation will occur at a level significantly above background . background hybridisation may occur , for example , because of other cdnas present in a cdna library . the signal level generated by the interaction between a polynucleotide of the invention and the coding sequence or complement of the coding sequence of seq . id . no . 1 or seq . id . no . 3 will typically be at least 10 fold , preferably at least 100 fold , as intense as interactions between other polynucleotides and the coding sequence of seq . id . no . 1 or seq . id . no . 3 . the intensity of interaction may be measured , for example , by radiolabelling the probe , e . g . with 32 p . selective hybridisation may typically be achieved using conditions of low stringency ( 0 . 3 m sodium chloride and 0 . 03 m sodium citrate at about 40 ° c . ), medium stringency ( for example , 0 . 3 m sodium chloride and 0 . 03 m sodium citrate at about 50 ° c .) or high stringency ( for example , 0 . 03 m sodium chloride and 0 . 03 m sodium citrate at about 60 ° c .). the coding sequence of seq id no : 1 or seq id no : 3 may be modified by nucleotide substitutions , for example from 1 , 2 or 3 to 10 , 25 , 50 or 100 substitutions . degenerate substitutions may be made and / or substitutions may be made which would result in a conservative amino acid substitution when the modified sequence is translated , for example as shown in the table above . the coding sequence of seq id no : 1 or seq id no : 3 may alternatively or additionally be modified by one or more insertions and / or deletions and / or by an extension at either or both ends . a polynucleotide of the invention capable of selectively hybridising to a dna sequence selected from seq . id no . 1 or 3 , the coding sequence thereof and dna sequences complementary thereto will be generally at least 70 %, preferably at least 80 or 90 % and more preferably at least 95 % or 97 %, homologous to the target sequence . this homology may typically be over a region of at least 20 , preferably at least 30 , for instance at least 40 , 60 or 100 or more contiguous nucleotides . any combination of the above mentioned degrees of homology and minimum sized may be used to define polynucleotides of the invention , with the more stringent combinations ( i . e . higher homology over longer lengths ) being preferred . thus for example a polynucleotide which is at least 80 % homologous over 25 , preferably over 30 nucleotides forms may be found suitable , as may be a polynucleotide which is at least 90 % homologous over 40 nucleotides . homologues of polynucleotide or protein sequences as referred to herein may be determined in accordance with well - known means of homology calculation , e . g . protein homology may be calculated on the basis of amino acid identity ( sometimes referred to as “ hard homology ”). for example the uwgcg package provides the bestfit program which can be used to calculate homology , for example used on its default settings , ( devereux et al . ( 1984 ) nucleic acids research 12 , 387 - 395 ). the pileup and blast algorithms can be used to calculate homology or line up sequences or to identify equivalent or corresponding sequences , typically used on their default settings , for example as described in altschul s . f . ( 1993 ) j . mol . evol . 36 , 290 - 300 ; altschul , s . f . et al . ( 1990 ) j . mol . biol . 215 , 403 - 10 . software for performing blast analyses is publicly available through the national center for biotechnology information ( http :// www . ncbi . nhn . nih . gov /). this algorithm involves first identifying high scoring sequence pairs ( hsps ) by identifying short words of length w in the query sequence that either match or satisfy some positive - valued threshold score t when aligned with a word of the same length in a database sequence . t is referred to as the neighbourhood word score threshold ( altschul et al ., supra ). these initial neighbourhood word hits act as seeds for initiating searches to find hsps containing them . the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased . extensions for the word hits in each direction are halted when : the cumulative alignment score falls off by the quantity x from its maximum achieved value ; the cumulative score goes to zero or below , due to the accumulation of one or more negative - scoring residue alignments ; or the end of either sequence is reached . the blast algorithm parameters w , t and x determine the sensitivity and speed of the alignment . the blast program uses as defaults a word length ( w ) of 11 , the blosum62 scoring matrix ( see henilkoff and henikoff ( 1992 ) proc . natl . acad . sci . usa 89 , 10915 - 10919 ) alignments ( b ) of 50 , expectation ( e ) of 10 , m = 5 , n = 4 , and a comparison of both strands . the blast algorithm performs a statistical analysis of the similarity between two sequences ; see e . g ., karlin and altschul ( 1993 ) proc . natl . acad . sci . usa 90 : 5873 - 5787 . one measure of similarity provided by the blast algorithm is the smallest sum probability ( p ( n )), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance . for example , a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1 , preferably less than about 0 . 1 , more preferably less than about 0 . 01 , and most preferably less than about 0 . 001 . polynucleotides according to the invention have utility in production of the proteins according to the invention , which may take place in vitro , in vivo or ex vivo . in such a polynucteotide , the coding sequence for the desired protein of the invention will be operably - linked to a promoter sequence which is capable of directing expression of the desired protein in the chosen host cell . such a polynucleotide will generally be in the form of an expression vector . polynucleotides of the invention , e . g . in the form of an expression vector , which direct expression in vivo of a polypeptide of the invention having immunomodulatory activity and / or anti - viral activity and / or anti - tumour activity may also be used as a therapeutic agent . expression vectors for such purposes may be constructed in accordance with conventional practices in the art of recombinant dna technology . they may , for example , involve the use of plasmid dna . they may be provided with an origin of replication . such a vector may contain one or more selectable marker genes , for example an ampicillin resistance gene in the case of a bacterial plasmid . other features of vectors of the invention may include appropriate initiators , enhancers and other elements , such as for example polyadenylation signals which may be desirable , and which are positioned in the correct orientation , in order to allow for protein expression . other suitable non - plasmid vectors would be apparent to persons skilled in the art . by way of further example in this regard reference is made again to sambrook et al ., 1989 ( supra ). such vectors additionally include , for example , viral vectors . examples of suitable viral vectors include herpes simplex viral vectors , replication - defective retroviruses , including lentiviruses , adenoviruses , adeno - associated virus , hpv viruses ( such as hpv - 16 and hpv - 18 ) and attenuated influenza virus vectors . promoters and other expression regulation signals may be selected to be compatible with the host cell for which expression is designed . for example , yeast promoters include s . cerevisiae gal4 and adh promoters , s . pombe nmt1 and adh promoter . mammalian promoters include the metallothionein promoter which can be induced in response to heavy metals such as cadmium and p - actin promoters . viral promoters such as the sv40 large t antigen promoter or adenovirus promoters may also be used . other examples of viral promoters which may be employed include the moloney murine leukemia virus long terminal repeat ( lv ltr ), the rous sarcoma virus ( rsv ) ltr promoter , the human cytomegalovirus ( cmv ) ie promoter , and hpv promoters , particularly the hpv . upstream regulatory region ( urr ). other suitable promoters will be well - known to those skilled in the recombinant dna art . an expression vector of the invention may further include sequences flanking the coding sequence for the desired polypeptide of the invention providing sequences homologous to eukaryotic genomic sequences , preferably mammalian genomic sequences , or viral genomic sequences . this will allow the introduction of such polynucleotides of the invention into the genome of eulcaryotic cells or viruses by homologous recombination . in particular , a plasmid vector comprising the expression cassette flanlked by viral sequences can be used to prepare a viral vector suitable for delivering the polynucleotides of the invention to a mammalian cell . the invention also includes cells in vitro , for example prokaryotic or eukaryotic cells , which have been modified to express the huifrg 68 . 1 protein or a variant thereof . such cells include stable , e . g . eulkaryotic , cell lines wherein a polynucleotide encoding huifrg 68 . 1 protein or a variant thereof is incorporated into the host genome . host cells of the invention may be mammalian cells or insect cells , lower eukaryotic cells , such as yeast or prokaryotic cells such as bacterial cells . particular examples of cells which may be modified by insertion of vectors encoding for a polypeptide according to the invention include mammalian hek293t , cho , hela and cos cells . preferably a cell line may be chosen which is not only stable , but also allows for mature glycosylation of a polypeptide . expression may , for example , be achieved in transformed oocytes . a polypeptide of the invention may be expressed in cells of a transgenic non - human animal , preferably a mouse . a transgenic non - human animal capable of expressing a polypeptide of the invention is included within the scope of the invention . polynucleotides according to the invention may also be inserted into vectors as described above in an antisense orientation in order to provide for the production of antisense sequences . antisense rna or other antisense polynucleotides may also be produced by synthetic means . a polynucleotide , e . g . in the form of an expression vector , capable of expressing in vivo an antisense sequence to a coding sequence for the amino acid sequence defined by seq . id . no . 2 , or a naturally - occurring variant thereof , for example that defined by seq id no . 4 , for use in therapeutic treatment of a human or non - human animal is also envisaged as constituting an additional aspect of the invention . such a polynucleotide will find use in treatment of diseases associated with upregulation of huifrg 68 . 1 protein . polynucleotides of the invention extend to sets of primers for nucleic acid amplification which target sequences within the cdna for a polypeptide of the invention , e . g . pairs of primers for pcr amplification . the invention also provides probes suitable for targeting a sequence within a cdna or rna for a polypeptide of the invention which may be labelled with a revealing label , e . g . a radioactive label or a non - radioactive label such as an enzyme or biotin . such probes may be attached to a solid support . such a solid support may be a micro - array ( also commonly referred to as nucleic acid , probe or dna chip ) carrying probes for further nucleic acids , e . g . mrnas or amplification products thereof corresponding to other type 1 interferon upregulated genes , e . g . such genes identified as upregulated in response to oromucosal or intravenous administration of ifn - α . methods for constructing such micro - arrays are well - known ( see , for example , ep - b 0476014 and 0619321 of affymax technologies n . v . and nature genetics supplement january 1999 entitled “ the chipping forecast ”). the nucleic acid sequence of such a primer or probe will preferably be at least 10 , preferably at least 15 or at least 20 , for example at least 25 , at least 30 or at least 40 nucleotides in length . it may , however , be up to 40 , 50 , 60 , 70 , 100 or 150 nucleotides in length or even longer . another aspect of the invention is the use of probes or primers of the invention to identify mutations in huifrg 68 . 1 genes , for example single nucleotide polymorphisms ( snps ). as indicated above , in a still further aspect the present invention provides a method of identifying a compound having immunomodulatory activity and / or antiviral activity and / or anti - tumour activity comprising providing a cell capable of expressing huifrg 68 . 1 protein or a naturally - occurring variant thereof , incubating said cell with a compound under test and monitoring for upregulation of huifrg 68 . 1 gene expression . such monitoring may be by probing for mrna encoding huifrg 68 . 1 protein or a naturally - occurring variant thereof . alternatively antibodies or antibody fragments capable of specifically binding one or more of huifrg 68 . 1 and naturally - occurring variants thereof may be employed . according to another aspect , the present invention also relates to antibodies ( for example polyclonal or preferably monoclonal antibodies , chimeric antibodies , humanised antibodies and fragments thereof which retain antigen - binding capability ) which have been obtained by conventional techniques and are specific for a polypeptide of the invention . such antibodies could , for example , be useful in purification , isolation or screening methods involving immunoprecipitation and may be used as tools to further elucidate the function of huifrg 68 . 1 protein or a variant thereof . they may be therapeutic agents in their own right . such antibodies may be raised against specific epitopes of proteins according to the invention . an antibody specifically binds to a protein when it binds with high affinity to the protein for which it is specific but does not bind or binds with only low affinity to other proteins . a variety of protocols for competitive binding or immunoradiometric assays to determine the specific binding capability of an antibody are well - known . a polypeptide of the invention is typically formulated for administration with a pharmaceutically acceptable carrier or diluent . the pharmaceutical carrier or diluent may be , for example , an isotonic solution . for example , solid oral forms may contain , together with the active compound , diluents , e . g . lactose , dextrose , saccharose , cellulose , corn starch or potato starch ; lubricants , e . g . silica , talc , stearic acid , magnesium or calcium stearate , and / or polyethylene glycols ; binding agents ; e . g . starches , arabic gums , gelatin , methyl cellulose , carboxymethylcellulose or polyvinyl pyrrolidone ; desegregating agents , e . g . starch , alginic acid , alginates or sodium starch glycolate ; effervescing mixtures ; dyestuffs ; sweeteners ; wetting agents , such as lecithin , polysorbates , laurylsulphates ; and , in general , non - toxic and pharmacologically inactive substances used in pharmaceutical formulations . such pharmaceutical preparations may be manufactured in known manner , for example , by means of mixing , granulating , tableting , sugar - coating , or film coating processes . liquid dispersions for oral administration may be syrups , emulsions and suspensions . the syrups may contain as carriers , for example , saccharose or saccharose with glycerine and / or mannitol and / or sorbitol . suspensions and emulsions may contain as carrier , for example a natural gum , agar , sodium alginate , pectin , methyl cellulose , carboxymethylcellulose , or polyvinyl alcohol . the suspensions or solutions for intramuscular injections may contain , together with the active compound , a pharmaceutically acceptable carrier , e . g . sterile water , olive oil , ethyl oleate , glycols , e . g . propylene glycol , and if desired , a suitable amount of lidocaine hydrochloride . solutions for intravenous administration or infusions may contain as carrier , for example , sterile water or preferably they may be in the form of sterile , aqueous , isotonic saline solutions . a suitable dose of huifrg 68 . 1 protein or a functional analogue thereof for use in accordance with the invention may be determined according to various parameters , especially according to the substance used ; the age , weight and condition of the patient to be treated ; the route of administration ; and the required regimen . again , a physician will be able to determine the required route of administration and dosage for any particular patient . a typical daily dose may be from about 0 . 1 to 50 mg per kg , preferably from about 0 . 1 mg / kg to 10 mg / kg of body weight , according to the activity of the specific inhibitor , the age , weight and condition of the subject to be treated , and the frequency and route of administration . preferably , daily dosage levels may be from 5 mg to 2 g . a polynucleotide of the invention suitable for therapeutic use will also typically be formulated for administration with a pharmaceutically acceptable carrier or diluent . such a polynucleotide may be administered by any known technique whereby expression of the desired polypeptide can be attained in vivo . for example , the polynucleotide may be introduced by injection , preferably intradermally , subcutaneously or intramuscularly . alternatively , the nucleic acid may be delivered directly across the skin using a particle - mediated delivery device . a polynucleotide of the invention suitable for therapeutic nucleic acid may alternatively be administered to the oromucosal surface for example by intranasal or oral administration . a non - viral vector of the invention suitable for therapeutic use may , for example , be packaged into liposomes or into surfactant containing vector delivery particles . uptake of nucleic acid constructs of the invention may be enhanced by several known transfection techniques , for example those including the use of transfection agents . examples of these agents include cationic agents , for example calcium phosphate and deae dextran and lipofectants , for example lipophectam and transfectam . the dosage of the nucleic acid to be administered can be varied . typically , the nucleic acid will be administered in the range of from 1 pg to 1 mg , preferably from 1 pg to 10 μg nucleic acid for particle - mediated gene delivery and from 10 μg to 1 mg for other routes . as also indicated above , in a still further aspect the present invention provides a method of predicting responsiveness of a patient to treatment with a type 1 interferon , e . g . ifn - α treatment such as ifn - α treatment by an oromucosal route or intravenously , which comprises determining the level of huifrg 68 . 1 protein or a naturally - occurring variant thereof , for example a protein having the amino acid sequence of seq id no : 2 or seq id no : 4 , or the corresponding mrna , in a cell sample from said patient , wherein said sample is taken from said patient following administration of a type 1 interferon or is treated prior to said determining with a type 1 interferon in vitro . preferably , the type 1 interferon for testing responsiveness will be the type 1 interferon selected for treatment . it may be administered by the proposed treatment route and at the proposed treatment dose . preferably , the subsequent sample analysed may be , for example , a blood sample or a sample of peripheral blood mononuclear cells ( pbmcs ) isolated from a blood sample . more conveniently and preferably , a sample obtained from the patient comprising pbmcs isolated from blood may be treated in vitro with a type 1 interferon , e . g . at a dosage range of about 1 to 10 , 000 iu / ml . such treatment may be for a period of hours , e . g . about 7 to 8 hours . preferred treatment conditions for such in vitro testing may be determined by testing pbmcs taken from normal donors with the same interferon and looking for upregulation of an appropriate expression product . again , the type 1 interferon employed will preferably be the type 1 interferon proposed for treatment of the patient , e . g . recombinant ifn - α . pbmcs for such testing may be isolated in conventional manner from a blood sample using ficoll - hypaque density gradients . an example of a suitable protocol for such in vitro testing of type 1 interferon responsiveness is provided in example 3 below . the sample , if appropriate after in vitro treatment with a type 1 interferon , may be analysed for the level of huifrg 68 . 1 protein or a naturally - occurring variant thereof . this may be done using an antibody or antibodies capable of specifically binding one or more of huifrg 68 . 1 protein and naturally - occurring variants thereof , e . g . allelic variants thereof . preferably , however , the sample will be analysed for mrna encoding huifrg 68 . 1 protein or a naturally - occurring variant thereof . such mrna analysis may employ any of the techniques known for detection of mrnas , e . g . northern blot detection or mrna differential display . a variety of known nucleic acid amplification protocols may be employed to amplify any mrna of interest present in the sample , or a portion thereof , prior to detection . the mrna of interest , or a corresponding amplified nucleic acid , may be probed for using a nucleic acid probe attached to a solid support . such a solid support may be a micro - array as previously discussed above carrying probes to determine the level of further mrnas or amplification products thereof corresponding to type 1 interferon upregulated genes , e . g . such genes identified as upregulated in response to oromucosal or intravenous administration of ifn - α . previous experiments had shown that the application of 5 μl of crystal violet to each nostril of a normal adult mouse using a p20 eppendorf micropipette resulted in an almost immediate distribution of the dye over the whole surface of the oropharyngeal cavity . staining of the oropharyngeal cavity was still apparent some 30 minutes after application of the dye . these results were confirmed by using 125 i - labelled recombinant human ifn - α1 - 8 applied in the same manner . the same method of administration was employed to effect oromucosal administration in the studies which are described below . six week old , male dba / 2 mice were treated with either 100 , 000 iu of recombinant murine interferon α ( ifn α ) purchased from life technologies inc , in phosphate buffered saline ( pbs ), 10 μg of recombinant human interleukin 15 ( il - 15 ) purchased from protein institute inc , pbs containing 100 μg / ml of bovine serum albumin ( bsa ), or left untreated . eight hours later , the mice were sacrificed by cervical dislocation and the lymphoid tissue was removed surgically from the oropharyngeal cavity and snap frozen in liquid nitrogen and stored at − 80 ° c . rna was extracted from the lymphoid tissue by the method of chomczynski and sacchi 1987 , ( anal . biochem . 162 , 156 - 159 ) and subjected to mrna differential display analysis ( lang , p . and pardee , a . b ., science , 257 , 967 - 971 ). differential display analysis was carried out using the “ message clean ” and “ rna image ” kits of the genhunter corporation essentially as described by the manufacturer . briefly , rna was treated with rnase - free dnase , and 1 μg was reverse - transcribed in 100 μl of reaction buffer using either one or the other of the three one - base anchored oligo -( dt ) primers a , c , or g . rna was also reverse - transcribed using one or the other of the 9 two - base anchored oligo -( dt ) primers aa , cc , gg , ac , ca , ga , ag , cg , gc . all the samples to be compared were reverse transcribed in the same experiment , separated into aliquots and frozen . the amplification was performed with only 1 μl of the reverse transcription sample in 10 μl of amplification mixture containing taq dna polymerase and α - 33 p datp ( 3 , 000 ci / mmole ). eighty 5 ′ end ( hap ) random sequence primers were used in combination with each of the ( ht1 1 ) a , c , g , aa , cc , gg , ac , ca , ga , ag , cg or gc primers . samples were then run on 7 % denaturing polyacrylamide gels and exposed to authoradiography . putative differentially expressed bands were cut out , reamplified according to the instructions of the supplier , and further used as probes to hybridize northern blots of rna extracted from the oropharyngeal cavity of ifn treated , il - 15 treated , and excipient treated animals . re - amplified bands from the differential display screen were cloned in the sfr 1 site of the ppcr - script sk (+) plasmid ( stratagene ) and cdnas amplified from the rapid amplification of cdna ends were isolated by ta cloning in the pcr3 plasmid ( invitrogen ). dna was sequenced using an automatic di - deoxy sequencer ( perkin elmer abi prism 377 ). differentially expressed murine 3 ′ sequences identified from the differential display screen were compared with random human expressed sequence tags ( est ) present in the dbest database of genbank ™ of the united states national center for biotechnology information ( ncbi ). the sequences potentially related to the murine est isolated from the differential display screen were combined in a contig and used to construct a human consensus sequence corresponding to a putative cdna . one such cdna was found to be 2175 nucleotides in length . this corresponded to a mouse gene whose expression was found to be enhanced approximately 8 - fold in the lymphoid tissue of the oral cavity of mice following oromucosal administration of ifn - α . in order to establish that this putative cdna corresponded to an authentic human gene , primers derived from the 5 ′ and 3 ′ ends of the consensus sequence were used to synthesise cdna from mrna extracted from human peripheral blood leukocytes ( pbl ) by specific reverse transcription and pcr amplification . a unique cdna fragment of the predicted size was obtained , cloned and sequenced ( seq . id . no . 1 ). this human cdna contains an open reading frame ( orf ) of 1818 bp in length at positions 42 - 1859 encoding a protein of 605 amino acids with a deduced molecular weight of 68 . 45 kda ( seq . id . no . 2 ). a second cdna was found to be 3411 nucleotides in length . as described above , a unique cdna fragment of the predicted size was obtained , cloned and sequenced ( seq id no : 3 ). this human cdna contains an open reading frame ( orf ) of 3297 bp in length at positions 95 to 3391 encoding a protein of 1098 amino acids with deduced molecular weight of 124 kda ( seq id no : 4 ). the nucleotide sequence of seq id no : 3 is a longer form of the nucleotide sequence of seq id no : 1 and encodes a variant of the huifrg 68 . 1 protein of seq id no : 2 which is extended at the amino terminus . male dba / 2 mice were injected intraperitoneally with 100 , 000 iu of recombinant murine ifn - α purchased from life technologies inc . in 200 μl of pbs or treated with an equal volume of pbs alone . eight hours later , the animals were sacrificed by cervical dislocation and the spleen was removed using conventional procedures . total rna was extracted by the method of chomczynski and sacchi ( anal . biochem . ( 1987 ) 162 , 156 - 159 ) and 10 . 0 μg of total rna per sample was subjected to northern blotting in the presence of glyoxal and hybridised with a cdna probe for huifrg 68 . 1 mrna as described by dandoy - dron et al . ( j . biol . chem . ( 1998 ) 273 , 7691 - 7697 ). the blots were first exposed to autoradiography and then quantified using a phospholmager according to the manufacturer &# 39 ; s instructions . enhanced levels of mrna for huifrg 68 . 1 protein ( approximately 10 fold ) were detected in samples of rna extracted from spleens of ifn - α treated animals relative to animals treated with excipient alone . human daudi , jurkat or hela cells were treated in vitro with 10 , 000 iu of recombinant human ifn - α2 ( intron a from schering - plough ) in pbs or with an equal volume of pbs alone . eight hours later the cells were centrifuged ( 800 × g for 10 minutes ) and the cell pellet recovered . total rna was extracted from the cell pellet by the method of chomczynski and sacchi and 10 . 0 μg of total rna per sample was subjected to northern blotting in the presence of glyoxal and hybridised with a cdna probe for huifrg 68 . 1 mrna as previously described in example 2 above and an equivalent cdna probe for the huifrg 68 . 1 variant described in example 1 . enhanced levels of mrna for huifrg 68 . 1 protein ( approximately 5 - fold ) were detected in samples of rna extracted from ifn - α treated daudi or hela cells compared to samples treated with pbs alone . enhanced levels of mrna for huifrg 68 . 1 variant protein ( approximately 5 - fold ) were detected in samples of rna extracted from ifn - α treated daudi or jurkat cells compared to samples treated with pbs alone . the same procedure may be used to predict type 1 interferon responsiveness using pbmcs taken from a patient proposed to be treated with a type 1 interferon . the huifrg 68 . 1 variant coding sequence was amplified and used as a probe to determine the tissue distribution of huifrg 68 . 1 variant mrna . huifrg 68 . 1 variant expression was assessed in a wide variety of tissues and was found to be widely expressed . tcaggtatgt gggcaaagac tattctgctg ctcaggaatt a atg gaa gat gag atg 56 aag gaa tat tac agt aag aat cct aag atc aca cca gtc cag gct gtg 104 lys glu tyr tyr ser lys asn pro lys ile thr pro val gln ala val aat gtt ggg cag ttg ctg gcc gta aat gcc gag gag gac gcc tgg tta 152 cgg gca cag gtc atc tca aca gaa gag aac aaa ata aag gta tgc tat 200 arg ala gln val ile ser thr glu glu asn lys ile lys val cys tyr gtt gac tat ggt ttt agt gaa aat gtt gaa aaa agc aaa gca tac aaa 248 tta aac ccg aag ttt tgt tca ctc tca ttt caa gct aca aaa tgt aag 296 ctt gca ggc ttg gaa gtc cta agc gat gac cct gat cta gtg aag gtg 344 gtt gaa tct tta act tgt gga aag atc ttt gca gtg gaa ata ctt gac 392 val glu ser leu thr cys gly lys ile phe ala val glu ile leu asp aaa gct gac att cca ctt gtt gtt ctg tac gat acc tca gga gaa gat 440 lys ala asp ile pro leu val val leu tyr asp thr ser gly glu asp gat atc aat atc aat gcc acc tgc ttg aag gct ata tgt gac aag tca 488 cta gag gtt cac ctg cag gtt gac gcc atg tac aca aat gtc aaa gta 536 leu glu val his leu gln val asp ala met tyr thr asn val lys val act aat att tgc tct gat ggg aca ctc tac tgc cag gtg cct tgt aag 584 thr asn ile cys ser asp gly thr leu tyr cys gln val pro cys lys ggt ctg aac aag ctc agt gac ctt cta cgt aag ata gag gac tac ttc 632 gly leu asn lys leu ser asp leu leu arg lys ile glu asp tyr phe cat tgc aag cac atg acc tct gag tgc ttt gtt tca tta ccc ttc tgt 680 his cys lys his met thr ser glu cys phe val ser leu pro phe cys ggg aaa atc tgc ctc ttc cat tgc aaa gga aaa tgg tta cga gta gag 728 gly lys ile cys leu phe his cys lys gly lys trp leu arg val glu atc aca aat gtt cac agc agc cgg gct ctt gat gtt cag ttc ctg gac 776 ile thr asn val his ser ser arg ala leu asp val gln phe leu asp tct ggc act gtg aca tct gta aaa gtg tca gag ctc agg gaa att cca 824 cct cgg ttt cta caa gaa atg att gca ata cca cct cag gcc att aag 872 tgc tgt tta gca gat ctt cca caa tct att ggc atg tgg aca cca gat 920 cys cys leu ala asp leu pro gln ser ile gly met trp thr pro asp gca gtg ctg tgg tta aga gat tct gtt ttg aat tgc tcg gac tgt agc 968 att aag gtt aca aaa gtg gat gaa acc aga ggg atc gca cat gtt tat 1016 ile lys val thr lys val asp glu thr arg gly ile ala his val tyr tta ttt acc cct aag aac ttc cct gac cct cat cgc agt att aat cgc 1064 leu phe thr pro lys asn phe pro asp pro his arg ser ile asn arg cag att aca aat gca gac ttg tgg aag cat cag aag gat gtg ttt ttg 1112 gln ile thr asn ala asp leu trp lys his gln lys asp val phe leu agt gcc ata tcc agt gga gct gac tct ccc aac agc aaa aat ggc aac 1160 atg ccc atg tcg ggc aac act gga gag aat ttc aga aag aac ctc aca 1208 met pro met ser gly asn thr gly glu asn phe arg lys asn leu thr gat gtc atc aaa aag tcc atg gtg gac cat acg agc gct ttc tcc aca 1256 gag gaa ctg cca cct cct gtc cac tta tca aag cca ggg gaa cac atg 1304 gat gtg tat gtg cct gtg gcc tgt cac cca ggc tac ttc gtc atc cag 1352 asp val tyr val pro val ala cys his pro gly tyr phe val ile gln cct tgg cag gag ata cat aag ttg gaa gtt ctg atg gaa gag atg att 1400 cta tat tac agc gtg tct gaa gag cgc cac ata gca gtg gag aaa gac 1448 leu tyr tyr ser val ser glu glu arg his ile ala val glu lys asp caa gtg tat gct gca aaa gtg gaa aat aag tgg cac agg gtg ctt tta 1496 gln val tyr ala ala lys val glu asn lys trp his arg val leu leu aaa gga atc ctg acc aat gga ctg gta tct gtg tat gag ctg gat tat 1544 lys gly ile leu thr asn gly leu val ser val tyr glu leu asp tyr ggc aaa cac gaa tta gtc aac ata aga aaa gta cag ccc cta gtg gac 1592 gly lys his glu leu val asn ile arg lys val gln pro leu val asp atg ttc cga aag ctg ccc ttc caa gca gtc aca gct caa ctt gca gga 1640 met phe arg lys leu pro phe gln ala val thr ala gln leu ala gly gtg aag tgc aac cag tgg tct gag gag gct tct atg gtg ttt cga aat 1688 val lys cys asn gln trp ser glu glu ala ser met val phe arg asn cat gtg gag aag aaa cct ctg gtg gca ctg gtg cag aca gtc att gaa 1736 aat gct aac cct tgg gac cgg aaa gta gtg gtc tac tta gtg gac aca 1784 asn ala asn pro trp asp arg lys val val val tyr leu val asp thr tcg ttg cca gac acc gat acc tgg att cat gat ttt atg tca gag tat 1832 ser leu pro asp thr asp thr trp ile his asp phe met ser glu tyr ctg ata gag ctt tca aaa gtt aat taa tgactgcctc tgaaaccttg 1879 glu asp ala trp leu arg ala gln val ile ser thr glu glu asn lys ile lys val cys tyr val asp tyr gly phe ser glu asn val glu lys ala thr lys cys lys leu ala gly leu glu val leu ser asp asp pro asp leu val lys val val glu ser leu thr cys gly lys ile phe ala thr ser gly glu asp asp ile asn ile asn ala thr cys leu lys ala ile cys asp lys ser leu glu val his leu gln val asp ala met tyr thr asn val lys val thr asn ile cys ser asp gly thr leu tyr cys gln val pro cys lys gly leu asn lys leu ser asp leu leu arg lys ile glu asp tyr phe his cys lys his met thr ser glu cys phe val trp leu arg val glu ile thr asn val his ser ser arg ala leu asp met trp thr pro asp ala val leu trp leu arg asp ser val leu asn ile ala his val tyr leu phe thr pro lys asn phe pro asp pro his arg ser ile asn arg gln ile thr asn ala asp leu trp lys his gln lys asp val phe leu ser ala ile ser ser gly ala asp ser pro asn arg lys asn leu thr asp val ile lys lys ser met val asp his thr tyr phe val ile gln pro trp gln glu ile his lys leu glu val leu tyr glu leu asp tyr gly lys his glu leu val asn ile arg lys val gln pro leu val asp met phe arg lys leu pro phe gln ala val thr ala gln leu ala gly val lys cys asn gln trp ser glu glu ala ser met val phe arg asn his val glu lys lys pro leu val ala leu val gln thr val ile glu asn ala asn pro trp asp arg lys val val val gggacgggcc gtgggccccc ggaacgaggc aaag atg ctg gaa gga gat ctg gtt 115 tca aag atg cta cga gct gtt ctg cag tct cat aag aat gga gta gca 163 ser lys met leu arg ala val leu gln ser his lys asn gly val ala tta ccc cgg ctc caa gga gag tac aga tcc ttg act gga gac tgg atc 211 leu pro arg leu gln gly glu tyr arg ser leu thr gly asp trp ile ccc ttc aaa cag cta ggt ttc cct aca cta gaa gcc tat ctg aga agt 259 pro phe lys gln leu gly phe pro thr leu glu ala tyr leu arg ser gtg cca gca gtg gtc agg ata gag act rgt aga tct gga gag att acc 307 tgc tat gcc atg gcc tgc aca gaa act gca aga att gct cag ctt gtg 355 cys tyr ala met ala cys thr glu thr ala arg ile ala gln leu val gct cgt caa agg agt tct aaa agg aaa acc ggg cgt caa gtt aat tgt 403 cag atg aga gtg aag aaa acc atg cca ttt ttt cta gaa gga aaa cca 451 gln met arg val lys lys thr met pro phe phe leu glu gly lys pro aaa gca acc ctc aga caa cca gga ttt gct tca aat ttt tct gtt ggc 499 lys ala thr leu arg gln pro gly phe ala ser asn phe ser val gly aaa aaa cct aat cca gca ccg tta aga gac aaa gga aac tct gtt gga 547 gtt aag cct gat gct gaa atg tct cct tat atg cta cac aca act ctt 595 val lys pro asp ala glu met ser pro tyr met leu his thr thr leu gga aat gaa gca ttc aaa gac att cca gtg caa agg cat gtg acc atg 643 gly asn glu ala phe lys asp ile pro val gln arg his val thr met tcc acc aac aac agg ttt agc cca aag gcg tcc ctt caa cca cct ttg 691 cag atg cat ctc tca aga acc tct act aag gaa atg agt gat aat tta 739 gln met his leu ser arg thr ser thr lys glu met ser asp asn leu aat cag act gtt gaa aaa ccc aat gtc aag cct cct gcc tct tac act 787 tat aaa atg gat gag gtt caa aat cgc ata aag gaa ata cta aac aag 835 tyr lys met asp glu val gln asn arg ile lys glu ile leu asn lys cat aac aat ggc att tgg ata tct aag ctt cca cat ttt tac aaa gag 883 his asn asn gly ile trp ile ser lys leu pro his phe tyr lys glu tta tat aaa gaa gac ctt aat caa gga att tta caa cag ttt gaa cac 931 leu tyr lys glu asp leu asn gln gly ile leu gln gln phe glu his tgg cct cat att tgc acg gtg gag aaa cct tgc agt ggt ggc caa gat 979 trp pro his ile cys thr val glu lys pro cys ser gly gly gln asp tta ctt ctt tat cca gct aag aga aag cag ctt ttg aga agt gaa ctg 1027 gat act gag aaa gta cct cta tcc cca cta cct ggt ccc aaa caa aca 1075 cca ccg ttg aaa ggg tgt cca aca gtt atg gca gga gac ttt aaa gaa 1123 pro pro leu lys gly cys pro thr val met ala gly asp phe lys glu aaa gtg gca gac ctg ctg gtg aaa tac aca agt ggc ctt tgg gcc agt 1171 gca ctt ccg aaa gca ttt gag gaa atg tac aaa gtg aaa ttc cct gag 1219 gat gcc tta aaa aat ctt gcc tca ctt tct gat gta tgc agc ata gac 1267 tac att tct gga aat ccc cag aag gcc att ctc tat gct aaa ctt cca 1315 ttg ccc act gac aaa atc caa aag gat gca ggg caa gca cat ggt gat 1363 aat gat atc aag gct atg gtt gaa caa gag tat ttg cag gta gaa gaa 1411 asn asp ile lys ala met val glu gln glu tyr leu gln val glu glu agc att gct gaa agt gct aat acc ttt atg gag gac ata aca gtt cct 1459 ser ile ala glu ser ala asn thr phe met glu asp ile thr val pro cct tta atg att cca act gaa gca tca cca tct gta ttg gtg gtt gaa 1507 ctg agc aac aca aat gaa gtg gtt atc agg tat gtg ggc aaa gac tat 1555 leu ser asn thr asn glu val val ile arg tyr val gly lys asp tyr tct gct gct cag gaa tta atg gaa gat gag atg aag gaa tat tac agt 1603 aag aat cct aag atc aca cca gtc cag gct gtg aat gtt ggg cag ttg 1651 ctg gcc gta aat gcc gag gag gac gcc tgg tta cgg gca cag gtc atc 1699 tca aca gaa gag aac aaa ata aag gta tgc tat gtt gac tat ggt ttt 1747 ser thr glu glu asn lys ile lys val cys tyr val asp tyr gly phe agt gaa aat gtt gaa aaa agc aaa gca tac aaa tta aac ccg aag ttt 1795 tgt tca ctc tca ttt caa gct aca aaa tgt aag ctt gca ggc ttg gaa 1843 gtc cta agc gat gac cct gat cta gtg aag gtg gtt gaa tct tta act 1891 tgt gga aag atc ttt gca gtg gaa ata ctt gac aaa gct gac att cca 1939 cys gly lys ile phe ala val glu ile leu asp lys ala asp ile pro ctt gtt gtt ctg tac gat acc tcr gga gaa gat gat atc aat atc aat 1987 gcc acc tgc ttg aag gct ata tgt gac aag tca cta gag gtt cac ctg 2035 ala thr cys leu lys ala ile cys asp lys ser leu glu val his leu cag gtt gac gcc atg tac aca aat gtc aaa gta act aat att tgc tct 2083 gln val asp ala met tyr thr asn val lys val thr asn ile cys ser gat ggg aca ctc tac tgc cag gtg cct tgt aag ggt ctg aac aag ctc 2131 asp gly thr leu tyr cys gln val pro cys lys gly leu asn lys leu agt gac ctt cta cgt aag ata gag gac tac ttc cat tgc aag cac atg 2179 ser asp leu leu arg lys ile glu asp tyr phe his cys lys his met acc tct gag tgc ttt gtt tca tta ccc ttc tgt ggg aaa atc tgc ctc 2227 thr ser glu cys phe val ser leu pro phe cys gly lys ile cys leu ttc cat tgc aaa gga aaa tgg tta cga gta gag atc aca aat gtt cac 2275 phe his cys lys gly lys trp leu arg val glu ile thr asn val his agc agc cgg gct ctt gat gtt cag ttc ctg gac tct ggc act gtg aca 2323 tct gta aaa gtg tca gag ctc agg gaa att cca cct cgg ttt cta caa 2371 gaa atg att gca ata cca cct cag gcc att aag tgc tgt tta gca gat 2419 ctt cca caa tct att ggc atg tgg aca cca gat gca gtg ctg tgg tta 2467 leu pro gln ser ile gly met trp thr pro asp ala val leu trp leu aga gat tct gtt ttg aat tgc tcg gac tgt agc att aag gtt aca aaa 2515 gtg gat gaa acc aga ggg atc gca cat gtt tat tta ttt acc cct aag 2563 val asp glu thr arg gly ile ala his val tyr leu phe thr pro lys aac ttc cct gac cct cat cgc agt att aat cgc cag att aca aat gca 2611 asn phe pro asp pro his arg ser ile asn arg gln ile thr asn ala gac ttg tgg aag cat cag aag gat gtg ttt ttg agt gcc ata tcc agt 2659 asp leu trp lys his gln lys asp val phe leu ser ala ile ser ser gga gct gac tct ccc aac agc aaa aat ggc aac atg ccc atg tcg ggc 2707 aac act gga gag aat ttc aga aag aac ctc aca gat gtc atc aaa aag 2755 asn thr gly glu asn phe arg lys asn leu thr asp val ile lys lys tcc atg gtg gac cat acg agc gct ttc tcc aca gag gaa ctg cca cct 2803 ser met val asp his thr ser ala phe ser thr glu glu leu pro pro cct gtc cac tta tca aag cca ggg gaa cac atg gat gtg tat gtg cct 2851 pro val his leu ser lys pro gly glu his met asp val tyr val pro gtg gcc tgt cac cca ggc tac ttc gtc atc cag cct tgg cag gag ata 2899 val ala cys his pro gly tyr phe val ile gln pro trp gln glu ile cat aag ttg gaa gtt ctg atg gaa gag atg att cta tat tac agc gtg 2947 tct gaa gag cgc cac ata gca gtg gag aaa gac caa gtg tat gct gca 2995 ser glu glu arg his ile ala val glu lys asp gln val tyr ala ala aaa gtg gaa aat aag tgg cac agg gtg ctt tta aaa gga atc ctg acc 3043 lys val glu asn lys trp his arg val leu leu lys gly ile leu thr aat gga ctg gta tct gtg tat gag ctg gat tat ggc aaa cac gaa tta 3091 gtc aac ata aga aaa gta cag ccc cta gtg gac atg ttc cga aag ctg 3139 val asn ile arg lys val gln pro leu val asp met phe arg lys leu ccc ttc caa gca gtc aca gct caa ctt gca gga gtg aag tgc aac cag 3187 pro phe gln ala val thr ala gln leu ala gly val lys cys asn gln tgg tct gag gag gct tct atg gtg ttt cga aat cat gtg gag aag aaa 3235 trp ser glu glu ala ser met val phe arg asn his val glu lys lys cct ctg gtg gca ctg gtg cag aca gtc att gaa aat gct aac cct tgg 3283 gac cgg aaa gta gtg gtc tac tta gtg gac aca tcg ttg cca gac acc 3331 gat acc tgg att cat gat ttt atg tca gag tat ctg ata gag ctt tca 3379 asp thr trp ile his asp phe met ser glu tyr leu ile glu leu ser met leu glu gly asp leu val ser lys met leu arg ala val leu gln ser his lys asn gly val ala leu pro arg leu gln gly glu tyr arg ser leu thr gly asp trp ile pro phe lys gln leu gly phe pro thr xaa arg ser gly glu ile thr cys tyr ala met ala cys thr glu thr tyr met leu his thr thr leu gly asn glu ala phe lys asp ile pro val gln arg his val thr met ser thr asn asn arg phe ser pro lys lys glu met ser asp asn leu asn gln thr val glu lys pro asn val lys pro pro ala ser tyr thr tyr lys met asp glu val gln asn arg leu pro his phe tyr lys glu leu tyr lys glu asp leu asn gln gly ile leu gln gln phe glu his trp pro his ile cys thr val glu lys pro cys ser gly gly gln asp leu leu leu tyr pro ala lys arg lys thr ser gly leu trp ala ser ala leu pro lys ala phe glu glu met tyr lys val lys phe pro glu asp ala leu lys asn leu ala ser leu ser asp val cys ser ile asp tyr ile ser gly asn pro gln lys ala ala gly gln ala his gly asp asn asp ile lys ala met val glu gln glu tyr leu gln val glu glu ser ile ala glu ser ala asn thr phe arg tyr val gly lys asp tyr ser ala ala gln glu leu met glu asp glu met lys glu tyr tyr ser lys asn pro lys ile thr pro val gln trp leu arg ala gln val ile ser thr glu glu asn lys ile lys val cys tyr val asp tyr gly phe ser glu asn val glu lys ser lys ala tyr lys leu asn pro lys phe cys ser leu ser phe gln ala thr lys lys val val glu ser leu thr cys gly lys ile phe ala val glu ile leu asp lys ala asp ile pro leu val val leu tyr asp thr xaa gly lys ser leu glu val his leu gln val asp ala met tyr thr asn val lys val thr asn ile cys ser asp gly thr leu tyr cys gln val pro tyr phe his cys lys his met thr ser glu cys phe val ser leu pro val glu ile thr asn val his ser ser arg ala leu asp val gln phe ile lys cys cys leu ala asp leu pro gln ser ile gly met trp thr cys ser ile lys val thr lys val asp glu thr arg gly ile ala his val tyr leu phe thr pro lys asn phe pro asp pro his arg ser ile asn arg gln ile thr asn ala asp leu trp lys his gln lys asp val leu thr asp val ile lys lys ser met val asp his thr ser ala phe lys asp gln val tyr ala ala lys val glu asn lys trp his arg val asp tyr gly lys his glu leu val asn ile arg lys val gln pro leu val asp met phe arg lys leu pro phe gln ala val thr ala gln leu ala gly val lys cys asn gln trp ser glu glu ala ser met val phe arg asn his val glu lys lys pro leu val ala leu val gln thr val ile glu asn ala asn pro trp asp arg lys val val val tyr leu val | 2 |
the following specific examples are used for illustrating the present invention and are not limiting . a person skilled in the art can easily conceive the other advantages and effects of the present invention . the present invention can also be implemented by different specific cases be enacted or application , the details of the instructions can also be based on different perspectives and applications in various modifications and changes do not depart from the spirit of the creation . many examples have been used to illustrate the present invention . the examples sited below should not be taken as a limit to the scope of the invention . isolation of lactobacillus plantarum subsp . plantarum ps128 and identification of the bacterial strains using pcr - fingerprinting lactobacillus plantarum subsp . plantarum ps128 ( hereinafter referred to ps128 ) was isolated from fu - tsai , traditional fermented mustard products of taiwan . eric - pcr was conducted to further distinguish the subspecies of bacteria with high sequence similarity . the pcr - fingerprinting profile of ps128 was carried out under the condition indicated in table 1 . dnas extracted from this strain were used as templates . the obtained amplification products were electrophoresed and the patterns were compared as shown in fig1 , wherein the primers represented by seq id no : 1 and seq id no : 2 were used . as indicated by white arrows , the bands of ps128 are unique in position among those of dsm 27445 , atcc 14917 or atcc 17638 and hence the result in fig1 shows that even though ps128 , dsm227445 and atcc14917 t all belong to lactobacillus plantarum subsp . plantarum , they are still different bacterial strains . consequently , ps128 represented a new strain of lactobacillus plantarum subsp . plantarum . lactobacillus plantarum subsp . plantarum ps128 has been deposited under budapest treaty at leibniz institute dsmz - german collection of microorganisms and cell cultures ( inhoffenstr . 7 b , d - 38124 braunschweig , germany ) on mar . 31 , 2014 and has been given the dsmz accession no . dsm 28632 by the international depositary authority . this biological material was subjected to the viability test and passed . sugar utilization for ps128 used in the present invention was investigated using api50chl kit ( biomerieux , france ), and the results are shown in table 3 . the fermentation test indicates that ps128 harbor a biochemical property similar to lactobacillus plantarum subsp . plantarum . lab was inoculated in man rogosa sharpe ( mrs , bd , usa ) broth , cultured at 37 ° c . for 18 hrs and harvested by centrifugation at 6000 × g for 10 mins . pellets were resuspended to a final concentration of 5 × 10 9 or 5 × 10 9 colony formation unit ( cfu ) per milliliter by fresh mrs containing 12 . 5 % glycerol and stored at − 20 ° c . until use . eight - week - old male c57bl / 6jnarl or timed - pregnant c57bl / 6jnarl were purchased from national laboratory animal center ( nlac , taipei , taiwan ) and housed in filter - top cages with chow diet ( labdiet autoclavable rodent diet 5010 , pmi nutrition international , brentwood , usa ) and water ad libitum in a specific pathogen - free room at laboratory animal center , national yang - ming university under standard condition ( temperature 22 ° c ., 50 - 60 % humidity and 12 - h light / dark cycle ) for approximately one week until delivery . all animal experimental procedures were reviewed and approved by the animal management committee , national yang - ming university . early life stress by maternal deprivation under hypothermal environment was modified from previous studies ( millstein and holmes 2007 , desbonnet , garrett et al . 2010 ). briefly , neonatal were separated from their mothers and littermates 3 h ( 11 : 00 - 14 : 00 ) daily between postnatal day ( pd ) 2 - 14 under room temperature (˜ 22 ° c .). followed by 2 weeks of undisturbed except bedding change once per week , the stressed pups were weaned and randomly assigned to 5 - 6 mice per cage . only male pups were used for experiment ( n = 12 for stress groups , n = 12 for stress + 10 9 ). the mice that did not receive early life stress were served as control group ( control , n = 10 ). mice were administrated with saline or ps128 ( 10 9 cfu / mouse / day ) for 4 weeks from weaning ( pd28 ) to the age of 8 - weeks - old . they underwent a battery of behavioral tests including oft and fst sequenced from the least to the most stressful ones conducted in light phase . on the day of sacrifice , mice were subjected to a short forced swimming as a stressor 30 min prior to retro - orbital blood collection followed cervical dislocation which all took place between 11 : 00 and 14 : 00 h to minimize the effects of circadian rhythm . brain were quickly removed and specific region prefrontal cortex was dissected on ice and frozen in liquid nitrogen or preserved in 0 . 6 % perchloric acid buffer , then stored at − 80 ° c . until use . the open field test ( oft ) is a common measure of exploratory behavior and general activity in both mice and rats , where both the quality and quantity of the activity can be measured . locomotor activity was monitored and calculated by an open field activity system ( tru scan activity system , coulbourn instruments , pa , usa ) comprised of one arena ( 25 . 4 × 25 . 4 × 38 cm ) with two photobeam sensor rings outside of the plexiglas wall . each mouse was placed into the same corner of the arena for 10 min to measure several activities including total distance moved . the box was cleaned with water and 70 % ethanol after each run , and the mouse was returned to its home cage . the activities were automatically recorded and quantified by the tru scan 2 . 2 software ( coulbourn instruments ). the forced swimming test is a rodent behavioral test used for evaluation of antidepressant drugs , antidepressant efficacy of new compounds , and experimental manipulations that are aimed at rendering or preventing depressive - like states . fst were assessed as previously described ( cryan , dalvi et al . 2001 ) with modifications . briefly , immobility was calculated 4 min ( 1 - 5 min ) of a single 6 - min forced swimming test which the mice were put in a transparent acrylic cylinder ( 30 cm height × 10 cm internal diameter , containing 15 cm - depth water with temperature adjusted to 23 ± 1 ° c . ), recorded by a camera and further analyzed by a video tracking software ethovision ( noldus information technology , wageningen , the netherlands ). mice were dried with tissue paper after tested and returned to their home cage . transparent acrylic cylinders ( 30 cm height × 10 cm internal diameter ) containing 15 cm - depth water with temperature adjusted to 23 - 25 ° c . were used for a single 6 - min trial . the behaviors were recorded by a video camera . a video tracking software ethovision ( noldus information technology , wageningen , the netherlands ) was used for analysis . immobility was calculated for 1 to 5 min with the same parameters to avoid human errors . mice were dried with tissue paper after tested and returned to their home cage . as shown in fig2 a - 2b , in the oft , the stressed mice had similar total distance moved compared to control ( fig2 a ) while they had greater time of immobile in fst ( fig2 b ). administration of ps128 to the stressed mice significantly increased the total distance moved in the oft and decreased the immobility in the fst ( fig2 a and 2b ) to the degrees similar to control mice . * p & lt ; 0 . 05 compared to control group ; $ p & lt ; 0 . 05 compared to stress group . plasma corticosterone level is an indicator the activation of the hypothalamic - pituitary - adrenal axis , the basic response in body - brain interaction under stress or fear . serum was obtained from blood samples centrifuged at 4 ° c ., 3000 × g for 10 min that were collected from mice under normal state or 30 min after forced swimming between 11 : 00 to 14 : 00 to reduce the effects of circadian rhythm . serum was properly diluted and then applied to a commercial cort eia kit ( cayman , usa ), concentrations were interpolated by standards provided by the kit . as shown in fig3 , by measuring the serum level , the inventors found that corticosterone was significantly elevated in the stressed mice and was reversed by the administration of ps128 ( stress + 10 9 ). * p & lt ; 0 . 05 compared to control group ; $ p & lt ; 0 . 05 compared to stress group . hplc - ecd has the high performance for routine measurements of biological or environmental samples such as catecholamines ( dopamine , norepinephrine , and epinephrine ), monoamines ( e . g ., serotonin , dopamine , norepinephrine , and epinephrine ) acetylcholine , glutamate , glycine , gaba , and others . the neurotransmitters to be measured include dopamine ( da ), dihydroxyphenylacetic acid ( dc ) and homo - vanillic acid ( hva ). the high performance liquid chromatography - electrochemical detector ( hplc - ed ) system comprised a micropump ( cma - 100 , cma , stockholm , sweden ), an on - line injector ( cma - 160 ), a microtech lc - pump ( micro - tech scientific , sunnyvale , calif . ), and bas - 4c electrochemical detector ( bioanalytical systems , inc ., west lafeyette , ind .) as previously described ( cheng , kuo et al . 2000 ). a reversed - phase column ( kinetex c 18 , 2 . 6 um , 100 × 2 . 1 mm i . d ., phenomenex , usa ) was used for analysis . the potential for the glassy carbon working electrode was set at + 650 mv with respect to a ag / agcl reference electrode at room temperature ( 25 ° c .). the mobile phase containing 0 . 1 m nah 2 po4 , 8 % methanol , 0 . 74 mm sos , 0 . 03 mm edta and 2 mm kcl , was adjusted to ph 3 . 74 with h 3 po 4 . whole brains were frozen on dry ice immediately after collected from cervical dislocated mice . prefrontal cortex was dissected and preserved in 0 . 6 % perchloric acid buffer and stored at − 80 ° c . until homogenized by sonication and centrifuged at 12000 × g , 10 min . supernatants were filtered by 0 . 22 m pvdf membrane ( 4 mm syringe filter , millex - gv , millipore , usa ) before analyze . properly diluted supernatants were injected ( 20 μl ) into the chromatographic system at a flow rate of 0 . 2 ml / min . the concentrations of monoamines were interpolated by the following standards : da , dc and hva ( sigma - aldrich , st . louis , mo ., usa ) ranged from 1 to 100 ng / ml . as shown in fig4 a - 4c , by applying the early life stress protocol , neurotransmitters in prefrontal cortex was altered . in the dopaminergic pathway , dopamine itself was reduced and the level of its metabolite dc was similar to that of control group ( fig4 a and 4b ) while the other metabolite hva was significantly decreased ( fig4 c ). administration of ps128 significantly increased dopamine , dc and hva levels of the stressed mice ( fig4 a - 4c ). * p & lt ; 0 . 05 compared to control group ; $ p & lt ; 0 . 05 compared to stress group . all data presented herein were expressed as means ± the standard deviation ( sd ). statistical analysis was calculated by one - way anova followed by a bonferroni post - hoc test . statistical difference between groups denoted by asterisk (*) or dollar sign ($) if p & lt ; 0 . 05 . the present invention finds a potential strain , lactobacillus plantarum subsp . plantarum ps128 , that exerts benefits on stressed mice and is reported that by administrating a lactobacillus strain ps128 , behaviors of the mice were improved . while some of the embodiments of the present invention have been described in detail in the above , it is , however , possible for those of ordinary skill in the art to make various modifications and changes to the particular embodiments shown without substantially departing from the teaching and advantages of the present invention . such modifications and changes are encompassed in the spirit and scope of the present invention as set forth in the appended claim . the references listed below and the atcc numbers cited in the application are each incorporated by reference as if they were incorporated individually . 1 . cheng , f . c ., j . s . kuo , h . m . huang , d . y . yang , t . f . wu and t . h . tsai ( 2000 ), “ determination of catecholamines in pheochromocytoma cell ( pc - 12 ) culture medium by microdialysis - microbore liquid chromatography ,” j . chromatogr . a ., 870 ( 1 - 2 ): 405 - 411 . 2 . cryan , j . f ., a . dalvi , s . h . jin , b . r . hirsch , i . lucki and s . a . thomas ( 2001 ), “ use of dopamine - beta - hydroxylase - deficient mice to determine the role of norepinephrine in the mechanism of action of antidepressant drugs ,” j . pharmacol . exp . ther ., 298 ( 2 ): 651 - 657 . 3 . desbonnet , l ., l . garrett , g clarke , b . kiely , j . f . cryan and t . g dinan ( 2010 ), “ effects of the probiotic bifidobacterium infantis in the maternal separation model of depression ,” neuroscience , 170 ( 4 ): 1179 - 1188 . 4 . millstein , r . a . and a . holmes ( 2007 ), “ effects of repeated maternal separation on anxiety - and depression - related phenotypes in different mouse strains ,” neurosci . biobehav . rev ., 31 ( 1 ): 3 - 17 . | 2 |
a multiple connector size compression tool 100 for at least two or more different sized or types of connectors is shown in fig1 - 6 that may comprise a body 10 having an upper portion 11 , a lower portion 12 , a first side 13 and a second side 14 . the compression tool 100 can be used while handheld or while resting on a surface , such as a table . the compression tool 10 has vertically offset connectors 11 , 12 within the body 100 . alternatively , the connectors 11 , 12 may be referred to as adapters , couplers , or fastener members or devices . the configuration for receiving the connectors 11 , 12 is permanently designed into the compression mechanism of the tool 100 to prevent the previous deficiencies such as looseness or misplacement of the adapters to fit various sizes . this allows for a simple tool with adaptability for multiple connectors without the problems associated with a unit designed for all possible connectors . attached to the body 10 may be an actuator , lever or handle 15 ( see fig1 - 6 ), wherein the handle 15 is movably attached 16 to the upper portion 11 of the body 10 . the downward movement of the handle 15 moves or linearly translates a sliding head 25 , wherein the head may be movably affixed 30 to the body 10 between either the first side 13 and / or the second side 14 of the body 10 and configured to be operatively coupled to the handle 15 . the handle 15 moves the sliding head 25 so that the force of moving the handle 15 against the body 10 may cause the sliding head 25 to translate within the interior of the body 10 from a first uncompressed position to a second compressed position . the sliding head 25 may also be advanced with a transfer element device 70 such as hydraulics , electronics or a mechanical advantage device such as a gear , screw , lever or handle to move the sliding head 25 with sufficient force to compress the connector onto the wire . the lever or handle 15 may have a material used for a grip or other ergonomic design ( not shown ) for ease of handling and comfort of the user . the lever or handle 15 may be movably attached to the sides or walls 13 , 14 of the body 100 by any of a number of devices such as a bar , catch , coupling , dowel , fastener , key , lag , latch , peg , pin , rivet , rod , screw , skewer , sliding bar , spike , staple , or stud . the body 10 could be any rigid material such as metal , composites , polymers or plastic that will not torsionally flex during the compression process . the body 10 , may be stamped , cut , shaped , finished , machined , forged , cold worked , heat treated or assembled with conventional fasteners , such as stamps , welds , adhesive , rivets , pins , screws , nails and the like . if made of a plastic , polymer or composite the body may be molded and either adhered or glued , welded or mechanically or chemically fastened together . the tool is not limited to any specific material as long as it is sufficiently stiff to prevent flexing or breaking of the body 10 for a period of time to permit a useful life of the tool . a first cable connector 101 and a second cable connector 102 are shown within the compression tool 100 . fig4 displays the upper compression chamber portion 40 that may be adjacent to the actuator or handle 15 . the upper or first compression chamber 40 may be configured for receiving a connector of a first dimension 101 . the lower or second compression chamber 45 is adjacent to the bottom 12 of the body 10 for receiving a connector of a second dimension 102 different than the first dimension 101 . the tool may be opened by raising the handle and retracting the sliding head 25 a sufficient distance to expand the compression chamber 40 , 45 so that at least one connector and a wire or cable can be inserted uncompressed into the connector within one of the compression chambers 40 , 45 . the first and second dimensions can be the same or any two different sized connectors that are defined , at least in part , by the shape and dimensions of the sliding head 25 . the compression chambers 40 , 45 are formed by the space created between the body 10 and the sliding head 25 . the compression chambers 40 , 45 may be fully compressed when the handle 15 is substantially flushed with the body 10 or at the end of its travel . the compression chamber volume is dependent on the specific type of connector and largely controlled by the shape and end position of the sliding head 25 or the body 10 . fig1 , 3 and 4 - 6 show a cable cradle 50 having an upper cable receiving portion 52 and a lower cable receiving portion 54 , wherein the cable cradle 50 may be affixed to the body 10 . the cable cradle 50 may help to align and hold the cable during the process of attaching the cable connector end onto the wire . the cable cradle 50 may also serve to receive the end of a connector and the cradle 50 remains stationary during the compression process so that the connector is compressed onto the cable from the movement of the sliding head 25 . in fig3 a protruding component 30 may be affixed to the sliding head 25 and configured to be operatively coupled either directly or indirectly such as linkage 70 with the handle 15 . the protruding component 30 works in conjunction with a receiving portion 35 that is positioned within at least one side of the body 10 . the receiving portion accepts the protruding component 30 of the head 25 to secure the sliding head 25 to the body . the linkage portion 70 moves the protruding component 30 within the receiving portion 35 so that the sliding head 25 moves toward the cable cradle 50 compressing the cable connector onto the wire . a hinge 60 pivotally affixes the handle 15 to the body 10 . the linkage portion 70 can be a rod , screw , piston , hydraulics , electrical motor , air piston , or any other force generating and / or transferring device suitable for inclusion . fig4 displays a first compressed length 65 that corresponds to the upper compression channel portion 40 of the head 25 and a second compressed length 66 that corresponds to the lower compression channel portion 45 of the head . the compressed lengths 65 , 66 are controlled by the dimensions of the specific connector . the connector dimensions are designed into and controlled by the sliding head 25 and the receiving portion 35 . the sliding head 25 is limited from further travel beyond the desired connector compressed length 65 , 66 . to further control the movement of the sliding head 25 a stop can be part of the receiving portion 35 . the toggle lever 70 also may be stopped by a toggle contact 72 on the sliding head 25 that may block further travel of the handle 15 as an additional optional feature . fig4 also displays a first driver tip 80 for the upper compression channel portion 40 of the sliding head 25 for receiving the connector of the first dimension . the driver tip 80 , which is a hollow tube , pipe , conduit , rod or any other device with a hole or spacing device to both protect the connector center electrode or post and to transmit the compression force from the sliding head 25 to the connector . the embodiment may also includes at least one additional driver tip or a second driver tip 82 for the lower compression channel portion 45 of the sliding head 25 for receiving the connector of the second dimension . the driver tips are received by the sliding head 25 by driver tip receivers 81 , 83 to center and guide the driver tip or are formed integrally into the sliding head 25 itself . the driver tips 80 , 82 that can be of the same or different diameters and lengths transmit the force from the sliding head 25 onto the connector to compress the connector onto the wire . the driver tips 80 , 82 may alternatively be incrementally or infinitely adjustable by expanding and / or contracting the length of the driver tips 80 , 82 through devices that would telescope or notches , pegs , ratchets or the like . the driver tips 80 , 82 may be integral or separate parts . fig1 - 6 display an embodiment of the multiple connector size compression tool 100 that can be made out of a metal , rigid plastic or similarly performing material that comprise a body 10 having a top 11 , a bottom 12 , a first side 13 and a second side 14 each side having a guidance portion 35 therein that can act to both control the direction and length of the stroke of the tool 100 . this tool 100 may be made in a form designed to portably fit within the grasp of a users single hand , but if desired by the user , three , four , five or more connectors compression channels can be designed to be present in the tool 100 . the tool 100 could be either permanently or removably affixed to a user &# 39 ; s workstation , desk , or other stationary or semi - stationary fixture . the tool 100 has a handle 15 , wherein the handle 15 may be pivotally attached to the body 10 to either the first side 13 , the second side 14 or to both sides and the handle 15 is attached to an linkage element 70 that actuates sliding head 25 . the optional linkage element 70 may aid in the speed of reloading the tool with an uncompressed connector because the sliding head retracts creating a larger compression chamber when the handle 15 is raised . the linkage 70 is any force transferring or generating device such as a rod , gear , pistons either hydraulic or pneumatic amongst other commonly know elements as discussed herein . the connectors are compressed onto the desired wire of the appropriate length by a sliding head 25 having an affixed protruding component 30 , wherein the protruding component 30 of the sliding head 25 may be both retained and movable within the guidance portion 35 of the body 10 . the guidance portion 35 can either be a groove , a valley formed between two raised surfaces or just a trough of sufficient depth to receive the guidance portion 35 or other similar features . the protruding component 30 can be anything that may operate with the guidance portion 35 . when the protruding component 30 is a post it can be used to assemble and retain the sliding head 25 within the body 10 by passing the post through the guidance portion 35 of the body 10 into the head 25 to be moveably affixed . the sliding head 25 can also alternatively be guided by the body if the walls of the body were assembled around the sliding head during production so that after assembly the only path for movement of the sliding head 25 would be linear and the linkage 90 would control the length of travel . fig4 displays a toggle lever 70 that is a linkage that is operable with the handle 15 that may work in conjunction with a portion of the body 10 and the sliding head 25 may be used to limit the travel of the handle 15 to prevent over - compression and crushing of the connector . this feature of the toggle lever 70 and a toggle contact 72 on the sliding head 25 may be used in conjunction with the guidance portion 35 of the body 10 to limit the travel to a certain desired point . the guidance portion 35 could also be placed on the sliding head 25 and the protruding component 30 could be affixed to either the handle 15 or the body 10 in an alternative method such as a bar , catch , coupling , dowel , fastener , key , lag , latch , peg , pin , rivet , rod , screw , skewer , sliding bar , spike , staple , or stud . to compress the connector , the body 10 forms an upper compression channel portion 40 configured to receive a connector of a first dimension and at least one lower compression channel portion 45 configured to receive a connector of a second dimension typically different than the first dimension . the sliding head 25 is driven toward a cable cradle 50 having an upper cable receiving portion 52 and a lower cable receiving portion 54 , wherein the cradle may be affixed to the body 10 between the first side 13 and the second side 14 . the handle 15 may also alternatively with an angled portion 20 contact a portion of the sliding head 25 to move the sliding head 25 from uncompressed to compressed positions or the handle 15 may use the mechanical advantage of the linkage element 70 to move the handle 15 from an uncompressed ( fig5 and 6 ) to compressed position ( fig1 - 4 ). the contact between the guide portion and the protruding component 30 is a surface to surface contact , but optionally a bearing 32 can be disposed over the protruding component 30 such as a post of the sliding head 25 . the bearing 32 would reduce the friction and wear between the two surfaces and provide for smoother movements when moving in conjunction with the guidance portion 35 that may be a groove . the connector may be pressed on by a driver trip 80 , 82 that can be permanently affixed within the sliding head 25 or removable for replacement due to wear . the type of connector that can be compressed may be defined by a first compressed length 65 and / or diameter that corresponds to the upper compression channel portion 40 of the head . the second compressed length 66 and / or diameter that corresponds to the lower compression channel portion 45 of the head 25 may facilitate multiple connectors to be compressed by the same tool without the use of adapters . a method of affixing a cable connector to a wire comprises providing a body 10 having a top 11 , a handle 15 that may be coupled to a linkage or toggle lever 70 , wherein the handle 15 is attached to the top 11 of the body 10 . this body 10 is configured to have the capacity to produce at least two different dimensioned connectors . the body 10 houses a sliding head 25 having a protruding component 32 that is slidably affixed to the body 10 and in contact with the angled portion 20 of the handle 15 , to allow movement of the sliding head 25 . the sliding head 25 and body 10 form an upper compression portion 40 of the sliding head 25 for receiving a connector of a first dimension , a lower compression portion 45 of the sliding head for receiving a connector of a second dimension larger than the first dimension , and a cable cradle 50 affixed to the body 10 . it should be understood that although a cradle 50 is depicted other shapes and devices may be within the purview of the present invention such as a fastener , catch , clasp , grip , lock , snap , vice , clamp , hole , guide , opening , aperture , cavity , chamber , cleft , cut , dent , depression , dimple , dip , gap , keyhole , lacuna , notch , orifice , outlet , or passage . the importance of the cradle 50 is for the purpose of holding or guiding the cable or wire during assembly of the connector . once the correct tool is provided the next step is providing a cable connector and a wire start by inserting the cable connector and the wire onto an appropriately sized driver tip in the body 10 . after inserting the uncompressed cable the next step is moving the sliding head 25 to drive the cable connector onto the wire forming a connector cable by means of either a handle or other means of mechanical leverage before removing the connector cable from the body . the tool 100 can compress , attach or affix two or more different sized connectors individually , consecutively or simultaneously compress and produce two cables by providing a second , third , fourth , etc . cable connector and a second , third , or fourth , etc . wire and then inserting the second cable connector and second the wire onto an appropriately sized driver tip in the body before compressing the handle . therefore embodiments of the present invention allow for either faster production or the option of producing two different sized connectors without using an adapter . while this invention has been described in conjunction with the specific embodiments outlined above , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art . accordingly , the preferred embodiments of the invention as set forth above are intended to be illustrative , not limiting . various changes may be made without departing from the spirit and scope of the invention as defined in the following claims . the claims provide the scope of the coverage of the invention and should not be limited to the specific examples provided herein . | 8 |
fig1 is an external perspective view of an ultrasonic sensor according to the first preferred embodiment of the present invention . fig2 is an external perspective view showing the ultrasonic sensor 1 in fig1 turned upside down . fig3 is a cross - sectional view taken along line a - a in the ultrasonic sensor 1 shown in fig2 . in the ultrasonic sensor 1 of the present preferred embodiment , piezoelectric devices 51 a and 51 b that create vibrations are disposed inside an aluminum housing 10 . in the housing 10 , two tubular containers 11 and 12 that are open at one end and closed at the other end by bottom portions 11 c and 12 c are connected together by a connecting portion 13 at end portions of side portions 11 b and 12 b of the tubular containers 11 and 12 , respectively , the end portions being adjacent to the bottom portions 11 c and 12 c . in other words , the housing 10 is an integral member including the two tubular containers 11 and 12 . the connecting portion 13 is defined by a plate having a uniform thickness . the side portions 11 b and 12 b are also of uniform thickness . as shown in fig1 , outer bottom surfaces 11 d and 12 d of the tubular containers 11 and 12 and an adjacent outer surface of the connecting portion 13 are connected to form a single flat surface . the piezoelectric devices 51 a and 51 b are disposed on inner bottom surfaces 11 e and 12 e , respectively , of the respective tubular containers 11 and 12 . lead wires ( not shown ) are attached to the respective piezoelectric devices 51 a and 51 b and extend outside the ultrasonic sensor 1 through respective openings 11 a and 12 a . the housing configuration of the present preferred embodiment includes side portions of the tubular containers that are connected to each other , by the connecting portion , near the bottom portions of the tubular containers . the reasons that this configuration is used are as follows . fig4 a is a schematic cross - sectional view showing a state in which the side portion 11 b vibrates in response to the drive of the piezoelectric device 51 a when a voltage is applied to an ultrasonic sensor 2 having a housing configuration including the single tubular container 11 . a power source , lead wires , and other components that are required for voltage application are omitted from fig4 a , which schematically illustrates only the piezoelectric device 51 a and the housing including the tubular container 11 . fig4 b is a graph showing the amount of displacement ( i . e ., the width of horizontal vibrations ) of the side portion 11 b which vibrates in response to the application of a voltage . the horizontal axis represents the location in the side portion ranging from the bottom portion 11 c at zero to an opening 11 a . the vertical axis represents the amount of displacement . fig4 a and fig4 b show that the amount of displacement increases as the location in the side portion 11 b approaches the opening 11 a . this is because , in the side portion 11 b , a portion closer to the opening 11 a is less affected by the restraining force of the bottom portion 11 while a portion closer to the bottom portion 11 c is more affected by the restraining force of the bottom portion 11 c , and thus , is inhibited from vibrating . therefore , in the present preferred embodiment of the present invention , the side portions of the plurality of tubular containers are connected to each other , by the connecting portion , at portions near the bottom portions where the amount of displacement of the side portions is small . in the first preferred embodiment , the connecting portion 13 is disposed at a location that enables the outer bottom surfaces 11 d and 12 d , where the amount of displacement is smallest , and the outer surface of the connecting portion 13 to form a single flat surface . the ultrasonic sensor 1 is mounted , for example , in a bumper of a vehicle to be used as a back - up sensor . fig5 is a partial perspective view of the vehicle 52 with the rear bumper 53 in which the ultrasonic sensor 1 is mounted . the outer bottom surfaces 11 d and 12 d of the ultrasonic sensor 1 are exposed to the outside , with the side portions 11 b and 12 b and openings 11 a and 12 a embedded in the rear bumper 53 . fig6 is a partial cross - sectional view taken along line b - b in the vehicle 52 shown in fig5 which shows the ultrasonic sensor 1 as viewed from above . the side portions 11 b and 12 b are embedded in the bumper 32 while being covered with an elastic member 54 made of rubber or other suitable material . supporting the housing 10 by the elastic member 23 in this manner enables the tubular containers 11 and 12 to vibrate freely , with virtually no interference , in response to the drive of the piezoelectric devices 51 a and 51 b , and thus , enables the effects of preferred embodiments of the present invention to be achieved . in addition to the functional effects described above , the present invention has the effect of enhancing the appearance of ultrasonic sensors , as the exposed surface of the ultrasonic sensor 1 is a single flat surface . fig7 is an external perspective view of an ultrasonic sensor according to the second preferred embodiment of the present invention . while the connecting portion 13 of the first preferred embodiment is preferably defined by a plate having uniform thickness , a connecting portion 33 of the present preferred embodiment includes a recessed portion 33 a having a reduced thickness . in the tubular containers 11 and 12 , the recessed portion 33 a is provided on the inner surface opposite the outer surface that is flush with the outer bottom surfaces 11 d and 12 d . the shapes of the other components of the present preferred embodiment are preferably the same as those of the first preferred embodiment . preferred embodiments of the present invention prevent the reverberations of vibrations created by piezoelectric devices disposed in respective tubular containers including an integral housing from affecting each other . therefore , in the housing configuration described above , two tubular containers are connected to each other at a location at which the amount of displacement caused by vibrations is smallest . in addition , varying the drive frequency of the piezoelectric devices 51 a and 51 b from the resonant frequency of the connecting portion 33 is preferable because it prevents the vibrations from being easily transmitted . these frequencies can be varied by modifying the shape of the connecting portion 33 , for example , by forming a recessed portion , as shown in fig7 , or conversely , a raised portion in the connecting portion 33 . another possible method is to adjust the thickness or length of the connecting portion . fig8 is an external perspective view of an ultrasonic sensor according to the third preferred embodiment of the present invention , as viewed from the openings . fig9 is a front view of an ultrasonic sensor 4 . the ultrasonic sensor 4 of the present preferred embodiment differs from the ultrasonic sensor 1 of the first preferred embodiment in terms of the thickness of side portions of tubular containers . the shapes of the other components are the same as those of the first preferred embodiment . the ultrasonic sensor 4 of the present preferred embodiment includes substantially rectangular tubular containers 41 and 42 whose respective side portions do not have uniform thicknesses . in the tubular containers 41 and 42 , the thickness c of a side portion connected to the connecting portion is greater than the thickness d of a side portion that is substantially perpendicular to the side portion connected to the connecting portion . specifically , the distance from the outer edge of each of outer bottom surfaces 41 d and 42 d , which are substantially rectangular in outline , to the outer edge of each of inner bottom surfaces 41 e and 42 e , in other words , the thickness of each side portion adjacent to the connecting portion 13 is greater than the thickness d , regardless of the location of a contact point 14 along a line between a side portion and the connecting portion 13 ( i . e ., thickness c 1 = c = c 2 & gt ; d ). vibrations of the housing caused by the drive of the piezoelectric devices 51 a and 51 b are large in thinner portions of the side portions , and small in thicker portions of the side portions . therefore , a configuration in which the thickness of a side portion adjacent to the connecting portion 13 is greater than the thickness of a side portion distant from the connecting portion 13 further reduces the effects of vibrations . although , in the present preferred embodiment , each opening of the housing defined by the tubular containers is preferably substantially rectangular in shape , the present invention is not limited to this . for example , each opening may be circular in shape . likewise , the shape of each piezoelectric device , which is preferably substantially circular in the present preferred embodiment , is not limited to this , and may alternatively be rectangular . although it is preferable that the tubular containers are connected to the connecting portion at side portions closest to the bottom portions , the connecting position of the connecting portion may be slightly shifted toward the openings so as to form a gap therebetween . moreover , the number of tubular containers is not limited to two . for example , the present invention is also applicable to a housing configuration in which three tubular containers are connected by two connecting portions . moreover , filling the tubular containers with elastic members causes virtually no interference with the vibrations of the housing , and thus , does not adversely influence the effects of the present invention . while preferred embodiments of the present invention have been described above , it is to be understood that variations and modifications will be apparent to those skilled in the art without departing the scope and spirit of the present invention . the scope of the present invention , therefore , is to be determined solely by the following claims . | 6 |
the basis of the proposed imaging method is a technique called “ orthogonal polarized spectral imaging ” ( opsi ). according to said technique , a semi - transparent target to be examined ( for example a finger ) is illuminated with a polarized light emitted by an excitation system such as a light emitting diode or a laser system , working generally in the near - infrared range , and an imaging system only detects light returning from said target with a polarization orthogonal to the polarization of the illuminating light . in this opsi technique , the light that is reflected by the target surface will have the same polarization as the light illuminating said target , and therefore it will not be detected by the imaging system . on the contrary , the light that has been transmitted in the target ( in the described example , in the skin and the finger ) will scatter multiple times and will lose its original polarization direction . this depolarized light will now back illuminate the target ( in the example , the blood vessels ) and a part of said depolarized light will reach the imaging system . if there are within the target objects that absorb more light than the surrounding medium ( for example , blood that absorbs more light than the surrounding tissue ), the imaging system will record an image of dark objects in a brighter medium ( for example , an image of dark blood vessels in a bright skin tissue ). this basis principle of opsi is illustrated in fig1 . the apparatus illustrated in said fig1 comprises a light source 11 ( ls ), for instance a light emitting diode , emitting an optical imaging beam 111 that is collimated and directed towards a polarizing beam splitter 12 ( pbs ). the collimated imaging beam 111 is passed through the polarizing beam splitter 12 , and the polarized imaging beam thus obtained is directed towards an optical stage 13 ( os ) and then received by a target 14 ( t ), in the example , by the skin of a person . the light that has penetrated the target 14 ( the skin ) and scatters multiple times is depolarized and back illuminates the target and the objects within it ( in the example , the blood vessels in the finger of the person ). the polarization component orthogonal to the initial polarization is now collected by the optical stage 13 , transmitted through the polarizing beam splitter 12 , and finally recorded by an imaging module 15 ( im 1 ). if the objects ( in the example , the blood vessels ) absorb the used wavelength more strongly than the surrounding medium , these objects ( the blood vessels ) appear dark in the captured image shown by the imaging module 15 . the main features of such a system are already known , for instance from the u . s . pat . no . 5 , 751 , 835 . a combination of a fingerprint detection method and the previously described technique then allows to eliminate the disadvantages associated with conventional fingerprint sensors and to perform a more reliable operation of fingerprint detection . an apparatus according to the invention , shown in fig2 which illustrates a combination of the opsi technique and the fingerprint imaging technique , first comprises the same modules as previously described with reference to fig1 ( the light source 11 , the polarizing beam splitter 12 , the optical stage 13 , and the imaging module 15 ), but also , in the present embodiment , a second imaging ; module 25 ( im 2 ). the first imaging module 15 is used as previously for opsi , while the second one is used to image the fingerprint of the person . the light coming back from the target 14 ( the finger of the person ) with the original polarization mostly corresponds to a light that is reflected from the top layers of the target ( the first skin layers ). the polarizing beam splitter 12 reflects this light , and a beam splitter 26 located in the optical path between said polarizing beam splitter 12 and the light source 11 can redirect said returning light towards the second imaging module 25 , able to record the fingerprint of the user . thus the information based on blood vessels ( available in the first imaging module 15 ) and the information based on the fingerprint ( available in the second imaging module 25 ) can be combined in an identification module 27 ( id 2 ), resulting in a more reliable biometric identification of the person . this disclosure is obviously illustrative and cannot be , in any way , a limitation of the scope of the invention . modifications to the disclosed apparatus may also be proposed . for instance , in another embodiment illustrated in fig3 , which corresponds to a combination of opsi and fingerprint imaging in which parts of the apparatus that are similar to the corresponding parts of the apparatus of fig1 and 2 ( light source 11 , polarizing beam splitter 12 , optical stage 13 ) have identical references , only one imaging module 35 ( im 3 ) is used for both opsi and fingerprint imaging . for this purpose , a liquid crystal cell 37 ( lcc 1 ) is used as a switchable quarter wave plate : when said quarter wave plate is switched off , the embodiment operates as an opsi apparatus ; when the quarter wave plate is switched on , the polarization of light is rotated such as the same polarization as the illumination light is now transmitted to the imaging module 35 . this way , said imaging module 35 will record mostly light that reflected from the first skin layers , which enables the imaging of the fingerprint of the person . the same reliable biometric identification of this person , based on a “ blood vessel ” information and a “ fingerprint ” information , is now possible and is done in an identification module 67 ( id 3 ). the advantage of this embodiment is to save space and cost . in another embodiment , illustrated in fig4 , which corresponds to a stereoscopic opsi biometric system and in which parts of the apparatus that are similar to corresponding parts of previous embodiments have identical references ( light source 11 , polarizing beam splitter 12 , optical stage 13 ), two imaging modules 45 a ( im 4 ) and 45 b ( im 5 ) are used to record blood vessels . if said modules are properly aligned , this results in a stereoscopic imaging system : the two imaging modules capture the same area , however under a different angle . the differences between both recorded images result in a 3d information related to the blood vessel pattern in the finger , which is used for identification of the person in an identification module 47 . ( 1 ) as the invention uses only optical methods to detect fingerprints and blood vessels , it is not necessary to have a mechanical contact between the sensor and the object ( the finger ): as a consequence , the sensor can be placed behind an optical window and will therefore be safe from outside influences ( weather , vandalism ) and will remain free of contaminants such as sweat , grease or dust ( moreover , it is possible to have a single surface where the person places a finger , which increase the user - friendless , compared to inserting a finger into a device ). ( 2 ) the invention uses blood vessels for identification , which makes spoofing more difficult since users do not leave blood vessel patterns on any object they touch or handle ( moreover , it is more difficult to construct a 3d blood vessel pattern compared to a fingerprint ), and , by examining the spectral contrast , it is possible to discriminate between living and dead fingers , because the spectral absorption changes with the oxygenation of blood ( access will be denied if the absorption of the light by the blood is different from what is expected from a reference database in the identification module ). it must be understood that the present invention is not limited to the aforementioned embodiments . variations and modifications may be proposed without departing from the spirit and scope of the invention as defined in the appended claims , and the following closing remarks are made . there are numerous ways of implementing functions by means of items of hardware or software , or both . in this respect , the drawings are very diagrammatic , each representing only one possible embodiment of the invention . thus , although a drawing shows different functions as different blocks , this by no means excludes that a single item of hardware or software carries out several functions , or that an assembly of items of hardware or software or both carry out a function . as said above , the description given with reference to the drawings illustrates rather than limits the invention , and numerous alternatives , which fall within the scope of the appended claims , are possible . the word “ comprising ” does not exclude the presence of other elements or steps than those listed in a claim . the word “ a ” or “ an ” preceding an element or step does not exclude the presence of a plurality of such elements or steps . | 6 |
a preferred embodiment of the present invention will be hereinafter described in detail with reference to the accompanying drawings . fig1 shows , as one example , a block diagram of a switching regulator according to an embodiment of the present invention . a switch 107 serves to supply therethrough an input voltage vin to a coil 109 . an error amplifier 101 serves to amplify a difference between a voltage which is obtained by dividing an output voltage vout with a resistor 110 and a resistor 111 , and a reference voltage vref supplied from a reference voltage source 200 . a signal which is obtained by subtracting a correction ramp wave outputted from the slope correcting circuit 102 from an output signal of the error amplifier 101 in a subtracter 103 is inputted to an inverting input terminal of a comparator 104 . the correction ramp wave outputted from the slope correcting circuit 102 , as shown in the figure , has a shape of a saw - tooth - wave which is synchronous with a period of an oscillator 105 . a voltage signal into which information of a current caused to flow through the switch 107 , or information of a current caused to flow through the coil 109 is converted is inputted to a non - inverting input terminal of the comparator 104 . a currents caused to flow through the respective constituent elements is usually detected using a sense resistor which is operatively connected in series with the switch 107 or the coil 109 . thus , a voltage signal having a value which is proportional to the current caused to flow through the switch 107 or the coil 109 is inputted as voltage information to the non - inverting input terminal of the comparator 104 . an output signal of the comparator 104 is inputted to a reset terminal r of an sr - latch 106 . the oscillator 105 is operatively connected to a set terminal s of the sr - latch 106 . then , pulses having a fixed period , as shown in the figure , are outputted from the oscillator 105 . an output terminal q of the sr - latch 106 is operatively connected to the switch 107 . then , when a signal level at the output terminal q of the sr - latch goes h , the switch 107 is turned on . as compared with the conventional current mode step - down switching regulator shown in fig3 , a reference voltage vref of the reference voltage source 200 is changed to thereby make the output voltage vout variable . moreover , the reference voltage vref as an output voltage of the reference voltage source 200 is inputted to the slope correcting circuit so that an increasing rate of the correction ramp wave as an amount of slope correction is made variable in accordance with the reference voltage vref . that is , in order that an amount of slope correction of the switching regulator is suitably maintained even if the output voltage vout is changed , an increasing rate of the correction ramp wave as an amount of slope correction is changed so as to follow a fluctuation of a decreasing rate of a coil current generated by changing the output voltage vout . detailed description will be hereinbelow given with respect to a case where an increasing rate of the correction ramp wave as an amount of slope correction is changed in proportion to the reference voltage vref . for example , in case of the step - down switching regulator , assuming that an inductance of the coil 109 is l , an increasing rate ( slope ) mu of the coil current when the switch 107 is in a turn - on state is approximately expressed as follows : on the other hand , a decreasing rate ( slope ) md of the coil current when the switch 107 is in a turn - off state is approximately expressed as follows : in particular , a current oscillation of the current mode step - down switching regulator has no connection with the increasing rate mu of the coil current , and hence it is sufficient to take into account only the decreasing rate md of the coil current . thus , only the decreasing rate of the coil current will be hereinbelow described . assuming that the reference voltage as the output voltage of the reference voltage source 100 is vref , and resistance values of the resistors 110 and 111 are r 110 and r 111 , respectively , the output voltage vout is expressed as follows : v out =( 1 + r 110 / r 111 )× v ref . ( expression 3 ) hence , if expression 3 is substituted for expression 2 , then the following expression is obtained : md =( 1 + r 110 / r 111 )× v ref / l . ( expression 4 ) on the other hand , assuming that the increasing rate ( slope ) mc of the correction ramp wave as an amount of slope correction outputted from the slope correcting circuit is expressed as follows so as to be proportional to the reference voltage vref , where k is a proportional constant , the following expression is obtained from expression 4 and expression 5 : from expression 6 , it is understood that a ratio of the increasing rate mc of the correction ramp wave as an amount of slope correction to the decreasing rate md of the coil current becomes fixed . from the foregoing , the increasing rate mc of the correction ramp wave as an amount of slope correction is made proportional to the reference voltage vref which is made to fluctuate for the purpose of changing the output voltage vout , whereby the ratio of the increasing rate mc of the correction ramp wave as an amount of slope correction to the decreasing rate md of the coil current can be made fixed against the output voltage vout . as a result , it is possible to constitute the current mode step - down switching regulator with which a suitable amount of slope correction is maintained against the output voltage vout . the detailed description has been given above with respect to the case where the increasing rate of the correction ramp wave as an amount of slope correction is changed in proportion to the reference voltage vref . however , even if a change in increasing rate md of the correction ramp wave as an amount of slope correction is not necessarily proportional to the reference voltage vref , effects of the present invention are provided as long as a relationship between the correction ramp and the decreasing rate of the coil current shows a proportional relationship . that is , in order to prevent the oscillation of the current mode step - down switching regulator , a value of the ratio of the increasing rate mc of the correction ramp wave as an amount of slope correction to the decreasing rate md of the coil current becomes important . in the embodiment shown in fig1 , the description has been given with respect to the case where the correction ramp wave is increased . however , even if a subtracter 103 is replaced with an adder such that the correction ramp wave is decreased , the same effects can be obtained . in this case , an amount of slope correction becomes a decreasing rate of the correction ramp wave . as described above , even with the circuit configuration different from that in the embodiment shown in fig1 , the same effects as those in the circuit configuration of fig1 of the present invention can be obtained . next , a description will be hereinbelow given with respect to a concrete circuit configuration of the slope correcting circuit . fig2 shows one example of a circuit for generating a correction ramp wave proportional to a change in reference voltage vref . in the figure , gate electrodes of transistors 153 and 154 constituting a mirror circuit are commonly connected to each other and also are operatively connected in parallel between a voltage source or the like and a ground electric potential . both a voltage from the reference voltage source 200 and a voltage developed across a resistor 151 are inputted to an operational amplifier 150 which in turn outputs a signal to a gate electrode of a transistor 152 . the transistor 154 and a capacitor 155 are operatively connected in series , and a correction ramp wave as a saw - tooth - wave is outputted through a node between the transistor 154 and the capacitor 155 . here , assuming that an output voltage of the reference voltage source 200 is vref , and a resistance value of the resistor 151 is r 151 , a current i 151 caused to flow through the resistor 151 is expressed as follows : if the p - channel enhancement type mos transistors 153 and 154 are equal in size for the sake of simplicity , then a current i 154 caused to flow through the p - channel enhancement type mos transistor 154 becomes equal to the current i 151 caused flow through the resistor 151 . since this current is caused to flow into the capacitor 155 , assuming that a capacitance value of the capacitor 155 is c 151 , an increasing rate mr of a terminal voltage vramp developed across opposite terminals of the capacitor 155 is expressed as follows : mr = i 154 / c 155 = v ref / r 151 / c 155 . ( expression 9 ) since both the resistance value r 151 of the resistor 151 and the capacitance value c 155 of the capacitor 155 are fixed values , expression 9 shows that the increasing rate mr of the terminal voltage vramp developed across the opposite terminals of the capacitor 155 is proportional to the reference voltage vref . in other words , if the terminal voltage vramp of the capacitor 155 is utilized for the correction ramp wave , then the correction ramp wave proportional to a change in reference voltage vref can be obtained . it should be noted that in any other circuit configuration as well , it is possible to obtain the same effects as those in the circuit configuration shown in fig2 . thus , the present invention does not refer only to the circuit configuration shown in fig2 . as set forth hereinabove , according to the present invention , in order to change the output voltage vout , the reference voltage vref is made variable , and at the same time , the increasing rate of the correction ramp wave as an amount of slope correction outputted from the slope correcting circuit is also made variable so as to be proportional thereto . consequently , it is possible to constitute the switching regulator in which even if the output voltage vout is changed , a suitable amount of slope correction is maintained . | 7 |
referring now to the drawings , fig1 shows the file format for the standard . zip file , in existence prior to the present invention . fig2 illustrates the preferred general record layout of a . zip file in accordance with the present invention . the newly modified . zip file format specification according to the present invention , as published by pkware , inc ., is described in a document entitled appnote . txt , which is attached hereto and incorporated herein by reference . the new version of the . zip file format provides an implementation of the use of strong encryption based on a key generated using a password . this implementation constitutes one example of a structure and layout of the records and fields suitable for processing secure . zip files as defined by the present invention . the complete description of the conventional or standard . zip file format will not be included here since this information is generally well known . only the portions pertaining to the new records and fields defined by the new format , capable of storing data using strong encryption , will be discussed in detail . the present invention extends the original . zip file format with the addition of new storage records to support the use of strong encryption methods including , as described above , both public / private key , or asymmetric , methods , and password - based , or symmetric , methods , and the capability to use a mixture of symmetric and asymmetric methods . an example of implementing a new strong encryption method is discussed below . this example identifies several new records and fields that must be defined within the . zip file format . a new general purpose bit flag having a hexadecimal value of 0x0040 to be set in both the local and central record headers when strongly encrypting a file . a new decryption header to be located immediately ahead of and adjacent to the compressed data stored for each file . a new extra field record definition with an id having a hexadecimal value of 0x0017 to be inserted into the central record header for each file . when using these new fields for strongly encrypting files , the following actions are indicated . 1 . if the general purpose bit flag value of 0x0040 is set to indicate strong encryption was applied to a file , the general purpose bit flag value of 0x0001 will also generally be set . 2 . files having a size of zero bytes ( an empty file ) should not generally be encrypted . as indicated , however , the file characteristics of the archived files may be encrypted , even if the file is of zero length and is not itself encrypted . 3 . the contents of the field labeled version needed to extract in both the local and central record headers should preferably be set to the decimal value of 50 or greater . if the aes encryption method is used , the contents of the field labeled version needed to extract in both the local and central record headers should preferably be set to the decimal value 51 or greater . 4 . data encryption should preferably be applied after a file is compressed , but encryption can be applied to a file if compression is not used . if compression is not applied to a file , it is considered to be stored in the . zip file . 5 . if encryption is applied using digital certificates , a list of intended recipients will be constructed . each entry in the recipient list identifies a person whose public key has been used in the encryption process for a file and who is allowed to decrypt the file contents using their private key . encryption algorithm id ( algid ) identifies which of several possible strong encryption algorithms was used for encrypting a file in the . zip file . the strong encryption algorithms that can be used include but are not limited to aes , 3des , 2des , des , rc2 and rc4 . the use of other unspecified strong algorithms for encryption is supported by the present invention . hash algorithm identifies which of several possible bash algorithms was used for the encryption process for a file in the . zip file . the algorithms that can be used include but are not limited to md5 , sha1 - sha512 . the use of other unspecified algorithms for hashing is supported by the present invention . name value description password_key 0x0001 password is used certificate_key 0x0002 recipient list is used combo_key 0x0003 either a password or a recipient list can be used to decrypt a file double_seed_key 0x0007 both password and recipient list are required to decrypt a file . erd is encrypted twice by 2 separate keys . double_data_key 0x000f both a password and a recipient list are required to decrypt a file . file data is encrypted twice using 2 separate keys . master_key_3des 0x4000 specifies 3des algorithm is used for msk size value ( bytes ) description recipient element size 2 combined size of hash of public key and simple key blob hash hash size hash of public key simple key blob variable simple key blob a simplified recipient list element is defined as a subset of a recipient list element and is stored to provide redundancy of the recipient list data for the purposes of data recovery . the following is a description of the most preferred encryption / decryption process for a single file using the storage format defined by this example . any programs , software or other processes available to suitably perform the encryption / decryption process may be used . 1 . validate public / private key 2 . calculate file digital signature and time - stamp 3 . compress or store uncompressed file data 4 . generate a file session key ( fsk ) ( see below ) 5 . calculate decryption information size 6 . adjust compressed size to accommodate decryption information and padding 7 . save decryption information to . zip file 8 . encrypt compressed or stored file data 9 . encrypt file characteristics 1 . decrypt file characteristics 2 . read decryption information from . zip file 3 . generate fsk ( see below ) 4 . verify decryption information ( see below ) 5 . if decryption information is valid , then decrypt compressed or stored file data 6 . decompress compressed data 7 . validate file time - stamp and digital signature 1 . if master_key — 3des is set , use 3des 3 - key as msk algorithm , otherwise use specified algorithm . 2 . if encrypting or decrypting with a password . 2 . 1 . 1 . prompt user for password 2 . 1 . 2 . calculate hash of the password 2 . 1 . 3 . pass calculated hash as argument into a cryptographic key derivation function or its equivalent . 3 . when encrypting using a public key ( s ). 3 . 1 . 1 . call a cryptographic key generation function or its equivalent to generate random key 4 . when decrypting using a private key ( s ). 4 . 1 . using recipient list information , locate private key , which corresponds to one of the public keys used to encrypt msk . 4 . 2 . decrypt msk . 1 . for algorithms that use both salt and iv , salt = iv 2 . iv can be completely random data and placed in front of decryption information 3 . otherwise iv = crc32 + 64 - bit file size 1 . determine salt and / or initialization vector size of the key for the encryption algorithm specified . usually salt is compliment to 128 bits , so for 40 - bit key salt size will be 11 bytes . initialization vector is usually used by block algorithms and its size corresponds to the block size . 2 . if salt size & gt ; 0 or initialization vector size is & gt ; 0 then set iv 1 to be used by the specified encryption algorithm . 1 when adjusting msk , if iv is smaller then required initialization vector ( or salt ) size it is complimented with 0 , if it is larger it is truncated . for all other operations tv is used as is without any modifications . 1 . fsk & lt ;- sha1 ( msk ( iv )). adjust msk with iv , and decrypt erd ( encrypted random data ). calculate hash of iv + random data . pass calculated hash as argument into a cryptographic key derivation function or its equivalent to obtain fsk . 1 . decryption information contains variable length password validation data ( pvd ). 2 . first password validation data size — 4 bytes are random data , and last 4 bytes are crc32 of that random data . this allows verification that the correct key is used and deters plain text attacks . the following modifications are used for encrypting and decrypting multiple files . 1 . generate msk 2 . for each file follow encryption steps . 1 . generate msk from the file decryption information 2 . for each file follow decryption steps 3 . if decryption information verification fails go to step 1 alternate storage formats can be defined for implementing the flexible security support within zip files . one such alternative is to use other fields , either existing or newly defined to denote that a strong encryption method was applied to a . zip archive . another alternative could be to use additional storage fields in addition to those defined in the above example , or to use the fields as defined , but ordered differently within each record . still other implementations may use fewer , or more , records or fields than are defined by the above example or the records and fields may be placed in other physical locations within the . zip file . alternate processing methods can also be defined for implementing the flexible security support within . zip files . one such alternative is to implement the encryption process for each file using another public / private key technology such as that defined by the openpgp message format as documented in rfc 2440 . another alternative could be to use a more direct form of encryption key generation where the file session key is directly used for encrypting each file . this method would not use the indirect form described in the above example where the file session key is derived from a master key . while the invention has been described with reference to preferred embodiments , it is to be understood that the invention is not intended to be limited to the specific embodiments set forth above . thus , it is recognized that those skilled in the art will appreciate that certain substitutions , alterations , modifications , and omissions may be made without departing from the spirit or intent of the invention . accordingly , the foregoing description is meant to be exemplary only , the invention is to be taken as including all reasonable equivalents to the subject matter of the invention , and should not limit the scope of the invention set forth in the following claims . | 6 |
in the following detailed description of exemplary embodiments of the invention , reference is made to the accompanying drawings that form a part hereof , and in which is shown by way of illustration specific exemplary embodiments in which the invention may be practiced . these embodiments are described in sufficient detail to enable those skilled in the art to practice the invention . other embodiments may be utilized , and logical , mechanical , and other changes may be made without departing from the spirit or scope of the present invention . the following detailed description is , therefore , not to be taken in a limiting sense , and the scope of the present invention is defined only by the appended claims . fig1 shows an elevation cross - section view of a folded coaxial radio frequency ( rf ) mirror 100 in cross - section with inner and outer coaxial pipes . an outer tube assembly 110 comprises an outer cylindrical tube 112 bounded by an inlet end 114 and an outlet end 116 to define a first cavity 118 that includes a forward section 120 filled with air . in exemplary embodiments , the forward section 120 extends 0 . 102 meter in length . a fore rod 122 extends along the forward section 120 . an inlet port 124 , with a coaxial input connector 126 ( such as series - n ), attaches upstream of the inlet end 114 . an inner tube assembly 130 includes an inner cylindrical tube 132 defined by an inlet end 134 and an open outlet boundary 136 to define a second cavity 138 that leads to an outlet section 140 filled with fluoropolymer foam . the outlet section 140 extends between the outlet boundary 136 and the outlet end 116 . in exemplary embodiments , the assembly 130 and the outlet section 140 respectively extend 0 . 07 meter and 0 . 01 meter in length . an electrically conductive pin 142 extends downstream from the inlet end 134 to an aft rod 144 that extends through the outlet end 116 to an outlet port 146 that attaches to an sma - type output connector 148 . in exemplary embodiments , the pin 142 extends 0 . 01 meter . an input signal 150 is received through the input connector 126 and into the first cavity 118 travelling along the interior walls of the outer cylindrical tube 112 in a downstream direction 151 . the signal travels along the annular concentric region between the inner wall of the outer cylindrical tube 112 and the outer wall of the inner cylindrical tube 132 . the signal reverses propagation direction 152 upon reaching the outlet boundary 136 and proceeds to travel in the upstream direction 153 along the inner wall of the inner cylindrical tube 132 . the signal reverses propagation direction 154 upon reaching the inlet end 134 and travels in the downstream direction 155 along the exterior of the aft rod 144 until exiting as an output signal 156 . the forward section 120 defines a first region for signal propagation filled with air . an outer annular envelope 160 defines a second region between the cylindrical tubes 112 and 132 , which is enveloped with fluoropolymer , such as polytetrafluoroethylene under tradename teflon ®, such as wrapping with tape of that material . a third region includes an inner annular envelope 162 that defines the second cavity 138 , minus the aft rod 144 contained in the inner cylindrical tube 132 . the second cavity 138 is filled with fluoropolymer foam . the aft section 140 , also filled with fluoropolymer foam , constitutes a terminal region before reaching signal exit . fig2 shows tabular lists 200 of dimensions and properties of the regions . the first tabular list 210 includes diameters ( i . e ., chord that passes through the tube longitudinal axis equivalent to twice the radius from that centerline ) in the three regions , the first pair of columns for the inner values , and the second pair of columns for the outer values . the regions of the mirror 100 in fig1 correspond to : ( 1 ) the forward section 120 that defines the first cavity 118 and includes the outer cylindrical tube 112 with inner diameter of 2 × r o1 and fore rod 122 with outer diameter of 2 × r i1 ; ( 2 ) the outer annular envelope 160 that includes the outer cylindrical tube 112 with inner diameter of 2 × r o2 ( identical to 2 × r o1 ) and inner cylindrical tube 132 with outer diameter of 2 × r i2 ; and ( 3 ) the inner annular envelope 162 that defines the second cavity 138 and includes inner cylindrical tube 132 with inner diameter of 2 × r o3 and aft rod 144 with outer diameter of 2 × r i3 . the second tabular list 220 in fig2 includes the permeability μ and the permittivity ∈ of the cavities of the three regions , with the filling materials identified alongside . the third tabular list 230 in fig2 includes the impedance z of each of the three regions . in the first tabular list 210 in fig2 listing inner and outer diameter boundaries of the three cavity regions , the first row ( for the forward section 120 or first region ) identifies the outer diameter of the fore rod 122 as 2 × r i1 = 0 . 00635 m , and the inner diameter of the outer cylindrical tube 112 as 2 × r o1 = 0 . 0340 m . the second row ( for the outer envelope 160 or second region ) identifies the outer diameter of the inner cylindrical tube 132 as 2 × r i2 = 0 . 0338 m , and the inner diameter of the outer cylindrical tube 112 as 2 × r o2 = 0 . 0340 m . the third row ( for the inner envelope 162 or third region within the cavity 138 ) identifies the outer diameter of the aft rod 144 as 2 × r i3 = 0 . 0036 m , and the inner diameter of the inner cylindrical tube 132 as 2 × r o3 = 0 . 03048 m . the diameters are denoted in the mirror 100 as double - radii . in the second tabular list 220 in fig2 , all regions have substantially similar relative values of magnetic permeability μ , proportional to the vacuum value of 4π × 10 − 7 n a − 2 . typical materials , ranging from copper and aluminum to water share approximately this unity value treated as μ 1 = μ 2 = μ 3 = 1 for the three regions . by contrast , comparative values of relative permittivity vary from aluminum at − 1300 to strontium titanate at + 310 , proportional to the vacuum value of 8 . 854 × 10 − 12 a 2 s 4 kg − 1 m − 3 . the relative permittivity for air in the first region is approximately unity as ∈ 1 = 1 , whereas ∈ 2 = 2 . 1 in the second region represents the corresponding relative permittivity value for teflon ®, and ∈ 3 = 1 . 65 in the third region provides an intermediate value of relative permittivity for a teflon foam mixture . in the third tabular list 230 , the first and third ( and terminal ) regions have an impedance of z o1 = z o3 = 100ω , and the second region has a lower impedance of z o2 = 0 . 244ω . fig3 presents a block diagram 300 of a narrow - band regenerative filter with a gain medium 310 flanked by an input mirror 320 and an output mirror 330 . the mirrors 320 , 330 are analogous to the coaxial mirror 100 that exhibits low losses . the medium 310 provides a limited gain of 3 db intended to compensate for attenuation losses while avoiding amplification that causes signal oscillation . the medium 310 extends a half - wavelength ( ½λ ) of the filtered signal . the oscillation behaves as an airy function , which represents the solution of y = ai ( x ) to the differential equation y ″− xy = 0 . the mirrors 320 , 330 reflect the signal passing through the medium 310 to enable detection of the weak return signal . fig4 shows an elevation cross - section view of a folded coaxial radio frequency ( rf ) mirror 400 in cross - section with inner and outer coaxial pipes as a secondary embodiment . a communication wire 410 extends coaxially through the inner tube assembly 130 and connects to the output connector 148 . a hollow tube 420 coaxially envelopes the wire 410 across most of its length from the outlet port 146 . the tube 420 opens adjacent and downstream of the inlet end 134 to produce a sixth region 430 filled with fluoropolymer foam through which the signal travels . a detail seventh region 440 provides a cross - section of the wire 410 and the tube 420 within the cavity 138 . fig5 shows tabular lists 500 of dimensions and properties of the first , second , third and sixth regions . the fourth tabular list 510 includes diameters ; the fifth tabular list 520 provides the dielectric constants μ and ∈, with the filling materials identified alongside ; the sixth tabular list 530 includes the impedances z . dimensions of the sixth region 430 are defined by the inner diameter 2 × r i4 of the hollow tube 420 ( as 0 . 0034 m ), and the material characteristics correspond to fluoropolymer foam . the hollow tube 420 has an outer diameter 2 × r i3 = 2 × r o4 ( as 0 . 0036 m ) corresponding to the third region 162 ( shown in fig1 ) with remaining dimensions corresponding to values from the first tabular list 210 . in particular , the fourth tabular list 510 in fig5 lists inner and outer diameter boundaries of four cavity regions , the first row ( for the forward section 120 or first region ) identifies the outer diameter of the fore rod 122 as 2 × r i1 = 0 . 00635 m , and the inner diameter of the outer cylindrical tube 112 as 2 × r o1 = 0 . 0340 m . the second row ( for the outer envelope 160 or second region in fig1 ) identifies the outer diameter of the inner cylindrical tube 132 as 2 × r i2 = 0 . 0338 m , and the inner diameter of the outer cylindrical tube 112 as 2 × r o2 = 0 . 0340 m . the third row ( for the inner envelope 162 in fig1 , or the third region within the cavity 138 ) identifies the outer diameter of the hollow tube 420 as 2 × r i3 = 0 . 0036 m , and the inner diameter of the inner cylindrical tube 132 as 2 × r o3 = 0 . 03048 m . the fourth row ( for the inner envelope 430 , or the sixth region within the cavity 138 ) identifies the inner diameter of the hollow tube 420 as 2 × r i4 = 0 . 0034 m , and the outer diameter of the hollow tube 420 as 2 × r o4 = 0 . 0036 m . values of permeability μ for the four regions listed in fig5 all correspond approximately to unity , μ 1 = μ 2 = μ 3 = μ 4 = 1 respectively for air , teflon and teflon foam mixture . values of permittivity ∈ for these regions include ∈ 1 = 1 for air in the first section 120 , ∈ 2 = 2 . 1 for teflon in the outer envelope 160 , and ∈ 3 =∈ 4 = 1 . 65 for the teflon foam mixture in the inner envelopes 162 and 430 . values for impedance for these corresponding regions include z o1 = z o3 = z o4 = 100ω , and z o2 = 0 . 244ω . fig6 and 7 show respective cross - section views of detail regions 170 ( fig6 ) and 440 ( fig7 ). as shown in fig6 , the first such view 600 illustrates an external cylindrical periphery 610 and an internal cylindrical periphery 620 of the outer tube 112 , an outer periphery 630 and inner periphery 640 of the inner tube 132 . the internal and outer peripheries 620 and 630 can be coated with an electrically conductive layer and correspond to the respective diameters 2 × r o2 and 2 × r i2 from column 210 whose dimensions define an outer annular conduit of the outer annular envelope 160 . the outer periphery 630 also defines the outer boundary of an inner annular region within the cavity 138 . the outer envelope 160 and the cavity 138 are correspondingly filled with teflon and mixed teflon foam that have respective impedance values of 0 . 244ω and 100ω reported in column 230 . as shown in fig7 , the second such view 700 illustrates an outer surface 710 of the wire 410 , an inner surface 720 and an outer surface 730 of the hollow tube 420 . the surfaces 710 and 720 define an inner boundary of the cavity 138 . the surface 730 defines the inner annular region of the envelope 430 whose radial boundaries extend to diameter 2 × r i4 from column 510 . these surfaces 710 , 720 and 730 can be coated with an electrically conductive layer . the cavity 138 ( extending radially from diameter 2 × r i3 to 2 × r o3 ) and the envelope 430 within the hollow tube 420 are filled with teflon foam as identified in column 520 and impedances from column 530 . the folded coaxial rf mirror 100 is to be used in a field deployable rf fabry - perot interferometer used in a rf brillouin scattering radar . the mirror 100 reduces the overall size and increases the ruggedness of a more conventional rf mirror . conventionally , a coaxial rf mirror may be constructed from co - linear concatenated sections of coaxial transmission line alternating between sections with high and low characteristic impedance . because each section of the mirror is quarter - wavelength ( ¼λ ) long at the center frequency of the mirror &# 39 ; s operation , the conventional co - linear mirror can be quite lengthy at low frequencies . for a mirror made from rigid materials , the need for a dielectric bragg - mirror to have a high q - resonation necessitates the construction of the mirror from a metal , such as copper , having very high conductivity . however , copper is a relatively soft metal and prone to bending or crushing , as well as being a difficult material to machine . conceivably , a coaxial . rf mirror could also be constructed from flexible cable , but such a mirror would have degraded performance . this is because the performance of this mirror although improves as the impedance contrast increases , it can be difficult to obtain a great deal of contrast between the characteristic impedances utilizing commercially available coaxial cable . multiple coaxial cables , such as assemblies 110 and 130 , are nested within each other to achieve the requisite alternating high and low characteristic impedances . the radii are varied and dielectrics can be carefully selected to achieve the desired characteristic impedance in each section . the mirror 100 demonstrates an exemplary embodiment with three folded sections . however , the design can be easily extendable to an arbitrary number of folded sections . the input side has a section of 50ω transmission line of arbitrary length terminated with a general radio type 874 ( gr874 ) input connector 126 ( or type - n ) and the output side has a section of 50ω semi - rigid coax of arbitrary length terminated with an sma output connector 148 . in the cross - section diagram of mirror 100 and the first table 210 , the notations r i1 , r i2 , r i3 signify the radii of the inner conductor ( being outer peripheries of the respective fore rod 122 , inner tube 132 and the aft rod 144 ), and r o1 , r o2 , r o3 the radii of the outer conductor of the respective first , second and third sections of coaxial transmission line ( being inner surfaces of the outer tube in the first and second sections and the inner surface of the inner tube ). in the cross - section diagram of mirror 400 and the third table 510 , the notations r i4 and r o4 (= r i3 ) respectively signify the inner and outer radii of the hollow tube 420 . this structure for the mirror 100 is thus physically shorter than the conventional design due to the nesting of the coaxial transmission lines . the mirror 100 can be constructed of silver or gold - plated brass to maintain the high q and improve the ruggedness of the structure . the layers 610 , 620 , 630 , 640 , 710 , 720 and 730 can be selectively coated with such electrically conductive metals . interferometer tests have been conducted with three - and - one - half - wavelength ( 3½λ ) quarter - wave tube of copper with slugs to provide a mirror antenna for ultra - high - frequency ( uhf ) waves . the phenomenon absorption and release of energy by photons from electron shells via acoustic travel has been demonstrated in the past . this can also be accomplished with radio waves , but with greater power levels because signal resolution from scatter cross - section diminishes as the fourth power of frequency , as ψ 4 , or of the wavelength inverse , as λ − 4 . electromagnetic signals are typically employ much shorter wavelengths than acoustic signals . while certain features of the embodiments of the invention have been illustrated as described herein , many modifications , substitutions , changes and equivalents will now occur to those skilled in the art . it is , therefore , to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the embodiments . | 7 |
in accordance with fig2 to 5 , a pumping device 1 according to the invention has a drive device 2 for the driving of a feed element 3 , for example of an impeller 4 ( cf . fig5 ) of the pumping device 1 . in order to enable as fine a controlling or respectively regulating of the pumping device 1 as possible with regard to its conveying capacity , a hydrostatic coupling 5 , in particular a gerotor coupling 5 ′ ( cf . also fig1 ) is provided , by means of which a torque transmission between the drive device 2 and the feed element 3 is able to be influenced . the pumping device 1 can be configured here for example as an oil pump ( cf . fig3 and 4 ) or as a water pump ( cf . fig5 ) or else as a fuel pump . in the gerotor coupling 5 according to the invention , a suction side 6 and a pressure side 7 are connected with one another by way of a coupling - fluid - carrying channel 8 , wherein a valve device 9 is arranged in the coupling - fluid - carrying channel 8 . if one observes the valve device 9 more closely , it can be seen that the latter has an adjustable piston 10 , which according to position controls a through - flow through the valve device 9 and therefore a torque transmission of the coupling 5 , 5 ′. also , a setting device 12 is provided for adjusting the piston 10 of the valve device 9 , which can be configured in particular as a wax expansion element , a hydraulic setting device , a pneumatic setting device , for example as an under box . the setting device 12 is operatively connected here with the piston 10 . a spring 11 is also provided , by means of which the piston 10 is prestressed into a position closing the valve device 9 , wherein with closed valve device 9 , during an operation of the pumping device 1 a build - up of pressure takes place in the coupling 5 , 5 ′, whereby a full torque transmission can be ensured from the drive device 2 to the feed element 3 . this is of great advantage in particular in a pumping device 1 configured as a coolant pump , because hereby an overheating for example of an internal combustion engine can be prevented . if one observes the gerotor coupling 5 ′ of fig1 more closely , it can be seen that it is able to be flowed through in both directions , i . e . both forwards and backwards , just as an associated valve device 9 which is to be adapted , so that generally the entire pumping device 1 can be operated both in a forwards operation and also in a backwards operation . according to fig1 the gerotor coupling 5 ′ has a drive shaft 13 , connected with the drive device 2 which is not shown , which drive shaft in this case brings about a torque transmission to an outer ring 14 . furthermore , an inner ring 15 is provided , which has at least one tooth less than the outer ring 14 and together with the outer ring 14 encloses a displacement volume 16 . here , either the inner ring 15 or the outer ring 14 can be mounted eccentrically . the inner ring 15 is connected by way of a torque - proof connection , for example a form - fitting or force - fitting connection , with the feed element 3 , for example by way of a shaft 17 . as can be further seen from fig1 , the inner ring 15 is mounted eccentrically to the outer ring 14 . generally , of course , the inner ring 15 can also be connected in a torque - proof manner with the drive device 2 , wherein then the outer ring 14 is connected in a torque - proof manner with the feed element 3 . observing fig2 , the coupling 5 , 5 ′ can be seen in a possible embodiment , wherein the reference numbers are largely taken over from fig1 . in order to obtain as full a torque transmission as possible with a closed valve device 9 , a gap seal 18 is provided , by means of which an undesired bypass flow and hence a loss of pressure in the displacement volume 16 can be prevented . at the same time , a sliding bearing 20 to a housing 19 takes place in this region . observing fig3 and 4 , the gerotor coupling 3 according to the invention can be seen in a pumping device 1 configured as an oil pump , wherein in particular in fig4 the sliding bearing 20 is again readily visible . in fig5 a pumping device 1 , configured as a water pump , is illustrated , with a feed element 3 configured as an impeller , with a seal 21 , which seals the water pump with respect to the coupling 5 , 5 ′, and with a housing 19 , into which the coupling 5 , 5 ′ is integrated . the coupling 5 , 5 ′ has again here an inner ring 15 , an outer ring 14 and a bearing 22 for bearing the drive shaft 13 . a cover plate 23 is additionally provided . the pumping device 1 can be controlled particularly exactly and in a problem - free manner with the coupling 5 , 5 ′ according to the invention . the principle which has been explained can also be transferred in an analogous manner to an internal gear pump , an external gear pump , a vane - type pump and a pendulum slide cell pump ( psc ). | 5 |
the term , &# 34 ; halogen &# 34 ; as used throughout this application , includes all four halogens , i . e ., bromine , chlorine , fluorine and iodine . as used throughout this application , the term &# 34 ; lower alkyl &# 34 ; comprehends both straight and branched chain saturated hydrocarbon groups containing from 1 to 6 carbon atoms , such as methyl , ethyl , propyl , isopropyl , etc . the term &# 34 ; lower alkoxy &# 34 ; comprehends lower alkoxy groups containing from 1 to 6 carbon atoms such as methoxy , propoxy , ethoxy , etc . the term &# 34 ; aryl &# 34 ;, as used throughout the application , includes mono - nuclear aryl groups such as phenyl which can be unsubstituted or substituted in 1 or more positions with a hydroxy , methylenedioxy , halogen , nitro , lower alkyl or a lower alkoxy substitutent , and polynuclear aryl groups such as naphthyl , anthryl , phenanthryl , azulyl , etc . which may be substituted with 1 or more of the aforementioned groups . the term &# 34 ; aryloxy carbonyl &# 34 ; comprehends aryloxy - carbonyl groups wherein the aryl moiety is defined as above . the preferred aryloxy carbonyl group is phenoxy - carbonyl . the term &# 34 ; aralkyloxy carbonyl &# 34 ; comprehends aralkoxy - carbonyl groups wherein aryl is defined as above and the alkyl is lower alkyl . the preferred aralkoxy - carbonyl group is benzyloxycarbonyl . the term &# 34 ; alkoxycarbonyl &# 34 ; as utilized herein includes lower alkoxycarbonyl groups wherein lower alkoxy is defined as above . among the preferred lower alkoxycarbonyl groups are included methoxycarbonyl , ethoxycarbonyl and isopropoxycarbonyl . the term &# 34 ; lower alkylcarbonyl &# 34 ; as defined herein includes the lower alkylcarbonyl groups wherein lower alkyl is defined as above . among the preferred lower alkylcarbonyl groups are included methylcarbonyl and ethylcarbonyl . the terms &# 34 ; oxo &# 34 ; and &# 34 ; thio &# 34 ; define oxygen and sulphur with two bonds (-- o -- and -- s --). the aryloxymethylene group as used herein incudes aryloxymethylene groups wherein aryl is defined as above . among the preferred aryloxymethylene groups is included phenyloxymethylene . the term &# 34 ; aralkoxymethylene &# 34 ; as used herein includes arloweralkyloxymethylene wherein aryl and lower alkyl are defined as above . the preferred aralkyloxymethylene in accordance with this invention is benzyloxymethylene . the term &# 34 ; alkoxymethylene &# 34 ; includes lower alkoxymethylene groups wherein lower alkyl is defined as above . among the preferred lower alkoxymethylene groups are included methoxymethylene , ethoxymethylene or isopropoxymethylene . the carbamyl group can be mono - substituted or disubstituted by lower alkyl . among the preferred lower alkyl - substituted carbamyl groups which can be utilized in accordance with this invention are included methylcarbamyl , n , n - dimethylcarbamyl , ethylcarbamyl , n , n - diethylcarbamyl and isopropylcarbamyl . the compounds of formula i are useful in the control of pests such as tineola biselliella ( clothes moth ), ephestia kuhniella ( meal moth ), dysdercus cingulatus ( cotton bug ) blatella germanica ( cockroach ). in contrast to most of the known pest - control agents which kill , disable or repell the pests by acting as contact poisons and feed poisons , the compounds of formula i above prevent maturation and proliferation of these pests by interferring with their hormonal system . in insects , for example , the formation into the imago , the laying of viable eggs and the development of laid normal eggs is disturbed . furthermore , the sequence of generations is interrupted and the insects are indirectly killed . the compounds of formula i above are practically non - toxic to vertebrates . the toxicity of these compounds is greater than 1000 mg / kg body weight . moreover , these compounds are readily degraded and the risk of accumulation is therefore excluded . therefore , these compounds can be used without fear of danger in the control of pests in animals , plants , foods and textiles . generally , in controlling invertebrate animals , the compounds of formula i above thereof are applied to the material to be protected , e . g ., foodstuffs , feeds , textiles , plants in concentrations of from about 10 - 3 to 10 - 8 gm / cm 2 of the material to be protected . generally , it is preferred to utilize the compounds of formula i above in a composition with a suitable inert carrier . any conventional inert carrier can be utilized . the compound of formula i can , for example , be used in the form of emulsions , suspensions , dusting agents , solutions or aerosols . in special cases , the materials to be protected ( e . g ., foodstuffs , seeds , textiles and the like ) can also be directly impregnated with the appropriate compound or with a solution thereof . moreover , the compounds can also be used in a form which only releases them by the action of external influences ( e . g ., contact with moisture ) or in the animal body itself . the compound of formula i above can be used as solutions suitable for spraying on the material to be protected which can be prepared by dissolving or dispersing these compounds in a solvent such as mineral oil fractions ; cold tar oils ; oils of vegetable or animal origins ; hydrocarbons such as naphthalenes ; ketones such as methyl ethyl ketone ; or chlorinated hydrocarbons such as tetrachloroethylene , tetrachlorobenzene , and the like . the compounds of formula i above can also be prepared in forms suitable for dilution with water to form aqueous liquids such as , for example , emulsion concentrates , pastes or powders . the compounds of formula i above can be combined with solid carriers for making dusting or strewing powders as , for example , talc , kaolin , bentonite , calcium carbonate , calcium phosphate , etc . the compositions containing the compound of formula i above can contain , if desired , emulsifiers , dispersing agents , wetting agents , or other active substances such as fungicides , bacteriacides , nematocides , fertilizers and the like . these materials which are to be protected act as bait for the insect . in this manner , the insect , by contacting the material impregnated with the compound of formula i above , also contacts the compound of formula i above . it will be appreciated from the foregoing that the invention also includes within its scope an agent useful for the control of pests which contains as an essential active ingredient or essential active ingredients one or more of the phenyl derivatives of formula i in association with a compatible carrier material . in addition , the invention includes within its scope a method of rendering a locus subject to or subjected to attack by pests immune to or free from such attack , said method comprising applying to said locus an agent as hereinbefore defined or one or more of the phenyl derivatives of formula i . among the phenyl derivatives which are included within formula i are the following : a . derivatives of the general formula : ## str5 ## wherein r 1 , r 3 , r 4 , r 6 , a , b , x , w , y and z are as above ; and the dotted bonds can be hydrogenated , b . derivatives of the general formula : ## str6 ## wherein r 1 , r 3 , r 4 , r 6 , a , b , k , l , x , w , y and z are as above ; and the dotted bonds can be hydrogenated , c . derivatives of the general formula : ## str7 ## wherein r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , a , b , d , e , x , w , y and z are as above ; and the dotted bonds can be hydrogenated , d . derivatives of the general formula : ## str8 ## wherein r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , a , b , d , e , k , l , x , w , y and z are as above and the dotted bonds can be hydrogenated . with regard to formulae i , iv , v , vi , and vii , the preferred derivatives are those in which w signifies hydrogen , y has the significance given earlier and z signifies hydrogen , halogen , lower alkyl , formyl , lower alkoxymethylene , phenyloxymethylene , benzyloxymethylene or carbamyl ( which may be lower alkyl - susbtituted ) or y and z when present on adjacent carbon atoms together signify an ethylenedioxy , propylenedioxy , vinylenedioxy or 1 , 3 - butadien - 1 , 4 - ylene group . also preferred among the compounds of formula i , iv , v , vi , and vii are those compounds where the dotted lines are not hydrogenated . especially preferred classes of phenyl derivatives of the formula iv are compounds having the formula : ## str9 ## wherein a 1 is hydrogen or chlorine and b 1 is hydrogen or a 1 and b 1 taken together form a carbon to carbon bond or an oxygen bridge . especially preferred among the compounds of formula v are those compounds having the formulae : ## str10 ## wherein a 2 and b 2 taken together form a carbon to carbon bond or an oxygen bridge ; ## str11 ## wherein a 3 , b 3 , k 1 and l are hydrogen ; or a 3 and b 3 taken together form a carbon to carbon bond or oxygen bridge ; and k 1 and l taken together form a carbon to carbon bond ; ## str12 ## wherein a 3 , b 3 , k 1 and l are as above ; ## str13 ## wherein a 3 , b 3 , k 1 and l are as above ; ## str14 ## wherein a 2 and b 2 are as above ; ## str15 ## wherein a 2 and b 2 are as above ; and the corresponding sulphinyl derivatives , ## str16 ## wherein a 2 and b 2 are as above ; and the corresponding sulphinyl derivatives ; and compounds of the formula ## str17 ## wherein r 1 , r 3 , r 4 , r 6 , a and b are as described above . especially preferred among the compounds of formula v above is the compound having the formula : ## str18 ## especially preferred among the compounds of formula vii above are the compounds having the formula : ## str19 ## wherein a 3 , b 3 , d 1 , e , k 1 and l are hydrogen ; or a 3 and b 3 taken together are a carbon to carbon bond or an oxygen bridge ; and d 1 taken together with e , and k 1 taken together with l form a carbon to carbon bond , examples of some of the preferred phenyl derivatives of formula i are the following : the halide starting materials of formula ii can be subdivided into four classes as follows : a . halides of the general formula : ## str21 ## wherein r 1 , r 3 , r 4 , r 6 , a &# 39 ;, b &# 39 ; and hal are as above ; b . halides of the general formula : ## str22 ## wherein r 1 , r 3 , r 4 , r 6 , a &# 39 ;, b &# 39 ;, k &# 39 ;, l and hal are as above ; c . halides of the general formula : ## str23 ## wherein r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , a &# 39 ;, b &# 39 ;, d &# 39 ;, and e are as above ; and hal is a halogen ; d . halides of the general formula : ## str24 ## wherein r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , a &# 39 ;, b &# 39 ;, d &# 39 ;, e , k &# 39 ;, l and hal are as above . in accordance with a preferred embodiment of this invention , a halide of formula ii - a , ii - b , ii - c or ii - d is reacted with a compound of formula iii in which w signifies hydrogen , y has the significance given earlier and z &# 39 ; signifies hydrogen , halogen , lower alkyl , formyl , lower alkoxycarbonyl , phenyloxycarbonyl , benzyloxycarbonyl , lower alkoxymethylene , phenyloxymethylene , benzyloxymethylene or carbamyl ( which may be lower alkyl - substituted ) or y and z &# 39 ; when present on adjacent carbon atoms taken together form an ethylenedioxy , propylenedioxy , vinylenedioxy or 1 , 3 - butadien - 1 , 4 - ylene group . e . reacting a halide of the general formula : ## str25 ## wherein hal is as above ; and the dotted bond can be hydrogenated , with an alkali metal salt of p - hydroxybenzaldehyde and , if desired hydrogenating , epoxidizing or hydrochlorinating the product obtained ; f . reacting a halide of the general formula : ## str26 ## wherein hal is as above ; with an alkali metal salt of benzyl alcohol and , if desired , the product obtained is epoxidized at the terminal unsaturation ; g . reacting a halide of the general formula : ## str27 ## wherein hal is as above ; and the dotted bonds can be hydrogenated ; with an alkali metal salt of 6 - hydroxymethyl - 1 , 4 - benzodioxan and , if desired , subjecting the product obtained to hydrogenation or epoxidation at the terminal unsaturation ; h . reacting a halide of general formula v - bi hereinbefore with an alkali metal salt of - hydroxybenzaldehyde and , if desired , subjecting the product obtained to hydrogenation or epoxidation at the terminal unsaturation ; i . reacting a halide of the general formula : ## str28 ## wherein hal is as above ; and the dotted bonds can be hydrogenated ; with an alkali metal salt of p - hydroxybenzaldehyde and , if desired , subjecting the product obtained to hydrogenation or epoxidation at the terminal unsaturation ; j . reacting a halide of formula v - ai above , with an alkali metal salt of thiophenol and , if desired , submitting the product obtained to oxidation or epoxidation at the terminal unsaturation ; k . reacting a halide of formula v - ai hereinbefore with an alkali metal salt of thio - p - cresol and , if desired , submitting the product obtained to oxidation and / or epoxidation at the terminal unsaturation ; l . reacting a halide of formula v - ai hereinbefore with an alkali metal salt of thio - o - cresol and , if desired , submitting the product obtained to oxidation and / or epoxidation at the terminal unsaturation ; m . reacting a halide of the general formula : ## str29 ## wherein hal is as above ; with an alkali metal salt of p - hydroxybenzaldehyde ; n . reacting a halide of the general formula : ## str30 ## wherein hal is as above ; and the dotted bonds can be hydrogenated ; with an alkali metal salt of p - hydroxybenzaldehyde and , if desired , subjecting the product obtained to hydrogenation or epoxidation at the terminal unsaturation ; and o . reacting a halide of the general formula : ## str31 ## wherein hal is as above ; with an alkali metal salt of thiophenol and , if desired , subjecting the product obtained to oxidation and / or epoxidation at the terminal unsaturation . the halide starting materials of formula ii and the starting materials of formula iii are known substances and they can be reacted with each other to produce a compound of the formula i above in accordance with methods known per se . for example , a halide of formula ii preferably a chloride or bromide , is expediently dissolved in an inert organic solvent and the solution allowed to act on a compound of formula iii ( formed in statu nascendi ). the compound of formula iii ( an alkali metal salt ) can advantageously be formed by reacting the corresponding phenol , alcohol , thiophenol or thioalcohol with an alkali metal hydride alkali metal alcoholate or alkali metal hydroxide , preferably sodium hydride , a sodium alcoholate or sodium hydroxide in a known manner . the salt formation and the reaction of the salt with the halide are expediently carried out in the presence of a suitable inert organic solvent . when sodium hydride is used , suitable solvents are , for example , dioxan , tetrahydrofuran , dimethylformamide or diethyl ether , when sodium methylate is used a suitable solvent is for example , methanol or when sodium hydroxide is used suitable solvents are for example , methanol , ethanol or acetone . the reaction of the halide with a phenol , alcohol , thiophenol or thioalcohol can also be carried out in the presence of a carbonate , preferably potassium carbonate . the reaction of a halide of formula ii with a compound of formula iii is expediently carried out at a temperature between 0 ° c . and the boiling temperature of the reaction mixture , advantageously in the presence of hexamethyl phosphoric acid triamide . the reaction mixture can be worked up in a conventional manner . for example , it can be poured onto ice and extracted with diethyl ether , the ether extract washed with water , dried and evaporated . the resulting derivative of formula i can be purified by adsorption ; for example , on kieselgel or aluminum oxide . when z , in the compound of formula i above is formyl , this compound can be oxidized to the corresponding acid or reduced to the corresponding alcohol in a known manner . the oxidation of the formyl group can advantageously be carried out at room temperature with the aid of silver oxide formed in an aqueous medium from silver nitrate and sodium hydroxide . after the oxidation , the aqueous solution is extracted with diethyl ether and the ether extract is discarded . by acidification of the aqueous phase , the sodium salt present therein is converted into the free acid which can be extracted ( e . g ., with diethyl ether or methylene chloride ) and isolated from the extract in a conventional manner . the acid obtained in this manner can be converted into an amide ( which may be lower alkyl - substituted ) by conventional amidation reactions . the reduction of the formyl groups can advantageously be carried out with the aid of a metal hydride or alkyl metal hydride in an inert organic solvent . mixed metal hydrides such as , for example , sodium borohydride or lithium aluminum hydride and , especially alkylated metal hydrides such as , for example , the dialkyl aluminium hydrides , particularly diisobutyl aluminum hydride or bis -[ methoxyethyleneoxy ]- sodium - aluminum hydride , are the preferred metal hydrides . suitable solvents are , inter alia , alkanols ( especially methanol ) when sodium borohydride is used , diethyl ether , tetrahydrofuran or dioxan when lithium aluminum hydride is used and diethyl ether , hexane , benzene or toluene when diisobutyl aluminum hydride is used . the reduction is expediently carried out at a temperature between - 20 ° c . and + 50 ° c . when z , in the compound of formula i above is an acid group , the acid can be converted into an acid chloride by conventional means such as by treatment with thionyl chloride , preferably in the presence of pyridine . the acid halide can be transformed into an ester by reaction with an alkanol or into an acid amide by reaction with ammonia or a monosubstituted amine or a disubstituted amine utilizing conventional procedures well known in the art . when z , in the compound of formula i above is a hydroxy methylene group , this group can be etherified by conventional procedures such as by reaction with an alkyl halide ( e . g ., with ethyl iodide ) in the presence of a base , preferably in the presence of sodium hydride , in a solvent such as dioxan , tetrahydrofuran , 1 , 2 - dimethoxyethane , dimethylformamide or also in the presence of an alkali metal alcoholate in an alkanol at a temperature of from 0 ° c . to room temperature . when z &# 39 ; in a compound of formula iii is a lower alkoxycarbonyl , aryloxycarbonyl , or aralkoxycarbonyl , the ester obtained is converted into an amide ( which may be lower alkyl substituted ). this conversion can be carried out , for example , by treating the ester with an appropriate dialkylaminelithium compound . the dialkylaminelithium needed for this treatment can expediently be prepared by dissolving a dialkylamine ( e . g ., diethylamine ) in diethyl ether and mixing the resulting solution in the cold ( preferably at - 10 ° c to - 20 ° c ) with a solution of butyl - lithium in hexane or tetrahydrofuran and subsequently allowing the mixture to react . the diethylamine - lithium obtained is advantageously reacted with the ester at room temperature . if desired , the derivatives of formula i in which a and b taken together , d and e taken together and k and l taken together form a carbon to carbon bond can be hydrogenated , oxidized , halogenated , epoxidized , episulfidized , hydrohalogenated , or hydroxyhalogenated in accordance with methods known per se . in addition , derivatives of formula i in which z signifies formyl can be oxidized or reduced , if desired , in accordance with methods known per se . the hydrogenation of unsaturated derivatives of formula i can be carried out at normal or elevated pressure with catalytically activated hydrogen , expediently at a temperature between room temperature and the boiling temperature of the solvent used . suitable catalysts are , for example , raney - nickel or , especially , noble metals such as , for example , palladium or platinum . suitable solvents include ethyl acetate , alkanols such as methanol and ethanol and glacial acetic acid . if the hydrogenation is carried out in ethyl acetate or in an alkanol ( e . g ., methanol ) under the conditions described hereinabove , the side chain is almost exclusively saturated . if , on the other hand , the hydrogenation is carried out in the presence of glacial acetic acid , not only the side chain but also the phenyl ring is saturated . the corresponding cyclohexyl derivatives are thus obtained and they can be separated by distillation from cleavage products of the hydrogen atom which may also be formed . it should be noted that only sulphur free - compounds can advantegeously be subjected to this type of hydrogenation . thioethers obtained can be oxidized to the corresponding sulfinyl or sulfonyl derivatives by oxidation . particularly suitable oxidizing agents are organic peracids , preferably m - chloroperbenzoic acid . the oxidation is advantageously carried out in an inert organic solvent , especially in methylene chloride at a temperature between 0 ° c . and room temperature . if 1 mole of peracid is used for each mole of thioether , the corresponding sulfinyl derivative is obtained . if 2 moles of peracid are used for each mole of thioether , the corresponding sulfonyl derivative is obtained . the epoxidation of derivatives of formula i can expediently be carried out by dissolving the derivative concerned in an inert solvent ( especially in a halogenated hydrocarbon such as methylene chloride or chloroform ) and treating the solution obtained with an organic peracid ( e . g ., with perbenzoic acid , m - chloroperbenzoic acid or perphthalic acid ) at a temperature between 0 ° c . and room temperature . alternatively , the derivative concerned can be suspended in water and treated with an appropriate amount of an inert solvent ( e . g ., with dioxan , tetrahydrofuran or 1 , 2 - dimethoxyethane ) such that a homogenous concentrated solution is obtained . n - bromosuccinimide is then introduced portionwise into this solution at a temperature between 0 ° c . and room temperature . the resulting bromohydrin can be smoothly converted into the desired epoxide by the action of alkali , especially by the action of sodium methylate in methanol . the introduction of a sulfur bridge into derivatives of formula i can be effected in various ways . if , for example , thiourea is allowed to act on a halohydrin ( preferably on the bromohydrin ) of a derivative of formula i there is firstly formed an isothiouronium salt . this salt is also formed when thiourea is allowed to act on an epoxide of formula i , a temperature of from 0 ° to 30 ° c . in the presence of a mineral acid . the isothiouronium salts obtained can be readily converted into the desired epithio derivatives of formula i by treatment with a base . the hydrohalogenation of a derivative of formula i is expediently carried out by dissolving the derivative concerned in an inert organic solvent ( e . g ., an ether , especially ethyl ether , or an alkanol , especially methanol or ethanol ), saturating the solution obtained with a hydrogen halide either at a low temperature ( e . g ., a temperature between - 20 ° c . and - 25 ° c .) or at a temperature between 0 ° c . and room temperature and working up the reaction solution in a conventional manner ; for example , by carefully evaporating the solution under reduced pressure , dissolving the concentrate in diethyl ether , deacidifying , drying and evaporating the extract . if the hydrohalogenation is carried out within the aforementioned low temperature range , the derivative used is almost exclusively monohydrohalogenated at the terminal unsaturation . on the other hand , if the hydrohalogenation is carried out at temperatures around and above 0 ° c . the elements of hydrogen halide are added to all double bonds present . derivatives having an allylic ether group are less suitable for the hydrohalogenation described hereinbefore , since the ether is , in part , cleaved under the hydrohalogenation conditions specified earlier . as described hereinbefore in the case of the epoxidation , the hydroxyhalogenation of a derivative of formula i can be carried out by treating the derivative concerned with an n - halosuccinimide ( especially with n - bromosuccinimide ) and isolating the halohydrin formed . the halogenation of a terminal double bond in the compound of formula i can be carried out by conventional halogenation procedures . in accordance with a preferred embodiment of this invention , the compound of formula i is dissolved in a lower aliphatic carboxylic acid ( preferably glacial acetic acid ) or in a chlorinated lower hydrocarbon ( preferably carbon tetrachloride ) and then treated with a solution of the appropriate halogen in the same solvent . the resulting mixture can be allowed to stand in the presence of an alkali acetate ( especially sodium acetate ) at a temperature between about 0 ° c . and 60 ° c ., advantageously at room temperature . the mixture can be worked up by conventional procedures . for example , the mixture can be diluted with water , extracted with diethyl ether , the ether extract washed with water and sodium bicarbonate solution , dried and evaporated . the derivative which remains behind can be purified by crystallization or by chromatography on kieselgel ( silica gel ). insofar as the side chain is unsaturated , the derivatives of formula i are obtained according to the process as a cis / trans isomer mixture . the mixture can , for example , be separated into the individual isomeric forms by adsorption on a material having selective activity . for example , the isomer mixture can be dissolved in an inert organic solvent ( e . g ., in hexane , ether or acetic acid ethyl ether ) and adsorbed on kieselgel . the isomers adsorbed in different zones can be eluted with one of the solvents named hereinbefore or a mixture thereof and isolated . in individual cases , the isomer mixture can also be separated by fractional distillation or by fractional crystallization . the following examples are illustrative but not limitative of this invention . in the examples , the suspension of the hydride mineral oil is percent by weight . the ether utilized in these exampls was diethyl ether . the petroleum ether utilized in these examples has a boiling point of from 40 ° c . to 45 ° c . in an inert gas atmosphere , 15 . 8 g of a 50 % suspension of sodium hydride in mineral oil are washed with two 50ml portions of tetrahydro - furan , then introduced into 100 ml of tetrahydro - furan and treated dropwise with a solution of 40 g of p - hydroxy - benzaldehyde in 150 ml of tetrahydro - furan . 78 . 0 g of 2 - bromo - 6 - methyl - heptane in 150 ml of hexamethylphosphoric triamide are subsequently added dropwise , then the resulting mixture is heated under reflux conditions for 2 hours , cooled , poured onto ice and exhaustively extracted with diethyl ether . the ether extract is washed with water , dried over sodium sulphate and evaporated under reduced pressure . the residual oily p -[( 1 , 5 - dimethyl - hexyl )- oxy ]- benzaldehyde is purified by adsorption on kieselgel ; boiling point = 155 °- 158 ° c / 0 . 1 mmhg . 2 - bromo - 6 - methyl - heptane was reacted with o - bromo - phenol to obtain o - bromo - phenyl 1 , 5 - dimethyl - hexyl ether ( boiling point = 190 °- 193 ° c / 17 mmhg ); 2 - bromo - 6 - methyl - heptane was reacted with 3 , 5 - dimethoxy - phenol to obtain 1 -[( 1 , 5 - dimethyl - hexyl )- oxy ]- 3 , 5 - dimethoxy - benzene ( boiling point = 135 ° c / 0 . 4 mmhg ); 2 - bromo - 6 - methyl - heptane was reacted with 3 - methoxy - 4 - hydroxy - 5 - bromo - benzaldehyde to obtain 5 - bromo - 4 -[( 1 , 5 - dimethyl - hexyl )- oxy ]- m - anisaldehyde ( boiling point = 190 °- 193 ° c / 0 . 1 mmhg ); 2 - bromo - 6 - methyl - heptane was reacted with p - hydroxy - benzonitrile to obtain p -[( 1 , 5 - dimethyl - hexyl )- oxy ]- benzonitrile ( boiling point = 165 °- 168 ° c / 1 . 0 mmhg ); 2 - bromo - 6 - methyl - heptane was reacted with m - methoxy - phenol to obtain m -[( 1 , 5 - dimethyl - hexyl )- oxy ]- anisole ( boiling point = 210 °- 212 ° c / 12 mmhg ); 2 - bromo - 6 - methyl - heptane was reacted with p - hydroxy - acetophenone to obtain p -[( 1 , 5 - dimethyl - hexyl )- oxy ]- acetophenone ( boiling point = 200 ° c / 1 . 0 mmhg ); geranyl bromide was reacted with vanillic acid n , n - diethyl amide to obtain p - geranyloxy - m - methoxy - n , n - diethyl - benzamide ( boiling point = 180 °/ 0 . 05 mmhg ); 2 - bromo - 1 , 4 , 5 - trimethyl - hex - 4 - ene was reacted with vanillic acid n , n - diethyl amide to obtain p -[( 1 , 4 , 5 - trimethyl - hex - 4 - enyl )- oxy ]- m - methoxy - n , n - diethyl - benzamide ( boiling point = 160 °- 162 ° c / 0 . 02 mmhg , n d 28 = 1 . 5185 ); 2 - bromo - 6 - methyl - heptane was reacted with vanillic acid n , n - diethyl amide to obtain p -[( 1 , 5 - dimethyl - hexyl )- oxy ]- m - methoxy - n , n - diethyl - benzamide ( boiling point = 180 °- 182 ° c / 0 . 1 mmhg ); 2 - bromo - 6 - methyl - heptane was reacted with p - methoxy - phenol to obtain p -[( 1 , 5 - dimethyl - hexyl )- oxy ]- anisole ( boiling point = 170 °- 172 ° c / 1 . 0 mmhg ); and 2 - bromo - 6 - methyl - heptane was reacted with p - hydroxy - benzonitrile to obtain p -[( 1 , 5 - dimethyl - hexyl )- oxy ]- benzonitrile ( boiling point = 165 °- 168 ° c / 1 . 0 mmhg ). 5 . 5 g of p -[( 1 , 4 , 5 - trimethyl - hex - 4 - enyl )- oxy ]- m - methoxy - n , n - dicthyl - benzamide are dissolved in 50 ml of ethanol and hydrogenated under normal conditions in the presence of 0 . 1 g of platinum oxide . after the uptake of 1 mol of hydrogen , the hydrogenation is terminated and the catalyst is filtered off . the clear filtrate is evaporated under reduced pressure . the residual oily p -[( 1 , 4 , 5 - trimethyl - hexyl )- oxy ]- m - methoxy - n , n - diethyl - benzamide is purified by adsorption on kieselgel ; boiling point = 158 °- 160 ° c / 0 . 02 mmhg ; n d 26 = 1 . 5060 . a solution of 2 g of p - geranyloxy - m - methoxy - n , n - diethyl - benzamide in 150 ml of methylene chloride is treated dropwise at 0 ° c with a solution of 1 . 2 g of 30 % by weight m - chloro - per - benzoic acid in 100 ml of methylene chloride . after 15 minutes , the resulting mixture is successively washed with a 2 % by weight sodium bisulphite aqueous solution , a 5 % by weight sodium bicarbonate aqueous solution and water , dried over sodium sulphate and evaporated under reduced pressure . the residual p -[( 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl )- oxy ]- m - methoxy - n , n - diethyl - benzamide is purified by adsorption on kieselgel ; n d 24 = 1 . 5294 . in a manner analogous to the foregoing , from p -[( 1 , 4 , 5 - trimethyl - hex - 4 - enyl )- oxy ]- m - methoxy - n , n - diethyl - benzamide there is obtained p -[( 4 , 5 - epoxy - 1 , 4 , 5 - trimethyl - hexyl )- oxy ]- m - methoxy - n , n - diethyl - benzamide ( n d 25 = 1 . 5108 ). 3 . 4 g of sodium are dissolved in 150 ml of absolute ethanol . while stirring at room temperature , the solution is treated with 18 . 6 g of thio - p - cresol . the resulting mixture is further stirred at room temperature for 30 minutes , then treated with 29 g of 2 - bromo - 6 - methyl - heptane under reflux conditions for 30 minutes , cooled and treated with 300 ml of water and 300 ml of diethyl ether . the ether phase is separated off , washed with water , and dried over sodium sulphate and evaporated under reduced pressure . the residual 1 , 5 - dimethyl - hexyl p - tolyl sulphide boils at 102 °- 105 ° c / 0 . 5 mmhg . 23 . 7 g of 1 , 5 - dimethyl - hexyl p - tolyl sulphide are dissolved in 250 ml of methylene chloride and treated portionwise at 0 °- 5 ° c with 13 g of m - chloro - perbenzoic acid . the resulting mixture is further stirred at room temperature for 1 hour and subsequently diluted with 200 ml of methylene chloride . the solution obtained is successively washes with 0 . 1 - n sodium hydroxide solution and water . the methylene chloride phase is separated off , dried over sodium sulphate and evaporated under reduced pressure . the residual 1 , 5 - dimethyl - hexyl p - tolyl sulphoxide is purified by absorption on kieselgel ; n d 25 = 1 . 5248 . 23 . 7 g of 1 , 5 - dimethyl - hexyl p - tolyl sulphide are dissolved in 250 ml of methylene chloride . with stirring , the solution is treated portionwise at 0 °- 5 ° c with 36 g of m - chloro - perbenzoic acid . the resulting mixture is further stirred at room temperature for 1 hour , then diluted with 200 ml of methylene chloride . the solution obtained is successively washed with 0 . 1 - n sodium hydroxide solution and water . the methylene chloride phase is separated off , dried over sodium sulphate and evaporated under reduced pressure . the residual 1 , 5 - dimethyl - hexyl p - tolyl sulphone is purified by adsorption on kieselgel ; n d 25 = 1 . 5101 . 50 g of a 50 % suspension of sodium hydride in mineral oil are washed 3 times with hexane , then inroduced into 300 ml of n , n - dimethyl - formamide and treated with 83 g of 6 - hydroxy - methyl - 1 , 4 - benzodioxan . 108 g of 1 - bromo - 3 , 7 - dimethyl - octa - 2 ,- 6 - diene are subsequently added dropwise and the resulting mixture is stirred at room temperature for 1 hour , then treated with 1000 ml of water and exhaustively extracted with diethyl ether . the ether extract is washed with water , dried over sodium sulphate and evaporated under reduced pressure . the residual 6 -{ [( 3 , 7 - dimethyl - octa - 2 , 6 - dienyl )- oxy ]- methyl }- 1 , 4 - benzodioxan is purified by adsorption on kieselgel ; n d 25 = 1 . 5285 . 2 , 4 - dichloro - phenol is reacted with 1 - bromo - 3 , 7 - dimethyl - octa - 2 , 6 - diene to produce 2 , 4 - dichloro - phenyl 3 , 7 - dimethyl - octa - 2 ,- 6 - dienyl ether ( n d 25 = 1 . 5368 ) and benzyl alcohol is reacted with 1 - bromo - 3 , 7 - dimethyl - octa - 2 , 6 - diene to produce 3 , 7 - dimethyl - octa - 2 , 6 - dienyl ether ( n d 25 = 1 . 5095 ). 15 g of 2 , 4 - dichloro - phenyl 3 , 7 - dimethyl - octa - 2 , 6 - dienyl ether are dissolved in 100 ml of ethyl acetate and hydrogenated under normal conditions in the presence of 0 . 5 g of platinum oxide . after the uptake of 2 mol of hydrogen , the hydrogenation is terminated and the catalyst is filtered off . the clear filtrate is evaporated under pressure . the residual 2 , 4 - dichloro - phenyl 3 , 7 - dimethyl - octyl ether boils at 123 °- 125 ° c / 0 . 01 mmhg . in a manner described in example 10 , 6 -{[( 3 , 7 - dimethyl - octa - 2 , 6 - dienyl )- oxy ]- methyl }- 1 , 4 - benzodioxan is hydrogenated to produce 6 -{[( 3 , 7 - dimethyl - octyl )- oxy ]- methyl }- 1 , 4 - benzodioxan ( n d 25 = 1 . 5009 ). 29 . 9 g of 2 , 4 - dichloro - phenyl 3 , 7 - dimethyl - octa - 2 , 6 - dienyl ether are dissolved in 300 ml of methylene chloride . with stirring , the solution is treated portionwise at 0 ° c with 21 . 8 g of m - chloro - perbenzoic acid . the resulting mixture is further stirred for 30 minutes at 0 ° c and subsequently for 30 minutes at room temperature . methylene chloride is then added until a clear solution is obtained . this solution is successively washed with 0 . 5 - n aqueous sodium hydroxide solution and water , dried over sodium sulphate and evaporated under reduced pressure . the residual oily 2 , 4 - dichloro - phenyl 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl ether is purified by adsorption on kieselgel ; n d 25 = 1 . 5312 . 3 , 7 - dimethyl - octa - 2 , 6 - dienyl benzyl ether is epoxidized to produce 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl benzyl ether ( n d 25 = 1 . 5431 ); and 6 -{ [ 3 , 7 - dimethyl - octa - 2 , 6 - dienyl )- oxy ]- methyl }- 1 , 4 - benzodioxan is epoxidized to produce 6 -{[( 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl )- oxy ]- methyl }- 1 , 4 - benzodioxan ( n d 25 = 1 . 5529 ) 11 . 5 g of sodium are dissolved in 400 ml of absolute ethanol . with stirring at room temperature , the solution is successively treated with 55 g of thiophenol and 108 g of 1 - bromo - 3 , 7 - dimethyl - octa - 2 , 6 - diene . the resulting mixture is stirred at room temperature for 1 hour . precipitated sodium bromide is then filtered off and the filtrate is evaporated , treated with 500 ml of water and extracted with ether . the ether extract is successively washed with water and aqueous sodium bicarbonate solution , dried over sodium sulphate and evaporated under reduced pressure . the residual 3 , 7 - dimethyl - octa - 2 , 6 - dienyl phenyl sulphide boils at 140 ° c / 0 . 85 mmhg . in the same manner as example 14 the following reactions are carried out : 2 - thionaphthol is reacted with 1 - bromo - 3 , 7 - dimethyl - octa - 2 , 6 - diene to produce 3 , 7 - dimethyl - octa - 2 , 6 - dienyl 2 - naphthyl sulphide ( boiling point = 138 ° c / 0 . 25 mmhg ; thio - p - cresol is reacted with 1 - bromo - 3 , 7 - dimethyl - octa - 2 , 6 - diene to produce 3 , 7 - dimethyl - octa - 2 , 6 - dienyl p - tolyl sulphide ( boiling point = 116 °- 118 ° c / 0 . 1 mmhg ); thio - m - cresol is reacted with 1 - bromo - 3 , 7 - dimethyl - octa - 2 , 6 - diene to produce 3 , 7 - dimethyl - octa - 2 , 6 - dienyl m - tolyl sulphide ( b . p . 122 ° c / 0 . 07 mmhg ); thio - o - cresol is reacted with 1 - bromo - 3 , 7 - dimethyl - octa - 2 , 6 - diene to produce 3 , 7 - dimethyl - octa - 2 , 6 - dienyl o - tolyl sulphide ( boiling point = 125 ° c / 0 . 08 mmhg ); and benzyl mercaptan is reacted with 1 - bromo - 3 , 4 - dimethyl - octa - 2 , 6 - diene to produce 3 , 7 - dimethyl - octa - 2 , 6 - dienyl benzyl sulphide ( boiling point = 128 ° c / 0 . 08 mmhg ). 49 . 2 g of 3 , 7 - dimethyl - octa - 2 , 6 - dienyl phenyl sulphide are dissolved in 200 ml of methylene chloride and , while stirring at 0 °- 5 ° c , treated with 43 . 4 g of m - chloro - perbenzoic acid . the resulting mixture is further stirred at room temperature for 30 minutes . 100 ml of methylene chloride are added and the resulting solution is washed with water and with sodium bicarbonate solution , dried over sodium sulphate and evaporated under reduced pressure . the residual 3 , 7 - dimethyl - octa - 2 , 6 - dienyl phenyl sulphoxide is purified by adsorption on kieselgel ; n d 25 = 1 . 5491 . from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl 2 - naphthyl sulphide there is obtained 3 , 7 - dimethyl - octa - 2 , 6 - dienyl 2 - naphthyl sulphoxide ( melting point = 74 °- 76 ° c ); from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl p - tolyl sulphide there is obtained 3 , 7 - dimethyl - octa - 2 , 6 - dienyl p - tolyl sulphoxide ( n d 25 = 1 . 5488 ); from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl m - tolyl sulphide there is obtained 3 , 7 - dimethyl - octa - 2 , 6 - dienyl m - tolyl sulphoxide ( n d 25 = 1 . 5480 ); from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl o - tolyl sulphide there is obtained 3 , 7 - dimethyl - octa - 2 , 6 - dienyl o - tolyl sulphoxide ( n d 25 = 1 . 5507 ); and from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl benzyl sulphide there is obtained 3 , 7 - dimethyl - octa - 2 , 6 - dienyl benzyl sulphoxide ( n d 25 = 1 . 5406 ). 26 g of 3 , 7 - dimethyl - octa - 2 , 6 - dienyl p - tolyl sulphide are suspended 25 ml of water . the suspension is treated with tetrahydro - furan until a clear solution is formed . this solution is treated portionwise with stirring at 0 °- 5 ° c with 17 . 1 g of n - bromo - succinimide . the resulting mixture is stirred for 1 hour , then extracted with 600 ml of ether . the ether extract is washed with water , dried over sodium sulphate and evaporated under reduced pressure . the residual crude bromo - hydrin is treated at room temperature with a sodium ethoxide solution prepared from 2 - 3 g of sodium and 200 ml of ethanol and stirred for 5 hours , then exhaustively extracted with diethyl ether . the ether extract is washed with water , dried over sodium sulphate and evaporated under reduced pressure . the residual 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl p - tolyl sulphide is purified by adsorption on kieselgel : n d 25 = 1 . 5410 . from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl phenyl sulphide there is obtained 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl phenyl sulphide ( n d 25 = 1 . 5560 °); from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl 2 - naphthyl sulphide there is obtained 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl 2 - naphthyl sulphide ( n d 25 = 1 . 6010 ); from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl m - tolyl sulphide there is obtained 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl m - tolyl sulphide ( n d 25 = 1 . 5425 ); from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl o - tolyl sulphide there is obtained 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl o - tolyl sulphide ( n d 25 = 1 . 5450 ); from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl phenyl sulphoxide there is obtained 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl phenyl sulphoxide ( n d 25 = 1 . 5486 ); from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl 2 - naphthyl sulphoxide there is obtained 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl 2 - naphthyl sulphoxide ( n d 25 = 1 . 5898 ); from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl p - tolyl sulphoxide there is obtained 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl p - tolyl sulphoxide ( n d 25 = 1 . 5409 ); from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl m - tolyl sulphoxide there is obtained 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl m - tolyl sulphoxide n d 25 = 1 . 5450 ); and from 3 , 7 - dimethyl - octa - 2 , 6 - dienyl o - tolyl sulphoxide there is obtained 6 , 7 - epoxy - 3 , 7 - dimethyl - oct - 2 - enyl o - tolyl sulphoxide ( n d 25 = 1 . 5437 ). 30 g of a 50 % by weight suspension of sodium hydride in mineral oil are washed 3 times with petroleum ether , then introduced into 100 ml of n , n - dimethyl - formamide and treated at room temperature , with stirring , with 18 g of 7 - hydroxymethyl - 1 , 5 - benzodioxepine . the mixture is further stirred at room temperature for 30 minutes , then treated with 28 . 5 g of 1 - bromo - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - triene and subsequently stirred at room temperature for 2 hours , then cooled with ice , treated with 500ml of water and extracted with ether . the ether extract is washed with water , dried over sodium sulphate and evaporated under reduced pressure . the residual 7 -{[( 3 , 7 , 11 - trimethyl - dodeca - 2 - 6 - 10 - trienyl )- oxy ]- methyl }- 1 , 5 - benzodioxepine is purified by adsorption on kieselgel ; n d 25 = 1 . 5253 . 4 g of 7 -{[( 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl )- oxy ]- methyl }- 1 , 5 - benzodioxepine are dissolved in 30 ml of ethyl acetate and hydrogenated under normal conditions in the presence of 300 g of platinum oxide . after the uptake of 3 mol of hydrogen , the hydrogenation is terminated and the catalyst is filtered off . the clear filtrate is evaporated under reduced pressure . the residual 7 -{[( 3 , 7 , 11 - trimethyl - dodecyl )- oxy ]- methyl }- 1 , 5 - benzodioxepine is purified by adsorption on kieselgel : n d 25 = 1 . 4968 . 6 g of 7 -{[( 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl )- oxy ]- methyl }- 1 , 5 - benzodioxepine are suspended in 6 ml of water . the suspension is treated with tetrahydro - furan until a clear solution is obtained . this solution is treated portionwise with stirring at 5 °- 10 ° with 2 . 7 g of n - bromo - succinimide . the resulting mixture is stirred for 1 hour , then treated with 200 ml of water and extracted with diethyl ether . the ether extract is washed with water , dried over sodium sulphate and evaporated under reduced pressure . the residual crude bromohydrin is introduced with stirring into a solution of 1 . 0 g of sodium in 50 ml of absolute ethanol . the resulting mixture is diluted with 200 ml of water and exhaustively extracted with ether . the ether extract is washed with water , dried over sodium sulphate and evaporated under reduced pressure . the residual 7 -{[( 10 ,- 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl )- oxy ]- methyl }- 1 , 5 - benzodioxepine is purified by adsorption on kieselgel : n d 25 = 1 . 5233 . 24 . 8 g of thio - p - cresol are introduced with stirring into a solution of 4 . 6 g of sodium in 150 ml of absolute ethanol . the resulting mixture is treated dropwise at 30 ° c with stirring with 57 g of 1 - bromo - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - triene . the mixture is then heated under reflux conditions for 2 hours , cooled , poured onto ice and exhaustively extracted with diethyl ether . the ether extract is washed with water , dried over sodium sulphate and evaporated under reduced pressure . the residual 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl p - tolyl sulphide boils at 145 °- 150 ° c / 0 . 05 mmhg . from thiophenol and 1 - bromo - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - triene there is obtained 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl phenyl sulphide ( n d 20 = 1 . 5428 ); and from 2 - thionaphthol and 1 - bromo - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - triene there is obtained 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl 2 - naphthyl sulphide ( n d 25 = 1 . 5881 ). a solution of 10 g of thiophenol in 300 ml of acetone is gradually treated at room temperature with a solution of 4 g of sodium hydroxide in 7 ml of water . 28 . 5 g of 1 - bromo - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - triene are then added dropwise at 0 ° c . the resulting mixture is stirred at room temperature for 12 hours , diluted with water and freed from acetone under reduced pressure . the aqueous concentrate is exhaustively extracted with diethyl ether . the ether extract is successively washed with 1 - n aqueous sodium hydroxide solution and saturated brine , dried over sodium sulphate and evaporated under reduced pressure . the residual 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl phenyl sulphide is purified by adsorption on aluminum oxide ( activity grade iii , eluant n - hexane ); boiling point = 150 ° c / 0 . 03 mmhg , n d 20 = 1 . 5428 . 16 . 4 g of 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl p - tolyl sulphide are suspended in 15 ml of water . the suspension is treated with tetrahydro - furan until a clear solution is obtained . this solution is treated portionwise with stirring at 0 °- 5 ° c with 8 . 8 g of n - bromo - succinimide . the resulting mixture is stirred for 2 hours , then extracted with 400 ml of diethyl ether . the ether extract is washed with water , dried over sodium sulphate and evaporated under reduced pressure . the residual crude bromo - hydrin is dissolved in 25 ml of absolute ethanol . the resulting solution is added with stirring to a solution of 1 . 15 g of sodium in 50 ml of absolute ethanol . the mixture obtained is stirred at room temperature for 1 hour , then diluted with water and exhaustively extracted with diethyl ether . the ether extract is washed with water , dried over sodium sulphate and evaporated under reduced pressure . the residual 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl p - tolyl sulphide is purified by adsorption on kieselgel ; n d 25 = 1 . 5411 . from 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl phenyl sulphide there is obtained 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl phenyl sulphide ( n d 20 = 1 . 5419 ); and from 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl 2 - naphthyl sulphide there is obtained 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl 2 - naphthyl sulphide ( n d 25 = 1 . 5444 ). 32 . 8 g of 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl p - tolyl sulphide are dissolved in 300 ml of methylene chloride and treated portionwise at 0 °- 5 ° c with 18 g of m - chloro - perbenzoic acid . the resulting mixture is further stirred at room temperature for 1 hour , then diluted with 200 ml of methylene chloride . the resulting solution is successively washed with 0 . 1 - n sodium hydroxide solution and water . the methylene chloride phase is separated off , dried over sodium sulphate and evaporated under reduced pressure . the residual 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl p - tolyl sulphoxide is purified by adsorption on kieselgel ; n d 25 = 1 . 5414 . from 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl phenyl sulphide there is obtained 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl phenyl sulphoxide ( n d 25 = 1 . 5423 ); and from 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl 2 - naphthyl sulphide there is obtained 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 , 10 - trienyl 2 - naphthyl sulphoxide ( n d 25 = 1 . 5822 ). 6 . 9 g of 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl p - tolyl sulphide are dissolved in 70 ml of methylene chloride . the solution is cooled to 0 °- 5 ° c and treated portionwise with stirring with 3 . 5 g of m - chloro - perbenzoic acid . the resulting mixture is stirred at room temperature for 1 hour , then diluted with 50 ml of methylene chloride . the resulting clear solution is successively washed with 0 . 1 - n sodium hydroxide solution and water . the methylene chloride phase is separated off , dried over sodium sulphate and evaporated under reduced pressure . the residual 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl p - tolyl sulphoxide is purified by adsorption on kieselgel ; n d 25 = 1 . 5447 . from 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl phenyl sulphide there is obtained 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl phenyl sulphoxide ( n d 25 = 1 . 5430 ); and from 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl 2 - naphthyl sulphide there is obtained 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl 2 - naphthyl sulphoxide ( n d 25 = 1 . 5797 ). a solution of 6 . 9 g of 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl p - tolyl sulphide in 80 ml of methylene chloride is treated portionwise with stirring at 0 °- 5 ° c with 7 g of m - chloro - perbenzoic acid . the resulting mixture is stirred at room temperature for 1 hour , then diluted with 80 ml of methylene chloride . the resulting clear solution is successively washed with 0 . 1 - n aqueous sodium hydroxide solution and water . the methylene chloride phase is separated off , dried over sodium sulphate and evaporated under reduced pressure . the residual 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl p - tolyl sulphone is purified by adsorption on kieselgel ; n d 25 = 1 . 5232 . from 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl phenyl sulphide there is obtained 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl phenyl sulphone ; and from 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl 2 - naphthyl sulphide there is obtained 10 , 11 - epoxy - 3 , 7 , 11 - trimethyl - dodeca - 2 , 6 - dienyl 2 - naphthyl sulphone ( n d 25 = 1 . 5908 ). by the process described in example 1 , 2 - bromo - methyl - heptane is reacted with p - hydroxy - benzoic acid methyl ester to produce p -[( 1 , 5 - dimethyl - hexyl )- oxy ]- benzoic acid methyl ester ( boiling point = 132 °- 133 ° c / 0 . 1 mmhg ; n d 24 = 1 , 4883 . 42 g of p -[( 1 , 5 - dimethyl - hexyl )- oxy ]- benzoic acid methyl ester are dissolved in 250 ml of benzene and treated dropwise with stirring with 50 g of 70 % by weight sodium dihydro - bis -( 2 - methoxy - ethoxy )- aluminate in benzene . the resulting mixture is further stirred at room temperature for 5 hours , then treated with water . the organic phase is separated off , dried over sodium sulphate , carefully filtered ( using a filter aid if necessary ) and evaporated under reduced pressure . the residual p -[( 1 , 5 - dimethyl - hexyl )- oxy ]- benzyl alcohol boils at 180 °- 182 ° c / 1 . 0 mmhg . by the process described in example 1 , p -[( 1 , 5 - dimethyl - hexyl )- oxy ]- benzyl alcohol is reacted with propyl bromide to give p -[( 1 , 5 - dimethyl - hexyl )- oxy ]- α - propoxy - toluene ( boiling point = 198 °- 200 ° c / 1 . 0 mmhg ). a solution of 23 g . 6 , 7 - epoxy - 1 -( p - ethylphenoxy )- 3 , 7 - dimentyl - 2 - nonene in 250 ml ethylacetate was trated with 1 . 0 g pt0 2 and hydrogenated until 2 . 15 l . of hydrogen ( corresponding to 1 double bond ) has been taken up . the ethylacetate solution after filtration of pt was washed with two 100 ml - portions of 2n aqueous naoh and finally with water . it was dried over magnesium sulfate , filtered and concentrated in vacuo at 35 ° temperature and 20 mmhg pressure to constant weight ; n d 25 1 , 4965 to produce 6 , 7 - epoxy - 1 -( p - ethylphenoxy - 3 , 7 - dimethylnonane . by the procedure of example 37 starting from : 6 , 7 - epoxy - 1 -( p - ethylphenoxy )- 3 - ethyl - 7 - methyl - 2 - nonene and h 2 there is produced 6 , 7 - epoxy - 1 -( p - ethylphenoxy )- 3 - ethyl - 7 - methylnonane , n d 24 : 1 , 4971 . by the procedure of example 37 , 6 , 7 - epoxy - 1 -( p - ethylphenoxy )- 3 , 7 - dimethyl - 2 - octene is converted to 6 , 7 - epoxy - 1 -( p - ethylphenoxy )- 3 , 7 - dimethyloctane , n d 24 : 1 , 4973 . by the procedure of example 37 6 , 7 - epoxy - 1 -( p - ethylphenoxy )- 3 , 6 , 7 - trimethyl - 2 - octene is converted to 6 , 7 - epoxy - 1 -( p - ethylphenoxy )- 3 , 6 , 7 - trimethyl - octane , n d 27 : 1 , 4998 . into a flask equipped with a cooling bath , stirrer , thermometer , nitrogen inlet and dropping funnel were placed 122 g of p - ethylphenol and 1 . 0 l of dimethylformamide . the solution was stirred with 75 g of powdered potassium hydroxide ( 85 %) and the temperature was maintained below 20 ° c during this addition . it was then cooled and 250 g of 1 - bromo - 3 , 7 - dimethyl - 2 , 6 - octadiene was added dropwise and the reaction was stirred overnight . thereafter , the solution was poured on a mixture of ice , 2n - naoh and hexane . the organic layer was then dried over sodium sulfate , filtered and concentrated in vacuo . the product was chromatographed on silicagel using hexane - ethylacetate ( 9 : 1 parts by volume ) as eluent . the fractions containing p - ethylphenyl - 3 , 7 - dimethyl - 2 , 6 - octadienyl ether were concentrated in a rotary evaporator . the residue was distilled , b . p . 124 °- 126 °/ 0 . 05 mmhg . by the procedure of example 41 , 1 - bromo - 3 , 7 - dimethyl - 2 , 6 - nonadiene and p - ethylphenol are reacted to form p - ethylphenyl - 3 , 7 - dimethyl - 2 , 6 - nonadienylether , b . p . 128 °- 130 ° c / 0 . 05 mmhg ; 1 - bromo - 3 - ethyl - 7methyl - 2 , 6 - nonadiene and p - ethylphenol are reacted to form p - ethylphenyl - 3 - ethyl - 7 - methyl - 2 , 6 - nonadienylether , n d 25 = 1 , 5048 ; and 1 - bromo - 3 , 6 , 7 - trimethyl - 2 , 6 - octadiene and p - ethylphenol are reacted to form p - ethylphenyl - 3 , 6 , 7 - trimethyl - 2 , 6 - octadienylether , n d 24 = 1 , 5141 . into a 2 l flask equipped with a stirrer , thermometer and a cooling bath were placed 30 g of p - ethylphenyl - 3 , 7 - dimethyl - 2 , 6 - octadienylether and 240 ml of methylenechloride . nitrogen was bubbled through the system and the stirred mixture was cooled to 0 ° c . a solution of 22g of m - chloroperbenzoic acid ( 80 %) in 300 ml of methylenechloride was added dropwise over 30 minutes at 0 °- 5 ° c . the reaction was stirred 30 minutes longer at 5 ° c and then the bath was removed to allow the mixture to warm to room temperature . it was stirred at this temperature for 15 minutes and after filtration m - chlorobenzoic acid , the dichloromethane solution was washed successively with two 250 ml portions of 2n aqueous sodium hydroxide , once with 200 ml of 0 . 1n aqueous sodium - thiosulfate and finally with 250 ml of water . it was dried over magnesium sulfate , filtered and concentrated in vacuo at 35 ° bath temperature and 20 mmhg pressure to constant weight ; n d 20 = 1 , 5025 . p - ethylphenyl - 3 - ethyl - 7 - methyl - 2 , 6 - nonadienylether is reacted with m - chloroperbenzoic acid to produce 6 , 7 - epoxy - 1 -( p - ethylphenoxy )- 3 - ethyl - 7 - methyl - 2 - nonene ; n d 23 = 1 , 5026 ; p - ethylphenyl - 3 , 7 - dimethyl - 2 , 6 - nonadienylether is reacted with m - chloroperbenzoic acid , to produce 6 , 7 - epoxy - 1 -( p - ethylphenoxy )- 3 , 7 - dimethyl - 2 - nonene ; n d 20 = 1 , 5097 ; and p - ethylphenyl - 3 , 6 , 7 - trimethyl - 2 , 6 - octadienylether is reacted with m - chloroperbenzoic acid to produce 6 , 7 - epoxy - 1 -( p - ethylphenoxy )- 3 , 6 , 7 - trimethyl - 2 - octene ; n d 28 = 1 , 5048 . in a 1 . 0 liter four - necked flask fitted with a reflux condenser a mechanical stirrer , dropping funnel and a gas inlet tube is placed 50 ml of dry tetrahydrofurane and 1 . 5 g nah ( prepared from 50 % suspension through washing with tetrahydrofuran ). 7 . 5g of p - ethylphenol in 50 ml of tetrahydrofuran is then added dropwise with stirring while a nitrogen atmosphere is maintained in the flask . the mixture is stirred until solution of nah is complet , and 13 . 0 g . 1 - bromo - 6 , 7 - epoxy - 3 , 7 - dimethyloctane in 20 ml hexamethylphosphoric triamide is added dropwise and with stirring . the resulting mixture is boiled under reflux , with stirring for 3 hours . after the addition of 1 . 0 liter of water the mixture is extracted with 0 . 5 liters of hexane and hexane extract is dried over sodium sulfate , filtered and concentrated in vacuo with water aspirator . the product was chromatographed on silica gel , fractions eluted with a mixture hexane - ethyl - acetate ( 9 : 1 parts by volume ) afforded 6 , 7 - epoxy - 1 -( 1 - ethylphenoxy )- 3 , 7 - dimethyl - octane n d 24 - 1 , 4973 . into a 2 liter round - bottomed flask equipped with a stirrer , thermometer and cooling bath were placed 20 . 0 g of 3 , 7 - dimethyl - 6 - octen - 1 - bromide and 150 ml dichloromethane . nitrogen was admitted to the system and the stirred mixture was cooled to 0 ° c . the solution of 22 g . of m - chloroperbenzoic acid ( 80 %) in 150 ml dichloromethane was added dropwise over 30 minutes at 0 ° to 5 ° c . the reaction was stirred over 30 minutes longer at 5 ° c and then the bath was removed to allow the mixture to warm to room temperature . it was stirred at this temperature for 15 minutes and after filtration of m - chlorobenzoic acid , the dichloromethane solution was washed successively with two 250 ml - portions of 2 n naoh , once with 200 ml 0 . 1 n sodium thiosulfate , and finally with 250 ml of water to produce 1 - bromo - 6 , 7 - epoxy - 3 , 7 - dimethyloctane . the product was dried over magnesium sulfate , filtered and concentrated in vacuo at 35 ° c bath temperature and 20 mmhg pressure to constant weight : n d 20 = 1 , 4986 . into a 2 liter round - bottomed flask equipped with a cooling bath , stirrer and thermometer was placed 70 g . of p - ethylphenol and 400 ml dimethoxy ethane . the resulting solution was stirred and 30 g . of potassium hydroxide in 200 ml ethanol was added within 5 minutes . the temperature was maintained below 20 ° c during this addition and then 110 g . of 1 - bromo - 3 , 7 - dimethyl - 6 - octene was added dropwise over 15 minutes . the reaction was stirred for two hours longer at 80 ° c and then allowed to rise to room temperature . after 3 hours the reaction was poured into a mixture of 500 g . of ice and 1 liter of hexane . the phases were separated and the aqueous layer was reextracted with two 0 . 5 l - portions hexane . all organic phases were combined and washed successively with 1 . 0 liter of water , two 250 ml portions of 2n sodium hydroxide and 1 . 0 liter of water . the organic layer was then dried over sodium sulfate , filtered , and concentrated in vacuo with water aspirator . the dark solution was chromatographed on 1 kg silica gel in hexane - ethylacetate ( 9 : 1 parts by volume ). the fractions yielding p - ethyphenyl - 3 , 7 - dimethyl - 6 - octenyl ether were concentrated in a rotary evaporator at 40 ° c bath temperature using a water pump for the vacuum . the residue was distilled through a small widmer column . the fraction of b . p . 118 °- 120 ° c 0 . 05 mmhg was p - ethylphenyl - 3 , 7 - dimethyl - 6 - octenyl ether . 49 g of dry diethylamine are dissolved in 530 ml of anhydrous ether and mixed at - 10 ° c with stirring with 420 ml of a 15 % by weight solution of butyl - lithium in hexane . the mixture is stirred at room temperature for 1 hour . 10 ml of the 1 - molar solution of diethylamine - lithium thus obtained are treated with a solution of 3 g of p -[( 1 , 5 - dimethyl - hexyl )- oxy ] benzoic acid methyl ester ( see example 34 ) in 30 ml of diethyl ether . the resulting mixture is stirred at room temperature for 4 hours , then washed with 0 . 1 - n aqueous hydrochloric acid and with water , dried over sodium sulphate and evaporated under reduced pressure . the residual p -[( 1 , 5 - dimethyl - hexyl ) oxy ]- n , n - diethyl - benzamide is purified by adsorption on kieselgel ; boiling point = 205 °- 208 ° c / 0 . 1mmhg . by the procedure given in example 47 , diisobutylamine is reacted with p -[( 1 , 5 - dimethyl - hexyl )- oxy ]- benzoic acid methyl ester to produce p -[( 1 , 5 - dimethyl - hexyl )- oxy ]- n , n - diisobutylbenzamide ( n d 24 = 1 . 4968 ). by the procedure described in example 1 , 2 - bromo - 6 - methylheptane is reacted with vanillic acid methyl ester to produce 4 -[( 1 , 5 - dimethyl - hexyl )- oxy ]- m - methoxy - benzoic acid methyl ester ( boiling point = 198 °- 200 ° c / 0 . 1 mmhg ). by the procedure described in example 48 , dimethylamine is reacted with 4 -[( 1 , 5 - dimethyl - hexyl )- oxy ]- m - methoxy - benzoic acid methyl ester to produce 4 -[( 1 , 5 - dimethyl - hexyl )- oxy ]- m - methoxy - n , n - diethyl - benzamide ( boiling point = 180 °- 182 ° c / 0 . 1 mmhg ). in examples 52 to 55 hereinafter , which relate to tests demonstrating the activity of the phenyl derivatives provided by the invention , the various phenyl derivatives are referred to by way of the letters indicated in the following list : two filter - paper discs ( 24 cm 2 ) are sprayed with a solution of active substance in acetone . after drying , they are so fixed together that a tunnel is formed to shelter larvae of the cockroach ( blatella germanica ) in the final larval stage . the same is done with an untreated filer - paper disc and a filter - paper disc treated only with acetone . the larvae remain in continuous contact with the filter paper and are provided with water and food . the further development of the larvae is noted daily and the results are evaluated ( 100 % disturbance of metamophosis ; a normal adult develops from none of the larvae ). ______________________________________ amount of active no . of substance no . of normal activityactive substance ( g / cm . sup . 2 ) larvae imagos (%) ______________________________________ q 10 . sup .-. sup . 4 10 1 90 r 10 . sup .-. sup . 4 10 0 100control with -- 10 10 0 acetonecontrol without -- 10 10 0 acetone______________________________________ a cotton disc ( 10 cm 2 ) is sprayed with a solution of active substance in acetone . after drying , 30 - 60 freshly laid eggs of the meal moth ( ephestia kuhniella ) are placed on the disc . the same is done with an untreated cotton disc and a cotton disc sprayed only with acetone . the discs are placed in a cage and kept at 25 ° c and 90 % relative humidity . the development of the eggs is registered over a period of a few days and the results are evaluated ( 100 % egg mortality : no development of the embryos in the eggs laid on discs soaked with active substance ). ______________________________________ amount of active substance no . of no . of mortalityactive substance g / cm . sup . 2 eggs larvae (%) ______________________________________ a 10 . sup .-. sup . 4 37 0 100 10 . sup .-. sup . 5 40 1 98 b 10 . sup .-. sup . 4 40 3 92 10 . sup .-. sup . 5 41 0 100 c 10 . sup .-. sup . 4 39 0 100 10 . sup .-. sup . 5 47 0 100 d 10 . sup .-. sup . 4 37 0 100 10 . sup .-. sup . 5 36 0 100 10 . sup .-. sup . 6 42 36 14 e 10 . sup .-. sup . 4 36 0 100 10 . sup .-. sup . 5 57 0 100 10 . sup .-. sup . 6 32 1 97 f 10 . sup .-. sup . 4 49 0 100 10 . sup .-. sup . 5 33 0 100 10 . sup .-. sup . 6 36 6 80 g 10 . sup .-. sup . 4 80 0 100 10 . sup .-. sup . 5 92 13 83 h 10 . sup .-. sup . 4 41 4 90 10 . sup .-. sup . 5 42 11 74 l 10 . sup .-. sup . 4 44 0 100 10 . sup .-. sup . 5 60 0 100 m 10 . sup .-. sup . 4 63 0 100 10 . sup .-. sup . 5 50 23 54 n 10 . sup .-. sup . 4 83 0 100 o 10 . sup .-. sup . 4 42 4 90 p 10 . sup .-. sup . 4 32 0 100 10 . sup .-. sup . 5 35 0 100 10 . sup .-. sup . 6 32 27 15control with acetone -- 50 50 0control without acetone -- 49 46 6______________________________________ a disc of woolen material ( 10 cm 2 ) is sprayed with a solution of active substance in acetone and , together with an untreated disc and a disc treated only with acetone , hung in a cage occupied by 20 young clothes moths ( tineola biselliela ). the development of eggs laid at 25 ° c is noted over a period of 4 days and the results are evaluated ( 100 % sterilant activity : larvae hatch from none of the eggs laid on treated and untreated discs of woolen material ; 100 % ovicidal activity : larvae hatch from none of the eggs laid on treated discs of woolen material ). ______________________________________ amount of active substance sterilant ovicidalactive substance ( g / cm . sup . 2 ) activity (%) activity (%) ______________________________________ h 10 . sup .-. sup . 3 9 93 j 10 . sup .-. sup . 3 0 100 k 10 . sup .-. sup . 3 0 82control with acetone -- 0 0control without acetone -- 0 0______________________________________ a filter - paper strip ( 90 cm 2 ) is sprayed with a solution of active substance in acetone . after drying , 3 - 4 pairs of freshly moulted imagos of the cotton bug ( dystercus cingulatus ) are placed on the strip . the same is done with an untreated filter - paper strip and a filter - paper strip treated only with acetone . the development of the eggs laid daily is noted and the results are evaluated ( 100 % egg - mortality : no development of the embryos in the eggs laid on filter - paper strips soaked with active substance ). ______________________________________ amount of active egg substance no . of no . of mortalityactive substance ( g / cm . sup . 2 ) eggs larvae (%) ______________________________________ d 10 . sup .-. sup . 5 59 0 100 e 10 . sup .-. sup . 5 mortality of the imago p 10 . sup .-. sup . 5 190 1 99control with acetone -- 270 262 3control without 410 acetone -- 390 5______________________________________ | 2 |
fig1 shows the overall configuration of the preferred embodiment of a system 20 designed to purify contaminated water , such as frac water , in batches . the contaminated fluid is first pumped into tank 8 . from the tank , the fluid passes through tank outlet line 17 to the inlet of cavitation generator 1 . as shown in fig2 and as described above , the cavitation generator consists of two primary parts , a rotor housing 4 and a rotor 5 . the rotor 5 is driven by a shaft 3 that is coupled to a motor 2 . in the preferred embodiment , an electric motor is used . the size of the motor is dependent on the size of the unit ; typically , 500 or 1000 horsepower motors would be used for applications requiring purification of up to 100 , 000 gallons per day . one skilled in the art will realize that any type of motive power capable of providing torque to a shaft can be substituted for an electric motor , although in these cases additional mechanical complexity may be required in the form of gears to match motor speed with the desired rotor rotational speed ( typically 1600 - 4000 rpm ). the speed of the rotor is one of several variables involved in inducing cavitation . typically , the outer edge of the rotor indentations ( i . e . the tips shown in fig3 - 6 ) must have a speed of at least 90 feet per second to induce cavitation in frac water , so the smaller the rotor diameter , the larger the rpm required to generate the required tip speed , and vice versa . the rpm range given above was found to be sufficient for rotors ranging in size from 5 inches in diameter to 36 inches in diameter . as contaminated fluid passes from tank 8 into the inlet of the cavitation generator 1 , it fills a cavity between the rotor 5 and the rotor housing 4 as shown in fig3 . for applications involving frac water , the gap between the rotor and housing is 0 . 250 inches . this gap , however , varies with the type of fluid designed to be heated . the exterior of the rotor and the interior of the housing contain indentations that are designed to maximize cavitation in the fluid flowing through the cavitation generator . as shown in fig3 , these indentations may be inclined into or away from the direction of rotation . the angle of inclination of the indentations either into or away from the flow and the depth of the indentations themselves will depend on the nature of the fluid to be heated . fig3 , 5 - 6 shows indentations that are defined by the intersection of planar surfaces , while fig4 shows indentations that are curved . cavitation bubbles are generated as the low - pressure boundary layer of the water in contact with the surface of the rapidly spinning rotor is swept over the lip of the indentations . this is similar to water flowing around a sharp bend in a pipe , where the pressure on the outside ( concave wall ) of the curve is higher than that on the inside ( convex wall ), where cavitation can occur . in the pipe the bubbles would be carried away by the movement of the fluid , but in the present invention the rotor indentations &# 39 ; shape and depth act to fix the location of the cavitation bubbles until the bubbles implode generating heat which is immediately imparted to the fluid . additionally as the harmonics of the device come into play the bubbles began to oscillate and continue to reform and collapse . bubble size and collapse are the results of the specifics of the irregularities and rotor design , causing millions of cavitation bubbles to form and collapse simultaneously . the heat generated by the collapsing bubbles is imparted directly to the fluid . the depth , shape , and number of these indentations , their inclination relative to the fluid flow , the speed of the outer part of the rotor ( i . e . the tip ), as well as the amount of time the fluid spends inside the cavitation generator determine how effective the cavitation generator is at generating heat . these variables depend upon the nature of the fluid to be heated . the viscosity of the fluid is a major factor in optimizing the design of the rotor and housing . higher viscosity fluids are generally more resistant to the formation of cavitation . all of the current embodiments feature indentations in both the rotor and the interior housing , which tend to increase the shear and therefore are ideally suited to counteract viscosity effects in the fluid . contaminated fluid pumped into cavitation generator 1 flows past the rotor , which is moving at high speed relative to the fluid . hydrodynamic flow patterns over the irregularities described above in the rotor and housing result in low pressure regions in the indentations , which causes the rapid formation and collapse of cavitation bubbles , resulting in heat which is then transferred to the fluid . the heated fluid passes out of the cavitation generator 1 and back into tank 8 through tank inlet line 9 . the temperature differential between the inlet and outlet of the cavitation generator is measured by water inlet temperature sensor 18 and water outlet temperature sensors 19 and displayed on panel 6 . the contaminated fluid is recirculated between tank 8 and cavitation generator 1 until the fluid in the tank begins to vaporize . pressure in the system is maintained by recirculation pump 7 . in the preferred embodiment , recirculation pump is a centrifugal pump driven by a 1 horsepower electric motor controlled from control panel 10 . as fluid continuously circulates from tank 8 to the cavitation generator 1 and back , the temperature of the fluid rises until steam is produced in tank 8 . the steam produced from the contaminated fluid in the tank passes through the top of tank 8 into steam supply line 12 and then into heat exchanger 13 . in heat exchanger 13 , the steam condensed and passes through condensate outlet line 15 and is collected . the collected fluid has now been purified and can be returned to its source . cooling water from an outside source , such contaminated frac water as shown in fig7 , is provided to the system through heat exchanger cooling water inlet 14 . power to the recirculation pump 7 is controlled at panel 10 , system temperatures are displayed on panel 6 , and power is provided through power box 11 . the fluid purification system described above processes contaminated fluid in batches . once the level of the contaminated fluid in the tank decreases to a certain level , additional fluid is added . at the end of the purification process , remaining liquid in tank 8 is drained through tank drain valve 16 . prior art cavitation generators by griggs used cylindrical dead - end bores in the rotor to generate shock waves in the fluid . however , it was discovered that cavitation effects were enhanced by modifying griggs &# 39 ; design in two ways . first , the griggs patents only disclose cylindrical indentations disposed around the circumference of the rotor . however , the current invention uses linear or curvilinear channels in the inner surface of the rotor housing that are similar to , and complimentary with , similar channels on the rotor &# 39 ; s circumference . it was discovered that the presence of channels in the inner surface of the housing as well as on the rotor increases shear in the fluid , encouraging turbulence and greatly enhancing cavitation and water hammer effect . as explained above , cavitation is desirable in this application because the rapid formation and violent collapse of cavitation bubbles generated results in significant heat being generated internally in the fluid . second , instead of cylindrical dead - end bores disposed around the circumference of the rotor , the channels in the rotor &# 39 ; s circumference extend across the width of the rotor , which results in increased surface area exposed to the fluid . in certain preferred embodiments shown in fig2 , 3 , 5 and 6 , when viewed in cross section , the channels have one or more angular corners defined by two or more intersecting planar surfaces in the rotor where the linear intersection of these two surfaces is oriented generally parallel to the rotor &# 39 ; s rotational axis . in other embodiments , however , the channels have smoothly curved walls ending with a discontinuity at the tip , such as those shown in fig4 . initial test results indicate that the currently disclosed design is more efficient than prior art models . distilling units using designs disclosed herein are approximately 30 % smaller than prior art units based on griggs &# 39 ; earlier cylindrical dead - end bore design , for the same amount of distilling capacity . other rotor and housing embodiments specifically adapted for heating contaminated water (“ frac water ”) used in hydraulic fracturing (“ fracking ”) operations are shown in fig5 and 6 . one embodiment shown in fig5 has a rotor that is 8 . 5 inches in diameter . the rotor channels disposed circumferentially when viewed in cross section are rectangular with a depth of approximately 0 . 75 inch and a width of approximately 0 . 5 inch . the rotor housing is 10 . 5 inches in outside diameter and 9 . 0 inches in inner diameter , and the corresponding channels in the rotor housing are typically 0 . 5 inches in depth and 0 . 5 inches in width . the gap between the edge of the mouth of the channels in the rotor and the rotor housing is 0 . 25 inches . a second rotor - rotor housing embodiment used in frac water purification is shown in fig6 . the rotor is 6 . 75 inches in diameter , and the channels in the rotor are defined by open pentagonal channels disposed around the rotor &# 39 ; s circumference as shown in fig6 . the bottom of the channels are typically square , with 0 . 5 inches on a side , with the channels flaring out at an angle to the outer circumference of the rotor ( i . e . the tip of the tooth attached to the rotor ). the outer diameter of the rotor housing is 10 . 5 inches and the inner diameter is 7 . 25 inches , leaving a gap of 0 . 25 inches between the tip of the pentagonal teeth of the rotor and the mouth of the channels in the rotor housing . also , it should be noted that although the rotor herein may be cylindrical , the rotor used in the preferred embodiments is a disc - wafer type rotor i . e ., a flat disc with thickness less than its diameter , as opposed to the cylinder - shaped rotor disclosed in the prior griggs patents . in the embodiments shown in fig5 and 6 , the width of the rotor is 1 . 5 inches and the outside width of the rotor housing is 1 . 875 inches . yet another embodiment that is a working prototype for a full - scale system features a 9 . 5 inch diameter rotor that is 1 inch wide . the rotor is driven with a 25 horsepower motor to 4000 rpm . such a prototype has purified 6 . 75 gallons of water per hour . a larger embodiment that is also a working prototype has a 28 inch diameter rotor which is 3 inches wide . the rotor is driven by a 125 horsepower diesel engine at 1800 rpm and distills 20 gallons of water every 2 hours and 20 minutes . another , large - scale embodiment of the system that is used to reclaim contaminated frac water is shown in fig7 . return water from the fracturing process is pumped through a pre - screen filter 21 , then into a mixing tank 22 where it is mixed with ozone from an ozone generator 23 . the ozone - treated water from mixing tank 22 is then pumped to a 40 foot long container 24 housing the system 20 described above and shown in fig1 . the heated water is sent through a high - pressure jet pump 25 , a sand bed filtration system 26 , and then to heat exchanger 27 . in heat exchanger 27 , the steam is condensed through heat exchange with return water from the fracturing process . the return water is thereby pre - heated before it passes through pre - screen filter 21 . the condensed water is then stored in a separation tank 28 , before being either discharged to the environment or reused in the fracking process . | 1 |
referring now to fig1 , an apparatus 10 for providing patient - controlled delivery of a medication includes a container 12 having a movable access panel or cover 14 coupled thereto . the access panel 14 may be secured to the container by a locking mechanism 16 ( or more simply a “ lock ” 16 ) which prevents an unauthorized user from accessing the inside of the container 12 . in the exemplary embodiment shown in fig1 , the access panel 14 is shown as a top cover 14 to the container 12 . those of ordinary skill in the art will appreciate of course that access panel 14 can also be provided as a bottom cover or side cover or as any removable portion or portions of container 12 . the apparatus 10 includes a timer 18 , a patient identification verification system 20 , an activation switch 22 , a drawer 24 having a handle 26 , and an indicator 23 . not visible in this view are internal subsystems such as a medication storage subsystem and a medication delivery subsystem . the container 12 , in a preferred embodiment , is tamper proof and made of a relatively strong material such as stainless steel or the like . container 12 has located therein a medication storage subsystem and a medication delivery subsystem which are used in combination to provide medication at predetermined time intervals to a properly identified patient . the patient selects the delivery time of the first dosage by completing a patient identification process once the time interval has elapsed . thus , the apparatus 10 functions such that the patient has the freedom to determine the time to begin taking the medication . the lock 16 secures cover 14 in a closed position to thus prevent unauthorized access into the container 12 . in one embodiment , the lock is operable by way of a key ( not shown ). it should be appreciated , however , that other types of lock systems ( e . g ., a keyless lock system ) could also be used . the cover 14 can be opened or removed by an authorized person ( e . g ., a doctor , nurse or other medical practitioner ) for the purpose of replacing the supply of medication , but otherwise is kept locked . this prevents patients or others from removing the medication supply or otherwise tampering with the contents of the container 12 . the timer 18 is used to measure the time interval between medication deliveries . in a preferred embodiment , the predetermined time interval between medication deliveries measured by the timer 18 is set by an authorized person such as a physician or nurse ( according to physician instruction ). the timer 18 is connected to a medication storage subsystem 30 ( described below in conjunction with fig2 ) and the medication delivery subsystem 40 ( also described below in conjunction with fig2 ). in the embodiment shown in fig1 , the timer 18 is mounted on a front surface of the container 12 . it should , however , be appreciated that the timer may be located on other locations of the apparatus 10 . it should also be appreciated that the timer may be physically separate from the apparatus 10 as long as the timer is coupled ( e . g . by a wire or wireless connection ) to the medication storage and delivery subsystems 30 , 40 . the timer 18 controls the medication delivery subsystem 40 such that medication is only available after the timer has elapsed as indicated by the front indicator 23 . indicator 23 may be an audio indicator , a visual indicator , a combination audio and visual indicator or other type of indicator as would be known by one of ordinary skill in the art . alternately , the indicator could be included as part of activation switch 22 . thus , once the time interval has elapsed , if the patient desires to have the medication the patient begins a medication dispensing process by performing a patient verification process ( e . g . by pushing an appropriate sequence of id keys ). once the verification process is completed correctly , the medication delivery subsystem 40 can be activated . in one embodiment , the activation switch 22 is engaged once the verification process is correctly completed and a patient or other person ( e . g . a caregiver ) can operate the activation switch 22 ( e . g . by pushing the activation switch ) to get a single dosage of the prescribed medication . medication delivery is not available if the time interval has not elapsed . this prevents a patient from taking too much medication during any one time period . after receiving the single dosage , the timer restarts and the patient is prevented from acquiring another dose of medication until the time interval elapses . the patient - controlled medication delivery system also includes the patient identification verification system 20 for verifying the identity of the patient or verifying that the patient or other person has the requisite information to operate the system . the system 20 thus prevents unauthorized use of the apparatus 10 . in a preferred embodiment , the patient identification device is provided as a personal identification number ( pin ) device 20 , although other identification verification systems could also be used ( e . g . a biometric verification system could be used ). the system 20 is in communication with the medication delivery subsystem 40 such that once a correct pin is entered , the patient is able to have the medication delivered if the time interval between medication deliveries has passed . in one embodiment the system 20 includes a digital touch - tone number pad . to operate the system , an id number is entered which must match a predetermined patient id number . once the correct id number is entered the patient can receive medication from the system . in one particular embodiment , a four - digit id system is installed . in this embodiment , a patient is allowed a predetermined number of attempts ( e . g . three attempts ) to enter a combination of digits corresponding to a valid id number ( the digits can be numbers , letters or a combination of letters and numbers ). three attempts are allowed considering the following factors : 1 ) a four - digit id system will have 16 combinations and is not easy to break with three tries and 2 ) in elderly groups , a mistake could be made more than once when entering the id by pushing the keys . however , after a predetermined number of attempts ( e . g . three attempts ) if the correct code has not been entered the system will be locked until the time interval between medication deliveries has elapsed . under such circumstances , the patient will not be able to receive medication from the apparatus 10 until the time interval has expired ( as measured form the last of the three attempts ). if the patient cannot wait that long to receive the medication , the patient will need to acquire the medication from another source , ( e . g . by contacting or visiting the appropriate doctor or other medical practitioner or appropriate pharmacist ). the patient will also have to contact the pharmacy or medical service provider ( with appropriate identification ) to have someone provide the patient &# 39 ; s correct pin number to them . it should be appreciated , of course , that id &# 39 ; s having fewer or more than four digits may also be used . the apparatus 10 also includes the activation switch 22 which is in communication with the medication delivery subsystem such that , if the timer interval has elapsed and the patient identification has been verified , engaging the activation switch 22 activates the medication delivery subsystem and a prescribed dosage of medication is made available to the patient . in a preferred embodiment the medication is deposited in the drawer 24 that the patient can access to remove the dosage of medication . in one particular embodiment , the switch 22 is provided as a pushbutton switch 22 disposed on the front surface of container 22 . it should be appreciated , however , that the activation switch 22 may be coupled to the apparatus 10 in any manner now or later known to one of ordinary skill in the art including via a wireless or hardwired connection . in some embodiments there may be an adjustable predetermined time delay ( e . g . a 10 to 30 second delay time ) after the first push of the delivery activation switch 22 before the timer 18 locks the medication delivery subsystem 40 for the next set time interval . the time delay allows the patient to engage the activation switch 22 one or more additional times such that one or more additional dosages of a desired medication is dispensed . in the case where activation switch 22 is provided as a pushbutton switch , the delay allows the patient time to push the pushbutton switch again to have an additional medication dosage if so desired ( according to the physician &# 39 ; s recommendation ). in most cases , one or two tablets or capsules are commonly used . however , in some versions of this device more than two pushes may be allowed to accommodate the prescription needs . activation switch 22 may include an indicator 23 ( e . g ., a light ) visible to the user ( e . g . from the surface of the activation switch ), which is connected with the timer . in the case where the indicator 23 is provided as an indicator light , the indicator light could be seen , for example , as a first color or light pattern ( e . g ., red or flashing ) during the locked interval and as a second color or pattern ( e . g . green or solid ) after the set time interval has elapsed . there may also be an alarm ( e . g . an audio or vibratory alarm signal ) system ( designated 25 in fig2 ) connected to the timer to remind the patient that the set time interval has elapsed and the device is ready to deliver the medication again if needed . referring now to fig2 , a cross - sectional side view of a patient - controlled medication delivery system 28 which may be similar to the system 10 shown in fig1 includes a medication storage subsystem 30 ( described below ) coupled to a medication delivery subsystem 40 . the medication delivery subsystem 40 includes an activation timer 18 ′ which may be similar to the activation timer 18 described above in fig1 , an id verification system 20 ′ which may be similar to the verification system 20 described above in fig1 , connecting rods 42 and 44 , a piston assembly 46 and an activation switch 22 ′ which may be similar to the activation switch 22 described above in fig1 . when either of rods 42 or 44 is deployed such that the distal end of the rod ( 50 and 48 respectively ) engages the appropriate detent ( 52 and 54 ) in piston assembly 46 , the piston disposed within piston assembly 46 is prevented from moving toward the medication storage subsystem 30 , and the delivery of medication is prevented . on the other hand , when the time interval has elapsed timer 18 ′ will disengage rod 42 from piston assembly 46 . similarly , when a patient id has been verified , rod 44 will also disengage from piston assembly 46 . it is only when both rods 42 and 44 have disengaged the piston assembly 46 that piston may be activated by operation of activation switch 22 ′ to release a dosage of medication from medication storage subsystem 30 . while a particular embodiment of the locking mechanism for the piston has been described , it should be appreciated that other locking means could be used , such as an electrically activated lock or the like . also shown in this figure is a recorder 51 , which is part of the medication storage subsystem 30 . in one embodiment , the recorder 51 imprints the time on a sticker when the patient presses the activation switch 22 ′. this sticker may be removed and transferred to the patient chart to give the physician the exact timing and intervals of the medication uses . this will help physician to further adjust the medication accordingly such as increasing the dosage , decreasing the dosage or changing the time interval between dosages . referring now to fig3 , a medication storage subsystem 31 , which may be similar to the medication storage subsystem 3 o described above in fig2 , includes a medication container 32 in which medications 34 ( e . g . tablet , capsules , pills etc .) are disposed . in the exemplary embodiment of fig3 , the medications 34 are in a medication package 36 have a disk shape ( i . e . circular shape ). as shown in fig3 , the medication 34 is disposed around a perimeter of the package 36 . it should be appreciated that although the package 36 and container 32 are here shown having a round shape , those of ordinary skill in the art will appreciate of course that other shapes may also be used . those of skill in the art should also appreciate that the medication 34 may be arranged in a pattern and location other than a circular pattern along a perimeter of a medication container 32 or package 36 . an authorized person ( e . g ., a medical practitioner such as a physician a nurse or a pharmacist ) mounts the medication package 36 into the storage subsystem 30 . at the appropriate time , the storage subsystem 30 dispenses an appropriate dose of the medication 34 . within the subsystem 30 the circular medication package 36 rotates in a clock - wise direction each time a medication 34 ( e . g . a pill ) is pushed out from the package 36 . when the patient pushes the activation switch 22 a hollow cylindrical shaped part of the piston ( described in detail below in conjunction with fig4 ) cuts the portion of the medication package 36 which serves the medication 34 ( e . g . a pill ) in the package 36 . in some embodiments , the medication 34 is secured via a plastic or foil cover . a solid portion of the piston then pushes the medication 34 out of the medication storage subsystem 100 and into the delivery drawer . also shown is a sticker 38 . the sticker is used by the recorder ( described above ) to record the time the medication was delivered . referring now to fig4 in conjunction with fig2 , the medication delivery system comprises a drawer 24 or similar structure for the purpose of receiving the pill after the pill has been dispensed ( e . g ., by having been pushed by the piston ), making it available for the patient to pick - up . this drawer 24 is located at the lower end of the device 10 and extends across the bottom of the device . a patient has to pull the drawer 24 by a handle 26 located on the surface of the draw and is able to pick - up the pill . an example of a preferred embodiment of the piston assembly 46 is shown in detail in although it should be appreciated that other types of piston assemblies could be utilized . in this example embodiment piston 56 is a cylindrically shaped structure with two indentations or detents 52 and 54 for the locking mechanism . detent 52 receives the distal end of rod 48 which extends between the piston assembly 46 and the id verification system 20 . detent 54 receives the distal end of rod 42 which extends between the piston assembly 46 and the timer 18 ′ ( fig2 ). the piston assembly 46 comprises a cylindrical bar 58 disposed within a hollow structure 56 here shown having a tubular shape for example . the bar 58 may be solid in some embodiments . the tubular structure 56 is provided having a sharp circular edge 60 at a distal end . this tubular structure 56 is movable over a short distance and allows the solid cylinder 58 to slide forward within the tubular structure 56 . the sharp edge 60 of the tubular structure is used to make a cut ( in this case circular cut ) around the plastic or foil containing the pill in the medication delivery subsystem 30 . the solid bar 58 then pushes the pill out of the foil . after the piston assembly 46 is activated by a patient through the activation switch ( e . g . activation switch 22 ′ in fig2 ) and delivers the medication , the connector rods 42 and 44 will lock , and prevent any forward movement of the piston assembly 46 for the set time interval and thus no medication will be delivered during the set time interval . once the set time interval has elapsed , the connector rod 42 will release from piston assembly 46 . if the patient desires to have the medication after the set time interval has elapsed , he or she is able to activate the piston assembly 46 by pushing the activation switch 22 ′ to get the medication , assuming the patient identification has also been verified and rod 44 has released piston assembly 46 . while a particular embodiment has been described , it should be appreciated that other embodiments are also within the scope of the present invention . for example , the timer 18 and the connecting rod 42 is connected together via a spring ( may also be a magnetic system ) mechanism . when the prescribed time elapses , the connecting rod 42 will un - lock itself from the detent 54 and remain in that position until the patient pushes the activation switch ( e . g . activation switch 22 ′) to receive the medication . the activation switch pushed by the patient to receive the medication , also has several other functions , including 1 ) rotating the cartridge containing the pills , 2 ) recoding the time of medication delivery on the sticker 51 , 3 ) resetting the timer 18 , and 4 ) locking the system ( e . g . by placing the connecting rod 42 into the dent 54 ). the delivery system could also be similar to a sliding door allowing pill ( s ) to slide out of the pill - cartridge , which may in a vertical fashion under this design . a flow chart of the presently disclosed method is depicted in fig5 . the rectangular elements are herein denoted “ processing blocks ” and the diamond shaped elements are herein denoted “ decision blocks ”. it will be appreciated by those of ordinary skill in the art that unless otherwise indicated herein , the particular sequence of processing blocks and / or decision blocks described is illustrative only and can be varied without departing from the spirit of the invention . thus , unless otherwise stated the processing blocks and / or decision blocks described below are unordered meaning that , when possible , the processing blocks and / or decision blocks can be performed in any convenient or desirable order . referring now to fig5 , the process for providing patient - controlled medication delivery 100 starts and processing block 102 is executed . in processing block 102 an authorized person sets the time interval . the authorized person may be a physician or nurse ( according to physician instruction ). the time interval defines the time between medication deliveries . in processing block 104 the patient ( or other authorized person ) selects the time of the first dosage . this is done at a time determined by the patient , not at a predetermined time of day . thus , the patient has the freedom to determine the time to begin taking the medication . in processing block 106 the identity of the patient is verified . in one embodiment , the patient is required to enter a patient id number via a pin device . alternately , other patient verification means could be used , such as scanning a bar code from a patient wrist band , or a medication card having a bar code or magnetic strip thereon or a biometric verification system can be used . in processing block 108 the medication is provided to the patient at the patient - determined time of day . one feature of the present invention is that the patient has determined the time of day to start taking the medication . in processing block 110 the time interval between dosages of the medication is observed . this time interval is determined by a doctor or other authorized medical practitioner . while the patient determines the starting time to begin taking the medication , the doctor ( or other authorized medical practitioner ) determines the time interval between dosages of the medication . once the time interval has elapsed , in processing block 112 the patient identification is again verified . this done to assure that the proper patient will be receiving the medication . this step is preferably done in a similar manner as the verification of the patient that was conducted in processing block 106 described above . in processing block 114 the medication is delivered . the patient has the medication made available to him or her at the predetermined time interval and after the identification of the patient has been verified . in decision block 116 a determination is made whether the supply of medication has been exhausted . if the supply of medication has been exhausted , then the process ends otherwise blocks 110 et seq . are executed . having described preferred embodiments of the invention it will now become apparent to those of ordinary skill in the art that other embodiments incorporating these concepts may be used . accordingly , it is submitted that the invention should not be limited to the described embodiments but rather should be limited only by the spirit and scope of the appended claims . | 0 |
illustrated in fig1 is the basic scheme for practicing the invention . a fan 10 is suspended from the ceiling 12 or upper wall of a semi - enclosed area and directed somewhat downwardly and generally toward an area below to be cooled , such as an outdoor restaurant seating area generally denoted by 14 . the fan 10 may also be a freestanding fan . the fan 10 preferably oscillates to provide better moving air distribution over the area generally in front of the fan . mounted on open fan grillwork 16 or otherwise in the fan air stream are a plurality of very small nozzles 18 preferably having a venturi internal configuration for best atomization . the nozzles 18 are supplied with high pressure water through one sixteenth inch inside diameter tubing 20 . a small vibratory , rotary or piston pump 22 capable of generating 250 to 600 pounds per square inch ( psi ) of water pressure supplies the nozzles 18 . the nozzles 18 are selected with the pump 22 to provide very fine atomization from the combination . the water spray is preferably completely vaporized before it can strike any persons below . the result is a very pleasant cooling effect without the dampness associated with sprays that strike persons before completely evaporating . for example , the water droplets are sprayed through nozzles 18 of 0 . 008 to 0 . 072 inches orifice diameter at 250 to 600 psi . the resulting droplet sizes average about 10 – 25 microns , resulting in evaporation of the droplets in a fraction of a second after ejection from the nozzle . the heat of evaporation is extracted from the air almost instantly , resulting in a very effective cooling of the air without any mechanical refrigeration cycle . water pressures to 1000 psi have been found effective to properly atomize the water ejected from the nozzles . water is fed to the pump 22 through a filter 24 from a reservoir or water line 26 . electrically connected and physically attached to the pump 22 is a controller 28 for setting the percentage of time or cycle for the pump . for example , the pump controller might be set for 7 . 5 seconds on and 7 . 5 seconds off and indefinitely cycle for these time periods . the time periods may be equal or unequal , however , for cyclic operation that preserves proper operation of the pump there are minimum times on and off that can be set . these limits have been set at 1 . 9 seconds on ( 2 % on ) and 1 . 9 seconds off ( 98 % on ). separate settings provide 100 % on and full off for the pump . fig2 illustrates a multiple fan installation for a large venue . the fans 30 may be mounted on the ceiling 32 or walls or columns of a pavilion for example . each fan 30 is equipped with a plurality of nozzles 34 positioned to direct a spray of water droplets into the moving air produced by the fan propellers . the fans 30 are electrically connected 36 to a central controller 38 whereby the fans 30 can be individually controlled , controlled in blocks or controlled as a whole . the nozzles 34 are supplied through one - sixteenth inch diameter tubing 40 to the individual fans 30 and as required larger tubing to small solenoid valves 42 which control the flow of water to the nozzles on each fan . the small solenoid valves 42 are electrically connected to a second controller 44 whereby the nozzles for each fan can be cycled on and off as required . the two controllers 38 and 44 are coordinated 46 to provide water flow only when the corresponding fan is operating . a single pump 48 supplies the nozzles 34 . as many as 50 nozzles 34 can be supplied simultaneously by one or more small electromagnetic pumps or by larger pumps . despite the high water pressures ( up to 1000 psi ) very light weight small diameter plastic tubing can be used along with corresponding small brass fittings . complicated high or standard ( 110 v ) voltage electrical systems can also be avoided since the solenoidal valves 42 can be 12 or 24 volt valves . illustrated in fig3 is the schematic of a cycle controller where the fan is on continuously and illustrated in fig4 is the associated dual high pressure pump . in this example the relay timer or controller 50 includes a master switch 52 with a dial knob ( not shown ) that can be turned to select the cycle time for the controller or turn the controller completely off . also included is an ac receptacle 54 directly connected to the line cord and into which the fan motor may be plugged . the controller 50 is connected to the dual pumps 56 and 58 by power lines 60 and 62 . referring to fig4 the pumps 56 and 58 are connected hydraulically in series by the water conduit 64 from the output of pump 56 to the input of pump 58 . the pumps 56 and 58 are electrically connected in parallel 60 , however , the electrical circuit is in series 68 through overheat protection 66 such as a thermo - couple on pump 56 . the entire controller 50 , pumps 56 and 58 and switch 52 are contained within a plastic enclosure about five inches on a side and three inches in depth . depending on the length of one - sixteenth inches high pressure tubing this particular pump can provide sufficient water to four nozzles on one fan at a minimum or considerably more nozzles or additional fans . for example , 25 to 50 or more nozzles can be suppled with this particular pump and controller described above . through testing and experience and depending on prevailing wind conditions each nozzle is effective at cooling 100 square feet of venue . with the large number of nozzles that can be supplied by the above pump and controller which draws about 46 watts of electric power , a very large venue can be cooled at the equivalent electric cost of a small incandescent light bulb . most important , the cooling is effective at high humidity ( above 85 %) with high temperature ( above 90 degrees f .). by purposefully cycling the apparatus , cooling can be effected without increasing the level of humidity sensible to individuals within the cooled venue . | 5 |
it is understood that the present invention is not limited to the particular methods and components , etc ., described herein , as these may vary . it is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only , and is not intended to limit the scope of the present invention . it must be noted that as used herein and in the appended claims , the singular forms “ a ,” “ an ,” and “ the ” include the plural reference unless the context clearly dictates otherwise . thus , for example , a reference to a “ protein ” is a reference to one or more proteins , and includes equivalents thereof known to those skilled in the art and so forth . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . specific methods , devices , and materials are described , although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention . all publications cited , herein are hereby incorporated by reference including all journal articles , books , manuals , published patent applications , and issued patents . in addition , the meaning of certain terms and phrases employed in the specification , examples , and appended claims are provided . the definitions are not meant to be limiting in nature and serve to provide a clearer understanding of certain aspects of the present invention . the term “ fusion ” or “ hybrid ” protein , dma molecule , or gene refers to a chimera of at least two covalently bonded polypeptides or dna molecules the term , “ nucleic acid ” or “ polynucleotide ” refers to a polymeric form of nucleotides of any length , either ribonucleotides and / or deoxyribonucleotides . these terms include a single -, double - or triple - stranded dna , genomic dna , cdna , rna , dna - rna hybrid , or a polymer comprising purine and pyrimidine bases , or other natural , chemically , biochemically modified , non - natural or derivatized nucleotide bases . the backbone of the nucleic acid can comprise sugars and phosphate groups ( as may typically be found in rna or dna ), or modified , or substituted sugar or phosphate groups . alternatively , the backbone of the nucleic acid can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be an oligodeoxynucleoside phosphoramidate ( p — nh 2 ) or a mixed phosphoramidate - phosphodiester oligomer . in addition , a double - stranded nucleic acid can be obtained from the single stranded nucleic acid product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions , or by synthesizing the complementary strand de novo using a dna polymerase with an appropriate primer . the following are non - limiting examples of nucleic acids : a gene or gene fragment , exons , introns , mrna , trna , rrna , ribozymes , cdna , recombinant nucleic acids , branched nucleic acids , plasmids , vectors , isolated dna of any sequence , isolated rna of any sequence , nucleic acid probes , and primers . a nucleic acid may comprise modified nucleotides , such as methylated nucleotides and nucleotide analogs , uracyl , other sugars and linking groups such as fluororibose and thioate , and nucleotide branches . the sequence of nucleotides may be interrupted by non - nucleotide components . a nucleic acid may be further modified after polymerization , such as by conjugation with a labeling component . other types of modifications included in this definition are caps , substitution of one or more of the naturally occurring nucleotides with an analog , and introduction , of means for attaching the nucleic acid to proteins , metal ions , labeling components , other nucleic acids , or a solid support . as used herein , the term “ operably linked ” means that nucleic acid sequences or proteins are operably linked when placed into a functional relationship with another nucleic acid sequence or protein . for example , a promoter sequence is operably linked to a coding sequence if the promoter promotes transcription of the coding sequence . as a further example , a repressor protein and a nucleic acid sequence are operably linked if the repressor protein binds to the nucleic acid sequence . additionally , a protein may be operably linked to a first and a second nucleic acid sequence if the protein binds to the first nucleic acid sequence and so influences transcription of the second , separate nucleic acid sequence . generally , “ operably linked ” means that the dna sequences being linked are contiguous , although they need not be , and that a gene and a regulatory sequence or sequences ( e . g ., a promoter ) are connected in such a way as to permit gene expression when the appropriate molecules ( e . g ., transcriptional activator proteins — transcription factors — or proteins which include transcriptional activator domains ) are bound to the regulatory sequence or sequences . the term “ plasmid ” refers to an extrachromosomal circular dna capable of autonomous replication in a given cell . in certain embodiments , the plasmid is designed for amplification and expression in bacteria . plasmids can be engineered by standard molecular biology techniques . see sambrook et al . laboratory manual , cold spring harbor laboratory press , cold spring harbor ( 1989 ), n . y . the term “ expression vector ” is used interchangeably herein with the term “ plasmid ” and refers to a recombinant dna molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for expression of the operably linked coding sequence ( e . g . an insert sequence that codes for a product ) in a particular host cell . nucleic acid sequences necessary for expression in prokaryotes usually include a promoter , an operator ( optional ), and a ribosome binding site , often along with other sequences . the term “ promoter ” refers to the dna region , usually upstream of the coding sequence of a gene or operon , which binds rna polymerase and directs the enzyme to the correct transcriptional start she . some embodiments of the present invention contemplate the use of promoters which contain at least one operator associated with a promoter sequence . the operator is positioned such that the binding of a repressor to the operator represses transcription from the promoter . operators are well known in the art and include , for example , the tryptophan operator of the tryptophan operon of e . coli . the tryptophan repressor , when bound to two molecules of tryptophan , binds to the e . coli tryptophan operator and , when suitably positioned ( i . e ., operatively linked ) with respect to the promoter , blocks transcription . thus , in particular embodiments , the terms “ trp promoter ” and “ trp promoter - operator ” can be used interchangeably to refer to a regulatory sequence comprising a trp promoter and a trp operator . additional examples of operators which can be used with the invention include the lac operator and the operator of the molybdate transport operator / promoter system of e . coli . other operators can include , but are not limited to , the xylose operator (“ xylo ”), the tetracycline operator (“ teto ”), the maltose operator (“ malo ”), and the lambda cl operator (“ λclo ”). these operators can be induced by the following inducers , respectively : xylose or analog thereof , tetracycline or analog thereof , maltose or analog thereof , lactose or analog thereof , tryptophan or analog thereof and temperature . the terms “ restriction endonuclease ” and “ restriction , enzyme ” refer to enzymes ( e . g . bacterial enzymes ), each of which cut double - stranded dna at or near a specific nucleotide sequence ( a cognate restriction site ). examples include , but are not limited to , bamhi , ecorv , hindiii , hincii , ncoi , sali , and noti . the term “ restriction ” means cleavage of dna by a restriction enzyme at its cognate restriction site . the term “ restriction site ” refers to a particular dna sequence recognized by its cognate restriction endonuclease . as used herein , the term “ rop gene ” refers to a gene encoding the repressor of primer protein , which regulates plasmid dna replication by modulating the initiation of transcription . rop is a 7 . 2 - kda , 63 amino acid plasmid - encoded protein , which acts in concert with rna 1 to negatively regulate copy number in some cole1 and cole1 - like plasmids . in certain embodiments , the term “ rop gene ” refers to a nucleic acid sequence that encodes the amino acid sequence of seq id no : 12 . in other embodiments , the term “ rop gene ” includes nucleic acid sequences that encodes a rop polypeptide having at least about 90 %, at least about 91 %, at bast about 92 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 % or more sequence identity to seq id no : 12 . as used herein , a “ selectable marker ” refers to a phenotypic trait conferred on transformed cells that protects them from a selective agent in their environment , i . e ., the growth media . examples of selectable markers include , but are not limited to , antibiotic resistance markers ( e . g ., genes encoding resistance to kanamycin , ampicillin , chloramphenicol , gentamycin , or tetracycline ) and metabolic markers ( e . g ., amino acid synthesis genes or transfer rna genes ). as used herein , the term “ vector ” refers to a nucleic acid construct designed for transduction / transfection of one or more cell types . vectors may be , for example , “ cloning vectors ” which are designed for isolation , propagation and replication of inserted nucleotides , “ expression vectors ” which are designed for expression of a nucleotide sequence in a host cell . the term “ replication ” means duplication of a vector . the expression plasmid described , herein produces fusion proteins at yields of greater than about 300 μg / ml of culture whether cultivated on milliliter or liter scales . these yields were realized without the need of chemical inducers , culture modifications , or temperature shifts during growth . culture growth could be initiated with the inoculum being a single colony , overnight culture , or glycerol stock culture . the system is applicable to high - throughput processing as well as large scale production . this system is successful at producing high protein yields because of the combination of high culture densities at laboratory scale production , and high cellular protein concentrations due to proteins accumulating as ibs . because ibs are quite resistant to degradation , they can accumulate during prolonged incubation after initiation of protein synthesis . many expression systems produce ibs , or a mixture of ibs and soluble protein , and methods have been published to differentiate these species using high - throughput processing . however , the problem with ibs is not the serious issue it was a decade ago . numerous methods have been developed for the denaturation and refolding of ibs into functional proteins on a laboratory as well as industrial scale . in the area of high - throughput analysis of expression , the formation of ibs are looked upon as an advantage in this system , because their formation is responsible for the greater than 95 % success rate described herein . also , the early stages of expression analysis require solubilization and denaturation of proteins prior to sds - page analysis and western blotting , so the insolubility status of the target protein is irrelevant , at least initially . to compare the expression plasmid of the present invention with other systems , the present inventors relied heavily upon the work conducted by the institute of proteomics , harvard medical school and other institutions , who have tested and compared a number of commercial vectors in their ability to produce recombinant proteins from orf libraries that could be analyzed in large numbers using robotic , high - throughput processing . see hu et al , 17 g enome r es . 536 - 43 ( 2007 ); aguiar et al . 14 g enome r es . 2076 - 82 ( 2004 ); marsischky and labaer , 14 g enome r es . 2020 - 28 ( 2004 ); murthy et al ., 36 p rotein e xpr . p urif . 217 - 225 ( 2004 ); braun et al , 99 p roc n alt . a cad . s ci . u . s . a . 2654 - 59 ( 2001 ); and büssow et al , 65 g enomics 1 - 8 ( 2000 ). the processing methodology was the same in all cases . colonies were robotically picked and grown in 96 well plates overnight followed by inoculation and growth in fresh medium , ( usually 1 ml ). the cultures were monitored , and a chemical inducer was added ( usually iptg ) at an appropriate culture density . after induction growth of several hours , cells were harvested and stored , or the target proteins were purified by high - throughput processing using the appropriate purification matrix . purification of proteins was usually required because insufficient amount of protein were produced to be unambiguously identified on protein gels except when total proteins were applied to gels followed by western blot analysis . after induction growth , the success rate at seeing novel bands was in the range of about 60 to about 85 % with the various systems alter applying total proteins to gels from 5 to 10 μl of culture followed by western blot analysis . affinity purified samples were analyzed by sds - page using about 50 to about 150 μl of culture . the fusion protein yields ranged from about 0 . 3 to more than about 1 μg per well . plasmid yields were not given for the various systems , but in general most expression systems are engineered to keep plasmids levels low so that they do not titrate the repressors that control transcript ion . rather than suppressing plasmid levels , the present inventors used runaway plasmid replication to automatically induce transcription at 37 ° c . dining late growth phase after culture densities have reached levels approaching about 20 od 600 in a few cases . thermal induction is not new , but it is usually done at temperatures between 40 and 45 ° c . ; temperatures not very optimum for growth and health of the host bacteria . after induction growth in 96 well plates using 150 μl of media , novel hands were easily observed using 0 . 5 to 1 . 5 μl of culture without fusion protein purification or western blots . the protein yields per well ranged from about 15 to about 70 μg compared to the other systems that produced , levels of 0 . 3 to 1 μg per well using 6 - fold more culture volume . plasmid dna levels averaged about 1 . 3 μg per well providing sufficient dna for restriction digests . larger induced culture volumes ( 1 ml ) could provide sufficient , plasmid yields for sequencing . larger scale inductions of 1 to 2 liters produced yields per volume comparable to smaller inductions . in the case of cells harboring prop 63 sp1 156 . a 1 . 5 liter preparation produced about 800 mg of column pure ropsp1 - fusion ( 533 mg / l ) or about 530 mg of target sp1 protein ( 353 mg / l ) using a standard laboratory shaker . this sort of yield falls within the range of some protein yields produced by commercial vectors that rely upon high density fermentation that produce culture densities of 50 - 80 od 600 units . see achmüller et al ., 4 n at . m ethods 1 . 037 - 43 ( 2007 ); sharma et al ., 125 j . b iotechnol , 48 - 56 ( 2006 ); and terpe et al , 72 a ppl . m icrobiol . b iotechnol , 211 - 22 ( 2006 ). in conclusion , the expression system of the present invention can be used to produce fusion proteins at high yields on a large or small scale and is very suitable for use in high - throughput expression analysis , because it bypasses several of the steps required using other commercial vectors . the vector could be easily converted to a destination vector using , for example , gateway technology ( invitrogen ) for non - ligation recombination cloning of available orf libraries that have been cloned into gateway entry vectors . the combination of high yields of target proteins , efficient purification and protease cleavage capabilities , ease of use , and low cost when used in high - throughput or larger scale protein production make this vector an attractive alternative to the arsenal of vectors currently used in functional proteomic research . without further elaboration , it is believed that one skilled in the art , using the preceding description , can utilize the present invention to the fullest extent . the following examples are illustrative only , and not limiting of the remainder of the disclosure in any way whatsoever . the following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds , compositions , articles , devices , and / or methods described and claimed herein are made and evaluated , and are intended to be purely illustrative and are not intended to limit the scope of what the inventors regard as their invention . efforts have been made to ensure accuracy with respect to numbers ( e . g ., amounts , temperature , etc .) but some errors and deviations should be accounted for herein . unless indicated otherwise , parts are parts by weight , temperature is in degrees celsius or is at ambient temperature , and pressure is at or near atmospheric . there are numerous variations and combinations of reaction conditions , e . g ., component concentrations , desired solvents , solvent mixtures , temperatures , pressures and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described process . only reasonable and routine experimentation will be required to optimize such process conditions . construction of expression vector ppgtrprop 63 . this vector was derived from the vector ppgtrpropap whose construction has been described in detail ( giza and huang 1989 ). the single ecorv site located down - stream from the trp promoter was eliminated by digestion of the plasmid with ecorv followed by transformation and plasmid extraction of the transformation culture . the digestion was repeated and transformed cells were plated for colonies . colonies were screened for plasmids that lacked the ecorv site . additional modifications were made as described in fig1 . construction of library expression vectors ppgtrprop 63 bamhi a , b , c . the vector ppgtrprop 63 carries a single bamhi site downstream from the trp promoter . this site was eliminated by digestion of the plasmid with bamhi , filling - in the ends , religating , transforming , and screening colonies lacking a bamhi site . the resultant plasmid was digested with pvuii and modified by the insertion of the 115 bp sequence shown in fig1 . the original pvuii site in the rop coding sequence was eliminated resulting in codon changes for ser 51 ( agc to agt ) and cys 52 ( tgc to tgt ). construction of 8 rop gene fusion plasmids . all of these constructs were made in the vector ppgtrprop 63 . the subscripts following the gene designation indicate the number of amino acids in the target protein . the hiv - 1 integrase ( in ) gene was excised from the plasmid pinsd . his . sol ( jenkins et al . 1996 ) by digestion with ndei + bamhi , filled - in , and ligated to the vector at the ecorv site to produce prop 63 in 288 . the plasmid pegfp - n3 ( bd bioscience clonetech ) was digested with ncoi + xbai and the fragment carrying the entire green fluorescent protein gene ( gfp ) was filled - in and ligated at the ecorv site to produce prop 63 gfp 239 . the plasmid sp1 - 167c ( sjøttem et al . 1997 ) was digested with sau3ai , filled - in , and a 469 bp fragment was ligated to the vector at the smai site . the fragment spans the entire 3 zinc - finger domains of sp1 plus an additional 68 amino acids down - stream to produce prop 63 sp1 156 . the plasmid survivin pcdna3 . 1 - myc - his ( chang et al . 2004 ) was used as the template with the primers 5 ′ catcccgggatgggagctccggcgctgccc ( seq id no : 10 ) and 5 ′ taccccgggttaggcagccagctgctcaattga ( seq id no : 11 ) to generate a pgr product that encoded the entire murine survivin gene ( surv ) with xmai restriction site termini . the fragment was ligated at the xmai site to produce prop 63 surv 140 . a 277 bp pgr generated fragment with bamhi ends ( kindly provided by molecular therapeutics inc . west haven , conn .) was filled - in and ligated at the smai site . the fragment carries the coding region for 88 amino acids of the n - terminal domain of icam - 1 ( stanton et al . 1988 ) to produce prop 63 icam 88 . the hiv - 1 envelope gene , strain bh10 ( mudrow et al 1987 ), was digested with styi and a 268 bp fragment was filled - in and ligated at the smai site . the fragment encodes 90 amino acids of residues 520 to 609 ( chan et al 1997 ) and was designated prop 63 gp41 90 . the entire hiv - 1 tat gene was removed from the plasmid prop - tat ( giza and huang 1989 ) by digestion with pvuii and ligated at the ecorv site to produce prop 63 tat 86 . a dna restriction fragment carrying the entire chinese hamster metallothiomm gene ( mt ) with clai linkers ( giza and huang 1989 ) was ligated to the vector at the pvuii site to produce prop 63 mt 61 . construction of test expression library . high molecular weight e . coli dna was digested with sau3ai and fragments were separated on 1 % agarose gels . fragment sizes from 100 - 400 bp and 300 - 600 bp were excised from the gels and purified using qiaex ii gel extraction kit ( qiagen science ). vectors ppgtrprop 63 bamhi a , b , and c were digested with bamhi , phosphatased , and purified on agarose gels to eliminate any circular plasmid and non - vector dna from contaminating the ligation reactions . ligations were performed using 150 ng of each vector and 1 , 2 , and 3 molar excess of the fragments in 20 μl reaction volumes incubated at 16 ° c . for 18 hours . transformation and cultivation of fusion clones under non - induced conditions . the host hb101 was used in all experiments . bacteria were grown in lb medium ( sambrook et al . 1989 ) at 37 ° c . to an od 600 of about 0 . 8 , centrifuged and made competent by incubation on ice in 100 mm cacl 2 . dna was added and cells were incubated on ice for 1 hour followed by a heat shock at 45 ° c . for 45 seconds . the cells were diluted 10 - fold with lb broth and incubated for 1 hour at 37 ° c . a portion of the culture was spread on lb plates to determine the number of transformants , and the remainder was diluted 100 - fold in lb broth and allowed to grow to saturation at room temperature . cultivation of fusion clones under induced conditions in liquid media . terrific broth ( tb ) ( sambrook et at ), supplemented with 200 μg / ml ampicillin ( ap ) was used in all induction experiments . media was inoculated with single colonies , frozen glycerol stocks , fresh overnight room temperature cultures , or in some cases transformation reactions . best results were usually obtained with fresh stock cultures because incubation times could be more accurately determined and culture densities were generally higher . all cultures were induced at 37 ° c . in some cases higher yields were obtained at growth temperatures between 30 and 37 ° c . induction of expression library . competent cells were incubated with , ligation reactions , heat shocked , diluted 10 - fold , and incubated at 30 ° c . for 1 hour . cells were plated for single colonies and incubated at room temperature for 36 hours . cells were washed from some of the plates with lb medium and a portion of the suspension was replated on tb agar and incubated at 30 ° c . for 18 hours followed by incubation at 37 ° c . for 10 hours or until average size colonies developed . a portion of the room temperature plate suspension was diluted in lb medium and grown at room temperature , and another portion diluted in tb and grown at 37 ° c . both cultures were grown to saturation and served as the non - induced and induced liquid cultures . cells from the room temperature and 37 ° c . plates were washed from the plates with 100 mm nacl , washed with water , and portions dissolved in sample buffer prior to sds - page . these samples served as the non - induced and induced plate colonies . portions of all sample pellets were frozen for later processing . falcon 96 well flat bottom plates ( 0 . 37 nil maximum volume ) were used for small volume single colony inductions . tb ( 150 μl ) was inoculated with single room temperature colonies and grown a 37 ° c . with shaking for 18 hours . from 1 to 1 . 5 μl of culture from each well was mixed , with an equal volume of 2 × laemmli loading buffer , heated for 5 minutes in boiling water , and applied to 14 % laemmli gels . the rest of the culture was used to isolate plasmid dna . purification and thrombin digestion of fusion proteins . frozen cell pellets were thawed and dissolved in 6m guhcl , 500 mm nacl , 20 mm na phosphate ( ph 7 . 4 ), 2 mm 2 - mercaptoethanol . pellets from large scale inductions were first lysed ( giza and huang 1989 ) and ibs isolated before dissolving in sample buffer . after centrifugation to remove particulate matter , the protein solutions were made to 10 mm imidazole and applied to a hitrap chelating hp column ( amersham pharmacia biotech ) equilibrated with sample buffer . the column was washed with 10 volumes of 6 m urea , 20 mm tris hq ( ph 7 . 4 ), 500 mm nacl , 2 mm 2 - mercaptoethanol , 20 mm imidazole and bound proteins were eluted with the same buffer supplemented with 500 mm imidazole . eluted proteins solutions were made to 50 mm 2 - mercaptoethanol , 0 . 1 % sarkosyl , incubated at 37 ° c . for 30 minutes and dialyzed against 2m urea , 20 mm tris - hcl ( ph 7 . 8 ), 50 mm nacl , 1 mm 2 - mercaptoethanol , 0 . 1 % sarkosyl . proteins were digested with thrombin for 5 hours at room temperature using 1 nih unit per mg of protein . the small rop moiety could be removed from the digest by passing the sample through the column after removal of the imidazole by dialysis . the plasmid ppgtrprop 63 was derived from the expression plasmid ppgtrpropap ( giza and huang 1989 ). ppgtrpropap was used to produce a number of proteins by the ligation of dma sequences at the single pvuii site located in the 63 amino acid rop coding sequence . interruption of the rop gene lead to the production of a fusion protein that was unable to control plasmid replication which resulted in cell lysis due to runaway plasmid replication . this lethal phenotype was suppressed by supplying functional rop protein synthesized on a similar plasmid that co - existed in the cell . upon loss of the helper plasmid , runaway plasmid replication occurred , followed by repressor titration of the trp promoter and induction of rop fusion protein synthesis . the need for the trans - helper plasmid was eliminated by ligating sequences at the 3 ′ end of the 63 amino acid coding sequence as shown in fig1 . the 11 . 5 bp sequence ligated at the pvuii site of ppgtrpropap encodes the terminal 1 . 2 amino acids of rop , eliminates the original pvuii site in the rop gene while maintaining the correct amino acid sequence . the ligated sequence also encodes 6 histidine amino acids for protein purification , a thrombin protease cleavage sequence ( leuvalproarg / glyleu ) ( seq id no : 9 ), restriction cloning sites in 3 reading frames , and stop codons in 3 reading frames . no sequences were eliminated from the original vector . cells harboring ppgtrprop 63 have a normal plasmid copy number when cultivated at room temperature ( 25 ° c .) and produce no novel protein bands when analyzed by sds - page . media inoculated with frozen glycerol stocks , fresh overnight mom temperature cultures , or freshly transformed cells , followed by incubation at 37 ° c . for 18 to 24 hours produced a soluble protein at levels of 250 μg / ml of culture and plasmid dna levels of 20 - 30 μg / ml this protein consists of 63 amino acids of native rop fused to 23 amino acids contributed by the remainder of the inserted dna sequence to yield a protein of 10 . 0 kda . eight fusion plasmids were constructed by ligating defined dna sequences at the appropriate restriction site in the vector to produce gene fusions in the correct reading frames . five of the constructs produced full - sized proteins : hiv - 1 integrase ( in ), green fluorescent protein ( gfp ), murine survivin ( surv ), hiv - 1 tat and hamster metallothionein ( mt ). smaller functional domains of 3 large proteins were produced : transcription factor sp1 zinc finger domain , intercellular adhesion molecule - 1 , domain 1 ( icam ), and a portion of hiv - 1 gp41 envelope protein spanning the 4 - 3 hydrophobic repeat region . in addition to these constructs high yielding rop fusions to the 72 amino acid “ histone four helix bundle ” of 2 thermophilic organisms were also produced , as we all as a construct consisting of multiple repeats of the 10 amino acid repeat motif of abductin , a compressible elastomeric protein found in the hinge ligament of bivalve mollusks . growth at room temperature in lb medium resulted in little or no observable accumulation of novel protein bands when samples were analyzed by sds - page as shown in fig2 a . even though the rop protein is truncated in these structures , it is capable of controlling plasmid copy number at lower temperatures . the low copy number insures that the trp repressor proteins are not titrated by the trp promoter - operator sequences carried on the expression plasmids . since sufficient copies of repressor are present in the cells , transcription is blocked on the expression plasmids and no fusion proteins are produced . cultivation of bacteria at temperatures above 3 ° c . leads to loss of the ability to control plasmid replication : plasmid dna accumulates to levels that greatly outnumber trp repressor molecules , and protein synthesis is automatically initiated . fig2 b shows the results when 20 ml of terrific broth ( tb ) was inoculated with approximately 2 μl of frozen glycerol stocks and incubated , with shaking at 3 ° c . for 24 hours . no chemical inducers were added , and the culture temperature was not changed after inoculation . all lanes shown in fig2 a and 2 b show total bacterial proteins from 2 . 0 × 10 7 cells . the average od 600 of the induced cultures was 7 . 1 and the average amount of culture volume applied to gels was 12 μl . the amounts of fusion protein , produced by the 8 constructs shown in fig2 b were determined by making dilutions of the total bacterial proteins and comparing the bands to dilutions of a bsa standards run on the same gel . the average accumulation of fusions was 175 μg / ml with the highest being 460 and 330 μg / ml for icam and gfp respectively , and the lowest being 37 and 52 μg / ml for in and tat . even though high yields were produced using glycerol stocks as the inoculum , higher yields were realized when fresh room temperature cultures were used . fig2 c shows the results when a 500 - fold dilution was made in the same medium and cultivated under the same conditions . to test the efficiency of the polyhistidine sequence at purifying the proteins , portions of the cultures were applied to a nickel affinity column , washed thoroughly , eluted from the column and assayed for protein yield . the average od 600 was 11 . 4 , and the average amount of protein eluted from the column was 340 μg when the proteins from 1 ml of induced cultures were applied to the column . the highest yielding construct was gfp at 1 , 300 μg because of an od 600 of 18 . 7 . the lowest yielding construct was mt at 71 μg . larger scale inductions produced yields per ml of culture at the same levels as the smaller volume inductions . a glycerol stock : of prop 63 sp1 156 was used to inoculate 1 . 5 liters of tb . after an overnight incubation at 37 ° c . ( od 600 of 12 . 5 ), the cells were harvested and inclusion bodies ( ibs ) were isolated , washed extensively , and dissolved in guanidine - hcl ( guhcl ). the yield of ibs before column , purification was 1 . 06 grams and 0 . 8 grams after purification . the total proteins shown in the 9 lanes of fig2 b are total proteins from 9 to 24 μl of culture ( average of 12 μl ) and an average yield of 175 ng / μl . since the fusion proteins could be easily distinguished from the host genomic proteins using less than 1 μl of culture , the feasibility of using this vector for high - throughput expression , library analysis was explored . the 3 blunt - end cloning sites in ppgtrprop 63 was modified by inserting a bamhi site where dna sequences could be inserted in 3 reading frames as shown in fig1 . the modified vector retained the 3 stop codons as well as the kpni and pvuii sites that could be used for future modifications . the initial test of the system was to determine if the 8 proteins shown in fig2 b could be cultivated under induced conditions , in very small volumes , inoculated with a single colony . additionally , whether a few microliters of induced cultures show the fusion proteins without ambiguity on standard protein gels was also tested . fig3 a shows the results when 150 μl of tb in a 96 well plate ( 0 . 37 ml maximum volume wells ) was inoculated with single colonies and incubated with shaking at 37 ° c . for 18 hours . the proteins shown in each lane were from 1 . 5 μl of culture that was mixed with 1 . 5 μl of 2 × protein sample buffer . the mixture was boiled for 5 minutes , not centrifuged , and applied to the gel . most of the fusion proteins are quite obvious except for in and tat in lanes 1 and 6 respectively . these initial results led the present inventors to explore the other important factor in determining the suitability of this plasmid for library construction . the present inventors wanted to determine the percentage of constructs that resulted in obvious bands on gels when random dna fragments were ligated to the 3 reading frame vectors . the host bacteria hb101 was digested with the restriction enzyme sau3ai and dna fragments from 100 to 400 bp were isolated from agarose gels . ligations and transformations yielded about 5000 colonies from each vector when grown on 25 × 25 cm plates . colonies were inoculated as before and 50 wells of each reading frame vector were analyzed on protein gels . strong , obvious bands were observed in 96 % of the samples with molecular weights in the range consistent with the size of the ligated fragments . the ligations were repeated with dna fragments ranging from 300 to 600 bp and analyzed 25 inductions of each vector . fig3 b shows typical results when 1 . 5 μl of culture ( vector a ) was applied to sds gels . the average size of the dna inserts was 500 bp and all randomly picked samples in fig3 b had inserts . to analyze the total population of proteins produced , cells were stripped from plates and grown in bulk at room temperature followed by induction growth ( 500 - fold dilution ) at 37 ° c . for 24 hours . to analyze single colony protein inductions , room temperature bulk cultures were plated on rich agar , and incubated at room temperature . one set of plates was kept at room temperature as a non - induced control , and the other set was incubated at 37 ° c . for 18 hours . colonies (˜ 1500 ) were stripped from plates and dissolved in buffer containing 6 m guhcl . portions of liquid cultures were centrifuged and dissolved in the same buffer . these samples were applied to a nickel affinity column to determine the amount and size range of the fusion proteins . the results of the liquid and plate inductions are shown in fig3 c . all lanes contain proteins from 1 . 5 × 10 7 cells except lanes 6 , 7 , and plate lane 4 , which contain 6 . 0 × 10 7 cells . lane v shows total proteins from cells harboring the expression vector without insert , grown under induced conditions ( 37 ° c .). this protein often migrates as a doublet . analysis of the column purified room temperature ( non - induced ) samples in lanes 2 ( liquid and plate ) show a trace of bound proteins indicating that growth in culture or on plates produced no significant protein accumulation whereas growth under induced conditions ( 37 ° c .) in lanes 5 , 6 , and plate lane 4 show very obvious protein bands ranging in size from 10 to 30 kda . this is the molecular weight range expected for the size of the dna fragments ligated to the vector and fusion protein synthesis terminated by stop codons carried on the fragments or terminated by stop codons supplied by the vector . after thrombin digestion of the proteins shown in lanes 6 , we see a shift in molecular weight ( lane 7 ) consistent with the loss of mass contributed by the rop moiety . protein analysis of the column eluates yielded values 350 μg / ml of induced culture and 880 μg from the stripped plate . on a per cell basis the induce culture yield was approximately 8 - fold greater than the induced plate yield . protein analysis of the room temperature plate and culture column eluates showed barely detectable levels of protein ( lanes 2 ). this expression plasmid not only produces high levels of protein but also generates high levels of plasmid dna , ranging from about 0 . 25 to about 5 μg per microliter plate well ( average of 1 . 5 μg ). these amounts of dna were sufficient to determine insert size as well as providing enough plasmid for several restriction digests . because the protein size could be quickly correlated with the size of the dna insert , the present inventors were able to obtain some information about the pool , of fusion proteins . about 60 % of the proteins produced by the shot - gun ligations were terminated by stop codons on the ligated dna fragments , while the remainder were terminated by stop codons supplied by the vector . | 2 |
as disclosed herein , improvements in the efficiency of a solar cell can be obtained by forming an outer nanodiamond coating on a top surface of the solar cell , by incorporating an inner nanodiamond coating into the solar on top of the photovoltaic material , or by a combination of the two coatings . the nanodiamond particles are preferably of a round or irregular shape having an average diameter of less than or equal to about 0 . 1 micron ( 100 nanometers ). most of the particles preferably have a size between about 1 nm and about 10 nm , and are more preferably between about 5 nm and about 7 nm . the nanodiamond particles can be formed by a process as disclosed in u . s . pat . no . 5 , 861 , 349 or u . s . pat . no . 5 , 916 , 955 , each of which is incorporated by reference herein in its entirety . the nanodiamond particles each include a mechanically stable , chemically inert core and a chemically active surface . by functionalizing the nanodiamond particle , surface with targeted species , the nanodiamond can be provided with specified chemical , physical , and electronic properties . functionalization can be done by various chemical , photochemical , and electrochemical methods to graft different organic functionalities onto the nanodiamond . depending on the desired physical property and application of the nanodiamond , functionalized nanodiamond materials can be fluorinated , chlorinated , carboxylated , aminated , hydroxylated , and sulfonated . in the testing described herein , aminated nanodiamond particles were used , but any of the other types of functionalized nanodiamonds could alternatively be used . fig2 shows an exemplary process of making a solar cell having an outer nanodiamond coating . in particular , after a solar cell has been manufactured according to a conventional process ( e . g ., as in fig1 ), an outer coating is formed on the top surface of the solar cell . the outer nanodiamond coating is formed from a mixture of nanodiamond particles and a binder or matrix material that is capable of creating a substantially uniform distribution of nanodiamond particles , such as a liquid polymer that can be spread in a thin layer and dried . the coating of nanodiamond particles suspended in the matrix material may be applied to the top surface of the solar cell by various methods . a manual blade method has been used to obtain a substantially uniform coating , by first applying the suspension to the top surface of the solar cell and then drawing a blade across the suspension to form the suspension to a desired thickness . other techniques may also be used to obtain a uniform coating , including but not limited to screen printing of the suspension and dip - coating of the suspension . in some cases , and in particular for coating an amorphous si substrate , spray coating may be used . regardless the method of application , the suspension is then dried to a film coating by allowing or encouraging the evaporation of volatile components in the suspension , such as solvents in a pvdf resin . in several embodiments , polyvinylidine fluoride ( pvdf ) resin sold under the brand name kynara ® by arkema , inc . was used as the polymer matrix material . nanodiamond was blended into a liquid . pvdf material for coating on a solar cell . in one example , a suspension was made including 0 . 01 % w / w nanodiamond , 0 . 1 % w / w of pvdf resin , and the balance dimethyl sulfoxide ( dmso ). a coating of the suspension was applied to the top - surface of the solar cell and allowed to dry , leaving the nanodiamond particles suspended in a film of pvdf polymer in a narrow band of distances above the top surface of the solar cell . coatings were tested having thickness from about 40 microns to about 100 microns , and the resulting change in efficiency of the solar cell was measured . as shown in fig9 a , efficiency improvement in the solar cell was inversely proportional to wet coating thickness , with a 100 micron coating achieving more than a 4 % increase in efficiency and a 40 micron coating achieving a nearly 7 . 5 % increase in efficiency . other compositions of coatings have been tested , varying the concentration of nanodiamond particles and pvdf resin in the suspension , and efficiency improvements in excess of 10 % have been achieved with 0 . 01 % w / w nanodiamond particles and 0 . 1 % w / w pvdf resin . for example , fig1 illustrates an 11 . 5 % increase in efficiency between a solar cell prior to coating having an efficiency of 15 . 4 % and the same solar cell after an outer coating of nanodiamond particles was applied having an efficiency of 17 . 2 %. without being bound by theory , the increase in efficiency of a solar cell having an outer nanodiamond coating is believed to result from the nanodiamond refracting sunlight reaching the solar panel . the net effect is to increase the flux of photons impinging on the photovoltaic material at normal or near normal incidence ( which impart higher levels of energy onto the photovoltaic material ) and to disperse the flux of photons that would otherwise impinge on the photovoltaic material at grazing angles ( which impart relatively low levels of energy onto the photovoltaic material ). this phenomena can eliminate the need for expensive tracking systems , particularly on residential and commercial buildings , by enabling solar cells to achieve higher efficiencies at less direct angles of solar illumination . fig5 shows test results for an outer nanodiamond coating made from 0 . 01 % w / w nanodiamond particles , 0 . 1 % w / w pvdf resin , and the balance dmso . at an angle of sunlight incidence of 90 degrees ( i . e ., normal to the top surface of the solar cell , for which a conventional solar dell is most efficient ), the nanodiamond outer coating increased solar cell efficiency by 10 . 1 %. but even greater increases in efficiency were observed at angles of sunlight incidence away from normal . at a modest angle of incidence of 60 degrees ( i . e ., 30 degrees from normal ), an efficiency increase of 12 . 7 % was observed , and at a relatively shallow angle of incidence or 30 degrees ( i . e ., 60 degrees from normal ), an efficiency increase of 21 . 9 % was observed . the practical results of the increased efficiency at less than optimal sunlight incidence angles can be seen in fig6 , which compares the electricity output throughout the course of a day between a solar cell fixed on a roof and a solar cell mounted on an expensive , heavy mechanical tracking mechanism . at the peak of the sun , when the angle of incidence is closest to normal , the coated solar cell showed a slight increase of less than 3 % as compared with the uncoated solar cell . but early and late in the day , even at times very close to sunrise and sunset , the solar cell with the tracking mechanism showed a dramatic increase in electricity production as compared to the fixed solar cell , sometimes by as much as 300 %. comparing fig6 ( which shows the benefits of solar cell tracking ) with fig5 ( which shows the improvements obtained by a nanodiamond outer coating ), the similar plateau shape of the curves indicates that providing a nanodiamond outer coating can achieve similar benefits , at less cost and complexity , as mounting a solar cell on an expensive mechanical tacking mechanism . a coated solar cell also shows improved performance due to the superior heat transfer capability of the nanodiamond particles in the coating , and this improvement increases as the temperature of the solar cell increases . test results are shown in fig7 comparing an uncoated cell and a cell coated with an outer coating including 0 . 01 % w / w nanodiamond particles and 0 . 1 % polymer resin . even at 23 ° c . the coated cell , outperformed the uncoated cell , in terms of conversion efficiency by 10 . 3 %. at 49 ° c ., the improvement in efficiency was 12 . 4 %. these results are due , at least in part , to the high thermal conductivity of the nanodiamond particles particles ( in the form of nanocrystals ), which dissipates heat generated by the solar cell . because heat can degrade the efficiency of a solar cell , the ability of the nanodiamond particles to dissipate heat both perpendicularly from the surface as well as laterally across the surface contributes to improvements in efficiency . fig3 shows an exemplary process of making a solar cell having an inner nanodiamond coating . in particular , the inner nanodiamond coating is incorporated into a solar cell during manufacture of the solar cell . the inner nanodiamond coating is formed from nanodiamond particles in the absence of a binder or matrix material which might otherwise break down at the elevated temperatures to which the inner components of the solar cell will be exposed . in comparison to the conventional process shown in fig1 , a process using the inner nanodiamond coating can be used both to improve solar cell efficiency and to decrease manufacturing costs . first , texture etching of the silicon substrate can be eliminated . in addition , the compound step of anti - reflective ( ar ) coating and plasma - enhanced chemical vapor deposition ( pecvd ) can be simplified ; the step of ar coating pecvd combines hydrogen annealing and pecvd , and the pecvd portion of the step can be eliminated and replaced with applying an inner nanodiamond coating . the performance of the inner nanodiamond coating has been found to be best when a substantially uniform monodispersed layer of nanodiamond particles can be achieved on a silicon solar cell . fig8 a and 8b show a comparison between a polydispersed coating ( i . e ., a coating having portions with a thickness of more than one nanodiamond particle ) and a monodispersed coating . similarly to the outer coating , the inner nanodiamond coating may be applied to the top surface of the photovoltaic material by various methods , including using a manual blade method , screen printing , dip - coating , and spray coating . alternatively , spin coating may be used . excellent uniformity and thickness control of the coating can be achieved using blade coating , although other methods may be refined to produce similar results . to facilitate coating , the nanodiamond particles are suspended in water or a non - polymer solvent that will essentially completely evaporate once the nanodiamond particles are spread uniformly as desired . suitable solvents include dmso , isopropyl alcohol , and n - methylpyrolidone ( nmp ). the inner nanodiamond coating eliminates the need for an etching step that is conventionally used to texture the surface of the silicon substrate of a solar cell so as to scatter light and increase collection efficiency . in addition , the outer nanodiamond coating reduces the reflection of sunlight , thereby causing more photons to reach the solar cell and increasing the electrical output of the cell . this can eliminate the need for an anti - reflective coating that is often used on top of a conventional solar cell to reduce the number of reflected photons . in testing on solar cells for which the silicon substrate had already been subjected to texture etching , efficiency improvements of over 3 % have been achieved using an inner nanodiamond coating of 40 microns thickness or less ( when wet ). fig9 b shows that for a coating formulation including 0 . 1 % w / w nanodiamond particles with the balance being dmso , efficiency gains ranged from slightly less than 1 % to more than 2 . 5 %. efficiency improvement for this formulation was almost directly inverse to inner coating thickness , with a wet coating thickness of 100 microns producing an efficiency improvement of 0 . 92 % and a thickness of 20 microns producing an efficiency improvement of 2 . 67 %. fig9 c shows even better results for a coating formulation including 0 . 01 % w / w nanodiamond particles with the balance being dmso , with maximum efficiency gains of nearly 4 %. efficiency improvement for this formulation improved generally with thinner coatings , but was about the same for coatings of 40 microns and 20 microns ( 3 . 86 % and 3 . 89 % respectively ). even at a relatively thick coating of 100 microns , an efficiency gain of 2 . 26 % was achieved . when both an inner nanodiamond coating and an outer nanodiamond coating are applied to a solar cell , a net improvement in efficiency results that is an aggregate of the efficiency improvements from each coating alone . thus , the efficiency gained by texture etching and anti - reflective coating can be equaled by replacing these steps with the inner nanodiamond coating , but at a lower cost . by adding the outer nanodiamond coating , a total cell efficiency increase of up to 10 % can be reliably achieved , exceeding the increase produced by texture etching and anti - reflective coating . while reference has been made to specific embodiments , it is apparent that other embodiments and variations can be devised by others skilled in the art without departing from their spirit and scope . the appended claims are intended to be construed to include all such embodiments and equivalent variations . | 2 |
while the support device of the present invention may be used in a range of different vessels , including blood vessels , it has particular application in procedures where an organ or anatomical region is undergoing localized perfusion with a therapeutic , diagnostic or other agent . for simplicity , these agents will be hereinafter referred to as therapeutic agents . however , it is to be understood that the term “ therapeutic ” is not to be construed as limiting , and that it includes , without limitation , therapeutic , diagnostic , prophylactic and other agents not specifically identified herein , but which would be considered by the relevant skilled addressee to be suitable for perfusion to an organ or anatomical region . perfusion may be total perfusion , where the entire organ is totally or substantially isolated from the systemic flow , or partial perfusion where only a portion of the organ is substantially isolated . localized perfusion of this kind presents advantages by improving efficacy and the time exposure of the therapeutic agent to the relevant cells . it also limits exposure and hence toxicity to non - target cells as described in brief above . however , it is to be understood that the present invention may also be used simply to collect or drain fluid from an organ or region . collected fluid may be removed from the subject and re - circulated into the organ , filtered and / or treated , or discarded . in some organs , it may be difficult to achieve total isolation , so partial isolation and perfusion may be performed , for example to the right or left lobe of the liver . despite partial perfusion being capable of delivering therapeutic agent to merely a part of the organ , significant therapeutic benefit may still be achieved . particular benefit may be achieved where perfusate is collected after perfusing the target organ , so as to prevent subsequent circulation of the therapeutic agent to other regions of the body where toxic effects may be observed , or the therapeutic agent wasted . the benefit may be improved further where collected perfusate is re - circulated into the target organ utilizing any therapeutic agent which remains after a first pass through the target organ . this may be achieved using the approach described in published patent application wo2005 / 082440 , the entire contents of which are herein incorporated by reference . as discussed infra , when fluid is collected from vessels draining from a target organ or region , one or more of these vessels may require cannulation with a collection catheter . when fluid is drained through these collection catheters , the vessels in which they are positioned become susceptible to collapse as the pressure inside decreases . while some vessels may be more susceptible to collapse than others , the support device of the present invention can provide advantages by supporting and stabilizing the vessel and even anchoring the collection catheter in position . the support device of the present invention may facilitate or at least improve the performance of perfusion . in some instances , the advantages of the present invention have been found to be essential to maintaining adequate positioning of collection catheters and flow rates within the vessel during perfusion . the right and left lobes of the liver have been identified as possible target regions and in this context , the support device may be deployed in one of the hepatic veins to support and maintain patency of the vein as fluid ( e . g . perfusate ) is collected from the liver . however , it is to be understood that fluid from many other organs or regions may be accessed in this way . deploying the support device may also protect the vessel wall by maintaining the tip of the catheter substantially centrally of the vessel or at least at a distance from the vessel walls to prevent aspiration or cavitation . deployment of the device may refer to partial or complete deployment . in complete deployment , the entire expandable member is released from the catheter and expanded to its full extent . in partial deployment , part of the expandable member is retained within the catheter and the amount of expansion is limited by the diameter of the catheter opening . partial deployment may be useful where , for example , during deployment it is found that the diameter of the expandable member may exceed the vessel diameter by an unsafe amount and complete deployment is likely to damage the vessel wall . limiting expansion of the device by partial deployment may avoid vessel damage . partial deployment may also stabilize the expandable member by limiting its movement relative to the catheter tip . thus by retaining part of the expandable member within the catheter , torsional , axial and lateral movement of the member , relative to the catheter is prevented or at least minimized by the struts of the expandable member being in abutment with the internal surface of the catheter . alternatively , the expandable member may be modified at the proximal end , for example by incorporating a lead , a link or other means to limit the extent of movement possible between the catheter tip and the expandable member once deployed . as a further positioning aid , markings may be provided at the proximal end of the control stem / shaft , outside the patient &# 39 ; s body . as the device is released into the vessel , the markings may be utilized to indicate the distance of device deployment , past the catheter tip . during collection of fluid from the vessel , low pressures may develop at the collection device tip , particularly where a roller / peristaltic pump or the like is used to draw fluid from the target organ out of the vessel . this may be indicated by pressures in a lumen feeding into the pump as low as , for example , − 190 mmhg , although clearly these pressures are variable depending on the vessel type , health and age of the subject , characteristics of the perfusion circuit and the like . in the absence of the inventive support device , these pressures can cause the vessel to collapse . not only would vessel collapse affect the perfusion procedure , vessel collapse can also cause venous pooling in the organ and irreversible tissue damage . the advantages and benefits of the present invention will be expanded upon in the following detailed description presenting some of the preferred embodiments of the invention , and the specific examples which follow . it is to be understood that the embodiments and examples provided herein are intended to indicate how the present invention may be performed and are not intended to be limiting on the scope of protection sought as is defined in the claims appended hereto . fig1 a shows an example of an expandable member , in its expanded condition , suitable for supporting a vessel . expandable member 104 is provided in the form of an expandable framework and is adapted to be percutaneously deliverable to the blood vessel in a collapsed condition . fig1 b shows the expandable member in a collapsed condition within a catheter 110 , in which ends 105 , 107 have been drawn apart to radially reduce the member . when collapsed within catheter 110 , atraumatic tip 101 may protrude from the catheter to assist in guiding the support device into the vessel prior to deployment . when the expandable member has been guided into the target blood vessel , the catheter 110 is retracted ( or the expandable member is pushed out of the catheter ), deploying the device into the vessel where it expands . fig1 c shows the support device fully deployed from the catheter , with the expandable member in its fully expanded condition . a guidewire or stem 106 extends within the catheter 110 and is used to deliver the device from a point of entry through the peripheral vasculature to the target vessel . atraumatic tip 101 coupled to the expandable member 104 , is adapted to make atraumatic contact with vessel walls during placement of the device by deforming or deflecting off the vessel wall on contact . this can be achieved by incorporating flexibility into the tip so that it deforms upon contact with the vessel wall . alternatively or additionally , the tip may be shaped or curved to avoid trauma . the atraumatic tip may take any one of a number of forms . in the examples illustrated in fig1 to 3 , the atraumatic tip 101 , 201 is j - shaped . however , other shapes are considered to be suitable , including but not limited to those illustrated in fig4 . for example , the atraumatic tip may have a cross section which is enlarged relative to the guidewire radius , and have a smooth surface so as to avoid causing perforation when the tip comes into contact with the vessel wall . one such example is shown in fig4 a where the atraumatic tip 401 is tear - shaped . alternatively , the atraumatic tip may include a portion having a pigtail shaped curve 402 ( fig4 b ), or an angled tip ( not shown ). preferably , the expandable member is formed from a biocompatible superelastic material , or alternatively from a shape memory material or a material which exhibits both of these properties , being capable of recovery after deformation for delivery in a collapsed or compressed state within a catheter . devices manufactured using these materials can be collapsed for percutaneous delivery to a deployment site and then resume a known shape on deployment . a range of biocompatible materials may be suitable such as alloys of nickel and titanium ( e . g . nitinol ). other suitable biocompatible materials include but are not limited to polymers and plastics such as hydrophilic plastics , ceramics and the like . fig3 illustrates the support device of fig1 a to 1 c , with an occluding balloon inflated around catheter 110 . the occluding balloon 114 may be utilized during collection of fluid from an organ or region of the body in isolation , where substantially all of the fluid flowing out of the organ or region is collected by the catheter 110 . the occluding means substantially prevents blood , therapeutic agent and / or other fluids entering the vessel from flowing on to other organs or regions , and permits collection of substantially all of the fluid entering the vessel . collected fluid may then be analyzed and / or re - oxygenated and / or perfused through the organ , discarded or handled otherwise . the occlusion means may include an occluding balloon , flange , disc or other means . catheter 110 is delivered to the vessel with the balloon 114 in a deflated condition . the expandable member is delivered , through the catheter , and deployed inside the vessel . the balloon is then inflated around the catheter and substantially all the fluid in the vessel flows through the catheter and into a perfusion set or reservoir to which it is connected . a pump , syringe or other means may be incorporated into the perfusion set to draw fluid out of the vessel , through the catheter , at a rate which substantially maintains the required flow through the organ or region , or through a re - perfusion circuit . as fluid is drawn out of the vessel through the catheter , the expanded support structure supports the vessel walls , preventing collapse or cavitation which might otherwise result from the low pressures or high flow rates generated at the catheter tip , maintaining patency and ensuring flow in the circuit . the expandable member may also anchor the device in position within the vessel , substantially precluding movement of the device and ensuring that the catheter is retained in an optimal location for collection of fluid . the expandable member may take a range of different shapes when in an expanded ( or collapsed ) configuration , and may provide any number of supporting filaments or struts . the design of the expandable member may be based on a range of criteria including but not limited to the size and strength of the vessel wall and the flow rates and pressures likely to be generated near the device . some of these embodiments are illustrated in fig8 a to 8 c although these are examples only and are not intended to limit the scope of the invention as broadly described herein . fig8 a to 8 c illustrate expandable members having elongate portions in the supporting struts adapted for contact with the vessel wall . in the example in fig8 b , the supporting struts are slightly rounded to reduce trauma to the vessel walls . fig8 c provides additional struts when compared with fig8 a , as may be necessitated in particularly flaccid vessels requiring more substantial support . embodiments illustrated herein provide expandable members with a substantially elongate structure adapted for coaxial insertion into and placement within the vessel . the elongate structure supports the vessel over a length on the elongate portions of the struts substantially parallel to and in contact with the vessel wall . these elongate portions may be substantially straight , or may be curved ( e . g . fig8 b ). supporting the vessel wall over a length of the support device , compared with the point of supports of the prior art , improves the capacity of the device to maintain patency , even when very low pressures and high flow rates are generated at the catheter tip , and also reduces the likelihood of the device causing damage to the vessel wall . the elongate portions may have a length which is about the same as or greater than the diameter of the vessel being supported , or some multiple of the vessel diameter , or for example from 1 mm up to 30 mm depending on the vessel size and structure . the length of the elongate portion may be selected according to the vessel being supported , the size of the catheter being used and the flow rates and pressures likely to be generated at the catheter tip . preferably , the elongate portions of the expandable member which contact the vessel wall , are just adjacent the distal tip of the catheter when the device is fully deployed . thus , a proximal end of one or more of the elongate portions may commence , for example , within 0 . 1 to 25 mm of the catheter tip , or at least at a distance which is less than the diameter of the catheter opening . this prevents the vessel wall from being drawn into the space between the catheter tip and the start of the elongate portion of the expandable member which contacts the vessel wall . further , the device may be configured so that when it is in an expanded condition , the distance between adjacent elongate portions is sufficiently small to prevent the vessel wall from being drawn into gaps between them . for example , the distance between adjacent elongate portions may be less than the diameter of the catheter . alternatively , the distance between the adjacent elongate portions may be less than , for example , 3 , 2 . 5 , 2 , 1 . 5 , 1 or 0 . 5 mm , depending on the size and type of the target vessel , and the diameter of the collection catheter being used . preferably , the support device possesses sufficient mechanical strength to maintain patency during collection of fluid , withstanding the deformation forces which may occur in response to suction or low pressures produced at the collection catheter tip . in some embodiments however , it may also be desirable for the device to exhibit some flexibility , and conform to the shape of the vessel when deployed . thus , the support device is capable of providing support and maintaining patency along a length of the vessel , even where there is a curve in the vessel wall . an alternative embodiment of a support device 200 is illustrated in fig2 . proximal end 205 of the expandable member 204 is fixedly attached to a stem or shaft 206 , whereas distal end 203 of the expandable member is movable and able to slide over part of the shaft . this enables the member to collapse radially for delivery inside a delivery catheter , and also facilitates recapture of the device . fig5 illustrates another alternative embodiment of a support device shown at 500 in an expanded condition . in this embodiment , both the proximal end 505 and the distal end 503 of the expandable member are movable along a stem or shaft 506 used to deliver the device to the vessel . stops 508 a , 508 b are provided at fixed locations on a distal portion of the shaft , arranged between ends 503 , 505 of the expandable member . these stops may consist of a small ring , crimp or node of increased diameter , relative to the shaft diameter , and prevent the ends of the expandable member from moving across the stop . this facilitates deployment and retrieval of the expandable member from a catheter . fig1 illustrates a support device 151 consisting of an expandable framework 155 having a woven or braided , basket - like configuration when in the expanded condition . in this arrangement , the support device may also include occluding means in the form of a thin flow - proof coating 156 on the inner and / or outer surface of framework 155 to prevent flow of liquid from the vessel . thus , substantially all fluid in the vessel may be collected by catheter 160 . the flow - proof coating may be made from biocompatible silicon , elastomer or flow - proof polymer . preferably , the support device includes a radiopaque or other marker so that it can be positioned within the target vessel using an imaging system such as those generally known in the art . this enables the physician to position and deploy the expandable member into the blood vessel accurately . the marker may be incorporated into the expandable member and / or into an atraumatic guiding tip which may be incorporated into the support device . preferably , the atraumatic tip is manufactured from , includes or is coated with a lubricant and / or a material having a low coefficient of friction . many materials having low coefficient of friction properties may be used including but not limited to biocompatible high density polyethylene ( hdpe ), teflon ®, polypropylene , polyethylene , microglide ™, low friction chromium and silicon to name a few . this improves the performance of the atraumatic tip , so that it “ slides ” along the vessel wall upon making contact , thereby substantially avoiding trauma . use of an atraumatic guiding tip improves the safety and ability to position the expandable member in the target vessel . moreover , since the atraumatic tip may exhibit greater flexibility than the rest of the device , the device is easier to manipulate into position . the atraumatic tip may be provided at a distance from the distal end of the expandable member which enables a physician to guide the expandable member into position within the target vessel . this distance may be anywhere from , for example , 0 . 25 to 5 centimeters from the distal end of the expandable member when in an expanded condition , although it is to be understood that larger or smaller distances may be utilized , depending on the location of the target vessel and the anatomy surrounding it . referring now to fig6 a and 6 b , another example of a support device 600 is shown . a lumen 602 has a control stem 601 extending therein . four loop portions 603 are provided . each loop portion is attached at a first loop end to a distal end 604 of the lumen , and at a second loop end to the control stem at 605 . the loop portions are controllably expandable by advancing the control stem within the lumen in the direction shown by arrow 606 ( fig6 b ). the support device is percutaneously deliverable with the plurality of loop portions housed substantially within the lumen 602 as illustrated in fig6 a and expandable as illustrated in fig6 b . whilst the embodiment illustrated in fig6 a and 6 b provides 4 loop portions , it is to be understood that any number of loop portions may be used . the number of loop portions incorporated into the device may depend on , for example , the anatomy of the vessel being supported , and / or the size of the catheter used to deliver the device . fig7 a and 7 b illustrate another example of a support device 700 which provides 3 loop portions 703 attached to control stem 701 at juncture 705 . the 3 loop portions are contained during delivery substantially within lumen 702 ( fig7 a ), and are controllably expandable to maintain patency within the blood vessel by advancing control stem 701 in the direction of arrow 706 ( fig7 b ). the rounded edges of the loop portions present a reduced risk of damaging the vessel walls , e . g . by perforation or bruising during delivery . the one or more loop portions may be attached to or near the distal end of the delivery lumen in any suitable manner . the point of attachment may be inside or outside the lumen . the loops may be manufactured from any suitable material such as a metal , metal alloy , plastic , polymer , or other filamentous material or composite . the one or more loop portions may be attached at a second loop end to the control stem by soldering , fusing , an adhesive , or any other suitable means . in another embodiment , the loop portions may be attached to a first and a second loop end to the control stem . the support structure of fig6 a , 6 b , 7 a and 7 b may further include an atraumatic guiding tip of the kind described above to aid in positioning the support structure within the blood vessel . alternatively , parts of the loop portions which may protrude from the lumen when the loop portions are in their collapsed state may be used to guide the support structure into the blood vessel . one or more of the loop portions may be provided with a radiopaque or other marker to assist in this regard . retention means may also be provided with the support structure to retain the expandable member in an expanded condition within the vessel . the retention means may be in the form of a clamp , clip , thumb - slide or the like accessible from outside the patient &# 39 ; s body , and may facilitate adjustment of a deployed expandable member during a procedure . retention means may also impart additional rigidity and strength to the expandable member . thus , the retention member may be used to counteract excessively low pressures which may otherwise cause the expanded member to fail . a support structure of the kind illustrated in the figures may be delivered within a multilumen catheter 900 of the kind illustrated in cross section in fig9 . using this catheter , the support device 910 can be delivered through a first internal lumen 901 without interfering with flow in a second lumen 902 . a third lumen 903 may be provided for monitoring flow rates and pressures , for blood analysis or for delivering other percutaneous tools or devices to the vessel or as an inflation lumen for an occlusion balloon . it is to be understood that in the various embodiments of the present invention , the expanded member does not require constant contact with the vessel walls to provide the required support . for example , the diameter of the expanded member may be less than the diameter of the vessel so that the expanded member only contacts the vessel wall when the vessel begins to collapse . patency is considered to be maintained as long as the support device keeps the vessel open to a degree which is sufficient to maintain continuous flow . to avoid causing turbulence or other undesirable blood flow effects within the vessel , and to optimize flow in the vessel it may be desirable to substantially match the diameter of the expanded member to the diameter of the vessel . alternatively the expandable member may be shaped , e . g . as a coil or helix , to have minimal effect on the flow in the vessel . in one embodiment , the expandable member may have a slightly larger expanded diameter than the relaxed vessel to create an anchoring effect . depending on the size of the outflow vessel from which blood and perfusate is collected from the target region , there may be a natural tendency for the collection catheter tip to move about and contact the vessel , thus increasing the risk of vessel collapse or invagination of the catheter tip into the vessel wall . this can cause pooling of fluid in the isolated target region and may cause serious and permanent damage to the organ or region of the patient being treated . use of a support structure in conjunction with the collection catheter to maintain patency of the outflow vessel , in accordance with embodiments of the present invention can minimize the risk of these complications eventuating . thus , a collection catheter associated with the expanding member can be retained in position during fluid collection . this minimizes movement of the catheter tip , ensures that it is substantially centered relative to the vessel walls and improves withdrawal of fluid out of the vessel . at completion of the procedure , it is desirable that the expanded member is collapsed or compressed and recaptured , preferably in the catheter from which it was deployed . this facilitates removal of the support device from the patient . a reinforcing tip may be provided on the catheter end to strengthen it for recapture . alternatively or additionally , the tip may be coated with a lubricant and / or material having a low coefficient of friction to facilitate smooth recapture of the expandable member . the catheter may also have an internal coating of lubricant and / or a material having a low coefficient of friction to assist translation of support device along its interior during delivery and removal of the device from the patient . although the present invention has been described in terms of the presently preferred embodiments , it is to be understood that the disclosure is not to be interpreted as limiting . various alterations and modifications will no doubt become apparent to those skilled in the art after having read the above disclosure and it is intended that the present disclosure be interpreted as covering all alterations and modifications as fall within the true spirit and scope of the invention . effect of support device on flow rates and pressures achievable during recirculation in sheep right hepatic vein , cephalic vein , coronary sinus and renal vein during recirculation a 0 . 014 ″ diameter superelastic nitinol wire stem of 1 . 35 m length was used , coupled to an expandable member having 6 pre - shaped elliptical loop portions welded to the stem . a 0 . 024 ″ od atraumatic tip of 2 cm length attached to the distal end of the expandable member was used to position the device in the blood vessel . a balloon occlusion catheter was positioned in the vessel and the expandable member deployed at the tip of the catheter . the balloon was inflated to isolate and capture flows in the vessel and the catheter was connected to a standard extracorporeal circuit for blood circulation . negative pressures were observed in perfusion lines draining the coronary sinus , renal vein , right hepatic vein and cephalic vein during recirculation both with and without a support device . these data show that cavitation is prevented at certain pressures in the vessels tested where a support device is used , but is not prevented where the support device is absent in the vessel at those pressures . although cavitation may occur even with the support device , it occurs at higher flows . also , cavitation ceases sooner where the support device was employed allowing flow to return to normal . in the coronary sinus , recovery from cavitation was not possible without the support device , emphasizing the importance of the device in the procedure . the data further demonstrates that vessel collapse can be irreversible in the absence of a support structure . however , where a support structure is present , the vessel collapse may be reversed by increasing pressure in the vessel or by slowing or reversing the flow rate of fluid through the vessel . more specifically , considering the data for the right hepatic vein , flow rates of up to 250 ml per minute may be achieved before cavitation occurs where a support device is present in the vessel . under the same conditions but where there is no support device , flow rates of only up to 180 ml per minute are possible . a more striking example of the advantages of the support device is seen for the cephalic vein where no flow is achievable without the device . when the vessel wall is supported by the device flow rates of up to 200 ml per minute are noted before cavitation occurs . when the vessel wall is supported flow rates of up to 200 ml per minute are noted before cavitation occurs . | 0 |
in a block diagram shown in fig1 used for carrying out a first embodiment of the present invention , a value introduced through an input setting switch 11 is memorized in a memory device 13 under the supervision of a digital operational device 12 . the input setting switch 11 may actually comprise a required number of rotary switches , each having ten positions permitting the setting of any one of the digits 0 to 9 . by rotating these rotary switches to required positions , any number having a required number of digits can be set . the memory device 13 may be a ram ( random access memory ) or the like which may be included in the digital operational device 12 or may be provided separately therefrom . the digital operational device 12 may be a minicomputer or a microcomputer of any suitable type adapted for the application as described hereinbefore . to clarify the description of the present invention , the value ( data ) thus set by the setting switch 11 is represented by [ sw ], and the value ( data ) memorized in the memory device 13 is represented by [ ram ]. the memorization of the value ( data ) is performed under the supervision of the digital operational device 12 . in an ordinary case , the operation carried out by digital operational device 12 is performed through a loop a as shown in fig2 . that is , a set value [ sw ] set by the input setting switch 11 is compared with a memorized value [ ram ] in the memory device 13 . when the result of the comparison indicates that the set value [ sw ] is equal to the memorized value [ ram ], the operation of the operational device 12 is shifted to the control operation for device 12 . for example , a control signal for a protective relaying apparatus may be executed in accordance with the memorized value [ ram ] to thus perform a controlled operation of the apparatus . after completion of one complete step of the control operation , the operation of the device 12 for comparing [ sw ] with [ ram ] is repeated . however , when the result of the comparison indicates inequality , the operation of the device 12 follows a route b thereby operating an alarm . as is apparent from the above description , the operation of the device 12 is shifted between the comparison and the control operation in a cyclic manner , and a periodic supervision of the set value is thereby achieved . it is also apparent that the above described two operations and the cyclic shifting between the two operations are performed under the control of a well known central processing unit cpu in the digital operational device 12 . although the comparison operation and the control operation have been described as being performed by the digital operational device 12 , it is apparent that the operation of the device 12 is not necessarily limited to the aforementioned two operations , but if required , any other operation may also be added to the two operations . by the above described example of the input setting method , an input value set by the setting switch 11 is first memorized in a memory device 13 , and the set value and the memorized value are periodically compared to each other . as a result , when a memorized value [ ram ] is found erroneous because of an erroneous manipulation of the setting switch 11 , a faulty operation of the same , or because of spurious noise and the like , the erroneous [ ram ] can be readily detected , thus providing an input setting method for a digital operational device of a high reliability . in fig3 there is illustrated another embodiment of the present invention wherein two memorizing devices 13 are provided for storing a value set by the input setting switch 11 . in the flow chart of fig4 showing this embodiment the periodic supervision of the set value is accomplished by comparing three values [ sw ], [ ram - 1 ], and [ ram - 2 ] with each other . that is , three conditions x , y , and z shown in fig5 are periodically checked for determining any erroneous value among the three values [ sw ], [ ram - 1 ], and [ ram - 2 ]. where a value [ ram - 1 ] is erroneous , conditions x and z do not hold , but the condition y holds . after surveying the three conditions as described above , either one of the two values [ sw ] and [ ram - 2 ], that is judged to be correct from the holding condition y , is used in the control operation of the digital operational device 12 . likewise , when [ ram - 2 ] is found erroneous as a result of the survey of the three conditions x , y , and z , either one of two values [ sw ] and [ ram - 1 ], both judged to be correct from the holding condition x , is used in the following control operation of the device 12 . similarly , when [ sw ] is judged to be erroneous from the holding condition z , either one of the values [ ram - 1 ] and [ ram - 2 ] is used in the control operation . where all of the three conditions x , y , and z do not hold , a device is provided in the operation device 12 so that it locks the control operation of the same device 12 that is , no new control operation is executed , as illustrated in the flow path 19 shown in fig4 . alternatively , the device provided in the operational device 12 may or allow operational device 12 to carry out the control operation by using the erroneous set value while invalidating the results of the control operation after the completion thereof . when all the conditions x , y , and z hold , the operation of the device 12 is carried out simply through the loop a . according to this embodiment , a value set by the input setting switch 11 and two values memorized in the two memorizing devices are compared with each other , and when two or more of the three values are found correct , the control operation of the digital operational device 12 is carried out by using the correct value . furthermore , since the correctness of the input value is assured by comparing the three values with each other , the reliability of the embodiment of the invention can be substantially improved . more specifically , even in the case where the data applied by input setting switch 11 becomes erroneous , the correctness of the control operation can be assured by the use of the any one of the memorized values which are found correct . this feature is particularly advantageous when the reliability of the input setting switch is comparatively low . in still another embodiment wherein three memory devices are provided , the set value is compared successively with the values memorized in the memory devices as shown in fig6 . this embodiment is particularly advantageous where the reliability of the memory devices 13 is comparatively low . in all of the above descriptions , it has been assumed that the number of input setting switches ( not of the actual number of the rotary switches ) is equal to unity . however , it is apparent that a plurality of input setting switches may also be provided for setting a corresponding number of input values . in this case , the number of the memory devices 13 is also increased in accordance with the number of the input setting switches 11 . in the case where the input setting switch 11 is also used commonly for other purposes , the comparison between the set value and the values memorized in memory devices will be some times impossible . in this case , the set value is memorized in a plurality of memory devices , and the comparison is effected between the memorized values . for instance , in the example shown in fig4 and 5 , the comparisons between [ sw ] and [ ram - 1 ], and [ sw ] and [ ram - 2 ] are eliminated , and a comparison between [ ram - 1 ] and [ ram - 2 ] is merely carried out . | 7 |
referring to fig1 , there is shown a trailer 100 and system 200 according to the preferred embodiment of the invention with the trailer configured for use and hitched to a typical pick - up truck 204 . trailer 100 consists of a main frame 106 preferably comprising three parallel square tubular steel longitudinal beams , 108 a through 108 c . center longitudinal beam 108 b serves as the support for hitch assembly 132 and also defines the longitudinal axis of main frame 106 and trailer 100 . longitudinal beams , 108 a through 108 c are rigidly and perpendicularly connected to four parallel square tubular steel upper cross beams , 112 a through 112 d , and to one square tubular lower cross beam 114 , which serves as a support for two identical wheel assemblies 116 r and 116 l . the longitudinal and cross beams are welded , riveted or otherwise permanently fastened together to cooperatively form a rigid and strong rectilinear structure , being main frame 106 . as this trailer 100 is preferred embodiment aimed to fit within the bed of a typical full - sized pick - up truck , main frame 106 has a width and length restricted accordingly . the length of longitudinal beams 108 a through 108 c , and thus the length of main frame 106 , and thus the length of trailer 100 when folded for storage , is approximately 96 inches . the length of cross beams 112 a through 112 d , and thus the width of main frame 106 , and thus the width of trailer 100 when folded for storage , is approximately 55 inches . in alternative trailer embodiments intended for storage into vehicles able to accept folded trailers of different dimensions , not shown here , the length and width dimension and the numbers of longitudinal and cross beams may be modified accordingly without departing from the spirit if the invention . wheel assemblies 116 r and 116 l are best viewed in fig3 and 9 , and each comprise support arm 118 , having a horizontal square shaft portion 120 sized and shaped to fit snugly and removably within the square hollow interior of square tubular lower cross beam 114 . removable pin / clip set 122 passes through aligned holes in both shaft portion 120 and lower cross beam 114 , to temporarily affix shaft portion 120 , and thereby wheel assemblies 116 r and 116 l , firmly to lower cross beam 114 , and thereby to main frame 106 . such removable pin / clip sets , as are preferably used throughout the invention , are commonly used in a variety of trailer applications , are commonly sold where trailer parts are sold , are well known , convenient , inexpensive , and reliable , but may be substituted by any sufficient means for temporarily and removably affixing the shaft to the beam without departing from the spirit of the invention . support arm 118 further comprises outwardly projecting axle 126 , onto which is mounted tired wheel 128 r or 128 l , using any typical state of the art trailer axle / bearing / wheel arrangement ( not shown ). tired wheels 128 r and 128 l are preferably typical trailer - type tire / wheel assemblies , as are commonly used on trailers , are readily replaceable wherever trailer parts are sold , and are rotationally free relative to axle 126 and thereby to trailer 100 . vertical connecting arm 130 rigidly connects axle 126 to shaft portion 120 , to complete the support arm 118 , such that when both wheel assemblies 116 r and 116 l are affixed to the main frame 106 , both axles 126 are coaxially positioned parallel to and sufficiently below lower cross beam 114 , and the two tired wheels 128 r and 128 l are substantially aligned perpendicular to center longitudinal beam 108 , and thereby to the longitudinal axis of the trailer 100 , and disposed horizontally such that the lowest points of the tired wheels will be substantially at ground level during use . by removing pin / clip set 122 , each wheel assembly 116 r and 116 l may be freely removed from main frame 106 , and positioned elsewhere for storage , as will be described later . hitch assembly 132 , comprises hitch bar 134 and hitch receiver 136 , which are rigidly affixed together by welding , riveting , or any other sufficiently strong fastening means . square hitch bar 134 is sized and shaped to fit snugly and movably within the square hollow interior of center longitudinal beam 108 b . removable pin / clip set 122 is positioned through aligned holes in both bar 134 and beam 108 b , to temporarily affix hitch assembly 132 to main frame 106 . hitch bar 134 may be substantially long , up to the same length as center longitudinal beam 108 b , and center longitudinal beam 108 b includes several holes 138 for receiving pin / clip set 122 , said holes 138 being equally longitudinally spaced and positioned to allow hitch assembly 132 to be moved within beam 108 b and repositioned and re - fixed longitudinally to thereby render trailer 100 longitudinally extendible and adaptable to payloads of various lengths and sizes . trailer 100 further comprises flat horizontal bed panel 142 , whose width , measured in the transverse horizontal direction perpendicular to the trailer &# 39 ; s longitudinal axis , and length , measured in the longitudinal horizontal direction along the trailer &# 39 ; s longitudinal axis , are substantially equal to those of main frame 106 . as explained above , in this preferred embodiment , that width is approximately 5 inches and that length is approximately 96 inches . bed panel 142 may be made of flat or embossed steel sheeting , plywood , or any other suitable material , and is rigidly and permanently affixed atop main frame 106 by any common fastening means , including welding . bed panel 142 provides a supporting surface for the payload that may be carried by the trailer when in use . two extension frames 150 l and 150 r consist of four parallel extension bars 152 a to 152 d , perpendicularly connected to longitudinal side bar 154 . square extension bars 152 a through 152 d are sized and shaped to fit snugly and movably within the square hollow interior of square tubular steel upper cross beams , 112 a through 112 d . removable pin / clip sets 122 pass through aligned holes 154 in both bars 152 a and 152 d and in beams 112 a and 112 d , to temporarily affix extension frame 150 l or 150 r to main frame 106 in either of two positions , those being the retracted position shown in fig3 and the extended positions shown in fig4 and 6 a . side panels 158 l and 158 r , made of flat or embossed steel sheeting , plywood , or any other suitable material , are attached by hinges 162 to the side edges of bed panel 142 and may be positioned about these hinges into either a vertical upright position as shown in fig1 through 3 and as panel 158 l is shown on the near side of fig5 . or the panels may be laid down horizontally to rest against the extended extension frames 150 l and 150 r and be coplanar with bed panel 142 , as shown in fig6 a and 10 , and as panel 158 r is shown on the distant side of fig5 . bracket 164 is permanently affixed to side panels 158 l and 158 r and disposed and configured to capture extension bars 152 a and 152 d when the panels are in their horizontal position . pin clip sets 122 are inserted though aligning holes in brackets 164 and the extension bars to temporarily rigidly hold the panels to the extension bars . front panel 168 made of flat or embossed steel sheeting , plywood , or any other suitable material , is attached by hinges 162 to the front edge of bed panel 142 and may be positioned about these hinges into either a vertical upright position as shown in fig1 through 3 , 5 , 7 and 12 , and as shown in solid line in fig6 b . or the panel may be laid down horizontally so that c - channel 170 rests against the hitch bar 134 and is thereby coplanar with bed panel 142 , as shown in fig1 and 11 and in broken line in fig6 b . pin clip set 122 is inserted though aligning holes in c - channel 170 and hitch bar 134 to temporarily rigidly hold the panel to the hitch bar . when front panel 168 is in its upright vertical position , it is supported by front panel supports 174 , which each comprise vertical support member 176 and square horizontal bar portion 178 that is sized and shaped to fit snugly and removably within the square hollow interior of either longitudinal beam 108 a or 108 c , into which it is temporarily affixed by pin / clip set 122 . wing panels 180 r and 180 l made of flat or embossed steel sheeting , plywood , or any other suitable material , are attached by hinges 162 to the forward edges of side panels 158 r and 158 l respectively , and each may be positioned about these hinges into either an upwardly or inwardly directed perpendicular position or a coplanar position , relative to the side panel . as shown in fig1 through 3 and as wing panel 180 l is shown on the near side of fig5 and in broken line in fig6 a , the inwardly directed position of the wing panel 180 r or 180 l , when the side panel 158 r or 158 l is in its vertical position , serves to support the vertically positioned front panel 168 when the trailer 100 is configured as a box trailer or folded compactly for storage . pin / clip set 122 is positioned through aligning holes in the wing and front panels to temporarily rigidly connect the panels . in its box trailer configuration 100 b shown in fig1 , the trailer is especially adapted to carry payloads in need of side support and wind protection , such as dirt or leaves . alternatively , the wing panels 180 r and 180 l may be laid down horizontally to be coplanar with bed panel 142 , as shown in fig1 , when the trailer 100 is configured as a flat - bed trailer 100 fb . pin / clip sets 122 ( not shown ) or some other fastening means temporarily rigidly connect the front and wing panels . in its flat - bed trailer configuration shown in fig1 , the trailer is especially adapted to carry large payloads in need of a wide and flat support surface , such as plywood or paneling . or the wing panels 180 r and 180 l may be extended coplanar with the side panels 158 r and 158 l and perpendicular to the horizontally positioned front panel 168 and bed panel 142 , as shown in fig1 , when the trailer 100 is configured as a side - paneled trailer 100 s . pin / clip sets 122 ( not shown ) or some other fastening means temporarily rigidly connect the front and wing panels . in its side - paneled trailer configuration shown in fig1 , the trailer is especially adapted to carry long payloads such as lumber or piping . or , as shown in solid line in fig6 a and as wing panel 180 r is shown on the far side of fig5 , the upwardly directed position of wing panel 180 r or 180 l , when the side panel 158 r or 158 l is in its horizontal position , serves as an extension of the vertically positioned front panel 168 when the trailer 100 is configured as a front - paneled trailer 100 fp as shown in fig1 . pin / clip sets 122 ( not shown ) or some other fastening means temporarily rigidly connect the front and wing panels . in its front - paneled trailer configuration shown in fig1 , the trailer is especially adapted to carry wide payloads in need of protection from wind and road grime , such as a snowmobiles or a motorcycle . upon the completion of use of the trailer 100 in whichever configuration had been used , trailer 100 can be easily and quickly folded up into a compact configuration for storage as shown in fig5 , and can be easily and conveniently stored into the very vehicle which had been towing it , as shown in fig8 a to 8 c , and can be secured and stored within the vehicle , as shown in fig9 . referring to fig5 , conversion of trailer 100 into its compact storage configuration is shown . first , front panel 168 , side panels 158 r and 158 l , wing panels 180 r and 180 l are configured and affixed into the same positions as those used and described above for the box trailer configuration . extension frames 150 r and 150 l are either pushed inward to their retracted positions or removed and stored within the trailer , hitch assembly 132 is disconnected from truck 204 and is either pushed inward into its retracted position or removed and stored within the trailer , and wheel assemblies 116 r and 116 l are removed and stored as shown within the trailer . holes are strategically positioned about the retailer panels so that those pin / clip sets used to fix each of these removed components may be temporarily rigidly fixed in a secure position within the trailer during storage . referring to fig8 a through 8c , the process of storing the compacted trailer 100 c into the vehicle and the system for doing so is shown . system 200 comprises a pair of longitudinal guide channels 202 r and 202 l which are permanently affixed within the vehicle , such as within the bed 206 of a truck 204 , transversely aligned support rollers 208 r and 208 l , which are permanently affixed to the inner surface of the truck &# 39 ; s rear hatch 212 , and transversely aligned guide rollers 214 r and 214 l , which extend outwardly from longitudinal beams 108 a and 108 c . support rollers 208 r and 208 l are positioned and arranged to be aligned with and support the undersides of beams 108 c and 108 a respectively , so that a lone person may easily lift just the forward end of the compacted trailer 100 c onto the rear hatch 212 and position beams 108 a and 108 c onto the support rollers 208 l and 208 r , respectively , then walk around to the rear end of the trailer and lift the trailer for easily aligning it for storing . guide channels 202 r and 202 l are positioned for alignment with and are shaped and configured to receive guide rollers 214 r and 214 l , respectively , so that the person can simply push and roll the compacted trailer 100 c into the truck bed 206 much in the way a cabinet drawer is pushed in . once trailer 100 c is fully inserted into truck bed 206 , it is secured in place either by merely closing hatch 212 or by the use of pin / clip sets 122 through holes ( not shown ) in guide channels 202 r and 202 l to temporarily deny longitudinal movement of the trailer relative to the channels . reversal of the storing process is followed to take the trailer out at the convenience of such a lone person , and to hitch it to the vehicle and configure it for the desired type of use . it should be obvious to those skilled in the art that the afore - described is merely one of many possible embodiments of the invention , and is not intended to limit the scope of the invention in any way . the invention is therefore best characterized by and should only be limited by the following claims ; | 1 |
the end plating machine of this invention is referred to generally by the reference number 10 while the reference number 12 refers to an elongated wood tie which is to be end plated . for purposes of discussion , tie 12 will be described as having opposite ends 14 and 16 . generally speaking , machine 10 includes a frame means 18 including end frames 20 and 22 which have a supporting structure 24 extending therebetween . the numeral 26 designates an in - feed conveyor for positioning the tie 12 , and successive ties , between the end frames 20 and 22 in a manner such as disclosed in u . s . pat . no . 4 , 513 , 900 . machine 10 is also provided with an out - feed conveyor 28 for rotating the end plated tie out of the machine 10 and for conveying the tie away from the machine . machine 10 further includes a tie squeezing or clamping apparatus 30 adjacent the inner end of end frame 20 and a tie squeezing or clamping apparatus 32 adjacent the inner end of end frame 22 for squeezing or clamping the opposite ends of the tie 12 to close splits or cracks in the tie prior to the end plating operation . the tie clamping apparatuses 30 and 32 are preferably constructed similar to that disclosed in u . s . pat . nos . 4 , 513 , 900 or 4 , 657 , 168 . as seen in fig6 c , machine 10 also includes a pivotal tie sensing arm 34 which is pivoted by cylinder 36 and which is adapted to engage the rearward end of the tie 12 to sense the thickness of the tie 12 , through microswitch 38 . if a tie 12 larger than that shown in fig6 c is introduced into the machine , arm 34 will be prevented from activating microswitch 38 due to the thicker tie preventing movement of sensing arm 34 towards microswitch 38 . if a thicker tie is sensed , a larger end plate will be driven into each end of that particular tie . inasmuch as the structure on each of the end frames 20 and 22 is substantially identical , only the structure on end frame 20 will be described in detail with &# 34 ;&# 39 ;&# 34 ; indicating identical structure on end frame 22 . a horizontally disposed power ram 40 is mounted on end frame 20 outwardly or laterally of the end of the tie 12 when it is positioned in the tie clamping apparatus 30 . ram 40 includes a magnetic head 42 for magnetically supporting a metal end plate thereon . for purposes of description , the numeral 44 will designate the smaller end plate handled by the machine 10 for smaller ties while the numeral 46 will designate the larger end plate for larger ties . each of the end plates 44 and 46 includes a plurality of teeth 48 extending from one side thereof which are driven into the end of the tie as will be described in greater detail hereinafter . a plurality of end plates 44 are stacked one upon the other in a horizontally disposed manner , with the teeth 48 thereof extending upwardly therefrom , in end plate station or hopper 50 mounted on end frame 20 . similarly , a plurality of end plates 46 are positioned in end plate station or hopper 52 . the lower ends of hoppers 50 and 52 are open so as to be in selective communication with openings 56 and 58 , respectively , of shuttle plate 54 which is selectively horizontally movable with respect to hoppers 50 and 52 by means of hydraulic cylinder 60 . hoppers 50 and 52 are provided with hopper closure assemblies 62 and 62 &# 39 ; thereon , respectively , which are provided to selectively close the lower end thereof . inasmuch as hopper closure assemblies 62 and 62 &# 39 ; are identical , only assembly 62 will be described in detail with &# 34 ;&# 39 ;&# 34 ; identifying identical structure on assembly 62 &# 39 ;. hopper closure assembly 62 includes a pair of arms 64 and 66 which are pivoted to the supporting structure of hopper 50 at 68 and 70 , respectively . arm 64 is pivotally connected to hydraulic cylinder 72 at 74 as seen in fig3 d . arm 64 is provided with a &# 34 ; knuckle &# 34 ; 76 which is movably received by opening 78 in arm 66 so that pivotal movement of arm 64 will cause pivotal movement of arm 66 , as illustrated in the drawings . arms 64 and 66 have a plurality of fingers 80 and 82 extending inwardly therefrom , respectively , which are designed to close the lower end of hopper 50 when in the position of fig3 d and to aid in separating the stack of end plates 44 in hopper 50 from the end plate positioned in the opening 56 of shuttle plate 54 , as will be described hereinafter . the numeral 84 refers generally to a plate elevator assembly which is positioned below the shuttle plate 54 and which includes a frame 86 pivotally mounted to end frame 20 at 88 . frame 86 includes a link arm 90 which is pivotally connected to hydraulic cylinder 92 at 94 . frame 86 has a hydraulic cylinder 96 mounted thereon which has a magnetic elevator plate 98 mounted on the end of its cylinder . when cylinder 92 is extended to the position of fig4 b , elevator plate 98 is positioned below shuttle plate 54 . when cylinder 92 is retracted , frame 86 is pivoted from the position of fig4 b to the position of fig4 c so that hydraulic cylinder 96 is horizontally disposed and so that elevator plate 98 is positioned inwardly of opening 100 formed in end frame 50 . extension of hydraulic cylinder 96 from the position of fig4 c to the position of fig4 d causes elevator plate to move towards opening 100 . the numeral 102 refers generally to a transfer arm assembly provided on end frame 50 and which includes a transfer arm 104 mounted on shaft 106 for movement therewith . the outer end of transfer arm 104 is provided with a plate holding portion 108 which has a plurality of openings 110 formed therein adapted to receive the teeth 48 of one of the end plates 44 or 46 to support the end plate thereon . transfer arm assembly 102 includes a hydraulic cylinder 112 for rotating transfer arm 104 from the position of fig4 d to the position of fig5 a and vice versa . further , transfer arm assembly 102 includes a hydraulic cylinder 114 for moving transfer arm 104 outwardly from the position of fig5 a to the position of fig5 b to free the transfer arm 104 from the end plate once the end plate has been placed on the magnetic head 42 of the power ram 40 as will be explained in greater detail hereinafter . prior to the beginning of the end plating operation , the various components of the machine are in the position illustrated in fig2 and 6b . fig6 b illustrates that a tie 12 is being delivered to the plating machine following the end plating of a preceding tie 12 which is illustrated on the left hand side of fig6 e . the tie 12 moves forward on the in - feed conveyor 26 until incoming tie 12 engages switch 116 and comes to rest against stop 118 . the tie sensing arm 34 is then pivotally moved from the position of fig6 a to the position of fig6 b until it engages the rearward side of the larger tie 12 . the engagement of the forward end of the tie sensing arm 34 with the rearward end of the tie 12 prevents the tie sensing arm 34 from moving into engagement with the switch 38 which indicates to the circuitry of the machine that a larger tie is being fed into the machine . if a smaller tie such as illustrated in fig6 c is sensed by the tie sensing arm 34 , the switch 38 is actuated so that the circuitry of the machine recognizes that a smaller tie is being fed into the machine which requires that a smaller end plate 44 such as those contained in hoppers 50 and 50 &# 39 ; must be driven into the ends of the smaller tie . if a larger tie is being received by the machine , end plates 46 from the hoppers 52 and 52 &# 39 ; will be transported to the ends of the tie and driven thereinto . once the thickness of the tie 12 has been sensed , the machine moves the tie from the position illustrated in fig6 b into the position illustrated in fig6 f . at that time , the tie clamping apparatus 30 and the clamping apparatus 32 will squeeze or clamp the ends of the tie to close any splits or cracks therein . inasmuch as the end plating operation at each end of the tie is identical , only the end plating operation at one end of the tie will be described in detail . assuming that a larger tie has been sensed by the tie sensing arm 34 , the shuttle plate 54 is moved to the position illustrated in fig4 c so that the opening 58 in end plate 54 is positioned directly below the stack of end plates 46 in hopper 52 . in this position , the fingers 80 &# 39 ; and 82 &# 39 ; are initially positioned beneath the lowermost end plate 46 in hopper 52 . the arms 64 &# 39 ; and 66 &# 39 ; are then pivotally moved from the position of fig4 c to the position of fig3 b so that the stack of end plates moves downwardly in hopper 52 which results in the lowermost end plate 46 being positioned in the opening 58 in shuttle plate 54 . the arms 64 &# 39 ; and 66 &# 39 ; are then pivotally moved from the position of fig3 b to the position of fig3 c which causes the end plates 46 , above the lowermost end plate 46 , to be raised with respect to the lowermost end plate 46 so that the lowermost end plate 46 is separated from the end plates thereabove . during this time , the plate elevator 84 is in the position illustrated in fig3 b so that the magnetic elevator plate 98 is facing upwardly as seen in fig3 e . the hydraulic cylinder 60 is then actuated which causes the shuttle plate 54 to be moved from the position of fig3 c to the position of fig3 d which results in the end plate 46 coming into contact with the magnetic elevator plate 98 and to be magnetically connected thereto . if the machine had sensed that a smaller tie was being introduced into the machine , the shuttle plate 54 would have been initially moved into the position illustrated in fig3 d so that opening 56 in shuttle plate 54 was positioned directly below the end plates 44 in hopper 50 . the arms 64 and 66 would then have been pivotally moved outwardly from the position of fig3 d to permit the lowermost plate 44 in the stack of plates in hopper 50 to move into the opening 56 in shuttle plate 54 . the arms 64 and 66 would then be pivotally moved towards one another so that the fingers 80 and 82 would pass between the lowermost plate 44 and the remaining plates in the stack of plates in hopper 50 . the shuttle plate 54 would then be moved from the position of fig3 e to a position wherein plate 44 is able to come into contact with the magnetic elevator head 98 . assuming that a plate 44 has been delivered to the magnetic elevator head 98 , an adjustment must be made of the position of the plate 44 thereon since a smaller tie has been sensed . the circuitry of the machine , after having sensed a smaller tie 12 , and after having delivered a smaller plate 44 to the magnetic elevator head 98 , causes the activation or retraction of cylinder 130 which rotates shaft 132 from the position ol fig3 g to the position of fig3 h . the rotation of shaft 132 to the position ol fig3 h causes the fingers 134 on shaft 132 to engage plate 44 ( fig3 h ) to shift or move plate 44 on elevator head 98 so that plate 44 will be properly positioned on elevator head 98 corresponding to the smaller tie 12 which is to be end plated . assuming that a plate 46 has been delivered to the magnetic elevator head 98 , the hydraulic cylinder 96 is then retracted so that the elevator head 98 moves from the position of fig4 a to the position of fig4 b . after the elevator head 98 and the plate 46 thereon has been moved to the position illustrated in fig4 b , hydraulic cylinder 92 is retracted so that the frame 86 is pivoted from the position of fig4 b to the position of fig4 c to align end plate 46 with the opening 100 and to align end plate 46 with the plate holding portion 108 of transfer arm 104 which is positioned outwardly of opening 100 . hydraulic cylinder 96 is then extended so that the magnetic elevator head 98 and the plate 46 thereon are moved from the position of fig4 c to the position illustrated in fig4 d . in the position of fig4 d , the teeth of the end plate 46 engage the openings 110 in the plate holding portion 108 of the transfer arm 104 to positively connect the plate 46 to the arm 104 . transfer arm 104 is then pivotally moved from the position of fig4 d to the position of fig5 a by the hydraulic cylinder 112 . the rotational movement of the transfer arm 104 from the position of fig4 d to the position of fig5 a causes the plate 44 to magnetically disengage from the magnetic elevator head 98 . when the transfer arm 104 and the plate 46 have been pivotally moved to the position of fig5 a , the plate 46 is magnetically connected to the magnetic head 42 of the power ram 40 . transfer arm 104 is then laterally moved from the position of fig5 a to the position of fig5 b by the hydraulic cylinder 114 to cause the transfer arm 104 to disengage from the plate 104 which is maintained in position on the magnetic head 42 of the power ram 40 . the transfer arm 104 is then rotated from the position of fig5 b to the position of fig5 c . at that time , hydraulic cylinder 114 is retracted to cause the transfer arm 104 to move from the position of fig5 c to the position of fig5 d . at that time , or simultaneously therewith , the power ram 40 is moved outwardly towards the end of the tie 12 to drive the plate 46 into the end of the tie which is being clamped or squeezed by the tie clamping mechanism 30 . it should be noted that while the sequence above is occurring , the identical sequence is occurring at the opposite end of the tie . further , it should be noted that while the transfer arms 104 and 104 &# 39 ; are positioning the plates and the power rams are driving the plates into the ends of the tie , the next tie would have already been sensed and the plate transfer process commenced . after end plating , the tie is released from the clamping apparatuses 30 and 32 and moved out of the machine . fig1 illustrates what is believed to be a novel method of bundling a stack of end plates to enable the same to be easily handled and to be inserted into one of the end plate hoppers on the machine . a plurality of end plates 46 ( or plate 44 if the smaller plates are being handled ) are stacked one upon the other as seen in fig1 so that the teeth thereof extend upwardly . a flexible strap 140 is placed around the stack of end plates 46 to maintain the end plates 46 in the stacked condition . handle or loop 142 is provided on the strap 140 as seen in fig1 . the entire stack may then be lifted by the handle 142 and placed in the proper hopper 50 , 50 &# 39 ;, 52 or 52 &# 39 ; in the machine 10 . once the stack is in the hopper , the strap 140 may be cut and removed from the stack . thus it can be seen that a novel end plating machine has been provided which end plates a tie without the need for initially hand tacking the end plates onto the ends of the tie . further , it can be seen that a novel end plating machine has been provided which enables ties of different dimensions to be automatically end plated . thus , it can been seen that the invention accomplishes at least all of its stated objectives . | 1 |
[ 0018 ] fig1 is a diagrammatic view of a continuous feed drilling system constructed in accordance with an exemplary embodiment of the present invention shown in elevation . a continuous feed drilling system includes a continuous feed drill head assembly 102 having a first chuck 122 and a second chuck 124 . a drill stem 112 passes through the continuous feed drill head assembly and is engaged by the first and second chucks . the drill stem is typically advanced into a previously drilled bore hole 114 drilled through an overburden 116 to a strata of interest 118 . the drill stem further includes a core drill bit 120 fixedly coupled to the drill stem . in operation , an operator uses a user input panel 108 to open both of the chucks and the operator inserts a drill stem 112 axially through them . the operator then closes both chucks . the operator selects a penetration rate for the drill bit and feed direction and initiates rotation of the chucks . the operator continues to monitor the continuous feed drilling system using a user display 106 . depending on where the chucks are in a continuous drilling cycle , one chuck opens and the other chuck remains closed . the closed chuck advances in the selected feed direction at the selected penetration rate . as the closed chuck advances , the open chuck retracts until the open chuck reaches a specified limit near the end of the open chuck &# 39 ; s stroke in the retracted direction . when the closed chuck reaches a specified advancement limit near the end of the closed chuck &# 39 ; s stroke in the feed direction , the open chuck begins moving in the selected feed direction until the open chuck &# 39 ; s linear velocity matches the actual linear velocity of the closed chuck . the open chuck then closes and continues to advance while the previously closed chuck opens and retracts . the process repeats indefinitely , thus providing a continuous drilling motion . the continuous feed drill head assembly further includes a rotary drive 121 operatively coupled to a power source 104 via a transmission 105 . the first and second chucks are slidably coupled to the rotary drive via a first keyed drive rod 126 and a second keyed drive rod 127 respectively . each keyed drive rod is fixedly coupled to the keyed drive rod &# 39 ; s corresponding chuck . in operation , the rotary drive rotates the keyed drive rods causing the chucks to rotate . as the keyed drive rods are coupled to the same rotary drive , the rotational velocities of the chucks are synchronous regardless of the linear positioning of the chucks . the first chuck is moveably coupled to the rotary drive via a first set of linear actuators such as hydraulic feed cylinders 128 . the first set of hydraulic feed cylinders is operable to slidably move the first chuck in relation to the rotary drive . the second chuck is moveably coupled to the rotary drive via a second set of hydraulic feed cylinders 130 . the second set of hydraulic feed cylinders is operable to slidably move the second chuck in relation to the rotary drive . a first linear transducer 134 extends between the first chuck and the rotary drive . the first linear transducer generates a signal proportional to the position of the first chuck . a second linear transducer 136 extends between the first chuck and the rotary drive . the second linear transducer generates a signal proportional to the position of the second chuck . a suitable linear transducer is model # btl - 5 - a11 - m0178 - p - k05 manufactured by balluff inc . of florence , ky . a controller 138 is operatively coupled to the continuous feed drill head assembly via valves and pressure transducers included in a hydraulic control system 140 . the controller receives user input signals from the user input panel and utilizes those signals to initiate and terminate the controller &# 39 ; s operation of the continuous feed drill head assembly . the controller further supplies electrical control signals to servo control valves included in the hydraulic control system . the control signals are transduced by the hydraulic control system into hydraulic control signals and power inputs to actuate the continuous feed drill head assembly . the continuous feed drilling system rests on the overburden and the overburden is above the strata of interest . this relationship is exemplary in that the continuous feed drilling system can be operated in any relationship with respect to the overburden and strata of interest . for example , the continues feed drilling system can be configured to operate in a horizontally oriented bore hole , or a bore hole above the continuous feed drilling system , as might be required in a cave or an underground mine . in the exemplary relationship , the drill stem is advanced down into the bore hole in order to reach the strata of interest . in the exemplary relationship , “ penetration rate ” is herein defined as the linear velocity at which a drill bit attached to the drill stem penetrates the strata of interest . the penetration rate of the drill bit is determined by the linear velocity of a chuck engaged to the drill stem . in the exemplary relationship , “ advancing a chuck ” is herein defined as moving a chuck such that the drill stem is fed into the bore hole or the drill bit penetrates the strata of interest . in the exemplary relationship , the first chuck is advanced by moving the first chuck away from the rotary drive in order to feed the drill stem into the bore hole . in a like manner , the second chuck is advanced by moving the second chuck toward the rotary drive to feed the drill stem into the bore hole . in the exemplary relationship , “ retracting a chuck ” is herein defined as moving a chuck opposite to its advancing direction . in the exemplary relationship , the first chuck is retracted by moving the first chuck toward the rotary drive . in a like manner , the second chuck is retracted by moving the second chuck away from the rotary drive . [ 0029 ] fig2 is a block diagram of an exemplary control system for a continuous feed drill head assembly in accordance with the present invention . a first linear transducer 134 is operably coupled to a controller 138 . the first linear transducer generates a first position signal 200 in response to the movement of a first chuck 122 . the first position signal is transmitted to the controller . a second linear transducer 136 is operably coupled to the controller . the second linear transducer generates a second position signal 202 in response to the movement of a second chuck 124 . the second position signal is transmitted to the controller . a user input panel 108 includes switches for generating user input signals 204 that are transmitted to the controller . the controller receives the first and second position signals , and the user input signals , and uses the signals to generate continuous feed drill head assembly control signals 206 . the continuous feed drill head assembly control signals are transmitted to a hydraulic control system 140 . the hydraulic control system uses the continuous feed drill head assembly control signals to generate first chuck hydraulic control signals 208 and transmits the first chuck hydraulic control signals to the first chuck . additionally , the hydraulic control system uses the continuous feed drill head assembly control signals to generate second chuck hydraulic control signals 210 and transmits the second chuck hydraulic control signals to the second chuck . the controller also generates user display signals 212 and transmits them to a user display panel 106 . the user display uses the user display signals to generate a user display for use by a user . the user input panel and the user display panel are operably coupled to the hydraulic control system . the user input panel includes valves for generating hydraulic user input signals 214 that are transmitted to the hydraulic control system . the hydraulic control system also generates hydraulic user display signals 216 that are transmitted to the user display panel . [ 0032 ] fig3 is a process flow diagram describing an exemplary operational sequence of a continuous feed drill head assembly in accordance with the present invention . the process starts 300 with first and second chucks 122 and 124 open and a drill stem 112 inserted in a continuous feed drill head assembly 102 ( all of fig1 ). the controller determines ( 302 ) which chuck is to be advanced and which is to be retracted . the controller closes the chuck to be advanced so that the drill stem is engaged by the advancing chuck . the controller simultaneously advances ( 304 ) the advancing chuck and retracts ( 305 ) the retracting chuck . the advancing chuck continues to move during the controller &# 39 ; s processing of the retracting chuck . once the retracting chuck is fully retracted , the processor monitors the position of the advancing chuck using the previously described corresponding linear transducer 134 or 136 ( both of fig2 ) to determine the position of the advancing chuck . when the controller determines ( 307 ) that the advancing chuck reaches a specified limit near the end of the advancing chuck &# 39 ; s stroke in the feed direction , the controller starts advancing the retracted chuck in the feed direction . once the retracted chuck is moving in the feed direction , the controller determines ( 309 ) the actual linear velocity of the advancing chuck using the corresponding linear transducer . the controller synchronizes the linear velocity of the retracted chuck with the linear velocity of the advancing chuck using the retracted chuck &# 39 ; s corresponding linear transducer . at this point , the linear velocities of the chucks are synchronized . the controller closes ( 314 ) the retracted chuck resulting in both the chucks being closed with their linear velocities synchronized . the controller then determines ( 318 ) which chuck is to be the new retracting chuck and opens the new retracting chuck . the controller repeats the above - described sequence of operations indefinitely from operation 304 thus generating a continuous advancement of the drill stem into a bore hole . in one embodiment of a continuous feed drilling system control process in accordance with the present invention , the closed chuck is advanced to substantially 1 ″ of the end of its stroke in the feed direction before the controller synchronizes the linear velocity of the open chuck with the linear velocity of the closed chuck . fig4 is a diagram of one form of continuous feed drill head assembly in accordance with the present invention . a continuous feed drill head assembly 102 includes a first chuck 122 and a second chuck 124 . a first keyed drive rod 126 , rotatably coupled to the first chuck , and a second keyed drive rod 127 , rotatably coupled to the second chuck , are slidably coupled to a rotary drive 121 . a drill stem 112 passes through the second chuck , an interior portion ( not shown ) of the second keyed drill rod , an interior portion ( not shown ) of the first keyed drill rod , and through the first chuck . application of a rotary force to the keyed drive rods by the rotary drive causes the chucks to apply a rotary force to an engaged drill stem . furthermore , rotational velocity of the keyed drill rods , and thus the chucks , is synchronous because the keyed drill rods are driven by the same rotary drive . the first chuck is coupled to the rotary drive for relative translational motion by a plurality of first hydraulic feed cylinders 408 and 409 . the second chuck is moveably coupled to the rotary drive via a plurality of second chuck actuators 410 and 411 . in an embodiment of a continuous feed drill head assembly in accordance with the present invention , the hydraulic feed cylinders have dual rods fixedly attached to a single piston slidably housed within an interior portion ( not shown ) of the hydraulic cylinders . the chucks may be moved longitudinally in relation to the rotary drive by a differential in pressurization on each side of the piston . for example , higher pressurization of the chuck side of one of the hydraulic feed cylinders causes a chuck to move closer to the rotary drive . conversely , higher pressurization of the rotary drive side of one of the hydraulic feed cylinders causes the corresponding chuck to move away from the rotary drive . in this way , the position of each of the chucks relative to the rotary drive may be controlled . in an embodiment of a continuous feed drilling system in accordance with the present invention , the chucks are moved in relation to the rotary drive via servo valves coupled to each side of the piston in the hydraulic feed cylinders . during movement of a chuck , there is always pressure on both sides of the piston . a top side of the piston is coupled to a “ pull down gauge ” and a bottom side of the piston is coupled to a “ hold back gauge ”. a differential pressure as determined by reading these two gauges may be used by an operator to determine a relative bit weight on a bit . when the differential pressure is higher on the top side of the piston , the continuous feed drilling system is operating in the pull down mode . when the differential pressure is higher on the bottom side of the piston , the continuous feed drilling system is operating in the hold back mode ( that is applying pressure to the lower side of the cylinder to hold back a fraction of the string weight ). rotary motion is imparted to the two chucks by the rotary drive via keyed drive rods . a keyed drive rod is slidably coupled to the rotary drive and fixedly coupled to the chuck . as the keyed rod moves with the chuck , it slides within the rotary drive . in this way , rotary motion can be applied to a chuck by the rotary drive anywhere along the chuck &# 39 ; s stroke as the chuck is moved either closer to or further from the rotary drive . finally , because each chuck has its own hydraulic feed cylinder ( s ), the relative position of the chucks from the rotary drive my be independently adjusted by pressurizing the appropriate hydraulic feed cylinder ( s ). forces are applied to a drill stem using the hydraulic feed cylinders . as previously described , a chuck may be engaged with the drill stem such that the drill stem is rotated by the chuck . movement of the chuck relative to the rotary drive also causes the drill stem engaged by the chuck to move longitudinally relative to the rotary drive . in a like manner , any force applied to the chuck will be applied to the drill stem engaged to the chuck . in this way , a continuous feed drilling system can apply forces to a drill stem in order to force a drill bit fixedly coupled to the drill stem against a strata of interest . a continuous feed drill head assembly further includes a first linear transducer 134 coupled between the rotary drive and the first chuck and a second linear transducer 136 coupled between the rotary drive and the second chuck . the linear transducers generate position signals , 200 and 202 , proportional to the position of the chucks . the position signals are received by a controller 138 operably coupled to the linear transducers . the controller uses the position signals to generate continuous feed drill head assembly control signals 206 that are transmitted to a hydraulic control system 140 . the hydraulic control system receives the continuous feed drill head assembly control signals and uses them to generate chuck hydraulic control signals 208 and 210 and transmits the chuck hydraulic control signals to the actuators included in the continuous feed drill head assembly . [ 0043 ] fig5 is an exploded perspective view of an exemplary embodiment of a chuck in accordance with the present invention . a continuous feed drill head assembly includes a plurality of chucks . a chuck 500 includes a crosshead adapter 502 moveably attached to a chuck assembly housing 504 via a plurality of actuators 505 ( one is shown ). a cylinder portion of the actuator is fixedly attached to the chuck assembly housing . a first end of a rod portion of the actuator is fixedly attached to the crosshead adapter . a second end of the rod portion is fixedly attached to a rod side of a piston ( not shown ) slidably housed within the cylinder portion of the actuator . the piston further includes a cylinder side opposite the rod side . pressurization of the rod side of the piston causes the crosshead adapter to move closer to the chuck assembly housing . pressurization of the cylinder side of the piston causes the crosshead adapter to move away from the chuck assembly housing . the chuck further includes a drive rod adapter 507 slidably and rotatably housed within the chuck assembly housing . a plurality of tapered jaws 508 , 509 , and 510 , are moveably coupled to the drive rod adapter . the plurality of tapered jaws and drive rod adaptor are slidably housed within an inner sleeve 511 . the inner sleeve includes a plurality of tapered interior grooves 512 , 514 , 516 corresponding to the plurality of tapered jaws . in operation , a traction force applied to a base portion 512 of the drive rod adapter causes the tapered jaws to slide along the tapered interior grooves of the inner sleeve such that the jaws close by moving closer together . a drill stem ( not shown ) passing through the drive adaptor can thus be engaged by the closed tapered jaws . removal of the traction force causes the tapered jaws to open by moving further apart in response to the force of a jaw retraction spring 518 . in this way , the drill stem can be selectively engaged and released by applying and relaxing traction forces to the base portion of the rod adaptor causing the jaws to close and open . a chuck further includes a crosshead 520 fixedly coupled to a bottom portion 521 of the crosshead adaptor . the crosshead adaptor is rotatably coupled to a keyed drive rod 522 . the keyed drive rod passes through the crosshead and is fixedly attached to the base portion of the drive rod adapter . pressurization of the cylinder side of the piston slidably housed in the cylinder of the actuator causes the crosshead to move further from the chuck assembly housing . additionally , such pressurization generates a traction force which is applied to the base portion of the drive rod adaptor by the keyed drive rod rotatably coupled to the crosshead . in this manner , pressurization of the actuator allows the chuck to selectively clamp on to a drill stem . subsequent rotation of the keyed drive rod causes rotation of the engaged drill stem . release of pressure results in release of the drill stem . once released , rotation of the keyed drive rod does not result in rotation of the drill stem . [ 0046 ] fig6 is a schematic of an exemplary hydraulic control system for controlling a continuous feed drill head assembly in accordance with the present invention . a hydraulic control system 140 includes a plurality of hydraulic control valves 603 , 605 , 607 , and 608 . each of the hydraulic control valves is electrically coupled to a controller 138 . each of the hydraulic control valves is hydraulically coupled to a hydraulic pump 601 . a first actuator control valve 603 is operably coupled to previously described first chuck actuators 408 and 409 . in a first position , the first actuator control valve pressurizes the first chuck actuators such that a first chuck clamps on to a drill stem as previously described . in a second position , the first actuator control valve pressurizes the first chuck actuators such that the first chuck releases the engaged drill stem as previously described . a second actuator control valve 608 is operably coupled to previously described second chuck actuators 410 and 411 . in a first position , the second actuator control valve pressurizes the second chuck actuators such that a second chuck clamps on to a drill stem as previously described . in a second position , the second actuator control valve pressurizes the second chuck actuators such that the second chuck releases the engaged drill stem as previously described . a first servo control valve 605 is operably coupled to previously described first hydraulic feed cylinders 412 and 413 . in a first position , the first servo control valve pressurizes the first hydraulic feed cylinders such that a first chuck is advanced . in a second position , the first servo control valve pressurizes the first hydraulic feed cylinders such that the first chuck is retracted . a second servo control valve 607 is operably coupled to previously described second hydraulic feed cylinders 410 and 411 . in a first position , the second servo control valve pressurizes the second hydraulic feed cylinders such that a second chuck is advanced . in a second position , the second servo control valve pressurizes the second hydraulic feed cylinders such that the second chuck is retracted . the hydraulic control system further includes a plurality of pressure transducers 610 , 612 , 614 , 616 , 618 , 620 , 622 , and 624 . the pressure transducers are each electrically coupled to the controller . a first drill stem engaged pressure transducer 612 is hydraulically coupled to first chuck actuators 409 and 408 . the first drill stem engaged pressure transducer generates a first drill stem engaged signal when pressure is applied to the first chuck actuators such that the first chuck clamps on to a drill stem as previously described . a first drill stem released pressure transducer 610 is hydraulically coupled to first chuck actuators 409 and 408 . the first drill stem released pressure transducer pressure transducer generates a first drill stem released signal when pressure is applied to the first chuck actuators such that the first chuck will release an engaged drill stem as previously described . a second drill stem engaged pressure transducer 624 is hydraulically coupled to second chuck actuators 406 and 407 . the second drill stem engaged pressure transducer generates a second drill stem engaged signal when pressure is applied to the second chuck actuators such that the second chuck will clamp on to a drill stem as previously described . a second drill stem released pressure transducer 622 is hydraulically coupled to second chuck actuators 406 and 407 . the second drill stem released pressure transducer generates a second drill stem released signal when pressure is applied to the second chuck actuators such that the second chuck will release an engaged drill stem as previously described . the controller receives the first and second drill stem engaged and released signals transmitted from pressure transducers 610 , 612 , 622 , and 624 . the controller uses the first and second drill stem engaged and released signals to determine which chuck is currently engaged onto the drill stem . additionally , the controller can generate error signals using the first and second drill stem engaged and released signals . for example , if the controller energizes a chuck &# 39 ; s actuator control valve such that the chuck should release an engaged drill stem and the controller does not receive a corresponding drill stem released signal , then the controller can generate an error signal indicating a malfunction somewhere in the hydraulic system . a first advance pressure transducer 618 is operably coupled to first hydraulic feed cylinders 410 and 411 . the first advance pressure transducer generates a first advance signal when pressure is applied to the first hydraulic feed cylinders such that a first chuck is advanced as previously described . a first retract pressure transducer 620 is hydraulically coupled to previously described first hydraulic feed cylinders . the first retract pressure transducer generates a first retract signal when pressure is applied to the first hydraulic feed cylinders such that the first chuck is retracted as previously described . a second advance pressure transducer 614 is operably coupled to second hydraulic feed cylinders 412 and 413 . the second advance pressure transducer generates a second advance signal when pressure is applied to the second hydraulic feed cylinders such that a second chuck is advanced as previously described . a second retract pressure transducer 616 is hydraulically coupled to the second hydraulic feed cylinders . the second retract pressure transducer generates a second retract signal when pressure is applied to the second hydraulic feed cylinders such that the second chuck is retracted as previously described . an exemplary continuous feed drilling system in accordance with the present invention includes a user interface that mimics a user interface for a drill with a single chuck . the hydraulic control system further includes an advance pressure gauge 630 , known in the art as a “ pull down gauge ”. the advance pressure gauge is operatively coupled to an advance pressure selection valve 626 . the advance pressure selection valve is hydraulically coupled to previously described first advance pressure transducer 620 and second advance pressure transducer 614 . the advance pressure selection valve is electrically coupled to previously described controller 138 . the controller transmits advance pressure selection signals ( not shown ) to the advance pressure selection valve in order to selectively apply pressure to the advance pressure gauge . in this manner , the controller can apply to the advance pressure gauge an advance pressure of previously described advanced chuck 122 ( fig1 ). the hydraulic control system further includes a retract pressure gauge 632 , known in the art as a “ hold back gauge ”. the retract pressure gauge is operatively coupled to a retract pressure selection valve 628 . the retract pressure selection valve is hydraulically coupled to previously described first retract pressure transducer 616 and second retract pressure transducer 620 . the retract pressure selection valve is electrically coupled to the controller . the controller transmits retract pressure selection signals ( not shown ) to the retract pressure selection valve in order to selectively apply pressure to the retract pressure gauge . in this manner , the controller can apply to the retract pressure gauge a retract pressure of the retracting chuck . the retract pressure selection valve and the advance pressure selection valve couple the pull down and hold back gauges to the set of hydraulic feed cylinders that are actually doing the drilling . whenever the drilling is handed off from one chuck to the other chuck that was previously idle , the retract pressure selection valve and the advance pressure selection valve shift and expose the gauges to the ports of the previously idle chuck &# 39 ; s corresponding hydraulic feed cylinders . at this point the previously idle chuck closes and begins to move under the influence of its corresponding hydraulic feed cylinders . in an embodiment of a continuous feed drilling system in accordance with the present invention , the hydraulic feed cylinders have dual rods . this results in both sides of each piston within a hydraulic feed cylinder having equal amounts of surface area exposed to the pressurized hydraulic fluid . in this embodiment , the pressure values on the pull down and hold back gauges do not change when the retract pressure selection valve and the advance pressure selection valve shift from one set of hydraulic feed cylinders to the other . if during operation the drill stem encounters an impenetrable object while drilling , the pressure in the pull down gauge will rise and the pressure in the hold back gauge will fall . conversely , if the drill stem is being retrieved from the bore hole , it may get stuck . in this case , the hold back pressure gauge will indicate a rise in pressure and the pull down pressure gauge will indicate a fall in pressure . in each case , the controller limits the amount of pressure rise by disabling the feed system of the continuous feed drilling system . [ 0062 ] fig8 is a diagram depicting the relationship between drill stem weight , hold back pressure , and pull down pressure . a drill stem force 800 is generated on a drill bit by the weight of a drill stem . this drill stem force is in the same direction as a pull down force 802 generated by a pull down pressure applied to a hydraulic feed cylinder coupled to a chuck attached to the drill stem as previously described . a hold back force 804 is generated on the drill bit by a hold back pressure applied to a hydraulic feed cylinder coupled to a chuck attached to the drill stem as previously described . the hold back force is in the opposite direction of the pull down force and the drill stem force . a resultant drill bit force 806 is thus equal to the hold back force minus the sum of the pull down force and the drill stem force . the resultant drill bit force can be expressed as a weight and is commonly termed “ weight on bit ” or “ bit weight ”. as noted above , in one embodiment of a continuous feed drilling system in accordance with the present invention , the hydraulic feed cylinders have dual rods , resulting in both sides of each piston having equal amounts of surface area exposed to pressurized fluid . as shown in fig8 a resultant drill bit force 806 is in the direction of a pull down force 802 even though a hold back force 804 is greater than the pull down force . this is because of the presence of a drill stem force 800 generated by the weight of a drill stem . thus , the embodiment having dual rod hydraulic feed cylinders , the hold back pressure can be higher than the pull down pressure and the drill bit can still advance toward the higher fluid pressure by virtue of the drill stem weight . [ 0064 ] fig7 is a diagram of an architecture for an exemplary controller useful in controlling a continuous feed drill head assembly in accordance with the present invention . a microprocessor 700 , including a central processing unit ( cpu ) 710 , a memory cache 720 , and a bus interface 730 , is operatively coupled via a system bus 735 to a main memory 740 and an i / o interface control unit 745 . the i / o interface control unit is operatively coupled via an i / o local bus 750 to a memory storage controller 795 the memory storage controller is operatively coupled to a storage device 725 . computer program instructions 797 for operating a continuous feed drilling system in accordance with the present invention are stored in the storage device . the microprocessor retrieves the computer program instructions and stores them in the main memory . the microprocessor then executes the computer program instructions stored in the main memory to implement the features of a continuous feed drilling system in accordance with the present invention . the controller further includes an analog i / o interface 780 operatively coupled to the i / o local bus . the controller uses the analog i / o interface to receive and transmit analog signals from and to external primary sensors and final control elements . the controller further includes a digital i / o interface 784 operatively coupled to the i / o local bus . the controller uses the digital i / o interface to receive and transmit digital signals from and to external primary sensors and final control elements . in one embodiment of a continuous feed drilling system in accordance with the present invention , an allen bradley slc - 503 programmable logic controller programmed in ladder logic is used to control the operations of the continuous feed drilling system . although this invention has been described in certain specific embodiments , many additional modifications and variations would be apparent to those skilled in the art . it is therefore to be understood that this invention may be practiced otherwise than as specifically described . thus , the present embodiments of the invention should be considered in all respects as illustrative and not restrictive , the scope of the invention to be determined by any claims supportable by this application and the claims &# 39 ; equivalents . | 4 |
in fig1 the character 10 denotes an fm receiver having the synthesizer - type and double super heterodyne - type structure . a received signal received from an antenna 11 is supplied to an electronic tuning - type antenna tuning circuit 12 , and a broadcast wave signal srx having a target frequency frx is extracted . the signal srx is supplied to a first mixer circuit 13 , an oscillation signal sl 01 having a frequency fl 01 where fif 1 is the first intermediate frequency , for example , fif 1 = 10 . 7 mhz is extracted from vco 21 , the signal sl 01 is supplied to a mixer circuit 13 as the first local oscillation signal , and the signal srx is subjected to frequency conversion and converted to a first intermediate frequency signal sif 1 ( first intermediate frequency fif 1 ). subsequently , the first intermediate frequency signal sif 1 is supplied to a first intermediate frequency circuit 14 . the first intermediate frequency circuit 14 having a wide pass band width of , for example , fif 1 ± 90 khz comprises , for example , a ceramic filter and an amplifier that are connected in cascade arrangement fashion . the first intermediate frequency signal sif 1 sent out from the first intermediate frequency circuit 14 is supplied to a second mixer circuit 15 , and a divided - frequency signal sl 02 having a frequency fl 02 where fif 2 is the second intermediate frequency , for example , fif 2 = 450 khz is extracted from the frequency dividing circuit 27 , the signal sl 02 is supplied to a mixer circuit 15 as the second local oscillation signal , and the signal sif 1 is subjected to frequency conversion and converted to a second intermediate frequency signal sif 2 ( second intermediate frequency fif 2 ). subsequently , the second intermediate frequency signal sif 2 is supplied to an fm demodulation circuit 18 through a variable band pass filter served for the second intermediate frequency circuit and a limiter amplifier 17 , an audio signal is subjected to fm demodulation at that time , and the audio signal is supplied to a terminal 19 . the characteristic of the variable band pass filter 16 will be described hereinafter . at that time , voltage controlled oscillator ( vco ) 21 constitutes pll 20 together with circuits 22 to 24 . in other words , the signal sl 01 supplied from vco 21 is supplied to the variable frequency dividing circuit 22 and divided into frequencies of 1 / n , and the divided - frequency signal is supplied to a phase comparison circuit 23 . furthermore , at that time , an oscillation signal having a stable frequency is taken out from a quartz oscillation circuit 25 , the oscillation signal is supplied to a frequency dividing circuit 26 to form a divided - frequency signal having a reference frequency δf , for example , frequency of 100 khz , and the divided - frequency signal is supplied to the comparison circuit 23 as the reference signal . the comparison output of the comparison circuit 23 is supplied to vco 21 through the low pass filter 24 as the control voltage . the output voltage of the filter 24 is supplied to the tuning circuit 12 as the tuning voltage , and the oscillation signal of the oscillation circuit 25 is supplied to a frequency dividing circuit 27 as the frequency dividing input . therefore , because the frequency of the divided - frequency signal supplied from the frequency dividing circuit 22 is equal to the frequency of the divided - frequency signal supplied from the frequency dividing circuit 26 in the steady state , the frequency fl 01 of the oscillation signal sl 01 is formulated as described herein under . frx = fl 01 + fif 1 = n x 0 . 1 + 10 . 7 ( mhz ) therefore , when the frequency dividing ratio is changed stepwise with step of 1 between 653 and 793 , the local oscillation frequency fl 01 changes stepwise with step of 100 khz between 65 . 3 mhz and 79 . 3 mhz , and the received frequency frx changes stepwise with frequency step of 100 khz (= δf ) over the frequency band ranging from 76 mhz to 90 mhz correspondingly to the frequency dividing ratio n . therefore , the fm broadcast band is sought by changing the frequency dividing ratio n stepwise with step of 1 in the above - mentioned range . a microcomputer 31 is provided for controlling the system , various key operations ( operation switch ) 32 are connected , and the frequency dividing ratio n is supplied from the microcomputer 31 to the variable frequency dividing circuit 22 . when the key 32 is operated , the microcomputer 31 functions to change the frequency dividing ratio n of the frequency dividing circuit 22 correspondingly to the operated key , and the received frequency frx is changed thereby . furthermore , the microcomputer 31 is provided with , for example , a seeking control routine 100 as shown in fig2 as a part of the program to be executed by a central processing unit ( cpu ), not shown in the drawing . the routine 100 is served to realize seeking and seeking stop in the present invention . though the detail of the routine 100 will be described hereinafter , only the part of the routine 100 that relates to the present invention is shown in fig2 . furthermore , the intermediate frequency signal sif 2 sent out from the band pass filter 16 is supplied to a detection circuit 41 , a detection signal s 41 for indicating whether the level of the intermediate frequency signal sif 1 is equal to or greater than a predetermined value or not , namely a detection signal s 41 for indicating whether the received electric field intensity of the received signal srx is equal to or greater than a predetermined value or not , is extracted , and the detection signal s 41 is supplied to the microcomputer 31 . furthermore , the intermediate frequency signal sif 2 sent out from the limiter amplifier 17 is supplied to a waveform shaping circuit 42 so as to shape it to generate a pulse p 42 , and the pulse p 42 is supplied to the microcomputer 31 . furthermore , the demodulated output sent out from the demodulation circuit 18 is supplied to a band pass filter 43 . the band pass filter 43 is served to detect a signal ( beat frequency component ) having the frequency adjacent to the received frequency frx being received at that time . to perform the detection , the pass band of the band pass filter 43 ranges over a predetermined frequency range having the center at 100 khz (= δf ), for example , range from 50 khz to 200 khz . the filter output is supplied to the detection circuit 44 , and the level of the filter output is detected and extracted . therefore , for example , as shown in fig3 when the frequency coincides with a certain received frequency frx after seeking , if the pass bandwidth of the variable band pass filter 16 is wide ( shown in fig3 with a solid line ) and a broadcast wave signal snx having high received electric field intensity exists on the adjacent frequency ( frx + δf ), a part of the broadcast wave signal snx is extracted from the band pass filter 43 as the filter output . however , if the pass band width of the variable band pass filter 16 is narrow ( for example , shown in fig3 with a broken line ), the output cannot be obtained from the band pass filter 43 even if a broadcast wave signal having high received electric field intensity exists on the adjacent frequency ( frx + δf ). furthermore , even if the pass band width of the variable band pass filter 15 is wide , the output cannot be obtained from the band pass filter 43 if a broadcast wave signal having high electric field intensity does not exist . furthermore , at that time , the detection signal s 44 that indicates the output level of the band pass filter 43 is extracted from the detection circuit 44 . the detection signal s 44 is supplied to the variable band pass filter 16 as a control signal for controlling the pass band width , and the pass band width is continuously changed correspondingly to the level of the detection signal s 44 . the pass band of the band pass filter 16 is controlled to be narrow , for example , fif 2 ± 10 khz ( for example , refer to the characteristic shown in fig3 with a broken line ) if the output of the filter 43 is large and the level of the detection signal s 44 is high , and on the other hand the pass band of the band pass filter 16 is controlled to be wide if the output of the filter 43 is small and the level of the detection signal s 44 is low , for example fif 2 ± 90 khz ( for example , the characteristic shown in fig3 with a solid line ). furthermore , a predetermined control signal s 31 is extracted from the microcomputer 31 , and the signal s 31 is supplied to the band pass filter 16 . in this case , the control signal s 31 sets any one of two modes described herein under to the pass band width of the variable band pass filter 16 . control by use of the detection signal s 44 is activated ( referred to as “ variable mode ” hereinafter ). control by use of the detection signal s 44 is inactivated , and wide band is set ( referred to as “ wide band mode ” hereinafter ). in the structure as described hereinabove , when an operation that requires the seeking in the fm broadcast band , for example , automatic tuning , is indicated by means of key operation of the key 32 , the process of the cpu is started from step 101 of the routine 100 in the microcomputer 31 , the frequency dividing ratio n of the variable frequency dividing circuit 22 is set to the minimum value in the next step 102 . as the result , the received frequency frx is set to the minimum frequency of 76 mhz . subsequently , whether the current received frequency frx exceeds the maximum frequency 90 mhz or not is determined in step 103 , and the sequence proceeds from step 103 to step 104 because the routine 100 just started and the received frequency frx is set to the minimum frequency 76 mhz in step 102 in this case . the control signal s 31 functions to set the pass band width of the band pass filter 16 to the variable mode in step 104 , and in the next step the detection signal s 41 is checked to determine whether the received electric field strength at the current received frequency frx is equal to or greater than a predetermined value or not . if the received electric field intensity at the current received frequency frx is lower than the predetermined value , then the sequence proceeds from step 105 to step 106 , and in step 106 the frequency dividing ratio n is incremented by 1 and the received frequency frx is concomitantly incremented by 1 step , namely by 100 khz , and the sequence thereafter returns to step 103 . therefore , steps 103 to 106 are repeated until the broadcast having the received electric field intensity of the predetermined value is received . ( seeking state ) if the broadcast having the received electric field of the predetermined value is received , the value is determined in step 105 , and the sequence proceeds from step 105 to step 107 . the control signal s 31 functions to set the pass band width of the pass band filter 16 to the wide band mode in step 107 , and the number of pulse p 42 is thereafter counted to thereby determine whether the received frequency frx tunes in to the transmission frequency ( carrier frequency ) of the broadcast wave signal or not in step 108 . if the received frequency frx does not tune in to the transmission frequency of the broadcast wave signal , then the sequence returns from step 108 to step 103 through step 106 . therefore , thereafter , steps 103 to 108 are repeated until the received frequency frx tunes in to the broadcast having the received electric field intensity equal to or greater than the predetermined value . if the received frequency frx tunes in to the broadcast having the received electric field intensity equal to or greater than the predetermined value , then the sequence proceeds from step 108 to step 111 , the control signal s 31 functions to set the pass band width of the band pass filter 16 to the variable mode in step 111 , and the routine 100 is thereafter brought to an end at step 112 . therefore , at that time , the seeking is stopped , and a broadcast station is selected automatically . if the received frequency frx exceeds the maximum frequency before the broadcast having the received electric field intensity equal to or greater than the predetermined value is not tuned in spite of repeated steps 103 to 108 , then it is determined in step 103 , the sequence proceeds from step 103 to step 111 , and the routine 100 is brought to an end at step 112 . according to the routine 100 , if the broadcast having the received electric field intensity equal to or greater than the predetermined value is tuned during the seeking , then the seeking is stopped at the received frequency frx . in this case , because the pass band width of the band pass filter 16 used for selecting the second frequency signal sif 2 is switched to the variable mode or wide band mode , the seeking will not be stopped or will not pass the frequency at which the seeking should be stopped erroneously . in other words , in the case that the received electric field intensity is checked in step 105 , the pass band width of the band pass filter 16 is switched to the variable mode in step 104 . therefore , as shown in fig3 if there is a broadcast wave signal snx having high received electric field intensity at the adjacent frequency ( frx + δf ) at a certain receiving frequency frx , then the detection signal s 44 functions to narrow the pass band width of the band pass filter 16 as shown in fig3 with a broken line . as the result , the broadcast wave signal snx having high received electric field intensity of adjacent frequency ( frx + δf ) is removed from the detection signal s 41 . therefore , as shown in fig3 even if there is a broadcast wave signal snx having high received electric field intensity at the adjacent frequency ( frx + δf ), the broadcast wave signal snx will not affect adversely on the step 104 and the received electric field intensity at the received frequency frx is determined correctly , and as the result the seeking is not stopped erroneously at the received frequency frx . if there is no broadcast wave signal snx having high received electric field intensity at the adjacent frequency ( frx + δf ) when the frequency comes to the received frequency frx , the variable band pass filter 16 is switched to the wide band mode . therefore , because the modulation of the broadcast wave signal srx is deep , the frequency spectrum component is dispersed as shown in fig4 with a broken line , and even if the energy of the broadcast wave signal srx is dispersed , the detection signal s 41 indicates a correct received electric field intensity of the broadcast wave signal srx , and as the result the seeking is stopped properly . furthermore , when whether the received frequency frx tunes in to the transmission frequency of the broadcast wave signal srx or not is checked by counting the number of the pulse p 42 in step 108 , because the pass band width of the band pass filter 16 is switched to the wide band mode in step 107 , the number of the pulse p 42 is counted without any error . in detail , in the case that the pass band width of the band pass filter 16 is switched to the variable mode , if there is a broadcast wave signal snx having high received electric field intensity at the adjacent frequency ( frx + δf ) when the frequency comes to a certain received frequency frx , the detection signal s 44 functions to narrow the pass band width of the band pass filter 16 as shown in fig3 with a broken line . as the result , the signal level at the received frequency frx is lowered or reduced to 0 , the number of the pulse p 42 is counted erroneously and the correct count value cannot be obtained . that is true in the case that the pass band width of the band pass filter 16 is fixed to the narrow band mode . however , in the routine 100 , because the pass band width of the band pass filter 16 is switched to the wide band mode in step 107 and then the number of the pulse p 42 is counted , when there is a broadcast wave signal snx having high received electric field intensity at the adjacent frequency ( frx + δf ) the pass band width of the band pass filter 16 is wide and the signal level at the received frequency frx is high . therefore , the number of the pulse p 42 is counted correctly . as described hereinabove , according to the above - mentioned fm receiver , the seeking can be stopped correctly and automatically even if there is a broadcast wave signal snx having high received electric field intensity . the intermediate frequency signal sif 2 sent out from the band pass filter 16 is supplied to the detection circuit 41 to thereby obtain the detection signal s 41 having the received electric field intensity in the above - mentioned embodiment , however , the intermediate frequency signal sif 2 may be extracted out from the middle of the limiter amplifier 17 and supplied to the detection circuit 41 to thereby obtain the detection signal s 41 . the control signal s 44 controls the band width so as to be switched by supplying the control signal s 31 to the variable band pass filter 16 in the above - mentioned embodiment , however , the control signal s 31 maybe supplied to the detection circuit 44 to control the band width so as to be switched similarly . furthermore , for example , in the case that auto - preset is employed , in the step subsequent to step 111 , the data for indicating the received frequency frx being received at that time , for example , the frequency dividing ratio n is stored in a nonvolatile memory , and then the sequence proceeds to step 108 . | 7 |
for the first time , fertile transgenic maize plants have been produced , opening the door to new vistas of crop improvement based on in vitro genetic transformation . the inventors have succeeded where others have failed by combining and modifying numerous steps in the overall process leading from somatic cell to transgenic plant . although the methods disclosed herein are part of a unified process , for illustrative purposes they may be subdivided into : culturing cells to be recipients for exogenous dna ; cryopreserving recipient cells ; constructing vectors to deliver the dna to cells ; delivering dna to cells ; assaying for successful transformations ; using selective agents if necessary to isolate stable transformants ; regenerating plants from transformants ; assaying those plants for gene expression and for identification of the exogenous dna sequences ; determining whether the transgenic plants are fertile ; and producing offspring of the transgenic plants . the invention also relates to transformed maize cells , transgenic plants and pollen produced by said plants . tissue culture requires media and controlled environments . &# 34 ; media &# 34 ; refers to the numerous nutrient mixtures that are used to grow cells in vitro , that is , outside of the intact living organism . the medium is usually a suspension of various categories of ingredients ( salts , amino acids , hormones , sugars , buffers ) that are required for growth of most cell types . however , each specific cell type requires a specific range of ingredient proportions for growth , and an even more specific range of formulas for optimum growth . rate of cell growth will also vary among cultures initiated with the array of media that permit growth of that cell type . nutrient media is prepared as a liquid , but this may be solidified by adding the liquid to materials capable of providing a solid support . agar is most commonly used for this purpose . bactoagar and gelgro are specific types of solid support that are suitable for growth of plant cells in tissue culture . some cell types will grow and divide either in liquid suspension or on solid media . as disclosed herein , maize cells will grow in suspension , but regeneration of plants requires transfer from liquid to solid media at some point in development . the type and extent of differentiation of cells in culture will be affected not only by the type of media used and by the environment , for example , ph , but also by whether media is solid or liquid . table 1 illustrates the composition of various media useful for creation of recipient cells and for plant regeneration . it is believed by the inventors that the ability to prepare and cryopreserve suspension cultures of maize cells is an important aspect of the present invention , in that it provides a means for reproducibly and successfully preparing cells for transformation . the studies described below set forth techniques which have been successfully applied by the inventors to generate transformable and regenerable suspension cultures of maize cells . a variety of different types of media have been developed by the inventors and employed in carrying out various aspects of the invention , including in particular , the development of suspension cultures . the following table , table 1 , sets forth the composition of the media preferred by the inventors for carrying out these aspects of the invention . table 1______________________________________illustrative embodiments of tissue culture media which are used for type ii callus development , development of suspension cultures and regeneration of plant cells ( specifically maize cells ) medium id . optimal other number ms * n6 sucrose ph components ** ______________________________________ 52 + - 2 % 6 . 0 0 . 25 mg thiamine 1 mg 2 , 4 - d 10 . sup .- 7 m aba bactoagar 101 + - 3 % 6 . 0 100 mg myo - inositol v bactoagar 142 + - 6 % 6 . 0 5 mg bap v 0 . 186 mg naa 0 . 175 mg iaa 0 . 403 mg 2 - ip 200 mg myo - inositol bactoagar 163 + - 3 % 6 . 0 3 . 3 mg dicamba v 100 mg myo - inositol bactoagar 171 + - 3 % 6 . 0 0 . 25 mg 2 , 4 - d v 100 mg bap 100 mg myo - inositol bactoagar 173 + - 6 % 6 . 0 5 mg bap v 0 . 186 mg naa 0 . 175 mg iaa 0 . 403 mg 2 - ip 10 . sup .- 5 m aba 200 mg myo - inositol bactoagar 177 + - 3 % 6 . 0 0 . 25 mg 2 , 4 - d v 10 mg bap 10 . sup .- 5 m aba 100 mg myo - inositol bactoagar 201 - + 2 % 5 . 8 25 mm proline v 1 mg 2 , 4 - d 100 mg casein hydrolysate gelgro . sup . r 205 - + 2 % 5 . 8 25 mm proline v 0 . 5 mg 2 , 4 - d 100 mg casein hydrolysate 227 - + 2 % 5 . 8 25 mm proline v 13 . 2 mg dicamba 100 mg casein hydrolysate gelgro . sup . r 401 + - 3 % 6 . 0 0 . 25 mg thiamine 1 mg 2 , 4 - d 2 mg naa 200 mg casein hydrolysate 500 mg k sulfate 100 mg myo - inositol 400 mg k phosphate ( monobasic ) 402 + - 3 % 6 . 0 0 . 25 mg thiamine 25 mm proline 1 mg 2 , 4 - d 200 mg casein hydrolysate 500 mg k sulfate 400 mg k phosphate ( monobasic ) 100 mg myo - inositol 409 + - 3 % 6 . 0 0 . 25 mg thiamine 25 mm proline 10 mg dicamba 200 mg casein hydrolysate 500 mg k sulfate 400 mg k phosphate ( monobasic ) 100 mg myo - inositol 501 - - 2 % 5 . 7 clark &# 39 ; s *** gelgro . sup . r______________________________________ * basic ms medium described in reference 30 . the medium described in ref . 30 is typically modified by decreasing the nh . sub . 4 no . sub . 3 from 1 . 64 g / to 1 . 55 g / l , and omitting the pyridoxine hcl , nicotinic acid , myoinositol and glycine . + = present ; - = absent ; v = vitamins ** naa = napthol acetic acid iaa = indole acetic acid 2ip = 2 , isopentyl adenine 2 , 4d = 2 , 4dichlorophenoxyacetic acid bap = 6benzyl aminopurine aba = abscisic acid *** basic medium described in reference 6 initiation of the suspension culture gii ( a188xb73 ) 716 ( designated sc716 ) for use in transformation this example describes the development of a maize suspension culture , designated sc716 , which was employed in various of the transformation studies described hereinbelow . the type ii tissue used to initiate the cell suspension was derived from immature embryos of a188 × b73 plated onto n6 - based medium with 1 mg / ml 2 , 4 - d ( 201 ; see table 1 ). a type ii callus was initiated by visual selection of fast growing , friable embryogenic cells . the suspension was initiated within 6 months after callus initiation . tissue chosen from the callus to initiate the suspension consisted of very undifferentiated type ii callus , the characteristics of this undifferentiated tissue are the earliest stages of embryo development along with the soft , friable , undifferentiated tissue underlying it . approximately one gram of tissue was added to 20 mls of liquid medium . in this example , the liquid medium was medium 402 to which different slow - release hormone capsule treatments were added ( see example 12 below ). these capsule treatments included 2 , 4 - d , naa , 2 , 4 - d plus naa , and 2 naa capsules . one flask was initiated for each of the different 402 media plus hormone combinations . every 7 days each culture was subcultured into fresh medium by transferring a small portion of the cellular suspension to a new flask . this involved swirling the original flask to suspend the cells ( which tend to settle to the bottom of the culture vessel ), tilting the flask on its side and allowing the denser cells and cell aggregates to settle slightly . one ml of packed cells was then drawn off from this pool of settled cells together with 4 mls of conditioned medium . a sterile ten ml , wide tip , pipet was used for this transfer ( falcon 7304 ). any very large aggregates of cells which would not pass easily through the pipet tip were excluded . if a hormone capsule was present , it was also transferred to the new flask . after approximately 7 weeks , the loose embryogenic cell aggregates began to predominate and fragment in each of the cultures , reaching a state referred to as &# 34 ; dispersed .&# 34 ; the treatment which yielded the highest proportion of embryogenic clusters was the 402 medium plus a naa capsule . after the cultures became dispersed and were growing at a fast rate , doubling approximately every two to three days as determined by increase in packed cell volume , a one ml packed cell inoculum from each culture was transferred into 401 medium using a ten ml narrow tip pipet ( falcon 7551 ). these transfers were performed about every 31 / 2 days . an inoculum from the 402 plus 2 , 4 - d plus naa capsules culture was also used to initiate a culture in 409 medium ( 402 minus 2 , 4 - d and plus 10 mg / l dicamba ) either with or without 1 ml coconut water ( gibco 670 - 8130ag ). the most dispersed cultures were cryopreserved after 2 weeks , 2 months or 5 months . the culture grown on 409 with coconut water was brought out of cryopreservation eight months later and thawed , cultured for two weeks on solid 201 culture medium using bms as a feeder layer ( 38 ) and transferred to media 409 without coconut water . the culture was maintained by subculturing twice weekly , using 409 media , by the method described above . initiation of the suspension culture ( a188 × b73 ) 82 ( designated sc82 ) for use in transformation this example describes the development of another cell line employed in various of the transformation studies set forth below , termed sc82 . in the development of sc82 , inoculum for suspension culture initiation was visually selected from a type ii callus that was derived from immature embryos plated on a n6 - based medium containing 13 . 2 mg / l dicamba ( 227 ) ( table 1 ). the suspension culture was initiated within 3 months of initiation of the type ii callus . small amounts ( 50 - 100 mg ) of callus distinguishable by visual inspection because of its highly proembryonic morphology , were isolated from more mature or organized structures and inoculated into a 50 ml flask containing 5 mls of filter - sterilized conditioned medium from the various gii ( a188 × b73 ) 716 suspension cultures ( 402 medium with four types of capsule treatments and 409 medium ). after one week , this 5 ml culture was sieved through a 710 micron mesh and used to inoculate 20 mls of corresponding fresh and filter - sterilized conditioned medium from the established gii ( a188 × b73 ) 716 cultures in 150 ml flasks . after one week or more of growth , two mls of packed cells were subcultured to fresh media by the method described above . the suspension culture maintained on 409 by this method was then cryopreserved within 3 months . the original cell line , which was maintained on 409 ( not a reinoculated cryopreserved culture ) was used in experiments 1 and 2 months later which resulted in stable transformation and selection ( see table 2 below ). the cryopreserved culture was used for experiment 6 ( see table 2 below ). studies following the fate of radioactively labelled plant hormones ( 2 , 4 - d and naa ) showed that within two days corn cells absorb most of the auxins present in suspension culture media . this problem of hormone depletion can be overcome by spiking the cultures with a small amount of auxin every other day . however , spiking cultures is very time consuming when done on a large scale and also increases the risk of contamination as the culture vessels must be opened frequently . slow release plant hormone capsules were developed to overcome these problems . in summary , these capsules comprise a plant hormone , usually in a crystalline state , encapsulated in a silicone matrix surrounded by a silicone limiting membrane . the rate of hormone release is controlled by the size of the diffusible area and the thickness of the membrane . they have the advantages of 1 ) supplying hormones at an acceptable and predictable rate ( e . g ., 20 - 100 μg / 20 ml culture media / day , 2 ) they are of a convenient size ( e . g ., 0 . 5 - 1 . 5 cm in length ) for use in liquid or solid culture medium , 3 ) they are very durable and easily sterilized by autoclaving , and 4 ) they can be stored dry until needed . the present formulation involves the controlled release of a plant hormone or selective agent for a plant tissue culture from an inner matrix containing crystals of the desired agent through an outer diffusion limiting membrane . a preferred embodiment of the formulation is to mix 30 % dry crystals of the desired agent with 70 % ( w / w ) room temperature vulcanizing ( rtv ) silicone which is then injected into silicone tubing having an appropriate diameter and wall thickness for the desired release rate of the desired agent . ( the preferred agents for employing in connection with the slow release capsules are 2 , 4 - d and naa , and the preferred dimensions are 0 . 062 &# 34 ; id × 0 . 125 &# 34 ; od ). the rtv silicone is then polymerized at room temperature or at a higher temperature to accelerate the vulcanization process . following vulcanization of the inner matrix , the tubing is cut to desired lengths and the ends sealed with rtv silicone . the preferred lengths for use in connection with the present invention are about 0 . 5 cm . after the end seals have polymerized , the resulting capsules can either be stored , as is , or autoclaved for 15 minutes on a fast exhaust cycle and stored indefinitely in a sterile form . prior to use the capsules may be equilibrated to establish a stable diffusion gradient across the membrane , or used directly without equilibration . another formulation for a much lower release rate is to enclose crystals of a desired substance suspended in a liquid such as water or silicone oil in a relatively nonpermeable tubing such as nylon - 11 . the release rate from this reservoir can then be regulated by drilling various size holes in the tubing and gluing a silicone window over the hole with silicone medical adhesive . once again the capsules can be sterilized by autoclaving and stored dry until use . an exemplary technique employed by the inventors for preparing slow release hormone capsules is as follows : 1 . two grams of dow corning mdx - 4 - 4210 medical grade elastomer and 0 . 2 grams of dow corning mdx - 4 - 4210 curing agent were weighed into a 10 ml syringe , the bottom of which was capped with a plastic cap . 2 . six - hundred mg of 2 , 4 - d ( or naa ), from which lumps have been removed by sieving through a 411μ stainless steel sieve , was added to the same syringe and thoroughly mixed with the elastomer and curing agent . 3 . the 10 ml syringe and its contents were then degassed for 1 / 2 hr in a vacuum centrifuge to remove bubbles . 4 . dow corning silastic medical grade silicone tubing ( 0 . 062 &# 34 ; id × 0 . 125 &# 34 ; od ) of medium durometer ( 50 shore a ) was preswelled 10 to 30 minutes by soaking in acetone . 5 . the plastic cap was removed from the end of the 10 ml syringe and the degassed silicone - 2 , 4 - d mixture was extruded into the preswollen tubing from which excess acetone had been removed by blowing a stream of air briefly through it . 6 . both ends of the filled tubing were then clamped shut and the tubing heated at 50 degrees ( the boiling point of acetone = 56 . 5 degrees ) overnight to accelerate the polymerization . 8 . the ends of the tubing sections were sealed with dow corning type a medical adhesive and allowed to dry for 24 hr . 9 . the finished capsules are autoclaved dry for 15 - 20 min and stored dry until use . 10 . before use the capsules may be preequilibrated for 48 hr by shaking in 25 ml of sterile 1 to 10 mm khco 3 , or added to cultures without equilibration . cryopreservation is important not only because it allows one to maintain and preserve a cell culture for future use , but it also is believed by the inventors that this may be a means for enriching for recipient cells . cell suspensions were cryopreserved using modifications of methods previously reported ( 15 , 49 ). the cryopreservation protocol comprised adding a pre - cooled ( 0 ° c .) concentrated cryoprotectant mixture dropwise over a period of one hour while stirring the cell suspension , which was also maintained at 0 ° c . during this period . the volume of added cryoprotectant was equal to the initial volume of the cell suspension ( 1 : 1 addition ), and the final concentration of cryoprotectant additives was 10 % dimethyl sulfoxide , 10 % polyethylene glycol ( 6000 mw ), 0 . 23m proline and 0 . 23m glucose . the mixture was allowed to equilibrate at 0 ° c . for 30 minutes , during which time the cell suspension / cryoprotectant mixture was divided into 1 . 5 ml aliquot ( 0 . 5 ml packed cell volume ) in 2 ml polyethylene cryo - vials . the tubes were cooled at 0 . 5 ° c ./ minute to - 8 ° c . and held at this temperature for ice nucleation . once extracellular ice formation had been visually confirmed , the tubes were cooled at 0 . 5 ° c ./ minute from - 8 to - 35 ° c . they were held at this temperature for 45 minutes ( to insure uniform freeze - induced dehydration throughout the cell clusters ). at this point , the cells had lost the majority of their osmotic volume ( i . e . there is little free water left in the cells ), and they could be safely plunged into liquid nitrogen for storage . the paucity of free water remaining in the cells in conjunction with the rapid cooling rates from - 35 to - 196 ° c . prevented large organized ice crystals from forming in the cells . the cells are stored in liquid nitrogen , which effectively immobilizes the cells and slows metabolic processes to the point where long - term storage should not be detrimental . thawing of the extracellular solution was accomplished by removing the cryo - tube from liquid nitrogen and swirling it in sterile 42 ° c . water for approximately 2 minutes . the tube was removed from the heat immediately after the last ice crystals had melted to prevent heating the tissue . the cell suspension ( still in the cryoprotectant mixture ) was pipetted onto a filter , resting on a layer of agarose - immobilized bms cells ( the feeder layer which provided a nurse effect during recovery ). dilution of the cryoprotectant occurred slowly as the solutes diffused away through the filter and nutrients diffused upward to the recovering cells . once subsequent growth of the thawed cells was noted , the growing tissue was transferred to fresh culture medium . the cell clusters were transferred back into liquid suspension medium as soon as sufficient cell mass had been regained ( usually within 1 to 2 weeks ). after the culture was reestablished in liquid ( within 1 to 2 additional weeks ), it was used for transformation experiments . when necessary , previously cryopreserved cultures may be frozen again for storage . as mentioned previously , there are several methods to construct the dna segments carrying dna into a host cell that are well known to those skilled in the art . the general construct of the vectors used herein are plasmids comprising a promoter , other regulatory regions , structural genes , and a 3 &# 39 ; end . dna segments encoding the bar gene were constructed into a plasmid , termed pdpg165 , which was used to introduce the bialaphos resistance gene into recipient cells ( see fig1 a and c ). the bar gene was cloned from streptomyces hygroscopicus ( 53 ) and exists as a 559 - bp sma i fragment in plasmid pij4101 . the sequence of the coding region of this gene is identical to that published ( 45 ). to create plasmid pdpg165 , the sma i fragment from pij4104 was ligated into a puc19 - based vector containing the cauliflower mosaic virus ( camv ) 35s promoter ( derived from pbi221 . 1 . provided by r . jefferson , plant breeding institute , cambridge , england ), a polylinker , and the transcript 7 ( tr7 ) 3 &# 39 ; end from agrobacterium tumefaciens ( 3 &# 39 ; end provided by d . stalker , calgene , inc ., davis , calif .). an additional vector encoding gus , pdpg208 , ( fig1 b and d ) was used in these experiments . it was constructed using a 2 . 1 kb bamhi / ecori fragment from pagus1 ( provided by j . skuzeski , university of utah , salt lake city , utah ) containing the coding sequence for gus and the nos 3 &# 39 ;- end from agrobacterium tumefaciens . in pagus1 the 5 &# 39 ;- noncoding and 5 &# 39 ;- coding sequences for gus were modified to incorporate the kozak consensus sequence ( 24 ) and to introduce a new hindiii restriction site 6 bp into the coding region of the gene ( see fig1 e ). the 2 . 1 kb bamhi / ecori fragment from pagus1 was ligated into a 3 . 6 kb bamhi / ecori fragment of a puc19 - based vector pcev1 ( provided by calgene , inc ., davis , calif .). the 3 . 6 kb fragment from pcev1 contains puc19 and a 430 bp 35s promoter from cauliflower mosaic virus adjacent to the first intron from maize adh1 . in terms of a member of the r gene complex for use in connection with the present invention , the most preferred vectors contain the 35s promoter from cauliflower mosaic virus , the first intron from maize adh1 , the kozak consensus sequence , sn : bol3 cdna , and the transcript 7 3 &# 39 ; end from agrobacterium tumefaciens . one such vector prepared by the inventors is termed pdpg237 . to prepare pdpg237 ( see fig1 f ), the cdna clone of sn : bol3 was obtained from s . dellaporta ( yale university , usa ). a genomic clone of sn was isolated from genomic dna of sn : bol3 which had been digested to completion with hindiii , ligated to lambda arms and packaged in vitro . plaques hybridizing to two regions of cloned r alleles , r - nj and r - sc ( 97 ) were analyzed by restriction digest . a 2 kb sst - hincii fragment from the psn7 . 0 was used to screen a cdna library established in lambda from rna of light - irradiated scutellar nodes of sn : bol3 . the sequence and a restriction map of the cdna clone was established . the cdna clone was inserted into the same plant expression vector described for pdpg165 , the bar expression vector ( see above ), and contains the 35s cauliflower mosaic virus promoter , a polylinker and the transcript 7 3 &# 39 ; end from agrobacterium tumefaciens . this plasmid , ppdg232 , was made by inserting the cdna clone into the polylinker region ; a restriction map of pdpg232 is shown in fig1 g . the preferred vector , pdpg237 , was made by removing the cdna clone and tr7 3 &# 39 ; end from pdpg232 , with avai and ecori and ligating it with a bamhi / ecori fragment from pdpg208 . the ligation was done in the presence of a bamhi linker as follows : ( seq id no : 2 and seq id no : 3 ) the final construct of pdpg237 contained a cauliflower mosaic virus 35s promoter , the first intron of adh1 , kozak consensus sequence , the bamhi linker , cdna of sn : bol3 , and the tr7 3 &# 39 ; end and is shown in fig1 f . additional vectors have been prepared using standard genetic engineering techniques . for example , a vector , designated pdpg128 , has been constructed to include the neo coding sequence ( neomycin phosphotransferase ( aph ( 3 &# 39 ;)- ii )). plasmid pdpg128 contains the 35s promoter from camv , the neomycin phosphotransferase gene from tn5 ( 66 ) and the tr7 terminator from agrobacterium tumefaciens . another vector , pdpg154 , incorporates the crystal toxin gene and was also prepared by standard techniques . plasmid pdpg154 contains the 35s promoter , the entire coding region of the crystal toxin protein of bacillus thuringiensis var . kurstaki hd 263 , and the tr7 promoter . various tandem vectors have also been prepared . for example , a bar / aroa tandem vector was constructed by ligating a blunt - ended 3 . 2 kb dna fragment containing a mutant epsp synthase aroa expression unit ( 93 ) to ndei - cut pdpg165 that had been blunted and dephosphorylated ( ndei introduces a unique restriction cut approximately 200 bp downstream of the tr7 3 &# 39 ;- end of the bar expression unit ). transformants having aroa in both orientations relative to bar were identified . a preferred dna delivery system that does not require protoplast isolation or introduction of agrobacterium dna is microprojectile bombardment ( 8 , 23 ). there are several potential cellular targets for microprojectile bombardment to produce fertile transgenic plants : pollen , microspores , meristems , and cultured embryogenic cells are but a few examples . germline transformation in maize has not been previously reported by bombardment of any of these types . one of the newly emerging techniques for the introduction of exogenous dna constructs into plant cells involves the use of microprojectile bombardment . the details of this technique and its use to introduce exogenous dna into various plant cells are discussed in klein , 1989 , wang , et al , 1988 and christou , et al , 1988 ( 22 , 50 , 8 ). one method of determining the efficiency of dna delivery into the cells via microprojectile bombardment employs detection of transient expression of the enzyme β - glucuronidase ( gus ) in bombarded cells . for this method , plant cells are bombarded with a dna construct which directs the synthesis of the gus enzyme . apparati are available which perform microprojectile bombardment . a commercially available source is an apparatus made by biolistics , inc . ( now dupont ), but other microprojectile or acceleration methods are within the scope of this invention . of course , other &# 34 ; gene guns &# 34 ; may be used to introduce dna into cells . several modifications of the microprojectile bombardment method were made by the inventors . for example , stainless steel mesh screens were introduced below the stop plate of the bombardment apparatus , i . e ., between the gun and the cells . furthermore , modifications to existing techniques were developed by the inventors for precipitating dna onto the microprojectiles . for bombardment , friable , embryogenic type - ii callus ( 1 ) was initiated from immature embryos essentially as set forth above in examples 1 and 2 . the callus was initiated and maintained on n6 medium ( 5 ) containing 2 mg / l glycine , 2 . 9 g / l l - proline , 100 mg / l casein hydrolysate , 13 . 2 mg / l dicamba or 1 mg / l 2 , 4 - d , 20 g / l sucrose , ph 5 . 8 , solidified with 2 g / l gelgro ( icn biochemicals ). suspension cultures initiated from these callus cultures were used for bombardment . in the case of sc82 , suspension culture sc82 was initiated from type - ii callus maintained in culture for 3 months . sc82 cells ( see example 1 ) were grown in liquid medium for approximately 4 months prior to bombardment ( see table 2 , experiments # 1 and # 2 ). sc82 cells were also cryopreserved 5 months after suspension culture initiation , stored frozen for 5 months , thawed and used for bombardment ( experiment # 6 ). in the case of suspension culture sc716 ( see example 2 ), it was initiated from type - ii callus maintained 5 months in culture . sc716 cells were cultured in liquid medium for 5 months , cryopreserved for 8 months , thawed , and used two months later in bombardment experiments # 4 and # 5 . sc94 was initiated from 10 month old type - ii callus ; and cultured in liquid medium for 5 months prior to bombardment ( experiment # 3 ). prior to bombardment , recently subcultured suspension culture cells were sieved through 1000 μm stainless steel mesh . from the fraction of cell clusters passing through the sieve , approximately 0 . 5 ml packed cell volume ( pcv ) was pipetted onto 5 cm filters ( whatman # 4 ) and vacuum - filtered in a buchner funnel . the filters were transferred to petri dishes containing three 7 cm filters ( whatman # 4 ) moistened with 2 . 5 ml suspension culture medium . the dish containing the filters with the immobilized cell suspensions was positioned 6 cm below the lexan plate used to stop the nylon macroprojectile . with respect to the dna , when more than a single plasmid was used , plasmid dna was precipitated in an equimolar ratio onto tungsten particles ( average diameter approximately 1 . 2 μm , gte sylvania ) using a modification of the protocol described by klein , et al . ( 1987 ). in the modified procedure , tungsten was incubated in ethanol at 65 degrees c . for 12 hours prior to being used for precipitation . the precipitation mixture included 1 . 25 mg tungsten particles , 25 μg plasmid dna , 1 . 1m cacl 2 and 8 . 7 mm spermidine in a total volume of 575 μl . after adding the components in the above order , the mixture was vortexed at 4 ° c . for 10 min , centrifuged ( 500 × g ) for 5 min and 550 μl of supernatant was decanted . from the remaining 25 μl of suspension , 1 μl aliquots were pipetted onto the macroprojectile for bombardment . each plate of suspension cells was bombarded twice at a vacuum of 28 inches hg . in bombarding the embryogenic suspensions of a188 × b73 and a188 × b84 , 100 μm or 1000 μm stainless steel screens were placed about 2 . 5 cm below the stop plate in order to increase the number of foci while decreasing their size and also to ameliorate injury to the bombarded tissue . after bombardment , the suspension cells and the supporting filter were transferred onto solid medium or the cells were scraped from the filter and resuspended in liquid culture medium . cells from embryogenic suspension cultures of maize were bombarded with the bar - containing plasmid pdpg165 alone or in combination with a plasmid encoding gus , pdpg208 ( fig1 ). in experiments in which a gus plasmid was included , two of the filters containing bombarded cells were histochemically stained 48 h post - bombardment . the total number of foci ( clusters of cells ) per filter transiently expressing gus was at least 1000 . in two separate studies designed to quantitate transiently expressing cells ( using an sc82 ( a188 × b73 ) suspension culture ), the mean number and standard deviation of gus - staining foci per filter was 1472 ± 211 and 2930 ±( n = 3 and 4 , respectively ). the number of cells in individual foci that expressed gus averaged 2 - 3 ( range 1 - 10 ). although histochemical staining can be used to detect cells transformed with the gene encoding gus , those cells will no longer grow and divide after staining . for detecting stable transformants and growing them further , e . g ., into plants , selective systems compatible with viability are required . it is believed that dna is introduced into only a small percentage of cells in any one experiment . in order to provide a more efficient system for identification of those cells receiving dna and integrating it into their genomes , therefore , one may desire to employ a means for selecting those cells that are stably transformed . one exemplary embodiment of such a method is to introduce into the host cell , a marker gene which confers resistance to some agent , e . g . an antibiotic or herbicide . the potentially transformed cells are then exposed to the agent . in the population of surviving cells are those cells wherein generally the resistance - conferring gene has been integrated and expressed at sufficient levels to survive . cells may be tested further to confirm stable integration of the exogenous dna . using embryogenic suspension cultures , stable transformants are recovered at a frequency of approximately 1 per 1000 transiently expressing foci . a specific embodiment of this procedure is shown in example 5 . one of the difficulties in cereal transformation , e . g ., corn , has been the lack of an effective selective agent for transformed cells , from totipotent cultures ( 36 ). stable transformants were recovered from bombarded nonembryogenic black mexican sweet ( bms ) maize suspension culture cells , using the neo gene and selection with the aminoglycoside , kanamycin ( 22 ). this approach is limited because many monocots are insensitive to high concentrations of aminoglycosides ( 12 , 19 ). the stage of cell growth , duration of exposure and concentration of the antibiotic , may be critical to the successful use of aminoglycosides as selective agents to identify transformants ( 26 , 51 , 52 ). in addition , use of the aminoglycosides , kanamycin or g418 , to select stable transformants from embryogenic maize cultures , in the inventors &# 39 ; experience , often results in the isolation of resistant calli that do not contain the neo gene . one herbicide which has been suggested in resistance studies is the broad spectrum herbicide bialaphos . bialaphos is a tripeptide antibiotic produced by streptomyces hygroscopicus and is composed of phosphinothricin ( ppt ), an analogue of l - glutamic acid , and two l - alanine residues . upon removal of the l - alanine residues by intracellular peptidases , the ppt is released and is a potent inhibitor of glutamine synthetase ( gs ), a pivotal enzyme involved in ammonia assimilation and nitrogen metabolism ( 33 ). inhibition of gs in plants by ppt causes the rapid accumulation of ammonia and death of the plant cells . the organism producing bialaphos also synthesizes an enzyme phosphinothricin acetyl transferase ( pat ) which is encoded by the bar gene . the use of the herbicide resistance gene encoding phosphinothricin acetyl transferase ( pat ) is referred to in de 3642 829 a wherein the gene is isolated from streptomyces viridochromogenes . this enzyme acetylates the free amino group of ppt preventing autotoxicity ( 45 ). the bar gene has been cloned ( 29 , 45 ) and expressed in transgenic tobacco , tomato and potato plants ( 10 ) and brassica ( 11 ). in previous reports , some transgenic plants which expressed the resistance gene were completely resistant to commercial ppt and bialaphos in greenhouses . pct application no . wo 87 / 00141 refers to the use of a process for protecting plant cells and plants against the action of glutamine synthetase inhibitors . this application also refers to the use of such of a process to develop herbicide resistance in determined plants . the gene encoding resistance to the herbicide basta ( hoechst phosphinothricin ) or herbiace ( meiji seika bialaphos ) was said to be introduced by agrobacterium infection into tobacco ( nicotiana tabacum cv petit havan sr1 ), potato ( solanum tuberosum cv benolima ) and tomato ( lycopersicum esculentum ) and conferred on plants resistance to application of herbicides . an exemplary embodiment of vectors capable of delivering dna to plant host cells is the plasmid , pdpg165 . this plasmid is illustrated in fig1 a and 1c . a very important component of this plasmid for purposes of genetic transformation is the bar gene which acts as a marker for selection of transformed cells . the suspension culture ( designated sc82 ) used in the initial experiments ( see example 3 ) was derived from embryogenic type - ii callus of a188 × b73 . following bombardment ( see example 3 ), cells on filters were resuspended in nonselective liquid medium , cultured for 1 to 2 weeks and transferred to filters overlaying solid medium containing 1 or 3 mg / l bialaphos . the degree of inhibition of tissue growth during selection was dependent upon the density of the cells on the filter and on the concentration of bialaphos used . at the density plated ( 0 . 5 pcv / filter ), the growth of the cells cultured on 1 mg / l bialaphos was only partially inhibited (˜ 30 - 50 % of nonselected growth ) and after 3 to 4 weeks much of this tissue was transferred as discrete clumps (˜ 5 mm in diameter ) to identical medium . on medium containing 3 mg / l bialaphos , the growth of cells on the original selection filter was severely inhibited (˜ 10 % of nonselected growth ) and selection was carried out without removing the tissue from the original filter . using either selection protocol ( 1 or 3 mg / l bialaphos ), resistant cell colonies emerged on the selection plates of sc82 bombarded with pdpg165 approximately 6 to 7 weeks after bombardment ( fig2 a ). bialaphos - resistant calli were maintained and expanded on selection medium . much of this tissue was embryogenic ( fig2 b ). no colony growth occurred on plates to which cells were added from suspension cultures on which no transforming attempts were made . these are controls which confirm the prediction that cells without the bar gene are not resistant to bialaphos . colonies on solid supports are visible groups of cells formed by growth and division of cells plated on such support . colonies can be seen in fig2 a on a petri dish . in this figure , the cells capable of growth are those that are resistant to the presence of the herbicide bialaphos , said resistance resulting from integration and expression of the bar gene . exposure of cells was to 1 mg / l bialaphos . fig2 b is a magnification showing the morphology of one bialaphos - resistant culture maintained on selection media indicating that growth is embryogenic . as a confirmation that the cells forming the colonies shown in fig2 had indeed incorporated the bar gene and were expressing it , bialaphos - resistant callus lines were analyzed for activity of the bar gene product , phosphinothricin acetyl transferase ( pat ), by thin - layer chromatography . protein extracts from eleven callus lines ( e1 - 11 ) isolated from sc82 bombardment experiments contained pat activity as shown in fig3 and activity levels varied approximately 10 - fold among the isolates . still further and more direct confirmation of the presence of the bar gene was obtained by analysis of the genomic dna of potential transformants by dna gel blots ( fig4 ). the sources of dna which were electrophoresed through the gel were the bialaphos - resistant callus lines designated e1 - e11 and a non - selected control , e0 . ( fig1 indicates the cleavage sites of those enzymes within the bar gene plasmid .) after the dna was electrophoresed through the gel and transferred to nylon membranes , the resulting blot was hybridized with a 32 p - labeled bar gene sequence from the plasmid pdpg165 . the radioactivity used per blot was approximately 25 × 10 6 cerenkov cpm . the lane in fig4 designated &# 34 ; 1 &# 34 ; and &# 34 ; 5 &# 34 ; copies contain 1 . 9 and 9 . 5 pg respectively of the 19 kb bar expression unit released from the plasmid pdpg165 by application of the ecori and hindiii enzymes ; these amounts represent about 1 and 5 copies per diploid genome . genomic dna from all eleven bialaphos - resistant isolates contained bar - hybridizing sequences as shown in fig4 . the hybridization in all isolates to a fragment migrating slightly larger than 2 kb may be due to contaminating puc19 sequences contained in this bar probe preparation ; no such hybridization occurred in subsequent experiments using the same genomic dna and a different preparation of the bar probe . hybridization to a 1 . 9 kb fragment in eight of the eleven isolates indicated that these isolates contained intact copies of the 1 . 9 kb bar expression unit . the estimated copy numbers of the intact unit ranged from one or two ( e1 , e7 , e8 , e10 , e11 ) to approximately 20 ( e3 , e4 , e6 ). hybridization with the bar probe in isolates e2 and e5 occurred only to a single , higher molecular weight fragment (˜ 3 kb ). to establish that the pat coding sequence was intact in isolates e2 and e5 , genomic dna was digested with smai , which releases a 559 bp fragment containing the pat structural gene ( fig1 a ), and subjected to dna gel blot analysis using 32 p - labeled bar . this analysis confirmed the presence of a single intact copy of bar . expression of pat in these isolates may not be dependent on the 35s promoter or the tr7 3 &# 39 ; end . the hybridization patterns of some of the isolates were identical ( e2 and e5 ; e7 and e8 ; e3 , e4 , and e6 ); therefore , it is probable that some isolates did not arise from independent transformation events but represent transformants that were separated during selection . seven hybridization patterns were unique , likely representing seven independent single - cell transformation events . the patterns and intensities of hybridization for the seven transformants were unchanged during four months in culture , providing evidence for the stability of the integrated sequences . the seven independent transformants were derived from two separate bombardment experiments . four independent transformants representing isolates e2 / e5 , e3 / e4 / e6 , e1 and e7 / e8 , were recovered from a total of four original filters from bombardment experiment # 1 and the three additional independent transformants , e9 , e10 , and e11 , were selected from tissue originating from six bombarded filters in experiment # 2 . these data are summarized in table 2 . table 2__________________________________________________________________________summary of maize transformation experiments # of # withindependent intact # of bar bar # with gus # with cointegration coexpression exp . culture filters transformants expression coding gus frequency frequency # bombarded bombarded recovered units sequence activity (%) (%) __________________________________________________________________________1 sc82 4 4 3 n . a . 2 sc82 6 3 2 n . a . 3 sc94 10 8 6 n . a . 4 sc716 * 8 13 8 11 3 85 23 5 sc716 * 8 7 4 6 1 86 14 6 sc82 * 4 19 17 13 3 68 16 totals 40 54 40 30 7 77 ( 30 / 39 ) 18 ( 7 / 39 ) __________________________________________________________________________ * culture reinitiated from cryopreserved cells n . a . not applicable ; only pdpg165 dna used or cotransformation analysis not done studies with other embryogenic suspension cultures produced similar results . using either an sc82 culture that was reinitiated from cryopreserved cells ( experiment # 6 ) or an a188 × b84 ( sc94 ) suspension culture ( experiment # 3 ), numerous independent transformants were recovered ( 19 and 18 respectively ; table 2 ). all transformants contained the bar gene and expressed pat . the copy number of bar - hybridizing sequences and levels of pat expression were comparable to the studies described above . integration of the bar gene into cell lines derived from the sc716 suspension culture bombardment studies and subsequent analyses were also performed on the a188 × b73 suspension culture , termed sc716 ( see example 1 ). the resultant transformed plant cells were analyzed for integration of bar genes . to carry out this analysis , genomic dna was obtained from r1 - r21 isolates ; 6 μg of dna was digested with the restriction endonucleases ecori and hindiii , and dna gel blot analysis was performed using the bar gene as probe . in fig9 molecular weights in kb are shown to the right and left . the untransformed control is designated &# 34 ; r0 ,&# 34 ; and the last column to the right contains the equivalent of two copies of the bar gene expression unit per diploid genome . for the dna load used , two copies the bar expression unit per diploid genome is 5 . 7 pg of the 1 . 9 kb ecori / hind fragment from the plasmid pdpg165 . the dna separated on the gel blot was hybridized to a 32 p - labeled bar probe . the label activity in the hybridization was approximately 10 × 10 6 cerenkov cpm . in a , the presence of an intact bar expression unit is inferred from the hybridization of the bar probe to a 1 . 9 kb band in the gel . sc716 transformants discussed in example 5 , were further analyzed for integration and expression of the gene encoding gus . as determined by histochemical assay , four of the sc716 transformants ( r5 , r7 , r16 , and r21 ) had detectable gus activity 3 months post - bombardment . expression patterns observed in the four coexpressing callus lines varied . the number of cells with gus activity within any given transformant sampled ranged from ˜ 5 % to ˜ 90 % and , in addition , the level of gus activity within those cells varied . the cointegration frequency was determined by washing the genomic blot hybridized with bar ( fig9 a ) and probing with 32 p - labeled gus sequence as shown in fig9 b . ecori and hindiii , which excise the bar expression unit from pdpg165 , also release from pdpg208 a 2 . 1 kb fragment containing the gus coding sequence and the nos 3 &# 39 ; end ( fig1 b ). seventeen of the independent bar transformants contained sequences that hybridized to the gus probe ; three , r2 , r14 and r19 did not . transformants in which gus activity was detected ( r5 , r7 , r16 and r21 ) had intact copies of the 2 . 1 kb ecori / hindiii fragment containing the gus structural gene ( fig9 b ). transformants that contained large numbers of fragments that hybridized to bar ( r1 , r5 , r21 ) also contained comparable number of fragments that hybridized to the gene encoding gus ( fig9 a and b ). this observation is consistent with those reported using independent plasmids in peg - mediated transformation of a188 × bms protoplasts ( lyznik , et al ., 1989 ) and in studies conducted by the inventors involving bombardment - mediated transformation of bms suspension cells . co - transformation may be achieved using a vector containing the marker and another gene or genes of interest . alternatively , different vectors , e . g ., plasmids , may contain the different genes of interest , and the plasmids may be concurrently delivered to the recipient cells . using this method , the assumption is made that a certain percentage of cells in which the marker has been introduced , have also received the other gene ( s ) of interest . as can be seen in the following examples , not all cells selected by means of the marker , will express the other genes of interest which had been presented to the cells concurrently . for instance , in example 7 , successful cotransformation occurred in 17 / 20 independent transformants ( see table 2 ), coexpression occurred in 4 / 20 . in some transformants , there was variable expression among transformed cells . co - integration and co - expression of the bar gene and the gus gene to cell lines derived from the sc82 suspension culture of the bialaphos - resistant isolates selected from a reinitiation of cryopreserved sc82 cells transformed with separate plasmids ( as described for sc716 ), nineteen independent transformants were selected in this experiment ( experiment # 6 , table 2 ). the frequency of cointegration and coexpression in those isolates was similar to that described for sc716 isolates ( table 2 ). the pattern of gus staining in these transformants varied in a manner similar to that described for coexpressing sc716 transformants . a transformant , y13 , which contained intact gus coding sequence , exhibited varying levels of gus activity as shown in fig8 . this type of expression pattern has been described previously in cotransformed bms cells ( klein , et al ., 1989 ). variable activity detected in the cells from a single transformant may be attributed to unequal penetration of the gus substrate , or differential expression , methylation , or the absence of the gene in some cells . these results show that both the bar gene and the gus gene are present in some of the cells bombarded with the two plasmids containing these genes . co - transformation has occurred . in the cotransformation examples described herein and summarized in table 2 , cotransformation frequency of the non - selected gene was 77 %; coexpression frequency was 18 %. for use in agriculture , transformation of cells in vitro is only one step toward commercial utilization of these new methods . plants must be regenerated from the transformed cells , and the regenerated plants must be developed into full plants capable of growing crops in open fields . for this purpose , fertile corn plants are required . the invention disclosed herein is the first successful production of fertile maize plants ( e . g ., see fig1 a ) from transformed cells . during suspension culture development , small cell aggregates ( 10 - 100 cells ) are formed , apparently from larger cell clusters , giving the culture a dispersed appearance . upon plating these cells to solid media , somatic embryo development can be induced , and these embryos can be matured , germinated and grown into fertile seed - bearing plants . the characteristics of embryogenicity , regenerability , and plant fertility are gradually lost as a function of time in suspension culture . cryopreservation of suspension cells arrests development of the culture and prevents loss of these characteristics during the cryopreservation period . one efficient regeneration system involves transfer of embryogenic callus to ms ( murashige and skoog , 1962 ) medium containing 0 . 25 mg / l 2 , 4 - dichlorophenoxyacetic acid and 10 . 0 mg / l 6 - benzyl - aminopurine . tissue was maintained on this medium for approximately 2 weeks and subsequently transferred to ms medium without hormones ( shillito , et al ., 1989 ). shoots that developed after 2 - 4 weeks on hormone - free medium were transferred to ms medium containing 1 % sucrose and solidified with 2 g / l gelgro ® in plant con ® containers where rooting occurred . another successful regeneration scheme involved transfer of embryogenic callus to n6 ( chu , et al ., 1975 ) medium containing 6 % sucrose and no hormones ( armstrong and green , 1985 ) for two weeks followed by transfer to ms medium without hormones as described above . regeneration was performed at 25 ° c . under fluorescent lights ( 250 microeinsteins · m - 2 · s - 1 ). after approximately 2 weeks developing plantlets were transferred to soil , hardened off in a growth chamber ( 85 % relative humidity , 600 ppm co 2 , 250 microeinsteins · m - 2 · s - 1 ), and grown to maturity either in a growth chamber or the greenhouse . regeneration of plants from transformed cells requires careful attention to details of tissue culture techniques . one of the major factors is the choice of tissue culture media . there are many media which will support growth of plant cells in suspension cultures , but some media give better growth than others at different stages of development . moreover , different cell lines respond to specific media in different ways . a further complication is that treatment of cells from callus initiation through transformation and ultimately to the greenhouse as plants , requires a multivariate approach . a progression consisting of various media types , representing sequential use of different media , is needed to optimize the proportion of transformed plants that result from each cell line . table 3 illustrates sequential application of combinations of tissue culture media to cells at different stages of development . successful progress is ascertained by the total number of plants regenerated . table 3__________________________________________________________________________plants to soil from bombardment of sc716 ( expts 1 , 2 ; table 2 ). regeneration media progressions 227b 227b 227b 227b 227b 227b 227b 227b # 227b 201b 52 163 205 227b 201b 205 163 227b 201b plants 227b 171 171 171 171 171 173 173 173 173 177 177 to cell line 101 101 101 101 101 101 101 101 101 101 101 101 soil__________________________________________________________________________controls a01c - 11 x 4 x x x x 2 x x x x x 6 * a01c - 01 x 7 x x x x 27 x x x x x 34 * total x 11 x x x x 29 x x x x x 40 * transformed a01c - 11 x x x 0 0 0 x x 0 0 x x 0 a01c - 12 x 2 x 0 0 0 x x 0 0 x x 2 a01c - 13 x 5 1 4 0 0 1 1 1 1 x x 14 * a01c - 14 x 2 x 0 0 0 x x 1 0 x x 3 * a01c - 15 x 28 0 12 7 1 23 13 0 0 0 0 84 * a01c - 17 x 7 0 0 0 0 17 0 0 0 0 0 24 a01c - 18 x 12 0 0 x 0 21 10 0 x 2 0 45 * a01c - 19 x 0 x x 0 x 0 x x 0 x 0 0 a01c - 20 x 10 x 0 0 x 0 x x 0 x 0 10 * a01c - 21 x 0 x x x x 0 x x x x 0 0 a01c - 24 2 4 0 0 0 0 6 5 0 0 0 0 17 * a01c - 25 x 9 x x 0 0 1 x 0 0 x x 10 a01c - 27 x 0 x x x x 10 x x x x 0 10 * total 2 79 1 16 7 1 79 29 2 1 2 0 219 * combined controls x 11 x x x x 29 x x x x x 40 * transformed 2 79 1 16 7 1 79 29 2 1 2 0 219 * total 2 90 1 16 7 1 108 29 2 1 2 0 259 * __________________________________________________________________________ x = regeneration not attempted by this route . * = more plants could have been taken to soil . 201b = 201 with 1 mg / l bialophos . 227b = 227 with 1 mg / l bialophos . it can be seen that using the same group of media , cell lines will vary in their success rates ( number of plants ) ( table 3 ). there was also variation in overall success rate , line ao1 - 15 yielding the greatest number of plants overall . ( it should be noted , however , that because tissue was limiting not all combinations of media were used on all lines , therefore , overall comparisons are limited .) a preferred embodiment for use on cell lines in general , at least initially , is the combination shown in the second column under the regeneration media progression ( media 227 , 171 , 101 , 501 ). media 227 is a good media for the selective part of the experiments , for example , to use for growth of callus in the presence of bialaphos . this media contains the hormone dicamba . naa and 2 , 4 - d are hormones in other media . in liquid media , these are usually encapsulated for controlled release ( see example 12 hereinbelow ). thus , it can be seen from table 1 that the various media are modified so as to make them particularly applicable to the development of the transformed plant at the various stages of the transformation process . for example , subculture of cells in media 171 after applying the selective agent , yields very small embryos . moreover , it is believed that the presence of bap in the media facilitates development of shoots . myo - inositol is believed to be useful in cell wall synthesis . shoot elongation and root development proceeds after transfer to media 101 . 101 and 501 do not contain the hormones that are required for earlier stages of regeneration . transfer of regenerating plants is preferably completed in an agar - solidified media adapted from a nutrient solution developed by clark ( 1982 ; ref . 6 ), media 501 . the composition of this media facilitates the hardening of the developing plants so that they can be transferred to the greenhouse for final growth as a plant . the salt concentration of this media is significantly different from that of the three media used in the earlier stages , forcing the plant to develop its own metabolic pathways . these steps toward independent growth are required before plants can be transferred from tissue culture vessels ( e . g . petri dishes , plant cans ) to the greenhouse . approximately 50 % of transformed callus lines derived from the initial sc82 and sc716 experiments were regenerable by the routes tested . transgenic plants were regenerated from four of seven independent sc82 transformants and ten of twenty independent sc716 transformants . regeneration of thirteen independently , transformed cell lines and two control lines of sc716 was pursued . regeneration was successful from ten of thirteen transformants . although a total of 458 plantlets were regenerated , due to time and space constraints only 219 transformed plants ( representing approximately 48 % of the total number of regenerants ) were transferred to a soilless mix ( see below ). approximately 185 plants survived . twelve regeneration protocols were investigated and the number of plants regenerated from each route has been quantified ( table 3 ). there appeared to be no significant advantage to maturing the tissues on 201 , 52 , 163 , or 205 ( see table 1 for media codes ) prior to transfer to medium 171 or 173 . the majority of the plants were generated by subculturing embryogenic callus directly from 227 to either 171 or 173 . these plantlets developed roots without addition of exogenous auxins , and plantlets were then transferred to a soilless mix , as was necessary for many of the transformants regenerated from sc82 . the soilless mix employed comprised pro mix , micromax , osmocote 14 - 14 - 14 and vermiculite . pro mix is a commercial product used to increase fertility and porosity as well as reduce the weight of the mixture . this is the bulk material in the mixture . osmocote is another commercial product that is a slow release fertilizer with a nitrogen - phosphorus - potassium ratio of 14 : 14 : 14 . micromax is another commercial fertilizer that contains all of the essential micronutrients . the ratio used to prepare the soilless mix was . 3 bales ( 3 ft 3 each ) pro mix ; 10 gallons ( vol .) vermiculite ; 7 pounds osmocote ; 46 ml micromax . the soilless mix may be supplemented with one or two applications of soluble fe to reduce interveinal chlorosis during early seedling and plant growth . regeneration of transformed sc82 selected cell lines yielded 76 plants transferred to the soilless mix , and 73 survived . the plants were regenerated from six bialaphos - resistant isolates , representing four of seven clonally independent transformants . eighteen protocols were used successfully to regenerate the seventy six plants ( table 4 ). differences in morphology between cell lines deemed some protocols more suitable than others for regeneration . table 4__________________________________________________________________________effects of progression of media on the number of plants regenerated ( sc82 )* 227b 227b 227b 227b 227b 227b 227b 227b 227b 227b 227b 227b 201b 227b 201b 201b 201b 201b 227b 227b 227b 227a 227a 227a 171 52 52 52 171 201b 227b 205 227b 205 1 52 142 173 171 205 209 173 173 173 173 171 173 173 178 171 177 177 178 171 cell 101 101 101 101 101 101 101 101 101 101 101 101 101 101 101 101 101 101 # of line 501 501 501 501 501 501 501 501 501 501 501 501 501 501 501 501 501 501__________________________________________________________________________ plantsb3 - 14 - 4 1 x 14 x x x 1 1 x 2 x x 5 x 5 x x x 29 b3 - 14 - 9 x x 1 1 x 4 1 x x x x x x 1 x 1 x x 9 b3 - 14 - 7 x x x x x x x x x x 6 2 x x x x x 1 9 b3 - 14 - 6 x x x x 1 x x x x x x x x x x x x x 1 b3 - 14 - 3 x x x x x x x x x x x x x x x x x x 0 b3 - 14 - 2 x x x x x x x x x x x x x x x x x x 0 b3 - 14 - 1 x x x x x x x x x x x x x x x x x x 0 b3 - 14 - 5 x x x x x x x x x x x x x x x x x x 0 b3 - 13 - 5 x x x x x x x x x x x x x x x x x x 0 b3 - 13 - 2 x 1 13 x x x 3 2 2 x x x x x 1 x x x 22 b3 - 13 - 1 x 3 x 1 x x x x 1 x x x x x x x 1 x 6 total 1 4 28 2 1 4 5 3 3 2 6 2 5 1 6 1 1 1 76__________________________________________________________________________ * see table 1 for media codes . x = this media progression was either attempted and unsuccessful or not attempted . 227a = 227 with 10 . sup .- 7 m aba . 227b = 227 with 1 mg / l bialaphos . prior to regeneration , the callus was transferred to either a ) an n6 - based medium containing either dicamba or 2 , 4 - d or b ) an ms - based medium containing 2 , 4 - d . these steps allowed further embryoid development prior to maturation . most of the maturation media contained high bap levels ( 5 - 10 mg / l ) to enhance shoot development and cause proliferation . an ms - based medium with low 2 , 4 - d ( 0 . 25 mg / l ) and high bap ( 10 mg / l ), as described by shillito , et al ., 1989 , was found to be quite effective for regeneration . likewise , an ms - based medium containing 1 μm naa , 1 μm iaa , 2 μm 2 - ip , and 5 mg / l bap ( modified from congar , et al ., 1987 ) also promoted plant regeneration of these transformants . after plantlets recovered by any of the regenerative protocols had grown to five cm , they were transferred to a nutrient solution described by clark , 1982 , which was solidified with gelgro . plantlets which were slow to develop roots were treated with 3 μl droplets of 0 . 3 % iba at the base of the shoot to stimulate rooting . plants with well developed root systems were transferred to a soilless mix and grown in controlled environmental chambers from 5 - 10 days , prior to transfer to the greenhouse . j . assays for integration of exogenous dna and expression of dna in r 0 r 1 plants studies were undertaken to determine the expression of the transformed gene ( s ) in transgenic r 0 and r 1 plants . functional activity of pat was assessed by localized application of a commercial herbicide formulation containing ppt to leaves of sc82 r 0 and r 1 plants . no necrosis was observed on leaves of r 0 plants containing either high levels ( e2 / e5 ), or low levels ( e3 / e4 ) of pat . herbicide - treated e3 / e4 / e6 and control leaves are shown in fig1 a . herbicide was also applied to leaves of e2 / e5 progeny segregating for bar . as demonstrated in fig1 b , leaves of r 1 plants expressing bar exhibited no necrosis six days after application of the herbicide while r 1 plants without bar developed necrotic lesions . no necrosis was observed on transformed leaves up to 30 days post - application . twenty - one r 0 plants , representing each of the four regenerable transformed sc82 callus lines , were also analyzed for expression of the bar gene product , pat , by thin - layer chromatographic techniques . protein extracts from the leaves of the plants were tested . pat activity of one plant regenerated from each callus line is shown in fig5 . all 21 plants tested contained pat activity . furthermore , activity levels were comparable to levels in the callus lines from which the plants were regenerated . the nontransformed plant showed no pat activity ( no band is in the expected position for acetylated ppt in the autoradiograph from the pat chromatogram ). a band appears in the bms lane that is not in lanes containing protein extracts from the plant leaves . this extra band was believed to be an artifact . as another method of confirming that genes had been delivered to cells and integrated , genomic ( chromosomal ) dna was isolated from a nontransformed plant , the four regenerable callus lines and from two r 0 plants derived from each callus line . fig6 illustrates results of gel blot analysis of genomic dna from the four transformed calli ( c ) and the r 0 plants derived from them . the transformed callus and all plants regenerated from transformed callus contained sequences that hybridized to the bar probe , indicating the presence of dna sequences that were complementary to bar . furthermore , in all instances , hybridization patterns observed in plant dna were identical in pattern and intensity to the hybridization profiles of the corresponding callus dna . dna from e3 / e4 / e6 callus and the desired r 0 plants contained approximately twenty intact copies of the 1 . 9 kb bar expression unit ( cauliflower mosaic virus 35s promoter - bar - agrobacterium transcript 7 3 &# 39 ;- end ) as well as numerous other bar - hybridizing fragments . e11 callus and plant dna contained 1 - 2 copies of the intact expression unit and 5 - 6 additional non - intact hybridizing fragments . e10 callus and plants contained 1 - 2 copies of the intact bar expression unit . e2 / e5 dna contained a single fragment of approximately 3 kb that hybridized to the probe . to confirm that the hybridizing sequence observed in all plants were integrated into the chromosomal dna , undigested genomic dna from one plant derived from each independent transformant was analyzed by dna gel blot hybridization . hybridization to bar was observed only in high molecular weight dna providing evidence for the integration of bar into the maize genome . plants were regenerated from the coexpressing callus line , y13 , shown in fig8 . plants regenerated from y13 ( experiment # 6 , table 2 ) were assayed for gus activity and histochemically stained leaf tissue from one plant is shown in fig1 c , d , e . numerous cell types including epidermal , guard , mesophyll and bundle sheath cells stained positive for gus activity . staining intensity was greatest in the vascular bundles . although all leaf samples from the regenerated plants tested ( 5 / 5 ) expressed the nonselected gene , some non - expressing leaf sectors were also observed . leaf tissue extracts from three y13 and three control plants were also assayed for gus activity by fluorometric analysis ( jefferson , 1987 ). activity detected in two opposing leaves from each of three y13 plants tested was at least 100 - fold higher than that in control leaves . a method to detect the presence of phosphinothricin acetyl transferase ( pat ) activity is to use thin layer chromatography . an example of such detection is shown in fig5 wherein various protein extracts prepared from homogenates of potentially transformed cells , and from control cells that have neither been transformed nor exposed to bialaphos selection , are assayed by incubation with ppt and 14 c - acetyl coenzyme a . 25 pg of protein extract were loaded per lane . the source in lanes e1 - e11 were sc82 transformants ; b13 is a bms ( black mexican sweet corn nonembryogenic ) bar transformant e0 is a nonselected , nontransformed control . as can be seen at the position indicated by the arrow ( the position expected for the mobility of 14 c - n - acppt ), all lanes except the nontransformed control have activities with the appropriate mobility . variation in activity among the transformants was approximately 10 fold , as demonstrated by the relative intensity of the bands . the results of this assay provide confirmation of the expression of the bar gene which codes for pat . for analysis of pat activity in plant tissue , 100 - 200 mg of leaf tissue was extracted in sintered glass homogenizers and assayed as described previously . gus activity was assessed histochemically as described using 5 - bromo - 4 - chloro - 3 - indolyl glucuronide ( jefferson , 1987 ); tissue was scored for blue cells 18 - 24 h after addition of substrate . fluorometric analysis was performed as described by jefferson ( 1987 ) using 4 - methyl umbelliferyl glucuronide . dna gel blot analysis was performed as follows . genomic dna was isolated using a procedure modified from shure , et al ., 1983 . approximately 1 gm callus tissue was ground to a fine powder in liquid n2 using a mortar and pestle . powdered tissue was mixed thoroughly with 4 ml extraction buffer ( 7 . 0m urea , 0 . 35m nacl , 0 . 05m tris - hcl ph 8 . 0 , 0 . 01m edta , 1 % sarcosine ). tissue / buffer homogenate was extracted with 4 ml phenol / chloroform . the aqueous phase was separated by centrifugation , passed through miracloth , and precipitated twice using 1 / 10 volume of 4 . 4m ammonium acetate , ph 5 . 2 and an equal volume of isopropanol . the precipitate was washed with 70 % ethanol and resuspended in 200 - 500 μl te ( 0 . 01m tris - hcl , 0 . 001m edta , ph 8 . 0 ). plant tissue may also be employed for the isolation of dna using the foregoing procedure . genomic dna was digested with a 3 - fold excess of restriction enzymes , electrophoresed through 0 . 8 % agarose ( fmc ), and transferred ( southern , 1975 ) to nytran ( schleicher and schuell ) using 10 × scp ( 20 × scp : 2m nacl , 0 . 6m disodium phosphate , 0 . 02m disodium edta ). filters were prehybridized at 65 ° c . in 6 × scp , 10 % dextran sulfate , 2 % sarcosine , and 500 μg / ml heparin ( chomet , et al ., 1987 ) for 15 min . filters were hybridized overnight at 65 ° c . in 6 × scp containing 100 μg / ml denatured salmon sperm dna and 32 p - labeled probe . the 0 . 6 kb smai fragment from pdpg165 and the 1 . 8 kb bamhi / ecori fragment from pcev5 were used in random priming reactions ( feinberg and vogelstein , 1983 ; boehringer - mannheim ) to generate labeled probes for detecting sequences encoding pat or gus , respectively . filters were washed in 2 × scp , 1 % sds at 65 ° c . for 30 min . and visualized by autoradiography using kodak xar5 film . prior to rehybridization with a second probe , the filters were boiled for 10 min . in distilled h 2 o to remove the first probe and then prehybridized as described above . the herbicide formulation used , basta tx ®, contains 200 g / l glufosinate , the ammonium salt of phosphinothricin . young leaves were painted with a 2 % basta solution ( v / v ) containing 0 . 1 % ( v / v ) tween - 20 . the prescribed application rate for this formulation is 0 . 5 - 1 % in fig1 a , basta ® solution was applied to a large area ( about 4 × 8 cm ) in the center of leaves of a nontransformed a188 × b73 plant ( left ) and a transgenic r 0 e3 / e4 / e6 plant ( right ). in fig1 b , basta was also applied to leaves of four r 1 plants ; two plants without bar and two plants containing bar . the herbicide was applied to r 1 plants in 1 cm circles to four locations on each leaf , two on each side of the midrib . photographs were taken six days after application . to recover progeny the regenerated , genetically transformed maize plants ( designated r 0 ), were backcrossed with pollen collected from nontransformed plants derived from seeds , and progeny ( designated r 1 ) that contained and expressed bar were recovered . an important aspect of this invention is the production for the first time of fertile , genetically transformed maize plants ( r 0 ) and progeny ( r 1 ). these were regenerated from embryogenic cells that were transformed . r 1 plants are those resulting from backcrossing of r 0 plants . pollination of transgenic r 0 ears with non - transformed b73 pollen resulted in kernel development . in addition , kernels developed from pistillate flowers on male inflorescences that were pollinated with non - transformed b73 pollen . kernels on transformed r 0 plants from sc82 developed normally for approximately 10 - 14 days post - pollination but after this period the kernels ceased development and often collapsed . most plants exhibited premature senescence at this time . a total of 153 kernels developed sporadically on numerous plants ( see table 5 ): 8 of 37 e2 / e5 plants , 2 of 22 e10 plants , and 3 of 6 e11 plants . viable progeny were recovered by embryo rescue from 11 e2 / e5 plants and one e10 plant . table 5__________________________________________________________________________regenerated plants ( r . sub . 0 ) and progeny ( r . sub . 1 ) # of independent # of bar regenerable # of # # of r . sub . 0 # of # of exp culture transformants transformed r . sub . 0 reaching producing kernels r . sub . 1 # bombarded recovered callus lines plants maturity kernels recovered plants__________________________________________________________________________1 , 2 sc82 7 4 . sup . 76 . sup . 73 23 153 40 4 , 5 sc716 20 10 . sup . 219 . sup . ( 35 ) ( 9 ) ( 51 ) ( 31 ) 3 sc94 8 2 . sup . a 11 . sup . a ( 0 ) ( 0 ) ( 0 ) ( 0 ) 6 sc82 19 4 . sup . a 23 . sup . a ( 0 ) ( 0 ) ( 0 ) ( 0 ) __________________________________________________________________________ . sup . a regeneration in progress . () experiment still in progress , data still being collected . sc716 r 0 plants were also backcrossed with seed - derived b73 plants . to date , from the 35 mature sc716 r 0 plants nine plants ( representing four independent callus lines ) yielded 51 kernels , 31 of which produced vigorous r 1 seedlings ( table 5 ). most kernels that developed on sc716 plants did not require embryo rescue kernels often developed for 30 - 40 days on the plant and some were germinated in soil . the remaining seed was germinated on ms - based medium to monitor germination and transferred to soil after a few days . in addition to the improved kernel development observed on sc716 r 0 plants relative to sc82 r 0 plants , pollen dehisced from anthers of several sc716 plants and some of this pollen germinated in vitro ( pfahler 1967 ). transmission of the foreign gene has occurred both through sc716 r 1 ears and using sc716 r 1 - derived pollen on nontransformed ears . pollen obtained from transformed r 1 plants has now been successfully employed to pollinate b73 ears and a large number of seeds have been recovered ( see fig1 c ). moreover , a transformed ear from an r 1 plant crossed with pollen from a non - transformed inbred plant is shown in fig1 d . the fertility characteristics of the r 1 generation has been confirmed both from a standpoint of the pollen &# 39 ; s ability to fertilize non - transformed ears , and the ability of r 1 ears to be fertilized by pollen from nontransformed plants . analysis of progeny ( r 1 ) of transformed r 0 plants for pat and bar a total of 40 progeny of e2 / e5 r 0 plants were analyzed for pat activity , ten of which are shown in fig7 a . of 36 progeny which were assayed , 18 had pat activity genomic dna from the same ten progeny analyzed for pat activity was analyzed by dna gel blot hybridization for the presence of bar as shown in fig7 b . the six progeny tested that expressed pat contained a single copy of bar identical in mobility to that detected in callus and r 0 plants ; the four pat - negative progeny tested did not contain bar - hybridizing sequences . in one series of assays , the presence of the bar gene product in 18 of 36 progeny indicates a 1 : 1 segregation of the single copy of bar found in e2 / e5 r 0 plants and is consistent with inheritance of pat expression as a single dominant trait . a dominant pattern of inheritance would indicate the presence in the plant of at least one copy of the gene coding for pat . the single progeny recovered from an e10 r 0 plant tested positive for pat activity . it was determined that the methods disclosed in this invention resulted in transformed r 0 and r 1 plants that produced functionally active pat . this was determined by applying basta ( ppt ) to the leaves of plants and determining whether necrosis ( tissue destruction ) resulted from this application . if functionally active pat is produced by the plants , the leaf tissue is protected from necrosis . no necrosis was observed on r 0 plants expressing high levels of pat ( e2 / e5 ) or on plants expressing low levels ( e3 / e4 / e6 ) ( fig1 a ). herbicide was also applied to leaves of r 1 progeny segregating for bar . in these studies , no necrosis was observed on r 1 plants containing and expressing bar , however , necrosis was observed on those r 1 plants lacking the bar gene . this is shown in fig1 b . segregation of bar did not correlate with the variability in phenotypic characteristics of r 1 plants such as plant height and tassel morphology . in fig9 b , the plant on the right contains bar , the plant on the left does not . in addition , most of the r 1 plants were more vigorous than the r 0 plants . of the 23 r 1 seedlings recovered to date from the sc716 transformants , ten of 16 had pat activity . pat activity was detected in four of ten progeny from r 0 plants representing callus line r18 and six of six progeny from r 0 plants representing callus line r9 . in cases where embryo rescue was required , developing embryos were excised from surface disinfected kernels 10 - 20 days post - pollination and cultured on medium containing ms salts , 2 % sucrose and 5 . 5 g / l seakem agarose . large embryos (& gt ; 3 mm ) were germinated directly on the medium described above . smaller embryos were cultured for approximately 1 week on the above medium containing 10 - 5 m abscisic acid and transferred to hormone - free medium for germination . several embryos became bacterially contaminated ; these embryos were transferred to medium containing 300 μg / ml cefoxitin . developing plants were subsequently handled as described for regeneration of r 0 plants . viable progeny , recovered from seven sc82 e2 / e5 plants and one sc82 e10 plant , were sustained by embryo rescue . this method consisted of excising embryos from kernels that developed on r 0 plants . embryos ranged in size from about 0 . 5 to 4 mm in length . small embryos were cultured on maturation medium containing abscisic acid while larger embryos were cultured directly on germination medium . two of the approximately forty viable progeny thus far recovered from sc82 r 0 plants are shown in fig1 b . most of the r 0 plants regenerated from sc82 transformants exhibited an a188 × b73 hybrid phenotype . plants were similar in height to seed derived a188 plants ( 3 - 5 feet ) but had b73 traits such as anthocyanin accumulation in stalks and prop roots , and the presence of upright leaves . many plants , regardless of the callus line from which they were regenerated , exhibited phenotypic abnormalities including leaf splitting , forked leaves , multiple ears per node , and coarse silk . although many of the phenotypic characteristics were common to all r 0 plants , some characteristics were unique to plants regenerated from specific callus lines . such characteristics were exhibited regardless of regeneration route and the time spent in culture during regeneration . nontransformed control plants were not regenerated from this culture and , therefore , cannot be compared phenotypically . pistillate flowers developed on tassels of one e11 ( 1 / 6 ), several e10 ( 3 / 22 ) and almost one - third of the e2 / e5 ( 12 / 37 ) plants with a range of three to approximately twenty ovules per tassel . primary and secondary ears developed frequently on most e2 / e5 , e1 , and e11 plants ; a mature e2 / e5 plant is shown in fig1 a . anthers rarely extruded from the tassels of plants regenerated from sc82 transformants and the limited number of anthers which were extruded did not dehisce pollen . some phenotypic characteristics observed were unique to plants regenerated from a specific callus line such as the lack of ears on e3 / e4 / e6 plants and a &# 34 ; grassy &# 34 ; phenotype ( up to 21 lone narrow leaves ) exhibited by all e11 plants . all sc82 plants senesced prematurely ; leaf necrosis began approximately two weeks after anthesis . the r 0 plants regenerated from sc82 transformed cell lines have tended to senesce prematurely ; typically before the developing kernels were mature . this has necessitated the use of embryo rescue to recover progeny ( r 1 generation ). segregation of bar in the r 1 generation does not correlate with the variability in phenotypic characteristics of r 1 plants such as plant height and tassel morphology . in fig1 b , the plant on the right contains bar , the plant on the left does not . in addition , most of the r 1 plants are more vigorous than the r 0 plants . transformed progeny ( r 1 ) have now also begun to yield kernels and r2 plantlets have been recovered . of 219 plants regenerated from 10 independent sc716 transformants , approximately 35 have reached maturity ( table 5 ). the sc716 plants did not exhibit the phenotypic differences which characterized the individual callus lines of sc82 . these plants were more uniform and abnormalities less frequent . the phenotype of these plants closely resembled that of control plants regenerated from a sc716 cryopreserved culture which was not bombarded . plant height ranged from three to six feet with the majority of the plants between five and six feet . most mature plants produced large , multi - branched tassels and primary and secondary ears . pistillate flowers also developed on tassels of several sc716 plants . although anther extrusion occurred at approximately the same low frequency as in the sc82 plants , a small amount of pollen dehisced from some extruded anthers . for most of the sc716 plants that reached maturity , senescence did not commence until at least 30 days after anthesis . the improved characteristics of sc716 plants over sc82 plants indicate that differences between the suspension cultures may be responsible . while the invention is susceptible to various modifications and alternative forms , specific embodiments thereof have been shown by way of example in the drawings and herein be described in detail . it should be understood , however , that it is not intended to limit the invention to the particular forms disclosed , but on the contrary , the intention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the invention as defined by the appended claims . the references listed below are incorporated herein by reference to the extent that they supplement , explain , provide a background for , or teach methodology , techniques , and / or compositions employed herein . reference 3 . carlsson j ., drevin h ., axen r . ( 1978 ), biochem j . 173 : 723 . reference 4 . chomet p . s ., wessler s ., dellaporta s . l . ( 1978 ). embo j 6 : 295 - 302 . reference 5 . chu c . c ., wang c . c ., sun c . s ., hsu c ., yin k . c ., chu c . y ., bi f . y . ( 1975 ). scientia sinica 18 : 659 - 668 . reference 7 . comai l ., gacciotti d ., hiatt w . r ., thompson g ., rose r . e ., stalker d . ( 1985 ). nature 317 : 741 - 744 ; conger , b . v ., novak , f . j ., afza , r ., erdelsky , k . ( 1987 ). plant cell rep 6 : 345 - 347 . reference 8 . cristou p ., mccabe d . e , swain w . f . ( 1988 ), plant physiol 87 : 671 - 674 . reference 10 . de block , m ., botterman j ., vandiwiele m ., dockx j ., thoen c ., gossele v ., movva n . r . thompson c ., van montagu m ., leemans j . ( 1987 ). embo j . 6 : 2513 - 2518 ; see also pct publication number wo 87 / 05629 , published sep . 24 , 1987 . reference 11 . de block , m ., botterman j ., vandiwiele m ., dockx j ., thoen c ., gossele v ., movva n . r ., thompson c ., van montagu m ., leemans j . ( 1989 ). plant physiol 91 : 694 - 701 . reference 12 . dekeyser r ., claes b ., marichal m ., van montagu m ., caplan a . ( 1989 ). plant physiol 90 : 217 - 223 . reference 13 . delannay x ., lavallee b . j ., proksch r . k ., fuchs r . l ., sims s . r ., greenplate j . r ., marrone p . g ., dodson r . b ., augustine j . j ., layton j . g ., fischhoff d . a . ( 1989 ), bio / technol 7 : 1265 - 1269 . reference 14 . feinberg a . p ., vogelstein b . ( 1983 ). anal biochem 132 : 6 - 13 . reference 15 . finkle b . j ., ulrich j . m ., rains w ., savarek s . j . ( 1985 ). plant sci 42 : 133 - 140 . reference 16 . fischhoff d . a ., bowdish k . s ., perlak f . j ., marrone p . g ., mccormick s . m ., niedermeyer j . g ., dean d . a ., kusano - kretzmer k ., mayer e . m ., rochester d . e ., rogers s . g ., fraley r . t . bio / technol 5 : 807 - 813 . reference 17 . fromm m . e ., taylor l . p ., walbot v . ( 1986 ). nature 312 : 791 - 793 . reference 18 . haughn g . w ., smith j ., mazur b ., somerville , c . ( 1988 ). mol gen genet 211 : 266 - 271 . reference 19 . hauptmann r . m ., vasil v ., ozias - aikins p ., tabaeizadeh z ., rogers s . g ., fraley r . t ., horsch r . b ., vasil i . k . ( 1988 ). plant physiol 86 : 602 - 606 . reference 21 . jefferson r . a . ( 1987 ). p1 mol biol repr 5 : 387 - 405 . reference 22 . klein t . m ., kornstein l ., sanford j . c ., fromm m . e . ( 1989 ). plant physiol 91 : 440 - 444 . reference 23 . klein t . m ., kornstein l ., sanford j . c ., fromm m . e . ( 1987 ). nature 327 : 70 - 73 . reference 25 . lorz h ., baker b ., schell j . ( 1985 ). mol gen genet 199 : 178 - 182 . reference 26 . lyznik l . a ., ryan r . d ., ritchie s . w ., hodges t . k . ( 1989 ). plant mol biol 13 : 151 - 16 . reference 27 . mccabe d . e ., swain w . f ., martinell b . j ., cristou p . ( 1988 ). bio / technol 6 : 923 - 926 . reference 28 . mcdaniel c . n ., poethig r . s . ( 1988 ). planta 175 : 13 - 22 . reference 29 . murakami t ., anzai h , imai s ., satoh a ., nagaoka k ., thompson c . j . ( 1986 ). mol gen genet 205 : 42 - 50 . reference 31 . nelson r . s ., mccormick s . m ., delannay x ., dube p ., layton j ., anderson e . j ., kaniewska m ., proksch r . k ., horsch r . b ., rogers s . g ., fraley r . t . beachy r . n . ( 1988 ). bio / technol 6 : 403 - 409 . reference 32 . nester , e . w ., et al , ( 1984 ). ann . rev . plant physiol 35 : 387 - 413 . reference 33 . ogawa , y . et al ( 1973 ). sci . rep ., meija seika 13 : 42 - 48 . reference 37 . prioli l . m ., sondahl m . r . ( 1989 ). bio / technol 7 : 589 - 594 . reference 38 . rhodes c . a ., pierce d . a ., mettler i . j ., mascarenhas d ., detmer j . j . ( 1988 ). science 240 : 204 - 207 . reference 39 . shillito r . d ., carswell g . k ., johnson c . m ., dimaio j . j ., harms c . t . ( 1989 ). bio / technol 7 : 581 - 587 . reference 40 . shah d . m ., horsch r . b ., klee h . j ., kishore g . m ., winter j . a ., tumer n . e ., hironaka c . m ., sanders p . r ., gasser c . s ., aykent s ., siegel n . r ., rogers s . g ., fraley r . t . ( 1986 ). science 233 : 478 - 481 . reference 41 . shimamoto k ., terada r ., izawa t ., fujimoto h . ( 1989 ). nature 338 : 274 - 276 . reference 42 . shure m ., wesler s ., federoff , n . ( 1983 ). cell 35 : 225 - 233 . reference 45 . thompson c . k ., movva n . r ., tizard r ., crameri r ., davies j . e ., lauwereys m ., botterman j . ( 1987 ). embo j 6 : 2519 - 2623 . reference 46 . tomes d . ( 1990 ). annual meting proceedings , 26th annual corn breeders school , university of illinois , february 26 - 27 , pp . 7 - 9 . reference 47 . twell d ., klein t . m ., fromm m . e ., mccormick s . ( 1989 ). plant physiol 91 : 1270 - 1274 . reference 48 . vaeck m ., reynaerts a ., hofte h ., jansens s ., de beuckeleer m ., dean c ., zabeau m ., van montagu m ., leemans j . ( 1987 ). nature 328 : 33 - 37 . reference 49 . withers l . a ., king p . j . ( 1979 ). plant physiol 64 : 675 - 678 . reference 50 . wong , y . c ., et al . ( 1988 ). plant mol biol 11 : 433 - 439 . reference 51 . yang h ., zhang m . h ., davey m . r ., mulligan b . j ., cocking e . c . ( 1988 ). plant cell rep 7 : 421 - 425 . reference 52 . zhang m . h ., yang h ., rech e . l ., golds t . j ., david a . s ., mulligan b . j ., cocking e . c ., davey e . r . ( 1988 ). plant cell rep 7 : 379 - 384 . reference 53 . white , j ., chang , s . p ., bibb , m . j ., bibb , m . j . ( 1990 ), nucl acids res , 18 : 1062 . reference 54 . zukowsky et al . ( 1983 ), proc . natl . acad . sci . usa 80 : 1101 - 1105 . reference 56 . doring , h . p . and starlinger ( 1986 ), ann . rev . genet . 20 : 175 - 200 reference 57 . federoff , n . ( 1989 ), &# 34 ; maize transposable elements &# 34 ;, in mobile dna . wowe , m . m . and berg , d . e ., eds ., amer . soc . microbiol ., wash ., d . c ., pp . 377 - 411 . reference 58 . shapiro , j . a . ( 1983 ), mobile genetic elements , academic press , n . y . reference 59 . dellaporta , s . l ., greenblatt , i . m ., kermicle , j ., hicks , j . b ., and wessler , s . ( 1988 ), stadler symposium 11 : 263 - 282 . reference 61 . stief , a ., winter , d ., stratling , w . h ., and sippel , a . e . ( 1989 ), nature 341 : 343 . reference 62 . phi - van , l ., kries , j . p ., ostertag , w ., stratling , w . h . ( 1990 ), mol cell biol 10 : 2302 - 2307 . reference 63 . coe , e . h ., neuffer , m . g ., and hoisington , d . a . ( 1988 ), in corn and corn improvement , sprague , g . f . and dudley , j . w . eds ., pp . 81 - 258 reference 64 . johnson , r ., norvdez , j ., an , g , and ryan , c . ( 1989 ), proc . natl . acad . sci . usa 86 : 9871 - 9875 reference 65 . hammock , b . d ., bonning , b . c ., possee , r . d ., hanzlik , t . n ., and maeda , s . ( 1990 ), nature 344 : 458 - 461 reference 66 . berg , d . e ., egner , c ., hirschel , b . j ., howard , j ., jorgensen , r ., and tisty , t . d . ( 1980 ) cold spring harbor symposium 45 : 448 - 465 reference 67 . hinchee , m . a . w ., connor - ward , d . v ., newell , c . a ., mcdonell , r . e ., sato , s . j ., gasser , c . s ., fischhoff , d . a ., re , c . b ., fraley , r . t ., horsch , r . b . ( 1988 ) bio / technol 6 : 915 - 922 . reference 68 . odell , j . t ., nagy , f ., chua , n . h . ( 1985 ) nature 313 : 810 - 812 . reference 69 . lawton , m . a ., tierney , m . a ., nakamura , i ., anderson , e ., komeda , y ., dube , p ., hoffman , n ., fraley , r . t ., beachy , r . n . ( 1987 ), plant mol . biol . 9 : 315 - 324 . reference 70 . ebert , p . r ., ha , s . b ., an . g . ( 1987 ), pnas 84 : 5745 - 5749 . reference 71 . walker , j . c ., howard , e . a ., dennis , e . s ., peacock , w . j . ( 1987 ), pnas 84 : 6624 - 6628 . reference 73 . conkling , m . a ., cheng , c . l ., yamamoto , y . t ., goodman , h . m . ( 1990 ), plant physiol . 93 : 1203 - 1211 . reference 74 . fromm , h ., katagiri , f ., chua , n . h . ( 1989 ), the plant cell 1 : 977 - 984 . reference 75 . ingelbrecht , i . l . w ., herman , l . m . f ., dekeyser , r . a ., van montagu , m . c ., depicker , a . g . ( 1989 ), the plant cell 1 : 671 - 680 ; bevan , m ., barnes , w . m ., chilton , m . d . ( 1983 ), nucleic acid res . 11 : 369 - 385 . reference 76 . callis , j ., fromm , m ., walbot , v . ( 1987 ), genes and develop . 1 : 1183 - 1200 . reference 77 . vasil , v ., clancy , m ., ferl , r . j ., vasil , i . k ., hannah , l . c . ( 1989 ), plant physiol . 91 : 1575 - 1579 . reference 78 . gallie , d . r ., lucas , w . j ., walbot , v . ( 1989 ), the plant cell 1 : 301 - 311 . reference 79 . sambrook , j ., fritsch , e . f ., and maniatus , t . ( 1989 ), molecular cloning , a laboratory manual 2nd ed . reference 80 . gelvin , s . b ., schilperoort , r . a ., varma , d . p . s ., eds . plant molecular biology manual ( 1990 ). reference 81 . fransz , p . f ., de ruijter , n . c . a ., schel , j . h . n . ( 1989 ), plant cell rep 8 : 67 - 70 reference 82 . potrykus , i ., saul , m . w ., petruska , j ., paszkowski , j ., shillito , r . d . ( 1985 ), mol gen genet 199 : 183 - 188 reference 83 . stalker , d . m ., malyj , l . d ., mcbride , k . e . ( 1988 ), j biol chem 263 : 6310 - 6314 reference 84 . ow , d . w ., wood , k . v ., deluca , m ., dewet , j . r ., helinski , d . r ., howell , s . h . ( 1986 ) science 234 : 856 - 859 reference 85 . ikatu , n ., souza , m . b . n ., valencia , f . f ., castro , m . e . b ., schenberg a . c . g ., pizzirani - kleiner , a ., astolfi - filho , s . ( 1990 ), bioltechnol 8 : 241 - 242 reference 86 . watrud , l . s ., perlak , f . j ., tran , m .- t ., kusano , k ., mayer , e . j ., miller - widemann , m . a ., obukowicz , m . g ., nelson , d . r ., kreitinger , j . p ., and kaufman , r . j . ( 1985 ), in engineered organisms and the environment , h . o . halvorson et al ., eds ., am . soc . reference 87 . cutler , a . j ., saleem , m ., kendell , e ., gusta , l . v ., georges , f ., fletcher , g . l . ( 1989 ), j plant physiol 135 : 351 - 354 . reference 88 . hilder , v . a ., gatehouse , a . m . r ., sheerman , s . e ., barker , r . f ., boulter , d . ( 1987 ) nature 330 : 160 - 163 . reference 90 . ikeda , h ., kotaki , h ., omura , s . ( 1987 ), j bacteriol 169 : 5615 - 5621 . reference 91 . gatehouse , a . m ., dewey , f . m ., dove , j ., fenton , k . a ., dusztai , a . ( 1984 ), j sci food agric 35 : 373 - 380 reference 92 . broakaert , w . f ., parijs , j ., leyns , f ., joos , h ., peumans , w . j . ( 1989 ) science 245 : 1100 - 1102 . reference 93 . barkai - golan , r ., mirelman , d ., sharon , n . ( 1978 ) arch . microbiol 116 : 119 - 124 reference 93 . comai , l ., u . s . pat . no . 4 , 535 , 060 ; and atcc deposit 39256 . reference 94 . european patent application publication number 0218571 a2 , published apr . 15 , 1987 . reference 95 . thillet , j ., absil , j ., stone , s . r ., pictet , r . ( 1988 ), j biol chem 263 : 12500 - 12508 reference 96 . chandler , v . l ., radicella , j . p ., robbins , p . p ., chen , j ., turks , d . ( 1989 ), the plant cell 1 : 1175 - 1183 reference 97 . dellaporta , s ., greenblatt , i ., kermicle , j ., hicks , j . b ., wessler , s . ( 1988 ) in chromosome structure and function : impact of new concepts , 18th stadler genetics symposium , j . p . gustafson and r . appels , eds ( new york : plenum press ), pp . 263 - 282 . reference 98 . sutcliffe , j . g . ( 1978 ), proc natl acad sci usa 75 : 3737 - 3741 __________________________________________________________________________ # sequence listing - - - - ( 1 ) general information : - - ( iii ) number of sequences : 3 - - - - ( 2 ) information for seq id no : 1 : - - ( i ) sequence characteristics : ( a ) length : 36 base - # pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - - ( xi ) sequence description : seq id no : 1 : - - gaggatccgt cgaccatggt aagcttagcg ggcccc - #- # 36 - - - - ( 2 ) information for seq id no : 2 : - - ( i ) sequence characteristics : ( a ) length : 29 base - # pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - - ( xi ) sequence description : seq id no : 2 : - - gatccgtcga ccatggcgct tcaagcttc - # - # 29 - - - - ( 2 ) information for seq id no : 3 : - - ( i ) sequence characteristics : ( a ) length : 29 base - # pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - - ( xi ) sequence description : seq id no : 3 : - - gcagctggta ccgcgaagtt cgaagggct - # - # 29__________________________________________________________________________ | 8 |
fig1 shows a catheter insertion device 1 having a catheter hub 2 which has a two - part form in the embodiment . a distal hub element 3 of the catheter hub has a holding section 3 a in which a catheter 4 is press - fitted . the proximal end of the hub element 3 has an enlarged diameter with regard to the distal end and forms a connecting section with a hub element 5 whose distal end overlaps the proximal end of the hub element 3 and which is provided at its proximal end with a luer thread 6 . between the two hub elements 3 and 5 , a check valve in the form of a valve disc 7 is inserted and is fixed in place by the two hub elements 3 and 5 . in the ready position according to fig1 , there is inserted in the catheter hub 2 a needle hub 8 to which a hollow needle 9 is fixed which extends through the valve disc 7 and the catheter 4 so that the needle tip 9 a is exposed . between needle hub 8 and valve disc 7 there is displaceably arranged in the proximal hub element 5 a valve actuating element 10 which has a truncated cone - shaped locating section 10 a which serves to open the valve disc 7 , as fig3 shows . on the proximal side , a plunger section 10 b adjoins the locating section 10 a and has a hollow space for receiving a needle guard element 13 . in the embodiment shown , the plunger section 10 b is formed by two spaced plungers between which the needle guard element in the form of a spring clip 13 is inserted , as shown in the cross - sectional view in fig4 . on withdrawal of the hollow needle 9 from the catheter hub 2 , an engaging means 9 b ( fig2 ), provided near the needle tip 9 a and having the form of a radial projection on the hollow needle which can be formed by light crimping , engages with the outer circumference of a bore in the rear wall 13 c of the spring clip 13 , so that the spring clip 13 is removed from the catheter hub with the needle 9 , while simultaneously the spring arms 13 a and 13 b of the spring clip cover the needle tip , completely protecting and blocking it . in this separated position shown in fig2 , the valve disc 7 , due to its elasticity , closes the through - hole for the hollow needle 9 so that no blood can flow out through the catheter 4 . as fig6 shows , the valve disc is provided for example with three slits 7 a starting from the middle and extending radially over a short section x , forming elastic flaps 7 b therebetween which can be expanded by the hollow needle . fig3 shows the insertion of a syringe 14 in the catheter hub 2 , wherein the neck portion 14 a of the syringe comes to abut on the plunger section 10 b of the valve actuating element 10 and presses it against the valve disc 7 , so that the truncated cone - shaped locating section 10 a outwardly displaces the flaps 7 b of the valve disc and thereby opens the valve , so that a liquid can be inserted from the syringe 14 into the catheter 4 . the incline of the truncated cone on the locating section 10 a and the displacement path of the actuating element 10 relative to the valve disc 7 are designed such that due to the elasticity of the material of the valve disc 7 , the flaps 7 b displace the locating section 10 a to the right in fig3 when the syringe 14 is removed from the catheter hub 2 . hereby , the valve disc 7 is automatically closed , as the position in fig2 shows . in the hub element 5 , there is formed by a shoulder 5 a a stop for the actuating element 10 , to define the position of the actuating element in the separated position in fig2 . hereby , the truncated cone - shaped locating section 10 a lies near the stop 5 a , while its distal end abuts on the valve disc 7 as shown in fig2 . the radial slits 7 a of the valve disc 7 are designed such that in the ready position in fig1 , the flaps 7 b are bent radially upwards less than in the open position by the locating section 10 a in fig3 . as the cross - sectional view in fig4 shows , the two plungers lob of the valve actuating element 10 are guided in longitudinal grooves 5 e of the hub element 5 and they project radially inwards into the bore 5 c of the hub element 5 , so that they form an abutting surface for the neck portion 14 a of the syringe 14 . the bore 5 c in the hub element 5 is formed slightly conically corresponding to the conical neck portion 14 a of a syringe . on the inner circumference of the bore 5 c of the hub element 5 , a further shoulder 5 b having a smaller diameter is formed , on which the radially outer areas of the spring arms 13 a and 13 b abut in the ready position in fig1 . hereby , the spring clip 13 is fixed in its position in the hub element 5 . when the needle hub 8 with the hollow needle 9 is removed from the catheter hub 2 , first the spring clip 13 is held on the shoulder 5 b by abutting until the radial projection 9 b comes to abut on the rear wall 13 c of the spring clip . in this position , the two spring arms 13 a , 13 b can be released from the shoulder 5 b and spring back inwards to cover the needle tip , as fig2 shows , whereupon the spring clip 13 with the hollow needle 9 can be removed from the catheter hub . in the embodiment according to fig1 to 3 , the distal end section of the hub element 5 is shrunk , welded or bonded onto the proximal end section of the hub element 3 after the valve actuating element 10 and the valve disc 7 are inserted in the hub element 5 . it is also possible to join the two hub elements 3 and 5 to one another , for example by a thread which is secured against loosening after assembly . the spring clip 13 is inserted together with the hollow needle 9 in the bore 5 c of the hub element 5 during assembly , wherein the radially outer areas of the spring arms 13 a , 13 b snap in at the shoulder 5 b under elastic deformation . preferably , in front of the shoulder 5 b a projection 5 b ′ can be formed in the bore 5 c of the hub element , as shown in fig2 . hereby the snap - in and holding effect of the spring clip 13 is increased . fig5 shows a modified embodiment of the connection of the two hub elements 3 and 5 , in which two cylindrical sections 3 b and 5 d engage in one another . a thread can be provided between these two cylindrical sections . however , it is also possible to bond or weld these two sections . in this embodiment , the valve actuating element 10 is also modified in relation to the embodiment of fig1 to 3 . fig7 a shows a side view of the approximately u - shaped actuating element 10 with the spring clip 13 inserted therein . as the side view rotated by 90 . degree . in fig7 b shows , the locating section 10 a is partly flattened on opposite sides so that the width of the plunger sections 10 b extends into the locating section 10 a . fig7 c is a front view from the left in fig7 b and shows the flattened structure of the locating section 10 a . fig7 d is a sectional view along the central line in fig7 b . fig7 e shows a section through the valve actuating element 10 along the line b - b in fig7 d . fig5 shows the lower half of the valve actuating element 10 corresponding to the view in fig7 a , and the upper half in a sectional view rotated by 90 . degree . corresponding to fig7 b . the shoulder 5 a for positioning the valve actuating element 10 in the hub element 5 is hereby formed on the ends of the diametrically opposite grooves 5 e ( fig4 ), so that the proximal ends of the plunger sections 10 b abut on the shoulders 5 a . corresponding to the shoulder 5 b in fig1 to 3 in the embodiment in fig5 , there is formed on the hub element 5 a projection 5 f which projects inwards at diametrically opposite positions on the bore 5 c of the hub element 5 and fixes the spring clip 13 in the hub element 5 until the spring arms 13 a , 13 b spring inwards over the needle tip and the spring clip with the hollow needle 9 is removed from the catheter hub . fig8 shows a modified embodiment having a hollow cylindrical valve actuating element 10 on whose inner circumference a projection 10 f is formed for positioning the spring clip 13 inside the valve actuating element 10 . fig9 a shows a front view of the valve actuating element 10 from the right and fig9 b shows a front view from the left in fig8 , wherein for locating the neck portion 14 a of a syringe 14 , in this embodiment radially inwardly projecting ribs 10 e are formed which protrude radially into the bore 5 c of the hub element 5 , as the upper half of the valve actuating element in fig8 shows , in which the sectional view of the lower half of the valve actuating element 10 is shown rotated by 90 . degree . in relation to the upper half . fig1 shows a modified embodiment wherein between the two hub elements 3 and 5 a check valve 17 is inserted , which has a hollow cylindrical section 17 b starting from a flange section 17 a and abutting on the inner circumference of the hub element 3 . from the inner circumference near the flange section 17 a there start two opposite flaps 17 c , which abut on the outer circumference of the hollow needle 9 in the ready position in fig1 . when the needle 9 is removed from the catheter hub 2 , the elastically deformed flaps 17 c move inwards and close the valve . in this embodiment , an actuating element for opening the valve 17 is not necessary , because the pressure of the fluid from the syringe 14 displaces the flaps 17 c radially outwards so that the liquid can flow out through the valve 17 . in this embodiment of a check valve , a so - called duck - bill valve is concerned , whose construction is in itself known . in fig1 , in order to allow the spring clip 13 to be held in the catheter hub during withdrawal of the hollow needle 9 from the catheter hub 2 until the radial projection 9 b on the hollow needle engages with the rear wall 13 c to cover the needle tip , in this embodiment there is formed on the inner circumference of the proximal hub element 5 a projection 5 f which extends radially inwards and on which the radially outer areas of the spring arms 13 a and 13 b come to abut and hold the spring clip until the spring arms spring back radially inwards to cover the needle tip . the inner diameter of the projection 5 f is designed only slightly smaller than the maximum radial dimension at the spring arms 13 a and 13 b , so that during assembly the spring clip 13 can be inserted by slight pressure into the position in the catheter hub as shown in fig1 . in the embodiment of a catheter insertion device according to fig1 to 9 , in the position of the valve actuating element 10 in fig2 the valve disc 7 can be opened by low pressure produced by the syringe 4 for drawing off liquid from the catheter , wherein the elastic flaps 7 b are bent upward by the low pressure . in the embodiment of fig1 , a drawing - off of liquid from the catheter is not possible , because the duck - bill valve does not open when there is low pressure on the proximal side . it is convenient to fabricate the check valve in the form of a valve disc 7 or of the flap valve 17 from elastic silicon , while a correspondingly rigid plastic material is used for the hub elements 3 and 5 and for the valve actuating element 10 . | 0 |
turning now to the drawings , and in particular to fig1 the window motor control circuit of the present invention is indicated generally at 10 . circuit 10 is configured around and includes an asic μ1 processor , shown in greater detail in fig2 described hereinbelow . asic μ1 is powered at pin v dd from the vehicle battery b + with 9 to 16 volts through resistor r6 . pin v dd of asic μ1 and resistor r6 are connected to ground through capacitors c1 and c3 , and through diode d10 , all connected in parallel to provide a regulated v dd voltage of 5 vdc . an oscillator output pin v os - out is connected through resistor r8 to an oscillator input pin v os - in , used to generate a clock frequency , and to ground through capacitor c5 . pins ref - out ( through resistor r5 ) and ref - in are connected through resistor r4 to pin agnd . as described in greater detail below , a percentage of a stall reference voltage is applied to asic μ1 through pin ref - in and pin ref - out is used to apply a stored voltage corresponding to the in - rush current to a voltage divider . pin agnd provides an analog reference output , in the presently preferred embodiment 1 / 4 v dd . switch s1 is closed in response to movement by a passenger or driver of the vehicle of an actuator to effect downward movement of a vehicle window and is electrically connected between v dd and down input pin down . in the exemplary embodiment of the present invention described herein , actuation of the connected actuator triggers the circuit into both &# 34 ; down &# 34 ; and &# 34 ; express down &# 34 ; modes . when depressed to a first detented position , a down mode is effected wherein the window moves down until the operator releases the actuator . effecting depression of the actuator to a second detented position causes a switch s3 to close , thereby causing the system to enter the express down mode wherein downward movement of the window continues until an end of travel is reached or the mode is canceled by the user . if the actuator is depressed a second time after the express down mode has already been initiated , the express down mode is cancelled . the depression of the &# 34 ; up &# 34 ; switch also cancels the express down mode . thus , even though switch s3 may be mechanically controlled with switch s1 via a single button , it is electrically separate . switch s3 is electrically connected between the vehicle battery , through resistor r9 , and ground via capacitor c7 , and to an express down input pin express of asic μ1 . however , one of skill in the art should readily appreciate that the present circuit will effectively operate in accordance with various other actuation schemes such as the provision of a separate express down actuator . pin v - ref of μ1 is grounded through capacitor c8 which is charged with the voltage corresponding to motor in - rush current . shunt voltage input v s received from window lift motor m1 , connected to the vehicle battery through a relay spdt which is operated by a coil k1 . when the motor m1 is running , this shunt voltage is used by asic μ1 to determine its state , i . e . in - rush , run or stall . pin v s is also coupled through resistor r3 to switch s2 which is actuable to initiate upward movement of the vehicle window . in this regard , resistor r3 acts as a current sensor as long as up switch s2 is not closed . output pin out provides an output drive current to a transistor q1 having its emitter connected through diode d5 to ground and its collector to the vehicle battery through diode d6 . diode d6 is connected on the opposite side to coil k1 . pin out is high whenever circuit 10 is in either the down or express down mode but is otherwise low . under normal conditions , asic μ1 is powered by the vehicle battery and is in a latent condition , waiting for input on either of the down or express pins . these inputs are normally tied to ground via a 30k ohm resistor . pin out is low at this time , thereby maintaining transistor q1 in a cutoff state . input v s , referenced to ground , is at zero volts . when a user actuates the down switch s1 , connecting pin down to v dd , the voltage at pin down will go above a predetermined trigger voltage v h set to indicate positive actuation of the down actuator . if this condition is maintained for at least 10 ms , asic μ1 considers it a valid signal confirming actuation of the down actuator . if , at this time , pin out is low , indicating no prior actuation of down switch s1 , pin out will go to a high state , thereby driving transistor q1 with 5 ma to saturate the transistor and energize power relay spdt via coil k1 . pin out remains high until the down actuator switch s1 is released , regardless of the amount of current flowing through motor m1 . when the voltage at pin down drops below the trigger voltage low v l for at least 10 ms , typically indicative of the release of down switch s1 , pin out returns to a low state and asic μ1 goes back to its wait state . if pin out is already in a high state when the down pin is made high , pin out will be pulled low . this will cancel the express down function . pin out will remain at a low state even though pin down is high . once pin down goes low , asic μ1 will be reset and made ready for a manual down operation . to effect an express down movement of the window , asic μ1 must be in a wait state and the operator must first actuate the down actuator thereby closing switch s1 , forcing the voltage at pin down above the trigger voltage high v h . if pin out is low , it will go to a high state and power up the motor through relay spdt . input pin v s will read and amplify ( by about 12 times in this exemplary embodiment ) the voltage drop across the external current shunt ( typically 28 to 120 mvdc ). when motor m1 is initially turned on , the in - rush current causes a voltage spike on input pin v s . the spike voltage value is amplified and stored by a peak - detect , sample / hold circuit and used as a reference on pin ref - in . in the sample / hold operation pin v - ref will charge an external capacitor c8 to a peak voltage charge during in - rush motor current . this peak voltage is a direct measurement of the in - rush current spike on pin v s , which is amplified about 12 times . the peak voltage will be stored at pin v - ref until pin out goes low . this can take up to 13 seconds . pin ref - out is a buffered output of pin v - ref , and an external voltage divider , formed by resistors r4 and r5 , will divide this voltage and connect it to pin ref - in . this ref - in voltage is the threshold voltage used for detecting stall current on input pin v s . in this exemplary embodiment , the threshold is set as a fixed percentage of the voltage corresponding to the in - rush current , preferably equating to about 87 % of in - rush current . however , it should be apparent that any other similar means of selecting a threshold based upon in - rush current could alternately be used . when the operator actuates express down switch s3 , after the input on pin down has gone above v h and pin out has gone to a high state , input pin express will go to a high level , v h . if this state is maintained for at least 10 ms , asic μ1 latches internally so that pin out remains high even though pins express and down are low ( i . e . the operator has released the express and down actuators ). pin out will remain at a high level even though either of pins express or down remain high . an internal oscillator in μ1 will be incrementing internal counters during the entire time that asic μ1 has been actuated into the express down mode . once circuit 10 is put into the express down mode , there are six modes of cancellation , the first being for time - out . when asic μ1 is in the express down mode , pin out remains high . during this time , the oscillator on pins vos - out and vos - in will increment internal time - out counters . if these counters complete a specified counting sequence , approximately 10 seconds with an oscillator frequency of 10 khz , asic pin out will be pulled to a high state . this time - out ensures that down window notion is stopped after a certain period time thus protecting the motor against a prolonged stall condition in the unlikely event that the stall current doesn &# 39 ; t exceed the threshold for some reason or some other circuit or mechanical anomaly has occurred . the second cancellation of the express down mode occurs in the case of motor tall , usually occurring at an end of travel position of the window . if the voltage level at in v s is higher than the reference voltage at pin ref - in , asic μ1 will detect a stall condition and begin incrementing internal stall delay counters . if this stall condition is maintained for more than a predefined stall delay period , approximately 0 . 5 seconds in this presently preferred embodiment , but then v s goes back to a lower value , asic μ1 resets the stall delay counters . if this latest peak value is higher than the in - rush , it will be stored by the peak detector and used for the new threshold . the ratio between the stall and time - out time periods can be modified . by pulling pin ratio high , the ratio between the stall time period ( t stall ) and the time - out period ( t tout ), t stall / t tout = 0 . 35 / 10 ; by pulling pin ratio low , t stall / t tout = 0 . 65 / 10 . in the presently preferred embodiment of the present invention , wherein the pin is left floating , this ratio is 0 . 5 / 10 . the express down mode can also be cancelled through further actuation of the down actuator . if pin down goes to a high state when pin out is high , asic μ1 resets and pulls pin out low . pin out will remain in a low state even though pin down aremains high . similarly , actuation of the express down actuator a second time also effects cancellation of the down mode . if after a down cancel as described above , pin down is maintained in a high state , asic μ1 resets and pulls pin out low . pin out remains low even though pin down is high . if the up switch s2 is actuated during an express down mode of asic μ1 , when pin out is high , the asic will be left without ground and shut off when ground is restored , all of the circuit &# 39 ; s internal counters and registers must be reset , pulling pin out to a low state . if a short circuit current is detected during an express down mode , i . e . if v s = 0 . 263 v corresponding to i sc = 45 a in the presently preferred embodiment , pin out will be immediately pulled to a low state . thus , the present circuit allows for effective interruption of applied electrical power to a motor in an express down mode . fig1 a shows one possible embodiment of the motor m1 mechanically connected to the vehicle window 12 to be controlled . additional details concerning the components of asic μ1 is included as fig2 . as shown in the functional block diagram included as fig3 asic μ1 includes 9 main functional subcircuits , including amplifier , peak detector , buffer , short circuit comparator , stall comparator , state machines and output driver subcircuits . these subcircuits operate in accordance with the method described above in conjunction with fig1 . the foregoing discloses and describes merely an exemplary embodiment of the present invention . one having skill in the art will readily recognize that various changes and modifications can be made thereto without departure from the spirit and scope of the present invention as set forth in the following claims . | 7 |
fig1 , 3 , 4 and 5 depict a first variation of a bending device according to the invention . this bending device includes a first conveyor 1 , horizontal or approximately so , which brings glass panes z in the direction of arrow f inside the bending device , at a first , low level , a second conveyor 3 which crosses the entire bending device at a higher level and of which at least a portion is over the downstream portion of conveyor 1 , a bending form 4 located in ready position inside the bending device beyond the conveyor 1 beneath the downstream end of the upper conveyor 3 , gas blowing means s set up under the downstream end of the lower conveyor 1 , beneath the bending form and along the entire length of the upper conveyor 3 . advantageously , the bending form 4 is mobile , for instance mounted onto a trolley 5 with rollers , so as to be able to exit from the bending device by running on rails 6 . in preferred embodiments , the bending form is such that it allows the gasses from blowing means s to pass , and it is particularly a curved profile frame , open at its center , designed to support the glass panes 2 from their periphery . preferably , the blowing means s is comprised of at least two blowing caissons 7 and 8 independent of one another , caisson 7 being placed beneath the downstream end of the lower conveyor 1 and acting basically in that zone , caisson 8 being set up beneath the bending form 4 in ready position beneath the downstream end of the upper conveyor 3 . each caisson 7 and 8 is equipped with its own calibration means of the volume pressure of gas that it blows , those calibration means being diagrammed as flaps 9 and 10 , respectively , arranged at the base of each caisson 7 and 8 , on the intake duct 11 , 12 of gas under pressure . the blown gasses are hot gasses either for maintaining the glass pane at a high temperature , or for heating to attain this high temperature . the lower conveyor 1 can be as diagrammed in the figures a roller conveyor like 13 . but it can also be any intake means of glass panes to be bent 2 , thus for instance a belt or wheel , gas cushion conveyor , a support like a trolley which places the glass panes under the upward end of the upper conveyor 3 and above blowing means s . therefore , the term lower conveyor encompasses a multitude of possible means . on fig1 , 3 , 4 and 5 , the upper conveyor 2 is a gas cushion conveyor which includes a gas blowing caisson 14 which forms the gas cushion , supplied with gas under pressure from a duct 15 , that caisson 14 being provided on its lower side designed to be facing the glass panes 2 with a pane 16 perforated with orifices as in 17 by which the gas escapes . this is a schematic description of a gas cushion conveyor , but such conveyors are well known . obviously , other variations of a gas cushion conveyor are possible : with blowing nozzles or hubs instead of orifices 17 through the pane 16 , with a plurality of caissons instead of the only one covering the entire surface of the conveyor , etc . as a gas cushion conveyor , reference is made to that described in the publication of french pat . no . 1 , 527 , 937 . this conveyor 3 displays its side facing the glass panes to be carried , directed downwards ; it is advantageously oblique , or the zone which receives the glass panes is at a much lower level than the end position where said glass panes arrive after having been shifted along said conveyor , and it is fed with hot gasses so as to preserve the high temperature for glass panes which they possess on arriving inside the device , or to converge for raising the temperature , thus permitting their bending and later tempering as well . advantageously , additional means , for instance such as a guide 18 , the position of which can be adjusted , is provided in order to facilitate the guidance preferably of glass panes 2 during their travel on gas cushion conveyor 3 . in the event that the conveyor 3 is not oblique , or in the event that the tilt is not sufficient for the shift of glass panes 2 to take place without further assistance , means are provided which allow the glass panes to advance or aid in their advance . these can consist for instance of chain or mobile pin systems moving along the entire length of the conveyor 3 . fig6 displays an alternative variation of the bending device according to the invention wherein the upper conveyor 3 is a roller conveyor such as 19 . this roller conveyor 3 can be an oblique ascent in order to facilitate the evolution of the glass panes along its length , without help from external means , but it can also be horizontal , and even descending , without interfering with the operation of the process . the glass panes blown flat against the lower side of said conveyor , simply need to be pulled along the conveyor , with the rotation of the rollers 19 , this rotation taking place for instance as a result of conventional drive systems such as a driving chain meshing on gears associated with each roller 19 . in other variations the upper conveyor 3 can be provided with both gas cushion and with rollers ; blowing is anticipated between the rollers in order to minimize pressure of the panes against the rollers . in this embodiment , the rollers help in the advance of the glass panes . a glass pane 2 arrives inside the bending device on the lower conveyor 1 ( phase illustrated in fig1 ). as soon as this pane is in position , therefore above the blowing caisson 7 , blowing begins , and raises the glass pane and flattens it against the upper air cushion conveyor 3 ( phase illustrated in fig2 ) or roller . ascending blowing continues to be exerted , so the glass pane remains in contact with the upper conveyor 3 . because the conveyor is oblique , the blowing drives the advance of the glass pane along said conveyor ( phase illustrated in fig3 ). in cases where the conveyor is not oblique , the driving means set forth causes the glass pane to advance , whether it is a mobile pin , a chain , etc ., connected with the air cushion conveyor , or whether it involves motive rollers 19 from the roller conveyor 3 . then , the glass pane passes to the influence of the gas blown from the caisson 8 . a bending form 4 , such as a bending frame , is present beneath the downstream end of the conveyor 3 , either static in that position , or brought back to a ready position during the previous phases by trolley 5 running on rails 6 . the blowing under the glass pane is reduced or ceases , which leads to a slow descent , up to a sudden fall , of the glass pane onto the bending form ( phase of the process illustrated in fig4 ). on the bending form , the high temperature glass pane acquires the desired shape ( phase of the process illustrated in fig5 ) as a result of gravity and ultimately the transformation of kinetic energy acquired by the glass pane during its fall . if the blowing from caisson 8 is not stopped completely , it is therefore possible to control the descent of the glass pane onto the bending form , and even after that to control the curve that said glass pane will adopt at the center of bending form comprised of a frame open at its center . finally , the glass pane is evacuated from the bending device . that occurs usually by removing from said device , the bending form unit and the glass pane that it supports , by rolling the trolley 5 on rails 6 . but it is also possible to leave the bending form in place and recover and the bent glass pane , alone , for instance with a suction transfer system , which is conventional in the area of glass pane handling . most of the time , after bending , the glass pane is subjected to tempering . the bending form can be concave or convex . it can be located more or less at the same level as the glass pane intake conveyor 1 , or on the contrary at a different level , lower or higher . other means can also be provided in addition , so as to complete or accelerate the bending , for instance , a press . in such a device the glass panes for bending can succeed each other very rapidly . they can arrive in uninterrupted fashion one behind the other on the intake conveyor 1 , then on the upper conveyor 3 and then they can descend to the various bending forms of a caroussel . thus , a plurality of trolleys where each carriers a bending form , can be placed one behind the other beneath the downstream end of the conveyor 3 , right in time to receive a glass pane , and then they can exit from the device and bear their glass pane to the following work station , especially a tampering station . thus , the pace can be very high and energy consumption reduced as a result of the low volume required to be kept at a high temperature . indeed , the entire device is enclosed inside a heated structure , especially by hot gasses from the different caissons , but this structure can have a low volume , both conveyors being close to one another . furthermore , the blown gas , usually air , can be recycled . with this process , equipment changes required by model changes in windows for manufacturing , such as they were exercised in the prior art , are unnecessary . at best , one might have to modify the position of a guide 18 for the glass panes which is associated to the upper conveyor 3 . the device wherein the upper conveyor 3 is provided with a gas cushion is especially suited for bending glass panes provided on their upper side with enameled patterns , that are still quite fragile during the bending phase . the lack of contact of this upper side of the glass panes with any mechanical means prevents decay of those enamel patterns on the one hand , and tarnishing of the equipment on the other . in such a device there can be a succession of glass panes to be bent , fitted or not with enamel patterns or other , those patterns can vary from one glass pane to the other , and those glass panes with varied shapes and / or sizes , without it being necessary to modify , change or adapt anything . therefore no temperature setting time , no preparation time is envisioned for each change of manufactured window model . this process wherein glass panes are blown upwardly to their encounter with an upper conveyor , shifted along that conveyor , then brought down again , was described within the framework of a bending operation , but it can also apply to any transfer of objects such as glass panes , from one support to another , for instance from one conveyor to another conveyor , from one work station to another , etc . in one alternative variation , maintenance of the glass panes supported against the upper conveyor 3 can be achieved by suction through said conveyor . to this end , in the case of an upper conveyor 3 with gas cushion , the device described in the prior patent fr no . 1527 937 where blowing and suction orifices alternate can be employed . in such a variation , the upper conveyor 3 is still oblique advantageously , but in that case it is preferably descending if the glass panes are to be transferred without the help of mechanical means like chains , pins . blowing through lower caissons 7 and 8 can be provided together with suction through the upper conveyor 3 in order to maintain the glass panes on contact with said conveyor . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein . | 2 |
a preferred embodiment of the invention which is capable of detecting microwave radar signals from any azimuth direction is shown in block diagram form in fig1 . in accordance with the present invention , a plurality of element antennas 10 are arranged in a planar circumferential array . each element antenna comprises a horn element 12 and a microwave - responsive diode 14 mounted on a substrate 16 , which preferably is a printed circuit board the underside of which contains conductive paths for interconnecting components mounted on the upper side of the board . for convenience , each like element antenna is identified with a descriptive alphabetical reference character a thru h . it will therefore be readily understood that when other parts are identified with an alphabetical reference character a thru h , that element is operatively associated with the corresponding element antenna bearing that reference character . eight horn elements 12a . . . 12h , and associated diodes 14a . . . 14h are arranged in a planar circular pattern centered on 45 ° intervals such that each horn element and associated diode are disposed to scan an azimuth arc segment of 45 °. when the plurality of antenna elements 10 receive x - band radiation from an external remote source , output signals are developed by each of the element antennas 10 as a result of the incoming radiation . these output signals are fed to an associated signal processing circuit 11a . . . 11h comprising amplifier 18 , digitizer 20 , and comparator 22 . the antenna output signals are applied on line 17 to the associated amplifier 18a . . . 18h and raised therein to a ttl level of 5 volts and fed via line 19 to a digitizer 20 . digitizer 20 converts the signal to pulse form , and the pulse is applied via 21 to a comparator 22 . at comparator 22 , the output of the digitizer is compared to a predetermined threshold , preferably approximately 4 . 5 v . dc . when a signal applied to a comparator exceeds the threshold , an indicator 24 connected to the output of the comparator via cable 23 is activated . in the preferred form , indicator 24 comprises a circular array of lights 26a . . . 26h , each of which corresponds to one of the element antennas 1oa . . . 10h such that when an antenna element detects x - band radar microwave energy from a remote source sufficient to develop a signal which overcomes the threshold value set in the comparator , a corresponding light 26 is energized . in operation , alarm 24 is mounted in a panel ( not shown ) at the bridge or operating station of the ship on which the radar detection system is operating . fig6 shows a typical control panel 30 , to the back of which is attached a housing 32 that contains the wiring connecting the indicators to the signal processing circuits . the face of the control panel is slightly larger than the housing so as to permit the housing to be conveniently mounted in a panel provided with a 7 &# 34 ; × 43 / 8 &# 34 ; rectangular cutout . the face of the control panel 30 includes a circular array of eight lights 26a . . . 26h corresponding to element antennas 10a . . . 10h . several additional indicator lights are also provided on the face of the panel including a power light 34 , sensitivity light 36 , audio level light 30 , and an audio alarm 40 . a pair of handles 42 , 44 , are provided to facilitate handling of the unit . a marker 46 on the face of a lined indicator card 47 to which the lights 26 are mounted is stationary and serves to identify a 0 ° heading . when installing the system on a ship , the antenna is placed such that one of the antenna elements , 10a for example , is aligned with the keel of the ship . thus , successive antenna elements 10b . . . 10h represent successive 45 ° positions and energization of any of the lights 26a . . . 26h provides an indication of the relative bearing of a vessel having an operating radar which is detected by one of the element antennas . light 26a indicates the azimuth area within 3271 / 2 ° to 221 / 2 ° of the ship &# 39 ; s bearing . light 26b monitors the azimuth area between 221 / 2 ° to 671 / 2 °, and the remaining lights 26c . . . 26h monitor successive 45 ° azimuth area sectors . one or more additional remote indicators may be provided , if desired , at different locations of the ship . a typical remote indicator 48 is illustrated in fig8 . remote indicator 48 includes indicator lights which are electrically connected and parallel with the lights in the control panel 30 . the system can be conveniently mounted at any suitable location of a small vessel and to this end is packaged in a small pvc housing 50 which is mounted by means of a swivel connection 52 to a pedestal 54 . pedestal 54 is undercut , as at 56 , so as to be capable of being locked in position by locking mechanism 58 . the entire unit is supported from a base plate 60 adapted to be conveniently mounted by bolts or the like at a suitable location aboard ship . the electronics package assembly of the circuit is entirely comprised of solid - state elements , and after being placed in housing 50 is environmentally sealed by a suitable potting compound after which cover 51 is applied and secured in place . the overall dimensions of the entire system within which all of the electronics are packaged , except for the indicators , are approximately 6 . 5 &# 34 ; × 7 . 5 &# 34 ; inclusive of the pedestal , and the depth for the housing of the electronics is approximately 2 &# 34 ;. there is thus provided a very compact and efficient unit , readily adapted for use even on very small boats . referring now to fig3 there is illustrated the electronics package which is mounted within housing 50 . the package contains a printed current board or substrate 16 having a plurality of element antennas 10a . . . 10h spaced about the periphery on axes spaced at 45 ° intervals . mounted on the top surface of substrate 16 are a plurality of integrated circuits 62 and individual resistive and capacitive components which are interconnected on the back side of the card via conductive paths 64 . the output from the signal processing circuit is connected via conductors 66a - 68h to associated light - emitting diodes , previously identified as 26a . . . 26h . to this end , the center of the board includes a central grommetted opening through which output leads 68a . . . 68h pass into the hollow supporting pedestal arm and thereafter to the control panel and remote panel locations by a suitable connecting cable ( not shown ). it should be apparent that each integrated circuit is formed within a semiconductor chip which may contain more than an operative element of a channel . for example , amplifiers 18 are on an lm 380 chip which is a dual operational amplifier . thus this chip serves two channels and four are required since eight channels a . . . h are used . the details of the signal processing circuit are shown in fig2 and will be described in connection therewith . referring now to fig2 there is illustrated the signal processing circuit of the present invention . for convenience , only the circuit associated with antenna element 10a is illustrated , it being understood that each antenna element has an identical circuit for processing a signal derived by the corresponding antenna . diode 14a of element 10a is serially connected to a resistor divider network 70 comprising resistors 72 and 73 , the diode being connected between the resistors with the other end of resistor 73 being connected to ground , and the other end of resistor 72 being connected to an rc input filter comprising resistor 74 and capacitor 75 for smoothing voltage and eliminating noise from the voltage supply line 76 . capacitor 75 and resistor 72 also form another rc circuit which cooperates with diode 14a to allow the diode to produce noise and an output signal responsive to microwave radiation . when diode 14a is bombarded with microwave radiation at the frequency within the parameters of the diode , changes of resistance occur in the diode which are reflected in variations in current drawn through the divider network 70 . these changes correspond to noise due to vibrations in the diode and occur at an audio frequency . the signal is coupled via capacitor 78 to amplifier 80 which may be 1 / 2 of an lm 387 integrated circuit chip . resistors 82 and 83 form a feedback circuit for amplifier 80 to maintain its gain at approximately 1 , 000 . one end of resistor 82 is connected to capacitor 78 , while the junction of resistors 82 and 83 is connected to the number 2 pin of amplifier 80 . the other end of resistor 83 is connected to pin 4 of amplifier 80 . a stabilizing capacitor 86 is connected from pin 1 of amplifier 80 to ground . the output of amplifier 80 is an amplified version of the variations occurring at the junction of resistor 72 and the anode of diode 14a and is applied to pin 3 of a quad operational amplifier lf 347 two sections 88 and 90 of which are used to form the digitizer 20 . the output of the amplifier is applied to the positive input at pin 3 , with the negative input being connected via resistor 92 and capacitor 94 to ground . the output of the first stage 88 is connected via diode 96 , which may be a 1n914 or equivalent to the positive input pin 6 of the second stage 90 of the integrated circuit . pin 6 is also connected to the junction of resistor 92 and capacitor 94 . the purpose of digitizer 20 comprising stages 88 and 90 is to create a dc voltage pulse responsive to the voltage fluctuations caused by the excited antenna element which is applied to the comparator 22 . with no resistance to the positive input of the digitizer element 88 , the resistance to the negative input gain is greater than 1 . the amplified positive voltage fluctuations are passed through diode 96 and stored in capacitor 94 . the circuit operates similar to a pump , charging up the capacitor with pulses that are passed through diode 96 until the voltage on the capacitor is sufficient to cause it to discharge through element 90 and apply a pulse to the inverting input , pin 4 , of comparator 96 . the noninverting input , pin 5 , of comparator 96 has applied thereto a threshold voltage of approximately 4 . 5 volts . to this end , pin 5 is connected to one end of resistor 98 , the other end of which is connected to the positive bus or rail 99 . if the digitized signal is lower than the threshold voltage , the resistance through the output to ground is infinite preventing an output signal from activating the alarm circuits . when the digitized signal rises above the threshold voltage , comparator 96 switches , thereby applying the output pulse to its load comprising the indicator circuits 24 . as shown in fig2 the indicator circuit 24 comprises an led 26 having its cathode connected to the output pin 2 of comparator 96 and its anode connected via resistor 100 to positive bus 99 . led 26 forms the primary visual indicator mounted on control panel 30 . one or more remote led devices 26 - 1 and associated current limiting resistor 100 - 1 may be connected in parallel with led 26 and are shown in the figure in phantom . in addition to the visual indicator and alarm provided by led 26 , an audible alarm may be provided by way of piezoelectric speaker 102 . diode 104 connected between speaker 102 and pin 2 of comparator 96 prevents the audio circuit from activating light emitting diodes of other sectors a - h . to this end , speaker 102 is connected to receive the output of each signal processing circuit via a separate diode 104a . . . h , shown in phantom so that only one speaker common to all sectors a - h need be utilized . speaker 102 may be manually placed in or out of the circuit through manually operated switch 106 serially connected therewith . also , provided in the speaker circuit is a volume control . the volume of the speaker is controlled by means of a high - low speaker control comprising manually operated switch 108 and current limiting resistor 110 adapted to be connected in series with the speaker and limit the driving current therein . comparator 96 also includes a sensitivity switch 112 which decreases the threshold voltage to approximately 2 volts dc when a higher sensitivity is desired . switch 112 is adapted to connect either resistor 114 or resistor 116 into the circuit . switch 112 includes a second movable contact for connecting a two - color led 118 to the positive rail 99 . this provides the green and red indicator lights on the control panel . the positive rail 99 is supplied with voltage from an external source which may be plugged into jacks 120 . input line 121 is fused with a one - amp fuse and includes on / off switch 122 and a filter comprising diode 123 and capacitor 124 . filter 125 is connected to the input of a voltage regulator 126 which may be an lm 317 i . c .. the output of regulator 126 is connected to rails 76 and 99 . smoothing capacitor 127 further serves to minimize fluctuations in the line . fig4 and 6 illustrate in greater detail antenna element 10 comprising horn element 12 and microwave diode 14 . there are eight brass , truncated v - shape microwave horns spaced about the periphery of printed circuit board 16 . each horn element is mounted to the substrate 16 and comprises a back wall 120 , approximately 1 . 2 centimeters in width and two extending sidewalls 122 , 124 , each extending approximately 3 centimeters in length . the height of the horn element is 3 centimeters . disposed in the throat of the horn is microwave diode 14 which is mounted approximately one centimeter above the surface of the substrate and approximately 2 . 2 centimeters from the back wall . the leads of diode 14 pass through openings 17 in board 16 and ar soldered to appropriate terminals on the bottom side of the board . it is , of course , possible to mount the microwave diode 14 with its leads extending to opposite sides of the sidewalls of the horn . as shown in fig3 to maximize miniaturization space limitations will require mounting of components between the sidewalls of adjacent horns . in that event , the angle of the sidewalls of the horn may be reduced such that the angle is less than 45 °. because many surface radars used on ships have wide lobes , this presents no serious limitation in operation of the system . while the invention has been described in relation to a specific embodiment which has been illustrated and described in detail , it will be understood that various changes will suggest themselves to those skilled in the art without departing from the true spirit of the inventive principles as set forth in the appended claims and resort to the claims should be made for a complete understanding of the full scope of the invention . | 6 |
a mat assembly in accordance with the subject invention is identified generally by the numeral 10 in fig1 and 2 . the mat assembly 10 comprises a mat 12 and a frame 14 . the mat 12 has a top surface 16 and an opposed bottom surface 18 which are spaced sufficiently apart to define a thickness for the mat 12 of about 0 . 25 - 0 . 375 ″. portions of the mat 12 adjacent the top surface 16 comprise at least one non - woven array of fibers that exhibit appropriate absorbency for the intended use . additionally , the top surface 16 of the mat 12 is formed to define an array of fuzzy loops facing upward . the fuzzy loops may be made by needle punch , air laid , resin , bonded , carded or buffed technologies . for example , portions of the mat 12 adjacent the top surface 16 may comprise randomly oriented polypropylene microfibers having diameters of 2 - 10 microns . an alternate mat could be formed from non - woven staple fibers of polypropylene 96 %- 98 % and ema 2 %- 4 %, and these respective fibers could have diameters in the range of 25 - 35 microns . still another alternate mat 12 could be formed from recycled cotton and polyester fibers oriented in a non - woven array and with a latex binder on one side . portions of the mat 12 adjacent the bottom surface 18 preferably define a barrier that is chemical resistant and skid resistant . the barrier adjacent the bottom surface 18 of the mat 12 prevents liquid from striking through the mat 12 and hence avoids contamination of the floor and / or ground . furthermore , the barrier adjacent the bottom surface 18 enhances the sorbent efficiency of the non - woven fabric adjacent the top surface 16 by forcing migration of liquid into the sorbent portions of the mat 12 . the barrier at the bottom surface 18 may be a low density polyethylene barrier film with a thickness of about 3 mils that is secured to the lower surface of the non - woven sorbent fabric . alternatively , a chemical resistant non - skid backing can be co - extruded for attachment to the lower surface of the needle punch non - woven layer . alternatively , a barrier may be defined by heat fusing one surface of a non - woven needle punch staple fiber mat . still further , the bottom surface 18 may be a melt blown polypropylene non - woven lint - resistant cover stock . in all of these options , the barrier adjacent the lower surface 18 prevents strike through of liquid that may be deposited on the mat 12 and further resists skidding of the mat 12 on the supporting surface . in certain embodiments , the mat 12 may include an intermediate layer . for example , the mat 12 may have an upper layer of needle punch non - woven polypropylene and an intermediate layer of melt blown non - woven polypropylene that is hydrophobic or hydrophilic in accordance with requirements of a particular application . an ldpe barrier film then may be secured to the lower surface of the melt blown intermediate layer . the mat assembly 10 illustrated in fig1 is of substantially l - shaped plan view configuration . this configuration is illustrated for discussion purposes only . a more typical configuration would be a rectangular mat assembly . however , many other configurations are possible in accordance with the subject invention . the configuration shown in fig1 or any other configuration can be achieved with simple tools , such as scissors , utility snips and / or utility knives . in particular , the mat 12 can be cut easily with conventional scissors to a shape appropriate for the shape of the area on the substrate that is to be protected . as shown in fig2 the mat 12 includes an edge 20 . as explained above , an edge region of a thin flexible mat easily can be folded into a non - planar shape , and can lead to accidental tripping by workers or pedestrians in the area of the mat 12 . the frame 14 of the mat assembly 10 substantially prevents the mat 12 from folding , wrinkling or otherwise moving . the frame 14 comprises a plurality of retention strips 24 . each retention strip 24 is an elongate member coextruded from an elastomeric material , and preferably a flexible pvc , to include opposed longitudinal side edges 26 and 28 , a top surface 30 and a bottom surface 32 . the retention strip 24 includes a base portion 34 that extends unitarily between the sides 26 and 28 . the retention strip 24 further includes a contrast stripe 36 integrally extruded with the base 34 at a location on the top surface 30 centrally between the side edges 26 and 28 . the contrast stripe 34 is a different color than the base 34 . for example , the base 34 may be extruded from the black elastomeric material , while the contrast stripe 36 may be extruded from a bright yellow material . the coextrusion process is carried out to substantially prevent separation of the contrast stripe 36 from the base 34 . the retention strip 24 is extruded such that the bottom surface 32 is substantially planar and such that the top surface 30 is convexly arcuate between the side edges 26 and 28 , as shown most clearly in fig5 . more particularly , the strip 24 may define a maximum thickness of about ⅜ ″ at locations centrally between the side edges 26 and 28 and a minimum thickness of less than ⅛ ″ at locations substantially adjacent the side edges 26 and 28 . an attachment tape 40 is securely affixed to the bottom surface 32 of the retention strip 24 . the attachment tape 40 comprises a substrate 42 and an array of resiliently deflectable hooked filaments 44 extending from the substrate 42 . attachment tapes 40 of this general type are sold under the trademark “ velcro ”. the substrate 42 of the attachment tape 40 is securely adhered to the bottom surface 32 of the retention strip 24 at a location centrally between the side edges 26 and 28 of the retention strip 24 . more particularly , the substrate 42 preferably is secured to the bottom surface 32 of the retention strip by a solvent or heat activated adhesive which is resistant to degradation of the adhesive due to plasticisers in the retention strip 24 . the retention strip 24 preferably defines a width “ w ” of about 3 . 50 ″ and the attachment tape 40 preferably defines a width of about 1 . 5 ″. thus , regions of the bottom surface 32 between the attachment tape 40 and the respective side edges 26 and 28 define widths of about 1 . 0 ″. the resiliently deflectable hooks 44 of the attachment tape 40 are releasably engageable with the fibers adjacent the upper surface 16 of the mat 12 . thus , as shown in fig1 and 2 , the bottom surface 32 of the retention strip 24 can be placed on portions of the top surface 16 of the mat 12 adjacent a side edge 20 . a minor downward force exerted on the retention strip 24 will cause the resiliently deflectable hooked filaments 44 of the retention strip 40 to releasably engage the fibers of the non - woven mat 12 . thus , the retention strip 24 will be retained on portions of the upper surface 16 of the mat 12 adjacent the side edge 20 . furthermore , the retention strip 24 will provide sufficient weight to prevent the mat assembly 14 from folding into a non - planar orientation . with this configuration , the mat will not assume a wrinkled or folded configuration that could cause workers or pedestrians near the mat assembly 10 to trip . furthermore , the mat assembly 10 can be used at exterior locations without significant risk of the mat 12 blowing away from the portion of the substrate to which the mat assembly 10 had been applied initially . the retention strip 24 may be cut to any selected length by scissors , snips or a utility knife to appropriate dimensions based on the dimensions of the mat 12 . however , to avoid complicated mitering , the frame 14 includes a plurality of corners 50 that are premitered into a right angle configuration . the corners 50 include the attachment tapes 52 on the lower surface , as shown most clearly in fig7 . furthermore , the corners 50 define a cross - sectional shape substantially identical to the cross - sectional shape of the strip 24 as shown in fig5 . the mat assembly 10 is employed by initially cutting the mat 12 to a selected size and shape depending upon the size and shape of the floor or other substrate to be protected . in this regard , the mat 12 may be purchased and stored in a roll form . thus , a sufficient part of the mat 12 can be unrolled and cut to an appropriate size and shape . the cutting can be carried out with conventional scissors , snips or a utility knife . the mat 12 then is placed on the floor or other substrate to be protected , such that the bottom surface 18 of the mat 12 is supported on the floor or other substrate . as noted above , the bottom surface 18 preferably is a film or backing layer that is substantially impervious to the fluid that is apt to be deposited on the mat assembly 10 . as a result of this orientation , the non - woven fiber array adjacent the upper surface 16 faces upwardly . the corners 50 then may be placed at the convex or exterior corners and the concave or interior corners of the properly cut mat 12 . the installer then positions elongate linear sections of the retention strips 24 between the corners 50 . the retention strips 24 may be cut by scissors , snips or a utility knife to the appropriate linear dimension for fitting between adjacent corners 50 . the mat 12 of the mat assembly 10 provides sorbency for absorbing oil or other liquid that may be dripped or splattered . thus , the mat 12 absorbs oil or other liquid that would otherwise accumulate on the floor . the strips 24 and the corners 50 function to hold the mat 12 in a substantially planar orientation . more particularly , corner and edge regions 20 of the mat 12 are prevented by the strips 24 and corners 50 from curling or folding upwardly in a manner that could create a safety hazard to workers or other pedestrians . additionally , the contrast stripe 36 provides good visual indication of the presence of the mat assembly 10 , thereby further preventing a worker or pedestrian from accidentally tripping over the mat assembly 10 . still further , the tapered narrow sides of the strip 24 minimize the potential for tripping as a person steps onto or off of the mat assembly 10 . after sufficient use , the mat 12 may approach saturation by oil or other liquid being spilled on the mat 12 . at this time , the strips 24 may be separated from the mat 12 . this merely requires an upward pulling of the strips 24 relative to the mat 12 . such pulling force will deform the filament hooks 44 of the attachment tape 40 and further may cause some disengagement of the non - woven fibers of the mat 12 . the mat 12 then may be folded or rolled for discard or recycling as appropriate . the strips 24 and the corners 50 , however , are retained for further use . thus , a new mat 12 can be cut as appropriate for disposition on the area of the floor from which the soiled mat 12 had been removed . the previously cut strips 24 and corners 50 then can be placed adjacent the edge regions 20 of the new mat 12 so that the restraining strips 40 releasably engage the upper surface 16 of the new mat 12 . while the invention has been described with respect to a preferred embodiment , it is apparent that various changes can be made without departing from the scope of the invention as defined by the appended claims . | 1 |
the schematic representation in fig1 shows a sectional view of a cylinder head 10 with a cylinder head chamber 11 and two inlets 12 and 13 . an intake system 14 is flange - mounted on the motor block 10 . this intake system comprises an induction passage 15 which divides into the induction passages 16 and 17 . induction passage 17 is provided with a butterfly valve 18 . this butterfly valve is fastened on an operating shaft 19 which is controlled by a drive unit 20 . to improve efficiency , especially in the lower rpm range of a lean - mix engine , the butterfly valve 18 is closed , and in the upper rpm range it is rotated to the open position shown in the figure . fig2 shows an intake system in a sectional view taken through the butterfly valve assembly . the flange area of the intake assembly 14 contains the first induction passages 16a to 16d , as well as the second induction passages 17a to 17d . the butterfly valves 18a - 18d are disposed in the induction passages 17a - 17d and are mounted on an operating shaft 19 . the left end of the operating shaft is coupled by a lever 21 to the drive unit 20 shown in fig1 . in order to journal the shaft 19 on the intake assembly 14 , a bushed bearing 22 is provided at the left end . also , the operating shaft 19 is supported on appropriately configured bearing halves or half shells 23 which are arranged adjacent each induction channel . a mounting frame 24 is provided for mounting the operating shaft 19 and the entire valve arrangement . this mounting frame is situated on the side of the intake system facing the connecting flange , and at the same time it is provided with the gasket system 25 . this gasket system 25 seals the intake system 14 against the cylinder head 10 and also seals the mounting frame 24 against the flange area of the intake assembly . the butterfly valves 18a - 18d are disposed on loops 33 formed in the operating shaft 19 , the loops 33 providing for the transfer of the rotary movement of the operating shaft 19 to the butterfly valves 18a - 18d . in assembling the system , first the butterfly valves 18a - 18d are mounted on the operating shaft while it is still outside of the intake system . then the left end of the operating shaft is threaded through the opening 26 , sealed in by an annular gasket 31 , inserted into the sleeve bearing 22 , and fixed in the illustrated position by setting the mounting frame 24 in place . on the right side of the mounting frame 24 is a spring 32 . spring 32 exerts an axial force on the operating shaft 19 in the direction of the bearing 22 , so that after the operating shaft 19 is installed it will not move axially . fig3 is a sectional view showing a single butterfly valve 18 . in the closed position shown in the drawing , this butterfly valve is in contact with the sealing area 28 of the induction passage 17 , and with the sealing area 27 of the mounting frame 24 . in order to assure a reliable seal , the butterfly valve 18 , which is made of plastic , can be manufactured by the so - called 2k - injection molding process with the sealing portion of the butterfly valve being made of an elastomer . a sealing lip can , of course , also be formed on the butterfly valve . the portion shown in broken lines indicates the butterfly valve in the open position . due to its shallow design , this valve presents only a small resistance area to the gas stream . as shown here , the butterfly valve 18 comprises two halves which are welded or cemented together , and between which the operating shaft 19 is embedded in an axially displaceable manner . fig4 shows a variant method of fastening a butterfly valve . the valve 18 in this case is constructed in one piece and has a partly open eye 29 and a lip 30 . the operating shaft 19 is inserted into the lip and snapped into the open eye 29 . this kind of mounting is easy to perform and constitutes a reliable fastening method . alternatively , the butterfly valve may be fastened to the shaft by other means . for example , the operating shaft could be provided with a flattened surface , and the valve secured to the flattened surface . in another example , the shaft could be formed in two halves , and the valve inserted between the two halves of the shaft . in yet another alternate example , snap fasteners could be used to fasten the valve to the shaft . the foregoing description and examples have been set forth merely to illustrate the invention and are not intended to be limiting . since modifications of the disclosed embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art , the invention should be construed to include everything within the scope of the appended claims and equivalents thereof . | 5 |
embodiments of systems according to the present invention will be described below with reference to the accompanying drawings . fig1 is a conceptual diagram of a lifeline information collection / monitoring system constituted by combining an asynchronous two - layer polling system serving as the first embodiment of a database network system according to the present invention and a high - speed database . a center station 1 comprises a main database 1 a for arranging collected data and accumulating the data for a required period of time . the center station 1 sequentially polls relay database stations . ( rds ) 3 1 to 3 p1 of a relay database station group 3 to collect data . the relay database stations 3 1 to 3 p1 are related to corresponding terminal groups , and sequentially poll terminal stations , e . g ., the terminal stations each corresponding to one household serving as a living unit , to collect data . although each of the relay database stations 3 1 to 3 p1 has the same function as that of the main database 1 a , this is omitted in fig1 for descriptive convenience . terminal station groups 5 1 to 5 p1 are related to the relay database stations 3 1 to 3 p1 , respectively . the terminal station group 5 1 related to the relay database station 3 1 includes p 2 terminal stations 5 11 to 5 1p2 . the relay database station 3 1 sequentially polls terminal stations 5 11 to 5 1p2 to collect data . the relay database station 3 2 sequentially polls terminal stations 5 21 to 5 2p2 to collect data . the relay database station 3 p1 sequentially polls terminal stations 5 p11 to 5 p1p2 to collect data . the sequential polling operations in the relay database stations are performed in parallel or almost in parallel to each other . upper - layer communication is indicated by a dotted line 6 , and an effective data transmission rate of communication between the center station 1 and the relay database station 3 1 or the like is represented by r 1 . lower - layer communication is indicated by a dotted line 8 , and an effective data transmission rate of communication between the relay database station 3 1 and a terminal station or the like is represented by r 2 . as communication media , various media including priority communication in , especially , the lower - layer communication are expected . however , a radio communication medium is used in this embodiment . as the first embodiment of the database network system , a system for recognizing within ten minutes the state of damage of city lifelines ( waterworks , electricity , or gas supply systems ) caused by a large earthquake will be described below . signals ( lifeline information ) representing the states of water , gas , and electricity supplies are collected and continuously monitored through meters installed in houses . collection , analysis , and accumulation / holding of the lifeline information are performed by using a dedicated network structured by combining radio communication devices and computers . in this case , each house corresponds to a terminal station , and information obtained from so - called electronic meters ( or microcomputer meters ) is used as the lifeline information . the electronic meter has functions of performing collection , holding , transmission , updating , and the like , of information data ( quantity used or the like ). information which has a high degree of emergency and must be continuously monitored is 3 . pieces of information having a high degree of emergency and which must be continuously monitored are periodically collected from the 260 , 000 house terminals every several minutes and updated . the collection / updating time is set at 10 minutes or less . in addition , a time record of the last 24 hours is always held . 4 . all the collected pieces of lifeline information are updated as needed ( or periodically ), and the latest contents of the lifeline information are held in the database in the system . the realization of a system satisfying the above requests uses the techniques ( combinations thereof ) described below . 2 . a conceptual view of the configuration of a lifeline information collection system constituted by combining a two - layer polling system and a high - speed database is shown in fig1 . 3 . pieces of house terminal lifeline information collected by a polling scheme ( 1 ) have given addresses , and ( 2 ) are classified by designated items . therefore , since the pieces of lifeline information collected from the house terminals have a database structure , a computer ( pc ) for acquiring and processing the pieces of lifeline information is regarded as a database , and functions and characteristics of the database are effectively used . 4 . in addition to arrangement of the main database device 1a in the center station 1 , databases are distributed in the relay stations 3 i . 5 . databases capable of updating a large quantity of data at high speed are used as the main database device 1 a and the relay station database devices ,. 6 . a relay station in which a database having a high - speed data updating function is arranged is called a relay database station ( to be referred to as an rds hereinafter ). ( 2 ) acquisition of lifeline information ( b 1 bytes / terminal , in this embodiment b 1 = 100 bytes ) from a house terminal . ( 3 ) data having a high degree of emergency or specific data is extracted , and data sets ( called event change information or specific data information ) of ( b 2 bytes / terminal , in this embodiment b 2 = 10 bytes )× p 2 are generated . ( 4 ) division of lifeline information 100 bytes / terminal ( the number of divided portions is n ), and holding of the divided portions for a predetermined period of time . 8 . the center station 1 sequentially polls p 1 relay database stations to collect information . for one polling period , [( 10 + 100 / n )× p 2 ] bytes are collected from each rds . 9 . as a result of item 7 , every one polling period , event change information of ( 10 bytes / terminal )× p 2 × p 1 is collected in the center station 1 . here , p 2 × p 1 is the total number of house terminals . 10 . as a result of item 7 , every n polling periods , lifeline information of ( 100 bytes / terminal )× p 2 × p 1 is collected in the center station . more specifically , every n periods , pieces of lifeline information from all the house terminals are collected . 11 . according to items 9 and 10 , the following is understood : from all the house terminals to the center station 1 , ( 1 ) event change information having a high degree of emergency is transmitted for a short time , and ( 2 ) all pieces of lifeline information are transmitted . the above two objects can be achieved by using one information transmission path . 12 . an upper - layer polling period t 1 is given by the following equation : where r 1 is the effective data transmission rate of the upper polling layer . when the number of all house terminals p 2 × p 1 is given , the polling period t 1 is mainly determined by r 1 . 13 . when the upper limit of t 1 is given to use a network , according to the above equation , the lower limit of r 1 is almost determined . 14 . a polling period t 2 of the lower polling layer is given by : where r 2 is the effective data transmission rate of the lower polling layer . 15 . the effective data transmission rate r 1 of the upper polling layer is given by : where r d1 is a data transmission rate in bits per second ( bps ) of a communication line for connecting an rds and the center station 1 to each other , and r u1 is a data updating rate of a database in the center station . 16 . the effective data transmission rate r 2 of the lower polling layer is given by : where r d2 is a data transmission rate of a transmission line for connecting house terminal stations and an rds , and r u2 is a data updating rate of a database in the rds . 17 . the upper polling layer and the lower polling layer operate asynchronously . in order to ensure that data collected in the center station and the upper - layer rds are the latest data collected in the rds , the condition t 1 = t 2 is satisfied , all the data collected in the lower polling layer are sent to the upper polling layer . for this reason , the data transfer efficiency is 100 %. 19 . at this time , the effective data transmission rate r 2 of the lower polling layer and the effective data transmission rate r 1 of the upper polling layer have the following relationship : where ( 1 / p 1 ) is a required rate reduction effect obtained by a parallel operation of p 1 lower polling cells , and [ 100 /( 10 + 100 / n )] is an adjustment effect obtained by a ratio of quantities of transmission information . 20 . actually , r 2 is set to be slightly larger than the above value : 21 . the memory capacity required for a database in an rds : ( 1 ) 100 × p 2 bytes : 100 bytes of data are collected from p 2 house terminals and stored . ( 2 ) 10 × p 2 bytes : 10 bytes are extracted from 100 bytes , and 10 bytes × p 2 are stored . 22 . the memory capacity required for a database in the center station : ( 1 ) 100 × p 2 × p 1 bytes : pieces of lifeline information collected from all the house terminals are stored and held . ( 2 ) 10 × p 2 × p 1 ×( 24 × 60 / t 1 ) bytes : pieces of event change information collected from all the house terminals for the latest 24 hours are stored and held . 24 . this system is a system which basically receives lifeline information of 100 × p 2 × p 1 bytes generated by the house terminals and accumulates the information in the relay / database station ( rds ) layer and the center station . the data generated by data processing in the system are accumulated in the layer in which the data are generated and the layer thereabove . 25 . the memory capacity which must be held by the system is basically twice ( the number of layers ). to this memory capacity , a capacity which is twice ( rds and center station ) the quantity of data generated in the system is added . 26 . for the cost of doubling the memory capacity , the function of collecting information having a high degree of emergency for a short time can be obtained . 27 . the high - speed database devices are distributed to make it possible to realize a network which is appropriate to achieve the objects of the invention by using a communication path having a limited data transmission rate . 28 . the network in which the high - speed database devices are distributed use a communication path having a limited data transmission rate is called a database network . 29 . the database network technique becomes a practically useful technique by the development of the high - speed database technique and a reduction in price of a large - scale memory . the effective data transmission rate r 1 of the upper polling layer is given by : where r d1 is a data transmission rate ( bps ) of a communication line for connecting an rds and the center station , and r u1 is a data updating rate of a database in the center station . the effective data transmission rate r 2 of the lower polling layer is given by : where r d2 is a data transmission rate of a communication line for connecting a house terminal station and an rds , and r u2 is a data updating rate of a database in the rds . a database which satisfies r d1 & lt ;& lt ; r u1 and r d2 & lt ;& lt ; r u2 is defined as a high - speed database . 31 . ( method of determining the number of relay / database stations ( rds ) p 1 ) a penalty function is defined for the database network by the following equation : where a 1 and a 2 are communication error generation rates per line connection in the upper polling layer and the lower polling layer . since p 2 × p 1 is equal to the number ( c ) of house terminals , is satisfied . when the above equations are combined , the following equation is obtained : when the penalty function f has an extreme value when δf / δp 1 = 0 is satisfied : p 1 =( a 2 / a 1 ) ( 1 / 2 ) ×( c ) ( 1 / 2 ) p 2 =( a 1 / a 2 ) ( 1 / 2 ) ×( c ) ( 1 / 2 ) . when p 1 and p 2 are selected according to the above equations , the expected value of the communication error rate of the whole network is minimized . design of a two - layer polling information collection / monitor system ( example 1 ) which is one example of database networks will be described below . the number of all house terminals = p 2 × p 1 = 2 18 = 262144 required upper polling layer data transmission rate : r 1 & gt ; 139 . 81 kbps required lower polling layer data transmission rate : r 2 & gt ; 682 . 7 ×( 1 + δ )= 685 bps . assumption 1 : it is assumed that the ratio of the error generation rate a 1 per line connection in the upper polling layer to the error generation rate a 2 per line connection in the lower polling layer is 1 : 1 . in this case , the number of rdss which minimize the error generation rate of the whole network is given by : p 1 = p 2 =( c ) ( 1 / 2 ) =( 262144 ) ( 1 / 2 ) = 512 . assumption 2 : it is assumed that the ratio of a 1 to a 2 is 1 : 4 . in this case , the number of rdss which minimize the error generation rate of the whole network is given by : p 1 =( a 2 / a 1 ) ( 1 / 2 ) ×( c ) ( 1 / 2 ) = 2 × 512 = 1024 p 2 =( a 1 / a 2 ) ( 1 / 2 ) ×( c ) ( 1 / 2 ) = 0 . 5 × 512 = 256 the upper - layer communication line error generation rate may be frequently higher than the lower - layer communication line error generation rate . in this case , the number selected by the designer is adequate . when the database network technique is extended to increase the number of layers of the network from two to three , the characteristics of the database network described above can be extended . 1 . fig2 is a conceptual diagram of the configuration of a three - layer database network according to the second embodiment . in this configuration , a relay database has two layers , i . e ., an upper layer and a lower layer . a center station 101 comprises a main database 101 a . the center station 101 polls upper - layer relay database stations 103 1 , 103 2 to 103 p1 included in an upper - layer relay database station group 103 to collect data of the upper - layer relay database stations . each upper - layer relay database station polls lower - layer relay database stations of a related lower - layer relay database station group to collect data of the lower - layer relay database stations . the upper - layer relay database station 103 1 polls lower - layer relay database stations 104 11 to 104 1p2 related to the upper - layer relay database station 103 1 to collect data of the lower - layer relay database stations . the lower - layer relay database station polls terminal stations of a terminal station group related to the lower - layer relay database station to collect data of each terminal station . for example , the lower - layer relay database station 104 11 polls terminals 105 111 to 105 11p3 of the terminal station group related to the lower - layer relay database station 104 11 . a lower - layer relay database station 104 p1p2 polls terminal stations 105 p1p21 to 105 p1p23 of a terminal station group related to the lower - layer relay database station 104 p1p2 . a dotted line 106 indicates upper - layer communication , and the effective data transmission rate of the upper - layer communication is represented by r 1 . a dotted line 107 indicates intermediate - layer communication , and the effective data transmission rate of the intermediate - layer communication is represented by r 2 . a dotted line 108 indicates lower - layer communication , and the effective data transmission rate of the lower - layer communication is represented by r 3 . 2 . more specifically , in addition to arrangement of the main database 101 a in the center station 101 , databases ( not shown ) are also distributed in the lower - layer relay stations and the upper - layer relay stations . 3 . the lower - layer and upper - layer relay stations in which high - speed databases are arranged are called a lower - layer relay database station ( lower - layer rds ) and an upper - layer relay database station ( upper - layer rds ). 4 . in fig2 the lower - layer rds mainly has four functions . ( 1 ) communication control of a lower polling layer . ( 2 ) acquisition of lifeline information ( 100 bytes / terminal ) from a house terminal . ( 3 ) data having a high degree of emergency is extracted , and data sets ( event change information ) of ( 10 bytes / terminal )× p 3 are generated . ( 4 ) division of lifeline information of 100 bytes / terminal ( the number of divided portions is n 3 ), and holding of the divided portions for a predetermined period of time . 5 . in fig2 the upper - layer rds mainly has five functions . ( 2 ) acquisition of event change information ( 10 bytes × p 3 ) from the lower - layer rds . ( 3 ) acquisition of lifeline information (( 100 bytes / n 3 )× p 3 ) from the lower - layer rds . ( 4 ) accumulation and holding of the lifeline information (( 100 bytes / n 3 )× p 3 )× p 2 acquired from the lower - layer rdss of p 2 stations . ( 5 ) data having an intermediate degree of emergency is extracted from the lifeline information , and data sets of ( 20 bytes / terminal )× p 3 × p 2 ( called maintenance information ) are generated . ( 6 ) division of the maintenance information of ( 20 bytes / terminal )× p 3 × p 2 ( the number of divided portions is n 2 ), and holding of the divided portions for a predetermined period of time . 6 . the center station sequentially polls the upper - layer rdss of the p 1 stations to collect event change information and maintenance information or event change information and detailed information . for one polling period , [( 10 + 20 / n 2 )× p 3 × p 2 ] bytes are collected from the upper - layer rdss . 7 . as a result of item 6 , every polling period , pieces of event change information of ( 10 bytes / terminal )× p 3 × p 2 × p 1 are collected . here , p 3 × p 2 × p 1 is the total number of house terminals . 8 . as a result of item 6 , every n 2 polling periods , pieces of maintenance information of ( 20 bytes / terminal )× p 3 × p 2 × p 1 are collected . more specifically , the pieces of maintenance information are collected from all the house terminals every n 2 periods . 9 . the pieces of lifeline information ( 100 bytes / terminal )× p 3 × p 2 are accumulated and held in the databases in the upper - layer rdss for a predetermined period of time . 10 . in place of the maintenance information , lifeline information is transmitted to the center station as needed . 5 × n 2 polling periods are required . 11 . each upper - layer rds sequentially polls lower - layer rdss of the p 2 stations to collect event change information and lifeline information . for one polling period , [( 10 + 20 / n 3 )× p 3 ] bytes are collected from the lower - layer rdss . 12 . the following is apparent from items 7 to 11 . from all the house terminals to the center station , ( 1 ) event change information having a high degree of emergency is transmitted for a short time ( every polling period t 1 ), ( 2 ) maintenance information having a second - high degree of emergency is transmitted in n 2 polling periods , and ( 3 ) lifeline information is transmitted for 5 × n 2 polling periods , if necessary . the above three objects can be achieved by using one information transmission path . 13 . an upper - layer polling period t 1 is given by the following equation : t 1 =[ 8 ×( 10 + 20 / n 2 )× p 3 × p 2 × p 1 ]/ r 1 where r 1 is the effective data transmission rate of the upper polling layer . 14 . an intermediate - layer polling period t 2 is given by the following equation : where r 2 is an effective data transmission rate of the intermediate polling layer . 15 . a lower - layer polling period t 3 is given by the following equation : where r 3 is the effective data transmission rate of the lower polling layer . 16 . in order to ensure that data collected in the center station and the upper layer rds is the latest data , the condition is satisfied , the data transfer efficiency is 100 %. under this condition , r 1 , r 2 , and r 3 have the following relationships : r 2 = r 1 ×( 1 / p 1 )×( 10 + 100 / n 3 )/( 10 + 20 / n 2 ) r 3 r 2 ×( 1 / p 2 )×[ 100 /( 10 + 100 / n 3 )]= r 1 ×( 1 / p 1 )×( 1 / p 2 )×[ 100 /( 10 + 20 / n 2 )] 18 . actually , r 2 and r 3 are set to be slightly higher than the above values . r 2 = r 1 ×( 1 / p 1 )×( 10 + 100 / n 3 )/( 10 + 20 / n 2 )×( 1 + δ ) r 3 = r 1 ×( 1 / p 1 )×( 1 / p 2 )×[ 100 /( 10 + 20 / n 2 )]×( 1 + δ ) 19 . the memory capacity required for a database in a lower - layer rds : ( 1 ) 100 × p 3 bytes : 100 bytes of data are collected from the house terminals and stored . ( 2 ) 10 × p 3 bytes : 10 bytes are extracted from 100 bytes and stored . 20 . the memory capacity required for a database in an upper layer rds : ( 1 ) 100 × p 3 × p 2 bytes : 100 bytes of data are collected from the house terminals , stored , and held . ( 2 ) 20 × p 3 × p 2 bytes : 20 bytes of data are extracted from 100 bytes and held . ( 3 ) 10 bytes × p 3 × p 2 bytes : event change data of p 3 × p 2 house terminals are collected and stored . 21 . the memory capacity required for a database in the center station : ( 1 ) 100 × p 3 × p 2 × p 1 bytes : pieces of lifeline information collected from all the house terminals are stored and held . ( 2 ) 20 × p 3 × p 2 × p 1 bytes : a latest f frame of pieces of maintenance information collected from all the house terminals is stored and held . ( 3 ) 10 × p 3 × p 2 × p 1 ×( 24 × 60 / t 1 ): event change information for the latest 24 hours is stored and held . 26 . three types of information are transmitted from a house terminal to the center station by using one communication path . in order to make this possible , lower - layer rdss and upper - layer rdss are distributed in the middle of the communication path . event change information is generated in the lower - layer rds , and maintenance information is generated in the upper - layer rds . 27 . required quantities of memory are added to distributed high - speed databases , so that various data processing functions can be achieved . a database network having characteristics depending on the object can be structured . 28 . ( method of determining the number of upper - layer relay / database stations p 1 and the number of lower - layer relay database stations p 2 ) a penalty function is defined for the database network having a three - layer structure by the following equation : where p 1 × p 2 × p 3 = c , the number of house terminals . a procedure for determining p 1 , p 2 , and p 3 will be considered in two steps . first , p 1 is regarded as a constant , and the relationship between p 2 and p 3 is determined . under this condition , the value of p 1 is determined . here , a penalty function f 2 about the relationship between p 2 and p 3 is defined . f 2 = a 2 p 2 + a 3 p 3 = a 2 p 2 + a 3 ( c / p 1 ) ( 1 / p 2 ) p 2 which gives the extreme value of f 2 will be calculated . δ f 2 / δp 2 = a 2 p 2 − a 3 ( c / p 1 )( 1 / p 2 2 )= 0 p 2 =( a 3 / a 2 ) ( 1 / 2 ) ×( c / p 1 ) ( 1 / 2 ) p 3 =( a 2 / a 3 ) ( 1 / 2 ) ×( c / p 1 ) ( 1 / 2 ) . when these values are put in the equation for defining f , the following equation is satisfied : f = a 1 p 1 + a 2 ( a 3 / a 2 ) ( 1 / 2 ) × ( c / p 1 ) ( 1 / 2 ) + a 3 ( a 2 / a 3 ) ( 1 / 2 ) × ( c / p 1 ) ( 1 / 2 ) = a 1 p 1 + 2 ( a 2 a 3 ) ( 1 / 2 ) × ( c / p 1 ) ( 1 / 2 ) . from the above equation , p 1 which gives the extreme value of f will be calculated . δ f / p 1 = a 1 −( a 2 a 3 c ) ( 1 / 2 ) ×[ 1 /( p 1 ( 3 / 2 ) )]= 0 p 1 =( a 2 a 3 / a 1 2 ) ( 1 / 3 ) ×( c ) ( 1 / 3 ) the value is substituted in the expressions of p 2 and p 3 : p 2 = ( a 3 / a 2 ) ( 1 / 2 ) × ( c / p 1 ) ( 1 / 2 ) = ( a 1 a 3 / a 3 2 ) ( 1 / 3 ) × ( c ) ( 1 / 3 ) p 3 = ( a 2 / a 3 ) ( 1 / 2 ) × ( c / p 1 ) ( 1 / 2 ) = ( a 1 a 2 / a 3 2 ) ( 1 / 3 ) × ( c ) ( 1 / 3 ) . it is assumed that a 1 , a 2 , and a 3 denote communication error generation rates per line connection of the upper - layer polling , the intermediate - layer polling , and the lower - layer polling , respectively . in this case , when p 1 , p 2 , and p 3 are set to be the above values , the communication error generation rate of the whole network is minimized . a design of a three - polling information collection / monitor system will be described with reference to an example ( example 2 ) of a database network . the number of all house terminals = p 3 × p 2 × p 1 = 2 19 = 524288 requirement for polling cycle period t 1 : t 1 ≦ 5 minutes ( design ) the number of divided portions of 20 bytes data : n 2 = 4 ( selected by designer ) required upper polling layer data transmission rate : r 1 ≧ 209 . 7 kbps the number of upper - layer rdss : p 1 = 512 ( selected by designer ) the number of divided portions of 100 bytes data : n 3 = 5 ( selected by designer ) the number of lower - layer rdss / the number of upper - layer rdss : p 2 = 32 ( selected by designer ) maintenance information collection time : t 1 ×( n 3 + n 2 )= 45 minutes detailed lifeline information collection time : t 1 ×( n 3 + n 2 × 5 )= 125 minutes adequacy of p 1 , p 2 , and p 3 selection will be examined . on the above assumptions , when p 1 , p 2 , and p 3 are calculated , the following results are obtained : p 1 = [ a 2 a 3 / a 1 2 ] ( 1 / 3 ) ( c ) ( 1 / 3 ) = 5 . 04 × 80 . 64 = 406 . 4 p 2 = [ a 1 a 3 / a 2 2 ] ( 1 / 3 ) ( c ) ( 1 / 3 ) = 0 . 630 × 80 . 64 = 50 . 8 p 3 = [ a 2 a 1 / a 3 2 ] ( 1 / 3 ) ( c ) ( 1 / 3 ) = 0 . 315 × 80 . 64 = 25 . 4 these values are close to the design values obtained when a communication error is minimized . when the database network system is to be used for emergency notification during the occurrence of a large earthquake , it must be assured according to the object of the invention that the database network system has been normally operating . the operational condition must at least be accurately recognized . for this reason , the database network system is continuously operated , and the main database of the center station is designed to always hold the history of the operation by accumulating specific information data or specific information data and other data for a predetermined period of time . therefore , it can be determined whether an accident or the like is caused by the disaster . since the database network system according to the present invention collects information without interruption as described above , the database network system can collect an enormous quantity of information . for this reason , not only the lifeline data described above , but also a large quantity of other information can be collected . more specifically , as a combination of the pieces of changing information , combinations of data for reading meter values included in lifeline data of meters , data for collecting / monitoring information related to various maintenance jobs , and information data related to security , care of elderly people , water pressures of fire hydrants , and monitors of air - conditioners can be employed . various modifications of the embodiments described in detail above can be effected without departing from the range of the spirit and scope of the present invention . although rdss having one layer and two layers are exemplified , the number of layers of the rds can be increased to three or more . in this case , the method of design described above can be similarly applied . although the database network system according to the present invention has been described above in detail with reference to collection of emergency information of city lifelines , the database network system can also be used to collect other information as described above . in the embodiments , although a radio communication medium is used as a communication medium , a cable communication network including optical fiber communications can also be established and used . cable communications and radio communications can be selectively used in different layers , and can be selectively used in different areas . | 8 |
the invention therefore provides polyurethane / polyurea elastomers which are obtainable by the reaction of components consisting of a ) an isocyanate component having an nco content of 3 to 10 wt . % consisting of a1 ) 5 - 20 wt . %, relative to a ), of a carbodiimide -/ uretonimine - modified 2 , 4 ′- diphenylmethane diisocyanate having an nco content of 25 to 31 . 5 wt . % and a crystallisation temperature below 20 ° c . obtainable from diphenylmethane diisocyanate containing 90 to 100 wt . % of 2 , 4 ′- diphenylmethane diisocyanate isomer a2 ) 80 - 95 wt . %, relative to a ), of an nco prepolymer obtainable from a2 ′) diphenylmethane diisocyanate containing 90 to 100 wt . % of 2 , 4 ′- diphenylmethane diisocyanate isomer and a2 ″) at least one polyol from the group consisting of polyether polyols and polyester polyols having number - average molecular weights of 250 to 6000 g / mol and functionalities of 1 . 95 to 2 . 20 b ) aromatic diamine chain extenders having a molecular weight of below 900 g / mol , c ) 0 to 2 wt . %, relative to the total amount of elastomer , of catalysts , d ) 0 to 0 . 5 wt . %, relative to the total amount of elastomer , of inhibitors , e ) 0 to 20 wt . %, relative to the total amount of elastomer , of flame retardant agents , f ) 0 to 10 wt . %, relative to the total amount of elastomer , of fillers , g ) 0 to 2 wt . %, relative to the total amount of elastomer , of antioxidants , h ) 0 to 5 wt . %, relative to the total amount of elastomer , of demolding agents , i ) 0 to 5 wt . %, relative to the total amount of elastomer , of coloring materials , j ) 0 to i 0 wt . %, relative to the total amount of elastomer , of plasticizers , k ) 0 to 2 wt . %, relative to the total amount of elastomer , of biocides , l ) 0 to 3 wt . %, relative to the total amount of elastomer , of adhesion promoters , m ) 0 to 2 wt . %, relative to the total amount of elastomer , of antistatic agents and n ) 0 to 3 wt . %, relative to the total amount of elastomer , of blowing agents and / or water . the use of 2 , 4 ′- mdi both in the production of the nco prepolymer and as the basis of component a1 ) eliminates the aforementioned disadvantages and results in 1 . an improved toxicology in comparison to tdi prepolymers 2 . an improved reactivity in comparison to 4 , 4 ′- mdi prepolymers 3 . an improved low - temperature stability of the cd -/ ui - modified 2 , 4 ′- mdi used , wherein 4 . pu elastomers having an improved level of properties in comparison to tdi systems are obtained , 5 . the cd -/ ui - modified 2 , 4 ′- mdi can be metered in liquid form , such that the nco content of the prepolymers can easily be increased without having to turn to solid mdi derivatives or solid 2 , 4 ′- mdi or without having to use modifications containing 4 , 4 ′- mdi , which would increase the reactivity too greatly . the invention also provides a process for producing the polyurethane / polyurea elastomers according to the invention , wherein a ) an isocyanate component having an nco content of 3 to 10 wt . % consisting of a1 ) 5 - 20 wt . %, relative to a ), of a carbodiimide -/ uretonimine - modified 2 , 4 ′- diphenylmethane diisocyanate having an nco content of 25 to 31 . 5 wt . % and a crystallisation temperature below 20 ° c . obtainable from diphenylmethane diisocyanate containing 90 to 100 wt . % of 2 , 4 ′- diphenylmethane diisocyanate isomer a2 ) 80 - 95 wt . %, relative to a ), of an nco prepolymer obtainable from a2 ′) diphenylmethane diisocyanate containing 90 to 100 wt . % of 2 , 4 ′- diphenylmethane diisocyanate isomer and a2 ″) at least one polyol from the group consisting of polyether polyols and polyester polyols having number - average molecular weights of 250 to 6000 g / mol and functionalities of 1 . 95 to 2 . 20 b ) an aromatic diamine chain extender having a molecular weight of below 900 g / mol , c ) 0 to 2 wt . %, relative to the total amount of elastomer , of catalysts , d ) 0 to 0 . 5 wt . %, relative to the total amount of elastomer , of inhibitors , e ) 0 to 20 wt . %, relative to the total amount of elastomer , of flame retardant agents , f ) 0 to 10 wt . %, relative to the total amount of elastomer , of fillers , g ) 0 to 2 wt . %, relative to the total amount of elastomer , of antioxidants , u ) 0 to 5 wt . %, relative to the total amount of elastomer , of demolding agents , j ) 0 to 5 wt . %, relative to the total amount of elastomer , of coloring materials , j ) 0 to 10 wt . %, relative to the total amount of elastomer , of plasticizers , k ) 0 to 2 wt . %, relative to the total amount of elastomer , of biocides , l ) 0 to 3 wt . %, relative to the total amount of elastomer , of adhesion promoters , m ) 0 to 2 wt . %, relative to the total amount of elastomer , of antistatic agents and n ) 0 to 3 wt . %, relative to the total amount of elastomer , of blowing agents and / or water cd -/ ui - modified 2 , 4 ′- mdi is obtained by reacting mdi having a 2 , 4 ′- isomer content of 90 to 100 wt . %, preferably 95 to 100 wt . %, particularly preferably 98 to 100 wt . %, preferably with the use of catalysts , for example phospholine derivatives . phospholine - type catalysts are described for example in ep - a 515 933 and u . s . pat . no . 6 , 120 , 699 . typical examples of these catalysts are the mixtures of phospholine oxides known from the prior art the amount of catalyst used depends on the quality and / or reactivity of the starting isocyanate . the simplest option is therefore to determine the amount of catalyst required in each case in a preliminary test . the carbodiimide / uretonimine modification reaction is conventionally performed in a temperature range from 50 to 150 ° c ., preferably 60 to 100 ° c . markedly higher reaction temperatures ( up to approx . 280 ° c .) are also possible , however . the optimum reaction temperature is governed by the type of catalyst used and can likewise by determined in a preliminary test . in a typical batch 2 , 4 ′- mdi is caused to react with 2 to 3 ppm of phospholine oxide at 80 to 100 ° c . in approximately 5 to 6 hours . the carbodiimide / uretonimine modification reaction is terminated when an nco content of 25 to 31 . 5 wt . %, preferably 27 to 30 . 5 wt . %, particularly preferably 28 to 30 wt . %, is achieved , by adding a stopper . the nco content is determined in the manner known to the person skilled in the art , either by titration or by an online method ( e . g . near - infrared analysis ). the progress of the reaction can of course also be determined from the amount of carbon dioxide escaping . this carbon dioxide amount , which can be determined by volumetric means , gives an indication of the degree of conversion achieved at a given time . to terminate the reaction , at least the equimolar amount of a stopper is used , particularly preferably a 1 to 20 times molar excess , most particularly preferably a 1 to 10 times molar excess . such stoppers are mentioned for example in de - a 25 37 685 , ep - a 515 933 , ep - a 609 698 and u . s . pat . no . 6 , 120 , 699 and include for example acids , acid chlorides , chloroformates , silylated acids and alkylating agents , such as for example esters of trifluoromethanesulfonic acid , such as ethyl trifluoromethanesulfonic acid ( etf ), for example . silylated acids are trimethylsilyltrifluoromethanesulfonate ( tmst ), for example . the stopper can be added to the reaction mixture in either one or two portions , the second portion being added after cooling , for example to room temperature . after the reaction has been terminated the reaction mixture can of course be completely freed from the carbon dioxide formed by application of a vacuum . this cd -/ ui - modified 2 , 4 ′- mdi has the advantage over the correspondingly modified 4 , 4 ′- mdi that with the same nco content , i . e . the same degree of carbodiimide modification , it crystallises at lower temperatures . this is an important processing advantage , of course , since this product does not have to be stored at an elevated temperature . this advantageous property can also be seen from table 1 . the nco prepolymers a2 ) are obtained by reacting a high - molecular - weight polyol with 2 , 4 ′- mdi . high - molecular - weight polyols are in particular hydroxyl group - terminated polyether and polyester polyols having a number - average molecular weight of 250 to 6000 g / mol , preferably 500 to 4000 g / mol . polyether polyols can be described by the general formula ho ( ro ) n h , wherein r is an alkylene radical and n assumes values such that the molecular weight is in the range from 250 to 6000 g / mol . these polyether polyols are polyols known to the person skilled in the art which are obtained by ring - opening polymerisation of monomeric cyclic ethers or by acid - catalyzed condensation of diols or dihydroxyethers . polyether polyols are normally bifunctional , but by choosing suitable higher - functional starters they can also have higher functionalities . typical monomeric cyclic ethers are ethylene oxide , propylene oxide and tetrahydrofuran . polyester polyols are obtained by reacting dicarboxylic acids with diols , with separation of water . important dicarboxylic acids are adipic , glutaric , succinic , sebacic or phthalic acid , this last mostly being used in the form of the anhydride . important diols are ethylene , 1 , 2 - propylene , 1 , 3 - propylene , 1 , 4 - butylene or diethylene glycol , but also 1 , 6 - hexanediol and the isomers thereof . in addition , to set a functionality higher than 2 , structural units from the group comprising glycerol , 1 , 1 , 1 - trimethylolpropane , pentaerythritol and sorbitol can be used . furthermore , ε - caprolactone and dimerised fatly acids can also be used to produce polyester polyols . polycarbonate polyols can also be used , of course . the 2 , 4 ′- mdi - based prepolymers are produced for example by allowing the polyol in question to run slowly into the prepared melted 2 , 4 ′- mdi . the reaction is then completed by stirring for a further 2 to 8 hours at elevated temperature , preferably 40 to 100 ° c ., particularly preferably 50 to 90 ° c . the prepolymers are blended with the cd -/ ui - modified 2 , 4 ′- mdi before use in order to vary the nco content of the prepolymer . the blends of 2 , 4 ′- mdi prepolymer and cd -/ ui - modified 2 , 4 ′- mdi are then reacted with chain extenders . cast elastomers are obtained which correspond in their properties to those produced with the added use of cd -/ ui - modified 4 , 4 ′- mdi , although in this case the disadvantage of increased reactivity , i . e . a shorter casting time , occurs . the advantage is that processing can take place with two isocyanate raw materials which are liquid at ambient temperature and cast elastomers having a broad range of properties can be produced which would otherwise only be attainable with a large number of raw materials . in order to cover a broad range of properties , particularly with regard to the hardness of the pu elastomers , with where possible just one nco prepolymer , the nco prepolymer is supplemented with monomeric diisocyanate . these monomeric diisocyanates should advantageously likewise be able to be stored and used in liquid form at ambient temperature , however . the cd -/ ui - modified 2 , 4 ′- mdi that is used satisfies these requirements . as component b ) aromatic diamines are exclusively used . the molecular weight of component b ) is below 900 g / mol . jeffamines ® available on the market are not used as component b ). other oligomeric or polymeric aliphatic diamines are also not used as component b ). the chain extenders for producing the cast elastomers are the aromatic diamines known per se . aromatic diamines which have a low melting point or are liquid are preferred . diamines which melt below 120 ° c . are particularly preferred . aromatic amine chain extenders are , for example , 4 , 4 ′- methylene bis -( 2 - chloroaniline ) ( mboca ), 3 , 3 ′, 5 , 5 ′- tetraisopropyl - 4 , 4 ′- diaminodiphenylmethane , 3 , 5 - dimethyl - 3 ′, 5 ′- diisopropyl - 4 , 4 ′- diaminophenylmethane , 3 , 5 - diethyl - 2 , 4 - toluylene diamine , 3 , 5 - diethyl - 2 , 6 - toluylene diamine ( detda ), 4 , 4 ′- methylene bis -( 3 - chloro - 2 , 6 - diethylaniline ), 3 , 5 - dimethylthio - 2 , 4 - toluylene diamine , 3 , 5 - dimethylthio - 2 , 6 - toluylene diamine ( ethacure ™ 300 , albemarle corporation ), methylene dianiline , trimethylene glycol - di - p - amino - benzoate ( polacure ™ 740 , air products and chemicals inc . ), 1 , 2 - bis -( 2 - aminophenylthio ) ethane ( cyanacure ™, american cyanamid company ), t - but .- toluene diamine ( tbtda ), 3 , 5 - diamino - 4 - chlorobenzoic acid isobutyl ester ( baytec ® xl 1604 , bayer materialscience ag ) or 4 , 4 ′- methylene bis -( 3 - chloro - 2 , 6 - diethylaniline ( lonzacure ™, mcdea ). components c ) to n ) are well - known additives and auxiliary agents which are described in g . oertel , polyurethane handbook , 2 nd edition , c . hanser verlag 1993 , pages 98 ff . common catalysts can also be used if required in the production of the elastomers . as examples for auxiliary substances and additives , acid stabilisers , for example chloropropionic acid , dialkyl phosphates , p - toluenesulfonic acid , or acid chlorides , such as benzoic acid chloride , phthalic acid dichloride , and antioxidants , such as for example ionol ®, phosphites and stabaxol ® as hydrolysis stabilisers can be named . fillers , for example carbon black , carbon nanotubes , chalk and glass fibers as well as coloring agents can be used . the cast elastomers are preferably produced by first degassing the isocyanate component at elevated temperature and under reduced pressure whilst stirring , and then stirring it with the chain extender and pouring the reacting melt into preheated moulds . the cast elastomers are used in applications requiring good mechanical properties , for example as industrial rolls in the paper industry , for example , and as rollers and wheels , doctor blades , hydrocyclones , screens , sports floor coverings and bumpers as well as for electrical encapsulation . the invention is illustrated in more detail by the examples below . all the references described above are incorporated by reference in their entireties for all useful purposes . while there is shown and described certain specific structures embodying the invention , it will be manifest to those skilled in the art that various modifications and rearrangements of the parts may be made without departing from the spirit and scope of the underlying inventive concept and that the same is not limited to the particular forms herein shown and described . with an nco content of approx . 8 wt . % from bayer with an nco content of approx . 6 wt . % from bayer 10 kg of the isocyanate concerned were heated under nitrogen to 90 ° c . whilst stirring . 2 . 5 ppm of the catalyst in the form of a 1 % solution in toluene were then added . the reaction mixture was heated under nitrogen at 90 ° c . whilst stirring until the desired nco content was reached . the progress of the reaction was monitored via the gas evolution . after the end of the reaction the carbodiimidisation was terminated by the addition of 10 to 50 ppm of stopper . stirring was continued for one hour . table 1 ( examples a - 1 and a - 2 ) shows that carbodiimide / uretonimine group - containing 2 , 4 ′- mdi with stopper amounts of 50 and 10 ppm and an nco content of 29 . 1 to 29 . 5 % delivers practically identical products in terms of crystallisation range and viscosity . examples a - 3 and a - 4 show that with almost identical nco contents the product according to the invention has the more favourable , i . e . lower , crystallisation range . example a - 4 ( c ) shows that even with a high degree of modification , i . e . a low nco value , good crystallisation properties are not achieved with 4 , 4 ′- mdi . the carbodiimide -/ uretonimine - modified 2 , 4 ′- mdi according to example a - 1 was homogenised with desmodur ® vp . pu me 40tf04 for one hour under nitrogen at 80 ° c . the nco content and viscosity were then determined . further data and the amounts used are set out in table 2 . the cast elastomers were produced using baytec ® xl 1604 ( 3 , 5 - diamino - 4 - chlorobenzoic acid isobutyl ester ) as crosslinker , the blends being stirred with baytec ® xl 1604 preheated to 100 ° c . for 30 seconds with degassing at 90 ° c . the reacting melt was poured into moulds preheated to 110 ° c . and cured for 24 hours at 110 ° c . the mouldings were then stored for 7 days at room temperature and the mechanical values determined ( see table 3 ). table 3 shows that when prepolymers / blends with the same nco content i . e . the same amounts of added baytec ® xl1604 , are used , the casting time is reduced disadvantageously if carbodiimide -/ uretonimine - modified 4 , 4 ′- mdi is used as the blend component . thus the cast elastomers according to the invention c - 3 and c - 5 have a casting time of 170 seconds and 210 seconds respectively , whereas the comparative example c - 1 ( c ) has a casting time of just 115 seconds . the two systems according to the invention ( c - 3 and c - 5 ) even achieve almost the same casting time as the elastomer produced directly c - 7 ( c ) and can be readily processed without difficulty . in this way elastomers ( c - 3 and c - 5 ) are obtained from blends of low - nco - containing prepolymers with modified 2 , 4 ′- mdi which have the same level of properties as elastomers produced directly with 2 , 4 ′- mdi prepolymers ( c - 7 ( c )). this means that by blending a high - nco - containing isocyanate component and a low - nco - containing prepolymer , elastomers can be produced having properties which are normally obtained only by using special isocyanate components . similar observations can also be made for the systems produced with around 20 parts by weight of baytec ® xl1604 . naturally these systems are generally somewhat faster owing to the higher nco content in the prepolymer . within allowable margins for error , the mechanical properties listed in table 3 are similar for elastomers made from prepolymers with the same nco contents , the use of elevated amounts of desmodur ® cd - s ( 4 , 4 ′- cds ) to achieve higher nco contents ( example c - 2 ( c )) leading disadvantageously to brittle products . taken as a whole , the elastomers according to the invention c - 3 , c - 4 and c - 5 therefore represent optimal solutions . | 2 |
novolak resins have been commonly used in the art of photoresist manufacture as exemplified by &# 34 ; chemistry and application of phenolic resins &# 34 ;, knop a . and scheib , w . ; springer verlag , new york , 1979 in chapter 4 . similarly , o - quinone diazide sulfonic acid esters are well known to the skilled artisan as demonstrated by &# 34 ; light sensitive systems &# 34 ;, kosar , j . ; john wiley & amp ; sons , new york , 1965 chapter 7 . 4 . however , the instant invention has found that the use of novolak resins isolated utilizing the process of the present invention by the separation of fractionated novolak resin in the heaviest layer of a 2 - or 3 - layer separation , using a liquid / liquid centrifuge , provides comparable or better lithographic performance at a fraction of the time required with traditional isolation / fractionation processes . the instant invention shows that using such a fractionation and separation process , useful novolak resins can be made for use in photoresist compositions . optional ingredients for the photoresist compositions of the present invention include colorants , dyes , anti - striation agents , leveling agents , plasticizers , adhesion promoters , speed enhancers , solvents and such surfactants as non - ionic surfactants , which may be added to the solution of novolak resin , sensitizer and solvent before the photoresist composition is coated onto a substrate . examples of dye additives that may be used together with the photoresist compositions of the present invention include methyl violet 2b ( c . i . no . 42535 ), crystal violet ( c . i . 42555 ). malachite green ( c . i . no . 42000 ), victoria blue b ( c . i . no . 44045 ) and neutral red ( c . i . no . 50040 ) at one to ten percent weight levels , based on the combined weight of novolak and sensitizer . the dye additives help provide increased resolution by inhibiting back scattering of light off the substrate . anti - striation agents may be used at up to about a five percent weight level , based on the combined weight of novolak and sensitizer . plasticizers which may be used include , for example , phosphoric acid tri -( beta - chloroethyl )- ester ; stearic acid ; dicamphor ; polypropylene ; acetal resins ; phenoxy resins ; and alkyl resins , at about one to ten percent weight levels , based on the combined weight of novolak and sensitizer . the plasticizer additives improve the coating properties of the material and enable the application of a film that is smooth and of uniform thickness to the substrate . adhesion promoters which may be used include , for example , beta -( 3 , 4 - epoxy - cyclohexyl )- ethyltrimethoxysilane ; p - methyl - disilane - methyl methacrylate ; vinyl trichlorosilane ; and gamma - amino - propyl triethoxysilane , up to about a 4 percent weight level , based on the combined weight of novolak and sensitizer . development speed enhancers that may be used include , for example , picric acid , nicotinic acid or nitrocinnamic acid up to about a 20 percent weight level , based on the combined weight of novolak and sensitizer . these enhancers tend to increase the solubility of the photoresist coating in both the exposed and unexposed areas , and thus they are used in applications when speed of development is the overriding consideration even though some degree of contrast may be sacrificed ; i . e ., while the exposed areas of the photoresist coating will be dissolved more quickly by the developer , the speed enhances will also cause a larger loss of photoresist coating from the unexposed areas . the solvents may be present in the overall composition in an amount of up to about 95 % by weight of the solids in the composition . solvents , of course are substantially removed after coating of the photoresist solution on a substrate and subsequent drying . non - ionic surfactants that may also be used include , for example , nonylphenoxy poly ( ethyleneoxy ) ethanol ; octylphenoxy ethanol at up to about 10 % weight levels , based on the combined weight of novolak and sensitizer . the prepared photoresist solution , can be applied to a substrate by any conventional method used in the photoresist art , including dipping , spraying , whirling and spin coating . when spin coating , for example , the resist solution can be adjusted with respect to the percentage of solids content , in order to provide a coating of the desired thickness , given the type of spinning equipment utilized and the amount of time allowed for the spinning process . suitable substrates include silicon , aluminum , polymeric resins , silicon dioxide , doped silicon dioxide , silicon nitride , tantalum , copper , polysilicon , ceramics , aluminum / copper mixtures ; gallium arsenide and other such group iii / v compounds . the photoresist coating produced by the described procedure is particularly suitable for application to thermally grown silicon / silicon dioxide - coated wafers , such as are utilized in the production of microprocessors and other miniaturized integrated circuit components . an aluminum / aluminum oxide wafer can also be used . the substrate may also comprise various polymeric resins , especially transparent polymers such as polyesters . the substrate may have an adhesion promoted layer of a suitable composition , such as one containing a hexaalkyl disilazane , preferably hexamethyl disilazane ( hmds ). the photoresist composition solution is then coated onto the substrate , and the substrate is treated at a temperature from 70 ° c . to 110 ° c . for from 30 seconds to 180 seconds on a hot plate or for from 15 to 90 minutes in a convection oven . this temperature treatment is selected in order to reduce the concentration of residual solvents in the photoresist , while not causing substantial thermal degradation of the photosensitizer . in general , one desires to minimize the concentration of solvents in the photoresist coating and this first temperature treatment ( soft bake ) is conducted until substantially all of the solvents have evaporated and a thin coating of photoresist composition , on the order of one micron in thickness , remains on the substrate . in a preferred embodiment the temperature is from 85 ° c . to 95 ° c . the heat treatment is conducted until the rate of change of solvent removal becomes relatively insignificant . the temperature and time selection depends on the photoresist properties desired by the user , as well as the equipment used and commercially desired coating times . the coated substrate can then be exposed to actinic radiation , e . g ., ultraviolet radiation , at a wavelength of from about 300 nm to about 450 nm , x - ray , electron beam , ion beam or laser radiation , in any desired pattern , produced by use of suitable masks , negatives , stencils , templates , etc . the photoresist coating is then optionally subjected to a post exposure second baking or heat treatment , either before or after development . the heating temperatures may range from 90 ° c . to 120 ° c ., more preferably from 100 ° c . to 110 ° c . the heating may be conducted for from 30 seconds to 2 minutes , more preferably from 60 seconds to 90 seconds on a hot plate or from 30 to 45 minutes in a convection oven . the exposed photoresist - coated substrate is then developed to remove the image - wise exposed areas by immersion in an alkaline developing solution or is developed using a spray development process . the solution is preferably agitated , for example , by nitrogen burst agitation . the substrate is allowed to remain in contact with the developer until all , or substantially all , of the photoresist coating has dissolved from the exposed areas . developers may include aqueous solutions of ammonium or alkali metal hydroxides . one preferred hydroxide is tetramethyl ammonium hydroxide . after removal of the coated wafers from the developing solution , one may conduct an optional post - development heat treatment or bake to increase the coating &# 39 ; s adhesion and chemical resistance to etching solutions and other substances . the post - development heat treatment can comprise the oven baking of the coating and substrate below the coating &# 39 ; s softening point . in industrial applications , particularly in the manufacture of microcircuitry units on silicon / silicon dioxide - type substrates , the developed substrates may be treated with a buffered , hydrofluoric acid base etching solution . the photoresist compositions of the present invention are resistant to acid - base etching solutions and provide effective protection for the unexposed photoresist - coating areas of the substrate . the following specific examples will provide detailed illustrations of the methods of producing and utilizing compositions of the present invention . these examples are not intended , however , to limit or restrict the scope of the invention in any way and should not be construed as providing conditions , parameters or values which must be utilized exclusively in order to practice the present invention . unless otherwise specified , all parts and percents are by weight , all temperatures are in degrees centigrade , and all molecular weights are weight average molecular weight . a novolak resin was synthesized by condensing formaldehyde with a mixture of 55 % meta - cresol and 45 % para - cresol at a ratio of 0 . 7 mole of formaldehyde to 1 mole of total cresols ( meta cresol plus para cresol ). the reaction was run with about 0 . 3 % ( by weight of solids ) of an oxalic acid catalyst . after reacting the mixture for about 6 hrs . at 90 - 95 ° c ., the mixture was distilled at a temperature up to about 200 ° c ., and then at 200 ° c . with 25 - 30 mm hg vacuum , to remove unreacted cresols . the molten novolak resin was then poured into a crystallizing dish and allowed to cool . the solidified resin was then broken up and powdered by grinding the resin with a mortar and pestle . 1200 grams ( gm ) novolak resin , produced according to the procedure of example 1 , was dissolved in 2800 gm pgmea to provide a 30 % solids solution . this novolak resin solution was diluted to 20 % solids by adding meoh , so that the final solvent composition was 58 % pgmea and 42 % meoh . this solution was used as one of two inlet feed streams into a cinc ™ model v2 liquid / liquid centrifuge . the other inlet feed stream was hexane . the pump speeds for each inlet stream had separate controls . trials were run with a range of temperatures from 0 - 55 ° c ., centrifuge rpm of from 1500 - 5000 ( equating to g - forces between 100 and 800 , respectively ) and inlet feed ratios ( and corresponding to outlet feed ratios ) of from 3 parts of the novolak resin solution : 0 . 5 parts of the c 5 - c 8 alkane or aromatic hydrocarbon , to 0 . 5 parts of the novolak resin solution : 2 parts of the c 5 - c 8 , alkane or hydrocarbon solvent . using a cinc ™ model v2 liquid / liquid centrifuge having an internal volume of about 140 milliliters ( ml ), the inlet feed rates into the centrifuge , for the novolak resin solutions , were from 75 to 400 ml / min . table i below shows the conditions used , the mw determined by gpc , and the dr for the final product . the experiments , the results of which are set forth in table i below , demonstrated that the present method effectively fractionated and separated a novolak resin . comparative drs were run in az ® 300 mif tetramethyl ammonium hydroxide developer ( available from az electronic materials , clariant corporation , somerville , n . j .) comparing a sample of unfractionated novolak resin dissolved in pgmea to the novolak resin solution obtained from the heaviest phase of the 3 - phase separation . the dr measurement was run on a xinix ™ model 2200 process monitor . silicon wafers , primed with hmds , were coated with 28 % solids novolak resin solution at 110 ° c . for 60 seconds at a spin speed appropriate to provide a coated film thickness of 1 . 60 ± 0 . 1 micrometers , as measured on a nano ™ 215 device using the 5 point 4 - inch wafer program . a wafer was attached to the xinix ™ probe and was immersed in a bath of az ® 300 mif developer , until the resin was removed . two wafers were run and averaged to obtain the dr as measured in angstroms / second ( å / sec .). whereas the unfractionated resin had a dr of about 200 å / sec ., the fractionated material had a dr of from 60 å / sec to 90 å / sec . weight average molecular weights ( mw ) measured by gel permeation chromatography ( gpc ), showed that the fractionated resin had a mw of 9 , 500 - 12 , 000 whereas the unfractionated resin had a mw of 7 , 500 . table i______________________________________ mw , trial temp ., ° c . rpm r / h gpc pd , mw / mn dr , å / sec . ______________________________________1 55 1000 2 9917 5 . 1 -- 2 0 5000 1 9941 5 . 4 -- 3 0 1000 2 9046 5 . 1 -- 4 55 1000 0 . 5 11710 5 . 0 69 . 5 5 55 5000 2 9601 5 . 0 -- 6 25 3500 2 9536 5 . 1 -- 7 25 1000 1 10069 5 . 0 -- 8 55 3500 1 10002 5 . 0 -- 9 0 1000 0 . 5 8788 5 . 3 -- 10 25 5000 0 . 5 9846 5 . 1 -- 11 25 5000 2 10274 5 . 3 -- 12 0 3500 2 10115 5 . 8 -- 13 0 3500 0 . 5 9513 5 . 4 -- 14 55 5000 1 12544 6 . 0 95 . 3 15 0 1000 1 9803 5 . 4 -- ______________________________________ an unfractionated control sample had a mw of 7500 and a dr of 200 å / sec . with a polydispersity of 15 . r = pump speed of the inlet feed of a 20 % solids novolak resin solution in 58 % pgmea142 % meoh ( in ml ./ min . ); another series of experiments was run according to the procedure of example 2 and the centrifuge rpm was maintained at 3500 rpm (˜ 500 g force ). in this series , the variables were the composition of the novolak resin solution , the inlet feed rate of the novolak resin solution , the solvent used ( where el was used as the photoresist solvent in place of pgmea ) and the temperature , as shown in table ii below . the el / meoh ratio was held at 58 %/ 42 %. a dr ranging between 30 and 190 å / sec . was obtained , as compared to an unfractionated resin that had a dissolution rate of 300 å / sec . the results are shown in table ii below . all feed rates are in ml ./ min . table ii______________________________________ inlet feed mw , trial temp ., ° c . r / h rate / novolak gpc pd dr , å / sec . ______________________________________1 55 2 400 11 , 247 8 . 8 137 . 9 2 40 2 400 9 . 2 146 . 3 3 35 0 . 5 75 10 , 169 8 . 6 145 . 6 4 25 0 . 5 75 11 , 368 9 . 5 187 . 3 5 40 2 400 11 , 728 9 . 3 149 . 6 6 25 2 400 11 , 857 9 . 6 176 . 5 7 55 2 400 11 , 340 4 . 3 140 8 25 2 400 11 , 674 9 . 4 186 . 7 9 55 0 . 5 75 14 , 155 8 . 1 40 . 6 10 55 1 200 12 , 659 9 . 7 159 . 2 11 25 1 . 25 225 11 , 980 9 . 6 189 . 9 12 25 1 . 25 225 11 , 183 9 . 1 191 . 2 13 55 1 . 5 250 12 , 032 9 . 3 113 . 4 14 35 1 . 5 250 11 , 688 9 . 4 143 . 4 15 45 0 . 5 75 10 , 999 9 . 0 127 . 4 16 55 0 . 5 75 13 , 862 6 . 8 28 . 5______________________________________ an fractionated control sample had a mw of about 9000 , a dr of 300 å / sec and a pd15 . r = pump speed of the inlet feed of a 20 % solids novolak resin solution in 58 % el / 42 % meoh ; a novolak resin was synthesized by condensing para - formaldehyde with a phenol mixture of 5 moles of meta - cresol , 4 moles of para - cresol , and 2 moles of 2 , 3 , 5 - trimethyl phenol at a ratio of 0 . 7 mole of formaldehyde to 1 mole of phenol mixture . the reaction was run with 0 . 3 % ( by weight of solids ) of an oxalic acid catalyst . after reacting the reaction mixture for 4 hrs . at 90 - 95 ° c ., the mixture was distilled up to about 200 ° c . and then at 200 ° c . with 25 - 30 mm hg vacuum to remove unreacted phenols . the molten resin was poured into a crystallizing dish and allowed to cool . the solidified novolak resin was then broken up and powdered by grinding the novolak resin with a mortar and pestle . a 20 % solids solution of the above novolak resin was made by dissolving 270 grams of the solid novolak resin in 875 . 5 grams of meoh and 229 . 1 grams of el . this solvent composition was 79 . 3 % meoh and 20 . 7 % el . to this solution , 341 . 5 grams of deionized water was added and the mixture was fed through one inlet , at a rate of 200 milliliters ( ml .) per minute at room temperature , into a cinc ™ model v - 2 liquid / liquid centrifuge running at 4000 rpm (˜ 600 g force ). the mixture was efficiently separated into two distinct layers , the heavy layer containing one phase and the lighter layer containing two other phases , which remained as a mixture . the lighter layer and the heavy layer were removed from the centrifuge through two separate outlet feeds , each at a rate of about 200 ml ./ min . the heavy layer was collected , and water was removed by vacuum distillation until the final solution was 30 % solids in substantially pure el . comparative drs were run in az ® 300 mif developer by the method described in example 2 . a sample of unfractionated resin dissolved in ethyl lactate solution was compared to the resin obtained from the heavier phase of the phase separation . whereas the unfractionated resin had a dr of 800 å / sec ., the fractionated material had a dr of 60 å / sec . molecular weights ( mw ) by gel permeation chromatography ( gpc ) showed that the fractionated resin had an mw of 5147 whereas the unfractionated resin had an mw of 2104 . ______________________________________nk - 280 ( a proprietary 2 , 1 , 5 - diazonaphthoquinone 2 . 02 gm sulfonyl chloride sensitizer available from nippon zeon co ) nk - 240 ( a proprietary 2 , 1 , 4 - diazonaphthoquinone 0 . 84 gm sulfonyl chloride sensitizer available from nippon zeon co .) fractionated novolak resin from example 4 22 . 58 gm b126x - sh proprietary speed enhancer resin available from 1 . 20 gm nippon zeon co . kp - 341 , a striation free surfactant 0 . 004 gm available from shinetsu chem . co . ( 2 % in el ) additional ethyl acetate 17 . 15 gm n - butyl acetate 5 . 85 gm______________________________________ the photoresist composition was coated on an hmds primed silicon wafer to a 1 . 083 micrometer ( μm ) film thickness , which was then soft baked at 90 ° c . for 60 seconds on a hot plate . the focus exposure matrix was printed on the coated wafer using a 0 . 54 na nikon ® i - line stepper and a nikon ® resolution reticle . the exposed wafer was peb ( post exposure baked ) at 110 ° c . for 70 seconds on an in - line hot plate . the wafer was then developed using az ® 300 mif ( tmah , tetramethyl ammonium hydroxide -- 2 . 38 %) developer for 60 seconds at 21 ° c . the developed wafer was examined using a hitachi (® s - 4000 sem ( scanning electron microscope ). a nominal dose ( dose to print , dtp ) was measured at the best focus by choosing the exposure at which the printed feature most closely matched the mask feature size on the developed sem photo . for this resist , the dose required to precisely replicate a given feature was 290 millijoules / cm 2 . resolution is the minimum feature size which can be discriminated ( resolved ) and was 0 . 32 μm . depth of focus is the range of usable focus at which nominal sizes can still be resolved . the depth of focus for this photoresist composition was 1 . 0 μm ( micrometer ). a novolak resin was synthesized by condensing para - formaldehyde with a phenol mixture of 5 moles of meta - cresol , 4 moles of para - cresol , and 2 moles of 2 , 3 , 5 - trimethyl phenol at a ratio of 0 . 7 mole of formaldehyde to 1 mole of phenol mixture . the reaction was run with 0 . 3 % ( by weight of solids ) of an oxalic acid catalyst . after reacting the mixture for 4 hrs . at 90 - 95 ° c ., the mixture was distilled up to about 200 ° c . and then at 200 ° c . with 25 - 30 mm hg vacuum , to remove unreacted phenols . the molten resin was poured into a crystallizing dish and allowed to cool . the solidified novolak resin was broken up and powdered by grinding the resin with a mortar and pestle . a 30 % solids solution of the novolak resin was prepared by dissolving 240 grams of novolak resin in 560 grams of el . this solution was diluted to 20 % solids by the addition of meoh , such that the final solvent ratio was 58 % el to 42 % meoh . this solution was used as one inlet feed stream ( r ) into a cinc ™ model v2 liquid / liquid centrifuge with hexane as the other feed stream ( h ), using the procedure set forth in example 2 . the r / h ratio was maintained at 1 / 1 by running the respective feed pumps at the same rate ( 0 . 4 l / min . ), the temperature was 40 ° c . and the centrifuge spin speed was 3500 rpm . the heavy layer was distilled to remove residual meoh and hexane , and was concentrated to 26 % solids . the dr was measured according to the procedure described in example 2 . the fractionated resin of this example had a dr of 270 å / sec . and a mw of 6365 , while the unfractionated resin had a dr of 600 å / sec . and a mw of 2860 . 300 gm of an unfractionated novolak resin prepared according to the procedure set forth in paragraph 1 of example 4 was dissolved in 2700 gm of ethyl lactate to provide a 20 % solids resin solution . this solution was used as one inlet feed stream ( r ) into a cinc ™ model v2 liquid / liquid centrifuge with hexane as the other feed stream ( h ) using the procedure set forth in example 2 . the r / h ratio was maintained at 2 / 1 by running the r pump at 200 ml / minute and the h pump at 100 ml / minute ; the temperature was 20 - 25 ° c . and the centrifuge spin speed was 3500 rpm . the heavy layer was distilled to remove traces of hexane and to concentrate the solution to 26 % solids . the dr was measured according to the procedure described in example 2 . when compared to the dr of 686 å / sec . and mw of 2383 for the unfractionated resin , the fractionated novolak resin of this example had a dr of about 584 å / sec . and a mw of 2653 . the yield of fractionated resin was about 80 %. 300 gm of an unfractionated novolak resin prepared according to the procedure set forth in paragraph 1 of example 4 was dissolved in 2700 gm of ethyl lactate to provide a 20 % solids resin solution . this solution was used as one inlet feed stream ( r ) with hexane as the other feed stream ( h ) using conditions similar to those found in example 2 . the r / h ratio was maintained at 1 / 2 by running the r pump at 100 ml / minute and the h pump at 200 ml / minute ; the temperature was 20 - 25 ° c . and the centrifuge spin speed was 3500 rpm . the heavy layer was distilled to remove traces of hexane and to concentrate the solution to 26 % solids . the dissolution rate ( dr ) was measured according to the procedures described in example 2 . when compared to the dr of 686 å / sec . and mw of 2383 for the unfractionated resin , the fractionated novolak resin of this example had a dr of about 533 å / sec . and a mw of 2870 . the yield of resin was about 65 %. 300 gm of an unfractionated m - cresol novolak resin ( available from asahi yuki company in japan ) was dissolved in 1200 gm of acetone to provide a 20 % solids solution . this solution was used as one inlet feed stream ( r ), with pentane as the other feed stream ( h ), into a cinc ™ model v02 liquid / liquid centrifuge . the r / h ratio was maintained at 1 / 1 by running the r pump at 150 ml / minute and the h pump at 150 ml / minute ; the temperature was 25 ° c . and the centrifuge spin speed was 3500 rpm . the heavy layer was distilled to remove the acetone and pentane . the thick residue was dissolved in sufficient 2 - heptanone to provide a solution to 26 % solids . the dr was measured according to the procedure described in example 2 . compared to the starting unfractionated novolak resin , which had a dr of 722 å / sec . and a mw of about 7 , 000 , samples of the fractionated novolak resin of this example taken at two stages near the end of the fractionation had a dr of 103 å / sec . and 118 å / sec ., and the final product had a mw of 8 , 054 . unless otherwise specified : 1 ) all molecular weights ( mw ) were weight average molecular weights measured by gel permeation chromatography ( gpc ); all parts and percents are by weight and all temperatures are in degrees centigrade . | 6 |
a partition system 30 ( fig1 ) includes partitions 31 adjustably interconnected and outfitted to form offices . tops and exposed ends of the partitions 31 are covered with top and end trim pieces 33 and 34 , for aesthetically covering and protecting the partitions . the illustrated trim pieces 33 and 34 are made of structural material and have beefed - up sections with elongated t - slots formed in their exposed surface , and further , they are securely attached to the partitions 31 . by this arrangement , a plurality of different accessories can be adjustably mounted to tops and ends of the trim pieces 33 and 34 on the partitions 31 . the illustrated accessories include a wire manager system 35 , a hook 36 , a screen 37 , an upright / lateral erasable marker board 38 , a hanging binder bin 39 , a hanging shelf 40 , a hanging erasable marker board 41 , a top - mounted cantilevered light 42 , a top - mounted cantilevered document holder 43 , and a side - attached table 44 , but it will be clear to persons skilled in the art of furniture after reading the description below that additional accessories can be developed using the present inventive concepts . the present inventive concepts can be adapted for use on most any partition or wall structure . the illustrated partitions 31 are sufficiently described below for an understanding of the present invention by persons skilled in this art . nonetheless , additional detailed discussion of the partitions 31 , their structure and advantages of their construction can be found in the following patent applications , the entire contents of which are incorporated in their entirety by reference : co - assigned application ser . no . 10 / 077 , 553 , filed feb . 15 , 2002 , entitled panel system , and co - assigned application ser . no . 10 / 076 , 709 , filed feb . 15 , 2002 , entitled partition panel with modular appliance mounting arrangement . the illustrated partitions 31 ( fig5 ) each include a frame assembly 50 having two end frame members 51 and 52 , a top frame member 53 , and a bottom frame member 54 forming a perimeter frame . the frame assembly 50 may also include one or more optional intermediate frame members 55 , and one or more optional intermediate accessory frame members 56 . the frame members 51 - 56 are covered using removable covers 57 ( fig1 ), and are secured together to form a rigid structure suitable for supporting work surfaces 58 , and other furniture and accessories commonly associated with office and subdivision of building space . the illustrated frame assembly 50 further includes adjustable glides or “ feet ” 59 so that the partitions 31 can be leveled to accommodate unevenness in floors . the top frame member 53 ( fig8 ) has a cross section with the flat center wall 60 and upwardly protruding rectangular side ridges 61 and 62 that define a center channel 63 between them . the ridges 61 and 62 include upper / outer corners with a horizontal row of longitudinally - extending short slots 63 ′, which can be engaged with hooked brackets for supporting furniture articles such as binder bins , shelves , and the like . the center wall 60 includes a series of holes 64 with threaded nuts 65 tack - welded under the holes 64 . long bolts 66 are extended through mating holes in the trim piece 33 and threadably into the holes 64 and nuts 65 . depending on a depth of the channel 63 , the number of bolts 66 , and a lateral strength requirement of the attachment , a foam block 67 ( fig1 ) or similar stabilizer can be added to each connection . if desired , the block 67 can have concave sides to allow for longitudinal passage of wires past the block 67 . in fig1 , a connector plate 67 ′ extends into channels 63 in adjacent frames 50 , and screws 67 ″ secure the connector plate 67 ′ to the frames 50 to align and interconnect the frames 50 . the end frame member 51 ( and 52 ) ( fig9 ) is similar to the top frame member 53 , although the channel that it defines is much shallower . specifically , the end frame member 51 includes a cross section with a flat center wall 70 , and outwardly protruding rectangular side ridges 71 and 72 that define a channel 73 between them . the ridges 71 and 72 include outer corners with a vertical row of longitudinally - extending short slots 73 ′, which can be engaged with hooked brackets for supporting furniture articles . the center wall 70 includes a series of holes 74 with threaded nuts 75 tack - welded under the holes 74 . long bolts 76 are extended through mating holes in the trim piece 34 and threadably into the holes 74 and nuts 75 . blocks similar to blocks 67 can be used if increased stability of the bolts 76 is needed , but it is contemplated that stabilizing blocks will not be needed due to the short length of the bolts 76 . also , it is noted that the frame members 51 ( and 52 ) are stabilized by a reinforcement 78 under center wall 70 ( fig9 ). the top trim piece 33 ( fig3 ) has a width and length chosen to cover a top surface of the partition 31 . notably , the length of the top trim pieces 33 can be longer or shorter than individual partitions 31 , as long as a total length equals a length of an interconnected run of partitions 31 . ( notice in fig1 that some top trim pieces 33 span two partitions 31 .) the illustrated trim piece 33 ( fig3 ) includes flat top and side surfaces 80 and 81 , and includes a bottom surface 82 with flat landings 83 and 84 for resting on the protruding ridges 61 and 62 . the bottom surface 82 further includes a down - ridge 85 that extends partially into the channel 63 . the down - ridge 85 has a width so that its edges abut the inside corners of the ridges 61 and 62 , thus centering the trim piece 33 on the top frame member 53 . if increased stability is desired , the outer edges of the side surfaces 80 and 81 can include a down lip so that the protruding ridges 61 and 62 are positively captured . a top surface of the top trim piece 33 is relatively flat , with the exception of a center area where the t - slot 87 is formed . the t - slot 87 includes a neck portion 88 and a wide portion 89 with blind surfaces 90 and 91 . a bottom flange 92 forms a bottom of the t - slot 87 . holes 93 are bored through the bottom flanges 92 , and each includes a recess 94 for receiving a head of the bolt 66 . by this arrangement , when the bolts 66 are in an assembled position , the head of the bolt 66 is removed from the t - slot 87 , so that the bolt 66 does not interfere with use of the t - slot 87 . it is also noted that the top trim piece 33 could be attached by extending screws through the top trim piece 33 at positions outside the t - slot 87 and into the side ridges 61 and 62 . a cross sectional shape of the trim piece 33 can be varied for aesthetics and functional reasons . the illustrated cross sections shape of trim piece 33 includes a flat top surface 80 and flat side surfaces 81 that define a rectangular shape . however , the top surface can be modified as shown by top trim piece 33 a , which includes top surface 80 ′ with a dish - shaped recess 96 . this dish shape has an aesthetic appeal , and when used with the wire manager system 35 , also provides increased room for routing wiring along a top of the partition 31 , as described below . it is noted that the trim piece 33 can span aligned adjacent partitions 31 ( see fig1 the top left two partitions ). it is also noted that the dish - shaped recess 96 could be divided in half by a vertical flange , so as to subdivide and separate recess 96 into two channels , one being for communication wiring and one being for power electrical wiring . the illustrated slots 87 work particularly well , since accessories can be positioned anywhere along the top or ends of the partitions 31 . however , a scope of the present inventive concepts is believed to include other attachment features , such as a protruding ridge ( e . g . a t - shaped ridge ), a plurality of discrete locations instead of continuous slot ( e . g . a series of holes or short slots , not unlike the slots 63 ′ in top frame member 53 ). hook and loop material could also be used . the illustrated end trim piece 34 ( fig9 but also see fig1 and 3 ) has the same cross sectional shape as the top trim piece 33 , and accordingly , a second description is not necessary for an understanding of trim piece 34 . the illustrated end trim piece 33 is interchangeable with top trim piece 33 , except perhaps for its length , which will vary depending upon the partitions 31 . as noted above , the illustrated accessories include a wire manager system 35 , a hook 36 , a screen 37 , an erasable marker board 38 , a hanging binder bin 39 , a hanging shelf 40 , a hanging erasable marker board 41 , a top - mounted cantilevered light 42 , a top - mounted cantilevered document holder 43 , and a side - attached table 44 . each accessory includes at least one anchor that operably engages a blind surface in the t - slot and further includes a base opposing the anchor , so that as the anchor is drawn toward the base , the arrangement clampingly and stably retains the accessory to an exposed outer surface of the trim piece 33 ( or 34 ) and hence to the associated partition 31 . depending on the functional needs of the accessory , such as the need for stability , the need to provide torque to resist lateral forces ( such as may occur when a person is writing on an erasable marker board ), the need for styling and / or aesthetics , and other considerations , the visible portion of the base can be varied , or multiple bases and anchors can be used , or both . the illustrated wire manager system 35 ( fig1 ) includes a tunnel element 100 , a terminator element 101 , and an overhead - utility down - feed element 102 . the overhead - utility down - feed element 102 is adapted to communicate utilities , such as wires , downwardly from a ceiling or from an overhead framework of a post - and - beam furniture system . the tunnel element 100 has an inverted u - shaped cross sectional shape ( fig1 a ) that forms an inner passageway 103 , and has a width selected so that the legs of the u - shape can rest on a top trim piece 33 of a partition 31 . a through hole or aperture 37 ′ ( fig1 b ) can be cut through the trim piece 33 ( or 34 ) to allow wires to pass through the trim piece 37 down into an internal cavity of the partition 31 . the overhead - utility down - feed element 102 ( fig1 ) includes a side wall facing the direction of the tunnel element 100 , with a cut - out 102 ′ shaped to mateably engage the tunnel element 100 , such that the tunnel element 100 can be extended into the cut - out for optimal aesthetics . at the other end of the tunnel element 100 , the terminator element 101 is positioned . the terminator element 101 ( fig1 - 16 ) has a half - cup - shaped body 104 with a lip 105 forming an open mouth for receiving the end of the tunnel element 100 . a base flange 106 extends around the down side of the body 104 , and is adapted to rest on the top trim piece 33 . a first pair of legs 107 and 108 extend downwardly from a middle area of the cup - shaped body 104 . the legs 107 and 108 are resilient , and include hooks 109 and 110 on their ends that are shaped to releasably engage opposing sides of the t - slot 87 to retain the body 104 on the top trim piece 33 . additional secondary legs 111 can be located between the legs 107 and the sides of the body , for providing additional stability and strength to the body 104 . it is noted that the tunnel element 100 can extend longer or shorter than the partition 31 , and longer or shorter than the top trim 33 on which it rests . in fig1 the down - feed element 102 drops wires 114 to one end of the partition 31 , and the tunnel element 100 extends across a top of and past that partition 31 onto the top of a second partition 31 . this allows wires 114 located within the tunnel element 100 to be communicated across a top of the first partition 31 and then down into the second partition 31 , without having to route the wiring through the first partition 31 into the second partition 31 . ( the wires 114 are extended along the t - slot 87 to light 42 .) this arrangement of wire management greatly facilitates office rearrangements , since the wiring is easy to reach , see , and re - route . the hook 36 ( fig1 - 19 ) includes a center stem 116 with a hook element 117 on one end and a transverse segment or anchor 118 on its other end . the stem 116 and anchor 118 form an inverted t - shape . a base or disk 119 is attached to the center stem 116 at a location spaced from the anchor 118 . the outside of the disk 119 is threaded , and a nut 120 is threaded onto the disk 119 . to insert the hook 36 into the t - slot , the anchor 118 is oriented so that it aligns with the neck portion 88 of the t - slot 87 . in this position , the anchor 118 fits through the neck portion 88 of the t - slot 87 . the stem 116 and anchor 118 are then rotated 90 - degrees , which causes the anchor 118 to move into the wide portion 89 of the slot 87 , with its ends engaging the blind surfaces 90 and 91 on the t - slot 87 . the nut 120 is then rotated while the hook element 117 is held stationary , such that the nut 120 threadably moves downwardly on the disk 119 until the nut 120 clamps against the marginal material of the top trim piece 33 forming the neck portion 88 . due to a width of the hut 120 and of the anchor 118 , the hook 36 is stably held on the top trim piece 33 . the hook 36 can similarly be attached to the end trim piece 34 ( see fig1 ). the screen 37 ( fig2 ) includes a bent wire frame 123 covered with a screen fabric material 124 . the frame 123 includes a lower horizontal frame member 125 with an up - bend 126 at its corners . the frame 123 includes side frame members 127 with foot sections 128 that extend below the up - bend 126 . the foot sections 128 are not unlike the stem 116 . the foot sections 128 include a transverse segment or anchor 129 on its other end , which forms an inverted t - shape . a base 130 is attached to the foot section 128 at a location spaced from the anchor 129 . the base 130 includes a disk 130 ′ that is threaded , and a nut 131 that is threaded onto the disk 130 ′. to insert the anchor 129 into the t - slot , the anchor 129 is oriented so that it aligns with the wide portion 89 of the t - slot 87 . in this position , the anchor 129 slops into an end of the t - slot , with the anchor 129 engaging the blind surfaces 90 and 91 on the t - slot 87 . the nut 131 is then rotated while the frame 123 is stationary , such that the nut 131 threadably moves downwardly on the disk 130 ′ until the nut 131 clamps against the marginal material of the top trim piece 33 forming the neck portion 88 . due to a width of the nut 131 and of the anchor 129 , the screen 37 is stably held on the top trim piece 33 . the screen 37 can similarly be attached to the end trim piece 34 ( see fig1 ). in such case , the screen 37 extends laterally outward from the partition 31 in a plane of the partition 31 . two erasable marker boards 38 and 41 are shown in fig1 with marker board 38 extending laterally or upwardly from the partition 31 , and the marker board 41 lying against a face of the partition 31 . specifically , the marker board 38 includes a perimeter channel frame 135 with white erasable marker board material 136 inside the channel frame 135 . two legs 137 extend laterally from the perimeter channel frame 135 . each include a threaded stem , an anchor , a base / disk , and a threaded nut , similar to those described above for the screen 37 . the marker board 38 can be attached to the top trim piece 33 or to the end trim piece 34 ( as shown ), and extends outwardly from the partition 31 . the marker board 41 includes an l - shaped bracket 139 ( fig2 ) having a top leg 140 ( fig2 ) that extends across the top trim piece 33 . a pair of stems 145 , anchors 146 , disks 147 , and threaded nuts 148 extend from the top leg 140 for clamping engagement with the t - slot 87 on the top trim piece 33 . the bracket 139 includes a down leg 141 that extends downwardly flush against a face of the partition 31 . the down leg 141 has a length so that it positions an erasable surface 142 ( fig1 ) at a desired height on the face of the partition 31 . the illustrated erasable board 41 has a perimeter channel frame 143 and a white erasable surface 144 like the marker board 38 . the hanging binder bin 39 ( fig1 ) is mounted on an l - bracket 139 ′ similar to the l - bracket 139 for the erasable marker board , but the l - bracket 139 ′ is beefed up for the additional weight that it is likely to carry . a pair of brackets 139 ′ can be used if necessary to support the binder bin 149 . the hanging shelf 40 ( fig1 ) is mounted on a pair of bent wire side supports 150 . the supports 150 have a triangular end with a horizontal segment 151 adapted to carry a shelf panel 152 in a horizontal position . the supports 150 further have an angled segment 153 to a top tip at the top trim piece 33 . a rear leg of bent wire 155 extends from the top tip across a top of the top trim piece 33 , and includes a stem , an anchor , a base / disk , and a threaded nut , as previously describe . the top - mounted cantilevered light 42 and the top - mounted cantilevered document holder 43 each include a panel base plate 160 that engages a top of the top trim piece 33 . each include a stem , anchor , ( base plate 160 ), and at least one nut 161 for clamping retention to the t - slot 87 of the top trim piece 33 . it is contemplated that furniture can be attached to the slots 87 . for example , the side - attached table 44 includes a stem , anchor , base , and nut for retaining the table 44 adjacent the end trim piece 34 of the partition 31 . it is contemplated that benches , chairs , or the like could also be coupled to or tethered to the partition 31 . an advantage of mounting the accessories 35 - 44 anywhere along the partitions 31 is that it provides infinite and easy adjustability . this lets the office worker locate accessories in optimal locations and positions for workflow , and lets the worker adjust for changing needs and preferences . customization of an office leads to individuality , identity , and personality of a workspace , as well as pride and ownership of the space . the user can easily adjust his office to changing needs without requiring skilled trades assistance in order to make the change . further , the accessories are mounted in areas not previously used , such as areas directly above the partitions and off free ends of the partitions , which areas were previously wasted space and / or at least under - utilized . additional accessories are shown in a commonly - assigned patent application ser . no . 10 / 113 , 124 , filed on mar . 29 , 2002 ( same day as present application ), entitled building outfitting system with common accessory mounting feature , and the entire contents of that application are incorporated herein in its entirety by reference . it is to be understood that variations and modifications can be made on the aforementioned structure without departing from the concepts of the present invention , and further it is to be understood that such concepts are intended to be covered by the following claims unless these claims by their language expressly state otherwise . | 4 |
with reference to fig2 a wireless communication system 10 , such as a direct sequence code division multiple access ( ds - cdma ) digital radiotelephone system is provided . base transceiver stations ( btss ) 22 , 32 , 42 may communicate with mobile device 24 , operating within coverage area 20 , served by bts 22 . similarly , btss 22 , 32 , 42 may communicate with a mobile device 34 operating within coverage area 30 , served by bts 32 . btss have fixed locations , such locations chosen to provide overlapping coverage areas . btss 22 , 32 , 42 are coupled to a media access controller , such as a base station controller ( bsc ) 50 , which includes , among other things , a processor 52 and a memory 54 . the bsc 50 is , in turn , coupled to a mobile switching center ( msc ) 60 , also including , among other things , a processor 62 and a memory 64 . the bsc and msc operate according to well - known methods and are commercially available from motorola , inc . while the present invention is being described with respect to a wireless communication system , it is to be appreciated that it is applicable to any system in which a plurality of subscriber units compete for access to a shared media , such as an internet - based and / or ethernet - based system . multiple access wireless communication between bts &# 39 ; s 22 , 32 , 42 and mobile devices 24 , 34 , 44 occurs via radio frequency ( rf ) channels over which digital communication signals such as voice , data , and video are transmitted . base - to - mobile device communications are said to occur on a forward - link channel 70 , while mobile - to - base communications are referred to as being on a reverse - link channel 80 . a communication system using cdma channelization is described in detail in eia / tia standard is95 - b . as shown in fig2 a communication signal 70 is transmitted on an is - 95b forward - link channel , such as a paging channel or traffic channel from a bts , such as bts 32 to mobile device 34 . alternately , a communication signal 80 may be transmitted via an is - 95b reverse - link channel , such as an access channel or a traffic channel , by mobile device 34 to its source bts 32 . similarly , other mobile devices may receive and / or transmit communication signals with other base transceiver stations . with reference now to fig3 there is shown a simplified block diagram of an exemplary mobile subscriber unit or wireless device 24 , 34 , 44 . the wireless device 24 , 34 , 44 can be a telephone , a cable telephony interface device , a cellular or pcs radiotelephone , a cordless radiotelephone , a radio , a personal digital assistant ( pda ), a pager , a palm - top computer , a personal computer , etc . accordingly , as used herein , wireless device refers to each of these devices and their equivalents . the device 24 , 34 , 44 includes a transceiver 70 , transceiver antenna 72 , microprocessor - based controller 74 , memory 76 , keypad 78 , transducers 80 ( e . g . microphone , speaker ), an analog - to - digital converter 82 , and a processor 84 . the wireless device 24 , 34 , 44 is adapted to communicate ( i . e . transmit and receive communication signals such as data and voice ) over a public switched telephone network ( pstn ) via a cellular radiotelephone system , such as a cdma cellular radiotelephone system , global system for mobile communication ( gsm ) cellular radiotelephone system , etc . with reference now to fig4 there is shown a second simplified block diagram of an exemplary subscriber unit or wireless device 100 . the subscriber unit 100 can be a telephone , a cable telephony interface device , a cellular or pcs radiotelephone , a cordless radiotelephone , a radio , a personal digital assistant ( pda ), a pager , a palm - top computer , etc . accordingly , as used herein , subscriber unit or wireless device refers to each of these devices and their equivalents . in one embodiment of the present invention , the subscriber unit 100 , which includes a processor 110 and a controller 112 , periodically transmits an access message 120 on an access channel 130 to a base transceiver station ( bts ) 140 , which is controlled by a controller 150 . access messages may include unsolicited registrations , data burst messages , mobile originations , and the like . because of the sporadic nature of cellular traffic , access attempts often fail because there are a greater number of access attempts than available time slots ( fig1 ). in the case of a failed access attempt , the subscriber unit 100 keeps a count of failed access attempts over a given period of time . this data is stored in a subscriber unit memory 160 , which consists of a failed attempts memory 162 and a time period memory 164 . it is to be appreciated that access attempts consist of probe sequences executed by the subscriber unit 100 before successfully accessing the cdma cellular system . one skilled in the art will appreciate that cdma systems allow a mobile subscriber unit up to sixteen probe sequences before aborting its attempt to access . in one preferred embodiment , the access message 120 from the subscriber unit 100 contains two new data fields , namely , a number of failed attempts data field 122 and a time period data field 124 . in another embodiment , the subscriber unit 100 calculates a sliding average of failed access attempts per unit time and transmits this field to the bts 140 . it is to be appreciated that the failed attempts data field 122 and the time period data field 124 may be optional within the access message , allowing pre - existing subscriber units to co - exist with subscriber units employing the present invention . in other words , the functionality of the present invention is not lost in an environment in which legacy subscriber equipment co - exists with a statistically sufficient population of subscriber equipment employing the present invention . the system congestion data 122 , 124 , i . e . the failed attempts per unit time , is passed to the access controller 150 for processing . from this data , the controller 150 generates an array of access restriction values . in one embodiment , the controller computes a sliding average of failed access attempts per unit time and uses the sliding average as an index into a lookup table of access restriction values . in another embodiment , the controller calculates an array of access restriction values from the transmitted system congestion data 122 , 124 . in a preferred cdma system , the access restriction values consist of an array of psist or persistence values . as is discussed more fully below , psist values are broadcast to and used by the subscriber units within a given coverage area in the calculation of persistence delay values . those skilled in the art will appreciate that different psist values may be transmitted for different mobile overload classes . in other words , different psist values are broadcast to be used for different traffic components based on the observed number of access probe sequences before the access channel request is satisfied . once the controller 150 generates the access restriction values , an access parameters message 170 is broadcast on a paging channel 180 to all subscriber units within a given coverage area . artisans will appreciate that the access parameters message 170 defines the parameters used by the subscriber units transmitting to the bts 140 along the access channel 180 . within the access parameters message 170 is an access restriction values field 172 , which contains the array of access restriction values calculated by the controller 150 . with reference now to fig5 and continued reference to fig4 a method for accessing a bts is provided . in one embodiment , a subscriber unit 100 transmits an access message 120 to the bts 140 ( step 200 ). during the access process , i . e . the executing of one or more probe sequences , the subscriber unit 100 records the number of failed access attempts ( step 210 ) over a given period of time before successful access to the system . at step 220 , the subscriber unit transmits the failed attempt data to the bts . in one embodiment , the failed attempt data is transmitted within the access message . in an alternate embodiment , the failed attempt data is transmitted to the bts in a separate message . as is discussed above , the controller 150 receives the failed access attempt data and calculates an array of access restriction values that are broadcast continuously to all subscriber units within the given coverage area . these access restriction values are received ( step 230 ) by the subscriber unit . the access restriction values are used by the subscriber unit to perform one or more persistence tests ( step 250 ). more particularly , the subscriber unit generates a persistence delay ( pd ) value ( step 245 ) using the access restriction values . in a preferred embodiment , the subscriber unit receives an array of psist values , such as those provided in table 1 , which are used to compute the pd value in a conventional manner . in addition , the subscriber unit generates a pseudorandom backoff value ( step 240 ) in a conventional manner . the pd value ( step 245 ) and backoff value ( step 240 ) are used to perform the persistence test at step 250 . more particularly , the calculated persistence delay value is compared to the backoff value . if the pd value is less that the backoff value , the persistence test ( step 250 ) fails . if the persistence test fails , the subscriber unit waits until the next access slot and performs another persistence test . persistence tests are performed until the test is passed . if the pd value is less that the backoff value , the persistence test passes and the subscriber unit transmits an access message ( step 260 ) to the bts at relatively low power . as illustrated in table 1 , it is to be appreciated that the access restriction values that the subscriber unit receives from the controller controls the probability of the persistence test passing for any given access slot . the invention has been described with reference to the preferred embodiment . modifications and alterations will occur to others upon a reading and understanding of the preceding detailed description . it is intended that the invention be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof . | 7 |
the following detailed description of the invention refers to the accompanying drawings . while the description includes exemplary embodiments , other embodiments are possible , and changes may be made to the embodiments described without departing from the spirit and scope of the invention . fig2 describes the global architecture of an e - ticket reconciliation service ( ers ) according to the invention and the interactions with external components such as the penalty generator ( 230 ), the electronic ticketing server or ets ( 240 ) and the publisher ( 210 ). publisher is the component in charge of forwarding pnr &# 39 ; s that need to be analyzed by ers ( 220 ). pnr &# 39 ; s are sent under the form of standard messages ( 212 ) containing pnr images to ers service which extracts from them the proper information so that each newly received pnr can be checked to determine if a reconciliation is actually needed . to this end , in response to a standard request ( e - ticket display request / response ) issued by ers towards ets ( 240 ), corresponding ticket image ( 242 ) is also retrieved and forwarded to ers . once ers has got pnr and e - ticket images ( 221 , 222 ) it builds a matrix of links ( 250 ) between e - ticket orphan coupons and pnr orphan segments if any . matching is achieved , when possible , with the help of the exemplary matching algorithm further discussed in fig5 . fig3 shows the various kinds of link statuses considered by ers link matrix ( 250 ) of previous figure . they are as follows : if a link is already established ( 361 ), i . e ., if link that was created when e - ticket was first issued or re - issued is still valid nothing is to be done by ers . orphan links are found if a de - synchronization has been introduced between previously associated coupons and segments as a result of pnr changes or because pnr contains non - ticketed segments . hence , coupon has no corresponding segment ( 362 ) or segment has no corresponding coupon ( 363 ). it is the purpose of ers to repair those links . repaired linked have the corresponding status , i . e . : ‘ established by ers ’, after links were automatically revalidated or re - issued ( 364 ). fig4 is the flow chart of operations performed by ers while reconciliation of orphan segments and orphan coupons are being performed for each passenger of a pnr . as already mentioned in fig2 , publisher ( 210 ) that watches all transactions performed on a reservation database , triggers the reconciliation service through the sending of a message to ers , containing an image of the pnr , each time a reservation is changed . as also mentioned previously changes are traditionally made by travel agents on behalf of a customer but can be as well the result of changes requested directly from end - users of online travel applications . whichever their actual origin is , changes to be brought to a pnr can be of three sorts : a pnr air segment is either updated or cancelled or an air segment is added ( 410 ). if the airline concerned by the change has actually subscribed to the reconciliation service of the invention ( 415 ) a search of orphan flight segments is immediately undertaken ( 420 ) over the pnr . otherwise ( 471 ), no automatic reconciliation is attempted ( 470 ). typically , the e - ticket reconciliation service of the invention is provided by a gds , a provider of travel services as discussed in the background section , to which airline companies may have subscribed or not . if no orphan flight segments are found ( 472 ) no automatic reconciliation is necessary ( 470 ). otherwise , all corresponding e - tickets mentioned in reservation must be retrieved ( 425 ). this is achieved as previously described through the sending of a corresponding request ( display request ) to the electronic ticketing server ( 240 ) shown in fig2 which returns an image of requested e - tickets to ers . then , ers can search for orphan coupons in requested e - tickets ( 430 ). if none are found ( 473 ), no automatic reconciliation is further attempted ( 470 ). otherwise , matching between orphan segments and orphan coupons is undertaken ( 435 ). an example of the matching process is described in fig5 . various matching algorithms can however be applied depending on the particular applications of the invention . if , after matching process has been executed , no matching can however be found ( 474 ) no automatic reconciliation can be done ( 470 ). if matching segments and coupons can be found though , corresponding re - associations are performed so that pnr and e - tickets are updated ( 440 ). if errors ( 475 ) are however detected no automatic reconciliation is attempted ( 470 ). otherwise , if successful , and when applicable , penalties need to be calculated by the penalty generator ( 445 ) previously discussed in fig2 . penalties are attached to the reservation ( 450 ). then , changes in reservation are committed ( 455 ) and reservation history updated ( 460 ). as also already mentioned , depending on the importance of changes done in pnr and rules attached to the initial pnr fare , e - ticket will be just revalidated or re - issued thus affecting the amount of computed penalties to be attached to the reservation . inputs of penalty generator are thus obtained from step ( 440 ) so that it can generate and deliver the penalties attached to the reservation ( 450 ). fig5 describes , through an example , how matching process is performed by the electronic ticket reconciliation service ( ers ) of the invention between orphan segments of a pnr ( 510 ) and the orphan coupons ( 520 ) of corresponding e - ticket . in the process of matching orphan segments and coupons the chronological order of the coupons must always be maintained . this implies that a coupon cannot be re - associated with a segment unless its departure date is indeed comprised between the one of coupon immediately preceding and the date of coupon that immediately follows . a ‘ full matching ’ of coupon and segment is achieved if only their departure dates are different . a ‘ loose matching ’ is obtained if airline , flight number , flight date and / or class of service differ while airports stay the same , i . e ., are within the same city pair . obviously , ‘ full matching ’ get precedence over ‘ loose matching ’ when segment and coupons are re - associated by ers . in the example of fig5 the unassociated or orphan segments resulting of changes brought to pnr ( 510 ) are those indexed 2 and 4 to 7 ( 512 ). the corresponding unassociated or orphan coupons of ticket are at indexes 1 , 3 and 4 ( 522 ). the associated segment and coupon left is shown in bold characters ( 530 ). coupons are listed in successive order of their departure cities . hence , in ( 520 ), there are four coupons listed . the first one , at index 1 , corresponds to a coupon from frankfurt , germany ( city : code : fra ) to london , united kingdom ( city code : lon ). the second one , at index 2 , is from london to frankfurt and so on . the first step of the matching process is aimed at verifying that chronological order can be maintained after revalidation of e - ticket . this implies that , for a given orphan coupon , those of segments which would change the sequence of e - ticket coupons are invalidated . this is achieved as follows for each orphan coupon : find the first preceding coupon still associated with a segment . find the first following coupon still associated with a segment . then , initial list of candidate segments for current orphan coupon is strictly comprised of the segments between the first preceding and the first following associated segments . in example of fig5 , the orphan coupon at index 1 is still possibly in sequence with segment at index 2 because date attached to this segment ( 514 ) is 8 . this value being less than 14 , i . e ., the date of the non orphan coupon that immediately follows ( 524 ); it is indeed feasible to match the corresponding segment and coupon . the same remark applies to the orphan coupons at indexes 3 and 4 which could match any of the orphan segments at indexes 4 to 7 since their attached dates are greater than 14 , i . e ., the date of the non orphan coupon ( 524 ) that immediately precedes them . because segment and coupons must share the same city pairs the next step of the re - association process checks this property so that routes are actually matching ( different airports within the same city give a route matching ). for a given coupon , ers removes segments with different city pairs if any . the result of this step is a list of candidate segments for each coupon as shown in fig5 ( 540 ). in this example , coupon at index 1 ( 541 ) and segment at index 2 ( 542 ) share a same route noted fralon , the standard airline short notation for a flight route from frankfurt , germany to london , united kingdom as already discussed above . because coupon assumes passenger leaves on day 10 from frankfurt for london , i . e ., the departure city of next coupon ( 543 ), routes indeed match . the next orphan coupon at index 3 corresponds also to the same route ( fralon ) matching with segments at indexes 4 , 5 and 7 ( 544 ). finally , the route of last orphan coupon at index 4 is found to match with the route of segment at index 6 ( 545 ). once the above checking step of the re - association process is complete ers must elect only one candidate segment per orphan coupon . then , for each passenger , ers proceeds with each unassociated coupon left in chronological order as in the exemplary following sequence : if current coupon considered has only one possible candidate segment and that segment is the candidate of only one coupon it is elected . otherwise : ers looks for a coupon perfectly matching the current only possible candidate segment . if such a coupon is indeed found it is elected . otherwise : if there is no other coupon matching with any of the several candidate segments , then ers looks for a segment perfectly matching with current coupon . if found , this segment is elected . otherwise : as a consequence of the above sequence of processing steps , each time a segment is elected , i . e ., re - associated with an orphan coupon , the elected segment , and all preceding ones ( not yet - elected ), are no longer valid candidate segments ; thus , are not further considered . it must be however noticed here that the above sequence is intended to just be a simple example of how matching algorithm can be actually operated in the framework of the invention . depending on specific applications of the invention ; especially , depending on airline preferences , more sophisticated matching sequences may have to be considered so that algorithm is overall better adapted to fulfill the particular objectives considered when implementing the invention for a given application . above matching algorithm can be easily tailored while the overall mode of operation of the invention stays identical . as a result of this elective process shown through the particular example of fig5 ( 550 ) orphan coupon at index 1 ( 551 ), the first to be processed , has only one possible candidate segment ( 552 ) to be associated with . hence , ers elects this segment and re - associates it with current coupon . as mentioned above the just elected segment can no longer be a candidate segment for further re - associations . then , matching algorithm proceeds with next orphan coupon , i . e ., the one at index 3 ( 553 ). this coupon has two possible candidate segments at indexes 5 and 6 , hence the first chronological one is selected , i . e . : the one at index 5 . finally , the remaining orphan coupon at index 4 ( 554 ) is left with two possible segments to be re - associated with , i . e . : the ones at indexes 4 and 7 . however , as a result of having already elected segment at index 5 at previous step the one at index 4 is no longer a valid candidate and is eliminated ( 555 ). hence , ers elects segment at index 7 to be re - associated with last orphan coupon ( 554 ) which ends the re - association process . after segments and coupons have been eventually re - associated as a result of the building of the matrix of links ( 250 ) shown in fig2 and exemplary matching process just discussed above penalties to be paid by the passenger for the requested changes are possibly generated by the penalty generator ( 230 ) on the basis of a predefined set of rules . computed penalties will generally depend on the fact that ticket is just revalidated or need to be re - issued . decision of re - issuing or just revalidating the e - ticket may depend of the amount of requested changes and also of the fare and rules attached to the original ticket . in any case , result of penalty calculation is returned to ers under the form of a corresponding message ( 232 ) as shown in fig2 . | 6 |
embodiments of data - parallel / instruction - parallel processors disclosed herein may be employed as co - processors that execute compound vector operations as computation kernels compiled from a programming language . as shown in fig1 , a host cpu 101 executes the main application code in a data processing system . the host cpu 101 sends commands ( not shown ) to a data - parallel and / or instruction - parallel processor , referred to herein as a stream processor 103 . the commands issued by the host cpu 101 to the stream processor 103 , referred to herein as stream commands , instruct the stream processor 103 when to load and store instructions and data from an external memory into the stream processor &# 39 ; s 103 local instruction memory 107 and data memory 109 , respectively , and when to execute computation kernels ( described below ) to process this data . fig2 shows one embodiment of a stream processor 130 with 16 lanes , each having 5 arithmetic - logic units ( alu 0 - alu 4 , also referred to as function units ), and 1 communication ( comm ) unit per lane . a dpu ( data - parallel unit ) dispatcher 131 receives the stream commands from a host processor via port 111 . the dpu dispatcher 131 buffers the commands locally until they are ready to be issued to various execution units . descriptor registers are stored in a descriptor register file 169 and accessed by the dpu dispatcher 131 when commands are issued to the execution units . there are three main units for executing stream commands : an instruction fetch unit 161 , a stream load / store unit 143 , and a kernel execute unit that includes , in this example , a very - long - instruction word ( vliw ) sequencer 165 , scalar unit 150 , sixteen execution lanes 141 0 - 141 15 ( also referred to singularly and generically as lane 141 , or collectively as lanes 141 ), and inter - lane switch 135 . the instruction fetch unit 161 transfers code between an external memory ( not shown ) and a local instruction memory 163 via instruction memory port 108 . the stream load / store unit 143 transfers data between external memory and the lane register files 145 ( lrfs ) via data memory port 110 . during kernel - execute stream commands , the vliw sequencer 165 fetches vliw instructions from the instruction memory 163 and sends decoded instructions to the lanes 141 0 - 141 15 and the scalar unit 150 . the vliw sequencer 165 also controls instruction sequencing with branch instructions . each of the lanes 141 ( also referred to as execution lanes ) includes a lane register file ( lrf ) 145 for data memory , some number of function units ( alu 0 - alu 4 , in this example ) for executing arithmetic and data movement instructions , and a number of dedicated operand register files ( rf ) per function unit . a comm unit 142 in each lane 141 may access the inter - lane switch 135 to provide a mechanism to exchange data among the lanes 141 0 - 141 15 and between the scalar unit 150 and the lanes 141 0 - 141 15 . the lanes 141 0 - 141 15 receive vliw instructions from the vliw sequencer 165 and execute the same instruction each clock cycle on each lane in a single - instruction multiple - data ( simd ) fashion . within each lane 141 , the vliw instruction controls the configuration of the local switch 149 , the reading and writing of the operand register files ( rf ), the reading and writing of the lane register file 145 , and the operations being performed on each of the function units ( alus ). in order to support high - frequency execution , a multi - stage hardware pipeline can be used . a long pipeline enables the long latency of executing one vliw instruction on a highly parallel machine to be split up . the steps typically involved in execution of one instruction involve sending the instruction address from the vliw sequencer 165 , reading a vliw instruction from the instruction memory 163 , decoding the instruction , distributing it across a long distance to all of the lanes 141 0 - 141 15 , reading from the operand register files ( rf ), executing function unit operations specified by the vliw instruction , traversing the local switch 149 for writing back results , and finally writing results back into the operand register file ( rf ). in a highly - parallel high - frequency processor , this process often uses tens of cycles to fully execute a vliw instruction . in the stream processor 130 of fig2 , individual instruction execution may be pipelined in order to achieve high - frequency operation . one embodiment of this pipelining is shown in fig3 . the instruction fetch and decode stages , denoted by f 1 - f 4 and d 1 - d 3 respectively , split the reading of the instruction memory and instruction decode across seven total cycles . within each lane , the register read ( rr ) and individual operations in the alu ( x1 , x1 : x5 depending on operation latency ) can be pipelined . finally , a cross - cluster ( i . e , intra - lane ) and write - back stage can be used for traversing the local switch 149 and writing back to the operand register files ( rfs ). other embodiments can use more or fewer pipeline stages in order to trade off power dissipation for clock frequency . herein , “ kernel ” refers to a relatively small program that generally uses data in the lane register files 145 as input data , writes output data back to the lane register file 145 and also accepts scalar arguments from the host processor 101 through the dpu dispatcher 131 . kernels may be prevented from accessing external memory locations . also , in one embodiment , only addresses in the lane register file 145 associated with each lane 141 are addressable during kernel computation . communication between lane register files is explicitly handled in the kernel program by using the comm unit 142 . since there is a single shared vliw sequencer 165 , control flow decisions such as branches for supporting loops apply to all lanes 141 . the stream processor 130 of fig2 generally achieves highest performance efficiency when executing compound vector operations in kernel inner loops . compound vector operations perform a sequence of arithmetic operations on data read from the lane register file 145 , and generate results written back to the lane register file 145 . during compound vector operations , data is read and written from the lane register file 145 sequentially at very high bandwidth . kernel execution in a stream processor is not limited to the compound vector operation model . random or indexed access to streams in the lane register file 145 may be provided , for example , using register - plus - offset indexed addressing . with indexed streams , data in the lane register file 145 is not treated as sequential streams and is not pre - fetched or buffered separately , but more like a traditional vliw architecture with a load / store unit , access to the lane register file 145 data memory is done directly using explicit addresses . in this mode of operation the architecture has a disadvantage of longer - latency and lower - bandwidth access but the advantage of providing random access to the lane register file 145 during kernels . the communication unit ( comm ) within each lane 141 provides a simple interface to the inter - lane switch 135 , used to exchange data between the lanes 141 . the comm unit 142 can support arbitrary permutations on 8 - bit , 16 - bit , or 32 - bit data . in normal modes , permutation patterns are specified when each destination lane specifies dynamically from one of its operands which lane to get its source data from . in this way , static permutations can be easily supported . dynamic inter - lane communication patterns can also be supported if the source lane ( for example , lane 141 0 ) is dynamically computed on the destination lane ( for example , lane 141 15 ). in some applications , it may be desirable for the source lane , rather than the destination lane , to compute the destination dynamically . in contrast to prior - art data - parallel processing devices , the stream processor 130 of fig2 supports this type of source - lane destination computation . in one embodiment , a special instruction , permutation compute ( permcomp ), is implemented to manage this type of communication . when the permcomp instruction is encountered by the vliw sequencer 165 , a microcontroller 137 formed by the vliw sequencer 165 and scalar unit 150 takes in a request to send data from each of the 16 lanes 141 0 - 141 15 . each request is comprised of a destination lane and a valid bit . once the requests are collected by the microcontroller 137 from all the lanes 141 , the requests are then arbitrated . the originating lane ( or source lane , not shown due to the many possible permutations ) is sent a single bit ( success / no success ) to inform the originating lane whether or not it can successfully send data . each destination lane ( not shown ) to which valid data is directed is sent the source lane number and a valid signal . an unsuccessful send ( i . e , bit indicating no - success to source lane ) signals the source lane that a collision has occurred ( i . e , conflict within the inter - lane switch 135 ). this approach has several advantages : 1 ) supports efficient data communication among lanes even when communication pattern is non deterministic . 2 ) fast communication with lower overhead than a pure software approach . 3 ) centralized arbitration reduces hardware requirements for this instruction ( permcomp ). 4 ) deterministic instruction latency allows for efficient scheduling in the compiler ; pipelined so that it does not become a cycle time limiter . fig4 illustrates the above - described signaling between the microcontroller 137 , execution lanes 141 , and inter - lane switch 135 during execution of a permcomp instruction . as discussed , at the start of permcomp execution , the microcontroller 137 receives a destination lane identifier ( dest lane ) and corresponding valid signal ( valid ) from each lane , the valid signal indicating whether the lane is requesting to transfer data via the inter - lane switch 135 ( i . e , whether the lane is a source lane ) and the destination lane identifier specifies the lane to which data is directed . referring to fig5 , which illustrates operations of the microcontroller 137 during permcomp execution , the microcontroller 137 examines the request from all lanes ( 201 ), and then , as shown at 203 , sends the success / failure flag ( success / failure ) to each lane having valid data ( i . e , asserting the valid signal ) if the destination lane requested by the source lane was not requested by any other lane ( i . e , no conflicts with other lanes ). if two or more lanes having valid data specify the same destination lane ( decision block 205 ), then a conflict arises and the microcontroller 137 responds as shown at 207 by arbitrating between the conflicting requests ( 209 ), sending a success flag ( or signal ) to the arbitration winner ( 211 ) and sending a failure flag to each arbitration loser ( 213 ). in the embodiment of fig4 , each of execution lanes 141 0 - 141 15 controls the source of any transfer via the inter - lane switch 135 , for example , by providing a source - lane value ( src lane ) to a respective one of multiplexers 193 0 - 193 15 . accordingly , as shown at block 215 in fig5 , after success / failure flags have been sent to each requesting lane ( i . e ., as in block 203 for non - conflicting requests , and as in blocks 205 / 207 for conflicting requests ), the microcontroller 137 identifies the destination lanes for all successful requests ( i . e ., requests for which success flags are asserted ) and sends source lane information to each destination lane to enable the destination lane to control the source lane selection in the corresponding multiplexer 193 . note that in the embodiment shown , each of multiplexers 193 includes a respective input port coupled to each of sixteen communication lanes ( 194 ) within the inter - lane switch 135 , thus enabling each lane to receive data from any others of the lanes and also permitting a given source lane to transmit data to multiple destination lanes . in alternative embodiments , other switching structures may be used ( e . g ., programmable cross - bar ), including structures that permit less than all possible source lanes to transfer to a given destination lane and / or that limit the number of destination lanes to which a source lane may send data . with regard to arbitration between conflicting requests ( e . g ., as shown in fig5 at 209 ), any desirable arbitration policy may be applied to identify the arbitration winner . for example , in one embodiment , the microcontroller 137 may arbitrate between conflicting requests based on a fixed priority assigned to individual lanes ( e . g ., always selecting a lower - numbered lane over a higher - numbered lane , or vice - versa ). in other embodiments , a least - recently selected policy or other starvation - avoidance policy may be applied to ensure that no individual lane fails to receive at least some share of the inter - lane transfer bandwidth ( i . e , no requesting lane is repeatedly denied access to the inter - lane switch 135 (“ starving ”) due to sustained higher - priority requests ). moreover , in yet other embodiments , the stream processor 130 may support multiple arbitration policies , with one of the multiple different arbitration policies selected through run - time configuration register setting ( or one - time or otherwise non - volatile programming operation during device production ) or selected by a bit or bits within or associated with the permcomp instruction . each of the alus shown within the execution lanes 141 ( and / or scalar unit ) of fig2 supports a number of 3 - input - operand ( or less ) and 2 - output - operand ( or less ) operations for doing arithmetic and logical functions . signal , image , and video processing applications may use the following data - types packed into a 32 - bit word : some example operations supported by an alu to process this packed data are shown below : there are particular advantages to supporting a three - operand instruction as a basic operation in dsp applications . since many image , video , and signal processing computation kernels exhibit large amounts of instruction - level parallelism ( ilp ) and data - level parallelism ( dlp ) ( which can be converted into ilp via software pipelining or loop unrolling ), kernel performance is often limited by the available instruction throughput ( instructions per cycle ) and not by the latency through the critical path of a computation kernel . in these types of applications , if two common arithmetic functions are grouped together into a single operation at a small or negligible area cost ( and / or frequency penalty ), this tradeoff can result in higher overall performance . in contrast to the more limited support for combined arithmetic functions in typical prior - art dsps multiply - accumulate as described above ), each of the alus within the stream processor of fig2 may include a microarchitecture that enables a substantially broader combination of arithmetic functions , including combinations of operations that use the multiplier array where the partial result is added to an accumulator before the final result is computed are supported . more specifically , such combination operations may include , in addition to multiply - accumulate ( i . e , multiplications in which the multiplication result is added to an accumulator ): dot - products ( both real and complex ) where the result is added to an accumulator multiple simultaneous dot products on packed data with shifted data alignment in one operation full and partial sums between sub - words where the result is added to an accumulator pseudo - code expressions for specific examples of these combined - function operations are provided below ( with corresponding graphical representation as shown by example in fig6 a - 6h ), wherein the symbol “*” indicates multiplication , “ x ” and “ y ” are outputs from a given alu ( e . g ., x = accumulated sum , y = carry value ), and “ a ”, “ b ” and “ c ” are operands supplied to the alu ( e . g ., a and b may be multiplicands , and c an accumulated value to which the a * b product is to be added ): 4 - way multiply and add ( same output precision ) ( fig6 c ): 2 - way multiply and add ( same output precision ) ( fig6 d ): 4 - way multiply with double - precision output and add ( fig6 e ): 2 - way multiply with double - precision output and add ( fig6 f ): 2 - way 4 - element sum and add ( 8 - bit a , 8 - bit b , 16 - bit c ) ( fig6 h ): in all operations , by supplying a zero to the c input operand , each operation can be simplified to a multiply , dot - product , or sum . furthermore , depending on input and output data - types , these basic operations can be augmented to support saturation and clipping or rounding . an efficient alu micro - architecture is essential to support the above instruction set containing many variations of multiply , multiply add , dot product , and sum instructions mentioned above . variations include operand size differences ( 8 -, 16 -, 32 - bits ), and operand types ( signed , unsigned ). in some embodiments , to support this rich isa , a unique partitioning of wallace trees is provided , including four levels of alu components , as shown in fig7 . a first level of alu components includes four instances ( a , b , c , d ) of 16 × 8 booth encoded multipliers constructed of 5 : 2 wallace csa ( carry / sum adder ) arrays . the second level of alu components includes two instances ( ab , cd ) of 4 : 2 wallace csa arrays . the first array ( ab ) adds together the results of a and b . the second array ( cd ) adds together the results of c and d . at the input of the arrays is a multiplexer allowing one of the results to be shifted left by one byte . this allows the array to add data with equal bit weights ( for dot products ), or perform partial product accumulation for larger multiplies . the third level of alu components includes two separate 5 : 2 wallace array instances ( x , y ). these can combine different combinations of the ab and cd results along with a third operand , and create carry / sum results ready for a full propagate adder . the fourth level of alu components includes two full propagate adders , one to combine x &# 39 ; s carry / sum results , and one to add y &# 39 ; s carry / sum results . this adder can also be used for add instructions . repeating the pseudo code examples of combined - function operations provided above , and lining up references input operands a , b and c ( and outputs x and y ) to the operand inputs ( and operation results ) shown in fig7 , it can be seen that the foregoing pseudocode examples , and alu micro - architecture of fig7 carries out the following sub - operations in support of a given combined - function operation ( note that a ′, b ′, c ′, d ′, ab ′ and cd ′ reflect the outputs of like - designated wallace csa &# 39 ; s in carry / sum format ): a ′= sign_ext ( opa [ 7 : 0 ]* opb [ 7 : 0 ]) b ′= sign_ext ( opa [ 15 : 8 ]* opb [ 15 : 8 ]) c ′= sign_ext ( opa [ 23 : 16 ]* opb [ 23 : 16 ]) d ′= sign_ext ( opa [ 31 : 24 ]* opb [ 31 : 24 ]) ab ′= bypass cd ′= bypass x [ 0 ]= sat ( a ′+ opc [ 7 : 0 ]) ( note : block carries at byte boundary ) x [ 1 ]= sat ( b ′+ opc [ 15 : 8 ]) x [ 2 ]= sat ( c ′+ opc [ 23 : 16 ]) x [ 3 ]= sat ( d ′+ opc [ 31 : 24 ]) a ′= sign_ext ( opa [ 15 : 0 ]* opb [ 7 : 0 ]) b ′= sign_ext ( opa [ 15 : 0 ]* opb [ 15 : 8 ]) c ′= sign_ext ( opa [ 31 : 16 ]* opb [ 23 : 16 ]) d ′= sign_ext ( opa [ 31 : 16 ]* opb [ 31 : 24 ]) ab ′= sign_ext ( a ′+( b ′& lt ;& lt ; 8 )) cd ′= sign_ext ( c ′+( d ′& lt ;& lt ; 8 )) x [ 0 ]= sat ( ab ′[ 31 : 0 ]+ opc [ 15 : 0 ]) ( note : block carries at 16 - bit boundary ) x [ 1 ]= sat ( cd ′[ 31 : 0 ]+ opc [ 31 : 0 ]) a ′= sign_ext ( opa [ 7 : 0 ]* opb [ 7 : 0 ]) b ′= sign_ext ( opa [ 15 : 8 ]* opb [ 15 : 8 ]) c ′= sign_ext ( opa [ 23 : 16 ]* opb [ 23 : 16 ]) d ′= sign_ext ( opa [ 31 : 24 ]* opb [ 31 : 24 ]) ab ′= bypass cd ′= bypass x [ 0 ]= sign_ext ( a ′+ opc [ 7 : 0 ]) ( note : block carries at 16 - bit boundary ) x [ 1 ]= sign_ext ( b ′+ opc [ 15 : 8 ]) y [ 0 ]= sign_ext ( c ′+ opc [ 23 : 16 ]) y [ 2 ]= sign_ext ( d ′+ opc [ 31 : 24 ]) 2 - way 4 - element sum and add ( 8 - bit a , 8 - bit b , 16 - bit c ): a ′= sign_ext ( opa [ 15 : 0 ]* 1 ) b ′= sign_ext ( opa [ 31 : 16 ]* 1 ) c ′= sign_ext ( opb [ 15 : 0 * 1 ) d ′= sign_ext ( opb [ 31 : 16 ]* 1 ) ab ′= sign_ext ( a ′+ b ′) ( note : block carries at 16 - bit boundary ) cd ′= sign_ext ( c ′+ d ′) x [ 1 ]= sign_ext ( ab ′[ 1 ]+ cd ′[ 1 ]+ opc [ 31 : 16 ]) ( note : block carries at 16 - bit boundary ) x [ 0 ]= sign_ext ( ab ′[ 0 ]+ cd ′[ 0 ]+ opc [ 15 : 0 ]) within the foregoing sub - operations , the function “ sign ext ( )” effects a sign extension from m - bits to n - bits ( 16 bits to 32 bits in this example ). the function , “ sat ( )” returns a minimum or maximum m - bit 2 &# 39 ; s complement number if the function argument ( i . e , the input to the function ) exceeds the minimum or maximum of the m - bit 2 &# 39 ; s complement number , and otherwise returns the least significant m bits of the function argument . also , the terms , “ x2 ”, “ s ”, and “ a ” are booth encoded control signals . using radix - 4 booth encoding , for example , allows the number of partial product terms summed in the wallace tree to be reduced by roughly half . three consecutive bits of the multiplier are encoded to produce an x2 , a , s control value that is used , in turn , to choose a single partial product term . the next 3 bit window of multiplier bits overlaps the first window by one bit . the encoding is as follows : one programming model for a system that includes the stream processor of fig2 consists of a main instruction stream running on a host cpu and separate computation kernels that run on the stream processor . the host cpu dispatches stream commands for respective strips of data and loops over the data strips in order to sustain real - time operation . this dataflow is shown graphically in fig8 . referring again to fig2 , the stream load / store unit 143 executes memld ( memory load ) or memst ( memory store ) stream commands that transfer data between external memory and the lrfs . in many cases , stream commands process between tens and thousands of bytes of data at a time using memory access patterns provided with the command . more specifically , memory access patterns may be used to specify the address sequence for the data transferred during memlds and memsts . these access patterns are defined by an external memory base address , an external memory address sequence , and an lrf address sequence . base addresses are arbitrary byte addresses in external memory . the address sequence can be specified as a stride between subsequent records all at address offsets from the base address or as a sequent of indirect record offsets from a common base address . fig9 a provides an example of a stride of 7 with a record size of 3 , whereas fig9 b shows indirect offsets with a record size of 3 . more complicated addressing patterns are supported with nested strided patterns or a combination of strided and indirect patterns . for example , with 2 levels of nesting , contiguous 2d blocks of pixels from an image stored in row - major order could be fetched where an inner stride would correspond to the image width while the outer stride would correspond to the block width . an example of such multiple - level nesting is shown in fig1 . the external memory access patterns may be described using command arguments that specify record sizes and strides ( non - nested or nested ) in external memory . once data records are fetched from external memory and arranged into a linear sequence of records belonging to the stream to be loaded , the data in the stream needs to be divided up among the lanes . a simple example with a 4 - lane stream processor where each 3 - word record is sent to each lane is shown in table 1 below . with a more complex example , multiple words from a single record ( i . e , having record_size number of words ) could be spread out over multiple lanes ( i . e , lanes_per_record ). fig1 a and 11b illustrate retrieval of data and distribution of the retrieved data to lanes in accordance with the example of table 1 ( record_size = 3 , lanes_per_record = 1 , stride = 7 ) and in an example having multiple words from a single record spread out over multiple lanes ( e . g ., record_size = 4 , lanes_per_record = 2 , stride = 7 ), respectively . the partitioning of records among the lanes can be described with command arguments that indicate the number of words from the sequentially assembled stream to write to each lane before filling up words in the next lane ( e . g ., record_size and lanes_per_record ). for implementation simplicity , it is beneficial to hold the number of words per lane constant during the memld or memst command execution . further complicating the loading or storing of this data from external memory , modern dram memory systems have relatively long data burst lengths in order to operate at high bandwidth . dram bursts are multi - word reads or writes from external memory that can be as high as 8 or 16 words per access in a modern memory system . memory addresses sent to the dram access these 8 - word or 16 - word bursts , not individual bytes or words within the burst . consequently , in a dram memory system that issues bursts of 8 words ( for example ), reading the first four records ( 12 words ) of the stream in the example above ( i . e , described in reference to fig9 a ) actually may result in reading three dram bursts , as shown in fig1 . the stream load / store unit is capable of taking these external memory access patterns , record partitioning across the lrfs , and converting these into sequences of burst addresses and transferring individual words from those bursts to / from the lrfs . it should be noted that the above description of access patterns can be extended to arbitrary record lengths , strides , nested strides , and partitioning of records across lrfs . in addition , although the example above was given for a memld , it also applies to memst . the stream load / store unit subsystem handles all aspects of executing memlds and memsts . it assembles address sequences into bursts based on flexible memory access patterns , thereby eliminating redundant fetches of bursts from external memory . it also manages partitioning of streams across the lanes 310 0 - 310 15 . fig1 shows an embodiment of a memory subsystem capable of accepting memld or memst stream commands with various strided and indirect access patterns . the memory system subdivides stream commands into external memory bursts to one or more dram channels 302 and 303 , and writes the loaded data back into the lrfs . in the particular embodiment shown , the memory subsystem is composed of several key components : address generators accept stream commands and access patterns from the dpu dispatcher and compute sequences of burst address requests . each lane 310 contains a load and store interface for buffering data between the lrfs and the memory switch 305 . a memory switch 305 handles routing burst address requests and burst data between dram channels and the lanes 310 0 - 310 15 . an optional cache 304 eliminates redundant read requests to the same burst in external memory . during execution of a specific stream command , stream commands are sent from the dpu dispatcher to address generator 301 . the address generator parses the stream command to figure out a burst address sequence based on the memory access pattern . as individual address requests are sent to dram , the load or store interface in each lane 310 analyzes the current burst address request to determine if it has any data that belongs to its lrf partition corresponding to the current burst . during stores , if a lane 310 has data corresponding to that burst , the lane 310 sends its data out with the current burst . during loads , a recording of the corresponding burst is stored locally in each lane 310 so that when the return data is sent back from dram , the return data gets stored into the appropriate lrf ( i . e , as indicated by the record of the burst stored in each lane 310 ). still referring to fig1 , the memory switch 305 handles routing of address requests and data values between the address generator and lrfs with the cache 304 and external dram channels . in a system without a cache 304 , if the address requests are restricted to native request sizes supported by each dram channel , it eases implementation complexity . for example , if each dram channel supports up to 8 - word bursts , the address requests sent out by the address generators could directly correspond to 8 - word bursts and memory requests could be supplied directly to the dram channel . this approach has the disadvantage of potentially incurring redundant accesses of data , particularly with indirect modes . with indirect modes , if multiple offsets within a stream command access the same burst , then the address generator would end up sending redundant address requests to external memory . in a system with a cache 304 , the address requests made by the address generators are not limited to native dram requests and redundant accesses can be supported . for example , consider a situation where each dram channel supports 32 - byte bursts and the cache 304 contains a 32 - byte line size . if one indirect - mode access requests the lower 16 bytes from that burst for a data record , then that burst will be loaded into the cache 304 . if an access later in the stream accesses the upper 16 bytes to the same burst , instead of accessing external memory to re - fetch the data , the data can be read out of the cache 304 . a system with a cache 304 can also support address requests from the address generator to non - burst - aligned addresses . individual address requests to bursts of data can be converted by the cache 304 into multiple external dram requests . although the above embodiment of a stream load / store unit contains one load unit , one store unit , sixteen lanes and two dram channels , multiple load units , multiple store units , a different number of lanes , and more or fewer dram channels may be provided in alternative embodiments . fig1 illustrates an embodiment of the load interface 351 and store interface 353 to the lrf 145 within a given execution lane . the store interface 353 contains a tag generator 355 , a tag matching circuit 357 , and a data fifo 359 ( first - in - first - out storage circuit ). the load interface 351 contains a tag generator 365 , a tag fifo 367 , a tag matching circuit 369 for return data , and a return data fifo 371 . during both loads and stores , the tag generator ( 355 , 365 ) also parses the stream command to determine the word address sequence of all of the data elements in this lane during a memory load or store data transfer . note that this is different than the address generator burst address sequence since it also indicates the location of a word within a burst . for example , in a memory system with an 8 - word burst , the tag generator ( 355 , 365 ) indicates that a certain data element has a burst address and is in offset 3 of 8 within that burst . tags may be formed by a combination of a subset of the addresses and the lane number and just need to be large enough to avoid aliasing between data elements across the lanes . during stores , as each address is computed , a word is transferred from the lrf sb into the data fifo 359 . once enough words have been transferred into the data fifo to form the first address request , the address generator will send out an address request and a corresponding write tag . the tag matching circuit 357 analyzes the write tag . if any data elements from the current burst are in this lane &# 39 ; s data fifo 359 , the match circuit 357 will indicate that , and write data will be driven onto the bus to correspond to this address request . during loads , as each address is computed , an entry in the tag fifo 367 indicating that this lane register file needs a word from a specific burst is updated . once read requests return from either the cache or external dram , a read tag corresponding to the request is compared against the next tag in the tag fifo 367 . if any of the elements from the current burst correspond to words that belong in this lane &# 39 ; s lrf , then those data elements are written into the data fifo 371 . once enough data elements have been accumulated in the data fifos 371 across all of the lanes , then words can be transferred into the lrfs through the sbs . it should be noted that the various circuits disclosed herein may be described using computer aided design tools and expressed ( or represented ), as data and / or instructions embodied in various computer - readable media , in terms of their behavioral , register transfer , logic component , transistor , layout geometries , and / or other characteristics . formats of files and other objects in which such circuit expressions may be implemented include , but are not limited to , formats supporting behavioral languages such as c , verilog , and vhdl , formats supporting register level description languages like rtl , and formats supporting geometry description languages such as gdsii , gdsiii , gdsiv , cif , mebes and any other suitable formats and languages . computer - readable media in which such formatted data and / or instructions may be embodied include , but are not limited to , non - volatile storage media in various forms ( e . g ., optical , magnetic or semiconductor storage media ) and carrier waves that may be used to transfer such formatted data and / or instructions through wireless , optical , or wired signaling media or any combination thereof . examples of transfers of such formatted data and / or instructions by carrier waves include , but are not limited to , transfers ( uploads , downloads , email , etc .) over the internet and / or other computer networks via one or more data transfer protocols ( e . g ., http , ftp , smtp , etc .). when received within a computer system via one or more computer - readable media , such data and / or instruction - based expressions of the above described circuits may be processed by a processing entity ( e . g ., one or more processors ) within the computer system in conjunction with execution of one or more other computer programs including , without limitation , net - list generation programs , place and route programs and the like , to generate a representation or image of a physical manifestation of such circuits . such representation or image may thereafter be used in device fabrication , for example , by enabling generation of one or more masks that are used to form various components of the circuits in a device fabrication process . the section headings in the preceding detailed description are provided for convenience of reference only , and in no way define , limit , construe or describe the scope or extent of such sections . also , while the invention has been described with reference to specific embodiments thereof , it will be evident that various modifications and changes may be made thereto without departing from the broader spirit and scope of the invention . for example , features or aspects of any of the embodiments may be applied , at least where practicable , in combination with any other of the embodiments or in place of counterpart features or aspects thereof . accordingly , the specification and drawings are to be regarded in an illustrative rather than a restrictive sense . | 6 |
with first reference to fig1 there is shown the apparatus of the present invention 100 in isometric view with an auxiliary surgical device a being disposed through a trocar housing 10 concentrically receiving a sleeve cylindrical housing 21 . the trocar housing 10 is held in position for introduction into the body walls , such as an abdomen , for performance of surgical procedures , and is held in the position , as shown , in a surgeon &# 39 ; s hand h , between fingers f , with the surgeon &# 39 ; s thumb t controlling the movement of the auxiliary surgical device a or in the palm of the surgeon . the trocar housing 10 has a first open end 11 for insertion into the abdomen or other body wall ( prior to introduction of the auxiliary surgical device a through the trocar housing 10 ), and a second open end 12 through which is received the sleeve housing 21 , as shown . the trocar housing 10 has an internal diameter 13 . as shown in fig2 a sleeve assembly 20 includes a sleeve cylindrical housing 21 shown concentrically received through the internal diameter 13 of the trocar housing 10 . the sleeve cylindrical housing 21 has an outer diameter 22 ( fig4 ) smaller than the internal diameter 13 of the trocar housing 10 at the outboard most end of the sleeve cylindrical housing 21 is a cap portion 23 having an outer diameter larger than the diameter of the second open end 12 of the trocar housing 10 such that the inwardly facing face 23a of the cap port - ion 23 will come into abutting relationship with a companion frontal housing 23b of the trocar housing 10 when the sleeve cylindrical housing 21 is concentrically received within the trocar housing 10 to limit telescopic contraction of the sleeve housing 21 relative to the trocar housing 10 . means for selective securement 24 are provided to secure the sleeve cylindrical housing 21 relative to the trocar housing 10 in telescopically contracted position and includes a snap groove 24a profiled around the sleeve cylindrical housing 21 and providing inner and outer shoulders 24b , 24c for receipt of a latch head portion 24e of a circumferentially extending flexible latch finger or ring 24d circumscribed interiorly within the trocar housing 10 outer most end and interior of the frontal housing 23b . thus , as the sleeve cylindrical housing 21 is introduced into the trocar housing 10 , the flexible latch fingers 24d will be biased radially outwardly , somewhat , as they pass around the outer diameter 22 of the sleeve cylindrical housing 21 until such time as the latch head portions 24e come into alignment with the snap groove 24a , such alignment permitting the flexible latch finger or ring 24d to radially contract to its normal radius and flex inwardly within the groove 24a such that the interengagement of the latch head 24e relative to the shoulder 24b resists telescopic expansion of the sleeve housing 21 relative to the trocar housing 10 . additionally , the interrelationship between the shoulder 24c and the head 24e resists further telescopic contraction of the members 21 , 10 relative to one another ( alone or in combination with the contact of the face 23a on the frontal housing 23b ). now with reference to fig7 the sleeve cylindrical housing 21 is shown with its passageway 26 therein outwardly terminating an opening 27 . a first seal means is housed within the cap portion 23 and may be composed of an elastomeric or similar substance and is held in position within the cap portion 23 by means of a doughnut - shaped seal retainer 29 which , in turn , also secures within the cap portion 23 a second seal 34 . the first seal means 28 has a concave curvature 30 facing inwardly within the passageway 26 . a central slit 31 is provided in the first seal means 28 for defining first and second seal lips 32 , 33 ( fig6 ). the second seal means 34 has a small diameter opening 34a such that when a subsequent sleeve cylindrical housing 21 is introduced within the first housing 21 , as in fig6 the second seal means will sealingly engage around the exterior diameter of the second sleeve cylindrical housing 21 . of course , when no device is inserted within the sleeve cylindrical housing 21 , the first and second seal lips 32 , 33 will come into sealing contact with one another ( fig7 ) to prevent fluid communication across the passageway 26 . in some instances , it may not be necessary for a second or other subsequential sleeve cylindrical housing 21 to be latchingly secured within its sleeve housing 21 or the trocar housing 10 . in such instance , a contoured sealing surface 25 may be provided through the opening 27 by means of provision of a conically shaped ring profile 25a on the sleeve housing 21 just inboard of the cap portion 23 for receipt within a respectively bevelled or profiled seal groove element 25b on the cap portion 23 such that the interalignment between the members 25 , 25b will provide a relatively tight seal therebetween and will at least satisfactorily resist fluid flow therebetween from the interior of either the trocar housing 10 or the sleeve cylindrical housing 21 . when it is anticipated during a surgical procedure that a plurality of auxiliary surgical devices a will be utilized during the operation , the trocar housing 10 will be introduced into the body cavity such that the first open end 11 is placed therethrough . a sleeve housing 21 may be introduced into the trocar housing 10 prior to or subsequent to such introduction of the housing 10 into the body cavity . typically , the sleeve housing 21 will not have been previously introduced into the trocar housing 10 . after , for example , a trocar spike has been thrust through the housing 10 , it will be retrieved therefrom . a sleeve cylindrical housing 21 , as described , will be introduced through the second open end 12 of the trocar housing 10 until the latch fingers 24d are then placed within the groove 24a and the cap portion 23 encounters the face 23a . now , the first and second seal lips 32 , 33 will be sealingly engaged around the exterior of the sleeve cylindrical housing 21 and the housing 21 will be latchingly secured within the trocar housing 10 in telescopically retracted position . a deliberate , but slight pull by the surgeon through application of the fingers f onto the cap portion 23 will overcome the interengagement of the latch fingers 24d in the groove 24a to remove the sleeve cylindrical housing 21 from the trocar housing 10 , if and when desired . subsequent to introduction of the sleeve cylindrical housing 21 into the trocar housing 10 , as described , the apparatus 100 will be in position as shown in fig2 . now , the auxiliary surgical device a may be introduced through the cap portion 23 of the sleeve cylindrical housing 21 such that it travels through the opening 27 into the passageway 26 and out the first open end 11 of the trocar housing 10 into the body cavity ( fig1 ). subsequent to performing the surgical operating procedure with the auxiliary surgical device a as shown in fig . such device a may be retrieved from the interior of the sleeve cylindrical housing 21 and a second sleeve cylindrical housing 21 may be introduced through the first sleeve cylindrical housing 21 in similar fashion , as shown in fig3 and 5 . it will be appreciated that provision of the present apparatus 100 enables the trocar housing 10 which is originally utilized to always remain within the body wall during the entire surgical procedure , while permitting the trocar housing 10 to always be in sealed relation to prevent fluid communication therein between the exterior and the interior thereof , as well as through the respective sleeve cylindrical housings 21 . additionally , it is not necessary for the trocar housing 10 to be removed and a subsequent smaller internal diameter trocar housing reintroduced into the body cavity slit for introduction of second , smaller , auxiliary surgical devices a . although the invention has been described in terms of specified embodiments which are set forth in detail , it should be understood that this is by illustration only and that the invention is not necessarily limited thereto , since alternative embodiments and operating techniques will become apparent to those skilled in the art in view of the disclosure . accordingly , modificatins are contemplated which can be made without departing frm the spirit of the described invention . | 0 |
thus , as shown in fig1 one embodiment of a high output voltage amplifierincludes a transconductance stage 3 coupled to receive a differential inputsignal having low dc bias from input terminals 1 and 2 . an auto - biased voltage buffer stage 4 , is coupled between the transconductance stage 3 and an intermediate current - controlled voltage source stage 5 , whose output is coupled to a voltage - controlled interface stage 9 having a current output 14 and a voltage output 15 . the voltage output 15 is coupled to an input of a current sourcing stage 6 and the current output 14 is coupled to a current - controlled sinking stage 7 . outputs of the current sourcing stage 6 and the current - controlled sinking stage 7 are coupled together and to an output terminal 8 of the high output voltage amplifier . a low voltage source 12 is used to provide power for a transconductance amplifier 16 forming the transconductance stage 3 . the output of the transconductance amplifier 16 is coupled to an npn transistor 17 forming part of the buffer stage 4 , the base of the npn transistor 17 being coupled to a voltage divider network formed by resistors 18 and 19 coupledbetween a ground reference potential and a jfet 20 powered from a high voltage source 13 . the npn transistor 17 is coupled to a further jfet 21 to provide an output of the buffer stage 4 to a negative input of a transimpedance amplifier 22 , forming part of the intermediate stage 5 and whose positive input is coupled to the high voltage source 13 . the transimpedance amplifier 22 is powered from the high voltage source 13 andfrom a second low voltage source 11 . the output of the transimpedance amplifier 22 , forming the output of the intermediate stage 5 , is coupled , via a miller capacitor 10 , to the output terminal 8 to provide stability . the output of the intermediate stage 5 is also coupled to the interface stage 9 at the base of an emitter follower pnp transistor 23 , whose emitter is coupled to a current source 24 and whose collector is coupled to the low voltage source 11 . the emitter of transistor 23 is coupled to drive the base of a further emitter follower pnp transistor 25 , whose emitter provides the voltage output 15 of the interface stage 9 . a resistor 28 is coupled to the emitter of transistor 25 to polarize it and the collector of the transistor 25 is coupled to a ground reference potential via a zener diode 30 to prevent its breakdown . the emitter of transistor 23 is also coupled to the emitter of a further pnp transistor 26 forming a differential pair , the base of the transistor 26 being coupled to a reference voltage source 29 and the collector providing , via a zener diode 27 , the current output 14 of the interface stage 9 . the voltage output 15 of the interface stage 9 is used to control a sourcing pnp transistor 31 of the current sourcing stage 6 . the output of transistor 31 is passed to a complex pnp device 32 , powered from the low voltage source 11 , and which will be more fully described below with reference to fig2 to provide the output of the sourcing stage 6 . the current output 14 of the interface stage 9 is coupled to the sinking stage 7 where it controls an npn common emitter transistor 33 and is polarized by resistor 34 . the emitter of the sinking transistor 33 is coupled to ground reference potential while its collector is coupled to the emitter of an npn cascode transistor 35 , the base of which is coupled to the low voltage source 12 via a resistor 36 . the collector of transistor 35 is coupled to the source of a jfet 37 , the drain of which provides the output of the sinking stage 7 . a more detailed embodiment is shown in fig2 where identical elements to those of the embodiment shown in fig1 generally have the same reference numerals as in fig1 . in this embodiment , differential input terminals 1 and 2 are coupled respectively to the bases of transistors q50 and q51 of the transconductance stage 3 . their emitters , tied together and to a current source i1 from ground reference potential , form a differential pair which converts the voltage seen between input terminals 1 and 2 into an intermediate differential current at the collectors of transistors q50 and q51 . this differential current drives the emitters of pnp cascode transistors q52 and q53 , the bases of which are coupled to a reference voltage source 40 and the collectors of which provide a differential output current . this differential current drives two npn current mirrors constituted by npn transistor pairs q54 , q56 and q55 , q57 . the currents atthe collectors of transistors q56 and q57 provide the differential output current of the transconductance stage 3 . the whole stage is supplied by current sources i2 and i3 from a low voltage source 12 . the differential output currents from the transconductance stage 3 are coupled to the respective emitters of npn cascode transistors q45 and q46 of the buffer stage 4 . the collectors of transistors q45 and q46 are coupled respectively to the sources of two cascode jfet transistors q47 and q48 , the bases of which are grounded . the bases of transistors q45 andq46 are connected to a central node between resistors r9 and r10 forming anequal - voltage divider network , one end of which is connected to ground reference potential and the other end to the source of a jfet q49 . the drain of jfet q49 is coupled to the high voltage power source 13 and its gate is grounded . thus the resistor - divider network is driven by the jfet source . the bases of transistors q45 and q46 see thus half the value of the source to gate voltage ( v sg ) while their collectors see all of the voltage v sg . consequently , half the value of voltage v sg appears between the collectors and bases of the transistors q45 and q46 . this buffer stage may also be termed an auto - bias buffer stage because thevoltage v sg is equally distributed between the output transistors q56 and q57 of the transconductance stage 3 and the input transistors q45 and q46 of the buffer stage 4 . the differential output current of the buffer stage 4 is taken at the drains of the jfets q47 and q48 which constitute the voltage buffer between the transconductance stage and the intermediatestage 5 . although the voltage v sg of jfets is not well defined , in this case the maximum allowed value of voltage v sg does not exceed twice the npn collector - emitter breakdown voltage v ce . for a higher voltage v sg , a larger number of npn transistors can be used . consequently , the number of resistors in the divider network must be chosen appropriately . the high voltage source 13 forms part of a power supply 41 , which also includes the low voltage source 11 providing a differential reference voltage . the positive terminal of the latter is connected to the positive node of the high voltage source 13 and its negative terminal is used as a negative reference rail for the intermediate , the interface and the sourcing stages 5 , 9 and 6 . the intermediate stage 5 is composed of a wilson mirror and an emitter follower stage . the output current from the drain of the jfet q47 of the buffer stage 4 is coupled to the base of a pnp transistor q34 , the input of the wilson mirror . the wilson mirror is formed by connecting a pnp current mirror ( formed by transistors q35 , q36 and q37 ) between the emitter and the base of pnp transistor q34 . the pnp diode formed by transistor q37 is provided to balance the emitter - collector voltages of pnp transistors q35 and q36 . the output of the wilson mirror , the collector of transistor q34 , is coupled to the drain of jfet q48 . transistors q41 to q44 are used to clamp the collector of the pnp transistor q34 to a value less than its breakdown voltage , thus preventingit from breakdown . the implementation of npn diode q41 in series with the emitter of transistor q42 , and npn diodes q43 and q44 in series with the collector of transistor q42 protects transistor q42 from breakdown . the combination of the two currents coming from the collector of transistorq34 and the drain of jfet q48 produces a single ended output current i . this output current i drives the base of an emitter follower npn transistor q38 , the emitter of which is supplied by a current source sinking from the collector of an npn transistor q39 . the base of transistor q39 is connected to the anode of an npn diode q40 and its emitter , together with the cathode of diode q40 , is connected to the negative terminal of the second low voltage source 11 . a current source i4supplied from the high voltage source 13 and applied to the anode of diode q40 , is mirrored by npn current source transistors q39 and q25 . the output terminal 47 of this intermediate stage 5 is taken at the emitterof transistor q38 . the emitter of npn transistor q38 is coupled to the baseof a pnp transistor q17 forming part of the interface stage 9 . the transistor q17 functions as an emitter follower supplied with a current from current source i5 from the high voltage source 13 and having a current limiting resistor r8 connected between its collector and the negative terminal of the low voltage source 11 . the emitter of transistor q17 drives the base of another pnp emitter follower transistor q19 which , in its turn , drives the base of a pnp output transistor q1 ( equivalent to the sourcing transistor 31 of fig1 ) forming part of the sourcing stage 6 . the purpose of the two cascaded emitter followers q17 and q19 , used in this interface stage 9 , is to provide voltage control of the pnp output sourcing transistor q1 . the advantage of this method is that it provides aconvenient way to obtain stability . a resistor r7 , shunted between the emitter and the base of transistor q1 is used to polarize the pnp transistor q19 . the pnp transistor q17 also forms a differential pair together with a pnp transistor q18 , the base of which is coupled to the emitter of a pnp transistor q20 having a reference voltage . this reference voltage , provided by pnp transistors q20 , q21 , q22 , q23 and q24 , is supplied by a current sink from the collector of the npn transistor q25 . the collector of each of the pnp transistors q18 and q19 is respectively coupled to ground via four zener diodes q26 , q28 , q30 , q32 and q27 , q29 , q31 , q33 , respectively , which can be npn transistors wired in a zener configuration , to prevent breakdown of the transistors q18 and q19 . the number of zener diodes used depends on the value of the high voltage source 13 and the emitter - collector breakdown voltage of the pnp transistors q18 and q19 . the current at the collector of transistor q18 has the opposite sign to the collector current of the pnp transistor q19 and is used to drive a sinking npn transistor q14 ( equivalent to transistor 33 of fig1 ) formingpart of the sinking stage . the intermediate stage 5 , together with the interface stage 9 , is similar to that described in u . s . pat . no . 5 , 021 , 746 . the current from the collector of the pnp transistor q18 passes through thefour zener diodes q26 , q28 , q30 , q32 and reaches the current - controlled sinking stage 7 at the base of the npn output sinking transistor q14 , which is connected in a common - emitter configuration . a resistor r0 ( equivalent to resistor 34 in fig1 ) is used to polarize transistor q18 . the emitter of transistor q14 is grounded while its collector is coupled to the emitter of an npn cascode transistor q15 . the base of transistor q15 is coupled to the low voltage source 12 via resistor r6 which allows the npn transistor q15 to go into saturation . the collector of transistor q15 is connected to the source of a jfet q16 , the drain of which is coupled to the output terminal 8 . this jfet q16 functions as a voltage buffer . the low impedance voltage , from the emitter of the pnp transistor q19 of the interface stage 9 , is applied to the base of the pnp output sourcing transistor q1 . this transistor functions as a transconductance amplifier and produces a current i6 at its collector . the current i6 flows into the emitter of a pnp transistor q2 whose collector is connected to the emitterof another pnp transistor q3 . in this manner , transistors q2 and q3 together pass current 16 to the output terminal 8 into a current i0 . current i0 sources a current to the load , thus creating a voltage v 0 relative to ground reference . the cathode of a diode q4 ( a pnp transistor configured in diode mode ) is connected to the output terminal 8 , the anode of which is connected to oneend of a voltage divider network formed of three equal resistors r1 , r2 andr3 . the other end 41 of the voltage divider network is connected , via threecascaded diodes q5 , q6 and q7 ( npn transistors configured in diode mode ), to the high voltage source 13 . consequently , the voltage drops across the three resistors are equal to : where v cc is the supply voltage from the high voltage source 13 , v 0 is the output voltage and v be is the base - emitter voltage drop of the diodes . fig3 shows the voltages at various nodes in the circuit . in particular , curve 51 represents the supply voltage v cc from the high voltage source 13 , curve 52 represents the difference of the voltages at the inputterminals 1 and 2 , and curve 53 represents the output voltage v 0 . curves 54 and 55 represent the voltages at nodes 42 and 43 , respectively , of the voltage divider network . curves 56 and 57 represent the voltages atnodes 44 , between transistors q1 and q2 , and 45 , between transistors q2 andq3 , respectively , and curve 59 represents the voltage at the output terminal 47 of the intermediate stage 5 . the two centre nodes 42 and 43 of the voltage divider network are connectedrespectively to the bases of pnp transistors q8 and q9 . the emitter of transistor q8 is coupled to the base of transistor q10 to form a darlington transistor pair . in the same manner , transistors q9 and q11 form another pnp darlington transistor pair , which is cascaded with the previous pnp darlington transistor pair by connecting the respective emitters to the collectors of transistors q8 and q10 . the outputs of thesecascaded pnp darlington pairs , taken at the emitters of transistors q10 andq11 , drive the bases of the pnp transistors q2 and q3 . the remaining collectors of transistors q9 and q11 are connected to the anode of the pnpdiode q4 to complete the loop . resistors r4 and r5 , connected respectively to the emitter - base junctions of transistors q10 and q2 , are used to polarize the cascaded darlington transistor pairs . thus , the voltage dropsacross resistors r3 , r2 and r1 are passed to the pnp transistors q1 , q2 andq3 , respectively . in this way , the voltage seen from the emitter to the collector of each pnp is equal to : when v 0 is equal to zero , the drops reach their maximum of ( v cc - 4v be )/ 3 . thus , in such a scheme approximately three times the pnp emitter - collector breakdown voltage can be dealt with . of course , a highernumber of pnp transistors could be chosen to enlarge the voltage capability . in this embodiment , the number three is chosen to ensure the local stability of the pnp darlington transistor pairs . the cascaded darlington pnp transistors q8 to q11 are used to boost the current to the load . devices q5 to q11 and r1 to r5 together form a control circuit , the input of which is taken at the anode of pnp diode q4 . such a circuit has a largevoltage drop between v cc and the output terminal 8 . this situation is undesirable , so a clamp circuit is implemented to eliminate this problem . this clamp circuit is composed of a pnp transistor q13 and a pnp diode q12 , the cathode of the latter being connected to the emitter of the former . the base of transistor q13 is then coupled to the high voltage source 13 via the low voltage source 11 and its collector is grounded via the three zener diodes q29 , q31 , q33 . as shown in fig3 when the output voltage v 0 increases beyond the threshold voltage v th equal to ( v cc - v ref + v be ), wherev ref is the voltage from the low voltage source 11 , the clamp circuit operates to anchor the anode of the diode q4 to ( v th + v be ), thenturns it off and disconnects the output terminal 8 from the control circuit . this releases the output terminal 8 , at which the voltage starts to increase until the pnp transistor q3 reaches saturation . curve 58 in fig3 represents the voltage at node 46 at the anode of diode q4 . the threshold voltage v th is chosen such that when the pnp transistor q1 starts to saturate , the clamping function begins to operate , as shown in fig3 between lines 49 and 50 . this is the optimal value of v th , butv th must be 100 mv lower to ensure the off condition of transistor q4 . the voltage between the emitter and the collector of transistor q2 is equalto the saturation voltage v sat of transistor q1 plus r2 . i b , wherer2 is the resistance value of resistor r2 and i b is the base current of q8 . the total output voltage drop is equal to : the bias current at the output branch ( consisting of transistors q1 , q2 , q3 , q14 , q15 and jfet q16 ) of the amplifier is governed by the equality between the junction voltages of transistors q21 , q22 , q23 and q18 , q19 , q1 . finally , to insure the overall stability , a miller capacitor 10 is coupled between the output terminal 8 and the base of the npn transistor q38 of the intermediate stage to compensate the amplifier frequency phase shift . it will be appreciated that although only two particular embodiments of theinvention have been described in detail , various modifications and improvements can be made by a person skilled in the art without departing from the scope of the present invention . | 7 |
as used herein , the term “ powder ” is defined as a dry , bulk solid composed of a large number of fine particles that may flow freely when shaken or tilted . as used herein , the term “ iron - based powder ” is defined as a powder , the particles of which comprise at least 99 wt % of iron . the iron - based powder may be a pure iron powder , the particles of which having a low content of contaminants such as carbon or oxygen . the iron content of the particles is preferably above 99 . 0 % by weight , however it may also be possible to utilise iron - based powder alloyed with e . g . silicon , phosphorus , or nickel . for a pure iron - based powder , or for an iron - based powder , the particles of which being alloyed with intentionally added alloying elements , the powders contain besides iron and possible present alloying elements , trace elements resulting from inevitable impurities caused by the method of production . trace elements are present in such a small amount that they do not influence the properties of the material . the choice of particle size of the iron - based powder is determined by the intended use , i . e . which frequency the component is suited for . the mean particle size of the iron - based powder , which is also roughly the mean size of the coated powder as the coating is very thin , may be between 20 to 300 μm . examples of mean particle sizes for suitable iron - based powders are e . g . 20 - 80 μm , a so called 200 mesh powder , 70 - 130 μm , a 100 mesh powder , or 130 - 250 μm , a 40 mesh powder . the method used for determining the particle size is by laser diffractometry according to standard iso 13320 - 1 : 1999 . the iron - based particles are coated by a phosphorous containing coating in addition to the clay coating . the phosphorous containing coating is the first layer . the phosphorous containing coating , which is normally applied to the bare iron - based powder , may be applied according to the methods described in u . s . pat . no . 6 , 348 , 265 . briefly , the iron or iron - based powder is mixed with phosphoric acid dissolved in a solvent such as acetone , followed by drying in order to obtain a thin phosphorous and oxygen containing coating on the powder . the amount of added solution depends inter alia on the particle size of the powder ; however , the amount shall preferably be sufficient in order to obtain a coating having a thickness between 20 and 300 nm . the concentration of the phosphoric acid should be between 1 and 5 % and may be sprayed onto the iron particles , or mixed in batch , using a phosphoric acid solution as above . alternatively , it is possible to add a thin phosphorous containing coating by mixing an iron - based powder with a solution of ammonium phosphate dissolved in water or using other combinations of phosphorous containing substances and other solvents . the resulting phosphorous containing coating i . e . the first layer , preferably makes up only a small proportion of the weight of the coated iron - based powder . in particular , the phosphorus containing coating preferably accounts for between 0 . 01 and 0 . 15 % of the total weight of the iron based powder according to the present invention ( i . e . with both first and second layers ). the clay layer is applied to the iron particles by mixing the powder particles with a clay according to the invention . in more detail , the second layer comprising the alkaline silicate and clay coating is applied after the first layer has been applied , i . e . to the phosphorous coated iron - based powder . the second layer can be applied by mixing the phosphorus coated iron - based powder with particles of a clay or a mixture of clays having the claimed small particle size and a water soluble alkaline silicate , commonly known as water glass . this is usually followed by a drying step at a temperature between 20 - 250 ° c . or in vacuum . the clay particles preferably display a high weight loss during heat induced dehydroxylation . the weight loss during heat induced dehydroxylation can be determined by using thermogravimetric analysis ( tga ). tga can be measured using a jupiter sta 449 f3 from netzsch scandinavia ( 21121 malmö , sweden ). the procedure of the analysis is as follows ; the pure clay sample is weighed ( 5 mg ) and then placed in the sample holder . the sample and reference are heated at a rate of 10 ° c ./ min up to 1100 ° c . in nitrogen gas . the weight of the sample is continuously monitored as the sample is heated . the weight loss in the temperature range 240 - 730 ° c . is taken as the weight decrease during dehydroxylation of the clay . for each sample a duplicate measurement is performed . preferably , the weight decrease during dehydroxylation is above 12 wt %, more preferably above 13 wt %, or even more preferably above 14 wt %, i . e . the weight loss observed in the 240 - 750 ° c . temperature range exceeds 12 , 13 , or 14 wt %, respectively . in accordance with the invention , the advantages of the invention are achieved when the clay particles are relatively small , i . e . in the size range of from 0 . 1 μm to 0 . 4 μm , or preferably from 0 . 1 μm to 0 . 3 μm . most preferably , the clay particle size is about 0 . 3 μm . these advantages are clearly shown by the examples , and illustrated in fig2 and 3 , where the samples with a clay particle size according to the invention show improved % trs increase compared to sample where the particle size of the clay is larger . the other properties are also improved as shown in table 1 in the examples . the particle size of the clay particles is determined by analytical centrifuge analysis and are d 50 values , i . e . 50 % of the particles are smaller than the d 50 value . in more detail , the particle size distribution of the clay particles is determined by analytical centrifuge analysis , using a lumisizer from teamator ( 250 23 helsingborg , sweden ), according to standards iso13318 - 1 and iso13318 - 2 . all reference to clay mean a clay mineral . clay minerals are hydrous aluminium phyllosilicates , sometimes with variable proportions to iron , magnesium , alkali metals , alkali metal earth metals , and other cations . the clay of the present invention therefore contains a phyllosilicate . examples of clays that are suitable for use in the present invention include kaolin , ball clays , fire clays , stoneware clay and earthenware clay . these types of clay are well known to the skilled person . the clay is preferably kaolin . the amount of clay containing defined phyllosilcates to be mixed with the coated iron - based powder shall preferably be between 0 . 2 - 5 %, preferably between 0 . 5 - 4 %, by weight of the coated composite iron - based powder . the amount of alkaline silicate calculated as solid alkaline silicate to be mixed with the phosphorous coated iron - based powder shall preferably be between 0 . 1 - 0 . 9 % by weight of the coated composite iron - based powder , preferably between 0 . 2 - 0 . 8 % by weight of the coated iron - based powder . it has been shown that various types of water soluble alkaline silicates can be used , thus sodium , potassium and lithium silicate can be used . before compaction , the coated composite iron - based powder may be mixed with a suitable organic lubricant such as a wax , an oligomer or a polymer , a fatty acid based derivate or combinations thereof . examples of suitable lubricants are ebs , i . e . ethylene bisstearamide , kenolube ® available from höganäs ab , sweden , metal stearates such as zinc stearate or fatty acids or other derivates thereof . the lubricant may be added in an amount of 0 . 05 - 1 . 5 % of the total mixture , preferably between 0 . 1 - 1 . 2 % by weight . compaction may be performed at a compaction pressure of 400 - 1200 mpa at ambient or elevated temperature . after compaction , the compacted components are subjected to heat treatment at a temperature up to 700 ° c ., preferably between 500 - 690 ° c . examples of suitable atmospheres at heat treatment are inert atmosphere such as nitrogen or argon or oxidizing atmospheres such as air . the following examples are intended to illustrate particular embodiments and not to limit the scope of the invention . the particle size distribution of the clay particles was determined by analytical centrifuge analysis , using a lumisizer from teamator ( 250 23 helsingborg , sweden ), according to standards iso13318 - 1 and iso13318 - 2 . samples were dispersed in a 20 mm nacl solution to a final concentration of 0 . 2 wt % or 0 . 4 wt % to reach an initial transmission of about 30 %. for each sample a duplicate measurement was performed . measurement was performed at + 7 ° c . with a speed ramp from 300 rpm to 4000 rpm . particle sizes were as shown in the thermal characteristics of the clay samples were determined by tga , using a jupiter sta 449 f3 from netzsch scandinavia ( 21121 malmö , sweden ). the procedure of the analysis was as follows ; the pure clay sample was weighed ( 5 mg ) and then placed in the sample holder . the sample and reference was heated a rate of 10 ° c ./ min up to 1100 ° c . in nitrogen gas . the weight of the sample was continuously monitored as the sample was heated . the weight loss in the temperature range 240 - 730 ° c . was taken as the weight decrease during dehydroxylation of the clay . for each sample a duplicate measurement was performed . the relative weight decrease due to dehydroxylation is listed in table 1 . samples of 1 kg of the powder asm200100 . 30 , a water atomized iron powder which has an iron content above 99 . 5 % by weight , and which is commercially available from höganäs aft sweden , were used . the powder particles were treated with a phosphorous containing solution according to wo2008 / 069749 . briefly , the coating solution was prepared by dissolving 20 ml of 85 % weight of phosphoric acid in 1 000 ml of acetone , and 30 ml of acetone solution was used per 1000 gram of powder . after mixing the phosphoric acid solution with the metal powder , the mixture was allowed to dry . a chemical analysis of the samples disclosed that the oxygen content of the powder obtained by using the aqueous solution was above 0 . 2 % higher than in the base powder , whereas the oxygen content of the powder obtained by using the process according to the invention had an oxygen content less then 0 . 2 % higher then that of the base powder . an aes analysis of the samples showed an oxide thickness below 100 nm for all the samples . the mean particle size of the iron - powder was about 45 μm as determined by laser diffractometry as in iso 13320 - 1 . the iron - powder was treated with a phosphorous containing solution according to u . s . pat . no . 6 , 348 , 265 , and water glass at an amount of 0 . 6 % by weight . the obtained dry phosphorous coated iron powder was further mixed with a clay according to the invention , or comparative examples , in varying amounts according to table 1 . after drying at 120 ° c . for 1 hour in order to obtain a dry powder , the powder was mixed with 0 . 6 % kenolube ® and compacted at 800 mpa into rings with an inner diameter of 45 mm , an outer diameter of 55 mm and a height of 5 mm . the compacted components were thereafter subjected to a heat treatment process at 530 ° c . or at 650 ° c . in a nitrogen atmosphere for 0 . 5 hours . the transverse rupture strength ( trs ) of the sintered components was assessed according to the iso 3325 : 1996 standard . a 6 mm thick test piece resting on two supports was broken by the application of a load at the midpoint between the supports under short - term static loading conditions . the trs values were as shown in table 1 . the resulting samples from example 3 were compacted at 800 mpa or 1100 mpa into rings with an inner diameter of 45 mm , an outer diameter of 55 mm and a height of 5 mm . the compacted components were thereafter subjected to a heat treatment process at 650 ° c . in a nitrogen atmosphere for 30 minutes . results are shown in table 1 . the specific resistivities of the obtained samples were measured by a four point measurement . for maximum permeability , μ max , and coercivity measurements the rings were “ wired ” with 100 turns for the primary circuit and 100 turns for the secondary circuit enabling measurements of magnetic properties with the aid of a hysteresisgraph , brockhaus mpg 200 . for core loss the rings were “ wired ” with 100 turns for the primary circuit and 30 turns for the secondary circuit with the aid of walker scientific inc . amh - 401pod instrument . coercivity was shown to be acceptable . | 1 |
the present invention relates to emulsion compositions and methods for preparing these emulsion compositions which employ amphipathic emulsifying agents and high shear polymeric emulsion techniques ( hspe ). the oil - in - water emulsion compositions of the present invention are highly substantive , safe , stable , and economical products . the emulsifying agents which may be used in the present invention exhibit amphipathic properties and are capable of primary emulsification of oil - in - water emulsions . the emulsifiers should be capable of rapidly inverting or de - emulsifying the emulsion to form an oil film upon application to the skin . the emulsifying agents which are useful in the present invention include carbopol ( carbomer ) 940 , carbopol 934 , carbopol 941 , carbopol 1342 and gulf polymer p18 ( octadecene / maleic anhydride copolymer ) and combinations thereof . other useful emulsifying agents include c 12 - c 22 alkyl - substituted acrylic acid copolymers , either alone or in combination with the above emulsifying agents , where the alkyl group is lauric , myristic , palmitic , stearic , oleic , linolenic or isostearic . still other useful emulsifying agents , either alone or in combination with the above emulsifying agents , include stearyl ether / maleic anhydride copolymers ( gantroz an - 8194 ) and allyl stearate / valeric anhydride copolymer ( mexomere pg ). the emulsifying agents which are useful in the present invention may be present in the range of from about 0 . 02 % to about 2 . 0 %, and preferably from about 0 . 8 % to about 1 . 4 %, by weight of the emulsion composition . the oils ( emollients or barrier aids ) which are useful in the present invention include dimethicone ( dow corning 200 fluids ), dimethicone and trimethylsiloxysilicate ( dow corning 593 fluid ), phenyl dimethicone ( dow corning 556 fluid ), stearoxy dimethicone ( sws 755 wax ), cyclomethicone ( dow corning 344 or 345 fluid , union carbide 7158 fluid , ge sf1173 , 1202 or 1204 , ganex u216 or u220 ), cyclomethicone and dimethicone ( dow corning x2 - 1401 ) and dimethicone ( ge se30 , 76 gums , ultra high molecular weight dimethicone , greater than 1 , 000 , 000 centistokes ( cs )) or combinations thereof . the oils which are useful in the present invention may be present in the range of from about 3 . 0 to about 40 %, and preferably from about 27 % to about 33 %, by weight of the emulsion composition . the emulsion compositions of the present invention are subjected to high shear polymeric emulsion forces . a turbine mixer and in - line homogenizer utilizing tandem rotor - stators ( two turbines and mating stators in tandem on a single shaft ) may be used for in - line continuous high - speed high - shear homogenizing - mixing , emulsifying and rapid dispersing . shaft - rotor speeds in the range of about 5 , 000 to about 15 , 000 may be used . a shaft - rotor speed of about 10 , 000 rpm is preferred . optional ingredients which may be used in the present invention include preservatives , antifungal agents , skin protectants , moistening / humectant agents , ph adjusters , powders and the like . the preservatives which may be used in the present invention include quaternium 15 ( dowicil 200 ), methyl paraben ( tegosept m ), propyl paraben ( tegosept p ), dhdm hydantoin ( glydant ), benzyl alcohol , methylchloroisothiazolinone and methylisothiazolinone ( kathon cg ), butyl paraben ( tegosept b ), imidazolidinyl urea ( germall 115 ), diazolidinyl ( germall ii ), and sequestrene no . 2 , no . 3 or no . 4 ( disodium edta , trisodium edta , tetrasodium edta , respectively ). the antifungal agents which may be used in the present invention include chlorobenzyl alcohol ( myacide sp ), mycostatin ( nystatin ), miconazole ( ohasept extra ), parachloro meta zylenol , undecyclenic acid , calcium undecyclenate and zinc undecyclenate . the skin protectants which may be used in the present invention include allantoin , zinc carbonate , zinc oxide , zinc acetate , cocoa butter , shark liver oil , kaolin , calamine , aluminum hydroxide gel and glycerin . the moistening / humectant agents which may be used in the present invention include glycerin , propylene glycol , peg 8 ( carbowax 400 ), sorbitol ( sorbo 70 %), polyglyceryl methacrylate and propylene glycol ( lubrajel ), proline and sodium pca ( agidew nso ). the agents which may be used to adjust ph in the present invention include triethanolamine ( tea , quadrox ), sodium hydroxide , potassium hydroxide , citric acid , lactic acid , glucamine ( desamine ) and arginine . the powders which may be used in the present invention include cornstarch , rice starch , talc , mica , starch modified polyacrylic acid , nylon powder , silicone treated nylon and silicon treated talc . a preferred emulsion composition comprises silicone 200 ( 350 cs and 1 , 000 cs ) ( 5 %), carbopol 1342 ( 0 . 15 %), kathon cg ( 0 . 10 %), 99 % triethanolamine ( 0 . 20 %), and sequestrene no . 2 ( 0 . 10 %) in water ( about 95 %). the emulsion compositions of the present invention may be applied with a wipe by impregnating or otherwise contacting the emulsion composition with a web which may be a cellulosic wipe . oil in water emulsion compositions prepared with amphipathic emulsifiers and subjected to high shear polymeric emulsification have advantages over emulsion compositions prepared using conventional techniques which include the following : 1 . emulsion compositions of the present invention de - emulsify when applied to the skin helping to increase the substantivity , or wash resistance , of the composition on the skin . this resulting protective substantive barrier significantly reduces wet and dry skin friction and protects the skin against the irritating effects of chemicals . de - emulsification of the compositions also results in a pleasant feel on the skin . 2 . emulsion compositions of the present invention may be prepared in a highly concentrated form resulting in significant cost advantage . the emulsion compositions may be prepared as a 10 - fold concentrate and then diluted with water using low shear processing equipment to complete preparation of the composition . both the emulsion concentrate and the diluted formula were found to be stable at 48 ° c ., 25 ° c ., 4 ° c . and - 15 ° c . for over one month . such emulsion stability is extremely difficult to achieve with compositions prepared by conventional emulsion technology , especially for lotions with viscosity less than 100 cps . 3 . emulsion compositions of the present invention require only very low concentrations of emulsifying agents ( carbopol 1342 , 0 . 15 %) to achieve emulsion stability . in addition to being economical , low emulsifying agent levels help reduce the irritation potential of the compositions . the primary skin irritation on 105 subjects was shown to be extremely low using the repeat insult patch test ( ript ). a chamber scarification test was also performed and the results showed that the emulsion compositions of the present invention were as gentle as physiological saline on human abraded skin . 4 . emulsion compositions of the present invention have significantly more uniform moisture profiles or gradients when absorbed onto a web than emulsion compositions prepared by conventional techniques . 5 . emulsion compositions of the present invention significantly improve the cosmetic properties of the web . the tactile properties on skin of the instant compositions impregnated on a wipe were judged to be greatly improved over that of other emulsion compositions impregnated on a wipe ( soft , smooth , tacky , moisturized ). emulsion compositions of the present invention also showed a 34 % reduction in the coefficient of friction on webs versus conventional emulsion compositions . this data correlated well with sensory panel testing data . 6 . emulsion compositions of the present invention do not significantly affect the physical strength of the web . emulsions prepared by a conventional means may chemically interact with the web binder and cause a significant reduction in the physical strength of the web . the methods employed to prepare the emulsion compositions of the present invention are applicable to the preparation of a great variety of emulsion compositions . such compositions include low irritation , wash resistant lotions , creams , sprays and clear gels ; high performance , unique feeling , skin treatment and sunscreen products ; alcohol - free , solubilizer - free perfumes , colognes , after - shave products ; ultra gentle baby products ; hair conditioners ; substantive toners ; highly effective , gentle makeup removers ; and many non - cosmetic products . a particularly preferred emulsion composition in the form of a barrier lotion useful for the treatment of diaper dermatitis was prepared in accordance with the present invention having the following composition : ______________________________________trade name ctfa name parts by weight______________________________________10 - fold concentrate formuladeionized water water 63 . 275200 fluid ( 350 cs ) dimethicone 24 . 000200 fluid ( 1000 cs ) dimethicone 10 . 000carbopol 1342 carbomer 1342 1 . 500triethanolamine tea . 125kathon cg methychloroiso - . 100 thiazolinone ( and methyisothiazo - linonedilution formuladeionized water water 89 . 60concentrate ( see above ) 10 . 00disodium ethylene disodium edta . 10diamine tetraacetic acidtriethanolamine tea . 10kathon cg methychloroiso - .-- thiazolinone ( and methyisothiazo - linone______________________________________ a preferred emulsion composition in the form of a barrier lotion useful for the treatment of diaper dermatitis was prepared in accord with the present invention having the following composition : ______________________________________trade name ctfa name percent range______________________________________deionized water water 94 . 03 70 - 99sequestrene no . 2 disodium edta . 10 . 01 -. 50carbopol 1342 carbopol 1342 . 15 . 02 - 1 . 5silicone 200 ( 350 cs ) dimethicone 2 . 40 1 - 10silicone 200 ( 1000 cs ) dimethicone 1 . 00 . 5 - 10deionized water water 1 . 00kathon cg methychloroiso - . 11 . 02 -. 12 thiazolinone ( and methyisothiazo - linonedeionized water water 1 . 0099 % triethanolamine tea . 21 . 05 - 3 . 0______________________________________ a preferred emulsion composition in the form of a barrier lotion concentrate useful for the treatment of diaper dermatitis was prepared in accord with the present invention having the following composition ; ______________________________________number trade name percent______________________________________a - 1 deionized water 65 . 768a - 2 sequestrene na . sub . 2 0 . 240b - 3 deionized water 1 . 000b - 4 triethanolamine 99 % 0 . 092c - 5 kathon cg 0 . 100d - 6 volatile silicone 12 . 000d - 7 carbopol 1342 1 . 100d - 8 silicone 200 ( 350 cs ) 12 . 000d - 9 silicone 200 ( 1000 cs ) 7 . 700______________________________________ volatile silicone ( d - 6 ) was charged to a feed kettle equipped with a propeller mixer . vigorous mixing was commenced . carbopol 1342 ( d - 7 ) was added and when completely wet - out , silicone 200 ( 350cs ) ( d - 8 ) was added and propeller mixed 5 minutes . silicone 200 ( 1000 cs ) ( d - 9 ) was then added to the mixture and propeller mixed . deionized water was charged to the main kettle equipped with a turbine mixer and in - line homogenizer utilizing tandem rotor - stators . turbine mixing was commenced 10 , 000 rpm ), sequestrene na 2 was added ( a - 2 ), and turbine mixing was continued 5 minutes . deionized water ( b - 3 ) and triethanolamine ( b - 4 ) were premixed with the propellar mixer . when mixture a and mixture b were uniform , mixture b was added to mixture a and turbine mixed 10 - 15 minutes . when the mixture of a , b and mixture d were uniform , kathon cg ( c - 5 ) was added to the mixture of a and b . the mixture of a and b and c . was turbine mixed 1 minute . the recirculation of mixture a and b and c . thru the in - line homogenizer was commenced . mixture d was introduced through an &# 34 ; i &# 34 ; connection on the recirculation loop . when the addition was complete , the feed kettle was rinsed with the withheld silicone . turbine mixing and recirculation was continued thru the in - line homogenizer for 60 minutes or until the carbopol was dispersed . the temperature was kept below 30 ° c . when the mixture was uniform , the recirculation thru the in - line homogenizer was stopped . turbine mixing was continued 60 minutes . the mixture was pumped and strained . as these and other variations , combinations and modifications of the features described above can be utilized without departing from the spirit of this invention , the foregoing description of the preferred embodiments should be taken by way of illustration rather than by way of limitation of the invention as defined in the claims . | 8 |
to better understand the present invention , fig1 illustrates a communication architecture 100 having an example network , e . g ., a packet network such as a voip network related to the present invention . exemplary packet networks include internet protocol ( ip ) networks , asynchronous transfer mode ( atm ) networks , frame - relay networks , and the like . an ip network is broadly defined as a network that uses internet protocol to exchange data packets . thus , a voip network , a soip ( service over internet protocol ) network , or an ims ( ip multimedia subsystem ) network is built on an ip network . in one embodiment , the voip network may comprise various types of customer endpoint devices connected via various types of access networks to a carrier ( e . g ., a service provider ) voip core infrastructure over an internet protocol / multi - protocol label switching ( ip / mpls ) based core backbone network . broadly defined , a voip network is a network that is capable of carrying voice signals as packetized data over an ip network . the present invention is described below in the context of an illustrative voip network . however , the present invention should not be interpreted to be limited by this particular illustrative architecture . the customer endpoint devices can be either time division multiplexing ( tdm ) based or ip based . tdm based customer endpoint devices 122 , 123 , 134 , and 135 typically comprise of tdm phones or private branch exchange ( pbx ). ip based customer endpoint devices 144 and 145 typically comprise ip phones or ip pbx . the terminal adaptors ( ta )/ voip gateway ( gateway ) 132 and 133 are used to provide necessary interworking functions between tdm customer endpoint devices , such as analog phones , and packet based access network technologies , such as digital subscriber loop ( dsl ) or cable broadband access networks . tdm based customer endpoint devices access voip services by using either a public switched telephone network ( pstn ) 120 , 121 or a broadband access network via a ta / gateway 132 or 133 . ip based customer endpoint devices access voip services by using a local area network ( lan ) 140 and 141 with a router 142 and 143 , respectively . the access networks can be either tdm or packet based . a tdm pstn 120 or 121 is used to support tdm customer endpoint devices connected via traditional phone lines . a packet based access network , such as frame relay , atm , ethernet or ip , is used to support ip based customer endpoint devices via a customer lan , e . g ., 140 with a router 142 . a packet based access network 130 or 131 , such as dsl or cable , when used together with a ta / gateway 132 or 133 , is used to support tdm based customer endpoint devices . the core voip infrastructure comprises several voip components , such as the border element ( be ) 112 and 113 , the call control element ( cce ) 111 , voip related application servers ( as ) 114 , and media server ( ms ) 115 . the be resides at the edge of the voip core infrastructure and interfaces with customers endpoints over various types of access networks . a be is typically implemented as a media gateway or a session border controller and performs signaling , media control , security , and call admission control and related functions . the cce resides within the voip infrastructure and is connected to the bes using the session initiation protocol ( sip ) over the underlying ip / mpls based core backbone network 110 . the cce is typically implemented as a media gateway controller , a softswitch , or a call session control function in an ims network and performs network wide call control related functions as well as interacts with the appropriate voip service related servers when necessary . the cce functions is a signaling endpoint for all call legs between all bes and the cce . the cce may need to interact with various voip related application servers ( as ) in order to complete a call that require certain service specific features , e . g . call waiting , call forwarding , voice mail , etc . calls that originate or terminate in a different carrier can be handled through the pstn 120 and 121 or the partner ip carrier 160 interconnections . originating or terminating tdm calls can be handled via existing pstn interconnections to the other carrier . originating or terminating voip calls can be handled via the partner ip carrier interface 160 to the other carrier . in order to illustrate how the different components operate to support a voip call , the following call scenario is used to illustrate how a voip call is setup between two customer endpoints . a customer using ip device 144 at location a places a call to another customer at location z using tdm device 135 . during the call setup , a setup signaling message is sent from ip device 144 , through the lan 140 , the router 142 , and the associated packet based access network , to be 112 . be 112 will then send a setup signaling message , such as a sip - invite message if sip is used , to cce 111 . cce 111 processes the called party information and queries the necessary voip service related application server 114 to obtain the information to complete this call . in one embodiment , the application server ( as ) functions as a sip back - to - back user agent . if be 113 needs to be involved in completing the call , then the cce 111 sends another call setup message , such as a sip - invite message if sip is used , to be 113 . upon receiving the call setup message , be 113 forwards the call setup message , via broadband network 131 , to ta / gateway 133 . ta / gateway 133 then identifies the appropriate tdm device 135 and rings that device . once the call is accepted at location z by the called party , a call acknowledgement signaling message , such as a sip 200 ok response message if sip is used , is sent in the reverse direction back to the cce 111 . after the cce 111 receives the call acknowledgement message , it will then send a call acknowledgement signaling message , such as a sip 200 ok response message if sip is used , towards the calling party . in addition , the cce 111 also provides the necessary information of the call to both be 112 and be 113 so that the media exchange can proceed directly between be 112 and be 113 . the call signaling path 150 and the call media path 151 are illustratively shown in fig1 . note that the call signaling path and the call media path are different because once a call has been setup up between two endpoints , the cce 111 does not need to be in the media path for actual direct media exchange . note that a customer in location a using any endpoint device type with its associated access network type can communicate with another customer in location z using any endpoint device type with its associated network type as well . for instance , a customer at location a using ip customer endpoint device 144 with packet based access network 140 can call another customer at location z using tdm endpoint device 123 with pstn access network 121 . the bes 112 and 113 are responsible for the necessary signaling protocol translation , e . g ., ss7 to and from sip , and media format conversion , such as tdm voice format to and from ip based packet voice format . media servers ( ms ) 115 are special servers that typically handle and terminate media streams , and to provide services such as announcements , teleconference bridges , transcoding , and interactive voice response ( ivr ) messages for voip service applications . voip services have proliferated in recent years due to rapid advance in technology and market demands . service providers are aggressively looking for ways to offer voip to customers via various quality of service ( qos ) mechanisms . however , the existing discussions on providing qos to voip traffic primarily focus on the voip call media path such as how to ensuring voice quality after calls are accepted . little has been done on providing qos treatment for voip signaling messages , such as sip signaling messages , especially at sip servers that are involved in setting up voip calls . in one embodiment of the present invention , cce 111 shown in fig1 is a sip server . providing qos treatment for voip signaling messages at sip servers is beneficial when sip servers are overloaded . in a well engineered network , sip servers will not be overloaded under the normal operation mode . however , overload will occur if there are failures in the network or if there are significant increases in traffic load beyond the engineered loads . when sip servers are overloaded , signaling messages will be dropped at the sip servers . the dropped signaling messages may be signaling messages that need to be treated with higher priority . for example , calls from callers such as government emergency control agents that manage or assist in the rescue efforts in a disaster , should be handled with priority . to prevent signaling message dropping of important calls , qos features have to be implemented at sip servers so that important messages will always be processed even under overload conditions . the present invention enables differential qos treatments of various signaling messages at signaling servers . in one embodiment , the present invention employs three components : classification of signaling messages , scheduling of signaling messages for processing , and selective discarding of signaling messages under overload conditions , to support differential qos treatments of signaling messages . signaling message are first classified to different priority levels and then scheduled to be processed and , if necessary , when memory space runs out , discarded by a signaling server according to their classified priority levels . fig2 provides an example signaling flow 200 for a call setup using sip signaling messages . in fig2 , endpoint 210 initiates a call setup request towards endpoint 220 via a proxy 230 and a proxy 240 as shown . in this example , endpoint 210 and endpoint 220 are user agent clients ( uac ) and proxy 230 and proxy 240 are user agent server ( uas ) for sip signaling purposes . user agent client ( uac ) is a logical entity that creates a new sip request and then sends it to the network . user agent server ( uas ) is a logical entity that generates a response to a sip request . the response accepts , rejects , or redirects the request . for instance , sip invite message f 1 is generated and sent by endpoint 210 to proxy 230 . upon receiving invite message f 1 , proxy 230 , acting as both a uac and a uas , generates and forwards an invite message f 2 to proxy 240 . in addition , proxy 230 , acting both as a uac and a uas , also responds to invite message f 1 by generating and sending the sip 100 trying message f 3 to endpoint 210 . upon receiving invite message f 2 , proxy 240 generates and forwards invite message f 4 to endpoint 220 in response to invite message f 2 . in addition , proxy 240 also generates a sip 100 trying message f 5 to proxy 230 in response to invite message f 2 . the rest of the signaling message flows can be similarly interpreted . note that once a call is setup between the two endpoints , the endpoints can then signal each other directly without going through the proxies . for instance , sip ack message f 12 , bye message f 13 , and 200 ok message f 14 are such directly exchanged signaling message between endpoint 210 and endpoint 220 . the media session flow represents the call media path and flow between endpoint 210 and endpoint 220 . in one embodiment , the classification component of the present invention decides which message gets higher priority than others . for example , a two - tier classification approach is introduced . in the first tier , calls are categorized into two classes , a high priority class and a low priority class . the high priority class comprises signaling messages that are more important than those of low priority class . the criteria of such categorization can be flexibly configured by individual service providers . for instance , calls originated from government emergency agents ( e . g ., government employees ( federal , state , city , county , etc . ), medical personnel , utility employees , and so on ) can be classified as the high priority class . in the second tier , signaling messages from the low priority class of calls are further classified into two classes based upon the nature of the messages . for instance , the sip call invite and bye messages can be configured to have higher priority than other sip signaling messages , such as 1 ×× messages comprising provisional responses . again , the actual classification criteria within the lower priority class can be flexibly configured by individual service providers . sip messages of different classes will then be queued separately so that they can be served in a differential manner . this illustrative two tier classification structure is based upon both the call type and the sip signaling message type . though one can define as many classes as it is needed , in one embodiment , a three class structure using this two tier classification is used : class 1 : all sip messages associated with high priority calls ; class 2 : important sip signaling messages from low priority calls , also know as non - provisional signaling messages ; and class 3 : non - important sip signaling messages from lower priority calls , also know as provisional messages . note that the number of high priority calls should be restricted to a small percentage of all call types . therefore , the amount of signaling message traffic of high priority calls shall be engineered to never overload any signaling servers in a voip network . fig3 illustrates an example 300 of the two tier with three classes signaling message classification scheme in a voip network of the present invention . in fig3 , all incoming signaling messages arrive first into queue 310 . then these messages are parsed and pre - processed by module 320 . the ip header differentiated service code point ( dscp ) field is used to determine the classes to which incoming signaling message belong . once the classification is performed , signaling message are then queued into the appropriate classes , e . g ., queue 330 for storing high priority messages , queue 340 for storing non - provisional messages , and queue 350 for storing provisional messages . queued signaling messages in these queues are then processed by module 360 according to the present invention described herein . since sip is an application layer protocol employing ip networks for transmissions , the actual sip messages are encapsulated within ip packets while traversing through ip networks . when ip packets carrying sip messages arrive at a sip server , the sip server needs to determine what type of sip message is carried within an arriving ip packet first before placing it into a service queue . thus , ip packet header needs to carry a sip message identity . in one embodiment , the present invention uses an existing ip header field for classification purpose , such as the differentiated service code point ( dscp ) field in the ip packet header . the dscp field is an 8 bit field within the ip packet that can be used to prioritize the importance of the ip packet . the marking for ip packets with encapsulated sip messages is performed whenever a new sip message is composed . for instance , when a call request arrives at a user agent client ( uac ), a new sip invite message is composed and created and the resulting ip packet is appropriately marked by the uac . note that some sip messages are generated at sip servers as responses to invite messages and their resulting ip packets will need to be marked accordingly before transmission as well . moreover , for any given call setup flow initiated at a sip user agent client ( uac ), there could be multiple sip user agent servers ( uas ) along the signaling path . therefore , some sip response messages will need to be forwarded by sip servers that are not the origin of the sip response messages . queuing only occurs for those sip messages that arrive at a sip server and must wait for processing . fig4 illustrates a flowchart of a method 400 for processing a call request by a sip user agent client ( uac ) in voip network , of the present invention . method 400 starts in step 405 and proceeds to step 410 . in step 410 , the method receives a call request at the uac . in step 420 , the method inspects the received call request to determine the classification of the call request . in one embodiment , the call request will be classified using the two tier and three class classification structure based on the customer type and the signaling message type . for example , the sip invite signaling message for a call associated with a particular customer can be assigned to the high priority class . in step 430 , a sip invite signaling message is composed and created . in step 440 , the method encapsulates the composed sip invite message within an ip packet . in step 450 , the method marks the ip packet with the appropriate classification determined in step 420 . in one embodiment , the ip packet is marked using the dscp field in the ip packet header . the method ends in step 460 . the scheduling of signaling message for processing component of the present invention places sip messages arriving at a sip server into different signaling message service queues . when ip packets with sip messages arrive at a sip server , the packet headers are inspected and the packets are then placed into different queues . the sip server then processes those sip messages according to the defined service scheduling algorithm . in one embodiment , the present invention uses a service scheduling algorithm that takes into consideration the time sensitive nature of sip messages . in one embodiment , the scheduling algorithm is a hybrid scheduling algorithm that combines strict priority scheduling and first in first out ( fifo ) scheduling . the strict priority scheduling means that a sip server will process sip messages from low priority call queues only when the high priority call queue is empty . for all other low priority call queues , the sip server will serve the sip message that has the longest waiting time regardless of which low priority queue that the sip message is in . essentially , the sip messages in the low priority queues are being served in fifo fashion . to ensure the proper order of services between two low priority queues , a message scheduler , is used to track the order of arrivals . whenever a new message arrives , it will be time stamped . a record is entered into the message scheduler indicating the type of the message and its associated arrival time . the reason for queuing low priority sip messages into separate queues is to allow intelligent selective discarding of signaling messages under overload conditions . for example , during a national disaster such as hurricane katrina , calls from all over the world would be directed to the disaster sites , the number of call attempts will be overwhelmingly high even five or ten times higher than the normal load . thus , the sip servers may become the bottleneck . the existing sip servers on the market will treat all the call attempts in a fifo fashion . under normal conditions , in a well engineered network , sip messages can be handled in a timely fashion using fifo serving discipline . however , under the overload conditions , the processing rate of a sip server will become lower than the sip message arrival rate , and will be accumulated in queues at the sip server . unfortunately , the arriving sip messages will be discarded upon arrival when the queues reach their full capacity . the issue associated with the fifo treatment of all messages at sip server is that the dropped messages can be the ones that trigger retransmission of sip messages from originating uac . consequently , more messages are created to flood the already overloaded sip servers . in a typical sip call setup flow , it is essentially a three - way handshake session of involving sip invite , sip 200 , and sip ack messages and a media session is terminated by a two - way handshake involving sip bye and sip 200 messages . all other messages are provisional ones that will not trigger retransmission of messages toward a sip server . by putting different messages into different queues , one has the advantage of deciding whether to discard a low priority message already sitting in a queue so as to be able to accept the newly arrived high priority message . moreover , due to the time sensitive nature of non - provisional messages , serving a non - provisional message that has been sitting in the queue for too long is a waste of resources . particularly when the volume of requests to high priority queue is unusually high , waiting time for the messages in the non - provisional queue can be significantly long . one way to overcome this problem is to discard the message from the head of the queue whenever it is necessary . it is sufficient to apply the head of queue dropping to the non - provisional queue only . in the present invention , two mechanisms can be used to determine when a message should be dropped from the head of queue . one approach is the time expiration message discarding method , and another approach is the head drop trigger message discarding method . in the time expiration message discarding method , a user configurable parameter , such as an expiration time , is introduced . the value of expiration time is the maximum allowable time that a non - provisional message can remain in the non - provisional queue . whenever a message has to be deleted from the non - provisional queue , the waiting time of the head of queue will be checked first . if the waiting time is larger than the expiration time , the message will be deleted from the head of the queue rather than from the tail of the queue . otherwise , the message form the tail of the queue will be discarded . a detailed flowchart of the processing of an arrived signaling message is also provided in fig5 . fig5 illustrates a flowchart of a method 500 for processing the arrival of a signaling message at a uas in a voip network of the present invention . method 500 starts in step 505 and proceeds to step 510 . in step 510 , the method receives a sip signaling message via an ip network . in step 515 , the method inspects the ip header of the ip packet that is received . for example , the priority of the sip message is extracted using information embedded in the ip packet header . in step 520 , the method checks if the sip server memory is completely utilized . if the sip server memory is completely utilized , the method proceeds to step 523 ; otherwise , the method proceeds to step 563 . in step 523 , the method checks if the sip message is a provisional signaling message . if the sip message is a provisional signaling message , the method proceeds to step 555 ; otherwise , the method proceeds to step 525 . in step 525 , the method checks if the provisional message queue is empty . if the provisional message queue is empty , the method proceeds to step 528 ; otherwise , the method proceeds to step 560 . in step 528 , the method checks if the non - provisional message queue is empty . if the non - provisional message queue is empty , the method proceeds to step 555 ; otherwise , the method proceeds to step 532 . in step 532 , the method checks the type of discard method to be used to drop signaling messages . if the time expiration discard method is used , the method proceeds to step 534 . if the head of queue drop trigger discard method is used , the method proceeds to step 536 . in step 534 , the method executes the time expiration discard method ( as further described below in method 1100 ). after the execution of step 534 , the method proceeds to step 555 if the received message is a non - provisional message and there is no time expired non - provisional message in the non - provisional message queue , or to step 570 if the received message is a non - provisional message and there is an expired message in the non - provisional message queue , or to step 580 if the received message is high priority message . in step 536 , the method executes the head of queue drop trigger discard method described in method 800 . after the execution of step 536 , the method proceeds to step 570 if the received message is a non - provisional message or to step 580 if the received message is a high priority message . in step 555 , the method discards the received signaling message . the method then proceeds to step 590 . in step 560 , the method discards a message from the tail of the provisional message queue . the method then proceeds to step 563 . in step 563 , the method checks if the received message is a high priority message . if the received message is a high priority message , the method proceeds to step 580 ; otherwise , the method proceeds to step 565 . in step 565 , the method checks if the received message is a provisional message . if the received message is a provisional message , the method proceeds to step 575 ; otherwise , the method proceeds to step 570 . in step 570 , the method places the received message into the provisional message queue . the method then proceeds to step 585 . in step 575 , the method places the received message into the non - provisional message queue . the method then proceeds to step 585 . in step 580 , the method places the received message into the high priority message queue . the method then proceeds to step 585 . in step 585 , the method updates the message scheduler accordingly . the method then ends in step 590 . fig1 illustrates a flowchart of a method 1100 for discarding signaling message from a non - provisional queue using time expiration in a voip network , of the present invention . method 1100 starts when step 534 in method 500 is reached and the method proceeds to step 1110 . in step 1110 , the method checks if the received message is a high priority message . if the received message is a high priority message , the method proceeds to step 1120 ; otherwise , the method proceeds to step 1150 . in step 1120 , the method checks if the head of queue message in the non - provisional message queue has exceeded the expiration timer threshold . if the head of queue message in the non - provisional message queue has exceeded the expiration timer threshold , the method proceeds to step 1130 ; otherwise , the method proceeds to step 1140 . in step 1130 , the method discards the head of queue message from the non - provisional message queue . the method then proceeds to step 580 in method 500 . in step 1140 , the method discards the tail of queue message from the non - provisional message queue . the method then proceeds to step 580 in method 500 . in step 1150 , the method checks if the head of queue message in the non - provisional message queue has exceeded the expiration timer threshold . if the head of queue message in the non - provisional message queue has exceeded the expiration timer threshold , the method proceeds to step 1160 ; otherwise , the method proceeds to step 555 in method 500 . in step 1160 , the method discards the head of queue message from the non - provisional message queue . the method then proceeds to step 570 in method 500 . in the head drop trigger message discarding method , a user configurable parameter , such as a head of queue drop trigger , is introduced . whenever a signaling message in the non - provisional queue is deleted due to high priority message arrivals , the server is spending more time on the high priority queue . it indicates that the messages in the non - provisional queue have to wait longer to be served . if a significant number of messages are deleted from the non - provisional queue since the last non - provisional message was served , there is a very high likelihood that the signaling message waiting at the head of the non - provisional queue is too old to be meaningful . thus , if the number of deleted messages from non - provisional queue exceeds the user configured parameter of the head of queue drop trigger , the head of queue discard will be performed if a non - provisional message has to be dropped . to implement the head drop trigger message discarding method , the concept of dropping zone is introduced . there are two dropping zones , the tail of queue dropping zone and the head of queue dropping zone . furthermore , a dropping counter to keep track of number of consecutive tail of queue drops from the non - provisional queue is introduced . consecutive dropping is defined to be the number of discard for non - provisional signaling messages since the last non - provisional message was served . when the dropping counter exceeds the head of queue drop trigger , the dropping zone is the head of queue dropping zone , otherwise it is the tail of queue dropping zone . if the dropping zone is in the tail of queue dropping zone , the dropping counter is reset to zero whenever a non - provisional message is served or scheduled . if it is in the head of queue dropping zone , the dropping counter is decremented by one whenever a head of queue discard occurs until it is zero . fig8 illustrates a flowchart of a method 800 for discarding a signaling message from a non - provisional queue using head of queue drop trigger in a voip network of the present invention . method 800 starts when step 536 in method 500 is reached and the method proceeds to step 807 . in step 807 , the method checks to verify if the method has previously been initialized already . if the method has previously been initialized already , the method proceeds to step 813 ; otherwise , the method proceeds to step 810 . in step 810 , the method initializes the dropping counter parameter to 0 and the dropping zone to tail of queue dropping when an initial signaling message arrives . the dropping counter parameter keeps track of the number of consecutive tail of queue drops from the non - provisional queue . the dropping zone parameter can either be the tail of queue dropping zone or the head of queue dropping zone , indicating signaling message shall be discarded from the tail of queue or the head of queue , respectively . in step 813 , the method determines if the received signaling message is a high priority message . if the received signaling message is a high priority message , the method proceeds to step 815 ; otherwise , the method proceeds to step 860 . in step 815 , the method checks if the dropping zone parameter is set to the tail of queue dropping zone . if the dropping zone parameter is set to the tail of queue dropping zone , the method proceeds to step 820 ; otherwise , the method proceeds to step 840 . in step 820 , the method increments the dropping counter parameter by 1 . in step 825 , the method checks if the dropping counter value exceeds the head of queue drop trigger parameter . note that the head of queue drop trigger parameter is a user configurable parameter set by the user . if the dropping counter value exceeds the head of queue drop trigger parameter , the method proceeds to step 830 ; otherwise , the method proceeds to step 835 . in step 830 , the method sets the dropping zone parameter to the head of queue dropping zone . in step 835 , the method discards a non - provisional signaling message from the tail of the non - provisional queue . the method then proceeds to step 580 in method 500 . in step 840 , the method decrements the dropping counter parameter by 1 . in step 845 , the method checks if the dropping counter parameter value is 0 . if the dropping counter parameter value is 0 , the method proceeds to step 850 ; otherwise , the method proceeds to step 855 . in step 850 , the method sets the dropping zone parameter to the tail of queue dropping zone . in step 855 , the method discards a non - provisional signaling message from the head of the non - provisional queue . the method then proceeds to step 580 in method 500 . in step 860 , the method discards a non - provisional signaling message from the tail of the non - provisional queue . the method then proceeds to step 570 in method 500 . fig9 illustrates a flowchart of a method 900 for resetting the dropping counter parameter in a voip network of the present invention . method 900 starts in step 905 and proceeds to step 907 . in step 907 , a signaling message is served by a signaling server . in step 910 , the method checks if the next signaling message to be processed is a message from the non - provisional queue . if the next signaling message to be processed is a message from the non - provisional queue , the method proceeds to step 920 ; otherwise , the method proceeds to step 940 . in step 920 , the method checks if the dropping zone parameter is set to the tail of queue dropping zone . if the dropping zone parameter is set to the tail of queue dropping zone , the method proceeds to step 930 ; otherwise , the method proceeds to step 940 . in step 930 , the method resets the dropping counter parameter to a value of 0 . the method ends in step 940 . compared to threshold based queue management schemes , another advantage of separate queues for sip messages is to maximize utilization of the memory space in a sip server . the four associated procedures that are performed by a sip server will be described as follows . in a first procedure , in order to facilitate the differential treatment of sip messages in a sip server , the classification rules are programmed into the sip server . a user interface is used by service providers to define and configure rules within the server according to service needs . in a second procedure , a message scheduler is used to track the order of arrival of sip signaling messages , including both provisional and non - provisional signaling messages , which do not belong to high priority queue . whenever such a new sip signaling message arrives , the arrival order is recorded into the message scheduler . whenever a message is processed , the associated record is eliminated from the message scheduler . fig7 illustrates an example message scheduler 700 in a voip network of the present invention . state 710 illustrates the initial state of the message scheduler before a signaling message , either provisional or non - provisional , is served by a sip signaling server . state 720 illustrates the state of the message scheduler after the head of queue provisional signaling message is served . state 730 illustrates the state of the message scheduler after a provisional signaling message is received and inserted into the tail of queue . in a third procedure , a sip signaling message that arrives at a user agent server ( uas ) is processed . the pseudo code of the processing of an arrived signaling message is given below . in a fourth procedure , the signaling messages in the various message queues are served by the uas . the pseudo code of this processing is given below . a detailed flowchart of the serving of signaling messages in various signaling message queues is provided in fig6 . fig6 illustrates a flowchart of a method 600 for serving signaling messages in signaling message queues at a uas in a voip network of the present invention . method 600 starts in step 605 and proceeds to step 610 . in step 610 , the method awaits to serve the next sip message in signaling message queues after a previous message has been served . in step 615 , the method checks if the high priority message queue is empty . if the high priority message queue is empty , the method proceeds to step 620 ; otherwise , the method proceeds to step 645 . in step 620 , the method checks if the message scheduler is empty . if the message scheduler is empty , the method proceeds back to step 610 ; otherwise , the method proceeds to step 625 . in step 625 , the method checks if the next signaling message to be served is a message from the provisional message queue according to the message scheduler . if the next signaling message to be served is a message from the provisional message queue according to the message scheduler , the method proceeds to step 630 ; otherwise , the method proceeds to step 635 . in step 630 , the method processes the signaling message from the head of queue of the provisional message queue . the method then proceeds to step 640 . in step 635 , the method processes the signaling message from the head of queue of the non - provisional message queue . the method then proceeds to step 640 . in step 640 , the method updates the message scheduler accordingly after a signaling message has been processed . the method then proceeds back to step 610 . in step 645 , the method processes a signaling message from the head of queue of the high priority message queue . the method then proceeds to step 610 . this fourth procedure guarantees call setup of high priority calls . while the third procedure effectively serves as an overload control mechanism to minimize the sip message retransmissions due to loss of non - provisional messages so as to increase the resource utilization as well as the successful call setup rate . it should be noted that although not specifically specified , one or more steps of methods 400 , 500 , 600 , 800 , 900 , and 1100 may include a storing , displaying and / or outputting step as required for a particular application . in other words , any data , records , fields , and / or intermediate results discussed in the method can be stored , displayed and / or outputted to another device as required for a particular application . furthermore , steps or blocks in fig4 , 6 , 8 , 9 , and 11 that recite a determining operation or involve a decision , do not necessarily require that both branches of the determining operation be practiced . in other words , one of the branches of the determining operation can be deemed as an optional step . fig1 depicts a high level block diagram of a general purpose computer suitable for use in performing the functions described herein . as depicted in fig1 , the system 1000 comprises a process serving signaling messages in signaling message queues at a uas or element 1002 ( e . g ., a cpu ), a memory 1004 , e . g ., random access memory ( ram ) and / or read only memory ( rom ), a module 1005 for prioritizing voip signaling messages , and various input / output devices 1006 ( e . g ., storage devices , including but not limited to , a tape drive , a floppy drive , a hard disk drive or a compact disk drive , a receiver , a transmitter , a speaker , a display , a speech synthesizer , an output port , and a user input device ( such as a keyboard , a keypad , a mouse , and the like )). it should be noted that the present invention can be implemented in software and / or in a combination of software and hardware , e . g ., using application specific integrated circuits ( asic ), a general purpose computer or any other hardware equivalents . in one embodiment , the present module or process 1005 for prioritizing voip signaling messages can be loaded into memory 1004 and executed by processor 1002 to implement the functions as discussed above . as such , the present process 1005 for prioritizing voip signaling messages ( including associated data structures ) of the present invention can be stored on a computer readable medium or carrier , e . g ., ram memory , magnetic or optical drive or diskette and the like . while various embodiments have been described above , it should be understood that they have been presented by way of example only , and not limitation . thus , the breadth and scope of a preferred embodiment should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents . | 7 |
the display panels constructed in accordance with this invention are composed of a display medium layer , a pair of flexible substrates sandwiching the display medium layer and a multiple structure seal . at least one part of the multiple seal is constructed of a resin having strong adhesion to the flexible substrates and another part is made of a resin having low water permeability . this separation of functions is usually necessary because resins having strong adhesions to the flexible substrates are generally high in water permeability . where the resin which strongly adheres to the flexible substrate has high water permeability it is desirable that it have low gas permeability . the term seal as used herein means for the resins having low water permeability an assembly constructed so that at least one layer of the low water permeability resin completely surrounds the liquid crystal or other display medium layer except at the liquid crystal , or other display medium , inlet . however , the resin having strong adhesion to the substrate need not be continuously formed around the liquid crystal layer . in other words , a part of the &# 34 ; seal &# 34 ; formed by the strongly adhesive resin may be partially discontinuous . the seal structure is formed of multiple components , e . g . two , three , four or the like layers . in general , however , the 2 - layer form is preferable because the narrowest width seal can be achieved and it is easiest to produce . one way of forming the seal is to have the sealing member on the liquid crystal layer side made of the low water permeability resin and the outer side sealing member being made of the strongly adhesive resin . however , it is also possible to reverse the relative placement of the seal parts . flexibility is herein defined as the property of a substance which prevents it from being easily broken when bent and remaining undamaged even when the substrate has a curvature imparted to it . it is generally preferable if the sealing member on the liquid crystal layer side of the seal is made of a material which does not easily react with the liquid crystal . however , there should be no problem if the reaction with the sealing member is completed during the assembly of the display cell and before the liquid crystal is introduced . it is preferable that the low water permeability resin used be either an epoxy type resin or an anaerobic ultraviolet curing resin . the anaerobic ultraviolet curing resin is preferably acrylic . the resin which strongly adheres to the flexible base is preferably selected from the group consisting of silicone type resins , urethane type resins , flexible epoxy type resins and polyester type resins . among these resins a preferred combination is using an epoxy type resin for the low water permeability resin and a silicone type resin for the strongly adhesive resin . it is also possible to construct the multiple part seal using a relatively non - reactive resin as the sealing member on the liquid crystal layer side and the low water permeability resin as the outer sealing member . in this situation the relatively non - reactive resin and the strongly adhesive , low - water permeability resin are formed so as to completely surround the liquid crystal layer except at the liquid crystal inlet . of the aforenoted resins strongly adhesive to the flexible substrates the silicone type resins and flexible epoxy type resins tend not to easily react with the liquid crystal . of these , the silicone type resins are least reactive with the liquid crystal . the flexible substrates used in the display panels in accordance with the invention are selected from the group consisting of : polyester type resins ; cellulose type resins such as cellulose diacetate , cellulose triacetate , cellulose acetate butyrate , etc . ; polyethersulfone type resins ; polysulfone type resins ; acrylic resins ; polyethylene terephthalate type resins ; phenoxy type resins ; phenoxy - urethane type resins ; urethane type resins ; polyether ketone type resins ; polyether ether ketone type resins ; polyether imide type resins ; epoxy type resins ; polyimide type resins ; polyamide type resins ; polyimideamide type resins ; polycarbonate type resins ; resins obtained by mixing two or more of the above resins ; and resins obtained by laminating two or more of the above resins . also included are the above resins made into a film . further , the above may be laminated on one side with an aluminum foil , an aluminum plate or deposited or spattered with aluminum , silver etc . especially in the case of liquid crystal display panels several additional examples of flexible substrates include a polyvinyl alcohol ( pva ) film imparted with polarizability by incorporation of a dichromatic dye into the aforenoted plastic resin or film , a substrate of a polarizing plate type obtained by integrally laminating the pva film with a cellulose acetate film , a substrate obtained by laminating with a polarizer comprising a k film , as well as a polarizing plate per se of , e . g ., the above mentioned film . the resin material for the aforenoted substrate ( e . g . phenoxy type resin etc .) is highly transparent and also adheres well between the substrate and a transparent electrically conductive film ( e . g . sno 2 , inso 3 , ito etc .). a substrate produced using one of these materials has no optical rotation if fabricated using e . g . extrusion . also , where monoaxial stretching is utilized in liquid crystal display panels optical rotation is acceptable where polarizing is accomplished by making the polarizing axis of the polarizer parallel or at right angles to the monoaxial stretching axis . deviations of five degrees or less , and preferably two degrees or less from the parallel or right angle directions are substantially negligible . monoaxial stretching is used , for example , in the preparation of substrates using polyethylene terephthalate type resins , ( including the preparation of polarizer - integrated bases ), etc . the thickness of the substrates are about 0 . 025 - 1 . 5 mm . where a thin liquid crystal display panel is desired a thickness of about 0 . 025 - 1 mm is preferred and more preferably about 0 . 05 - 0 . 2 mm . the process for forming a display panel with the above described multiple parts sealed structure consists of forming two resins having different characteristics , one on each of the substrates by screen printing , gravure printing , offset printing , etc ., and then combining the pair of substrates and subjecting them to a heat reaction . the invention is more particularly described by the following examples directed to various embodiments constructed in accordance with the invention . reference is made to fig1 and 2 wherein a liquid crystal cell constructed in accordance with an embodiment of the invention is depicted . the liquid crystal cell has plastic substrates 10 , 11 a liquid crystal composition 12 , and epoxy type adhesive seal part 13 and a silicone type adhesive seal part 14 . a sealant 15 covers a liquid crystal inlet 17 . a gap agent 16 is used to maintain a uniform liquid crystal layer thickness . as noted above , by making the seal a double layered structure the lack of adhesion to plastic suffered by epoxy type adhesives is avoided by also utilizing a silicone type adhesive . silicone type adhesive 14 need not completely encircle epoxy type adhesive 13 , as shown in fig1 and is satisfactory even when it is discontinuous as shown in fig3 . a structure similar to the embodiment of fig1 was produced except that the relative positioning of epoxy type seal part 13 and silicone type adhesive 14 was reversed . in this case the silicone type adhesive is in contact with liquid crystal composition 12 and epoxy type adhesive 13 is formed on the outside of the cell . this configuration is highly reliable and forms a good bond . however , under the stress of a severe bending test the epoxy resin at the edge of the cell tends to peel off and is , as a result , less flexible than the above described structure . a double layered seal was formed by screen printing an epoxy type adhesive on one substrate and screen printing a silicone type adhesive on the other substrate . a spacer 16 was added to at least one of the substrates . then the two substrates were combined and heated to cure the adhesives easily forming a double layered seal structure . reference is next made to fig3 wherein alternate embodiments of liquid crystal display panels prior to final assembly in accordance with the invention are depicted , like elements having like reference numerals . if rings 13 and 14 of the multiple seal are made completely continuous around liquid crystal display composition 12 air tends to be trapped between seal parts 13 , 14 . the trapped air can lead to a fluctuation in cell thickness , a deterioration of display quality due to bubble formation in the display medium , etc . by forming cuts on one of the multiple seal parts air is not trapped between the inner and outer seal part . in this configuration where one of the seals is printed and also provided with cut regions when upper and lower substrates 10 , 11 are laminated the discontinuous seals are squeezed thereby expelling the air present between the adjacent seal parts and giving a continuous seal in the final construction . as noted in this example the multiple seal is preferably constructed by screen printing different resins on the respective substrates and combining the substrates to form a cell . a process which forms a seal on the inner side of the cell as it is being assembled and subsequently impregnates it with an outer sealing material does not produce desirable results . flexible substrates are generally used to make thin display devices and if the device is thin , the impregnated resin tends to stick to undesirable locations . the resin has a tendency to stick to the top and rear surfaces of the cell thereby causing the cell to become thicker in these regions causing a fluctuation in the thickness of the display composition and as a result a fluctuation in the thickness of the display device . where glass substrates are used the excess resin can be removed by , for example , a metal blade . however , if flexible substrates are used , the substrate surfaces tend to scratch when attempts are made to remove the resin and the quality of the display is deteriorated and possibly damaged . substrates 10 , 11 were formed of 100μ thick polyether sulfone film with an indium oxide - tin oxide transparent electrically conductive film 500 å thick formed thereon using a low temperature spattering method . thereafter , a predetermined pattern was formed by photolithography , an orientating agent was coated , calcined and rubbed in the predetermined direction with gauze . thereafter , an epoxy type adhesive was screen printed on one of the substrates and a silicone type adhesive was screen printed on the other substrate and then a spacer was scattered on the substrates . the substrates were then combined and heated to cure the adhesives . the cell was filled with a liquid crystal substance by a vacuum injection method . then the inlet was sealed with a room temperature epoxy resin type adhesive . the bending resistance of the resulting display panel is shown in fig5 a . the number of bendings that were endured depended on the bending radius . for example , when the cell was bent to a radius of 100 mm or greater a durability of 10 , 000 times or more without any defective cells was achieved , which is a commercially practical level . these results show that the double - layered seal is far superior to the seal formed with only an epoxy type resin . where the seal is composed of a double layered seal and the seal on the liquid crystal layer side is of the silicone type resin and the outer sealing member is the epoxy type resin , the bending versus percent defective characteristic curve lies between the solid line ( double layered seal with epoxy resin on the inside ) and the dotted line ( only epoxy resin ), for any given bending radius . as a result the flexibility characteristics of the double layered seal where the silicone type resin is on the liquid crystal layer side of the double seal , while not as flexible as the double layer seal , with the epoxy type resin on the liquid crystal layer side , is more flexible than a single epoxy resin seal . in addition , the liquid crystal and the sealing member do not easily react and water and other deleterious substances do not easily invade the liquid crystal composition from outside of the outer seal of the double layered seal and the deterioration of the liquid crystal is greatly reduced . a liquid crystal display cell was formed using a silicone type resin , as the resin having the low reactivity , on the liquid crystal layer side . the outer seal was formed using an epoxy type resin which has low water permeability . both the epoxy type resin and the silicone type resin were formed in a continuous manner before the final assembly of the display cell . the display panel was otherwise produced similarly to the display panel of example 1 . the bending resistance of this display panel is shown in fig5 b . while the number of durable bendings varies depending on the bending radius , the results for the double layered seal are significantly superior to the result for the single layered epoxy seal . for example , where r = 150 mm there were no poor results out of the 100 specimens tested in a one thousand time bending test and fewer than 5 % were defective in a ten thousand time bending test . a display panel was produced similarly to the display panel of example 1 except that the spacer in example 1 was replaced by a plastic fiber . a display panel is produced similarly to the display panel of example 1 except that the spacer in example 1 was replaced by a glass spacer , such as glass beads , glass fiber , etc . a display panel was produced similarly to the display panel of example 1 except that the spacer in example 1 was replaced by plastic balls . a display panel was produced similarly to the display panel of example 1 except that the spacer was uniformly distributed on the substrate by placing the substrate in the gas atmosphere in which the spacer material was suspended . a display panel was produced similarly to the display panel of example 1 except that the spacer was uniformly distributed on the substrate by placing the substrate in the liquid containing the suspended spacer and withdrawing it at a constant rate . a display panel was produced similarly to the display panel of example 1 except that the spacer was uniformly distributed on a substrate by spraying a solution of the spacer and a volatile solvent over the substrate using a sprayer . a display panel was produced similarly to the display panel of examples 1 - 8 except that a sealing member was printed on one of the orientated substrates , an upper - lower conductive member was applied and the spacer was distributed on the substrate . separately the other sealing member was printed on the other orientated substrate and the spacer was distributed on that substrate . then , both substrates were laminated to integrate them . the upper - lower conductive member is the electrically conductive member which electrically connects the electrodes respectively formed on the pair of substrates sandwiching the display medium . examples include electrically conductive adhesives incorporating an electrically conductive metal powder , such as silver , aluminum , gold , copper , etc ., and plastic fiber balls , glass fiber balls which are coated with a metal or other electrically conductive substance . the diameter of these conductive members can be as large as the thickness of the display medium . a display panel was produced similarly as in examples 1 - 8 except for the following differences . one of the sealing members was printed on one of the orientated substrates , then the spacer was distributed on that substrate and an upper - lower conductive member was applied . separately , the other sealing member was printed on the other orientated substrate and both bases were laminated to integrate them . a display panel was produced similarly to the display panels of examples 1 - 8 except for the following differences . one of the sealing members was printed on one of the orientated substrates , an upper - lower conductive member was applied to the substrate and the spacer was distributed on the substrate . then this first substrate was laminated with the other orientated substrate which had been printed with the other sealing member , thereby integrating the substrates . a display panel was produced similarly to the display panels of examples 1 - 8 except for the following differences . a sealing member was printed on one of the orientated substrates and then the spacer was distributed on the substrate . separately , the other sealing member was printed on the other orientated substrate and an upper - lower conductive member was applied . thereafter both substrates were laminated to integrate them . a display panel was produced similarly to the display panels of examples 1 - 8 except for the following differences . a sealing member was printed on one of the orientated bases , a spacer was distributed on the substrate and an upper - lower conductive member was applied to the substrate . thereafter , this substrate was laminated with the other orientated substrate which had been printed with the other sealing member , thereby integrating the substrates . a display panel was produced similarly to the display panels of examples 1 - 13 except for the following differences as depicted in the embodiments of fig6 a , 6b . an upper - lower conductive part 26 was formed within the water permeability seal part 13 ( epoxy type resin ). the sealed part composed of a resin which is strongly adhesive to the substrate ( silicone type resin ) 14 was formed on the outer side of seal part 13 . upper - lower conductive part 26 was formed on a portion b inside a boundary a between seal parts 13 , 14 . a display panel was produced similarly to the display panels of examples 1 - 13 except for the following differences , as depicted in the embodiment of fig7 . upper - lower conductive part 26 was formed within liquid crystal layer 12 rather than in seal part 13 , which is strongly adhesive to the substrate ( silicone type resin ), or in outer seal part 14 , having low water permeability ( epoxy type resin ). a display panel as produced similarly to the display panels of examples 1 - 13 except for the following differences , as depicted in the embodiment of fig8 . seal part 14 , having strong adhesion to the substrates was formed on the inside ( on the liquid crystal layer side ) and the low water permeability seal part 13 ( epoxy type resin ), was formed on the outside , the reverse of the embodiments of fig6 a , 6b . in addition , upper - lower conductive part 26 was formed within seal part 13 on the outer side of the multiple part seal . a display panel was produced similarly to the display panels of examples 1 - 13 except for the following differences , as depicted in the embodiments of fig9 a , 9b , 9c , 9d . these liquid crystal display panels have a three - part seal composed of a single low water permeability seal part 13 sandwiched between inner and outer strongly adhesive seal parts 14 . the three layered seal , as shown in 9b , 9c , 9d may have cuts 19 on inner and outer strongly adhesive seal parts 14 . however , it was also possible for cuts 19 to be present prior to assembly of the multiple seal but to disappear during assembly and form a continuous three part seal as shown in fig9 a . upper - lower conductive part 26 was located in low water permeability seal part 13 as shown in fig9 b . upper - lower conductive part 26 was also placed in the inner , strongly adhesive seal part 14 as shown in fig9 c . finally , upper - lower conductive part 26 was located in the outer , strongly adhesive seal part 14 as shown in fig9 d . a display panel was produced similarly to the display panels of examples 1 - 13 except for the following differences , as depicted in the embodiments of fig1 a , 10b , 10c . in fig1 a strongly adhesive seal part 14 is located entirely within low water permeability seal part 13 . it is not necessary for strongly adhesive seal part 14 to be continuous because its sole function is to ensure that spacers 10 , 11 remain firmly attached . however , low water permeability seal part 13 must be continuous when finally assembled to prevent the movement of water across the multiple seal . cuts 19 may be made in two or three layers of seal parts 13 , 14 prior to the bonding of upper and lower substrates 10 , 11 ( fig1 b , 10c ). the bonding process can then provide a continuous seal , as shown in fig1 a after final assembly . a display panel was produced similarly to the display panels of examples 1 - 13 except for the following differences , as depicted in the embodiments of fig1 a , 11b . as shown in fig1 a , liquid crystal inlet 15 was formed on the terminal part side . the shape of inlet 17 through multiple seal parts 13 , 14 is designed so that inlet sealant 15 cannot easily invade the liquid crystal display region . particularly with the inlet shape and placement of fig1 b the sealant enters directly opposite low water permeability seal part 13 and is less likely to invade the inner portion of the display cell . a display panel was produced similarly to the display panels of examples 1 - 13 except for the following differences , as depicted in the embodiment of fig1 . multiple seal parts 13 , 14 were formed and an edge barrier 50 was provided between strongly adhesive seal part 14 and the edge of substrate 10 . the liquid crystal display panel constructed in accordance with this embodiment was connected with a connecting sheet having a conductive passage ( made of e . g . graphite , silver powder ), and an adhesion layer ( e . g . heat seal layer or adhesive layer ) formed on a flexible plastic sheet by hot pressing ( or by merely pressing ), and connected with a drive circuit substrate . edge barrier 50 prevents seal part 14 , which strongly adheres to the substrate , from forming an electrically insulating layer on the terminal . edge barrier 50 may also be made of the same resin , as seal part 13 , having low water permeability . by using the same material for barrier 50 and seal part 13 it is possible to form both elements in a single printing . when producing display panels in accordance with the invention electrode patterns were formed on a pair of large - sized substrates , such that a plurality of display panels could be produced . one substrate was provided with a resin having a strong adhesion to the substrate and the other with a resin having low water permeability . then the two substrates were laminated to give multiple layer seals and thereafter cut into individual display panels . reference is made to fig1 wherein an electrode 7 and an orientating agent 8 formed on each of bases 10 and 11 are depicted . electrode 7 and orientating agent 8 are not shown in fig1 - 12 . however , in each of those embodiments they are formed as shown in fig1 . electrode 7 is formed on each of substrates 10 , 11 and an orientating agent 8 is coated on substrate 10 , 11 over electrode 7 to impart orientation . a display device having a thickness of 1 mm or less where the display element , as constructed in the above described examples , was connected to a drive circuit substrate having substantially the same thickness as the display panel . the power source for the display device was a solar battery having substantially the same thickness as the display panel , and formed on a substrate by a screen printing process , evaporation process or a sputtering process . the solar battery was connected to the drive circuit substrate . such display devices are used for calculators , flat screen television sets , wrist watches , pocket watches , etc . while constructing the display device of example 23 the outer side of the display panel , the drive circuit substrate and the power source were covered with a plastic resin , such as polyester and polyvinyl resins . while in the above examples silicone type resin was used as the resin strongly adhesive to the substrate and epoxy type resin was utilized as the resin having low water permeability , similar results can be obtained by using other resins selected from the aforementioned groups . in constructing display panels having multiple seal parts it is possible to print low water permeability resin 13 in a discontinuous manner so that when the substrates are assembled air is allowed to escape from between seal parts 13 , 14 and seal part 13 becomes continuous . it is further possible to print resins 13 , 14 in a discontinuous manner and upon assembly cause low water permeability seal part 13 to form a continuous seal around the display medium . in addition , when constructing a display panel having a flexible substrate in accordance with the invention the electrode substrates may be provided with a barrier layer 5 ( fig1 ) against passage of air or moisture . barrier layer 5 prevents the passage of any substance deleterious to the display quality or display substance , such as air , moisture , etc . although it is more desirable to prevent both air and moisture from breaching barrier layer 5 a viable display panel which is satisfactory for use in many circumstances can be produced by protecting against either air or moisture . the display mediums 12 used in this invention are held between two substrates 10 , 11 at least one of which is flexible . the display medium is protected against invasion by any deleterious substance from both the electrode surfaces 7 and the seal surface , thereby forming a highly reliable display panel . barrier layer 5 may be formed , for example , on the display medium surface ( e . g . liquid crystal ), side ( hereinafter inside ) of the electrode substrate on the opposite side ( hereinafter outside ) or on both sides . where the barrier layer is formed on the flexible substrates the seal may be either a single or a multiple structure . however , where a multiple seal structure is used a more reliable display panel is provided . the barrier layer may be composed of an organic type barrier layer or an inorganic type barrier layer both of which are described in more detail below . various types of material may be used as the organic type barrier layer . they serve to prevent moisture or air from invading the display medium ( e . g . liquid crystal ) layer . the organic barrier layer may be formed on the inside or outside substrate surfaces . when the barrier layer is formed on the inside substrate surface ( i . e ., the display medium layer side ), the order of formation may be electrode substrate , electrode , barrier layer and finally orientated layer . it may also be electrode substrate , barrier layer , electrode and then orientated layer . in the former case the barrier layer may also act as the orientated layer . the barrier layer should not be formed on the terminal portion which is connected with the outside circuitry or the upper - lower conductive part connecting the upper and lower electrode bases with an electrically conductive material . there are additional restrictions on the barrier layer , in a liquid crystal display panel , where the barrier layer is formed on the liquid crystal layer side of the substrate . for example , the orientating agent used should not cause the invasion of any deleterious substances into the liquid crystal from the orientating agent upon the calcination of the orientating agent , and so forth . however , this restriction is unnecessary when the barrier layer is formed on the opposite side of the substrate surface from the liquid crystal layer . the barrier layer may be made of polyvinylidene chloride . a polyvinylidene chloride barrier layer acts as both a moisture and air barrier . a polyvinylidene chloride barrier layer is formed only on the outside surface of the substrate . this is necessary because if the barrier layer is formed on the display medium layer ( e . g . liquid crystal ) side , then during calcination of the orientating agent , chlorine ions and sometimes hydrochloric acid are formed from the polyvinylidene chloride and invade the display medium , ( e . g . liquid crystal ), thereby deteriorating the display medium ( e . g . liquid crystal ). the barrier layer may also be made of polyvinyl alcohol ( hereinafter referred to as pva ), which has excellent air barrier properties although it has weak moisture barrier properties . the pva barrier layer can be formed on either surface of the substrate , that is on the display medium ( e . g . liquid crystal ) layer side or the opposite side . the barrier layer may also be made of polyacrylonitrile ( hereinafter referred to as pan ), in which case the barrier layer has excellent air barrier properties and weak moisture barrier properties . the pan barrier layer may be formed on either surface of the substrate , that is on the display medium ( e . g . liquid crystal ) layer side or on the opposite side . the barrier layer may also be formed of polyvinyl butyral ( hereinafter referred to as pvb ), in which case the barrier layer has high air barrier properties but weak moisture barrier properties . if the pvb barrier layer is formed on the display medium ( e . g . liquid crystal ) layer side , the lamination of the orientating agent with the barrier layer , by disolving the orientating agent in a solvent , causes the barrier agent to swell or tend to dissolve because the display medium ( e . g . liquid crystal ) is also a kind of organic solvent . the pvb barrier layer should therefore , be formed on the substrate surface on the side opposite to the display medium ( liquid crystal ) layer . the barrier layer may also be made of a mixture of pva and an acrylic resin . the proportion of the acrylic resin incorporated in the mixture is about 20 - 50 % by weight based on the total composition , preferably about 30 % by weight . such a barrier layer may be formed on either surface of the substrate , that is , the display medium layer side or the opposite side . this barrier layer may also be formed as an ultraviolet curing type , and this is especially effective in resisting the invasion of moisture . the barrier layer may also be made of a mixture of pvb and an epoxy type resin . in this case the epoxy type resin incorporated is about 10 - 40 % by weight based on the total composition , and preferably , about 20 % by weight . such a barrier layer may be formed on either the inside or outside surfaces of the substrate . the barrier layer may also be made of a combination of a coat of a urethane type primer and pan layer thereon . the thickness of the urethane type primer necessary so that the base does not lose its flexibility is about 500 å - 5μ and preferably 1 - 2μ . by using a urethane type primer the adhesion of the pan to the substrate is enhanced . the aforenoted organic type barrier layers possess sufficient moisture and air barrier properties if they are about 5μ thick or more . a thickness of about 5 - 50μ allows for flexibility while maintaining the desired barrier properties . it is also possible to provide an acrylic undercoat layer on the substrate and form an organic type barrier layer thereon or on the surface opposite to the acrylic undercoat layer . the acrylic undercoat layer is made of an acrylic resin which is a thermosetting resin . therefore , when the acrylic undercoat layer has been formed on the liquid crystal layer side of the substrate it does not react with and is not swollen by the solvent used to dissolve the orientating agent when the barrier layer is formed . the invasion of deleterious substances attributable to the various barrier layers into the display medium , which can occur during the formation of the barrier layer , may be prevented where the acrylic undercoat layer is formed on the display medium ( e . g . liquid crystal ) layer side rather than on the barrier layer side . to achieve the above described effect the acrylic undercoat layer is formed to a thickness of about 500 å or more . in order for the substrate to retain its flexibility ( which means that the undercoat layer does not break when the substrate is bent ), the thickness of the acrylic undercoat layer is suitably up to about 5μ and preferably 1 - 2μ . an example is where an acrylic undercoat was formed on the base surface on the side opposite to the display medium ( e . g . liquid crystal ) layer , and thereafter a barrier layer of polyvinylidene chloride was formed . in addition , pan and pva can act as both barrier layer and orientated layer . one inorganic type barrier layer is a sio 2 layer . this silicone dioxide layer may be formed on either surface of the substrate . barrier properties are imparted with a thickness of about 0 . 5μ or more . in order that the base has flexibility , the thickness of the silicone dioxide layer is preferably about 0 . 5 - 2μ and more preferably about 1μ . the silicone dioxide layer may be formed by deposition , spattering or by coating an organic or inorganic material containing si and thereafter affecting a chemical reaction or heat treatment . another inorganic barrier layer is a phosphoric acid - iron type coating layer . a specific example is phosphate glass incorporating iron . a 5μ thickness can provide barrier properties . however , in order to secure both flexibility and barrier properties a thickness of about 10μ is preferred . this barrier layer may be formed on either side of the substrate but preferably on the opposite side from the display medium ( e . g . liquid crystal ) layer side . as has been described above in detail , a display panel of , e . g . liquid crystal , constructed in accordance with the invention as above using flexible substrates to sandwich a display medium ( e . g . liquid crystal ), successfully avoids various problems which have been encountered in producing such display panels . first , where flexible substrates are used , it is generally difficult to bond the substrates to each other , sandwiching the display medium ( e . g . liquid crystal ), without causing any harm to the display medium ( e . g . liquid crystal ). however , when a display device using the display panel of , e . g . liquid crystal , constructed in accordance with this invention is constructed , the display panel having multiple seal parts is resistant to bending and thus handling of the display panel ( of e . g . liquid crystal ), which is easily bendable by a weak force during construction . since a display panel ( of e . g . liquid crystal ), constructed in accordance with the invention may be used in a bent form , and the advantages of a display panel ( of e . g . liquid crystal ), composed of flexible substrates may be utilized to their maximum extent . further , even a display panel made using substrates composed of an innately hard substrate material or in a thick form and therefore difficult to bend can sometimes be made flexible by thinning the substrate . where it is desired to make the display panel and consequently the display device thinner it is often necessary that the substrate , display panel and display device should be flexible . the multiple seal part and barrier layer of this invention are extremely useful for display panels and display devices in these situations . it will thus be seen that the objects set forth above , among these made apparent from the preceding description , are efficiently attained and , since certain changes may be made in carrying out the above process and in the construction set forth without departing from the spirit and scope of the invention , it is intended that all matter contained in the above description and shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described and all statements of the scope of the invention which , as a matter of language , might be said to fall therebetween . | 8 |
referring now to the drawing figures , wherein like references numerals identify identical or corresponding elements throughout the several views , an embodiment of the presently disclosed structure and method of forming fuse and antifuse structures will now be disclosed in detail . in the following description , numerous specific details are set forth , such as particular structures , components , materials , dimensions , processing steps and techniques , in order to provide a thorough understanding of the present invention . however , it will be appreciated by one skilled in the art that the invention may be practiced without these specific details . in other instances , well - known structures or processing steps have not been described in detail to avoid obscuring the invention . the materials described herein are employed to illustrate the present disclosure in one application and should not be construed as limiting . it will be understood that when a layer is referred to as being “ on ” or “ over ” another layer , it can be directly on the other element or intervening layers may also be present . in contrast , when a layer is referred to as being “ directly on ” or “ directly over ” another layer , there are no intervening layers present . it will also be understood that when a layer is referred to as being “ connected ” or “ coupled ” to another layer , it can be directly connected to or coupled to the other layer or intervening layers may be present . the present disclosure provides an apparatus and a method for fabricating an integrated circuit having reversible electromigration for enhancing the efficiency of a fuse and antifuse structure . in one embodiment , a vertical sublithographic structure is provided including a fuse and antifuse structure having an airgap therewithin for enhancing programming thereof . the airgap is adapted for reducing the heat loss during programming and for increasing the degree or electromigration . in addition , the apparatus and method is not limited by the capability of the lithographic tool and processes . in a second embodiment , a horizontal stack is provided having a constrict region for crating a region of high material divergence and current density for enhancing the fuse and antifuse action . the structure described herein can be made using conventional techniques of back end of the line ( beol ) processing known to those skilled in the art . in addition , front end of the line ( feol ) and middle end of the line ( mol ) processing are also envisioned . fig1 - 6 illustrate a vertical sub - lithographic structure for forming a compact fuse and antifuse structure having an airgap to enhance the programming of an electronic fuse , in accordance with the present disclosure . with initial reference to fig1 , an interconnect structure is illustrated and is designated generally as interconnect structure 100 . interconnect structure 100 includes generally a first dielectric layer 102 formed on a semiconductor substrate ( not shown ) and containing therewithin a first interconnect features 104 a and 104 b . a capping layer 106 is provided over first dielectric layer 102 and first interconnect features 104 a and 104 b . in one embodiment , capping layer 106 includes a thickness ranging from about 15 nm to about 55 nm . a second dielectric layer 108 is disposed on the upper exposed surface of capping layer 106 . semiconductor substrate may include any of several semiconductor materials well known in the art , such as , for example , a bulk silicon semiconductor substrate , silicon - on - insulator ( soi ) and silicon - on - sapphire ( sos ). other non - limiting examples include silicon , germanium , silicon - germanium alloy , silicon carbide , silicon - germanium carbide alloy and compound ( i . e . iii - v and ii - vi ) semiconductor materials . non - limiting examples of compound semiconductor materials include gallium , arsenide , indium arsenide and indium phosphide semiconductor material . typically , semiconductor substrate may be about , but is not limited to , several hundred microns thick , for example a thickness ranging from about 0 . 5 mm to about 1 . 5 mm . in one embodiment , first dielectric layers 102 include a dielectric constant , k , of about 4 . 0 or less and a thickness ranging from about 200 nm to about 450 nm . dielectric layer 102 may include any interlevel or intralevel dielectric , and may be porous or non - porous . suitable materials include , but are not limited to , sin , sio2 , si3n4 , sicoh , silk ( a polyarylene ether available from dow chemical corporation ), jsr ( a spin - on silicon - carbon contained polymer material available from jsr corporation ), silesquioxanes , c doped oxides ( i . e . organosilicates ) that include atoms of si , c , o , and / or h , thermosetting polyarylene ethers , etc . or layers thereof . it is understood , however , that other materials having different dielectric constant and / or thickness may be employed . second dielectric layer 108 may include the same or different dielectric material as that of first dielectric material 102 . moreover , the processing techniques and thickness ranges described hereinabove with respect to first dielectric 102 are also applicable to second dielectric 108 . capping layer 106 is formed through conventional deposition processes , such as , for example , cvd , atomic layer deposition ( ald ), physical vapor deposition ( pvd ), plasma enhanced chemical vapor deposition ( pecvd ), etc . capping layer 106 may include any of several materials well known in the art , for example , si3n4 , sic , sio2 , and sic ( n , h ) ( i . e ., nitrogen or hydrogen doped silicon carbide ), etc . with continued reference to fig1 , lines 112 a , 112 b , 112 c and 112 d are formed including damascene lines 112 a and 112 d and dual damascene lines 112 b and 112 c , as illustrated by the figure . dual damascene lines 112 b and 112 c includes contact vias extending through second dielectric layer 108 and capping layer 106 for connecting with first interconnect features 104 a and 104 b , respectively . first interconnect features 104 a and 104 b and lines 112 a , 112 b , 112 c and 112 d include a conductor material 116 and a highly resistive diffusion barrier 118 to prevent conductive material 116 from diffusing . diffusion barrier 118 is deposited using atomic layer deposition ( ald ), or alternatively , a chemical vapor deposition ( cvc ) may be used . in one embodiment , diffusion barrier includes a thickness ranging from about 4 nm to about 40 nm . conductor material 116 may be selected from a material including , for example , cu , al , w , tin , tan , ta , mo , their alloys , and any suitable conductive material . highly resistive diffusion barrier 118 may be selected from a material including ta , tan , tin , ru , run , w , wn , or any other barrier material . with reference to fig2 , conductive material 116 is removed from damascene lines 112 a , 112 b , 112 c and 112 d through conventional techniques including , for example a combination of acid such as hf , h2so4 , hci , hno3 , etc ., for defining contact via openings 114 a , 114 b , 114 c and 114 d having diffusing barrier 118 . via openings 114 b and 114 c are configured for exposing a portion of interconnect features 104 a and 104 b , respectively . with reference to fig3 , a fuse material layer 120 is formed within via openings 114 a , 114 b , 114 c and 114 d over diffusion barrier 118 . in particular , fuse material layer 120 is deposited non - conformally thus overhanging 122 on a top portion of and abutting via openings 114 a , 114 b , 114 c and 114 d for creating a high material divergence and a high current density area of a bottom portion of the via openings . in one embodiment , the resultant sheet rho of diffusion barrier 118 and fuse material layer 120 is about 2 , 000 to 10 , 000 ohms / square . fuse material layer 120 may be selected from a material including , for example , cu , ru , ir , rh , pt , or any other suitable material . in one embodiment , fuse material 120 includes a thickness ranging from about 10 nm to about 100 nm . with reference to fig4 , a blanket deposition of a third dielectric layer 124 is formed over structure 100 through , for example , a cvd technique . as illustrated by the figure , third dielectric layer 124 partially fills via openings 114 a , 114 b , 114 c and 114 d . in particular , because of overhang portion 122 of via openings 114 a , 114 b , 114 c and 114 d and the nature of cvd deposition , a portion of third dielectric layer 124 acts as a plug for creating fuse element 125 a , 125 b , 125 c and 125 d , each having airgap 126 . airgaps 126 provide room for the fuse material to expand upon heating and ablation during programming under which a high current density is imparted to the fuse material . also , compared to a solid plug , the structure of airgaps 126 will dissipate less heat away and indirectly enhance the sensitivity of the programming . third dielectric layer 124 may comprise the same or different dielectric material as that of first dielectric material layer 102 . moreover , the processing techniques and thickness ranges described hereinabove with respect to first dielectric layer 102 are also applicable to third dielectric layer 124 . with reference to fig5 , electroplates 130 a , 130 b , 130 c and 130 d are formed in third dielectric layer 124 using standard patterning , through lithographic , etching processes and metallization . electroplates 130 a , 130 b , 130 c and 130 d connect with fuse elements 125 a , 125 b 125 c and 125 d , as illustrated by the figure . in addition , electroplates 130 a , 130 b , 130 c and 130 d each include a conductive material 128 and diffusion barrier 118 . conductive material 128 may comprise the same or different materials as that of conductive material 116 . with reference to fig6 , electroplates 130 a , 130 b , 130 c and 130 d are connected to electroplates 104 a and b via electronic fuse elements 125 a , 125 b , 125 c and 125 d . in particular , fuse element 125 a , for example , can be programmed through interconnect feature 130 a and 130 b . similarly , fuse element 125 b can be programmed through interconnect feature 130 a and 130 c or interconnect feature 130 b and 104 a or interconnect feature 130 c and 104 a . in addition , fuse element 125 c may be programmed through electroplates 130 c and 130 d or through electroplates 130 b and electroplates 104 b ; or through electroplates 130 d and interconnect features 104 b . finally , fuse element 125 d may be programmed through electroplates 130 d and 130 e . electromigration is the movement of material as a result of momentum transfer between the materials with the flowing electron . as an example , current ( electron in opposite direction of current by convention ) can flow from about electroplate 130 a through fuse element 125 a onto electroplate 130 b , onto fuse element 125 b , then up electroplate 130 c , etc . accompanying the current flow is a migration of material within the chain of conductors . when a sufficient high current density is created within the fuse element , sufficient mass transfer will results in void formation and as a result leading to an increase of electrical resistance , and eventually lead to an open condition within the current conducting chain . in addition , the electromigration can be made reversible by changing the direction of the programming current , as illustrated by fig1 . the resistance of electroplates 130 a , 130 b , 130 c and 130 d can be increased by inducing electromigration through flowing current into electronic fuse element 125 a , 125 b , 125 c and 125 d . the resistance can be reduced back by simply reversing the current flow . thus fuse and antifuse functionality can be achieved by a single device . with reference to fig7 , in conjunction with fig1 - 6 , a flow diagram of an exemplary method of fabricating an integrated circuit having reversible fuse and antifuse structures , in accordance with the present disclosure , is illustrated . a device structure , such as , for example , an interconnect structure 100 is provided . in accordance with the present disclosure , initially , at step 150 a first dielectric layer 102 is formed on a semiconductor substrate . at step 152 first interconnect features 104 a and 104 b are formed within first dielectric layer 102 . at step 154 , a capping layer 106 and a second dielectric layer 108 are sequentially deposited over first dielectric 102 . at step 156 , lines 112 a , 112 b , 112 c and 112 d are formed extending through second dielectric layer 108 and capping layer 106 for connecting with first interconnect features 104 a and 104 b . at step 158 , a conductive material 116 is removed through a wet etching process from lines 112 a , 112 b , 112 c and 112 d thus forming cavities 114 a , 114 b , 114 c and 114 d . at step 160 a non - conformal fuse material deposition is formed on cavities 114 a , 114 b , 114 c and 114 d for defining overhang portion 122 of cavities 114 a , 114 b , 114 c and 114 d . at step 162 , a blanket deposition of a third dielectric layer 124 is the formed using cvd technique for defining fuse elements 125 a , 125 b , 125 c and 125 d having airgap 126 . at step 164 an interconnect features 130 a , 130 b , 130 c and 130 d are formed within third dielectric layer 124 for connecting with fuse elements 125 a , 125 b , 125 c and 125 d . fuse elements 125 a , 125 b , 125 c and 125 d are then programmed . with reference to fig8 - 12 , a second embodiment of an integrated circuit having reversible electromigration for enhancing the efficiency of a fuse and antifuse structure is described . in this particular embodiment , a parallel stack with a constrict region is formed on a semiconductor substrate for forming a region of high material divergence and current density to enhance the fuse and antifuse action . with initial reference to fig8 , an electrical structure is provided and is designated generally as electrical structure 200 . electrical structure 200 includes a highly resistive material 204 having a thickness ranging from about 20 nm to about 200 nm formed on a semiconductor substrate 202 . the combined sheet rho of the stack formed by semiconductor substrate 202 and resistive material 200 ranges from about 2 , 000 to about 10 , 000 ohms / square . highly resistive material 204 includes , for example doped poly or ge or sige , or a single crystal si , etc . in addition , similar to diffusion barrier 118 , resistive material 204 may be selected from a material including ta , tan , tin , ru , run , w , wn . with reference to fig9 , an electrically conductive material 206 is deposited over resistive material 204 for defining a stack having a combined sheet rho ranging from about 200 to about 2 , 000 ohms / square . conductive material 206 may be deposited by sputtering , evaporation , cvd or ald . in another embodiment , conductive material 206 includes a nickel silicide , which is deposited by co - sputtering ni and si and then reacted to form silicide by thermal annealing . with reference to fig1 , in conjunction with fig1 , resistive material 204 and conductive material 206 are patterned using standard lithography steps followed by rie process for selectively etching a portion of resistive material 204 and conductive material 206 and for defining a trapezoidal shape having a constriction region 212 ( fig1 ). reactive ion etching of tin can be done in an ar / cf3 / cc13 or cbr3 chemistry . if nickel silicide is used , it is easier to deposit blanket silicon first , then do litho and standard si etch to define the trapezoidal shape si followed by blanket nickel or nickel alloy deposition such as sputtering . nickel mono - silicide will be formed by subjecting the substrate to a rta process ( 300 - 450 c for 30 seconds up to 2 minutes ). unreacted nickel can be stripped of by various wet etchant including but not limited to nitric acid , nitric acid - acetic acid mixture . with reference to fig1 , electrical contacts 208 are formed by a blanket deposition of a conductive material , for example , by sputtering , evaporation , cvd , ald , electroless or electrolytic plating . the conductive material may includes , for example , cu , al , w , tin , tan , ta , mo , their alloys , and any suitable conductive material . a standard lithographic masking and rie is then followed . in an embodiment where the conductive material includes cu , a standard damascene process may be followed . alternatively , a thorough - mask electrolytic plating followed by wet etching of the conductive material may be performed . with reference to fig1 , a simplified top and cross sectional views of the semiconductor substrate of fig1 is illustrated having a taper design of fuse and antifuse structure , in accordance with the present disclosure . macro void elements 210 are formed as a result of electromigration in the fuse and antifuse structure as electric current flow through the structure from one end to the other end . a very high resistance results if a high concentration of macro void elements 210 are created at construct region 212 . void elements 210 may be swept away from taper portion 214 and resistance will be decreased as void elements 210 become a less volume fraction of the much broader section . the structure 200 having construct region 212 creates a region of high material divergence and current density to enhance the fuse and antifuse action . it is noted that structure 200 is reversible , as indicated by directional arrows 214 . with reference to fig1 , an experimental data shows resistance measurements from the fuse andti - fuse structure shown in fig1 . during the forward - current stress , resistance of this structure increases with time due to electromigration effect . however , resistance of the structure is “ recovered ,” i . e . decrease , during the reverse current stress . this data demonstrate the feasibility of the structure shown in fig1 for fuse and antifuse applications . with reference to fig1 , in conjunction with fig8 - 12 , a flow diagram of an exemplary method of fabricating a reversible fuse and antifuse structure having a constriction region , in accordance with the present disclosure , is illustrated . in accordance with the present disclosure , initially at step 250 , a resistive material 204 and a conductive material 206 is sequentially formed over a semiconductor substrate 202 . at step 252 , resistive material 204 and conductive material 206 are patterned and a rie process is followed for etching a portion thereof . at step 254 electrical contacts 208 are formed through conventional lithographic mask and rie . finally , at step 256 , constriction region 212 is formed for defining material divergence and forming void elements 210 . it will be understood that numerous modifications and changes in form and detail may be made to the embodiments of the presently disclosed structure and method of forming reversible electronic fuses and antifuse structures for semiconductor devices . it is contemplated that numerous other configuration of the fuse and antifuse structures may be used , and the material of the structures and method may be selected from numerous materials other than those specifically disclosed . therefore , the above description should not be construed as limiting the disclosed structure and method , but merely as exemplification of the various embodiments thereof . those skilled in the art will envisioned numerous modifications within the scope of the present disclosure as defined by the claims appended hereto . in short , it is the intent of the applicants that the scope of the patent issuing herefrom will be limited only by the scope of the appended claims . having thus complied with the details and particularity required by the patent laws , what is claimed and desired protected is set forth in the appended claims . | 7 |
in the attached fig1 , a cooling system in accordance with the invention is shown is by 10 . this includes a cold producing device 12 , a cold conveyance system 14 and an area 16 , in which cold is consumed . the cold producing device 12 has two cooling machines 18 and 20 , in which a cold carrier medium is cooled down by means of a cold vapour process generally known in the field of thermodynamics , and supplied to the cold conveyance system 14 along two parallel lines 22 and 24 of a cooling circuit 25 . in the cold conveyance system 14 , the two parallel lines 22 and 24 are united at a point 26 . cold carrier medium is supplied to a pump unit 30 by means of a supply line 28 provided with a specially controllable check valve 29 . the pump unit 30 has two pumps 32 and 34 which are controlled parallel to one another , and to which separately controllable check valves 36 and 38 are assigned . a cold carrier medium intermediary storage unit 40 is connected to the parallel arrangement of the pumps 32 and 34 in the pump unit 30 . this serves to equalize volume if there are thermal expansion effects or leakage effects . by means of the circulatory effect of the pump unit 30 , cooled down cold carrier medium is supplied to different cold consumers 44 , 46 and 48 by means of a supply line 42 . the cold consumers 44 , 46 and 48 are , for example , functional units which require cooling in the on - board kitchen ( galley ) of an aircraft , such as , for example , a cooling chamber which is filled with food and drinks , or computer units which must be cooled during use , or an aircraft video system . the cooled cold carrier medium is supplied from the supply line 42 via individual lines to the respective cold consumers 44 , 46 , 48 . the cold carrier medium is heated up in each of the cold consumers 44 , 46 , 48 , i . e . it absorbs this heat . in other words ,. the cold carrier medium dispenses its “ cold ” to the cold consumers 44 , 46 , 48 . the correspondingly warmed up cold carrier medium is then taken back to the cooling machines 18 and 20 of the cold producing device 12 through the cold conveyance system 14 via a return line 50 by means of the pump unit 30 . there , the cold carrier medium which has meanwhile heated up , is cooled back down , and can be taken back into the cold conveyance system 14 via the lines 22 and 24 . depending upon the size of the aircraft and the requirement for cold within the aircraft , the cooling system can be arranged and controlled differently . it is possible , for example , if there is likely to be a relatively large requirement for cold , to provide more cooling machines which can then be turned on as required , i . e . in operational situations where there is a large requirement for cold , and can be switched to idling state or totally turned off in operational situations where there is limited requirement for cold . equally , it is possible , when there is a large requirement for cold , to switch the check valve 29 to a check position so that all of the cooled - down cold carrier medium is supplied to the cold consumers 44 , 46 , 48 via the supply line 42 . in an operational state , however , where there is limited requirement for cold , the check valve 29 is opened so that part of the cooled - down cold carrier medium is supplied to the cooling machines 18 and 20 by means of the pump unit 30 . another possibility for the control of the cold output of the cooling system 10 is to control the circulation pumps 32 and 34 dependent upon requirement . a variation of the invention therefore proposes that the revolutions per minute of the pumps 32 and 34 can be continuously changed , and so the supply output of pumps 32 and 34 can also be changed within certain limits . with the cooling system 10 , it is also possible to open or to close the check valves 36 and 38 assigned to the pumps 32 and 34 dependent upon the current cold output requirement . this means that the valve position of check valves 36 and 38 can continuously be changed between a fully open position and a fully closed position . the same applies for check valve 29 . in this way , the supply volume of the cold conveyance system can also be specifically set . control of the pumps 32 and 34 and of the check valves 29 , 36 , 38 can , for example , be carried out dependent upon pressure values which are measured at different points within the cold conveyance system 14 , for example by a sensor 52 in the lines 42 . moreover , each of the consumers 44 , 46 , 48 can have a temperature sensor whereby the different controllable components of the system , such as the cold machines 18 , 20 , the pumps 32 and 34 , and the individual check valves 29 , 36 and 38 can be controlled dependent upon the temperatures measured in the consumers 44 , 46 and 48 . it is clear to the man skilled in the art that parameters for the cold carrier medium can also be measured at a number of other points within the cooling system 10 , such as temperature , pressure , flow speed etc ., and the aforementioned controllable components of the cooling system 10 can be controlled with reference to the values measured . the invention shows a cooling system 10 with which a number of different cold consumers 44 , 46 , 48 can be cooled centrally with a sufficiently strongly cooling cold carrier medium for the purpose of safe and reliable operation , whereby the cold output of the cooling system 10 can be adapted to the current requirement for cold . in this way , the degree of efficiency during partial loading operation , i . e . with a relatively low current requirement for cold , can be increased . ultimately , this leads to reduced consumption of electrical energy within the aircraft which also means reduced fuel consumption of the aircraft . moreover , with the cooling system 10 in accordance with the invention , the cooling machines 18 , 20 used are not continuously operational , but can be switched off as required . this means that their operational life can be considerably extended . fig2 shows a second embodiment of a cooling system in accordance with the invention which is generally identified by 110 . in order to avoid repetition , in the following description of fig2 , the same reference numbers will be used for components operating in the same way or of the same type as with the previous description of fig1 , but modified with by “ 1 ”. fig2 shows that the cold conveyance system is subdivided into two cooling circuits 125 and 127 . the cooling circuit 125 , shown in fig2 by hatched lines , is hydraulically uncoupled from the cooling circuit 127 , which is shown in fig2 with continuous lines . both cooling circuits 125 and 127 are thermally coupled with the cooling machines 118 and 120 in which the cold carrier medium supplied to the cooling circuits 125 and 127 is cooled down . in both cooling circuits 125 and 127 , two circulation pumps are respectively provided , i . e . in cooling circuit 125 the circulation pumps 132 and 134 , and in cooling circuit 127 , the circulation pumps 156 and 158 . circulation pumps 132 and 134 and circulation pumps 156 and 158 are controlled respectively in parallel to one another . a storage unit for cold carrier medium is connected to each parallel control of the circulation pumps , i . e . storage unit 140 in cooling circuit 125 and storage unit 160 in cooling circuit 127 . the cooling machines 118 and 120 , circulation pumps 132 and 134 as well as 158 and 156 and the storage units 140 and 160 are combined in one central unit 164 , and positioned at a point within the aircraft where they do not form an obstruction . from this central unit 164 , cold carrier medium can then be supplied to the different cold consumers by means of the lines of cooling circuits 125 and 127 . the cooling circuit 125 has , for example , the cold consumers 144 , 146 and 148 in the form of galley air coolers of an on - board kitchen ( galley ) positioned on the side of the aircraft . in addition , the cooling circuit 125 has an electronic air cooler 162 with which an electronic appliance of the aircraft is cooled . moreover , another section of kitchen air coolers for on - board kitchens ( galleys ) positioned in the centre of the aircraft is supplied with cold by means of the cooling circuit 125 , namely kitchen air coolers 166 , 170 and 174 . finally , a check valve 186 is also provided in the cooling circuit 125 in order to be able to vary the flow of cold conveyance medium through the cooling circuit 125 . the cooling circuit 127 , on the other hand , supplies the galley air coolers 180 , 182 and 184 with cold . moreover , the electronic cooler 178 is also supplied with cold from the cooling circuit 127 . in addition , the cooling circuit 127 cools another section of galley air coolers of the galleys positioned in the centre of the aircraft , namely galley air coolers 168 , 172 and 176 . the cooling circuit 127 also has a check valve 188 with which the flow of cold carrier medium can be controlled . based upon the schematic representation in accordance with fig1 , fig2 shows that , with the cooling system in accordance with the invention , different cold consumers can be supplied with cold carrier medium more or less as desired , dependent upon requirement and the aircraft fittings , and at the same time high safety standards can be met . the advantage of the version in accordance with fig2 , for example , is that a minimum cold output can be provided even if one of the cooling machines 118 and 120 in both cooling circuits 125 and 127 fail . even if one of the circulation pumps within a cooling circuit 125 and 127 fails , the supply of cold carrier medium can still be guaranteed by the parallel control of pumps 132 and 134 as well as 158 and 156 . even if one of the cooling circuits 125 and 127 completely fail as a result of leakage effects or other defects , cooling of the essential functional units within the aircraft is guaranteed because the respective other cooling circuit , which is still functional , will provide cooled cold carrier medium . | 5 |
referring now to the drawings , fig1 illustrates a dexterity evaluation apparatus generally shown at 1 according to the present invention . the apparatus 1 includes a housing having top portion 4 and bottom portion 5 , circuit panel 2 , and a display 3 for a digital timer contained within the housing . the top portion 4 and bottom portion 5 are releasably secured together by a latch 6 . the timer display 3 is preferably mounted on the side of the housing facing the individual completing the dexterity evaluation . the housing 1 has a power control switch 7 and a female electrical receptacle 8 for interconnection to an optional separate dexterity evaluation apparatus to be discussed later . the circuit panel 2 has two identical arrays of apertures . a first array of apertures 9 has female receptacles 10 and 11 for receiving male plugs . the second array of apertures 12 has an identical arrangement of femal receptacles 14 and 15 for receiving a similar pair of male plugs . the male plugs are used to start and stop the digital timer display 3 according to a circuit and logic means which shall be discussed later . the first array of apertures 9 has electronic circuit components , shown as 13 , installed thereon in a predetermined arrangement . in the preferred embodiment , the electronic circuit components 13 comprise simple jumper wires of varying lengths . the wires have distinguishing indicia , such as color , which uniquely identify wire members of different lengths . referring to fig3 the bottom housing portion 5 preferably includes a storage panel 16 for storing a collection of wire members 17 of varying length which will be used by the individual when conducting the dexterity test . bottom portion 5 also has a storage compartment 18 containing male plugs 19 and 20 . the wire members 17 stored on panel 16 are color coded according to length in the same manner as the pre - wired components 13 in the first array 9 illustratead in fig1 . fig5 is a flow diagram of the dexterity evaluation process showing a sequence of steps necessary to utilize the apparatus of this invention . initially , the top portion 4 is detached from bottom portion 5 by opening latch mechanism 6 . the top portion 4 is then placed in front of the individual taking the dexterity test . the male plugs 19 and 20 are removed from storage compartment 18 of the lower housing portion 5 and installed in the female receptacles 10 and 11 in the pre - wired array 9 . the power control switch 7 is then turned on which resets the digital timer display 3 to &# 34 ; 1000 &# 34 ;. the dexterity test is initiated by removing the first male plug 19 from female receptacle 10 and inserting it into female receptacle 14 . this also serves to start the digital timer display countdown from &# 34 ; 1000 &# 34 ;. the individual being tested then proceeds to remove the wire members 17 from storage panel 16 , and install them in the second array of apertures 12 so as to duplicate the pre - wired arrangement of components 13 installed on the first array of apertures 9 . when completed , the individual removes the second male plug 20 from female receptacle 11 and inserts it into female receptacle 15 . this stops the digital timer which holds the count at the then current display . the installed wire members 17 in array 12 are then visually checked for correspondence with the pre - wired components 13 in array 9 and the elapsed time recorded . referring now to fig5 a and 5b , a circuit diagram of the digital timing circuitry is shown . the timing circuit may be divided into five units , including a control circuit 1000 , an oscillator 1001 , a counter circuit 1002 , a digital display 1003 , and a reset circuit 1004 . the control circuit 1000 controls the application of the output signal from the oscillator 1001 to the counter circuit 1002 to thereby control the time period during which the counter is decremented . the frequency of the output signal from the oscillator circuit 1001 determines the rate at which the counter circuit 1002 is decremented . the output of the counter circuit 1002 in turn is used to drive the digital display 1003 and the reset circuit 1004 is used to clear the digital display 1003 . the control circuit 1000 includes the power control switch 7 , which has three pairs of contacts that are mechanically interconnected . contact pairs 25 and 26 are both engaged when the power control switch 7 is turned on , thereby connecting the positive terminal of a 9 v d . c . storage battery 27 to v dd , and the negative terminal of battery 27 to v ss . contact pair 28 is engaged when the power control switch 7 is turned off thereby connecting v dd to v ss through resistor r1 . the control circuit 1000 further includes a normally open electrical connection between points 29 and 30 that is completed by installing a male plug 19 into female receptacle 14 . this provides a path for current flow from v dd through r2 to v ss causing the start input of ic1 to switch from a logic &# 34 ; 1 &# 34 ; to a logic &# 34 ; 0 &# 34 ;. this serves to start the digital display countdown . when male plug 20 is installed in female receptacle 15 , the electrical connection between points 31 and 32 is completed providing a path for current flow between v dd and v ss through r3 . this causes the output of exclusive or gate ic13 and hence the stop input to ic1 to switch from a logic &# 34 ; 0 &# 34 ; to a logic &# 34 ; 1 &# 34 ;. such a logic change stops the digital timer display countdown . ic1 comprises a nor logic gate which serves to control the passage of the output signal from the oscillator circuit 1001 to the counter circuit 1002 and thereby control the starting and stopping of the digital timer . specifically , when &# 34 ; start &# 34 ; plug 19 has not yet been inserted into receptacle 14 and the start input of ic1 is hi , the output of ic1 is clamped lo regardless of the logic status of the other inputs to ic1 . similarly , when the stop input of ic1 goes hi upon the insertion of &# 34 ; stop &# 34 ; plug 20 into receptacle 15 , the output of ic1 is clamped lo regardless of the logic states of the other inputs to ic1 . however , when both the start and stop inputs are lo , corresponding to &# 34 ; start &# 34 ; plug 19 being inserted int receptacle 14 and receptacle 15 being &# 34 ; open &# 34 ; ( assuming also for the moment that the zero input to ic1 is also lo ), nor gate ic1 will simply act as an inverter with respect to the oscillator output signal provided to the pulse input of ic1 , thereby effectively allowing the oscillator output signal to pass therethrough . the oscillator circuit 1001 is adapted to produce a square - wave output signal on line 40 at an appropriate frequency for decrementing the digital counter circuit 1002 . the oscillator output signal is generated by a conventional 3 . 6 mhz quartz crystal oscillator whose output is provided to a programmable cmos divider circuit ic2 for reducing the frequency of the 3 . 6 mhz signal to a suitable level . the factor by which ic2 divides the frequency of the 3 . 6 mhz quartz crystal signal is determined by a tunable rc network comprised of series resistors r3 and r4 , capacitor c1 , and adjustable capacitor c2 . capacitor c2 in the preferred embodiment is tuned so that ic2 divides the 3 . 6 mhz oscillator pulse generated by qc1 down to a 60 hz signal . the 60 hz oscillator output signal on line 40 is supplied through nor gate ic1 to the input of a 7 - stage ripple - carry binary counter ic3 . counter ic3 further divides the frequency of the oscillator signal down to 1 . 8 hz . the 1 . 8 hz output signal from counter ic3 is in turn provided to the input of the first stage ic4 of a 4 - stage digital counter circuit ic4 - ic7 . the first three stages ic4 - ic6 of the digital counter circuit comprise 4024 synchronous 4 - bit up / down decade counters . the fourth stage ic7 comprises a d - type flip - flop . ic4 provides the &# 34 ; ones &# 34 ; count , ic5 provides the &# 34 ; tens &# 34 ; count , ic6 provides the &# 34 ; hundreds &# 34 ; count , and ic7 provides the &# 34 ; thousands &# 34 ; count . when the counter begins a cycle , ic4 starts with a zero and counts down to the bcd equivalent of a nine , whereupon a borrow pulse is generated at ic4 borrow . ic4 borrow is connected to ic5 count down . ic5 also starts with a zero and counts down upon receipt of each borrow pulse from ic4 to the bcd equivalent of a nine , whereupon ic5 generates a borrow pulse at ic5 borrow . ic5 borrow is connected to ic6 count down . ic6 also starts with a zero , and counts down upon receipt of each borrow pulse from ic5 to the bcd equivalent of a nine , whereupon ic6 generates a borrow pulse at ic6 borrow . ic6 borrow is in turn connected to ic7 in . flip - flop ic7 produces a logic &# 34 ; 1 &# 34 ; at its q2 output upon receipt of a hi signal at its clear input and a logic &# 34 ; 0 &# 34 ; at its q2 output upon receipt of a hi borrow signal from ic6 at its in input . the borrow outputs of counters ic4 - ic6 together with the q2 output of flip - flop ic7 are provided to the inputs of a 4 - input nor logic gate ic8 . the output of nor - gate ic8 will therefore go hi when all of the inputs thereto are a logic &# 34 ; 0 &# 34 ;. this condition will occur when the count on ic4 , ic5 , ic6 , and ic7 reaches the bcd equivalent of the base ten digit &# 34 ; 0000 &# 34 ;. a logic &# 34 ; 1 &# 34 ; is then generated at the output of nor - gate ic8 which is in turn provided t0 the zero input of nor - gate ic1 . as previously discussed , a logic &# 34 ; 1 &# 34 ; at any one of the inputs to ic1 effectively clamps the output of ic1 at a logical &# 34 ; 0 &# 34 ; and prevents the passage of the oscillator output signal on line 40 to the digital counter portion of the circuit . thus , if the dexterity evaluation test is not completed within the time it takes for the digital timer to count down to &# 34 ; 0000 &# 34 ;, then the digital timer is automatically halted and the test procedure terminated . when the dexterity evaluation is completed prior to the timer count reaching the base ten digit &# 34 ; 0000 &# 34 ;, by virtue of the test individual inserting male plug 20 into female receptacle 15 , the completed electrical connection between 31 and 32 produces a logic &# 34 ; 1 &# 34 ; at the stop input to ic1 , thereby inhibiting further countdown of the digital counter portion of the circuit . the display portion of the circuit includes ic8 , ic9 , and ic10 , which comprise 4055 bcd - to - 7 - segment decoder / drivers . thus , ic8 , ic9 , and ic10 each convert a single digit bcd input to a base ten digit which is then illuminated by the seven segment digital display units ud1 , ud2 , and ud3 . the &# 34 ; thousandths &# 34 ; count in the display is provided by digital segment display element ud4 . since the display when initialized is set to the number &# 34 ; 1000 &# 34 ; and counted down therefrom , a full 7 - segment display is not needed for the thousandths count . display element ud4 is driven by the output of an exclusive - or gate ic11 which has a first input connected to the q2 output of flip - flop ic7 and a second input connected to receive the 60 hz oscillator signal on line 40 . when ic7 receives a reset signal , the q2 output of ic7 goes hi . when the 60 hertz oscillator pulse on line 40 is also hi , a logic &# 34 ; 1 &# 34 ; is produced at the second logic input to ic11 and the output of ic11 goes lo . when the 60 hertz oscillator pulse is a logic &# 34 ; 0 &# 34 ;, a logic &# 34 ; 0 &# 34 ; is produced at the second logic input to ic11 and the output of ic11 goes hi . thus , when the first logic input to ic11 from th q2 output of ic7 is a logic &# 34 ; 1 &# 34 ;, the output of ic11 comprises a 180 degrees phase shift of the 60 hertz oscillator pulse on line 40 . if the first logic input to ic11 from the q2 output of ic7 is a logic &# 34 ; 0 &# 34 ;, then the output of ic11 will duplicate the 60 hertz oscillator pulse . digital segment display ud4 produces a visual digit &# 34 ; 1 &# 34 ; when the frequency supplied at ud4 - p is 180 degrees out of phase with the frequency supplied at ud4 - a . ud4 appears blank when the frequencies are in phase . the frequencies are 180 degrees out of phase when the q2 output of ic7 is a logic &# 34 ; 1 &# 34 ;. when ic7 receives a first borrow pulse from ic6 , the q2 output of ic7 goes lo and the frequencies become in phase as previously described , resulting in a blank display at ud4 . ic3 , ic4 , ic5 , ic6 , and ic7 are reset by a logic &# 34 ; 1 &# 34 ; supplied to the respective clear pins of the individual elements . a momentary reset signal is produced by reset circuit 1004 each time the power control switch 7 is turned on . reset circuit 1004 includes an exclusive - or logic gate ic12 which has a first input connected to v dd through a resistor r5 and to v ss through a capacitor c3 . the second input to ic12 is directly connected to v dd , thereby resulting in a continuous logic &# 34 ; 1 &# 34 ; at the second input to ic12 . when the power control switch 7 is initially turned on , current flows between v dd and v ss through resistor r5 and capacitor c3 . the initial voltage change across capacitor c3 is sufficiently small to produce a logic &# 34 ; 0 &# 34 ; at the first input to ic12 . therefore , with a logic &# 34 ; 0 &# 34 ; at the first input to ic12 and a logic &# 34 ; 1 &# 34 ; at the second input to ic12 , the output of ic12 becomes a logic &# 34 ; 1 &# 34 ;. this logic &# 34 ; 1 &# 34 ; serves as the reset signal on line 42 . as capacitor c3 becomes fully charged , the voltage change thereacross increases , resulting in a logic &# 34 ; 1 &# 34 ; at the first input to ic12 . this change in the logic state of the first input to ic12 results in a logic &# 34 ; 0 &# 34 ; at the output of ic12 , thereby terminating the reset signal on line 42 . when power control switch 7 is turned off , v dd and v ss are connected through resistor r1 thereby draining any charge which may be stored in capacitor c3 . thus , each time the power control switch 7 is cycled , the reset pulse on line 42 is produced . in another embodiment of the invention , the control portion 1000 of the circuit includes an additional female electrical connection 8 best seen in fig1 which permits connection of the timer circuit to other testing apparatus , such as a separate dexterity evaluation device . the separate dexterity evaluation device is connected to the timer circuit by inserting a male electrical connector 100 into female receptacle 8 . referring to fig5 c , the timing circuit can be controlled by a separate dexterity testing device ( not shown ) by means of an electrical switch 101 associated with the device which may , for example , be actuated by the opening and closing of a lid 102 on the device . opening of the lid switch 101 would therefore serve to initiate the digital display countdown and closing of the lid switch 101 would serve to terminate the digital display countdown . the circuit embodiment shown in fig5 c consists of a modification of the control circuit portions producting the signal provided to the stop input to ic1 . the remainder of the circuit operates in the same manner as that described above . when the separate dexterity evaluation device is used , male plug 19 is installed in female receptacle 14 to produce a logic &# 34 ; 0 &# 34 ; at ic1 start , and male plug 20 is installed in female receptacle 15 to produce a logic &# 34 ; 0 &# 34 ; at the first logic input to exclusive or gate ic13 . the second logic input to ic13 is modified from the circuit embodiment previously discussed . the second logic input to ic13 is now the logic output of exclusive or gate ic14 . the first logic input to ic14 is connected to v ss thereby establishing a continuous logic &# 34 ; 0 &# 34 ;. the second logic input to ic14 is initially connected to v dd through a resistor r6 , thereby providing a logic &# 34 ; 1 &# 34 ; at the second input to ic14 and resulting in a logic &# 34 ; 1 &# 34 ; being provided at the output of ic14 . when switch 101 is closed , an electrical connection is completed between points 33 and 34 establishing a path between v dd and v ss through resistor r6 , resulting in a logic &# 34 ; 0 &# 34 ; at the second input to ic14 . with both logic inputs to ic14 at a logic &# 34 ; 0 &# 34 ;, the output of ic14 becomes a logic &# 34 ; 0 &# 34 ;. with both logic inputs to ic13 at a logic &# 34 ; 0 &# 34 ;, the output of ic13 similarly becomes a logic &# 34 ; 0 &# 34 ;, thereby providing a logic &# 34 ; 0 &# 34 ; signal to ic1 stop . with ic1 stop , ic1 start , and ic1 zero at logic &# 34 ; 0 &# 34 ;, ic1 output will allow the oscillator output to pass therethrough starting the digital timer countdown . when the lid switch 101 is opened , breaking the electrical connection between 33 and 34 , the second logic input to ic14 becomes a logic &# 34 ; 1 &# 34 ; and the output of ic14 changes to a logic &# 34 ; 1 &# 34 ;. when the output of ic14 is a logic &# 34 ; 1 &# 34 ;, the second input to ic13 also becomes a logic &# 34 ; 1 &# 34 ; which in turn changes the output of ic13 to a logic &# 34 ; 1 &# 34 ;. a logic &# 34 ; 1 &# 34 ; at the output of ic13 results in a logic &# 34 ; 1 &# 34 ; at ic1 stop which clamps the output of ic1 to a logic &# 34 ; 0 &# 34 ;, thereby preventing the passage of the oscillator output signal to the counter portion of the circuit and stopping the digital timer countdown . when the circuit embodiment including the modification illustrated in fig5 c is used without the separate apparatus , male plug 19 and male plug 20 are used to control the timer circuit according to the sequence described for the circuit embodiment previously described . while the above description constitutes the preferred embodiments of the present invention , it will be appreciated that the invention is susceptible to modification , variation , and change without departing from the proper scope or fair meaning of the accompanying claims . | 6 |
while it is not intended that the scope of the present invention be limited by any specific theory of operation , it is believed that infections , particularly those which are not controlled by the normal immunological response of a patient , can be treated using a photopheresis treatment according to the invention . the herein described treatment is also believed by the inventors to ( i ) restore the ability of a treated patient &# 39 ; s immune system to combat other infections , and ( ii ) restore the immune system &# 39 ; s anamnestic response to previous infections . in accordance with the photopheresis methods of the invention , treated infected cells as well as killed and / or attenuated pathogen , peptides , native sub - units of the pathogen itself ( which are released upon cell break - up and / or shed into the blood ) and / or pathogenic noninfectious pathogens may be used . mutation of the pathogen does not shield it from attenuation / inactivation during photopheresis and consequent generation of an immune response to the mutant forms of the pathogen . thus , the treatment methods according to the invention provide a dynamic autogenous vaccine against infection . the invention methods are also useful in the treatment of patients having an abnormally low white blood cell count . according to the claimeds methods , a photoactive compound is first administered to the blood of an infected patient . the photoactive compound may be administered in vivo ( e . g ., orally or intravenously ) or may be administered in vitro to a portion of the patient &# 39 ; s blood which has been removed from the patient by employing conventional blood withdrawal techniques . in accordance with the present invention , the photoactive compound selected should preferably be one that binds to the cell membrane of the pathogen and / or infected cells ( e . g ., by binding to a receptor and / or a nucleic acid fragment on the cell membrane ) and / or to a nucleic acid in the cell nucleus or cell cytoplasm upon activation by exposure to electromagnetic radiation of a prescribed spectrum , such as ultraviolet light , for the purpose of inactivating and / or attenuating the pathogen and permitting the so treated pathogen and / or infected cells to be presented to the immune system of the patient . psoralen compounds are particularly preferred for this purpose , especially the compound 8 - methoxypsoralen -- in which case uva radiation is preferred for activating said compound . next , the portion of the patient &# 39 ; s blood to which the photoactive compound has been administered is treated by subjecting the portion of the blood to photopheresis using said electromagnetic radiation -- for example , ultraviolet light . the photopheresis step is preferably carried out in vitro using an extracorporeal photopheresis apparatus . the photopheresis step in accordance with the present invention may also be carried out in vivo ( puva ). a presently preferred extracorporeal photopheresis apparatus for use in the methods according to the invention is currently manufactured by therakos , inc ., westchester , pa . under the name uvar . a description of the therakos uvar photopheresis apparatus may be found in u . s . pat . no . 4 , 683 , 889 , granted to r . l . edelson on aug . 14 , 1987 , the contents of which are hereby incorporated by reference in their entirety . the exposure of blood to ultraviolet light in a photopheresis apparatus is within the ability of persons having ordinary skill in the art . when the photopheresis step is carried out in vitro , at least a fraction of the treated blood , or the treated free isolated virus , is returned to the patient following the photopheresis treatment . preferably , the treatment method described hereinabove is repeated at an interval of about once per week to about once every four weeks . most preferably , the treatment methods described herein are administered on two successive days and repeated approximately once per month ( i . e ., the patient preferably receives two treatments every month ). in view of the disclosure contained herein , those persons who are skilled in the art will be able to adjust the treatment parameters -- i . e ., dosage of the photoactive compound and electromagnetic radiation , periodicity of treatment ( e . g ., monthly , weekly , etc .) and the number of treatments administered in each period ( e . g ., twice per month on two successive days )-- depending on the condition of the patient and the patient &# 39 ; s response to the treatment . preferred photoactive compounds for use in accordance with the present invention are compounds known as psoralens ( or furocoumarins ) which are described in u . s . pat . no . 4 , 321 , 919 the disclosure of which is incorporated herein by reference in their entirety . the preferred photoactive compounds for use in accordance with the present invention include the following &# 34 ; the most particularly preferred photoactive compound for use in accordance with the invention is 8 - methoxypsoralen . the determination of an effective dosage is within the ability of persons having ordinary skill in the art . the photoactive compound , when administered to the patient &# 39 ; s blood in vivo is preferably administered orally , but also can be administered intravenously and / or by other conventional administration routes . the preferred dosage of the photoactive compound is in the range of about 0 . 3 to about 0 . 7 mg / kg of body weight although larger or smaller doses may be employed . when the photoactive compound is administered in vitro to only a portion of the patient &# 39 ; s blood or fraction thereof , it is within the ability of those skilled in the art to calculate a dosage which is equivalent to said range based upon the volume of treated blood or fraction thereof . when administered orally , the photoactive compound should preferably be administered at least about one hour prior to the photopheresis treatment . the timing of administration may be adjusted up or down as needed depending on the bioavailability of the photoactive compound , its expected half - life , etc . if administered intravenously , the times would generally be shorter . the photopheresis treatment in the treatment methods according to the invention is preferably carried out using long wavelength ultraviolet light ( uva ) at a wavelength within the range of 320 to 400 nm . the exposure to ultraviolet light during the photopheresis treatment preferably has a duration of about three to four hours , although shorter or longer treatment periods may be used if desired . whatever the spectrum of electromagnetic radiation , the exposure of infected cells and / or pathogen thereto , following administration of the photoactive compound , should be of sufficient intensity / duration to effectively inactivate and / or attenuate the pathogen . the selection of an appropriate wavelength for photopheresis as well as the exposure , depending upon the photoactive compound being employed and the conditions of treatment ( e . g ., in vivo exposure or in vitro exposure ), is within the ability of those skilled in the art in view of the present disclosure . when the photoactive compound is 8 - methoxypsoralen , it is preferred in accordance with the invention to utilize an exposure to uva radiation of about 2 joules / meter 2 based upon the surface area of the pathogen and infected cells undergoing treatment . when the photopheresis treatment according to the invention is carried out in vivo , careful attention should be paid to controlling the maximum radiant exposure so as to avoid unnecessary injury to the patient . methods for calculating maximum radiant exposure to ultraviolet light are known in the art and , therefore , shall not be described herein . a male patient , roughly 47 years of age , having lymes disease and arthritis ( diagnosis based upon positive lymes titer , severe arthritis and effusion of the right knee ) and who failed to respond to multiple courses of antibiotic therapy , was treated in the following manner : the patient received treatment employing an 8 - mop dosage of 0 . 6 mg / kg ( two treatments on successive days ) initially repeated every four weeks . after three to four courses of the treatment in accordance with the invention , the patient enjoyed a general sense of well - being and , in particular , his joint pain completely subsided so that he was able to exercise as normal . the patient was maintained on the foregoing course of therapy for ten months at which point the frequency of treatment was extended to one 2 - day treatment every six weeks . this course of therapy was continued for four months at which point the frequency of treatment was extended to one 2 - day treatment every eight weeks . it was found that expansion of the treatment frequency in this manner did not cause the patient to regress . the patient is now being treated every three months on two successive days . thus , it was found that the photopheresis treatment employed in this patient was able to relieve all of his debilitating symptoms which were consistent with an advanced state of lymes infection while conventional antibiotic therapy was completely ineffective . while the foregoing description has been provided to illustrate the present invention , the inventors intend the scope of their invention to be limited solely by the scope of the following claims . | 0 |
a preferred embodiment of the invention is now described in detail . referring to the drawings , like numbers indicate like parts throughout the views . as used in the description herein and throughout the claims , the following terms take the meanings explicitly associated herein , unless the context clearly dictates otherwise : the meaning of “ a ,” “ an ,” and “ the ” includes plural reference , the meaning of “ in ” includes “ in ” and “ on .” referring now to fig1 , illustrated therein is a prior art flexible circuit substrate 10 , or “ flex ”. the flex 10 is made from a polyimide film , like kapton ® for example . due to design requirements , such a flex is often required to bend in many applications . as such , the flex 10 includes a central portion 100 with a first extension 101 and a second extension 102 extending from the central portion 100 of the flex 10 . between the two extensions 101 , 102 is as parting line 105 . the parting line 105 may be as simple as a slit cut into the flex to facilitate bending of the extensions 101 , 102 in different directions , or may be more complex shapes . in either case , the parting line 105 ends at a termination point 106 . for exemplary purposes , a simple , single fold will be used as an illustration . to make this simple , single fold , extension 101 will be folded across extension 102 and the central member 100 in the direction of line 104 . folding line 103 illustrates where the flex 10 is intended to bend when extension 101 is folded . referring now to fig2 , illustrated therein is the problem associated with prior art flexes . when extension 101 is folded across the central member 100 , the folding forces , exerted naturally against the termination point 106 , will often cause the flex 10 to tear . for example , force f 1 and f 2 act as a shearing force against the flex 10 . robust materials , like kapton ®, will initially resist tearing , so long as the shearing force remains below about 0 . 6 lbs . however , once this limit is exceeded , a tear 200 will result . once the tear has started , forces less than 0 . 1 lbs can increase the length of the tear 200 . referring now to fig3 , illustrated therein is a tear - resistant flex 30 in accordance with the invention . the flex 30 is made of at least two layers of flexible material , like polyimide films . between and / or atop the layers , electrically conductive traces 307 may be disposed . these traces may be manufactured from copper , copper alloys , aluminum , or other equivalent conductors . electrically conductive pads 308 may be disposed atop the layers . the pads 308 may couple to the traces 307 so as to form a circuit network . electrical components ( not shown ) may be coupled to the pads 308 . the flex 30 includes a central member 304 from which at least one extension 305 extends . in keeping with the illustrative example of fig1 and 2 , the flex 30 is shown with two extensions 305 , 306 , although the invention is not so limited . it will be clear to those of ordinary skill in the art who have the benefit of this disclosure that any number of extensions , in any number of shapes , may extend in any number of directions from the central member . between the two extensions 305 , 306 is as parting line 309 . the parting line 309 may be as simple as a slit cut into the flex to facilitate bending of the extensions 305 , 306 in different directions , or may be more complex , cut - away shapes as noted in subsequent paragraphs . in either case , the parting line 309 ends at a termination point , shown here as point 310 . an annular member 300 is disposed about the termination point 310 . the annular member 300 is preferably made of metal . to reduce cost of the overall flex 30 , it is often desirable to construct the annular member 300 from the same metal as the conductive traces 307 . the annular member 300 is thus preferably constructed from copper , copper alloys , aluminum or other conductors . a second metal 303 is deposited upon the annular member 300 . the second metal 303 serves to reinforce and strengthen the annular member 300 . to reduce overall cost , the second metal 303 is preferably solder that is deposited upon the annular member 300 by way of reflow soldering , hand soldering , wave soldering or other equivalent method . while soldering works well , other methods , like vapor deposition or plating would also suffice . if solder is employed as the second metal 303 , it is desirable to include an aperture 301 in at least one of the film layers of the flex 30 . the aperture 301 allows the annular member to contact solder during conventional manufacturing processes , like reflow soldering for example . to properly retain the annular member 300 between the film layers , the area of the aperture 301 should be less than the area of the annular member 300 . for a single sided flex ( pads only on one side of the flex ), the aperture 301 may only pierce the top layer of film , whereas for double sided flexes ( pads on both the top and bottom of the flex ), apertures may be found through both the top and bottom layers of film , thereby allowing the second metal to be deposited on both the top and bottom of the annular member 300 . for convenience in folding , a second aperture 302 may be added about the termination point . the second aperture 302 is essentially a hole that passes through all the layers of the flex 30 , as well as through the annular member 300 . the second aperture 302 is added to the annular member 300 prior to the deposition of the second metal 303 . the length of the annular member 300 will vary depending upon the application . for this exemplary embodiment , where one extension 305 is being folded in a perpendicular fashion with respect to the central member 304 , a fold line 307 indicates where the fold will be made . the annular member 300 runs approximately 225 degrees , in that it runs from the parting line to the fold line . other applications , as will be discussed with respect to fig6 – 8 , may require greater or lesser angles . referring now to fig4 , illustrated therein is the substrate of fig3 after the extension 305 is folded . note that the annular member 300 , with the second metal 303 deposited atop , functions as a mechanical restraint that prevents the flex 30 from tearing when shearing forces are applied to the extensions 305 , 306 . experimental results have shown that for both single sided ( pads only on one side of the flex ) and double sided ( pads on both the top and bottom of the flex ), employing the annular member with a second metal deposited atop has greatly improved the tear strength against shearing forces . consider the following table : in table 1 , tests 1 and 4 represent a single sided flex and double sided flex , respectively , that includes only a parting line between extensions ( similar to fig1 ). in these two tests , the pull strength to tear the flex was less than 1 lb . tests 2 and 5 are single and double sided flexes , respectively with only an annular member . in other words , there is no second metal deposited atop the annular member for these tests . tests 3 and 6 correspond with the present invention , in that test 3 is a single sided flex with an annular member disposed about the termination point of the parting line , the annular member having a second metal deposited thereon . test 4 , correspondingly , is a double sided flex with an annular member having the second metal deposited upon both sides . note that test 3 increases tear resistance by 240 % over the flex alone , and by 56 % over the flex with only an annular ring . test 6 increases the tear resistance by 285 % over the flex alone , and by 25 % over the flex with only an annular ring . referring now to fig6 – 8 , illustrated therein are some of the various folding applications to which the invention may be applied . fig6 – 8 do not represent all of the applications , but rather are for exemplary purposes only . it will be clear to those of ordinary skill in the art who have the benefit of this disclosure that other scenarios also exist . with respect to fig6 , the parting line 601 is u - shaped , thereby allowing a u - shaped extension 602 to fold across the central member 600 of the flex 60 along folding line 604 . in this embodiment , the annular members 603 may run 270 degrees in length . with respect to fig7 , the parting line 701 is an elongated l - shape , thereby allowing the extension 702 and central member 700 to form a t - shape . the extension 702 would then fold along folding line 704 atop the central member 700 of the flex 70 . in this embodiment , the annular members 703 may run up to 270 degrees in length . with respect to fig8 , the parting line 801 is also l - shaped , but is disposed within the boundaries of the central member 800 , thereby allowing the extension 802 to extend within the overall limits of the flex 80 . as such , the extension 802 becomes an l - shaped triangle , folding atop the central member 800 across folding line 804 . in such an embodiment , the annular members 803 may run up to 315 degrees in length . with respect to fig9 , the parting line 901 is again l - shaped , but is configured differently from the flex of fig8 . the flex 90 of fig9 is designed to allow the extension 902 to “ flop ” below the central member 900 by folding along line 904 . this is often desirable when one component is much larger than the rest . a flopping extension 902 compensates for the additional height of the component . in this configuration , the annular members 903 are positioned at the vertex of the parting line 901 , and at the termination point . an annular member 903 at the vertex is preferable because force 905 tends to shear flexes comprising right angle cuts . referring now to fig5 , illustrated therein is one exemplary application for a flex in accordance with the invention . this exemplary application is that of a rechargeable battery pack 50 . a cell 505 is positioned within a housing 504 . as noted above , rechargeable cells require certain circuits , like safety circuits , charging circuits , etc ., for operation . such a circuit may be constructed on a flexible circuit in accordance with the invention . the flex 507 includes a central member 500 and a folded extension 501 . in keeping with the exemplary geometry of the preceding figures , a parting line 508 exists between the first extension 901 and the second extension . an annular member 503 with a second metal deposited atop is disposed about the termination point of the parting line 508 . a circuit is constructed on the flex 507 by coupling electrical components 506 to the pads of the flex . while a battery is one application , it will be clear to those of ordinary skill in the art having benefit of this disclosure that other applications work equally well with the flex of the present invention . while the preferred embodiments of the invention have been illustrated and described , it is clear that the invention is not so limited . numerous modifications , changes , variations , substitutions , and equivalents will occur to those skilled in the art without departing from the spirit and scope of the present invention as defined by the following claims . | 7 |
fig2 shows the configuration of an ultrasound imaging device according to the present invention . a probe 400 , which transmits and receives ultrasound waves , incorporates a transmission / reception element group 410 formed by transmission / reception elements 4001 , 4002 - 400 e that provide electroacoustic conversion . in most cases , the transmission / reception elements 4001 , 4002 - 400 e are made of piezoelectric materials or other ferroelectric materials that generates a pressure from a voltage when transmitting an ultrasound wave and generates a voltage from an ultrasound wave pressure when receiving an ultrasound wave . as is well known , an ultrasound imaging device gives different voltage waveforms to the transmission / reception group 410 to emit a transmission sound wave tw into a living - body , which is a subject , receives a reception sound wave ( echo ) rw , which is reflected from a specific point of the living - body , compensates for the arrival time difference and phase difference between the reflected sound waves , and adds up the results of compensation to reconstruct a living - body image . signals reflected from specific focal points acquired by the individual elements of the transmission / reception element group 410 are properly phase - compensated and then built up during summation . meanwhile , signals reflected from undesired directions are interfered with each other and suppressed during summation to form an acoustic beam and scan in vivo information to produce an image . when an ultrasound wave is to be transmitted , a waveform for each channel is generated in accordance with the transmission delay time ( transmission time ) and amplitude output information concerning each transmission channel output from a beamformer data computation section 100 so that a transmission beamformer 190 acquire a desired point spread function at a focal point . this is accomplished when a pulse transmission circuit 200 supplies a transmission voltage having a waveform generated by the transmission beamformer 190 to the transmission / reception element group 410 in the probe 400 through a transmission / reception separation circuit 300 . an ultrasound wave is transmitted after a voltage is converted to a pressure by the transmission / reception element group 410 . the ultrasound wave transmitted from the probe 400 is reflected from the interior of the subject . the reflected wave is then received again by the transmission / reception element group 410 of the probe 400 , subjected to pressure - to - voltage conversion , and input into a reception circuit 210 through the transmission / reception separation circuit 300 . the reception circuit 210 subjects the signal of a reception channel to amplification and band limitation , and then supplies the resulting signal to a reception beamformer 120 . in accordance with output information about delay time and weight , which is output from the beamformer data computation section 100 , the reception beamformer 120 forms a beam output signal 121 the directionality of which is provided by the synthesis of time and amplitude . the beam output signal 121 is input into a scan converter 130 , converted to a video signal 131 , and used to display , for instance , a real - time tomographic image or stereoscopic image on a display section 140 . a processor tcpu not only provides overall control over the system , but also writes beamformer data in an attached storage section extram through the beamformer data computation section 100 . the storage section extram can be implemented , for instance , by using a static random access memory ( hereinafter referred to as the sram ). an imaging technology for performing a linear scan with a group of different point spread functions on the same transmission / reception beam will now be described with reference to fig1 ( 1 ) to 1 ( 4 ). fig1 ( 1 ) is a schematic diagram illustrating a case where the probe 400 makes a linear scan to synthesize an image by performing a number of transmission / reception cycles in each beam direction . a transmission beam bt 1 and a reception beam br 1 are formed at the same scan beam position ( transmission / reception aperture position ). the transmission beamformer 190 and reception beamformer 120 shown in fig2 operate so as to form point spread function psf 1a in relation to point p 1 on the first transmission / reception cycle , form point spread function psf 1b in relation to point p 1 on the second transmission / reception cycle , and form point spread function psf 1c in relation to point p 1 on the third transmission / reception cycle . it is assumed that point spread functions psf 1a , psf 1b , and psf 1c serve as a group of multiple point spread functions and spread in different dominant wave number vector directions like point spread functions psf 1 , psf 2 , and psf 3 in fig3 ( 1 ) to 3 ( 5 ) in order to produce an effect similar to that of imaging based on spatial synthesis from different transmission / reception aperture positions . more specifically , one or more of these point spread functions have an asymmetrical spatial spreading in a direction parallel to the direction of the transmission beam bt 1 and reception beam br 1 ( in a direction side by side or beam sound axis direction ) and in a direction orthogonal to the direction of the transmission beam bt 1 and reception beam br 1 ( in the array direction of the transmission / reception element group 410 of the probe or in an azimuth direction ), as is the case with point spread functions psf 1a and psf 1c . further , in the case of point spread function psf 1b , the direction of a dominant wave number vector component forming point spread function psf 1b ( the direction of wave amplitude peak arrangement at an instantaneous point of time ) is along ( parallel to ) the direction of the transmission beam bt 1 and reception beam br 1 . in the case of point spread functions psf 1a and psf 1c , however , the direction of the dominant wave number vector component is rotated through a predetermined angle relative to point p 1 . although point spread functions psf 1a , psf 1b , and psf 1c are formed respectively at the same transmission / reception aperture position , they differ from each other in the direction of the dominant wave number vector component . for example , point spread function psf 1b is obtained when the signals of the transmission / reception element group 410 in the transmission / reception aperture are provided with transmission and reception sensitivities ( amplitudes ) left - right symmetrical from the center on the basis of the same time pulse waveform by using point p 1 as a beamforming focal point , and also provided with left - right symmetrical delay time . on the other hand , point spread functions psf 1a and psf 1c are obtained when the signals of the transmission / reception element group 410 in the transmission / reception aperture are subjected to frequency - dependent asymmetrical beamforming from the aperture center . the reception beamformer 120 applies dynamic variations to phase difference and weight in dependence on frequency components during reception . referring to fig1 ( 2 ), the transmission / reception aperture position moves so that a transmission beam bt 2 and a reception beam br 2 are formed again at the same scan beam position . the transmission beamformer 190 and reception beamformer 120 shown in fig2 operate so as to form point spread function psf 2a in relation to point p 2 on the first transmission / reception cycle , form point spread function psf 2b in relation to point p 2 on the second transmission / reception cycle , and form point spread function psf 2c in relation to point p 2 on the third transmission / reception cycle . referring to fig1 ( 3 ), the transmission / reception aperture position moves so that a transmission beam bt 3 and a reception beam br 3 are formed again in the same direction . the transmission beamformer 190 and reception beamformer 120 shown in fig2 operate so as to form point spread function psf 3a in relation to point p 3 on the first transmission / reception cycle , form point spread function psf 3b in relation to point p 3 on the second transmission / reception cycle , and form point spread function psf 3c in relation to point p 3 on the third transmission / reception cycle . these processes are the same as indicated in fig1 ( 1 ) except that the aperture position is moved . it is assumed that points p 1 , p 2 , and p 3 are at the same distance from the aperture . at an imaging stage , point spread functions having different dominant wave number vector component directions are used around points p 1 , p 2 , and p 3 as shown in fig1 ( 4 ). in an addition process ( coherent addition ) before wave detection , characteristically strong wave number vector components interfere with each other in directions parallel to the directions of reception beams br 1 , br 2 , and br 3 ( transmission beams tr 1 , tr 2 , and tr 3 ) so that point spread functions psf 1b , psf 2b , and psf 3b come closer to a less anisotropic response around points p 1 , p 2 , and p 3 . as a result , the aspect ratio of speckle changes . in synthesis after wave detection , the dominant wave number vector component directions of the point spread functions form different angles so as to reduce the correlation between the reflections from seemingly uniform scatterers . this decreases the ratio of variance of speckle luminance to its average . in a situation where there is no specular component of a reflector ( a large number of spatially uniform scatterers exist in a main volume of point spread functions ), the expected value of a signal correlation coefficient decreases when the wave number vector component directions change to become mutually orthogonal . when , for instance , the dominant wave number vector component directions of point spread functions psf 1b and psf 3b are mutually orthogonal , it is expected that the speckle will be reduced . although fig1 ( 1 ) to 1 ( 4 ) show examples of synthesis from three different point spread functions , any number of point spread functions can be set . the point spread functions shown in fig1 ( 1 ) to 1 ( 4 ) represent the effects of both the transmission beamformer 190 and reception beamformer 120 . when a transmission cycle is performed n times at each beam position , the imaging time substantially increases n times in accordance with the number of times the transmission cycle is repeated . therefore , the frame rate decreases as far as the intervals between individual beam positions remain unchanged . as a method of avoiding a decrease in the frame rate , the reception beamformer 120 can perform effectively n different processes in relation to one transmission of the transmission beamformer 190 in a situation where a transmission / reception cycle is performed once at each aperture position instead of n times with the processing capacity of the reception beamformer 120 increased n times . causing the reception beamformer 120 to perform a number of different processes in relation to a reception signal based on one transmission is hereinafter referred to as the use of “ reception multiple beams .” an example of high - speed processing with reception multiple beams will now be described with reference to fig5 ( 1 ) to 5 ( 4 ). fig5 ( 1 ) is a schematic diagram illustrating a case where the probe 400 makes a linear scan so as to synthesize an image with three ( n = 3 ) reception multiple beams in each transmission beam direction . three reception multiple beams br 1 , br 2 , br 3 are formed around a transmission beam bt 1 . reception beam br 2 , which is one of the three reception multiple beams , is formed in substantially the same direction . the number ( n ) of reception multiple beams is not limited to three ( three different point spread functions ). any number of reception multiple beams can be set in accordance with the processing capacity of the reception beamformer 120 . the transmission beamformer 190 and reception beamformer 120 shown in fig2 operate so that the point spread functions for points p 1a / p 1b , and p 1c are psf 1a , psf 1b , and psf 1c , respectively . here it is assumed that point spread functions psf 1a , psf 1b , and psf 1c are spreading in different directions , like point spread functions psf 1 , psf 2 , and psf 3 in fig3 ( 1 ) to 3 ( 5 ), to produce the same effect as that of an imaging operation based on spatial synthesis . more specifically , one or more of these point spread functions , such as psf 1a and psf 1c , have an asymmetrical spatial spreading in a direction parallel to the direction of reception beams br 1 and br 3 and in a direction orthogonal to the direction of reception beams br 1 and br 3 . further , in the case of point spread function psf 1b , the direction of its dominant wave number vector component is parallel to the direction of reception beam br 1 . in the case of point spread functions psf 1a and psf 1c , however , the directions of their dominant wave number vector components are rotated respectively through a predetermined angle relative to points p 1a and p 1c . although point spread functions psf 1a , psf 1b , and psf 1c are formed respectively at the same transmission / reception aperture position , they differ from each other in the direction of the dominant wave number vector component . for example , point spread function psf 1b is obtained when the signals of the transmission / reception element group 410 in the transmission / reception aperture are provided with transmission and reception sensitivities ( weights ) left - right symmetrical from the center on the basis of the same time pulse waveform by using point p 1b as a beamforming focal point , and also provided with left - right symmetrical delay time . on the other hand , point spread functions psf 1a and psf 1c are obtained when the signals of the transmission / reception element group 410 in the transmission / reception aperture are subjected to different asymmetrical beamforming processes while the center of the aperture is regarded as the center of symmetry on an individual frequency basis . further , the output of the transmission beamformer 190 preferably can care insertion loss during transmission / reception in consideration of the formation of point spread functions made from all reception multiple beams formed by the reception beamformer 120 . referring to fig5 ( 2 ), the transmission / reception aperture position moves so that three reception multiple beams br 2 , br 3 , br 4 are formed again around transmission beam bt 2 . transmission beam bt 2 and reception beam br 3 , which is one of the reception multiple beams , are formed in the same direction . the transmission beamformer 190 and reception beamformer 120 shown in fig2 operate so that the point spread functions for points p 2a , p 2b , and p 2c are psf 2a , psf 2b , and psf 2c , respectively . however , the processes are the same as indicated in fig5 ( 1 ) except that the aperture position is moved . similarly , referring to fig5 ( 3 ), the transmission / reception aperture position moves so that three reception multiple beams br 3 , br 4 , br 5 are formed again around transmission beam bt 3 . transmission beam bt 3 and reception beam br 4 are formed in the same direction . as shown in fig5 ( 4 ), received signals based on point spread functions psf 1c , psf 2b , and psf 3a , which are p 3a , are acquired upon completion of three transmission / reception cycles and can be spatially synthesized . a reception beamformer output 121 forming point spread functions psf 1c , psf 2b , and psf 3c , which have different dominant wave number vector components in multiple directions , is synthesized . in a synthetic addition process ( coherent addition ) prior to wave detection , therefore , the wave number vector components of point spread function psf 2b possessed in the direction of reception beam br 3 interfere with each other to alleviate a characteristic anisotropic nature . further , in an addition subsequent to wave detection , the directions of dominant wave number vector components of the point spread functions form mutually different angles . this produces a speckle reduction effect . in the above - described scan , the transmission aperture position moves with the intervals between the reception multiple beams equalized so that the positions of formed reception beams overlap with each other . therefore , different point spread functions in the same reception beam direction can be acquired . further , as the number of transmission cycles does not increase n times unlike the case shown in fig1 ( 1 ) to 1 ( 4 ), the frame rate does not decrease due to an increase in the transmission / reception time . in addition , as synthesis is based on temporally continuous transmission / reception , the degree of isochronism between reception beamformer outputs to be synthesized is higher than in the case of fig1 ( 1 ) to 1 ( 4 ). a function exercised by the scan converter 130 shown in fig2 to perform a coherent addition process on a reception beamformer output 121 during a scan shown in fig5 ( 1 ) to 5 ( 4 ) will now be described with reference to fig6 ( 1 ) and 6 ( 2 ). fig6 ( 1 ) shows a typical configuration of a computation circuit for the coherent addition process . fig6 ( 2 ) is a time frame diagram illustrating the sequence of its synthesis operations . the following description assumes that the number ( n ) of reception multiple beams is three , as is the case with fig1 ( 1 ) to 1 ( 4 ) and fig5 ( 1 ) to 5 ( 4 ). the reception beamformer output 121 includes a received signal ra that includes signals derived from point spread functions psf 1a , psf 2a , and psf 3a in fig5 ( 1 ) to 5 ( 4 ), a received signal rb that includes signals derived from point spread functions psf 1b , psf 2b , and psf 3b in fig5 ( 1 ) to 5 ( 4 ), and a received signal rc that includes signals derived from point spread functions psf 1c , psf 2c , and psf 3c in fig5 ( 1 ) to 5 ( 4 ). received signals ra , rb , and rc correspond , for instance , to signal names of time phases of time - series signals output as three - phase time - division signals . received signals ra , rb , and rc are stored in individual beam memories ma 0 , mb 0 , mc 0 , ma 1 , mb 1 , mc 1 , ma 2 , mb 2 , mc 2 , ma 3 , mb 3 , mc 3 . each of these memories has a space for q samples in a time - series direction , which is determined by the longest period of the time of a continuous reception and the data interval of reception beamformer output . the spaces of individual beam memories ma 0 , mb 0 , mc 0 , ma 1 , mb 1 , mc 1 , ma 2 , mb 2 , mc 2 , ma 3 , mb 3 , and mc 3 are ( ma 01 , ma 02 , . . . , ma 0 q ), ( mb 01 , mb 02 , . . . , mb 0 q ), ( mc 01 , mc 02 , . . . , mc 0 q ), ( ma 11 , ma 12 , . . . , ma 1 q ), ( mb 11 , mb 12 , . . . , mb 1 q ), ( mc 11 , mc 12 , . . . , mc 1 q ), ( ma 21 , ma 22 , . . . , ma 2 q ), ( mb 21 , mb 22 , . . . , mb 2 q ), ( mc 21 , mc 22 , . . . , mc 2 q ), ( ma 31 , ma 32 , . . . , ma 3 q ), ( mb 31 , mb 32 , . . . , mb 3 q ), and ( mc 31 , mc 32 , . . . , mc 3 q ), respectively . for each transmission and each of reception multiple beams , the reception beamformer output 121 is stored in the individual beam memories ma 0 , mb 0 , mc 0 , ma 1 , mb 1 , mc 1 , ma 2 , mb 2 , mc 2 , ma 3 , mb 3 , mc 3 in accordance with a write enable signal ( not shown ). as n = 3 for each transmission , four sets of three individual memories ( ma 0 , mb 0 , mc 0 ), ( ma 1 , mb 1 , mc 1 ), ( ma 2 , mb 2 , mc 2 ), ( ma 3 , mb 3 , mc 3 ) are sequentially selected so that time - series values of reception multiple beam signals based on the same transmission are written in the respective sets in the order of ra , rb , rc . when transmission beam numbers are to be assigned to individual transmissions in the order of 1 , 2 , 3 , and so on , the reception beamformer output 121 for transmission beam no . 1 repeatedly operates to write the time - series value of ra in ma 0 , the time - series value of rb in mb 0 , and the time - series value of rc in mc 0 . the reception beamformer output 121 for transmission beam no . 2 repeatedly operates to write the time - series value of ra in ma 1 , the time - series value of rb in mb 1 , and the time - series value of rc in mc 1 . the reception beamformer output 121 for transmission beam no . 3 repeatedly operates to write the time - series value of ra in ma 2 , the time - series value of rb in mb 2 , and the time - series value of rc in mc 2 . the reception beamformer output 121 for transmission beam no . 4 repeatedly operates to write the time - series value of ra in ma 0 , the time - series value of rb in mb 0 , and the time - series value of rc in mc 0 . when the above - described transmission cycle is repeated until individual beam memories ma 3 , mb 3 , and mc 3 are written into , the above operation is repeated to overwrite the individual beam memories beginning with ma 0 , mb 0 , and mc 0 . memory selectors bmux 0 , bmux 1 , bmux 2 , bmux 3 , sela , selb , selc output the contents of the individual beam memories ma 0 , mb 0 , mc 0 , ma 1 , mb 1 , mc 1 , ma 2 , mb 2 , mc 2 , ma 3 , mb 3 , mc 3 to multipliers mpyba , mpybb , mpybc . the multipliers mpyba , mpybb , mpybc multiply the contents of individual beam memories by beam synthesis weighting factors bwa , bwb , bwc , respectively , and allow an adder sumb to output a coherent addition signal bsm . the operations of the above memory selectors will now be described with reference to fig6 ( 2 ). each time the transmission beam number is incremented by one , the received signals ( ra , rb , rc ) are sequentially stored in the order of ( ma 0 , mb 0 , mc 0 ), ( ma 1 , mb 1 , mc 1 ), ( ma 2 , mb 2 , mc 2 ), ( ma 3 , mb 3 , mc 3 ), ( ma 0 , mb 0 , mc 0 ), ( ma 1 , mb 1 , mc 1 ), and so on . during a period of time during which the transmission beam number is between 1 and 3 , no coherent addition signal bsm is output . during a period of time during which the transmission beam number is 4 , the received signals ra , rb , rc are read from individual beam memories ma 2 , mb 1 , and mc 0 , respectively , from the period of time during which the transmission beam number is between 1 and 3 , and supplied to the multipliers mpyba , mpybb , mpybc . these multipliers multiply the received signals ra , rb , rc by the beam synthesis weighting factors bwa , bwb , bwc . the results of multiplication are then added together by the adder sumb to obtain an output bsm 1 of the coherent addition signal bsm . the beam synthesis weighting factors bwa , bwb , bwc may be changed in a time - series manner . similarly , during a period of time during which the transmission beam number is 5 , the received signals ra , rb , re are read from individual beam memories ma 3 , mb 2 , and mc 1 , respectively , from the period of time during which the transmission beam number is between 2 and 4 , supplied to the multipliers mpyba , mpybb , mpybc , multiplied by the beam synthesis weighting factors bwa , bwb , bwc , and added together by the adder sumb to obtain an output bsm 2 of the coherent addition signal bsm . outputs bsm 1 and bsm 2 are signal packets having a length of q . subsequently , a coherent addition is repeated upon each transmission . the outputs of the coherent addition signal bsm are converted to the video signal 131 shown in fig2 through a wave detection / compression section , a filter section , or other section not shown . an incoherent synthesis process ( compound process ), which the scan converter 130 shown in fig2 performs in accordance with the reception beamformer output 121 by using one of its functions during the operation shown in fig5 ( 1 ) to 5 ( 4 ), will now be described with reference to fig7 . the configuration shown in fig7 is such that wave detection / compression sections bdta , bdtb , bdtc are inserted respectively between the memory selectors sela , selb , selc and multipliers mpyba , mpybb , mpybc shown in fig6 ( 1 ) and 6 ( 2 ). wave detection / compression section bdta is a nonlinear process section for generating luminance information that is without carrier phase information in the output of the reception beamformer 120 . an alternative configuration may be employed so that a compression process , such as a logarithmic compression process , is not performed by the wave detection / compression sections bdta , bdtb , bdtc , but is performed as needed after various computations on a final output symb . a typical configuration for enhancing the anisotropic nature of spatial sampling will now be described as a second embodiment . first of all , the principle of anisotropic nature enhancement will be described with reference to fig1 ( 1 ) and 10 ( 2 ). a case where a boundary obnd exists in an imaging region as shown in fig1 ( 1 ) to cause a strong reflector distribution change that is not orthogonal or parallel to a transmission / reception beam b s will be discussed . when a conventional technology was used , the same point spread function psfb was used at the same depth ( at the same distance from the aperture ) as point p s no matter whether the anisotropic nature of such reflection exists . meanwhile , although the boundary obnd is long in a particular direction , the direction of the dominant wave number vector having the best spatial resolution of the point spread function psfb ( the direction of the transmission / reception beam b s ) is not orthogonal to the direction in which the spatial resolution of the boundary obnd is high . therefore , there is a tendency where an image in which the boundary obnd is blurred in the direction of the transmission / reception beam b s is formed . except for phase inclination for beam orientation steered , the point spread function of a conventional beamformer that gives left - right symmetrical weight and phase within the aperture is spread in an azimuth direction orthogonal to the direction of the transmission / reception beam b s instead of the direction of transmission / reception beam b s . therefore , when point spread function psfb is changed to another point spread function that is centered around point p s and seemingly rotated along the direction of the boundary obnd , the image of the boundary obnd may be enhanced . if , for instance , in a situation where the transmission / reception beam b s is formed perpendicularly to the array direction of the transmission / reception element group 410 , the reflector distribution near point p s is sampled with point spread function psfc , which is centered around point p s shown in fig1 ( 2 ), and the direction of a dominant wave number vector of the reflector distribution near point p s coincides with the direction of a dominant wave number vector of point spread function psfc , it is conceivable that the degree of correlation may increase to increase the reception beamformer output 121 and invoke image enhancement . when a point spread function is rotated or its inclination is changed as described above , the manner of spatial correlation changes locally , thereby enhancing the spatial distribution of a local reflector . it should be noted that the dominant wave number vector of a reflector distribution near point p s of an anatomical boundary obnd does not always coincide with point spread functions psfb and psfc . therefore , an adaptive process or enhancement process dependent on the statistical fluctuation of a reflector distribution is performed . point spread function psfc , which provides the highest degree of correlation with the transmission / reception beam b s , is not known before transmission . it is therefore necessary to actually perform sampling with at least point spread functions corresponding to multiple rotated or inclined states in addition to point spread function psfc in fig1 ( 2 ). in reality , however , performing a large number of sampling operations with point spread functions corresponding to multiple rotated or inclined states imposes an excessive load on the reception beamformer 120 . therefore , a practical method would be to make an estimate from the results produced by point spread functions corresponding to a predetermined number of rotated states . even when it is difficult to generate point spread functions rotationally symmetrical to point spread function psfb at an arbitrary rotation angle with respect to point p s under restrictions imposed by finite frequency bands of the transmission beamformer 190 and reception beamformer 120 , finite aperture diffraction limit , and beamformer processing capacity limit , it is possible to estimate the rotation angle of the most suitable dominant wave number vector in an interpolation approximation manner from the beamforming ( beamforming ) output results of a series of point spread functions that differ in dominant wave number vector direction . it is now assumed that bda denotes an output signal of the reception beamformer 120 that is derived from point spread function psfa which approximates to point spread function psfb rotated through an angle ( θ ) of θ a with respect to point pc ( reference point ) as shown in fig9 ( 1 ), and that bdb denotes an output signal of the reception beamformer 120 that is derived from point spread function psfb which remains unrotated ( θ = θ b = 0 ), and further that bdc denotes an output signal of the reception beamformer 120 that is derived from point spread function psfc which approximates to point spread function psfb rotated through an angle ( θ ) of θ c . as shown in fig9 ( 2 ), an interpolation function acrth is estimated as a function relative to angle θ . then , θpk , which may have the maximum absolute value pk , is estimated to perform interpolation , for instance , with a lagrange polynomial . if weighting factors bwa , bwb , and bwc are equal to ( θpk − θb )( θpk − θc )/( θa − θb ) ( θa − θc ), ( θpk − θa ) ( θpk − θc )/( θb − θa ) ( θb − θc ), and ( θpk − θa ) ( θpk − θb )/( θc − θa ) ( θc − θb ), respectively , the maximum value pk based on a lagrange polynomial can be calculated from the equation below : pk = bwa × bda + bwb × bdb + bwc × bdc . if acrth is a quadratic function , θpk can be determined while it is subjected to smooth interpolation . however , θpk can also be determined by performing a simple maximum value judgment procedure in relation to output signals bda , bdb , and bdc . an estimate can also be made with signals that are obtained by subjecting the outputs bda , bdb , bdc of the reception beamformer 120 to wave detection and compression . the process described above is similar to an operation that is performed by rotating a point spread function at point pc ( reference point ) in angular direction and determining a correlation sample of a space whose angle is a variable by means of interpolation . fig8 shows a typical circuit configuration for performing the above - described computations . the configuration shown in fig8 is obtained by adding synthesis signal selection sections sla , slb , slc and a weighting factor computation section adp to the configuration shown in fig7 . the synthesis signal selection sections sla , slb , slc select signals before and after the wave detection / compression sections bdta , bdtb , bdtc . the weighting factor computation section adp performs interpolation computations described above . this configuration implements a nonrecursive adaptive process . in an imaging process in which a coherent addition different from an adaptive process is performed , the synthesis signal selection sections sla , slb , slc connect signals bsa , bsb , bsc , which are not yet subjected to wave detection and compression , to the multipliers mpyba , mpybb , mpybc in accordance with a command inco . the weighting factors bwa , bwb , and bwc are determined in accordance with a predetermined point spread function . when the above - described incoherent adaptive process is to be performed , detected / compressed signals bda , bdb , bdc after the wave detection / compression sections bdta , bdtb , bdtc are connected to the multipliers mpyba , mpybb , mpybc in accordance with the command inco . when the output signals bda , bdb , bdc are input , the weighting factor computation section adp computes the weighting factors bwa , bwb , bwc in accordance with the above arithmetic expression . the results of multiplications by the multipliers mpyba , mpybb , mpybc are added together in the adder sumb and output as output signal sybm . the above - described process is an example of an estimation process concerning a particular point pc . however , as local fluctuation of a reflector distribution always occurs , the estimated value of θpk always fluctuates . the weighting factor computation section adp may store the aspect ratio of an imaging region around point pc in the imaging plane and the values of bda , bdb , and bdc within a range that is extended in the distance direction and scanning array direction of a beam , and cause , for instance , a statistical model estimation section to output desirable weighting factors bwa , bwb , bwc for point pc in accordance with the results of computations on the stored values . in the embodiments described above , the point spread functions according to the present invention do not limit the signal waveform formation method of the transmission beamformer 190 and reception beamformer 120 . the point spread functions according to the present invention are such that the transmission waveform of the transmission beamformer 190 is not limited to a pulse configuration in which energy is consolidated at one point on a time axis . even when a pulse dispersion / compression process , in which pulses are dispersed on the time axis in the transmission beamformer 190 and compressed in the reception beamformer 120 for process gain improvement purposes , a time encoding transmission process , and a time decoding reception process relative to the time encoding transmission process are performed , the point spread functions are formed in the same manner as in the case of pulses that are not subjected to the above - mentioned processes after being compressed or decoded relative to a point within the imaging region . when applied to a transmission / reception beamformer ( beamforming circuit ) of a medical ultrasound imaging device , the present invention implements a system that produces high - quality images . br 1 , br 2 , br 3 , br 4 , br 5 . . . . reception beam psf 1a , psf 1b , psf 1c , psf 2a , psf 2b , psf 2c , psf 3a , psf 3b , psf 3c , psf 1 , psf 2 , psf 3 , psf a , psf b , psf c , psf 1a , psf 2a , psf 3a , psf 1b , psf 2b , psf 3b , psf 1c , psf 2c , psf 3c . . . . point spread function ma 0 , mb 0 , mc 0 , ma 1 , mb 1 , mc 1 , ma 2 , mb 2 , mc 2 , ma 3 , mb 3 , mc 3 . . . . individual beam memory bmux 0 , bmux 1 , bmux 2 , bmux 3 , sela , selb , selc . . . . memory selector | 6 |
the present invention is described with reference to embodiments of the invention . throughout the description of the invention reference is made to fig1 - 17 . when referring to the figures , like structures and elements shown throughout are indicated with like reference numerals . as described in detail below , an aspect of the present invention is a phase change memory ( pcm ) cell structure with a pnp bipolar junction transistor ( bjt ) access device . the bjt access device provides the drive current to operate the pcm device with minimal crosstalk between adjacent individual memory cells . furthermore , memory cells of the present invention may be advantageously formed together with cmos devices , such as mosfets , on the same substrate . thus , embodiments of the present invention can utilize both the low crosstalk advantages of the bjt memory cell design and the cmos power consumption advantages of peripheral circuitry on the same integrated circuit . fig1 illustrates an exemplary embodiment of a p - doped silicon substrate 102 . as discussed in detail below , the silicon substrate 102 acts as a collector in the pnp bjt access device . in an alternate embodiment , a blanket p + implant is performed on the silicon substrate 102 . it is noted that although a pnp bjt structure is described herein , those skilled in the art will understand the claimed invention may also be achieved using a npn bjt structure with drive polarities and dopant species reversed . thus , the substrate 102 may alternatively be doped with n material . fig2 illustrates a base layer 204 is formed on the substrate 102 by epitaxial growth or ion - implantation . a shallow trench isolation ( sti ) process is performed . those skilled in the art will recognize various etching techniques such as lithographic masks with directional reactive ion etch ( rie ) can be utilized to perform the sti process . the trenches are filled with a first insulating layer 202 comprised of an insulating ( dielectric ) material such as silicon dioxide ( sio2 ). the base layer 204 will act as the base in the pnp bjt access devices . the base layer 204 may be comprised of a semiconductor material with negative charge carriers , such as n - doped silicon or n + silicon . the base layer 204 might incorporate germanium as well . turning to fig3 , a cmos gate oxide layer 302 is deposited above the insulating layer and the base layer . while the cmos gate oxide layer 302 is deposited on the entire surface of the insulating layer and the base layer the cmos gate oxide layer 302 will not be a part of the memory cells . the cmos gate oxide layer 302 will only be a part of the cmos devices in the integrated circuit . in fig4 , a cmos polycrystalline silicon layer 402 is deposited above the cmos gate oxide layer 302 . like the cmos gate oxide layer 302 , the cmos polycrystalline silicon layer 402 illustrated in fig4 will not be a part of the memory cells . in one embodiment of the invention , the cmos polycrystalline silicon layer 402 is comprised of doped polycrystalline silicon . those skilled in the art will recognize that the doping of the cmos polycrystalline silicon layer 402 depends on the type of cmos being created in the integrated circuit . now turning to fig5 , a patterned etch on the cmos polycrystalline silicon layer 402 and the cmos gate oxide layer 302 is carried out . those skilled in the art will recognize that the patterned etch may be performed with lithographic masks and rie to etch the cmos polycrystalline silicon layer 402 and the cmos gate oxide layer 302 . other techniques known in the art , such as using a hydrogen fluoride ( hf ) etch , may be used during this patterning step . at fig6 , nitride spacers 606 are deposited around the pillar structures of the polycrystalline silicon layer 402 and the cmos gate oxide layer 302 . in addition , rapid thermal oxide ( rto ) spacers 608 are disposed around the spacers 606 . those skilled in the art will recognize that the formation of the rto spacers 608 may be performed utilizing thermal oxidation techniques . the formation of the nitride spacers 606 is also well known to those skilled in the art . after the nitride spacers 606 are formed , implants 610 are implanted only on the base layer of the cmos devices 602 using a mask 612 to tune the characteristics of the peripheral cmos devices . the implants 610 in the cmos devices 602 are doped while the base layer 204 for the bjt devices is protected by the mask 612 . in fig7 , the mask is removed and a protective nitride layer 702 is deposited above the top surface of the structure . thus , the nitride layer covers the implants 610 , the rto spacer 608 , the insulating layer 202 , and the base layer 204 . the protective nitride layer 702 protects the cmos devices 602 from etching performed during the formation of the bjt access devices . turning to fig8 , a sacrificial insulating layer 802 is deposited above the protective nitride layer 702 . in one embodiment of the invention , the sacrificial insulating layer 802 is comprised of silicon dioxide . in fig9 , trenches 902 are formed in the areas of the bjt access devices . as illustrated , the trenches 902 are etched through the sacrificial insulating layer 802 , through the protective nitride layer 702 , and through the sidewalls of the rto spacers 608 . the trenches 902 stop on the base layer 204 . also illustrated , the nitride spacers 606 and the rto spacer 608 under the sacrificial insulating layer 802 still remain . the remaining nitride spacers 606 and the rto spacer 608 are used for the bjt access devices . those skilled in the art will recognize that a lithographic mask can be formed over the surface of the sacrificial insulating layer 802 and a rie or wet chemical etching can be performed to etch through the aforementioned layers and structures . in fig1 , an emitter layer 1002 is formed within and completely filling the trenches 902 ( see fig9 ) and above the base layer 204 . the emitter layer 1002 serves as the emitter in the pnp bjt access device . the emitter layer 1002 may be comprised of a variety of semiconductor materials with positive charge (“ holes ”). an example of this would be p - doped polycrystalline silicon or p + polycrystalline silicon . this layer could be formed by , for example , low pressure chemical vapor deposition ( lpcvd ), rapid thermal chemical vapor deposition ( rtcvd ), or atomic layer chemical vapor deposition ( alcvd ). this region could be doped by , for example , ion implantation or by diffusion during the deposition process . in one embodiment of the invention , a very thin insulator layer comprising of sio2 may be present between the interface of the emitter layer 1002 and the base layer 204 . the purpose of this very thin insulator layer , if used , is to ensure that the emitter layer 1002 will not turn into single - crystalline form , but will remain in polycrystalline form , during the subsequent fabrication steps . a bjt having a polycrystalline emitter has smaller base current than a bjt having a single - crystalline emitter . thus , a small base current reduces cross - talk among memory cells . in one embodiment of the present invention , after the emitter layer 1002 has been deposited into the trenches , a chemical - mechanical polish ( cmp ) is performed so the surface of the sacrificial insulating layer 802 and the surface of the emitter layer 1002 are level and parallel to the surface of the substrate 202 . referring to fig1 , the emitter layer 1002 is recessed . the emitter layer 1002 is recessed so that the emitter layer 1002 may be contained within the rto spacers 608 . in one embodiment of the invention , a timed rie is employed since there is no etch stop preventing the complete etching of the emitter layer 1002 . turning to fig1 , the sacrificial insulating layer 802 ( see fig1 ) is removed . an etch stopping on the nitride spacer and the emitter layer is employed . wet etches such as dilute hydrofluoric acid ( dhf ) may be utilized for this step of the process . in fig1 , the protective nitride layer 702 ( see fig1 ) is removed , leaving the nitride spacer 606 , the cmos devices 602 , and pnp bjt device 1302 exposed . those skilled in the art may recognize that the removal of the protective nitride layer can be performed by a timed rie that does not remove the emitter layer 1002 or base layer 204 ( polycrystalline silicon ). alternatively , a timed rie with a lithographic mask over the emitter layer 1002 and polycrystalline silicon may be used during this step . fig1 illustrates silicidation of the exposed base layer 204 and the emitter layer 1002 . those skilled in the art will recognize that a variety of metals , such as nickel ( ni ), tungsten ( w ), or cobalt ( co ), may be employed for silicidation . the metal is deposited above the emitter layer 1002 and above the exposed base layer 204 . a rapid thermal anneal ( rta ) is performed to form the bonds between the silicon and metal , and a wet metal etch is performed to remove any un - reacted metal . now turning to fig1 a and 15b , a second insulating layer 1502 is deposited over the cmos and pnp bjt devices . fig1 b is a cross sectional view of fig1 a along line 15 b - 15 b . the first insulating layer 204 and the second insulating layer 1502 create an insulating region 1514 containing the base layer 204 and the emitter layer 1002 . in addition , several trenches are formed in the insulating layer 1502 . those skilled in the art will recognize the trenches may be formed utilizing normal rie processes , as described above . referring to fig1 a , a set of cmos polycrystalline silicon trenches 1504 , a set of cmos base layer trenches 1506 , and a set of emitter layer trenches 1508 are formed . the trenches are formed such that the bottoms of the trenches are the surfaces of the silicide formed over the structures . referring to fig1 b , a set of base layer trenches 1510 are formed through the second insulating layer 1502 so that the bottom of the trenches are the surface of the silicide formed in base layer 204 . a set of collector contact trenches 1512 are formed through the insulating region 1514 ( the second insulating layer 1502 and the first insulating layer 202 ), and into the substrate . fig1 a shows a deposition of a liner and tungsten ( w ) plug 1602 filling the set of cmos polycrystalline silicon trenches 1504 , the set of cmos base layer trenches 1506 , and a set of emitter layer trenches 1508 ( see fig1 a ). fig1 b illustrates a deposition of a liner and tungsten ( w ) plug 1602 filling the set of base layer trenches 1510 and the set of collector contact trenches 1512 ( see fig1 b ). in one embodiment of the invention , the tungsten plug 1602 in the cmos polycrystalline silicon trenches is coupled to memory decoding and selection logic ( not shown ). the tungsten plug 1602 in the cmos base layer trenches is coupled to ground . the tungsten plug 1602 in the set of emitter layer trenches is utilized to form a bit - line for the memory cells . fig1 a and 17b illustrate integration of the memory element 1710 and metallization . in one embodiment , the memory element 1710 is comprised of phase change elements . fig1 b is a cross sectional view of fig1 a along line 17 b - 17 b . memory cells 1702 and the cmos device 1716 are connected with metal lines . the phase change element 1710 is formed above the tungsten plug 1602 in the memory cells 1702 . the phase change element 1710 may be formed from a chalcogenide . in one embodiment of the invention , the chalcogenide utilized is , but not limited to , a germanium - antimony - tellurium ( gst ) chalcogenide glass ( ge2sb2te5 ). those skilled in the art will recognize methods for phase change element 1710 formation . for the memory cells 1702 , bit - lines 1708 and word - lines 1706 are formed from a conductive metal such as copper ( cu ). as illustrated , the bit - lines 1708 in fig1 a and the word - lines 1706 in fig1 b are perpendicular to each other . those skilled in the art will recognize the methods required for bit - line 1708 and word - line 1706 formation . also formed during integration and metallization are cmos to cmos connections 1704 made of a conductive metal such as copper ( cu ), tungsten ( w ) connectors 1712 for the cmos devices 1716 , and collector contacts 1714 . those skilled in the art will recognize the processes necessary to form phase change elements 1710 , the integration of memory cells 1702 , and metallization . the description of the present invention has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention . the embodiment was chosen and described in order to best explain the principles of the invention and the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated . having thus described the invention of the present application in detail and by reference to embodiments thereof , it will be apparent that modifications and variations are possible without departing from the scope of the invention defined in the appended claims . | 7 |
the combustion instabilities can be controlled by influencing the time - lag between the fuel injection and the periodic heat release , i . e ., the flame front . the basic idea of the invention is to interfere with the time - lag τ between the periodic heat release at the flame front and the pressure fluctuation at the injection , so that the rayleigh criterion g ( x ) = 1 t ∫ 0 t p ′ ( x , t ) q ′ ( x , t ) t & lt ; 0 is no longer fulfilled , i . e ., the heat release and pressure maximum are no longer in phase . this prevents the driving mechanism for the occurrence of thermoacoustic vibrations . the illustration of the rayleigh criterion following fourier transformation in the frequency range shows this connection even more clearly : g ( x )= 2 ∫| s pq ( x , f )| cos ( φ pq ) df whereby s pq presents the cross spectrum between pressure fluctuations p ′ and fluctuations of the heat release q ′, and φ pq presents the phase differential . by choosing the correct phase differential between the heat release ( can be influenced by the time - lag ) and the pressure signal , the rayleigh index can be adjusted to g ( x )& lt ; 0 , i . e ., the system is attenuated . it was now found that the time - lag in existing premix burners is constant from the injection site at the fuel nozzles to the flame front over the entire injection length of the premix gas at specific operating points . this is , for example , the case for a double cone burner according to the state of the art as shown in fig1 a ). in this longitudinal section through a double cone burner 1 , which should be understood as an example , as known , for example , from ep 0 321 809 , the top gap 7 can be seen between the two conical burner shells 8 and 9 . the combustion air 23 enters through this gap 7 , passing the fuel nozzles 6 distributed over the burner length , into the inner chamber 22 , whereby the fuel is entrapped and enclosed by the air 23 that flows by . inside the inner chamber 22 of the burner 1 , the combustion air stream flows along the flow lines 5 under formation of a conical fuel column spreading in the flow direction . the fuel / air mixture then reaches the combustion chamber 2 , where it is ignited at a flame front 3 . in such a double cone burner , the time - lag τ that passes between the injection at the fuel nozzles 6 and the ignition at the flame front 3 is almost constant for all positions of the fuel nozzles , as shown schematically in fig1 b ) ( the x coordinate hereby extends from the outlet 10 of the burner 1 to its back end , i . e ., in fig1 a ) from right to left ). in other words , no systematic variation of the time - lags τ as a function of the fuel nozzle position along the burner 1 can be observed ( for example , shorter time - lags for nozzles 6 that are close to the burner outlet 10 ), but rather a more or less random appearing distribution of the function with only little fluctuation from a mean value as a function of the injection site x . as shown in fig2 it is now suggested according to the invention that instead of the formerly essentially constant time - lag from the fuel injection 6 to the flame front 3 , a distribution of the time - lag over the burner length is set . in a first selection , the distribution is adjusted so that the time - lags τ are varied in a linear manner by a time - lag differential δτ , i . e ., with a linear increase from a minimum τ max − δτ to the maximum in the rear burner area of τ max . in a two - dimensional illustration , fig3 shows the burner stability as a function of the parameters δτ ( x - axis ) and τ max ( y - axis ) for a time - lag distribution as shown in fig2 . individual measuring values given are hereby , as examples , three values for the behavior at different flow speeds in the burner : for a low flow speed 17 , for a medium flow speed 18 , and for a high flow speed 19 . in general , it is found that two basically unstable areas form ( here shown striated ). on the one side is an unstable area 16 with short time - lags . almost independent from the selection of δτ , the burner is not acoustically stable here for such high flow speeds . a second , island - like area 13 with unstable behavior is found for low speeds , i . e ., high values of τ max and for low values of δτ . it can now be seen clearly that the stability of a burner that operates with its typical operating values in most cases close to the island 13 can be stabilized by an increase of the flow speed according to arrow 15 , as well as by an increase of the time - lag differential δτ , i . e ., by shifting of the operating point in the graphic to the right , according to the arrow 14 . since for practical reasons the value of τ max cannot always be shifted into the stable lower range according to 15 , a shifting by setting higher time - lags differentials δτ , i . e ., via broader spread time - lags , is often an efficient and feasible alternative . typically , the time - lags for burners are in the range of τ = 5 - 50 ms , for double cone burners normally in the range from 5 - 15 ms at flow speeds of 10 - 50 m / s . δτ now can be varied within a broad range , but typically variations of δτ = 0 . 5 τmax are used ; for double cone burners , a variation of δτ ≧ 0 . 5 τ max was found to be especially advantageous . such a distribution can be technically realized in an exemplary embodiment of a double cone burner as shown already in fig1 by way of a simple modification of the fuel injection into the combustion air stream 23 . the fuel nozzles 6 here are not arranged directly at the gap 7 between the two shells 8 and 9 , but are set onto or respectively into the cone surfaces of elements 8 and 9 , so that the time - lags are systematically set . for this purpose , the fuel nozzles 6 can be divided into groups , and the nozzle groups of a group each are hereby arranged on lines 20 that follow the flow lines along the burner contour . nozzles of one group feed a specific region of the flame front , but with a different time - lag τ between the moment of injection and the arrival at the flow front 3 . it is hereby of advantage to form as many small groups as possible in order to create an evenly distributed flame additionally to the spreading of the time - lag . a number of 32 nozzles , which is typical for double cone burners because of the drop in pressure , a division into 8 groups , whose 4 each nozzles ( two per cone 8 or respectively 9 ) are arranged on 8 lines with identical time - lag , are suitable to prevent the thermoacoustic vibrations . an arrangement of the fuel nozzles 6 on such lines 20 now permits the adjustment of time - lags distributions in an overall range 21 as shown in fig4 b ). naturally , other arrangements of the fuel nozzles at or , respectively , in a burner that result in a systematic distribution of the time - lags that specifically prevent thermoacoustic vibrations , are possible . both the presented exemplary embodiment as well as the specified , essentially linear distributions should only be understood as examples . 1 double cone burner 2 combustion chamber 3 flame front 4 wall of combustion chamber 5 flow lines of fuel / air mixture 6 fuel nozzles 7 gap between conical shells of the burner 8 inner conical shell of the burner at 7 9 outer conical shell of the burner at 7 10 front end of double cone burner 11 constant time - lag 12 distribution of time - lags 13 unstable region of long time - lags 14 stabilizing shift towards wide distributions of time - lags 15 stabilizing shift towards short time - lags 16 unstable region of short time - lags 17 behavior for slow flow 18 behavior for medium flow 19 behavior for fast flow 20 lines for same region of the flame front 21 adjustable range of time - lags 22 inner chamber 23 flow of combustion air | 5 |
referring now to appended fig1 a and 1b , there is illustrated an integrally blow - moulded bag - in - container ( 2 ) and a preform ( 1 )& amp ;( 1 ′) for its manufacturing . the preform ( 1 ) comprises an inner layer ( 11 ) and an outer layer ( 12 ) joined at least at the level of the neck region ( 6 ) by an interface ( shown on the right hand side ). the region between inner and outer layers ( 11 ) and ( 12 ) may either consist of an interface ( 14 ) wherein the two layers are substantially contacting each other , or comprise a gap ( 14 ′) in fluid communication with at least one vent ( 3 ). said vent ( 3 ) comprises an opening to the atmosphere in ( 4 ). many vent geometries have been disclosed and it is not critical which geometry is selected . it is preferred , however , that the vent be located adjacent to , and oriented coaxially with said preform &# 39 ; s mouth ( 5 ) as illustrated in fig1 . more preferably , the vents have the shape of a wedge with the broad side at the level of the opening ( 4 ) thereof and getting thinner as it penetrates deeper into the vessel , until the two layers meet to form an interface ( 14 ) at least at the level of the neck region . this geometry allows for a more efficient and reproducible delamination of the inner bag upon use of the bag - in - container . the container may comprise one or several vents evenly distributed around the lip of the bag - in - container &# 39 ; s mouth . several vents are advantageous as they permit the interface of the inner and outer layers ( 21 ) and ( 22 ) of the bag - in - container ( 2 ) to release more evenly upon blowing pressurized gas through said vents . preferably , the preform comprises two vents opening at the vessel &# 39 ; s mouth lip at diametrically opposed positions . more preferably , three , and most preferably , at least four vents open at regular intervals of the mouth lip . the preform may consists of an assembly of two independent injection moulded preforms ( 11 ) and ( 12 ) produced independently from one another and thereafter assembled such that the inner preform ( 11 ) fits into the outer preform ( 12 ). this solution allows for greater freedom in the design of the neck and vents , as well as in the choice of materials constituting each preform component . alternatively , it can be an integral preform obtained by injection moulding one layer on top of the other . the latter embodiment is advantageous over the assembled preform in that it comprises no assembly step and one production station only is required for the preform fabrication . on the other hand , the design of the vents in particular is restricted and the respective melting temperatures of the inner and outer layers must be carefully matched depending on which layer is injected first ; the rule of thumb being that the layer being injected first generally requires a higher melting temperature . the inner and outer layers of the preform ( 1 ) may consist of different materials or the same material . in case different materials are used , some requirements must be fulfilled depending on the process parameters in the injection moulding of the preform as well as in the blow - moulding of the bag - in - container . it is important of course that both materials may be processed in a rather similar process window and that they will not form too strong an interface which would not satisfactorily release upon injecting pressurized gas at the interface . alternatively and surprisingly , good results can be obtained also with preforms wherein both laser and outer layers consist of the same material . particularly is case of integral , over - moulded preforms , it is generally believed that better results are obtained with semi - crystalline polymers . the same polymer is considered in contact on either side of the interface between the inner and outer layers in the following cases : inner and outer layers consist of the same material ( e . g ., pet inner pet outer , regardless of the specific grade of each pet ); or the inner and outer layers consist of a blend or copolymer having at least one polymer in common , provided said polymer in common is at the interface , whilst the differing polymer is substantially absent of said interface ( e . g ., ( 0 . 85 pet + 0 . 15 pa6 ) inner ( 0 . 8 pet + 0 . 2 pe ) outer . the presence in a layer of low amounts of additives is not regarded as rendering the material different , so far as they do not alter the interface substantially . preferred materials for the preform and bag - in - container of the present invention are polyesters like pet , pen , ptt , ptn ; polyamides like pa6 , pa66 , pa11 , pa12 ; polyolefins like pe , pp ; evoh ; biodegradable polymers like polyglycol acetate ( pgac ), polylactic acid ( pla ); and copolymers and blends thereof . in case different materials are used for the inner and outer layers , their optimal blow - moulding temperature should not differ from one another by more than 70 ° c ., preferably 40 ° c ., most preferably 10 ° c ., and ideally should have the same blow - moulding temperature . the two layers ( 11 ) and ( 12 ) of the preform may be connected by an interface ( 14 ) throughout substantially the whole inner surface of the outer layer . inversely , they may be separated over a substantial area of the preform &# 39 ; s body by a gap ( 14 ) containing air and which is in fluid communication with at least one interface vent ( 3 ). the latter embodiment is easier to realize when using a preform assembly designed such that the inner preform is firmly fixed to the outer preform at the neck region ( 6 ) and a substantial gap ( 14 ) may thus be formed between inner and outer layers ( 11 ) and ( 12 ). the bag - in - container ( 2 ) of the present invention is obtained by providing a preform as described above ; bringing the inner and outer layers of said preform to blow - moulding temperature ; fixing the thus heated preform at the level of the neck region with fixing means in the blow - moulding tool ; and blow - moulding the thus heated preform to form a bag - in - container , such that the inner layer is locally anchored to the outer layer at a location ( 7 ) remote from the bag - in - container &# 39 ; s neck region . the inner and outer layers ( 21 ) and ( 22 ) of the thus obtained bag - in - container are connected to one another by an interface ( 24 ) over substantially the whole of the inner surface of the outer layer . said interface ( 24 ) is in fluid communication with the atmosphere through the vents ( 3 ), which maintained their original geometry through the blow - moulding process since the neck region of the preform where the vents are located is held firm by the fixing means and is not stretched during blowing . it is essential that the interface ( 24 ) between inner and outer layers ( 21 ) and ( 22 ) releases upon blowing pressurized gas through the vents in a consistent and reproducible manner . the success of said operation depends on a number of parameters , in particular , on the interfacial adhesive strength , the number , geometry , and distribution of the vents , the pressure of the gas injected , and the inner bag stability . the latter can be substantially improved by fixing the inner layer to the outer layer at a location remote from the neck region and mouth of the bag - in - container , such that the interface between inner and outer layers will not release at said anchoring point upon injecting pressurized gas at a point of the interface . the bag is thus fixed at two points remote from one another ; the neck region and the anchoring point . this allows to better control the collapse of the bag , which is essential for a reliable and reproducible operation of the bag - in - container . the anchoring of the inner to the outer layers may be provided by a locally enhanced mechanical , physical , or physical adhesion . mechanical adhesion includes any interaction between inner and outer layers at all scales spanning from macroscopic mechanical interlocking to cross - crystallinity as well as molecular inter - diffusion across the interface , all phenomena well known to the person skilled in the art . physical and chemical adhesion is also well studied and involves dispersive forces ( e . g ., london and keaton forces ), acid base interactions ( sometimes also referred to as polar forces ), hydrogen bonds , and covalent bonds . all , but macroscopic interlocking , of the above adhesion mechanisms are temperature dependent and may be locally promoted , e . g ., by controlling the local temperature of the interface at the point where anchoring is desired . in case of preform assemblies , an adhesive may be applied at the desired anchoring point prior to fitting the inner preform into the outer one . the adhesive must resist the blow - moulding temperature and be compliant enough to stretch with the preform upon blowing . macroscopic interlocking may be achieved by using a blow - moulding tool comprising a sump or depression at the desired anchoring point , preferably at the bottom of the container as illustrated in fig1 . upon blow - moulding the heated preform expands and the inner and outer layers engage into the sump . the angle , α , formed by the sump wall with the surrounding container &# 39 ; s body wall maybe greater to or equal to 90 degrees , in which case an anchoring point is formed by enhanced friction between the inner and outer layer at the level of the thus produced protrusion or , alternatively , the angle can be smaller than 90 degrees , in which case a mechanical interlocking of the two layers is formed like a rivet . preferably a stretching rod drives the preform downwards during the blow - moulding process to promote longitudinal stretching and to ensure that good contact of the preform with the tool &# 39 ; s wall is effected at the desired point of anchoring . in the case the angle , α , formed by the sump wall with the surrounding container &# 39 ; s body wall is smaller than 90 degrees and the mechanical interlocking of the two layers is formed like a rivet , the anchoring point comprises an undercut . the creation of this undercut can be achieved in several methods , some of which are described below . according to a first method , the undercut is created by using a blow - moulding tool comprising two half - moulds that are only partially closed at the location of the sump , the side walls of the half - moulds at the sump location defining a negative of the anchoring point to be created . the preform is driven down in the sump by means of a stretching rod , where after both half - moulds are moved towards each other to entirely close the mould , creating the undercut . according to another method , a blow - moulding tool is used comprising axially moving pins that can be introduced in the mould cavity during blow - moulding , allowing creation of the undercut . according to yet another method , the blow - moulding tool with half - moulds defining a sump negative to the anchoring point to be created . the preform beind driven into the sump by means of the fluid pressure applied during blow - moulding thereof . in this method , a stretching rod may be used that either stops at a position distant from the sump or that extends into the sump . in the last case , it is preferred to use a stretching rod provided with a central fluid channel and lateral openings at its distal end ( the end extending in the blow - moulding tool ) that extends into the sump during stretching , such that part of the fluid used to stretch the preform is guided through the fluid channel and the lateral openings to facilitate stretching of the preform into the sump and against the inner wall the mould cavity defining the sump . fig2 schematically represents a blow - moulding tool with provided therein a chime comprising said sump or depression at the desired anchoring point . this chime is inserted in the blow - moulding tool prior to blow - moulding the preform , such that upon blow moulding the heated preform expands and the inner and outer layers engage into the sump . in this manner , the desired macroscopic interlocking is achieved and additionally a chime is provided on the container . in the case the sump defined by the chime is designed for the creation of an anchoring point in the form of a rivet , the anchoring point can successfully be created by means of fluid pressure forcing the material of the preform into the sump . both methods applying a stretching rod and not applying a stretching rod can be used . a release agent may be applied at the interface on either or both surfaces of the inner and outer layer , which are to form the interface of the bag - in - container . in the case the outer layer is injection moulded into the inner layer , the release agent can be applied at the outer surface of the inner layer prior to moulding the outer layer . any release agents available on the market and best adapted to the material used for the preform and resisting the blowing temperatures , like silicon - or ptfe - based release agents ( e . g ., freekote ) may be used . the release agent may be applied just prior to loading the preforms into the blowmoulding unit , or the preforms may be supplied pretreated . the application of a release agent is particularly beneficial with respect to the design of the inner layer . indeed , lowering the interferential adhesive strength facilitates delamination of the inner layer from the outer layer and hence reduces stress exerted on the inner layer upon delamination , as such the inner layer can be designed very thin and flexible without risking that the inner layer is damaged upon delamination . clearly , the flexibility of the inner bag is a key parameter for the liquid dispensing and moreover costs savings can be achieved in terms on material savings when the inner layer can be designed very thin . | 1 |
the predictive model uses features derived from multiple data sources that are fed to learning algorithms . one of the features used in this process is hierarchical categorization by major clinical conditions or mccs . both medical and pharmacy claims data is mapped into these mccs . the international classification of diseases , 9th revision , was detailed by the world health organization . united states department of health and human services publication dhhs pub . no . phs 94 - 1260 , october 1994 , is the 9th revision of the international classification of diseases — clinical modifications . these classifications are incorporated herein by reference . the classification codes contained therein are more commonly known as icd9 - cm codes . these codes are used by hospitals and health care professionals to bill for charges and services . these codes identify the specific diagnosis assigned to each patient at the time of treatment . for each visit or service , there can be multiple diagnoses . because there are approximately 12 , 000 icd9 - cm codes , the number of codes needed to be collapsed and categorized into cohesive broad groups or categories that made clinical sense , with flexibility in drill down into sub or sub - sub groups . realizing that the icd9 - cm codes were too many , the major categories in the icd9 - cm code book were too few and too broad , episode treatment groups ( etgs ) were numerous and the major practice categories ( mpcs ) within etgs were too broad , and diagnosis - related groups ( drg ) only included hospital based treatment , we embarked on developing the mccs , which classified all the icd9 - cm diagnostic codes into 33 major categories plus a summary category for chronic conditions . in developing the mccs , we considered those diseases / conditions that were high risk / high cost and potentially presented opportunity for management or guidance . for consistency in coding , we also evaluated those conditions that had or could have disease management programs in place . classifying the 12 , 000 icd9 - cm codes into 34 categories enables the predictive model to run more efficiently , and allows us to present a visual picture over time that follows the progression of illness and can be easily interpreted . as icd codes are changed or revised , the changed or revised codes can be easily mapped into the same 34 mccs , thereby providing a method and system which the user of the visual picture sees as transparent to the changes and revisions . within each major clinical condition , there may be specific conditions or categories that are more definitive or may be clinically significant . because all icd9 - cm codes are included in the mccs , we developed sub - categories and sub - sub categories to allow a greater level of detail ; e . g ., mcc — cancer ( can ), sub - mcc digestive ( dig ), sub - sub mcc — upper gastrointestinal ( ugi ) and sub - sub mcc lower gastrointestinal ( lgi ). although there are 34 major clinical conditions , within the mccs , there are 259 mcc , sub - mcc , and sub - sub - mcc categories . each mcc has been assigned a three letter acronym ( tla ); the sub - mccs and sub - sub mccs have also been assigned acronyms of 2 - 4 letters . to complete the clinical picture , we mapped pharmacy data to corresponding mccs by using drug classes . certain drug classes can be used to treat multiple conditions . in those instances , logic was incorporated into the model to identify the presence of a condition before mapping the pharmacy data . that logic is , if the corresponding medical claim data was available to identify the relevant mcc , the pharmacy claim data was mapped to the same mcc . an example would be oral anti - diabetic agents are primarily used to treat diabetes , but it is sometimes used in the treatment of polycystic ovary disease ( pcos ). in this instance , the model scans for the presence of a diagnosis of either diabetes or pcos and maps the drug claim to the appropriate diagnosis ; if both diagnoses are present , the claim is equally allocated to both diseases . however , if the corresponding medical claim data was not available ( for example , because only pharmacy claim data was available for that individual or because the pharmacy claim data was received and processed before the pharmacy claim data ), the pharmacy claim data is equally allocated among all mccs that include the drug class related to the claim . while these drug classes are not as precise in identifying a disease or illness ( some medications can be used for multiple disease processes ), they are of value in interpreting and evaluating a member &# 39 ; s total health picture . by classifying drugs by disease condition , one can get a quick visual picture of individual member adherence to medication by looking at the consistency of color or shades of gray intensity over time and the gaps in refills for those drugs that should be taken on a regular basis . it is noted that pharmacy claim data may be submitted by national drug code ( ndc ). there are other pharmacy drug code systems in use , such as the medispan generic product identifier ( gpi ) classification code system . all of these code systems can be mapped to the drug classes identified below with each of the 34 mccs . the following explains the 34 mccs with the corresponding sub - mcc , and sub - sub - mcc categories and the icd9 codes mapped to each mcc , sub - mcc , and sub - sub - mcc category and the drug classes mapped to each mcc , sub - mcc , and sub - sub - mcc category . mcc category # 1 is cad — coronary artery disease . the overall category has the following icd9 codes mapped thereto — v4581 , v4582 , 410 , 412 , 413 , 411 , 414 , 272 . drug classes mapped to this category are cardiotonics , anti - anginals , beta blockers , calcium channel blockers , cardiology supplies . sub - mccs for cad are as follows : cabg — coronary artery bypass graft with icd9 code — v4581 ; ptca — percutaneous transluminal coronary angioplasty with icd9 code — v4582 ; mi — myocardial infarction with icd9 codes 410 , 411 ; ang — angina with icd9 code 413 ; isch — other ischemic heart disease with icd9 code 411 ; ashd — coronary atherosclerosis with icd9 code 414 ; and chol — hyperlipidemia with icd9 code 272 and drug class cholesterol lowering agents . cad has no sub - sub - mcc categories . mcc category # 2 is chf — congestive heart failure with icd9 code 428 mapped thereto . drug classes mapped to chf are beta blockers , antihypertensive agents , and diuretics . chf has no sub - mccs or sub - sub - mccs . mcc category # 3 is hdz — other heart disease . the overall category has the following icd9 codes mapped thereto — 394 - 3979 , 424 - 4243 , 426 , 427 , 420 - 422 , 429 , 4249 , v151 , 425 . one sub - mcc is valv — valve diseases / disorders with icd9 codes 394 - 3979 , 424 - 4243 and drug classes of coumarin . another sub - mcc is arrh — arrhythmias / conduction disorders with icd9 codes 426 , 427 and drug classes of antiarrythmics and coumarin , with sub - sub - mcc svi — supraventricular arrhythmia with icd9 codes 4270 , 4272 , 4273 , and sub - sub - mcc vtc — ventricular arrhythmia with icd9 codes 4271 , 4274 , 4275 . the remaining sub - mccs for this category are itis — carditis with icd9 codes 420 - 422 , 4290 , 4249 ; surg — surgery to heart with icd9 code v151 ; myop — cardiomyopathy with icd9 code 425 ; and othr = sum of mcc — sub - mcc with drug class of pressor agents . mcc category # 4 is cir — circulatory . the overall category has the following icd9 codes mapped thereto — 390 - 459 785 , 7943 , 7892 , v125 , 79092 . drug classes mapped to this category are sclerosing agents and anticoagulants . one sub - mcc is hbp — hypertension with icd9 codes 401 - 405 , with drug classes of beta blockers , calcium channel blockers , antiarrhythimics , antihypertensives , diuretics , with sub - sub - mccs ehbp — essential hypertension with icd9 codes 4011 , 4019 , and comp — complicated hypertension with icd9 codes 4010 , 402 - 405 . the remaining sub - mccs for this category are art — arteriosclerosis with icd9 codes 440 and drug class of cholesterol lowering agents ; anur — aneurysms with icd9 codes 441 , 442 ; and othr = sum of mcc — sub mcc with drug class of miscellaneous cardiovascular agents ; vasodilators , cardioplegics , vasoconstrictors , vasoprotectants . all codes found in mccs # 1 , 2 , 3 , 18 , 12 are excluded from this mcc and its sub - mccs and sub - sub - mccs . mcc category # 5 is bld — blood and blood forming organs . this category has the following icd9 codes mapped thereto — 280 - 289 , 7900 - 79009 , v123 . drug classes mapped to this category are hematopoietic agents except epo , gm - gsf ) and interleukins , hemostatics , platelet aggregation inhibitors , hematorheological , hemin , in vitro hema agents , plasma expanders , plasma proteins , protamine , thrombolytic enzymes , hematologic o2 transporter assigned to the overall category . sub - mccs are as follows : anem — anemias with icd9 code / s 280 - 285 ; and othr = sub of mcc — sub mcc . all codes listed in mcc 16 are excluded from this mcc and its sub - mccs . bld has no sub - sub - mccs . mcc category # 6 is can — malignant neoplasms . this category has the following icd9 codes mapped thereto — 140 - 2089 , 230 - 239 , v10 - v109 , v131 , v581 , v672 . drug classes mapped to this category are antineoplastics , erythropoeitins , gm - csf , interleukins , immunosuppressive agents . one sub - mccs is brst — breast with icd9 codes 174 - 1759 . another sub - mcc is dig — digestive and peritoneum with icd9 codes 150 - 1599 , with sub - sub - mccs of ugi — upper gastrointestinal with icd9 codes 150 - 152 , lgi — lower gastrointestinal with icd9 codes 153 - 154 , pbl — pancreas , liver with icd9 codes 155 - 157 , and othr — other gastrointestinal with icd9 codes 158 - 159 . another sub - mcc is res — respiratory with icd9 codes 160 - 165 , with sub - sub - mccs of uair — upper airway with icd9 codes 160 - 161 , lair — lower airway with icd9 codes 162 - 163 , and othr — other respiratory with icd9 codes 164 - 165 . another sub - mcc is gu — genitourinary system with icd9 codes 179 - 1899 , v131 , with sub - sub - mccs of fgen — female genital with icd9 codes 179 - 184 , v131 , mgen — male genital with icd9 codes 185 - 187 , lgu — lower genito - urinary with icd9 code 188 , and ugu — upper genitor - urinary with icd9 code 189 . additional sub - mccs are lymp — lymphatic and hematopoietic with icd9 codes 200 - 2038 ; sec — secondary cancer with icd9 codes 196 - 1991 ; and h & amp ; n — head and neck with icd9 codes 140 - 1499 . another sub - mcc is skn — skin cancers with icd9 codes 173 - 1739 , 172 , with sub - sub - mccs of mel — malignant melanoma with icd9 code 172 , and othr — other skin cancer with icd9 code 173 . the remaining sub - mccs are leuk — leukemia with icd9 codes 2040 , 2042 - 208 ( excludes 2041 ); ner — nervous system with icd9 codes 191 - 192 ; end — endocrine system with icd9 codes 193 - 194 ; h / o — history of cancer with icd9 codes v10 - v109 , v581 , v672 ; and othr = sum of mcc — sub - mccs . all codes found in mcc # 23 are excluded from this mcc and its sub - mccs and sub - sub - mccs . mcc category # 7 is ben — benign neoplasms . this category has the following icd9 codes mapped thereto — 210 - 2299 , v1241 . sub - mccs are ner — benign neoplasms of the brain and nervous system with icd9 codes 225 , v1241 ; and othr — all other = sum of mcc — sub - mccs . this category has no sub - sub - mccs . mcc category # 8 is dia — diabetes . this category has the following icd9 codes mapped thereto — 250 , 6480 , ( 3572 , 3371 , 7135 , 3540 - 3559 , 3581 ), ( 3620 ), ( 36641 ), ( 58381 , 58181 ), ( 7854 , 44381 ), 7902 , 7915 — codes in parenthesis are secondary codes . these secondary codes are used in conjunction with a primary diagnosis ; the primary diagnosis must be coded first as it is the underlying cause of the secondary illness . for example , nephropathy ( kidney failure ) is frequently a complication of diabetes , but it can also be caused by other diseases . in this instance , diabetes would be coded primary ( as it was the cause of nephropathy ) and nephropathy would be coded as secondary . drug classes mapped to dia are antidiabetic agents , needles & amp ; syringes , diabetic supplies , wound care products , control reagents , angiotensin converting enzyme inhibitors ( ace ), ace and thiazides , angiotensin ii receptor blockers ( arb ), arbs and thiazides . sub - mccs are as follows : neu — neuropathy with icd9 codes 2506 , ( 3572 , 3371 , 7135 , 3540 - 3559 , 3581 ); eye — ophthalmic complications with icd9 code / s 2505 , ( 3620 , 36641 ); nep — nephropathy with icd9 code / s 2504 , ( 58381 , 58181 ); pvd — peripheral vascular disease with icd9 code / s 2507 ( 7854 , 44381 ); and othr = sum of mcc — sub mcc . this category has no sub - sub - mccs . mcc category # 9 is obe — obesity . the following icd9 codes are mapped thereto — 27800 , 27801 . drug classes mapped to obe are nnorexiants , antiobesity agents . this category has no sub - mccs or sub - sub - mccs . mcc category # 10 is end — endocrine . icd9 code / s 240 - 279 7945 , 7946 , 7947 , 7834 - 7839 , 7994 , v122 , 7916 , 70904 , v150 , v121 , v691 are mapped to this category . sub - mccs are as follows : thy — thyroid with icd9 codes 240 - 246 , 79094 and drug class of thyroid hormones ; gld — other glandular disorders with icd9 codes 251 - 259 ( exclude 2564 ) and drug classes of corticosteroids , adrenal inhibitors , calcium regulators , hormone receptor modulators , luteinizing hormone releasing , luteinizing hormone agonist , gnrh / lhrh antagonists , grown hormones , somatostatic agents , posterior pituitary agents , corticotrophin , prolactin inhibitors , dopamine receptor agents ; meta — other metabolic and immunity disorders with icd9 codes 270 - 279 , v150 and drug class of gout agents ; nutr — nutrition with icd9 codes 260 - 269 , 7830 - 7833 , v121 , v691 and drug classes of vitamins , minerals & amp ; electrolytes , nutrients , dietary products ; synx — dismetabolic syndrome x with icd9 code 2777 ; and othr = sum of mcc — sub mcc and drug classes of metabolic modifiers and miscellaneous endocrine combinations . all codes found in mccs # 1 , 8 , 9 , 11 , 16 are excluded from this mcc and its sub - mccs . there are no sub - sub - mccs for this category . mcc category # 11 is gus — genitourinary system . the following icd9 codes are mapped to this category — 580 - 629 , 788 , 7944 , 7935 , 7938 , 7939 , v130 , 7910 - 7913 , 7917 - 7919 , 7922 , 7950 , 7951 , v1329 , v6701 , 2564 . some of the sub - mccs are kub — kidneys , ureters , bladder with icd9 codes 580 - 584 , 587 , 589 - 599 , 7910 - 7913 , 7917 - 7919 , v130 and drug classes of urinary anti - infectives , urinary antispasmodics , acidifiers , alkalinizers , urinary analgesics , cystinosis agents , interstitial cystits agents , urinary stone agents ; gu irrigants , uroprotectant , gi_gu ostomy supplies ; male — male genitourinary with icd9 codes 600 - 608 , 79093 , 7922 and drug classes of androgen - anabolics , impotence agents , prostatic agents ; and brst — breast with icd9 codes 610 - 611 . another sub - mcc is fem — female with icd9 codes 614 - 629 , 7950 , 7951 , v1329 , v6701 , 2564 and drug classes of estrogens , progestins , selective estrogen receptor modulators , fertility regulators , progesterone antagonists , menopausal sx suppressants , vaginal products , with sub - sub - mcc is as follows : pcos — polycystic ovaries with drug class of oral antidiabetic agents . the final sub - mcc for this category is othr = sum of mcc — sub mcc . all codes found in mcc # 12 are excluded from this mcc and its sub - mccs . mcc category # 12 is ckd — chronic kidney disease . this category has the following icd9 codes mapped thereto — 5811 , 58181 , 5819 , 582 , 75312 , 75313 , 75314 , 75316 , 75319 , 40301 , 40311 , 40391 , 40402 , 40403 , 40412 , v56 , 7925 , 40413 , 40492 , 40493 , 585 , 586 , 588 . drug classes mapped to this mcc are erythropoietin , potassium removing resin , peritoneal dialysis solutions , hemodiialytics , and peritoneal dialysis supplies . ckd has no sub - mccs or sub - sub - mccs . mcc category # 13 is pre — pregnancy . icd9 codes 630 - 677 , 7923 , v1321 , v137 , v22 - v24 , v27 - v28 are mapped to this category . sub - mcc are as follows : ect — ectopic / molar / abortive with icd9 code / s 630 - 639 ; com — complications with drug classes of oxytocics , abortifacients , uterine relaxants , prostaglandins ; del — normal delivery , mul — multiple ; l & amp ; d — labor and delivery ; care — pregnancy care / outcome of delivery / contraception with drug class of contraceptives ; and othr = sum of mcc — sub - mcc . all codes found in mcc # 8 are excluded from this mcc and its sub - mccs . there are no sub - sub - mccs for this category . mcc category # 14 is neo — neonates . icd9 codes 760 - 779 , v29 - v39 are mapped thereto . there are no sub - mccs or sub - sub - mccs for this category . mcc category # 15 is ano — congenital anomalies . icd9 codes 740 - 759 , v136 are mapped thereto . sub - mccs are as follows : cns — central nervous system with icd9 codes 740 - 742 ; hrt — cardiovascular with icd9 codes 745 - 747 ; dig — digestive with icd9 codes 7503 - 751 ; mus — musculo - skeletal with icd9 codes 754 - 75659 ; gus — genitourinary system with icd9 codes 752 - 753 ; and othr = sum of mcc — sub - mcc . all codes found within mcc 12 are excluded from this mcc and its sub - mccs . there are no sub - sub - mccs for this category . mcc category # 16 is rar — rare diseases . the sub - mccs are as follows : cf — cystic fibrosis with icd9 code 2770 and drug class of cystic fibrosis agents ; hem — hemophilia with icd9 codes 2860 , 2861 , v8302 and drug class of antihemophilics ; ms — multiple sclerosis with icd9 codes 340 , 3419 with drug class of ms agents ; mg — myasthenia gravis with icd9 code 3580 with drug class of antimyasthenic agents ; lup — lupus with icd9 codes 7100 , 6954 ; als — amyotrophic lateral sclerosis with icd9 code 3352 with drug class of als agents ; cid — chronic inflammatory demyelinating polyneuropathy with icd9 codes 3570 , 3578 , 3579 ; drm — dermatomyositis with icd9 code 7103 ; par — parkinson &# 39 ; s with icd9 code 3320 with drug class of antiparkinson agents ; pol — polymyositis with icd9 code 7104 ; ra — rheumatoid arthritis with icd9 codes 714 - 7143 ; scl — scleroderma with icd9 code 7101 ; and sca — sickle cell anemia with icd9 codes 2826 - 2869 . there are no sub - sub - mccs for this category . mcc category # 17 is tra — transplant . icd9 codes v420 - v421 , v426 , v427 , v428 - v4299 , 9968 and drug class of immunosuppressants are mapped to this category . there are no sub - mccs or sub - sub - mccs for this category . mcc category # 18 is cer — cerebrovascular . the following icd9 codes are mapped thereto — 430 - 432 , 433 - 434 , 78002 , 435 , 438 . the sub - mccs are as follows : hem — hemorrhage with icd9 codes 430 - 432 ; occ — occlusions with icd9 codes 433 - 434 and drug class of coumarin agents ; tia — transient ischemic attach with icd9 codes 78002 , 435 and drug class of coumarin agents ; and seq — late effects or sequelae of cerebrovascular accident with icd9 code 438 . this category has no sub - sub - mccs . mcc category # 19 is ner — nervous system . this mcc has the following icd9 codes mapped thereto — 320 - 359 , 7810 - 7814 , 7816 - 7818 , 78199 , 7843 , 7840 , 7940 , 79410 , 79417 , 79419 , 7844 - 7846 , 7920 , v1240 , v1249 . sub - mccs are as follows : infl — inflammatory diseases with icd9 codes 320 - 326 ; deg — hereditary / degenerative diseases with icd9 codes 330 - 337 ; migr — migraine with icd9 code 346 and drug class of migraine products and beta blockers ; epil — epilepsy with icd9 code 345 with drug class of anticonvulsants ; and othr = sum of mcc — sub - mccs . all codes found within mccs 8 , 16 , 21 are excluded from this mcc and its sub - mccs . there are no sub - sub - mccs for this category . mcc category # 20 is sor — sense organs . icd9 codes 360 - 389 , 79411 - 79416 , 78193 are mapped to this mcc . one sub - mccs is eye — eye with icd9 codes 360 - 379 ( exclude 3620 , 36641 ), 79411 - 79414 , 78193 with drug class of ophthalmic agents , with sub - sub - mccs being catr — cataracts with icd9 code 366 , glau — glaucoma with icd9 code 365 , ret — retinal diseases with icd9 codes 361 - 363 , vis — visual disturbances with icd9 codes 367 - 369 , optc — optic nerve with icd9 code 377 , and othr = sum of sub - mcc — sub - sub mcc . the other sub - mcc for this category is ear — ear with icd9 codes 380 - 389 , 79415 - 79416 with drug class of otic agents , with sub - sub - mccs of xear — external ear with icd9 codes 380 , mear — middle ear with icd9 codes 381 - 385 , othr — other ear with icd9 code 388 . mcc category # 21 is trm — trauma . icd9 codes 800 - 8049 , 805 - 8069 , 952 - 9529 , 851 - 8541 , 925 - 9252 , 344 - 3449 , 808 - 8089 , 820 , 8181 - 819 , 828 - 8281 are mapped thereto . the sub - mccs are as follows : skul — skull fractures with icd9 codes 800 - 8049 ; spfx — spinal cord fracture with icd9 codes 805 - 8069 ; spnj — spinal cord injury with icd9 codes 952 - 9529 ; brn — brain laceration or contusion with icd9 codes 851 - 8541 ; f / n — crushing injury face / neck / scalp with icd9 codes 925 - 9252 ; prly — paralysis with icd9 codes 344 - 3449 ; hip — hip / pelvis / neck of femur fractures with icd9 codes 808 - 8089 , 820 ; fxu — multiple fracture upper limbs with icd9 codes 8181 - 819 ; fxul — multiple fractures lower and / or upper limbs with icd9 codes 828 - 8281 . this mcc has no sub - sub - mccs . mcc category # 22 is mus — musculo - skeletal and connective tissue . icd9 code / s 710 - 739 , 7930 , 7937 , v134 , v135 , v674 , 7815 , 78191 , 78192 , 7842 are mapped thereto . drug classes mapped to the overall category are analgesics , narcotic and non - narcotics , anti - inflammatory agents , neuromuscular agents , depolarizing and non - depolarizing muscle relaxants , musculoskeletal therapy agents . the sub - mccs are as follows : oste — osteoporosis with icd9 code 7330 ; arth — arthritis ( excludes rheumatoid arthritis ) with icd9 codes 712 , 713 , 715 , 720 , 721 , v134 ; back — back / neck pain with icd9 codes 722 - 724 , 846 , 847 ; atrp — arthropathies with icd9 codes 712 , 713 , 715 , 720 , 721 , v134 ; inf — infections with icd9 codes 711 , 730 ; jnt — joint specific disorder with icd9 codes 717 - 719 ; soft — soft tissue disorders with icd9 codes 725 - 729 ; form — malformations with icd9 codes 734 - 738 ; othr = sum of mcc — sub - mcc . all codes found within mccs 8 , 16 are excluded from this mcc and its sub - mccs . this category has no sub - sub - mccs . mcc category # 23 is hiv — hiv and related conditions . icd9 codes 042 , v08 , v6544 , 176 , 1363 , 79571 and drug class of antiviral agents are mapped thereto . sub - mccs are as follows : kapo — kaposi &# 39 ; s sarcoma with icd9 code 176 ; pcp — pneumocystic carnii pneumonia with icd9 code 1363 ; othr = sum of mcc — sub mcc . this category has no sub - sub - mccs . mcc category # 24 is inf — infections . icd9 codes 001 - 1398 , 7901 , 7907 , 7908 , 7953 - 7956 , v01 - v02 , v07 , v09 , v120 , v1585 are mapped thereto . drug class mapped to the mcc is anti - infective agents . sub - mccs are as follows : cand — candidial with icd9 codes 11281 , 11284 , 11285 , 1124 , 1125 , 11283 ; myco — mycobacteria with icd9 codes 0310 , 0312 ; men — meningococcal infection with icd9 codes 036 ; sep — septicemia with icd9 code 038 ; othr = sum of mcc — sub mcc . all codes found within mccs 23 , 26 are excluded from this mcc and its sub - mccs . this category has no sub - sub - mccs . mcc category # 25 is res — respiratory . icd9 codes 460 - 519 , 786 ( exclude 7865 ), 7942 , 7931 , 7932 , v461 , 7847 - 7849 , 7841 , 79091 , 7991 , 7990 , v126 , v1584 are mapped thereto . sub - mccs are as follows : asth — asthma with icd9 code 493 with drug classes of antiasthmatics nebulizers , peak flow meters ; copd — chronic obstructive pulmonary disease with icd9 codes 491 - 492 , 496 with drug classes of alpha - proteinase inhibitor , anticholinergics , long acting beta - agonists , nebulizers ; inf — infections and inflammatory disorders with icd9 codes 460 - 466 , 472 - 477 , 47821 - 47824 , 47871 , 4788 , 480 - 487 , 490 , 513 , 47829 with drug classes of allergenic extracts , antihistamines , nasal products , cough / cold / allergy ; fail — respiratory failure with icd9 codes 5188 , 5190 with drug class of hypoxic respiratory failure agents ; and othr = sum of mcc — sub mcc with drug class of other respiratory therapy supplies , respiratory aids , medical gases , miscellaneous respiratory , pleural sclerosing agents . this mcc has no sub - sub - mccs . mcc category # 26 is dig — digestive . icd9 codes 520 - 579 , 787 , 7933 , 7934 , 7891 , 7895 , 7948 , 7905 , v127 , 7924 , 7921 , 04186 , 7914 and drug class of ostomy supplies are mapped thereto . a sub - mccs is : ugi — upper gastro - intestinal with icd9 codes 520 - 537 , 5301 , 04186 , 7924 , with sub - sub - mccs of pud — peptic ulcer disease / gastro - esophageal reflux disease with icd9 codes 520 - 537 , 5301 , 04186 , 7924 and drug class of antacids , ulcer drugs , prostaglandins , mou — mouth with icd9 codes 520 - 529 , 7924 and drug class of local mouth and throat agents , eso — esophagus with icd9 codes 5300 , 5303 - 5307 , 53083 - 5309 , and stom — stomach with icd9 codes 536 - 537 and drug class of antiemitics , digestive aids . other sub - mccs are : lgi — lower gastro - intestinal with icd9 codes 540 - 569 , 7921 and drug class of anorectal agents , laxatives , antidiarrheals , antiflatulent combos , gi stimulants , intestinal acidifiersrs irritable bowel agents , ( ibs ) agents ; p / b — pancreas / biliary with icd9 codes 574 - 577 , 7914 with drug class of gallstone agents ; liv — liver with icd9 codes 570 - 573 and drug class of hepatropic agents ; and othr = sum of mcc — sub - mcc with drug class of miscellaneous gi , phosphate binders . mcc category # 27 is skn — skin and subcutaneous tissue . icd9 codes 680 - 709 , 700 - 709 , 7820 - 7822 , 7827 - 7829 , v133 , v820 are mapped thereto . the sub - mccs are as follows : inf — inflammatory / infections with icd9 codes 680 - 698 with drug class of dermatologics , - acne , topical antibiotics , topical antifungals , topical antihistamines , anti - inflammator , antiprruitics , antipsoriatics antiviral , corticosteroids , scabicides , sunscreens , wound care , poison ivy ; an — acanthosis nigricans with icd9 codes 7012 ; and othr = sub of mcc — sub - mcc with drug class of dermatologics , analgesics , antiseborrheic , antineoplastic , bath , burn , cauterizing , tar , diaper rash , emollients , enzymes , hair , keratolytics , immunomodulating , linaments , anesthetics , pigmenting , vasoprotectants , miscellaneous topical , podiatric , miscellaneous dermatology . all codes found within mcc 16 are excluded from this mcc and its sub - mccs . there are no sub - sub - mccs for this category . mcc category # 28 is inj — injury and poisoning . icd9 codes 800 - 999 , e800 - e807 , e820 - e888 , e900 - e929 , e950 - e999 , v155 - v156 , v1586 , v14 are mapped thereto . the sub - mccs are as follows : org — injury to major organ with icd9 codes 860 - 869 ; drug — drug complications with icd9 codes 960 - 979 , e850 - e858 , e930 - e949 , v14 ; comp — complications with icd9 codes 995 - 9954 , 99586 - 999 , e870 - e879 ; othr = sum of mcc — sub mcc with drug class of chleating agents . all codes found within mcc 17 , 21 , 29 , 30 are excluded from this mcc and its sub - mccs . this category has no sub - sub - mccs . mcc category # 29 is brn — burns . icd9 codes 940 - 949 , e890 - e899 are mapped thereto . sub - mccs are as follows : acc — accident / fire / flames with icd9 code / s e890 - e899 ; and othr = sum of mcc — sub - mcc . this category has no sub - sub - mccs . mcc category # 30 is mva — motor vehicle accident . icd9 codes e810 - e819 are mapped thereto . this category has no sub - mccs or sub - sub - mccs . mcc category # 31 is men — mental / behavioral disorders . icd9 codes 290 - 319 , v112 , v118 , v119 , v154 , v673 , v693 , v698 , v692 , v111 , v110 , v1582 , v113 and drug classes of antianxiety , antidepressants , antipsychotics , hypnotics , amphetamines , analeptics , misc stimulants , antidementia , smoking deterrants , chemical dependency agents , combination psycho agents are mapped thereto . sub - mccs are as follows : dep — depression with icd9 codes 296 , 3004 , 311 , v111 and drug class of antidepressants ; schz — schizophrenia with icd9 codes 295 , v110 ; abus — substance abuse with icd9 codes 304 , v1582 and drug classes of agents for chemical dependency , agents for narcotic withdrawal ; alco — alcoholism with icd9 codes 291 , 303 , 7903 , v113 and drug class of alcohol deterrents ; smok — smoking with icd9 code 3051 and drug class of smoking deterrents ; and othr = mcc — sub - mcc and drug classes of antianxiety agents , antipsychotics , misc psy & amp ; neuro agents , antidementia agents , combination psychotherapeutics . this category has no sub - sub - mccs . mcc category # 32 is sns — signs and symptoms with icd9 codes 780 - 799 . sub - mccs are as follows : coma — coma with icd9 codes 78001 , 78003 ; cons — altered consciousness with icd9 codes 78009 , 7801 - 7804 ; abd — abdomen with icd9 codes 7890 , 7893 , 7894 , 7896 , 7899 , 7936 ; chst — chest with icd9 code 7865 ; dth — death with icd9 code 798 ; and othr = sum of mcc — sub mccs and drug classes of hypnotics , analgesics ( narcotic & amp ; non narcotic ), anti - inflammatory analgesics , local anesthetics , general anesthetics . all codes found within mccs 4 , 5 , 8 , 10 , 11 , 12 , 13 , 18 , 19 , 20 , 22 , 23 , 24 , 25 , 26 , 27 , 31 are excluded from this mcc and its sub - mccs . this category has no sub - sub - mccs . mcc category # 33 is vco — v - codes with icd9 codes v01 - v83 with drug classes of vaccines and toxoids . one sub - mcc is exam — examination and screening with icd9 codes v70 - v83 , with sub - sub - mccs of cad — screening for ischemic heart disease with icd9 codes v810 , v7791 , hdz — screening for other heart disease with icd9 code v812 , bld — screening for blood disorders with icd9 codes v780 - 781 , v783 - v789 ; can — screening for cancer with icd9 code v76 , dia — screening for diabetes with icd9 code v771 , obe — screening for obesity with icd9 code v778 , end — screening for endocrine disorders with icd9 codes v770 , v773 - v775 , v777 , v772 , v7799 , gus — screening genitourinary with icd9 codes v815 , v157 , v723 , v816 , v25 - 26 , v724 , ano — screening for anomalies with icd9 codes v823 - 824 , rar — screening for rare diseases with icd9 codes v776 , v821 , v782 , v8301 , v838 , ner — screening for nervous system disorders with icd9 codes v792 - 793 , v800 , sor — screening for sense organ disorders with icd9 codes v801 - 803 , v720 - 721 , mus — screening for musculo - skeletal disorders with icd9 codes v822 , v8281 , inf — screening for infections with icd9 codes v73 - 75 res — screening for respiratory disorders with icd9 codes v813 , v727 , v814 , dig — screening for digestive disorders with icd9 code v722 , skn — screening for skin disorders with icd9 code v820 , inj — screening for poisoning with icd9 code v825 , and men — screening for mental / behavioral disorders with icd9 codes v790 - 791 , v798 - 799 . the remaining sub - mccs for this category are care — care given to infant / child with icd9 codes v20 - v21 ; vac — need for vaccine with icd9 codes v03 - v06 ; fho — family history of cancer with icd9 codes v16 - v19 ; and othr = sum of mcc — sub mccs . all codes found within mccs 1 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 19 , 20 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 31 are excluded from this mcc and its sub - mccs . mcc category # 34 is chr — chronic mccs . this category includes items in prior detailed mcc categories or sub - mccs that are considered chronic or long term . mccs are listed first , followed by sub - mccs ; all acronyms have been previously detailed . mcc # 1 — cad , mcc # 2 chf , mcc # 3 hdz ( excludes sub - mcc of itis ), mcc # 6 — can , mcc # 8 — dia , mcc # 12 — ckd , mcc # 15 — ano , mcc # 16 — rar , mcc # 17 — tra , mcc # 18 — cer , mcc # 23 — hiv , sub - mcc epil ( found within mcc # 19 — ner ), sub - mcc asth ( found within mcc # 25 — res ), sub - mcc copd ( found within mcc # 25 — res ), sub - mcc liv ( found within mcc # 26 — dig ), sub - mcc osteo ( found within mcc # 22 — mus ), sub - mcc schz ( found within mcc # 31 — men ), sub - mcc alco ( found within mcc # 31 — men ), sub - mcc hbp ( found within mcc # 4 — cir ), sub - mcc art ( found within mcc # 4 — cir ), sub - mcc depr ( found within mcc # 31 — men ). when medical claims are submitted , the submitter is identified . these submitters can be classified into place of treatment ( pot ) categories and mapped accordingly thereto . in the preferred embodiment , eleven pot categories are used . these pot categories are hi — hospital inpatient , oi — other facility inpatient , hs — hospital outpatient surgery , he — hospital emergency , ho — hospital outpatient other , oo — other facility outpatient other , pi — physician service inpatient , po — physician service outpatient , pp — physician service office visit , px — physician service all other , and op — other providers . the following example will explain the system as could be used by a healthcare insurance company with its various health plans . in this type of system , there will be members of the various plans who will have provided member information and have been assigned a unique member identifier (“ member id ”). these members may be enrolled for medical care , for prescription services , or both . prior to some procedures being performed on a member , advance authorization may be required . some of the member data , authorization data , pharmacy data , and medical claim data is submitted electronically and some is submitted by other means , such as , for example , by the submission on paper of a claim seeking reimbursement . however , all of the relevant data , whether submitted electronically or not , is established in an electronic database . this database will generally contain more information than is needed for displaying the information used in the prediction system of the present invention . while other data relationships are possible to accomplish the same result , the system of the present invention extracts the desired data from the database and converts it so that it is included in four relational database tables , pharmacy claims , medical claims , authorizations , and membership , all related by member id . for example , in the preferred embodiment , it is desired to display medical and pharmacy claim information and place of treatment information over time for each individual . it is also desired in the preferred embodiment to display similar information by groups of members , for example , for all members of one ppo , or for all members in a geographic area . it is also desirable in the preferred embodiment to be able to compare similar information for different member groupings . therefore , in this example , the membership database table will include at least the unique member id , the ppo identifier , and the geographic area identifier or identifiers , for example , city , state , and zip code . if other comparison is desired , that additional needed information can be extracted from the electronic database and included in the appropriate relational database table . as it is preferred to display medical , pharmacy , and place of treatment information over time and based on cost , the information relevant to map medical claim and pharmacy claim costs to mcc and to map where treatment was received to pot is extracted and included in the appropriate relational database table . using the data in the relational database tables , a transformation algorithm converts the icd9 codes in the medical claims to mcc , sub - mcc , and sub - sub - mcc and associates time and cost information with each claim . a transformation algorithm converts the pharmacy claim information by drug class to mcc , sub - mcc , and sub - sub - mcc and associates time and cost information with each claim . where there is a corresponding medical claim , and multiple possible mccs for a drug class , the pharmacy claim is associated with the medical claim in the same mcc . where there is no corresponding medical claim and where there are multiple possible mccs for the drug class , the cost is equally divided among the possible drug classes . further , a transformation algorithm converts the medical claim claimant information to one of the eleven place of treatment categories and associates time , utilization , and amount information with each claim . for display of the information , cost amount over time is important . for a color display of cost amount , a “ hot to cold ” color scheme can be employed for each cost event . for example , the most costly procedures could be shown in the color red and the least costly procedures in the color blue , with other colors assigned to cost ranges in between . for a black and white display , “ shades of gray ” can be used with the darker shade ( black ) representing the most costly procedure . fig1 is a sample information display for one unique individual . item 1 identifies the member id , for example , in this case , 123678903 . any unique identifier can be used . item 2 is a mapping over a time period ( january 2001 - february 2003 ) of the medical claim costs by mcc , sub - mcc , and sub - sub - mcc using the primary icd9 diagnosis code associated with the medical claim . in the initial display of the preferred embodiment , the costs are displayed at the mcc level only , but the display user can expand the display to include the sub - mcc and sub - sub - mcc information by clicking on the mcc category the user wishes to expand . as shown , item 2 has had mcc category # 6 can ( malignant neoplasm ) expanded to show the thirteen secondary or sub - mccs , namely brst ( breast ), dig ( digestive & amp ; peritoneum ), res ( respiratory ), gu ( genitourinary organs ), lymp ( lymph & amp ; hema ), sec ( secondary ), h & amp ; n ( head & amp ; neck ), skn ( skin cancer ), leuk ( leukemia ), ner ( nervous system ), end ( endocrine ), h / o ( v codes ) and othr ( all other ). additionally , some of these secondary or sub - mccs are further divided into tertiary categories or sub - sub - mccs . dig has four tertiary mccs — ugi ( upper gastrointestinal ), lgi ( lower gi ), pbl ( pancreas / bile ducts / liver ) and othr ( other ). res has three tertiary mccs — uair ( upper airway ), lair ( lower airway ) and othr ( other ). gu has 4 tertiary mccs — fgen ( female genital ), mgen ( male genital ), lgu ( lower urinary ) and ugu ( upper urinary ). skn has two tertiary mccs — mel ( melanoma ) and othr ( other ). the main or primary mcc categories are shown down the left side of the display as three letters without a dash in front of them , for example , item 10 is can . the sub - mccs are displayed with a “ _ ” before the letters representing the sub - mcc , for example , item 11 is _dig . the sub - sub - mccs are displayed with a “ _ ” before the letters representing the sub - sub - mcc , for example , item 12 is _lgi . as shown in fig1 , item 2 , member 123678903 has medical claims related to the sixth primary mcc can ( malignant neoplasm ). more specifically , these claims are classified under the secondary or sub - mcc dig ( digestive & amp ; peritoneum ), and are also further categorized to the tertiary or sub - sub - mcc ugi ( upper gi ). as seen , some of the representations are darker shades of gray than others . item 13 identifies a darker black mark than the lighter gray item 14 . this identifies that the cost associated with medical claim item 13 was greater than the cost associated with medical claim item 14 . item 3 is a mapping over a time period ( january 2001 - february 2003 ) of the medical claim costs by mcc , sub - mcc , and sub - sub - mcc using the secondary icd9 diagnosis code associated with the medical claim . again , as with item 2 , in the initial display of the preferred embodiment , the costs are displayed at the mcc level only , but the display user can expand the display to include the sub - mcc and sub - sub - mcc information by clicking on the mcc category the user wishes to expand and selecting one of the context menus . as shown , item 3 has had mcc category # 22 mus ( musculoskeletal and connective tissues ) expanded to show nine secondary or sub - mcc categories . there are no sub - sub - mccs under mcc # 22 mus . as shown in item 3 , under the primary mcc mus , this member has claims more particularly associated with the secondary or sub - mccs back ( back / neck pain ) and soft ( soft tissue disorders ). item 4 is a mapping over a time period ( january 2001 - february 2003 ) of the pharmacy claim costs by mcc , sub - mcc , and sub - sub - mcc using the drug class associated with the pharmacy claim . again , as with items 2 and 3 , in the initial display of the preferred embodiment , the costs are displayed at the mcc level only , but the user can expand the display to include the sub - mcc and sub - sub - mcc information by clicking on the mcc category the user wishes to expand . as shown , item 4 has mcc category # 4 cir ( other circulatory ) expanded to show the three secondary or sub - mccs thereunder . under mcc # 4 , cir , this member has pharmacy claims that are especially related to hypertension ( secondary mcc hbp or high blood pressure ). item 5 is a mapping over a time period ( january 2001 - february 2003 ) of the place of treatment ( pot ) utilization profile and item 6 is a mapping over the same time period of the place of treatment paid cost profile , using the eleven pot categories previously explained . as shown , this member has a lot of procedures done in an outpatient setting . these individual displays have many uses . for example , an individual member may want to have a copy when going to a doctor . also , members may be enrolled in clinical programs or other services which assist the members in managing their healthcare . these programs and services would have available these individual displays for all enrollees , but could also retrieve displays for members meeting certain criteria . for example , displays could be identified for any enrollee who has had two hospital emergency room visits over a set period , or who was an inpatient at a hospital . instead of showing displays of fig1 by individual member , members can be grouped , for example by all members covered under a medical plan , and the information displayed for the total group as shown for the individual in fig1 . this type of group display would let the user see the medical , pharmacy , and place of treatment profiles for the entire group . an example of such a group display is shown in fig2 , where the data for a selected group detailed as item 20 is shown covering the period february 2001 - january 2004 . items 30 , 31 , and 32 show medical claim information for group 20 . the item 30 display is similar to the item 2 display in fig1 . this is a display over time of the primary icd9 information mapped to the mcc categories , but showing cumulative information for all members of group 20 . again , the darker the shade of gray , the more the cost . item 31 parallels item 30 and shows the total amount for group 20 per mcc over the total time period reflected in item 30 . item 32 reflects the total amount over all mccs for group 20 over the same time period . as with the related display group of items 30 , 31 , and 32 , items 33 , 34 , and 35 form a related display group . these items show pharmacy claim information for group 20 . the item 33 display is similar to the item 4 display in fig1 . this is a display over time of the pharmacy claim information mapped to the mcc categories , but showing cumulative information for all members of group 20 . item 34 parallels item 33 and shows the total amount for group 20 per mcc over the total time period reflected in item 33 . item 35 reflects the total amount over all mccs for group 20 over the same time period . items 36 , 37 , and 38 relate to types of services ( tos ) received by group 20 . the tos codes shown , hi , oi , hs , he , ho , oo , pi , po , pp , px , and op are the same as the pot codes previously explained . item 36 shows the number of encounters over time for group 20 by tos code . item 37 shows total encounters for group 20 per tos code for the time period of item 36 . item 38 shows the total encounters for group 20 for all of the tos codes combined over the same time period as in item 36 . items 39 , 40 , and 41 are similar to items 36 , 37 , and 38 , as they also show tos information over time for group 20 . however , instead of showing information based on encounters , they reflect cost paid information . additional group displays and comparisons are desired in advanced embodiments . for example , fig3 shows group - level rolled - up data for medical , pharmacy , and place - of - treatment ( pot ) or type - of - service ( tos ) data for two different selected groups 20 and 21 for comparison . as with fig2 , the data shown in fig3 covers the period february 2001 - january 2004 . items 50 , 51 , and 52 show medical claim information for group 20 and 21 . item 50 display is similar to the item 30 display in fig2 . this is a display over time of the primary icd9 information mapped to the mcc categories , but showing cumulative information for all members of groups 20 and 21 , the group 20 information being shown on the left and the group 21 information being shown on the right of display item 30 . the group 20 information shown in item 30 of fig2 has been compressed for the display of fig3 so that the data for group 20 can be shown adjacent to the data for group 21 for side by side comparison of the information displayed . again , the darker the shade of gray , the more the cost . item 51 parallels item 50 and shows the total amount per group 20 and group 21 per mcc over the total time period reflected in item 50 . item 52 reflects the total amount over all mccs for each of group 20 and group 21 over the same time period . as with the related display group of items 50 , 51 , and 52 , items 53 , 54 , and 55 form a related display group . these items show pharmacy claim information for groups 20 and 21 . items 56 , 57 , and 58 relate to types of services ( tos ) received by groups 20 and 21 . the tos codes shown , hi , oi , hs , he , ho , oo , pi , po , pp , px , and op are the same as the pot codes previously explained . item 56 shows the number of encounters over time for each of groups 20 and 21 by tos code . item 57 shows total encounters by group per tos code for the time period of item 56 . item 58 shows the total encounters by group for all of the tos codes combined over the same time period as in item 56 . items 59 , 60 , and 61 are similar to items 56 , 57 , and 58 , as they also show tos information over time for each of groups 20 and 21 . however , instead of showing information based on encounters , they reflect cost paid information . fig4 a is a flow chart of member map data generation . fig4 b is a flow chart showing how the data generated in fig4 a is used to create the various member and group displays . with reference to fig4 a , edw is the enterprise data warehouse where the medical , pharmacy , and member information is retained , for example , by an insurance company having members and processing medical and pharmacy claims . some of the boxes in fig4 a have numbers in parenthesis . those will be used in this added description . ( 1 ) from the enterprise data warehouse ( edw ), we fetch the most recent one - year rx and medical claims data for each active member at the end of each month . this process is repeated monthly . ( 2 ) the raw relational database records are converted into all - numeric binary files for fast retrieval by computational engines . the string variables , such as icd9 and other alphanumeric codes , are also converted into numeric codes with each numeric code representing unique alphanumeric code in the code look - up table . summary information ( database field name , numeric data format for each field , and the number of records ) along with string look - up tables ( lut ) is stored in a matlab format data file . for speed , create a numeric icd9 lut from the mcc codebook . it is noted that matlab ( matrix laboratory ) is a high - level object - oriented , scientific programming language produced by the mathworks in natick , mass . it has a number of built - in graphical visualization and scientific algorithms that facilitate rapid transition from concept formulation to prototyping . it also has real - time code generation capabilities that allow matlab programs to be converted into embeddable and standalone applications through the use of c / c ++ and java compilers working in concert with windows / unix components . the embedded applications can be generated in windows common object model ( com ) module or dynamic linked library ( dll ) that can be called from external programs written in visual basic ( vb ), c / c ++, or java . matlab format is simply the way matlab stores data in binary format , so matlab can efficiently fetch data . ( 3 ) retrieve just the required fields from the binary claims data for speed and memory . pgk = person gen key , a unique identification assigned to each member . ( 4 ) for each medical claim with up to nine icd9 &# 39 ; s , perform numeric search , not string match , to find the corresponding mcc , sub - mcc , and sub - sub - mcc . assign the associated cost to appropriate cells in the two - dimensional hierarchical mcc and time space . if there is more than one icd9 ( if there is only one icd9 , it is the primary icd9 by definition ), assign the first icd9 to the primary mcc - time map with 80 % of the total claim cost . assign icd9 2 through 9 ( secondary icd9 ) to the secondary mcc - time map with the remaining 20 % equally distributed to the secondary icd9 &# 39 ; s . for example , if a claim costing $ 10 , 000 has a primary icd9 of congestive heart failure ( chf ) and secondary icd9 &# 39 ; s of coronary artery disease ( cad ) and chronic obstructive pulmonary disease ( copd ), the cost breakdown for chf , cad , and copd will be $ 8 , 000 , $ 1 , 000 , and $ 1 , 000 , respectively . ( 5 ) each claim with the tos code is mapped onto an appropriate tos - time cell . in this case , two separate tos - time maps are created , representing utilization (# of hospital days or # of visits , such as emergency room , urgent - care center , and physician office visit ) and cost . ( 6 ) the tos and mcc maps are written to a set of binary and matlab files for both storage efficiency and fast retrieval of member - specific maps later . ( 7 ) each rx prescription is mapped to an appropriate mcc . if there is one - to - many mapping for drugs that can be prescribed to treat multiple mcc conditions , we refer to the medical mcc - time map for the member . we compare all the possible rx mcc &# 39 ; s with the appropriate medical mcc &# 39 ; s . if there is only one medical mcc present , then we assign the entire rx cost to that mcc . if there are multiple matches , then we assign the rx cost equally to the matched medical mcc &# 39 ; s . ( 9 ) the rx mcc - time map is written to a set of binary and matlab files . at the bottom right of fig4 a , there is a number 1 in a circle . this links to fig4 b , showing how the medical mcc and tos and pharmacy mcc data files are used to create the various member and group displays . the visual basic ( vb ) program gets the input of the member id from the user and passes it to the matlab com , the matlab com generates an output portable network graphics or png file . the vb program then displays the image stored in the output file . inserting item numbers from fig1 - 3 as examples only , the present invention is for a method for automated extraction and display of past health care use data to aid in predicting future health status , comprising the steps of : a . accessing a database containing insurance claim information ; b . mapping the insurance claim information by individual and claim to at least one of a set of major clinical conditions to create a plurality of mcc claim mappings ; c . associating each mcc claim mapping with an individual identifier , a time identifier , and a cost identifier ; and , d . creating at least one display ( 2 , 3 , 4 , 30 , 33 , 50 , 53 ) for at least one individual ( 1 , 20 , 21 ) showing , by each set of major clinical conditions ( 10 ) over a time period , a representation of the mcc claim mappings ( 13 , 14 ), each mcc claim mapping being weighted by its respective cost identifier . the step of mapping the insurance claim information can further include mapping by individual and claim to at least one of a set of place of treatment identifiers to create a plurality of pot claim mappings ; the step of associating each mcc claim mapping with an individual identifier , a time identifier , and a cost identifier , can further include associating each mcc claim mapping to each pot claim mapping ; and , the step of creating at least one display can further include creating an additional display ( 6 , 39 , 59 ) showing by each of the place of treatment identifiers over said time period a representation of the pot claim mappings , each pot claim mapping weighted by its respective cost identifier . the step of creating at least one display can further include creating an additional display ( 5 , 36 , 56 ) showing by each of said place of treatment identifiers over said time period a representation of the pot claim mappings , each pot claim mapping weighted by a utilization identifier . the step of mapping can include mapping primary diagnosis codes , secondary diagnosis codes , and / or pharmacy information contained in the insurance claim information to the set of major clinical conditions . the display created can be a color display where different colors are used to identify different cost identifiers or a shades of gray display where different shades of gray are used to identify different cost identifiers . the major clinical conditions may include hierarchical code levels , or sub or sub - sub levels , with mapping to the hierarchical code levels , where the step of creating at least one display includes providing the capability to expand the display to additionally show the mcc claim mappings by each of the set of major clinical conditions ( 10 ) and by any hierarchical code levels ( 11 , 12 ). the step of creating at least one display can create the display ( 2 , 3 , 4 of fig1 ) for an individual ( 1 ), the display ( 30 , 33 of fig2 ) for a single group ( 20 ), or the display ( 50 , 53 of fig3 ) for multiple groups ( 20 , 21 ). finally , the present invention is for a method for automated extraction of past health care use data to aid in predicting future health status , comprising the steps of : a . accessing a relational database containing available medical claim information , pharmacy claim information , and individual information ; b . performing data conversion of said available medical claim information , pharmacy claim information , and individual information in said relational database to create a set of binary data and a related set of summarization data for fast retrieval of data ; c . assigning icd codes per medical claim to primary and secondary hierarchical mcc codes ; e . assigning pharmacy claims to said primary and secondary hierarchical mcc codes ; and f . assigning medical claims to pot categories in terms of utilization and cost . the foregoing detailed description is given primarily for clearness of understanding and no unnecessary limitations are to be understood therefrom for modifications can be made by those skilled in the art upon reading this disclosure and may be made without departing from the spirit of the invention and scope of the appended claims . | 6 |
with reference to fig1 specimen 10 seats on specimen pedestal 12 within vacuum chamber 14 evacuated to ˜ 10 - 6 torr by pump 16 . small pedestal rim 18 of height less than the thickness of specimen 10 retains specimen 10 on the end of specimen pedestal 12 . heater 20 , wrapped about specimen pedestal 12 is used to raise the temperature of the specimen . light from laser 22 , positioned directly above specimen 10 , shines through window 24 on to specimen 10 . thinning may be automatically terminated on perforation of specimen 10 when light from laser 22 passes through specimen 10 , down pedestal bore 26 and strikes photodetector 28 . first ion gun 30 comprises cathode 32 connected to ground and anode 34 connected to adjustable high voltage supply 35 . argon is supplied to first ion gun 30 via first supply line 36 , the flow being regulated by first supply valve 38 . the high voltage discharge between anode and cathode generates and directs an energetic ion beam via cathode aperture 40 towards specimen 10 . charge recombination results in the beam impinging on the specimen being composed mainly of energetic neutrals . second ion gun 42 is constructed after a similar fashion to first ion gun 30 . the two ion guns are arranged symmetrically about the specimen and so positioned that the angle between the specimen surface and the ion beams is about 5 °. although argon is typically used to generate the ion beams almost any noble gas or other inert gas is suitable . for example , krypton , xenon , nitrogen and carbon dioxide would all be possible . ion beam induced damage in the specimen may be reduced by reducing the voltage applied to the ion guns , perhaps as low as 500 v . iodine crystals 44 are contained within capsule 46 mounted outside vacuum chamber 14 . capsule 46 , via second supply line 50 , connects to nozzle 48 . the high vapor pressure of iodine at room temperature and the lower pressure within vacuum chamber 14 result in a strong flow of iodine vapor second supply line 50 to nozzle 48 , directing a jet of iodine vapor on to specimen 10 . compared with the ion gun beam , the molecular gas jet is low energy . prior art suggests that the ratio of nozzle diameter to length is critical for obtaining a well collimated jet and must be equal to 1 : 10 . for the present invention as described , this is not found to be a very sensitive parameter . the optimum value was determined to be ˜ 1 : 5 but values from 1 : 4 to 1 : 6 were almost as effective . the flow rate of iodine vapor is adjustable by second supply valve 52 . iodine crystals 44 may be replaced by bromine or other suitable material having a significant vapor pressure at room temperature or volatile liquids , such as carbon tetrachloride , in a suitable carrier . a particular advantage of the present invention is its flexibility of operation . three distinct modes are possible : ( i ) ion beam milling alone with an inert gas : in this mode the invention functions as a conventional ion beam milling system . it may be used on a whole range of metallic , ceramic and semiconductor materials . however , the new specimen holder permits very low miling angles which considerably reduces ion beam damage of the specimen . ( ii ) beam milling with an inert gas in combination with molecular gas jetting : this mode is suited to the preparation of iii - v and ii - vi compound semiconductors and their alloys . it especially effective on inp , cdte and alloys containing indium , cadmium or mercury for which conventional ion beam milling results in the creation of crystal imperfections and metallic islands on the surface . formation of these islands is prevented by exposure of the specimen to an iodine or bromine molecular gas jet . the reaction rate between the iodine or bromine and the metallic island is maximized by the specimen holder heater . the combined mode may also be used to effect with a range of specimen materials and a variety of gas sources . for example , the thinning rate of tungsten is considerably increased by combined ion beam / molecular gas jet milling . ( iii ) molecular gas jetting along : even with the extremely low milling angles possible with the new specimen holder , some ion beam damage is introduced into the specimen . this is apparent as a thin amorphous layer , which obscures the underlying crystalline specimen , preventing good atomic resolution tem . molecular gas jetting alone removes this final artefact . fig2 illustrates an alternative embodiment of the invention . this shows a conventional arrangement of ion guns and specimen holder , permitting milling from both sides of the specimen with the addition of a bifurcated molecular gas jet with nozzles directed at each side of the specimen . this embodiment has many of the disadvantages of prior art systems . in particular , the method of mounting the specimen limits the milling angle to a minimum of ˜ 10 ° and promotes contamination of the specimen from material sputtered from the specimen holder . further , the holder design makes it difficult to position the molecular gas jet nozzles sufficiently close to the specimen to enjoy the maximum benefit of the reactive process . however , this configuration is suitable for modifying existing ion beam milling systems so that they can also enjoy some of the benefits of the present invention . accordingly , the reader will see that not only can the invention prepare high quality tem specimens from compound semiconductors by a molecular gas jet in combination with ion beam milling but that other modes are possible . for example , the invention can be operated as a conventional ion beam milling system alone or it may be operated in a molecular gas jetting mode alone . further additional advantages include : ( i ) a reduction in the quantities of corrosive and toxic material used , thereby extending the lifetime of system components , a reduction which is particularly great if most of the milling is undertaken by the conventional ion beam milling mode alone and the molecular gas jet used for only final removal of surface artefacts ; ( iii ) a reduction in ion beam damage by permitting grazing incidence ion beam milling ; ( iv ) increased efficiency in the removal of the volatile compounds created from reaction with the iodine or bromine jet by heating the specimen . while the above description contains many specificities , these should not be construed as limitations on the scope of the invention but merely as exemplifications of the preferred embodiments thereof . those skilled in the art will envisage other possible variations within its scope . for example , the invention need not be limited to a single molecular gas jet and significant advantages could be obtained with several jets , each using a different gas . similarly , the reduced milling rate arising from the very low milling angle can be compensated for with more than two ion guns . it will also be obvious to those skilled in the art to add a heater to capsule 46 to increase the flow of vapor into vacuum chamber 14 . this improvement would also increase the variety of chemicals which may sublimated or evaporated to produce a vapor for injection into vacuum chamber 14 . thus the scope of the invention should be determined by the appended claims and their legal equivalents , rather than by the examples given . | 6 |
the present invention is of a method of selective color control of digital video images . for purpose of illustration , the following description of the preferred embodiments of the present invention focuses on the crcb format of the chromatic part of a digital video image . the method of the present invention is applicable to other formats , such as uv or iq , of a digital video image . the steps and implementation of the method of selective color control of digital video images , according to the present invention are better understood with reference to the drawing and the accompanying description . it is to be noted that the drawing and accompanying description of the present invention shown here are for illustrative purposes only and are not meant to be limiting . fig1 is a flow diagram of a preferred embodiment of the method of selective color control of digital video images , according to the present invention . in fig1 each generally applicable , principle step of the method of selective color control of digital video images is numbered and enclosed inside a frame . notation and symbols appearing in the following description are consistent with those used in fig1 . included in the description of fig1 are definitions of relevant terms , mathematical expressions , and one or more substeps representing further of an indicated principle step of the method of selective color control of digital video images shown in fig1 . substeps are indicated by a letter in parentheses , and the multiplication operation is indicated by an asterisk (*). referring now to fig1 a preferred embodiment of the method of selective color control of digital video images , according to the present invention , is as follows . in step 1 , a digital video input image , having chromatic components , featuring pixels , is received by a data processor . in step 2 , the input image and its target output image are characterized . in step ( a ), cr and cb are defined as two chromatic components of a digital video input image at time t , cr or cb can be plotted in an input image grid ( not shown ) having an input image grid coordinate system featuring rows ( lines ) and columns ( pixels ). each input image grid location is identified by coordinates of row number i and column number j , such that pixel position coordinates of cr or cb , represented as ( i , j ) in the input image grid are row i and column j . in step ( b ), values of chromatic components cr and cb are assigned into the input image grid . each chromatic component of the digital video input image , cr and cb , is scanned , row by row , pixel by pixel . each input image pixel value is assigned an address to be operated on by values in the individual color luts . cr ( i , j ) and cb ( i , j ) are defined as digitized pixel values of the input image chromatic components cr and cb , respectively , whose position coordinates are ( i , j ). for an input image chromatic component , cr or cb , of size m rows by n columns , pixel position coordinates ( i , j ) are limited to the input image size as follows : i : 0 . 1 , 2 , . . . m - 1 : and j : 0 , 1 , 2 , . . . n - 1 . in step ( c ) of step 2 , cr &# 39 ; and cb &# 39 ; are defined as the two chromatic components of the digital video output image at time t , calculated from the input image chromatic components , cr and cb , respectively . cr &# 39 ; or cb &# 39 ; can be plotted in an output image grid ( not shown ) having an output image grid coordinate system featuring rows ( lines ) and columns ( pixels ). each output image grid location is identified by coordinates of row number k and column number l , such that pixel position coordinates of cr &# 39 ; or cb &# 39 ;, represented as ( k , l ), in the output image grid are line k and column l . cr &# 39 ;( k , l ) and cb &# 39 ;( k , l ) are defined as digitized pixel values of the output image chromatic components cr &# 39 ; and cb &# 39 ;, respectively , whose position coordinates are ( k , l ). in preferred embodiment of the method of the present invention , for an input image chromatic component , cr or cb , of size m rows by n columns , pixel position coordinates ( k , l ) are limited to the input image size as follows : k : 0 , 1 , 2 , . . . m - 1 ; and l : 0 , 1 , 2 , . . . n - 1 , whereby the same memory array is used for the input image and output image chromatic components . in this case , output image pixel position coordinates , k and l , are equivalent to the corresponding input image pixel position coordinates , i . e ., k = i , and l = j . thus , the output image chromatic pixel values cr &# 39 ;( k , l ) and cb &# 39 ;( k , l ), are equivalently written as cr &# 39 ;( i , j ) and cb &# 39 ;( i , j ), respectively . in step 3 , there is definition of sets of color look - up - tables ( luts ), whose values are to be used for digitized selective control of individual colors , where each color is composed of a linear combination of the input image chromatic components cr and cb . the luts are defined such that each of the output image chromatic components , cr &# 39 ; and cb &# 39 ;, is related to the both input image chromatic components , cr and cb , and correspondingly , each of the output image chromatic pixel values , cr &# 39 ;( i , j ) and cb &# 39 ;( i , j ) is related to both input image chromatic pixel values , cr ( i , j ) and cb ( i , j ). in the general case of the preferred embodiment of the present invention , a set of four luts are defined for selective control of each individual color as follows : lut cr &# 39 ; -- color -- cr ( m ), relating output image chromatic component , cr &# 39 ;, to input image chromatic component , cr , lut cr &# 39 ; -- color -- cb ( m ), relating output image chromatic component , cr &# 39 ;, to input image chromatic component , cb , lut cb &# 39 ; -- color -- cb ( m ), relating output image chromatic component , cb &# 39 ;, to input image chromatic component , cb , and lut cb &# 39 ; -- color -- cr ( m ), relating output image chromatic component , cb &# 39 ;, to input image chromatic component , cr . ` m ` represents two things , simultaneously : ( 1 ) the value of an input image chromatic pixel , cr ( i , j ) or cb ( i , j ), and , ( 2 ) the index of the particular individual color lut used for changing the saturation of a selected individual color of that chromatic component . the dynamic range of m is determined between the chromatic black level and the chromatic white level of the digitized video input image , and is a function of the number of bits ( for example , 6 , 8 , or 10 bits ) per pixel of a given color component of the chromatic part of a video input image . as an example , in the preferred embodiment of the method of the present invention , it is assumed that the chromatic dynamic range is 8 - bits , which results in the range of - 128 to + 127 . adding an offset control , defined as oc , where in this example , oc =+ 128 , to m , results in a chromatic dynamic range of 0 to 255 . in this case , the chromatic black level is 0 , and the chromatic white level is 255 . according to a linear combination of the particular chromatic components of the video input image , any number of different colors can be included in the method of the present invention . for illustration , six different colors , red , green , blue , yellow , magenta , and cyan , are defined and featured hereinafter . the colors red and green are controlled via the chromatic component cr . the colors blue and yellow are controlled via the chromatic component cb . each of the colors magenta and cyan is controlled via a linear combination of both chromatic components cr and cb . in step ( a ), the following set of luts are defined for selective control of red color through input image chromatic components cr and cb : in step ( b ), the following set of luts are defined for selective control of green color through input image chromatic components cr and cb : in step ( c ), the following set of luts are defined for selective control of blue color through input image chromatic components cr and cb : in step ( d ), the following set of luts are defined for selective control of yellow color through input image chromatic components cr and cb : in step ( e ), the following set of luts are defined for selective control of magenta color through input image chromatic components cr and cb : in step ( f ), the following set of luts are defined for selective control of cyan color through input image chromatic components cr and cb : in step 4 , there is definition of color control functions , to be used for calculating values in each set of individual color luts . sets of individual color control functions are subsequently used for digitized selective control of individual colors , by operating on linear combinations of values of the input image chromatic components , cr ( i , j ) and cb ( i , j ). in the general case of the preferred embodiment of the present invention , a set of four color control functions are defined for selective control of each individual color as follows : lut cr &# 39 ; -- color -- cr ( m )= tangent cr &# 39 ; -- color -- cr *[ lut cr &# 39 ; -- color -- cr ( m )- m cr &# 39 ; -- color -- cr ]+ m cr &# 39 ; -- color -- cr , relating output image chromatic component , cr &# 39 ;, to input image chromatic component , cr , lut cr &# 39 ; -- color -- cb ( m )= tangent cr &# 39 ; -- color -- cb *[ lut cr &# 39 ; -- color -- cb ( m )- m cr &# 39 ; -- color -- cb ]+ m cr &# 39 ; -- color -- cb , relating output image chromatic component , cr &# 39 ;, to input image chromatic component , cb , lut cb &# 39 ; -- color -- cb ( m )= tangent cb &# 39 ; -- color -- cb *[ lut cb &# 39 ; -- color -- cb ( m )- m cb &# 39 ; -- color -- cb ]+ m cb &# 39 ; -- color -- cb , relating output image chromatic component , cb &# 39 ;, to input image chromatic component , cb , and lut cb &# 39 ; -- color -- cr ( m )= tangent cb &# 39 ; -- color -- cr *[ lut cb &# 39 ; -- color -- cr ( m )- m cr &# 39 ; -- color -- cr ]+ m cb &# 39 ; -- color -- cr , relating output image chromatic component , cb &# 39 ;, to input image chromatic component , cr . in these sets of color control functions , color control parameters tangent cr &# 39 ; -- color -- cr , tangent cr &# 39 ; -- color -- cb , tangent cb &# 39 ; -- color -- cb , tangent cb &# 39 ; -- color -- cr , and m cr &# 39 ; -- color -- cr , m cr &# 39 ; -- color -- cb , m cb &# 39 ; -- color -- cb , and m cb &# 39 ; -- color -- cr , are defined in step 5 , and the symbol * represents the multiplication operation . consistent with step 3 , for illustration , six sets of color control functions of six different colors , red , green , blue , yellow , magenta , and cyan , are defined and featured hereinafter . in step ( a ), the set of color control functions for selective control of red color through input image chromatic components cr and cb are : lut cr &# 39 ; -- red -- cb ( m )= tangent cr -- red -- cb *[ lut cr &# 39 ; -- red -- cb ( m )- m cr &# 39 ; 13 red -- cb ]+ m cr &# 39 ; -- red -- cb , lut cb &# 39 ; -- red -- cb ( m )= tangent cb &# 39 ; -- red -- cb *[ lut cb &# 39 ; -- red -- cb ( m )- m cb &# 39 ; -- red -- cb ]+ m cb &# 39 ; -- red -- cb , and in step ( b ), the set of color control functions for selective control of green color through input image chromatic components cr and cb are : lut cb &# 39 ; -- green -- cb ( m )= tangent cb &# 39 ; -- green -- cb *[ lut cb &# 39 ; -- green -- cb ( m )- m cb &# 39 ; -- green -- cb ]+ m cb &# 39 ; -- green -- cb , and in step ( c ), the set of color control functions for selective control of blue color through input image chromatic components cr and cb are : lut cb &# 39 ; -- blue -- cb ( m )= tangent cb &# 39 ; -- blue -- cb *[ lut cb &# 39 ; -- blue -- cb ( m )- m cb &# 39 ; -- blue -- cb ]+ m cb &# 39 ; -- blue -- cb , and in step ( d ), the set of color control functions for selective control of yellow color through input image chromatic components cr and cb are : lut cb &# 39 ; -- yellow -- cb ( m )= tangent cb &# 39 ; -- yellow -- cb *[ lut cb &# 39 ; -- yellow -- cb ( m )- m cb &# 39 ; -- yellow -- cb ]+ m cb &# 39 ; -- yellow -- cb , and in step ( e ), the set of color control functions for selective control of magenta color through input image chromatic components cr and cb are : lut cb &# 39 ; -- magenta -- cb ( m )= tangent cb &# 39 ; -- magenta -- cb *[ lut cb &# 39 ; -- magenta -- cb ( m )- m cb &# 39 ; -- magenta -- cb ]+ m cb &# 39 ; -- magenta -- cb , and in step ( f ), the set of color control functions for selective control of cyan color through input image chromatic components cr and cb are : lut cr &# 39 ; -- cyan -- cr ( m )= tangent cr &# 39 ; -- cyan -- cr *[ lut cr &# 39 ; -- cyan -- cr ( m )- m cr &# 39 ; -- cyan -- cr ]+ m cr &# 39 ; -- cyan cr , lut cb &# 39 ; -- cyan -- cb ( m )= tangent cb &# 39 ; -- cyan -- cb *[ lut cb &# 39 ; -- cyan -- cb ( m )- m cb &# 39 ; -- cyan -- cb ]+ m cb &# 39 ; cyan -- cb , and lut cb &# 39 ; -- cyan -- cr ( m )= tangent cb &# 39 ; -- cyan -- cr *[ lut cb &# 39 ; -- cyan -- cr ( m )- m cb &# 39 ; -- cyan -- cr ]+ m cb &# 39 ; cyan -- cr . in step 5 , tangent and integer break point color control parameters , are defined and characterized . in step ( a ), tangent color control parameters , tangent cr &# 39 ; -- color -- cr , tangent cr &# 39 ; -- color -- cb , tangent cb &# 39 ; -- color -- cb , tangent cb &# 39 ; -- color -- cr , are defined as real positive parameters , greater than or equal to zero . tangent color control parameters are used as free parameters in the color control function , for selectively controlling the saturation , or intensity , of selected individual color , color , of the video input image , without affecting the remaining colors of the video input image . in each set of color control functions ( defined in step 4 ), there is a corresponding set of four tangent color control parameters , whereby , in each set , two tangent color control parameters , tangent cr &# 39 ; -- color -- cr , and tangent cr &# 39 ; -- color -- cb , appear in the color control functions for relating the output image chromatic component , cr &# 39 ;, to input image chromatic components , cr and cb , and two tangent color control parameters , tangent cb &# 39 ; -- color -- cb , and tangent cb &# 39 ; -- color -- cr , appear in the color control functions for relating the output image chromatic component , cb &# 39 ;, to input image chromatic components , cr and cb . in the preferred embodiment of the method of the present invention , featuring selective control of six individual colors , there are twenty - four independent tangent color control parameters , i . e ., for red color control , tangent cr &# 39 ; -- red -- cr , tangent cr &# 39 ; -- red -- cb , tangent cb &# 39 ; -- red -- cb , and tangent cb &# 39 ; -- red -- cr ; for green color control , tangent cr &# 39 ; -- green -- cr , tangent cr &# 39 ; -- green -- cb , tangent cb &# 39 ; -- green -- cb , and tangent cb &# 39 ; -- green -- cr ; for blue color control , tangent cr &# 39 ; -- blue -- cr , tangent cr &# 39 ; -- blue -- cb , tangent cb &# 39 ; -- blue -- cb , and tangent cb &# 39 ; -- blue -- cr ; for yellow color control , tangent cr &# 39 ; -- yellow -- cr , tangent cr &# 39 ; -- yellow -- cb , tangent cb &# 39 ; -- yellow -- cb , and tangent cb &# 39 ; -- yellow -- cr ; for magenta color control , tangent cr &# 39 ; -- magenta -- cr , tangent cr &# 39 ; -- magenta -- cb , tangent cb &# 39 ; -- magenta -- cb , and tangent cb &# 39 ; -- magenta -- cr ; and , for cyan color control , tangent cr &# 39 ; -- cyan -- cr , tangent cr &# 39 ; -- cyan -- cb , tangent cb &# 39 ; -- cyan -- cb , and tangent cb &# 39 ; -- cyan -- cr ; corresponding to the six individual colors , red , green , blue , yellow , magenta , and cyan , respectively . in step ( b ), integer break point color control parameters , m cr &# 39 ; -- color -- cr , m cr &# 39 ; -- color -- cb , m cb &# 39 ; -- color -- cb , and m cb &# 39 ; -- color -- cr , are defined . each integer break point color control parameter represents the point , or value , at which the chromatic function ( or chromatic curve , as may be appropriately drawn in a color coordinate system ) of a selected individual color , color , exhibits a change in its slope . values of integer break point parameters are chosen according to the format of the chromatic part of the video input image , e . g ., crcb , uv , or iq . in the preferred embodiment of the method of the present invention , featuring chromatic components cr and cb , integer break point values are in the range of 0 to 255 . in each set of color control functions ( defined in step 4 ), there is a corresponding set of four integer break point color control parameters , whereby , in each set , two integer break point color control parameters , m cr &# 39 ; -- color -- cr , and m cr &# 39 ; -- color -- cb , appear in the color control functions for relating the output image chromatic component , cr &# 39 ;, to input image chromatic components , cr and cb , and two integer break point color control parameters , m cb &# 39 ; -- color -- cb , and m cb &# 39 ; -- color -- cr , appear in the color control functions for relating the output image chromatic component , cb &# 39 ;, to input image chromatic components , cr and cb . in the preferred embodiment of the method of the present invention , featuring selective control of six individual colors , there are twenty - four independent integer break point color control parameters , i . e ., for red color control , m cr &# 39 ; -- red -- cr , m cr &# 39 ; -- red -- cb , m cb &# 39 ; -- red -- cb , and m cb &# 39 ; -- red -- cr ; for green color control , m cr &# 39 ; -- green -- cr , m cr &# 39 ; -- green -- cb , m cb &# 39 ; -- green -- cb , and m cb &# 39 ; -- green -- cr ; for blue color control , m cr &# 39 ; -- blue -- cr , m cr &# 39 ; -- blue -- cb , m cb &# 39 ; -- blue -- cb , and m cb &# 39 ; -- blue -- cr : for yellow color control , m cr &# 39 ; -- yellow -- cr , m cr &# 39 ; -- yellow -- cb , m cb &# 39 ; -- yellow -- cb , and m cb &# 39 ; -- yellow -- cr ; for magenta color control , m cr &# 39 ; -- magenta -- cr , m cr &# 39 ; -- magenta -- cb , m cb &# 39 ; -- magenta -- cb , and m cb &# 39 ; -- magenta -- cr ; and , for cyan color control , m cr &# 39 ; -- cyan -- cr , m cr &# 39 ; -- cyan -- cb , m cb &# 39 ; -- cyan -- cb , and m cb &# 39 ; -- cyan -- cr ; corresponding to the six individual colors , red , green , blue , yellow , magenta , and cyan , respectively . in the method of the present invention , the novel utility of using the tangent and integer break point color control parameters , is that using the individual sets of color control functions , represents changing ( controlling ) the slope ( tangent ) of a particular chromatic function ( curve ) in several different alternative ways , including : from an initial value to an integer break point , or , between two integer break points , or , from an integer break point to an upper limit value , within a particular chromatic dynamic range of a specified chromatic part of a digital video input image , without affecting the slopes ( tangents ) of the remaining color components of each chromatic part of the same digital video input image . since saturation or intensity of an individual color component is directly related to the tangent of the chromatic curve of that color component , using sets of individual color control functions for operating on the chromatic parts , cr and cb , of the digital video input image , represents changing or controlling the saturation or intensity of a selected individual color component , without affecting the saturations or intensities of the remaining color components of the specified chromatic part of the digital video input image . values of the integer break point color control parameters , for each individual color , colors are assigned once and used repeatedly by the data processor in all requests for selective change of a color , color , of a given digital video input image . in contrast , values of the tangent color control parameters , for each individual color , color , are assigned anew and used by the data processor in each separate request for selective color change of a color , color , of a given digital video input image . in terms of practical implementation of the preferred embodiment of the method of the present invention , values of the integer break point parameters , and the tangent parameters , for each individual color , are factory set at the time of finalizing or adjusting the initial settings of the data processor ( e . g ., tv or video system controller ). during viewer use of the tv or video system controller , values of integer break point parameters remain constant and are not changed by viewer request of selective color changes . in contrast , values of tangent parameters are changed , within the range of initial factory settings of tangent parameters , each time there is a viewer request of selective color change . for example , change in values of tangent parameters may be in the form of a viewer pushing a button , designated to affect an individual color change , as part of the tv or video system controller . further of this example , a designated pushbutton on a tv or video system controller could have two push options , one for increasing the saturation of a selected individual color , and one for decreasing the saturation of a selected individual color , with such options possibly indicated by a `+` or `-` on the controller device , for increasing or decreasing , respectively , the saturation of the selected individual color . in step 6 , there is insertion of initial values into each set of individual color luts , also identified as pushbutton reset . the function of pushbutton reset is , that when the data processor ( e . g ., tv or video system controller ) is initially turned on , each set of the individual color luts is assigned initial values ( i . e ., resetting of the controller pushbuttons used for selective color control of the video image ), which may also include the set of values last appearing in the individual color luts at the time the data processor ( controller ) was last turned off . in the general case , for a known chromatic dynamic range of m between m 1 and m 2 , initial values are inserted into each set of color luts , corresponding to each individual color , color , as follows : for m = m 1 to m 2 , where m is described in step 3 , assign : in the preferred embodiment of the method of the present invention , featuring six individual color components of the chromatic part of the video input image , each having a chromatic dynamic range of m 1 = 0 to m 2 = 255 , initial values are inserted into each set of the individual color luts as follows : for m = 0 to 255 , assign : the effect of the pushbutton reset step is to provide an initially linear relation between each set of individual color luts and the parameter m , where , by referring to the generalized set of color control functions , lut cr &# 39 ; -- color -- cr ( m )= tangent cr &# 39 ; -- color -- cr *[ lut cr &# 39 ; -- color -- cr ( m )- m cr &# 39 ; -- color -- cr ]+ m cr &# 39 ; -- color -- cr , lut cr &# 39 ; -- color -- cb ( m )= tangent cr &# 39 ; -- color -- cb *[ lut cr &# 39 ; -- color -- cb ( m )- m cr &# 39 ; -- color -- cb ]+ m cr &# 39 ; -- color -- cb , lut cb &# 39 ; -- color -- cb ( m )= tangent cb &# 39 ; -- color -- cb *[ lut cb &# 39 ; -- color -- cb ( m )- m cb &# 39 ; -- color -- cb ]+ m cb &# 39 ; -- color -- cb , and lut cb &# 39 ; -- color -- cr ( m )= tangent cb &# 39 ; -- color -- cr *[ lut cb &# 39 ; -- color -- cr ( m )- m cb &# 39 ; -- color -- cr ]+ m cb &# 39 ; -- color -- cr , the slope of each equation is a corresponding tangent color control parameter , equal to one , and the y - intercept of each equation is a corresponding integer break point color control parameter , equal to zero . thus , initial values inserted into each set of individual color luts are equivalent to the values of m , which according to the definition of mn , represents the chromatic pixel values , cr ( i , j ) or cb ( i , j ), of the video input image , that are located at the address ( i , j ) in the video input image grid . simultaneously , according to the definition of m , which also represents the location index of a value in a particular color lut , these initial lut values have location indices , m , in the individual color luts . in step 7 , there is calculation and assignment of new values into the sets of individual color luts , also identified as pushbutton color control . the function of pushbutton color control is , that when the data processor ( e . g ., tv or video system controller ) is in the ` on ` mode , following completion of the pushbutton reset step , request by a viewer for a selected individual color change ( e . g ., by depression of a pushbutton designated to the selected individual color , as part of operation of a tv or video system controller ) causes a new set of values to be inserted into each corresponding set of luts of the selected color . step 7 is in preparation for the next step ( step 8 ), involving calculations of the particular color control function operating on a linear combination of the chromatic components , cr and cb , of the video input image . step 7 is also performed in the event that a viewer desires to change either the same , or a different , color of the digital video image , following completion of a previous color change in the digital video image . this next request by a viewer for a selected individual color change ( e . g ., by depression of a pushbutton designated to the selected individual color , as part of operation of a tv or video system controller ) causes a response by the data processor to initialize values in the set of color luts of this next selected color , via action of the pushbutton reset step ( step 6 ), whereby previous modifications to the set of color luts of the newly selected color are erased . following completion of this pushbutton reset step , the data processor performs the pushbutton color control step , in order to effect the change in the newly selected individual color of the digital video image , by calculating and inserting new values into the set of color luts of the newly selected individual color of the digital video image . in step 7 , in the general case , for a selected individual color change , for values of m from m initial to m final , where m initial and m final are known values within the general chromatic dynamic range of m 1 to m 2 , including values of 0 to 255 as in this embodiment , or values of known integer break points , and where values of m initial and m final can vary for the calculation of values in each color lut , new values are inserted into each color lut within each particular set of color luts as follows : for m = m initial to m final , assign : lut cr &# 39 ; -- color -- cr ( m )= tangent cr &# 39 ; -- color -- cr *[ lut cr &# 39 ; -- color -- cr ( m )- m cr &# 39 ; -- color -- cr ]+ m cr &# 39 ; -- color -- cr , relating output image chromatic component , cr &# 39 ;, to input image chromatic component , cr , for m = m initial to m final , assign : lut cr &# 39 ; -- color -- cb ( m )= tangent cr &# 39 ; -- color -- cb *[ lut cr &# 39 ; -- color -- cb ( m )- m cr &# 39 ; -- color -- cb ]+ m cr &# 39 ; -- color -- cb , relating output image chromatic component , cr &# 39 ;, to input image chromatic component , cb , for m = m initial to m final , assign : lut cb &# 39 ; -- color -- cb ( m )= tangent cb &# 39 ; -- color -- cb *[ lut cb &# 39 ; -- color -- cb ( m )- m cb &# 39 ; -- color -- cb ]+ m cb &# 39 ; -- color -- cb , relating output image chromatic component , cb &# 39 ;, to input image chromatic component , cb , and for m = m initial to m final , assign : lut cb &# 39 ; -- color -- cr ( m )= tangent cb &# 39 ; -- color -- cr *[ lut cb &# 39 ; -- color -- cr ( m )- m cb &# 39 ; -- color -- cr ]+ m cb &# 39 ; -- color -- cr , relating output image chromatic component , cb &# 39 ;, to input image chromatic component , cr . tangent and integer break point color control parameters are defined and characterized in step 5 , and the initial value of each corresponding color control function appearing in the bracketed term is assigned according to pushbotton reset ( step 6 ). in the general case of inserting new values into the sets of individual color luts , values obtained from calculations of the sets of individual color control functions , are considered either valid or invalid , according to comparison of these values to specified values of the chromatic dynamic range of m 1 to m 2 . valid values are inside the chromatic dynamic range of m 1 to m 2 , and invalid values are outside the chromatic dynamic range of m 1 to m 2 . invalid values are replaced with valid cutoff values . for determining a value to be either valid or invalid , and replacing an invalid value , the following lut cutoff conditions and cutoff values are used : if value of a color control function & lt ; 0 , ( invalid value ), then value of that color control function = m 1 , ( valid value ), or , if value of a color control function & gt ; m 2 , ( invalid value ), then value of that color control function = m 2 ( valid value ). cutoff values are determined from the chromatic dynamic range ( step 3 ), where the dynamic range of m is determined between the chromatic black level and the chromatic white level of the digitized video input image , and is a function of the number of bits ( for example , 6 , 8 , or 10 bits ) per pixel of a given color component of the chromatic part of a video input image . in the preferred embodiment of the method of the present invention , featuring six individual color components , red , green , blue , yellow , magenta , and cyan , as linear combinations of the chromatic parts cr and cb , of the video input image , each having a chromatic dynamic range of m 1 = 0 to m 2 = 255 , corresponding to 8 - bits , new values are inserted into the sets of individual color luts as follows : lut cb &# 39 ; -- red -- cb ( m )= tangent cb &# 39 ; -- red -- cb *[ lut cb &# 39 ; -- red -- cb ( m )- m cb &# 39 ; -- red -- cb ]+ m cb &# 39 ; -- red -- cb , and lut cb &# 39 ; -- red -- cr ( m )= tangent cb &# 39 ; -- red -- cr *[ lut cb &# 39 ; -- red -- cr ( m )- m cb &# 39 ; -- red -- cr ]+ m cb &# 39 ; -- red -- cr , where , for calculation of new values in each lut of the set of four red color luts , red color cutoff values are assigned as follows : if value of red color control function & lt ; 0 , ( invalid value ), then new value of red color control function = 0 , ( valid value ), or , if value of red color control function & gt ; 255 , ( invalid value ), then new value of red color control function = 255 , ( valid value ). lut cb &# 39 ; -- green -- cb ( m )= tangent cb &# 39 ; -- green -- cb *[ lut cb &# 39 ; -- green -- cb ( m )- m cb &# 39 ; -- green -- cb ]+ m cb &# 39 ; -- green -- cb , and lut cb &# 39 ; -- green -- cr ( m )= tangent cb &# 39 ; -- green -- cr *[ lut cb &# 39 ; -- green -- cr ( m )- m cb &# 39 ; -- green -- cr ]+ m cb &# 39 ; -- green -- cr , where , for calculation of new values in each lut of the set of four green color luts , green color cutoff values are assigned as follows : if value of green color control function & lt ; 0 , ( invalid value ), then new value of green color control function = 0 , ( valid value ), or , if value of green color control function & gt ; 255 , ( invalid value ), then new value of green color control function = 255 , ( valid value ). lut cb &# 39 ; -- blue -- cb ( m )= tangent cb &# 39 ; -- blue -- cb *[ lut cb &# 39 ; -- blue -- cb ( m )- m cb &# 39 ; -- blue -- cb ]+ m cb &# 39 ; -- blue -- cb , and lut cb &# 39 ; -- blue -- cr ( m )= tangent cb &# 39 ; -- blue -- cr *[ lut cb &# 39 ; -- blue -- cr ( m )- m cb &# 39 ; -- blue -- cr ]+ m cb &# 39 ; -- blue -- cr , where , for calculation of new values in each lut of the set of four blue color luts , blue color cutoff values are assigned as follows : if value of blue color control function & lt ; 0 , ( invalid value ), then new value of blue color control function = 0 , ( valid value ), or , if value of blue color control function & gt ; 255 , ( invalid value ), then new value of blue color control function = 255 , ( valid value ). lut cb &# 39 ; -- yellow -- cb ( m )= tangent cb &# 39 ; -- yellow -- cb *[ lut cb &# 39 ; -- yellow -- cb ( m )- m cb &# 39 ; -- yellow -- cb ]+ m cb &# 39 ; -- yellow -- cb , and lut cb &# 39 ; -- yellow -- cr ( m )= tangent cb &# 39 ; -- yellow -- cr *[ lut cb &# 39 ; -- yellow -- cr ( m )- m cb &# 39 ; -- yellow -- cr ]+ m cb &# 39 ; -- yellow -- cr , where , for calculation of new values in each lut of the set of four yellow color luts , yellow color cutoff values are assigned as follows : if value of yellow color control function & lt ; 0 , ( invalid value ), then new value of yellow color control function = 0 , ( valid value ), or , if value of yellow color control function & gt ; 255 , ( invalid value ), then new value of yellow color control function = 255 , ( valid value ). lut cb &# 39 ; -- magenta -- cb ( m )= tangent cb &# 39 ; -- magenta -- cb *[ lut cb &# 39 ; -- magenta -- cb ( m )- m cb &# 39 ; -- magenta -- cb ]+ m cb &# 39 ; -- magenta -- cb , and lut cb &# 39 ; -- magenta -- cr ( m )= tangent cb &# 39 ; -- magenta -- cr *[ lut cb &# 39 ; -- magenta -- cr ( m )- m cb &# 39 ; -- magenta -- cr ]+ m cb &# 39 ; -- magenta -- cr , where , for calculation of new values in each lut of the set of four magenta color luts , magenta color cutoff values are assigned as follows : if value of magenta color control function & lt ; 0 , ( invalid value ), then new value of magenta color control function = 0 , ( valid value ), or , if value of magenta color control function & gt ; 255 , ( invalid value ), then new value of magenta color control function = 255 , ( valid value ). lut cb &# 39 ; -- cyan -- cb ( m )= tangent cb &# 39 ; -- cyan -- cb *[ lut cb &# 39 ; -- cyan -- cb ( m )- m cb &# 39 ; -- cyan -- cb ]+ m cb &# 39 ; -- cyan -- cb , and lut cb &# 39 ; -- cyan -- cr ( m )= tangent cb &# 39 ; -- cyan -- cr *[ lut cb &# 39 ; -- cyan -- cr ( m )- m cb &# 39 ; -- cyan -- cr ]+ m cb &# 39 ; -- cyan -- cr , where , for calculation of new values in each lut of the set of four cyan color luts , cyan color cutoff values are assigned as follows : if value of cyan color control function & lt ; 0 , ( invalid value ), then new value of cyan color control function = 0 , ( valid value ), or , if value of cyan color control function & gt ; 255 , ( invalid value ), then new value of cyan color control function = 255 ( valid value ). the effect of the pushbutton reset step is to provide the actual , or working , new functional relation between each set of individual color luts and the parameter m , where , by referring to the generalized set of color control functions , lut cr &# 39 ; -- color -- cr ( m )= tangent cr &# 39 ; -- color -- cr *[ lut cr &# 39 ; -- color -- cr ( m )- m cr &# 39 ; -- color -- cr ]+ m cr &# 39 ; -- color -- cr , lut cr &# 39 ; -- color -- cb ( m )= tangent cr &# 39 ; -- color -- cb *[ lut cr &# 39 ; -- color -- cb ( m )- m cr &# 39 ; -- color -- cb ]+ m cr &# 39 ; -- color -- cb , lut cb &# 39 ; -- color -- cb ( m )= tangent cb &# 39 ; -- color -- cb *[ lut cb &# 39 ; -- color -- cb ( m )- m cb &# 39 ; -- color -- cb ]+ m cb &# 39 ; -- color -- cb , and lut cb &# 39 ; -- color -- cr ( m )== tangent cb &# 39 ; -- color -- cr *[ lut cb &# 39 ; -- color -- cr ( m )- m cb &# 39 ; -- color -- cr ]+ m cb &# 39 ; -- color -- cr , the slope of each equation is a corresponding tangent color control parameter , which varies from greater than or equal to zero , and the y - intercept of each equation is a corresponding integer break point color control parameter , which varies in the chromatic dynamic range , from 0 to 255 , in this example . thus , new values inserted into each set of selected individual color component luts are linear functions of the values mn , representing chromatic pixel values , cr ( i , j ) or cb ( i , j ), of the video input image , which are located at the address ( i , j ) in the video input image grid . simultaneously , according to the definition of m , which also represents the location index of a value in a particular color lut , these new lut values have location indices , m , in the individual color luts . in step 8 , there is calculation and assignment of values to the target output video image , featuring the new chromatic components , cr &# 39 ;( k , l ) and cb &# 39 ;( k , l ). in the general case , output pixel values featuring the new chromatic components , cr &# 39 ;( k , l ) and cb &# 39 ;( k , l ), are obtained by having the individual color luts operate on a linear combination of the input image chromatic components , cr ( i , j ) and cb ( i , j ). in the preferred embodiment of the method of the present invention , for an input image chromatic component , cr or cb , of size m rows by n columns , output image chromatic pixel position coordinates ( k , l ) are limited to the input image size as follows : row number , k : 0 , 1 , 2 , . . . m - 1 ; and column number , l : 0 , 1 , 2 , . . . n - 1 , whereby the same memory array is used for the input image and output image chromatic components . in this case , output image pixel position coordinates , k and l , are equivalent to the corresponding input image pixel position coordinates , i . e ., k = i , and l = j . thus , the output image chromatic components , cr &# 39 ;( k , l ) and cb &# 39 ;( k , l ) are equivalently written as cr &# 39 ;( i , j ) and cb &# 39 ;( i , j ), respectively . in the general case , output image pixel values featuring the new chromatic components , cr &# 39 ;( i , j ) and cb &# 39 ;( i , j ), are obtained by having , the individual color luts operate on a linear combination of the input image chromatic components , cr ( i , j ) and cb ( i , j ), as follows : cr &# 39 ;( i , j )= u 1 * lut cr &# 39 ; -- color -- cr [ cr ( i , j )]+ v 1 * lut cr &# 39 ; -- color -- cb [ cb ( i , j )]+ w 1 , and cb &# 39 ;( i , j )= u 2 lut cb &# 39 ; -- color -- cr [ cr ( i , j )]+ v 2 * lut cb &# 39 ; -- color -- cb [ cb ( i , j )]+ w 2 , where u 1 , v 1 , w 1 , and u 2 , v 2 , w 2 , are real valued parameters greater than or equal to zero . in step 8 , in the preferred embodiment of the method of the present invention , featuring six individual color components of the chromatic part of the video input image , output image pixel values featuring the new chromatic components , cr &# 39 ;( i , j ) and cb &# 39 ;( i , j ), are obtained by having the individual color luts operate on a linear combination of the input image chromatic components , cr ( i , i ) and cb ( i , j ), as follows : cr &# 39 ;( i , j )= x 1 * lut cr &# 39 ; -- red -- cr [ cr ( i , j )]+ y 1 * lut cr &# 39 ; -- red -- cb [ cb ( i , j )]+ z 1 , and cb &# 39 ;( i , j )= x 2 * lut cb &# 39 ; -- red -- cr [ cr ( i , j )]+ y 2 * lut cb &# 39 ; -- red -- cb [ cb ( i , j )]+ z 2 , where x 1 , y 1 , z 1 , and x 2 , y 2 , z 2 , are real valued parameters greater than or equal to zero . in a particular example of the preferred embodiment of the method of the present invention , individual color red is selectively controlled through input image chromatic component cr . therefore , for selective red color control , output image pixel values featuring the new chromatic component , cr &# 39 ;( i , j ), may be obtained by having the cr related red color lut operate on single input image chromatic component , cr ( i , j ), as follows : cr &# 39 ;( i , j )= x 1 * lut cr &# 39 ; -- red -- cr [ cr ( i , j )]+ z 1 , where , in the general equations for red color control , parameters y 1 , and x 2 , y 2 , z 2 equal zero . cr &# 39 ;( i , j )= x 3 * lut cr &# 39 ; -- green -- cr [ cr ( i , j )]+ y 3 * lut cr &# 39 ; -- green -- cb [ cb ( i , j )]+ z 3 , and cb &# 39 ;( i , j )= x 4 * lut cb &# 39 ; -- green -- cr [ cr ( i , j )]+ y 4 * lut cb &# 39 ; -- green -- cb [ cb ( i , j )]+ z 4 , where x 3 , y 3 , z 3 , and x 4 , y 4 , z 4 , are real valued parameters greater than or equal to zero . in a particular example of the preferred embodiment of the method of the present invention , individual color green is selectively controlled through input image chromatic component cr . therefore , for selective green color control , output image pixel values featuring the new chromatic component , cr &# 39 ;( i , j ), may be obtained by having the cr related green color lut operate on single input image chromatic component , cr ( i , j ), as follows : cr &# 39 ;( i , j )= x 3 * lut cr &# 39 ; -- green -- cr [ cr ( i , j )]+ z 3 , where , in the general equations for green color control , parameters y 3 , and x 4 , y 4 , z 4 equal zero . cr &# 39 ;( i , j )= x 5 * lut cr &# 39 ; -- blue -- cr [ cr ( i , j )]+ y 5 * lut cr &# 39 ; -- blue -- cb [ cb ( i , j )]+ z 5 , and cb &# 39 ;( i , j )= x 6 * lut cb &# 39 ; -- blue -- cr [ cr ( i , j )]+ y 6 * lut cb &# 39 ; -- blue -- cb [ cb ( i , j )]+ z 6 , where x 5 , y 5 , z 5 , and x 6 , y 6 , z 6 , are real valued parameters greater than or equal to zero . in a particular example of the preferred embodiment of the method of the present invention individual color blue is selectively controlled through input image chromatic component cb . therefore , for selective blue color control , output image pixel values featuring the new chromatic component , cb &# 39 ;( i , j ), may be obtained by having the cb related blue color lut operate on single input image chromatic component , cb ( i , j ), as follows : cb &# 39 ;( i , j )= y 6 * lut cb &# 39 ; -- blue -- cb [ cb ( i , j )]+ z 6 , where , in the general equations for blue color control , parameters x 5 , y 5 , z 5 , and x 5 equal zero . cr &# 39 ;( i , j )= x 7 * lut cr &# 39 ; -- yellow -- cr [ cr ( i , j )]+ y 7 * lut cr &# 39 ; -- yellow -- cb [ cb ( i , j )]+ z 7 , and cb &# 39 ;( i , j )= x 8 * lut cb &# 39 ; -- yellow -- cr [ cr ( i , j )]+ y 8 * lut cb &# 39 ; -- yellow -- cb [ cb ( i , j )]+ z 8 , where x 7 , y 7 , z 7 , and x 8 , y 8 , z 8 , are real valued parameters greater than or equal to zero . in a particular example of the preferred embodiment of the method of the present invention , individual color yellow is selectively controlled through input image chromatic component cb . therefore , for selective yellow color control , output image pixel values featuring , the new chromatic component , cb &# 39 ;( i , j ), may be obtained by having the cb related yellow color lut operate on single input image chromatic component , cb ( i , j ), as follows : cb &# 39 ;( i , j )= y 8 * lut cb &# 39 ; -- yellow -- cb [ cb ( i , j )]+ z 8 , where , in the general equations for blue color control , parameters x 7 , y 7 , z 7 , and x 8 equal zero . cr &# 39 ;( i , j )= x 9 * lut cr &# 39 ; -- magenta -- cr [ cr ( i , j )]+ y 9 * lut cr &# 39 ; -- magenta -- cb [ cb ( i , j )]+ z 9 , and cb &# 39 ;( i , j )= x 10 * lut cb &# 39 ; -- magenta -- cr [ cr ( i , j )]+ y 10 * lut cb &# 39 ; -- magenta -- cb [ cb ( i , j )]+ z 10 , where x 9 , y 9 , z 9 , and x 10 , y 10 , z 10 , are real valued parameters greater than or equal to zero . cr &# 39 ;( i , j )= x 11 * lut cr &# 39 ; -- cyan -- cr [ cr ( i , j )]+ y 11 * lut cr &# 39 ; -- cyan -- cb [ cb ( i , j )]+ z 11 , and cb &# 39 ;( i , j )= x 12 * lut cb &# 39 ; -- cyan -- cr [ cr ( i , j )]+ y 12 * lut cb &# 39 ; -- cyan -- cb [ cb ( i , j )]+ z 12 , where x 11 , y 11 , z 11 , and x 12 , y 12 , z 12 , are real valued parameters greater than or equal to zero . in step 9 , the new digital video output image , featuring an individually selected color change , obtained from the new set of chromatic components , cr &# 39 ;( i , j ) and cb &# 39 ;( i , j ), is displayed on the tv or video display screen . all remaining colors , other than the individual color selected for change , of the video input image chromatic components cr ( i , j ) and cb ( i , j ), are left unchanged by this procedure , and appear in the display along with the selected individual color change . while the invention has been described with respect to one embodiment , it will be appreciated that many variations , modifications and other applications of the invention may be made . | 7 |
fig1 is a perspective view of a patient 10 positioned on the mattress of the patient cart 12 ready to undergo an upper gi endoscopy with the flexible fiberoptic endoscope 28 retained the endoscope holder 18 . fig2 is a perspective view of the patient cart 50 with the cover of the medical procedure drape 20 and the endoscope holder 18 . fig3 is a plan view of the medical procedure drape 16 and the endoscope holder 18 . fig4 is a plan view of the medical procedure drape 16 in the present invention . fig5 is a perspective view of the endoscope holder 18 of the present invention . fig6 is a perspective view of the medical procedure drape 16 of fig4 fixed to the endoscope holder 18 of fig5 . the embodiments of the present invention described below are not intended to be exhaustive or to limit the invention to the precise forms disclosed in the following detailed description . rather , the embodiments are chosen and described so that others skilled in the art may appreciate and understand the principles and practices of the present invention . referring now to fig1 , there is shown a medical procedure drape 16 including a cover and an endoscope holder 18 . during the procedure the patient 10 is sedated or anesthetized with intravenously administered medication while also having a topically applied anesthetic to the posterior oral pharynx . this may be accomplished by either swallowing a viscous liquid , or spraying a topical anesthetic directly on the mucosal surfaces of the posterior oral pharynx . the patient 10 is positioned on the patient cart 50 in the left lateral decubitus position with the head on a supportive pillow . the airway is protected by proper positioning to allow unobstructed spontaneous respiration and adequate pulmonary function . the medical procedure drape 16 is positioned such that the cover of the medical procedure drape 20 will have the cephalad portion of the cover 22 superimpose the supportive pillow , while the caudal portion of the cover 24 superimposes the neck , chest , and arms of the patient 10 . a free flap of the cover 26 hangs over the side of the mattress of the patient cart 12 . the attached endoscope holder 18 is positioned so that the horizontal member 42 of the endoscope holder 18 is introduced between the mattress of the patient cart 12 and the deck of the patient cart 14 . the vertical member 40 of the endoscope holder 18 is aligned with the side of the mattress of the patient cart 12 . the flexible fiberoptic endoscope 28 is positioned with the controlling handpiece of the endoscope 32 on the patient 10 side of the endoscope holder 18 , having the umbilical of the endoscope 34 lying in the notch 48 of the endoscope holder 18 . the working end of the endoscope 30 is lying on the cover of the medical procedure drape 20 , on the horizontal surface of the mattress of the patient cart 12 . this positions the working end of the endoscope 30 for manual insertion into the oral pharynx and esophagus of the patient 10 . the endoscope holder 18 allows the endoscopist to utilize both hands for the insertion of the flexible fiberoptic endoscope 28 without the possibility of the controlling handpiece of the endoscope 32 falling off of the patient cart 50 and sustaining damage . the endoscopist and the medical equipment cart containing light source , camera , suction , and air and water supplies are not depicted for clarity , and to demonstrate the detail and position of the medical procedure drape 16 , the patient 10 , and the patient cart 50 . fig2 is a perspective view of the medical procedure drape 16 , including the cover of the medical procedure drape 20 overlying the mattress of the patient cart 12 , and the endoscope holder 18 inserted in position between the mattress of the patient cart 12 and the deck of the patient cart 14 . the cephalad portion of the cover 22 , the caudal portion of the cover 24 , and the free flap of the cover 26 are demonstrated here . the relationship of the endoscope holder 18 and its location between the mattress of the patient cart 12 and the deck of the patient cart 14 are depicted . the patient 10 , the flexible fiberoptic endoscope 28 , and the pillow are omitted from this figure to depict the detail of this embodiment of the present invention . fig3 is a plan view of the medical procedure drape 16 including the cover of the medical procedure drape 20 and the endoscope holder 18 . the cephalad portion of the cover 22 used to superimpose the pillow is seen directly opposite the endoscope holder 18 . the cephalad portion of the cover 22 has an edge or side 52 that is disposed along the width of the support surface of the patient cart 50 . the free flap of the cover 26 is the portion of the cover of the medical procedure drape 20 which hangs vertically over the edge of the mattress of the patient cart 12 , thus protecting the patient cart 50 . the caudal portion of the cover 24 superimposes the chest and arms of the patient 10 and a portion of the patient cart 50 . the caudal portion of the cover 24 has an edge or side 54 that is disposed along the width of the support surface of the patient cart 50 . the cephalad portion of the cover 22 and the caudal portion of the cover 24 are further defined by an angularly disposed edge or side 56 that is positioned between edges 52 and 54 and is configured to define a cut - out section 58 that can accommodate the neck of the patient 10 . a cut - line 60 is also disposed along the width of the support surface of the patient cart 50 and specifically between the cephalad portion of the cover 22 and the free flap of the cover 26 to thereby allow the free flap to hang over the side of the patient support surface 50 . an adhesive strip with peel - off paper backing 38 is located on the reverse side of the cover of the medical procedure drape 20 to cause the cover to adhere to the patient &# 39 ; s chest and right arm . fig4 is a plan view of the cover of the medical procedure drape 20 . the cover of the medical procedure drape 20 has an obverse side seen in this figure and a reverse side . it is constructed of a synthetic fabric which is flexible and impervious to liquids . once again , as in fig3 , the cephalad portion of the cover 22 , the caudal portion of the cover 24 , and the free flap of the cover 26 are shown . also shown is a flap of the cephalad of the cover 36 and is to accommodate adhesive attachment to the endoscope holder 18 as in fig3 . on the reverse side of the cover of the medical procedure drape 20 is an adhesive strip with peel - off paper backing 38 to attach the caudal portion of the cover 24 to the patient 10 . fig5 is a perspective view of the endoscope holder 18 . the endoscope holder 18 can be constructed of rigid plastic , solid or corrugated cardboard . it is made up of two members , a vertical member 40 and a horizontal member 42 . they are joined by a hinge 44 which may be made of the same material as the rigid members , or may be constructed of a flexible fabric . the hinge 44 allows the endoscope holder 18 to be folded flat , like a book , when closed . the motion is constrained , when fully open , to a right angle configuration by a gusset 46 at each end of the endoscope holder 18 . the gusset 46 is constructed from a flexible fabric or tape material , adherent to each member . the vertical member 40 has a notch 48 along the superior edge . it is shaped to accommodate the flexible fiberoptic endoscope 28 as depicted in fig1 . the caudal end of the endoscope holder 18 is tapered to a dimension approximating the thickness of the mattress of the patient cart 12 . since other modifications and changes varied to fit particular operating requirements and environments will be apparent to those skilled in the art , the invention is not considered limited to the example chosen for purposes of disclosure , and covers all changes and modifications which do not constitute departures from the true spirit and scope of this invention . | 0 |
when reference is made to the drawing , like numerals indicate like parts and structural features in the various figures . fig1 is an exploded view of a fluid displacement module ( fdm ) showing a double - ended single piece piston 2 . piston 2 has an end 9 having an opening 6 for holding a stem 8 of a single piece piston head 7 . a second piston head is held in the opposite end of piston 2 . in assembly , the piston heads are joined to the piston by pins 10 . each piston head 7 has a protrusion 5 for filling openings 20 in cylinder heads 12 at top dead center . hereafter , one piston / cylinder combination with associated elements is described since each combination is identical to the other in configuration although diameter of cylinders can vary . the piston and piston head assembly fits into a cylinder 11 . cylinder 11 has a groove 15 on an end 16 providing for the location of a compliant sealing member 14 such as an o - ring . the end 16 of cylinder 11 fits into counterbore 13 of cylinder head 12 . in assembly with the cylinder head , the cylinder 11 is not pressed against the bottom 17 of counterbore 13 as shown in fig4 . in assembly , the bottom surface 25 of cylinder 11 is cushioned from contact with cylinder carriage 19 by a compliant washer 26 interposed between the two parts . cylinder head 12 has a sliding surface 23 which is machined and lapped for sliding against a port plate , not shown in fig1 . opposite surface 23 is a surface 18 of cylinder head 12 which mates with small contact surfaces 22 on cylinder carriage 19 . there are four contact surfaces 22 on each end of cylinder carriage 19 to mate with surface 18 . the four small contact surfaces are provided by locating four recesses 21 in the end of cylinder carriage 19 . a crankshaft , not shown , drives piston 2 through a bearing 3 . fig2 is an exploded view of two fluid displacement modules showing how one can be nested in assembly with another around the crankshaft bearing 3 . cylinder carriage 19 and cylinder carriage 19 a carry pistons 2 and 2 a , respectively , with bearing 3 passing through the openings 30 and 30 a in the pistons . fig3 shows two fluid displacement modules 31 and 32 in assembly . when in assembly the device is a four - piston fluid displacement device and the two modules 31 and 32 are then sometimes referred to as one fluid displacement module . fig4 is a cross - sectional view taken along line 4 — 4 of fig3 . it shows the cylinder , cylinder head , piston head and piston in assembly . cylinder head 12 has an opening 20 which is emptied of fluid by protrusion 5 on piston head 7 at top dead center of piston travel . in assembly , cylinder 11 is spaced from cylinder head 12 by clearance space 24 . the bottom end of cylinder 11 is located on a compliant washer 26 which is interposed between cylinder 11 and cylinder carriage 19 and is intended to reduce clearance space 24 to near zero . cylinder 11 is shown assembled within counterbore 13 with compliant sealing member 14 located between the cylinder and the cylinder head to provide sealing engagement therebetween . piston 2 is assembled with piston head 7 through pin 10 . a seal between piston head 7 and cylinder 11 is provided by a sealing lip 4 which is integral with piston head 7 . lip 4 is backed by an elastomeric element 27 which may be an o - ring . fig5 is a partial cross - sectional view showing the assembly of floating port plate 33 with the cylinder / piston combination . an urging member 37 , which may be of elastomeric material , is interposed between the top surface of port plate 33 and the housing 34 of the pfdd . pliable members 35 and 35 a , which may be made of elastomeric material , are interposed between the left and right surfaces of port plate 33 and the housing 34 . fig5 shows displacement chamber 39 within cylinder 11 . chamber 39 receives and discharges fluid through opening 20 in cylinder head 12 . fig6 also shows the captivation of the port plate 33 within the housing 34 and shows another pliable buffering member 40 interposed between the back side of port plate 33 and the housing 34 . together fig5 and 6 show that the port plate 33 does not come into direct mechanical contact with the housing 34 . pliable seal 41 , which may be an o - ring , provides a seal between manifold 42 and port plate 33 . rail 44 is located within a groove 43 in the housing 34 and provides support for the cylinder head 12 which slides within the rail 44 . a resilient member 45 is located between rail 44 and housing 34 providing compliance to the arrangement of rail and housing . fig7 is a partial perspective view of cylinder carriage 19 and shows four recesses 21 in the end surface of cylinder 19 . recesses 21 provide four small contact surfaces 22 which are machined and lapped to close tolerance for connection to cylinder head 12 . these four surfaces as well as surfaces 18 and 23 of cylinder head 12 ( fig4 ) are machined and lapped to a flatness of better than two light bands . fig8 is a partial cross - sectional view showing the pliable member 37 as a spring 46 interposed between the housing 34 and port plate 33 . spring 46 is located in a groove 47 in port plate 33 with the ends 48 of spring 46 bearing against the housing 34 . the spring applies pressure in the center of the port plate achieving superior control with a reduction in the clearance between the port plate and the housing compared to the elastomeric embodiment of fig5 . fig9 and 10 show a two - layer manifold with a first layer 42 directly adjacent to the port plate 33 and a second layer 49 on the opposite side of layer 42 . layer 49 has inlet and outlet ports 50 and 51 to supply fluid to the pfdd and an outlet connection to components outside the pfdd . fig9 shows layer 42 with grooves 61 and 63 cut into the surface of layer 42 extending from and to ports 60 and 62 . grooves 61 and 63 are machined into the surface of layer 42 and are sealed by layer 49 when the manifold is assembled to create passageways for fluid to communicate with ports 60 and 62 . ports 60 a and 62 a may be the inlet and outlet ports in communication with corresponding ports in the port plate of a first piston / cylinder assembly . ports 60 b and 62 b are for a second piston / cylinder assembly , ports 60 c and 62 c are for a third such assembly , and ports 60 d and 62 d are for a fourth such assembly . fig1 is a cross - sectional view of the pfdd in assembly with motor 64 . drive shaft 70 is directly connected to crankshaft 67 through a pin 66 . bearing 68 carries the crankshaft 67 and is interposed between adapter 69 and the housing 34 of the pfdd . crankpin 65 is connected with a centerline offset from the centerline of crankshaft 67 in order to provide an orbital motion to piston 2 mounted on the crankpin . diameter of piston movement is equal to twice the eccentricity of crankpin 65 . this design achieves a small pfdd / motor package and provides direct connection of the motor driveshaft to the pfdd crankshaft . fig1 is an exploded view showing another motor 78 with its shaft modified to accommodate a pinion 76 . the pinion meshes with gear 72 to drive crankshaft 74 through disk 73 and achieve torque requirements . the pinion 76 is secured with the pin 77 to the motor driveshaft . disk 73 is secured to crankshaft 74 . location of the disk 73 is accurately controlled and provides precise meshing of the pinion and the ring gear . the motor is bolted to the adapter 69 via an eccentric ring 71 that provides support for the bearing 75 . in operation of the pfdd , and with respect to fig4 fluid enters the displacement chamber 39 through opening 20 in the cylinder head and fills the displacement chamber . the fluid contacts piston seal 4 but never comes into contact with the piston 2 . the 5 fluid is also dispelled from the displacement chamber through opening 20 and on through the port plate 33 and the passageways and ports in the manifold to using devices exterior to the pfdd . note that the cylinder 11 fits inside the cylinder head 12 into the counterbore 13 with a seal which is a compliant sealing member 14 . the end 16 of cylinder 11 does not come into pressurized mechanical contact with the bottom 17 of the counterbore 13 and therefore axial forces are not placed on the cylinder 15 ( nor on the cylinder head .) the sealing pressure of member 14 , which may be an o - ring , is exerted radially in a plane parallel to the large surface 18 of the cylinder head . sealing pressure from member 14 is along line a — a as shown in fig4 . the presence of the small clearance space 24 prevents any possibility of axial pressure on the cylinder head or the cylinder when the two are assembled . note that the other end 25 of cylinder 11 is restrained on the cylinder carriage by a washer 26 made out of a semi - compliant material such as teflon . as a result the cylinder , which is often made of glass or ceramic material , is not stressed under axial forces when the pfdd is assembled and in use . also , the arrangement avoids pressure on the cylinder head in a direction perpendicular to sliding surface 23 and therefore distortions of the surface sliding against the port plate are prevented . fig2 an exploded view of fluid displacement modules , shows the construction which enables a nesting of the cylinder carriages within each other . it shows two double - ended pistons which are connected together around a bearing sleeve 3 . since the pistons are connected around a bearing sleeve , the 90 ° angle between the two double - ended pistons is not defined by the pistons but rather by the position of the cylinder heads sliding within the rails 44 . rails 44 are in turn held inside grooves 43 in the pfdd housing . as a consequence , no binding occurs and precision in establishing the angularity of the pistons is not required . note that the carriages 19 and 19 a are of the same basic construction with the center of each carriage cut or milled out to allow the nesting of the carriages into each other . in that manner the axis of the two double - ended pistons are in the same plane , perpendicular to the axis of the crankshaft . fig3 shows the two double - ended pistons and the carriages nested together to form a four piston fluid displacement module . as mentioned above , fig5 and 6 show that the port plate 33 does not come into direct mechanical contact with housing 34 . the port plate is urged against the cylinder head by pliable member 37 which may be , for example , an elastomer or a spring , and is held away from housing 34 by pliable members 35 , 35 a , 37 and 40 . forces exerted on the port plate by resilient members 40 are balanced by the pliable seal 41 located between the manifold 42 and the port plate . the port plate is never in direct mechanical contact with either the housing 34 or the manifold 42 , thus avoiding any abrasion which would be caused by micromotion of the hard material port plate ( ceramic , sapphire , hardened steel , etc .) with the housing or manifold . the only direct contact of surfaces on the port plate with another part is the surface - to - surface contact with surface 23 of cylinder head 12 . because of manufacturing tolerance , the cylinder head sliding in the rails 44 of the housing is not kept in a constant geometric location . therefore , the surface of port plate 33 in contact with surface 23 of cylinder head 12 , which surface must always be in intimate contact with the cylinder head 12 , must be allowed to float and follow the geometric location of the cylinder head . as a result , a constant micromotion of the port plate results and can be very destructive to other surfaces of the port plate if they are in direct mechanical contact with the housing or manifold . the use of pliable members between those surfaces allows micromotion of the port plate to follow the cylinder head with no damage . fig6 shows a groove 43 cut into the housing 34 . the purpose of the groove is to hold rail 34 along which the cylinder head slides . a resilient member 45 is located at the bottom of groove 43 and urges the cylinder head toward the manifold 42 . this arrangement eliminates clearance between the two large longitudinal sliding surfaces of the cylinder head , that is , surfaces which slide against the rail and the manifold . this assures a quiet operation and eliminates the requirement of precision manufacturing tolerances on the cylinder head and in the depth of the groove 43 . fig9 and 10 show the two - layer manifold which has grooves cut into the surface of the first manifold layer in order to provide communication between the ports 60 and 62 . the grooves may be cut in the same manufacturing setup in which the surface of manifold layer 42 is machined . the grooves are sealed by a second manifold layer 49 to provide passageways for conducting fluid through the manifold . the surfaces between the two layers are lapped to a flatness of better than two light bands to insure leak tightness without the need for using a gasket . inlet and outlet ports on the second manifold layer 49 are connected to the passageways in the first manifold layer 42 . for applications where very low flow is required and minimum volume in the pump is a requirement , the passageways can be very small yet accessible and easy to clean . while the invention has been shown and described with reference to preferred embodiments thereof , it should be understood that changes in the form and details of the invention may be made therein without departing from the spirit and scope of the invention . | 8 |
hereinbelow , an embodiment of the liquid recording head ( ink jet recording head ) of the present invention will be described . fig1 ( a ) is a partially enlarged schematic plan view showing ejection outlets , flow passages and a common liquid chamber in an ink jet recording head 10 in this embodiment . fig1 ( b ) is a schematic sectional view taken along a - a ′ line indicated in fig1 ( a ). as shown in fig1 ( a ), in the recording head 10 in this embodiment , a plurality of large droplet ejection outlets 3 ( 3 a to 3 d ) is arranged in a line at one side of a common liquid chamber 2 in a longitudinal direction of the common liquid chamber 2 and a plurality of small droplet ejection outlets 4 is arranged in a line at the other side of the common liquid chamber 2 in the longitudinal direction . the large droplet ejection outlets 3 ( 3 a to 3 d ) communicate with the common liquid chamber 2 through large droplet flow passages 5 ( 5 a to 5 d ), respectively . each small droplet ejection outlet 4 communicates with the common liquid chamber 2 through an associated small droplet flow passage 6 . further , the large droplet flow passage 5 a causing the large droplet ejection outlet 3 a to communicate with the common liquid chamber 2 and the large droplet flow passage 5 b causing the large droplet 3 b to communicate with the common liquid chamber 2 are connected with each other by a sub - flow passage 7 . similarly , the large droplet flow passage 5 c causing the large droplet ejection outlet 3 c to communicate with the common liquid chamber 2 and the large droplet flow passage 5 d causing the large droplet ejection outlet 3 d to communicate with the common liquid chamber 2 are connected with each other by another sub - flow passage 7 . that is , with respect to the large droplet ejection outlet 3 a , in addition to the large droplet flow passage 5 a , the large droplet flow passage 5 b and the sub - flow passage 7 function as a flow passage for supplying ink . further , also with respect to the large droplet ejection outlet 3 b , in addition to the large droplet flow passage 5 b , the large droplet flow passage 5 a and the sub - flow passage 7 function as the flow passage for supplying the ink . the above - described structure is true for other large droplet flow passages including those which are not shown in fig1 ( a ). as a result , a flow resistance of a flow passage from the common liquid chamber to each large droplet ejection outlet 3 is remarkably reduced compared with a conventional constitution in which a single flow passage is provided to each ejection outlet . by the above described constitution , it is possible to keep the flow resistance of the flow passage from the common liquid chamber to each large droplet ejection outlet 3 within a predetermined range even when a distance ( oh ) and a height ( h ) are decreased as shown in fig1 ( b ). therefore , according to the recording head 10 in this embodiment , the flow resistance with respect to the large droplet ejection outlet 3 can be suppressed at a low level and kept within the predetermined level even when the distance ( oh ) is decreased in order to properly retain an ejection performance of the small droplet ejection outlet 4 while further decreasing an ejection amount of the small droplet ejection outlet 4 . as a result , refilling time can be kept in a short state , so that an upper limit of an ejection frequency can be kept at a high level and thus it is possible to maintain a high throughput . in the conventional constitution in which the single ink flow passage is provided to each large droplet ejection outlet , the ink flow passage is placed in a blockage state on a rear side of the ink flow passage ( at a side opposite ( remote ) from the common liquid chamber side ), so that asymmetry of the ink flow passage with respect to the flow passage direction is strongly exhibited . on the other hand , in the recording head in this embodiment , the ink flow passage ( the large droplet flow passage 5 ) is connected with its adjacent large droplet flow passage 5 at the rear side thereof , so that each of the large droplet flow passages 5 is not placed in the blockage state and has good symmetry . for this reason , even when the distance ( oh ) is further decreased , symmetry of the flow passage for the large droplet ejection outlet 3 with respect to the flow passage direction can be kept well . accordingly , the trailing of the ejected droplet does not occur at the portion toward the common liquid chamber 2 in an asymmetrical manner , thus being prevented from contacting the large droplet ejection outlet 3 , so that the dew - like ink cannot be deposited around a portion close to the ejection outlet 3 . as a result , an occurrence of inconveniences such that the ejection direction of the ink droplet is deviated from a predetermined direction and that a main droplet cannot be formed normally to fail in normal dot printing can be obviated . an ejection type of the ink droplet from the large droplet ejection outlet 3 connected as described above is roughly classified into the following types ( a ) and ( b ). here , the ejection type corresponds to a drive type of an ejection energy generating means ( e . g ., a heater ) corresponding to each of the large droplet ejection outlets 3 . ( a ) after an ink droplet is ejected from one of two adjacent large droplet ejection outlets 3 connected by the flow passage , an ink droplet is ejected from the other large droplet ejection outlet 3 with a time difference . ( b ) depending on print data , a time from ejection of an ink droplet from one of the two adjacent large droplet ejection outlets 3 connected by the flow passage to ejection of an ink droplet from the other large droplet ejection outlet 3 is changed . with respect to the type ( a ), an effect of alleviating a crosstalk - like phenomenon between the connected large droplet ejection outlets 3 by deviating ( shifting ) ejection timings of the ink droplets ejected from the connected large droplet ejection outlets 3 from each other is achieved . when the number of the plurality of large droplet ejection outlets 3 connected by the large droplet flow passages 5 ( and the sub - flow passages 7 ) is taken as n and a time required for ejecting ink droplets from all of the connected plurality of large droplet ejection outlets 3 is taken as t , the time difference of the ejection timings may preferably be approximately t / n . in an optimum embodiment , an ink refilling operation with respect to one of the connected ( adjacent two ) large droplet ejection outlets 3 is completed after an ink droplet is ejected from this large droplet ejection outlet 3 , and thereafter an ink droplet is ejected from the other large droplet ejection outlet 3 . however , in this case , a time from ejection of ink droplets from all the large droplet ejection outlets 3 until the ink refilling operation is completed is prolonged , so that it is preferable that a drive time difference between the connected large droplet ejection outlets 3 is decreased within such a range that the crosstalk - like phenomenon presents no problem . with respect to the type ( b ), escape of bubble generating power of the case of ejecting ink droplets from both of the connected large droplet ejection outlets 3 at the same time is smaller than that of the case of ejecting the ink droplets only from one of the connected large droplet ejection outlets 3 . therefore , ejection energy imparted to the ink droplets can be increased , so that it is possible to increase an ejection amount . in other words , by changing the ejection timing from the connected large droplet ejection outlets 3 , it is possible to modulate the ejection amount . as described above , according to the present invention , even in the case where the distance ( oh ) is decreased in order to properly retain the ejection performance from the small droplet ejection outlets while decreasing an ejection amount from the small droplet ejection outlets , the ejection frequency upper limit of the large droplet ejection outlets can be kept at a high level and it is possible to satisfactorily keep the symmetry of the ink flow passage . as a result , a high throughput and a good ejection state can be maintained . further , the above - described effects can be realized simply and inexpensively with accuracy . another embodiment of the ink jet recording head of the present invention will be described . fig2 is a partially enlarged schematic plan view showing ejection outlets , flow passages and a common liquid chamber in an ink jet recording head 20 in this embodiment . a base constitution of the recording head 20 in this embodiment is in common with the recording head 10 in embodiment 1 . therefore , the common constitution is omitted from the following description by using identical reference numerals . the recording head 20 in this embodiment is characterized in that three large droplet flow passages 5 are connected . more specifically , a large droplet flow passage 5 a provided for a large droplet ejection outlet 3 a , a large droplet flow passage 5 b provided for a large droplet ejection outlet 3 b , and a large droplet flow passage 5 c provided for a large droplet ejection outlet 3 c are connected with each other by a sub - flow passage 7 . in other words , with respect to one large droplet ejection outlet 3 , the three large droplet flow passages 5 and the sub - flow passage 7 connecting these large droplet flow passages 5 function as a flow passage for supplying ink . the above - described structure is similar to those with respect to other large droplet ejection outlets . for example , a large droplet flow passage 5 d provided for a large droplet ejection outlet 3 d and two adjacent large droplet flow passages ( not shown ) provided for two large droplet ejection outlets ( not shown ) are connected with each other by a sub - flow passage ( not shown ). in this embodiment , the recording head 20 having the above - described features has an advantage of increasing in ejection amount modulation range , compared with the recording head 10 in embodiment 1 , by changing a time difference of ejection from each of the large droplet ejection outlets 3 . further , when the ink droplets are ejected from each large droplet ejection outlet 3 alone , the number of the flow passages is three , so that escape of bubble generating power is large . as a result , an ejection amount is small . on the other hand , when the ink droplets are ejected from the three large droplet ejection outlets 3 provided with the connected three large droplet flow passages 5 at the same time , the escape of bubble generating power is decreased , so that the ejection amount is increased . further , the ink droplets can be ejected from any two large droplet ejection outlets 3 . another embodiment of the ink jet recording head of the present invention will be described . fig3 is a partially enlarged schematic plan view showing ejection outlets , flow passages and a common liquid chamber in an ink jet recording head 30 in this embodiment . a base constitution of the recording head 30 in this embodiment is in common with the recording head 10 in embodiment 1 . therefore , the common constitution is omitted from the following description by using identical reference numerals . the recording head 30 in this embodiment is characterized in that all the plurality of large droplet flow passages 5 are connected . in fig3 , only large droplet flow passages 5 a to 5 d are shown , but other large droplet flow passages are also connected by a single sub flow passage 7 . in other words , in this embodiment , all of large droplet ejection outlets 3 are connected each to other through the flow passages 5 and 7 . the large droplet ejection outlets 3 in the recording head 10 shown in fig1 and the recording head 20 shown in fig2 have asymmetry with respect to an arrangement direction thereof except for the central large droplet ejection outlet 3 of the three large droplet ejection outlets 3 in the recording head 20 ( e . g ., the large droplet ejection outlet 3 b shown in fig2 ). accordingly , there is possibility of such an influence that an ejection direction of the ink droplet is inclined . on the other hand , the recording head 30 in this embodiment has complete symmetry of all the large droplet ejection outlets 3 with respect to an arrangement direction of the large droplet ejection outlets 3 . another embodiment of the ink jet recording head of the present invention will be described . fig4 is a partially enlarged schematic plan view showing ejection outlets , flow passages and a common liquid chamber in an ink jet recording head 40 in this embodiment . a base constitution of the recording head 40 in this embodiment is in common with the recording head 10 in embodiment 1 . therefore , the common constitution is omitted from the following description by using identical reference numerals . in the recording head 40 in this embodiment , the large droplet ejection outlet 3 b which is provided on the large droplet flow passage 5 b in the recording head 10 is provided on the large droplet flow passage 5 c . in other words , in the recording head 40 in this embodiment , on one of two large droplet flow passages 5 connected through the sub - flow passage 7 , one large droplet ejection outlet 3 is provided . accordingly , the recording head 40 is in common with the recording head 10 in that the two large droplet flow passages 5 and the sub - flow passage 7 connecting these flow passages function as an ink supply passage for the one large droplet ejection outlet 3 . more specifically , referring to fig4 , with respect to the large droplet ejection outlet 3 a provided on the large droplet flow passage 5 a , the large droplet flow passages 5 a and 5 b and the sub - flow passage 7 connecting these passages function as the ink supply passage . further , with respect to the large droplet ejection outlet 3 b provided on the large droplet flow passage 5 c , the large droplet flow passages 5 c and 5 d and the sub - flow passage 7 connecting these passages function as the ink supply passage . however , in the recording head 10 shown in fig1 , two adjacent large droplet ejection outlets 3 are connected with each other through not only the common liquid chamber 2 , but also the two large droplet flow passages 5 and the sub - flow passage 7 , whereas in the recording head 40 in this embodiment , the two adjacent large droplet ejection outlet 3 are connected with each other through only the common liquid chamber 2 . in the recording head 40 in this embodiment , the large droplet ejection outlets 3 are independent from each other , so that the recording head 40 has such an advantage that there is substantially no crosstalk - like phenomenon . another embodiment of the ink jet recording head of the present invention will be described . fig5 is a partially enlarged schematic plan view showing ejection outlets , flow passages and a common liquid chamber in an ink jet recording head 50 in this embodiment . a base constitution of the recording head 50 in this embodiment is in common with the recording head 40 in embodiment 4 . a different point is that in this embodiment , the large droplet ejection outlets 3 are provided on the sub - flow passage 7 connecting the two large droplet flow passages 5 . in other words , each of the large droplet ejection outlets 3 is provided at a central portion of the ink supply passage therefor . more specifically , referring to fig5 , the large droplet ejection outlet 3 a is provided on the sub flow passage 7 connecting the large droplet flow passages 5 a and 5 b . further , the large droplet ejection outlet 3 b is provided on the sub flow passage 7 connecting the large droplet flow passages 5 c and 5 d . similarly , each of other large droplet ejection outlets ( not shown ) is provided on an associated sub flow passage connecting two large droplet flow passages . in the recording head 50 in this embodiment , all the large droplet ejection outlets 3 are completely symmetrical with respect to an arrangement direction thereof , so that the recording head 50 has an advantage that there is less possibility of such an influence that the ejection direction of the ink droplet is inclined . another embodiment of the ink jet recording head of the present invention will be described . fig6 is a partially enlarged schematic plan view showing ejection outlets , flow passages and a common liquid chamber in an ink jet recording head 60 in this embodiment . in the recording head 60 in this embodiment , at both sides of the common liquid chamber 2 , the large droplet ejection outlets 3 and the small droplet ejection outlets 4 are alternately arranged . two large droplet flow passages 5 for supplying the ink to a pair of large droplet ejection outlets 3 disposed adjacent to each other while sandwiching a small droplet ejection outlet 4 are connected with each other through a sub - flow passage 7 at one side of the common liquid chamber 2 . further , the sub - flow passage 7 connects the two large droplet flow passages with each other at a side opposite ( remote ) from the common liquid chamber 2 with respect to the small droplet ejection outlet 4 located between the sub - flow passage 7 and the common liquid chamber 2 . more specifically , referring to fig6 , the large droplet flow passages 5 a and 5 b for supplying the ink to the pair of large droplet ejection outlets 3 a and 3 b which are disposed adjacent to each other while sandwiching the small droplet ejection outlet 4 therebetween are connected with each other by the sub - flow passage 7 provided at a side opposite from the common liquid chamber 2 while sandwiching the small droplet ejection outlet 4 between the sub - flow passage 7 and the common liquid chamber 2 . as a result , the ink supply passage consisting of the two large droplet flow passages 5 a and 5 b and the sub - flow passage 7 is formed in a u - shape so as to surround the small droplet ejection outlet 4 a . in the recording head 60 in this embodiment , an influence of bubble generation at the large droplet ejection outlet 3 is dispersed into a plurality of flow passages in the constitution in which the large droplet ejection outlets 3 and the small droplet ejection outlets 4 are alternately arranged at both sides of the common liquid chamber 2 , so that the recording head 60 has such an advantage that the influence on an adjacent small droplet ejection outlet 4 is diminished . another embodiment of the ink jet recording head of the present invention will be described . fig7 is a partially enlarged schematic plan view showing ejection outlets , flow passages and a common liquid chamber in an ink jet recording head 70 in this embodiment . in the recording head 70 in this embodiment , the sub - flow passages 7 provided on both sides of the common liquid chamber 2 in the recording head 6 shown in fig6 are connected with each other on each side so that all the large droplet ejection outlets 3 are connected with each other . in the recording head 70 in this embodiment , all the large droplet ejection outlets 3 are completely symmetrical with respect to an arrangement direction thereof , so that the recording head 70 has an advantage that there is less possibility of such an influence that the ejection direction of the ink droplet is inclined . another embodiment of the ink jet recording head of the present invention will be described . fig8 is a partially enlarged schematic plan view showing ejection outlets , flow passages and a common liquid chamber in an ink jet recording head 80 in this embodiment . in the recording head 80 in this embodiment , two common liquid chambers 2 a and 2 b are provided on a single substrate 81 . at both sides of one of the common liquid chambers ( the common liquid chamber 2 a in this case ), only the large droplet ejection outlets are arranged and at both sides of the other common liquid chamber 2 b , only the small droplet ejection outlets 4 are arranged . each of the large droplet ejection outlets 3 communicates with the common liquid chamber 2 a through the large droplet flow passage 5 . further , two large droplet flow passages 5 causing a pair of large droplet ejection outlets to communicate with the common liquid chamber 2 are connected with each other by the sub - flow passage 7 . on the other hand , each of the small droplet ejection outlets 4 communicate with the common liquid chamber 2 b through an independent small droplet flow passage 6 . the recording head 80 in this embodiment has such an advantage that the large droplet and the small droplet can be used for different colors . another embodiment of the ink jet recording head of the present invention will be described . fig9 is a partially enlarged schematic plan view showing ejection outlets , flow passages and a common liquid chamber in an ink jet recording head 90 in this embodiment . in the recording head 90 in this embodiment , two large droplet flow passages 5 which are symmetrical with respect to a large droplet ejection outlet 3 are provided . further , on the same substrate , a plurality of common liquid chambers 2 is provided . to one of the common liquid chambers 2 , one of a pair of large droplet flow passages 5 and a small droplet flow passage 6 are connected , and to the other common liquid chamber 2 , the other large droplet flow passage 5 is connected . in the recording head 90 in this embodiment , deposition of a dew - like ink in the neighborhood of the ejection outlets 3 is prevented by symmetrical two large droplet flow passages 5 . as a result , it is possible to obviate inconveniences such that the ejection direction of the ink droplet is deviated from a predetermined direction and that a main droplet is not normally formed to fail in normal dot printing . further , the pair of two large droplet flow passages 5 is connected with different common liquid chambers , so that the recording head 90 has a preferable structure for preventing the crosstalk - like phenomenon . the present invention is also applicable to appropriate combinations of the above - described embodiments . while the invention has been described with reference to the structures disclosed herein , it is not confined to the details set forth and this application is intended to cover such modifications or changes as may come within the purpose of the improvements or the scope of the following claims . this application claims priority from japanese patent application no . 329379 / 2006 filed dec . 6 , 2006 , which is hereby incorporated by reference herein . | 1 |
the present disclosure is directed to systems and methods for personalizing prosthetic and orthotic devices . many specific details of certain embodiments in accordance with the present disclosure are set forth in the following description and in fig1 - 27 to provide a thorough understanding of such embodiments . one skilled in the art , however , will understand that the present invention may have additional embodiments , or that the invention may be practiced without several of the details described in the following description . fig1 is a flowchart showing a method 100 of personalizing prosthetic or orthotic devices in accordance with an embodiment of the present disclosure . more specifically , in at least some embodiments , the method 100 may include painting carbon braid , nylon , co - poly , poly - pro , and / or other common trade specific plastics used as substrates for prosthetic sockets and orthosis ( a . k . a . orthotic braces ), however , in alternate embodiments , other types and compositions of prosthetic and orthosis may be personalized . as shown in fig1 , in this embodiment , the method 100 includes : ( a ) pre - clean with ppg acryi - clean ppg product or rubbing alcohol ( at 102 ); ( b ) dry sand prosthetic braided carbon substrate with 320 grit dry sandpaper , mirka or 3m ( at 104 ); ( c ) 2 - 3 coats of high 5 filler primer ( waiting 10 - 20 minutes in between coats ) ( at 106 ) note : braided carbon substrate would also accept a primer base coat ppg k - 36 product ; ( d ) wet sand primer with 600 - 800 grit wet or dry sandpaper , mirka or 3m ( at 108 ) ( e ) base coat ( base color ) with customer chosen color , ppg brand paint — apply 2 - 3 coats with dbc basecoat , waiting 5 - 10 minutes between coats ( at 110 ) ( f ) apply clear coats — ppg 2042 high solids clear / mixed with dcx61 catalyst and 870 reducer ( at 112 ); ( g ) optional step : then apply an inter - coat with 1 or 2 coats of ppg dbc 500 product with catalyst ( at 114 ); in at least some embodiments , dcb is an additional prep hardener with catalyst that may need to be applied over the previous coat of 2042 ; basically , a form of prep prior to airbrushing artwork ; ( h ) wet sand after application of inter - coats ( at 116 ); ( i ) apply art work using dbc and / or house of candy color dyes ( at 118 ); the applying at 118 may include airbrushing and / or hand - painting ; and ( j ) apply clear coats — ppg 2042 high solids clear / mixed with dcx61 catalyst and 870 reducer ( at 120 ). as noted above , the applying of personalizing artwork at 118 may include airbrushing and / or hand - painting . no conventional methods of personalizing prosthetic or orthotic devices are known that include airbrushing and / or hand - painting as disclosed herein . in addition , in some embodiments , methods in accordance with the teachings of the present disclosure may use one or more of automotive dyes , paints , or concentrated colored pigments which may be mixed into an acrylic resin and installed during fabrication , and can be used on orthotic and prosthetic devices ( e . g . devices shown in fig2 - 10 ). embodiments of methods in accordance with the present disclosure may advantageously provide an option to a “ wearer ” for an opportunity to personalize a prosthetic socket or orthotic “ orthosis ” brace that is otherwise not available in the market . for example , in some embodiments , a wearer may provide their individual choice of personalization artwork ( e . g . clip art , graphics , personal camera photos and portrait photos in jpeg , png , gif , tif etc .) for application onto a device , thus allowing a wearer to choose their own custom “ tattoo ” or personalization . more specifically , in some embodiments , a file containing personalization artwork provided by a wearer may be modified ( e . g . using photoshop or other suitable software ) to create a collage or other specified design full prints by means of , for example , “ sublimation printing ” ( or other suitable sub - process ) on a material ( e . g . polyester or cotton fabric for prosthetics and transfer paper custom paper prints to be applied on various plastic types as shown in fig2 thru fig1 ). a particular size of the material may vary depending on the particular device ( e . g . prosthetic , brace , etc .) being personalized ( typically sizes ranging in 12 ″ sq . up to 36 ″ sq . have been found to be suitable ). in some embodiments , the resulting custom “ tattoo ” fabric and / or paper prints may be shipped to the wearer or prosthetist to apply when a new device is being fabricated . it will be appreciated that one or more of the above - referenced actions of the method 100 may be optional ( even if not expressly stated above ) and may be omitted without departing from the spirit and scope of the invention . fig2 is a front isometric view of an exemplary above - knee prosthetic device 200 in accordance with an embodiment of the present disclosure . fig3 is a front isometric view of an exemplary below - knee prosthetic device 220 in accordance with an embodiment of the present disclosure . fig4 is a front isometric view of an exemplary upper - extremity prosthetic device 240 in accordance with an embodiment of the present disclosure . fig5 shows a front isometric view ( s ) of an exemplary orthotic brace 260 in accordance with an embodiment of the present disclosure . fig6 shows a front isometric view of another exemplary orthotic brace 280 in accordance with an embodiment of the present disclosure . fig7 shows a front isometric view ( s ) of yet another exemplary orthotic brace 300 in accordance with an embodiment of the present disclosure . fig8 shows a front isometric view ( s ) of yet another exemplary orthotic brace 320 in accordance with an embodiment of the present disclosure . fig9 shows a front isometric view of another exemplary orthotic brace 340 in accordance with an embodiment of the present disclosure . fig1 shows a front isometric view of still another exemplary orthotic brace 360 in accordance with an embodiment of the present disclosure . fig1 shows isometric views of various exemplary personalizations and / or designs of prosthetic or orthotic devices in accordance with alternate embodiments of the present disclosure . more specifically , fig1 shows an embodiment of a first ( or “ waves ”) personalization 400 , an embodiment of a second ( or “ real flames ”) personalization 420 , an embodiment of a third ( or “ termi - nator or bio - mechanical design with gears ”) personalization 440 , an embodiment of a fourth ( or “ sky ”) personalization 460 , and an embodiment of a fifth ( or “ fiery flames ”) custom fabric tattoo personalization 480 . in the embodiments shown in fig1 , personalizations 420 and 440 are examples of personalizations that have been performed by methods that include one or more of airbrushing and hand - painting . fig1 shows an isometric view of another exemplary personalization and / or design of a prosthetic or orthotic device in accordance with an embodiment of the present disclosure . more specifically , fig1 shows an embodiment of a “ purple heart ” personalization 500 . fig1 shows an isometric view of another exemplary personalization and / or design of a prosthetic or orthotic device in accordance with another embodiment of the present disclosure . more specifically , fig1 shows an embodiment of a “ liberty ” personalization 520 . fig1 shows an isometric view of yet another exemplary personalization and / or design of a prosthetic or orthotic device in accordance with another embodiment of the present disclosure . more specifically , fig1 shows an embodiment of an “ eagle and flag ” personalization 540 . fig1 shows an isometric view of another exemplary personalization and / or design of a prosthetic or orthotic device in accordance with another embodiment of the present disclosure . more specifically , fig1 shows an embodiment of a “ rose and heart ” personalization 560 . fig1 shows an isometric view of another exemplary personalization and / or design of a prosthetic or orthotic device in accordance with another embodiment of the present disclosure . more specifically , fig1 shows an embodiment of a leather arizona brace ankle - foot - orthosis a . k . a afo with ( or without ) poly - propelyne , copoly or polypro plastic interface with “ embroidery of gtopi logo ” personalization 580 . fig1 shows an isometric view of another exemplary personalization and / or design of a prosthetic or orthotic device in accordance with another embodiment of the present disclosure . more specifically , fig1 shows an embodiment of a “ mechanical ” personalization 600 . fig1 shows an isometric view of another exemplary personalization and / or design of a prosthetic or orthotic device in accordance with a further embodiment of the present disclosure . more specifically , fig1 shows an embodiment of the first protocol “ real flames ” personalization 640 . fig1 shows an isometric view of another exemplary personalization and / or design of a prosthetic or orthotic device in accordance with an embodiment of the present disclosure . more specifically , fig1 shows an embodiment of the second protocol “ termi - nator or bio - mechanical design with gears ” personalization 660 . fig2 shows an isometric view of another exemplary personalization and / or design of a prosthetic or orthotic device in accordance with another embodiment of the present disclosure . more specifically , fig2 shows an embodiment of a a first type of “ 3d fiberglass mold of gecko ” personalization 680 . in at least some embodiments , the “ 3d fiberglass mold of gecko ” personalization 680 involves applying a molded or shaped three - dimensional ( 3d ) piece of artwork that is secured onto the prosthetic or orthotic device . for example , in some embodiments , the 3d piece of artwork is epoxied and placed onto the substrate ( whether it be carbon braid or painted surface ). of course , other suitable methods of securing the 3d piece of artwork may be used . fig2 - 25 show alternate isometric views of another exemplary personalization and / or design of a prosthetic or orthotic device in accordance with another embodiment of the present disclosure . more specifically , fig2 shows an embodiment of a “ chrome background ” personalization 700 . fig2 shows an enlarged partial view 702 of the “ chrome background ” personalization 700 of fig2 . fig2 - 25 show additional isometric views of a “ chrome background ” personalization 704 , 706 , 708 . in at least some embodiments , performing a “ chrome background ” personalization may include procedures substantially similar to prep and paint processes described herein , and may use materials to provide an appearance of one or more of chrome , brass , gold , silver and other metals . more specifically , in some embodiments , performing a “ chrome background ” personalization may include procedures currently available from spectrachrome ™ or cosmichrome ™. fig2 shows isometric views of various exemplary personalizations and / or designs for application to prosthetic or orthotic devices in accordance with further embodiments of the present disclosure . more specifically , fig2 shows portions of material personalized for application on a device by a wearer or third party ( e . g . subsequent to or during fabrication ). in specific embodiments , the personalized material portions shown in fig2 may be referred to as custom tattoo fabric and / or transfer paper , and may be applied to orthotic devices according to one or more methods disclosed herein . fig2 shows an embodiment of a first ( or “ waves ”) personalized material portion 710 , an embodiment of a second ( or “ bio - mechanical design ”) personalized material portion 712 , an embodiment of a third personalized material portion 714 , and an embodiment of a fourth personalized material portion 716 . in further embodiments , a method of personalizing an orthotic or a prosthetic device may include sublimation of custom transfer paper tattoo art prints , which also may be termed a custom cosmetic treatment . in some embodiments , such a sublimation process may include applying transfer paper art to an orthotic or a prosthetic device , thereby allowing personalization and printing allowing the wearer to make a personal choice or self expression with tattoo art by furnishing a personal digital camera image , clip art , three - dimensional ( 3d ) high graphic images , or other suitable art . in some embodiments , a user may make a selection from a library of pre - selected designs . in further embodiments , a print is pre - ordered by a wearer , prior to the fabrication process , and is applied by a third party ( e . g . orthotist , prosthetist , technician , etc .). the custom transfer art print can be installed onto polypro , copoly , or other plastic types . the transfer paper print may be laid on top of the plastic substrate while the plastic is still in the oven , and may become an integral part and fused to the plastic . in at least some embodiments , the installation of the transfer paper is done prior to pulling the plastic over the cast , mold or cnc carved foam and vacuum pulled during the clinical fabrication . such a method can be used at an assembly line in other non - custom manufactured plastic orthotics devices , including , but not limited to : cranial helmets , lumbar jackets , arm braces , prosthetic limbs , both upper and lower extremity fabricated limbs , knee ankle foot orthosis ( kafo ), and / or ankle foot orthosis ( afo ). such processes may be available directly to the consumer , or through a prosthetist who can preorder for a patient by special order through several “ oandp ” ( orthotic and prosthetic ) supply distribution centers . in still further embodiments , systems and methods for personalizing prosthetic and orthotic d may include choosing a wearer choosing a preselected art design or providing an image of their choice . the image may be custom modified by a graphic designer ( e . g . by means of utilizing photoshop ™) to enlarge , and / or collage the image to a specific size . a proof may be provided ( e . g . email ) to a customer for approval prior to application . after approval , the image is printed on a transfer paper , which may be similar or the same as conventional transfer paper . in at least some embodiments , the prints may be a high quality , sublimation full color image . the print may then be shipped in a mailer tube package to the wearer , and installed by the wearer or a suitable third party ( e . g . prosthetist , orthotist , oandp technician , etc .). in still further embodiments , a method in accordance with the teachings of the present disclosure may include sublimination of custom fabric tattoo art prints on oandp devices and can be applied onto upper and lower extremity prosthetic ( prostheses ) limbs and / or many suitable orthotic braces . again , such methods allow personalization and printing , allowing the wearer to make a personal choice or self expression with tattoo art by furnishing a personal digital camera image , clip art , 3d high graphic images or they make a selection from a library pre - selected designs . the custom fabric prints may be installed by third - party technicians and prosthetist and orthotist , and may be laminated with 100 % acrylic resin . in at least some embodiments , such custom fabric prints can be applied over several substrates of common materials used to fabricate prosthetic limbs and orthotic braces , including , for example , compositions of ( or including ) carbon braid , fiberglass , or nylon substrates . similarly , in at least some embodiments , such custom fabric prints may be applied to a variety of devices , including but not limited to , orthotic braces clinical custom fabricated and other pre - manufactured braces . again , in some embodiments , such processes may be available to the consumer , or through a prosthetist who can preorder for a patient by special order through several oandp supply distribution centers ( e . g . sps and cascade ), and may also be available for pre - manufactured plastic orthotic companies . devices that this method can applied to include , for example , cranial helmets , arm braces , prosthetic limbs , both upper and lower extremity fabricated limbs , knee ankle foot orthosis ( kafo ), and ankle foot orthosis ( afo ). methods that include sublimination of custom fabric tattoo art prints can also be supplied to oandp manufacturers who may fuse such a fabric over a silicone liner during a specialty manufacturing process . the silicone liner may then be used by the wearer or amputee donned and applied over the residual limb . such a method may also be supplied to oandp manufacturers , who may fuse a fabric over a silicone suspension sleeve during the specialty manufacturing process . the silicone suspension sleeves used by the wearer or amputee support and attach the prosthetic limb to the residual limb . in a further embodiment , a method may include : ( a ) choosing an image for application onto a prosthetic or orthotic device ( e . g . prosthetist , orthotist or wearer of device chooses a preselected art design or can provide an image of their choice ); ( b ) custom modifying the image ( e . g . a graphic designer modifying the image by means of utilizing photoshop to enlarge , collage the image to a specific size ); ( c ) determining a size of the image to be applied based on dimensions of the device ( e . g . height and width of image to be applied based on the height and circumference of the device ); ( d ) providing the final image to the customer for approval ( e . g . via email ); and ( e ) after approval , the print is printed on a suitable fabric ( e . g . 97 % cotton with 3 % spandex , cotton / polyester blend with a 3 % spandex , etc .). in at least some embodiments , the material may be permeable to allow for the 100 % acrylic resin to fuse and saturate through the fabric when laminated over typical substrates . in at least some embodiments , the print may be a high quality , sublimation full color image . one or more additional prints may be supplied on each order that can be used on their next fabricated assistive device . the method may further include ( e ) providing the final print to the customer ( e . g . the print may be shipped in a mailer package to the wearer ), and ( f ) installing the print on an orthotic or prosthetic device ( e . g . by third party prosthetist , orthotist , oandp technician , etc . or by the wearer ). in further embodiments in accordance with the teachings of the present disclosure , methods and apparatus for personalizing an orthotic or prosthetic device may include disposing a global positioning system ( gps ) locator in or on the device . such a gps locator may advantageously assist in locating a prosthetic limb device in the event it is stolen or lost . in some embodiments , a gps transmitter chip may be installed by the prosthetic limb manufacturer during the assembly . alternately , a gps transmitter chip may be available as an after - market add on that can be installed to existing prosthetic limbs ( e . g . by the wearer or by a prosthetist or oandp technician ) at the clinical level . in some embodiments , a transmitter chip is placed onto the prosthetic device and attached with epoxy or other bonding agent or method to the prosthetic limb substrate . each transmitter may have a serial number and may be monitorable by a third party . in some embodiments , for example , a subscription with a monitoring company ( e . g . lojack ) may be activated by the wearer , or by a health insurance company or the entity or provider who purchases a gps locator for prosthetic limbs security system . in further embodiments in accordance with the teachings of the present disclosure , methods and apparatus for personalizing an orthotic or prosthetic device may include providing one or more lights on the device . for example , in some embodiments , a light assembly may have a light emitting portion ( e . g . led or the like ), a protective cover ( e . g . lens ), a power unit ( e . g . battery ), and may be attached to the orthotic or prosthetic device using a bonding agent ( e . g . epoxy , peel and stick contact paper , etc .). in at least some embodiments , the light may be a blinking on and off alternating flashing light which is activated only by motion . fig2 shows views of various exemplary lights and / or designs for application to prosthetic or orthotic devices in accordance with further embodiments of the present disclosure . lighting devices in accordance with the teachings of the present disclosure may vary in size depending on the shape of object ( e . g . average size 1 cm , 1 . 5 cm , or ½ ″- ¾ ″, etc .). lights may be applied in various quantities and mixed or single shapes . it will be appreciated that the detailed descriptions of the above embodiments are not exhaustive descriptions of all embodiments contemplated by the inventor to be within the scope of the invention . indeed , it will be recognized that certain aspects or elements of the above - described embodiments may variously be combined or eliminated to create further embodiments , and such further embodiments fall within the scope and teachings of the invention . it will also be apparent to those of ordinary skill in the art that the above - described embodiments may be combined in whole or in part to create additional embodiments within the scope and teachings of the present disclosure . accordingly , the scope of the invention should be determined from the following claims . | 8 |
the present disclosure describes a dip and dip installation process that may be used in conjunction with fasteners to assemble a frame joint from component members . in one embodiment , the clip may be used to join a stile and rail of a door or window frame , e . g ., made from hollow members , such as extrusions made from aluminum alloy . the clip may be used to align vertical and horizontal components relative to each other , allowing them to be joined at the proper angle . the clip may be used to join members of various lengths , such as tall / short top and bottom rails , allowing a variety of structures to be assembled using a common clip , e . g ., to produce a variety of frames of different dimensions . the clip may be made from plastic , aluminum or steel depending on the strength needed for the joint connection . in those applications where high strength , low cost and formability are required , steel can be used . progressive , one - piece steel stamping designs are presented herein , but fabricated steel , machined aluminum , machined plastic , extruded or cast aluminum and extruded or cast plastics could also be used for forming the clip . the present disclosure includes clip installation methods that could be categorized as : inside mounting , outside mounting or slide - in mounting . in one embodiment , the clip may be attached to the members to be joined through the use of blind fasteners . the fastener dimensions may be selected to provide the required strength for the application and may be set using a hydraulic or pneumatic gun , eliminating welding and the inherent heat related problems that it creates . other types of fasteners can be used for attachment , such as screws , bolts , rivets , spot welds , etc . typically , the use of the clip and methods of the present disclosure allow a reduction in the number of parts required to join members into a frame structure over conventional approaches . the avoidance of welding may also lead to reductions in labor costs and required skill levels , assembly time , number of parts to assemble and stock , manufacturing costs , rework and scrap . the ease of assembly provided by the clip may also allow assembly to take place in the field versus in the factory . fig1 and 2 show a clip 10 for assembling members 11 , 13 ( see fig5 ) in accordance with an embodiment of the present disclosure . the clip 10 could be described as having a stacked or double l configuration with a first leg 12 having a first panel 14 , an offset 16 and a second panel 18 . a second leg 20 extends at an angle , e . g ., 90 degrees from the first panel 14 , defining the bottom portion of a first l shape and a third panel 22 depends from a reverse curve 24 , such that the third panel 22 extends parallel to the second panel 18 and in line with the first panel 14 . the offset 16 has dimensions approximating the thickness of the third panel 22 and permits the third panel 22 to be in line with the first panel 14 . a third leg 26 extends from the third panel 22 at an angle , e . g ., 90 degrees , forming in conjunction with the third panel 22 , another l shape that nests ( with a space between second leg 20 and third leg 26 ) with the l shape formed by the first leg 12 and the second leg 20 . the second leg 20 has a flattened u shaped cross - section with a central area 20 c , bends 20 b and flat portions 20 f that overall provide a stiffening function and may mate in complementary fashion with interior surfaces of the member 13 . a pair of support wings 28 extend from opposite sides of the first panel 14 with a connected portion 28 c extending at an angle , e . g ., 90 degrees relative to the first panel 14 to a bend 28 b of , e . g ., 90 degrees from which extends a lip 28 l . a similar pair of support wings 30 with portions 30 c , 30 b and 30 l extend in a similar manner from third panel 22 . holes 32 a 1 - 32 e permit the passage of fasteners ( not shown ) like rivets , screws , bolts , etc . through the clip 10 . fig3 and 4 show the installation of the clip 10 into a hollow structural member 11 that may be made , e . g ., from extruded aluminum or plastic . the member 11 has a wall 11 w with a shallow u cross sectional shape . slots s 1 , s 2 in the wall 11 w receive the second leg 20 and the third leg 26 , respectively , there through and apertures a 1 , a 2 align with apertures 32 a 1 / 32 a 2 and , 32 b of the clip 10 . because the clip 10 is inserted into the hollow member 11 and then the second leg 20 and third leg 26 are extended through the slots s 1 , s 2 , the arrangement can be designated an “ inside mount ” of the clip 10 . when fully inserted into the slots s 1 , s 2 , the support wings 28 , 30 , being complementarily shaped relative to the shallow u shaped wall 11 w , bear against the wall 11 w and / or the interior 11 i of the member 11 to resist torsional forces f 1 , f 2 ( clockwise or counterclockwise , see fig5 also ) that may be exerted on the clip 10 and members 11 , 13 . the slots s 1 , s 2 and apertures a 1 , a 2 may be punched , drilled or machined into the wall 11 w . fig5 - 8 show an assembly 34 formed from members 11 , 13 conjoined by clip 10 and fasteners 36 a - 36 e . the fasteners 36 a - 36 e may be “ blind fasteners ,” such as pop rivets that can be applied from one side of an assembly and have a head portion h , which is larger than the apertures a 1 , a 2 in member 11 ( member 13 having similar apertures ) and an expandable portion m , which is inserted through aligned apertures , e . g ., a 1 and 32 a 1 , 32 a 2 and then expanded ( by pulling on a central , breakable core pin with a swage tip ) to enlarge the expandable portion m to a dimension larger than the apertures a 1 , 32 a 1 , 32 a 2 , clamping the member 11 to the clip 10 . blind fasteners do not require access to the side of the assembly 34 opposite to the head portion h . the member 13 is similarly held to the clip 10 by the action of fasteners 36 c , 36 d and 36 e . other types of fasteners 36 may be used , such as machine or self - threading screws or bolts with mating nuts . fig9 and 10 show a clip 110 for assembling members 111 , 113 ( see fig1 ) in accordance with an embodiment of the present disclosure . the clip 110 could be described as having a stacked or double l configuration with a first leg 112 having a first panel 114 , an offset 116 and a second panel 118 . a second leg 120 extends at an angle , e . g ., 90 degrees from the first panel 114 , defining the bottom portion of a first l shape and a third panel 122 depends from a reverse curve 124 , such that the third panel 122 extends parallel to the second panel 118 offset from the plane occupied by the first panel 114 . the offset 116 has dimensions approximating the thickness of the third panel 122 plus the thickness of the member 111 ( wall 111 w ) and permits the third panel 122 to abut against the interior surface of the wall 111 w while the first panel 114 abuts the exterior surface of the wall 111 w , when the clip 110 is installed on member 111 ( see fig1 ). a third leg 126 extends from the third panel 122 at an angle , e . g ., 90 degrees , forming in conjunction with the third panel 122 , another l shape that nests ( with a space between second leg 120 and third leg 126 ) with the l shape formed by the first leg 112 and the second leg 120 . the second leg 120 has a flattened u shaped cross - section like second leg 20 of fig1 . a pair of support wings 129 extend from opposite sides of the first panel 114 extending at an angle , e . g ., 90 degrees relative to the first panel 114 . holes 132 a 1 - 132 e permit the passage of fasteners like rivets , screws , bolts , etc . through the clip 10 . additional holes , like 132 f ( only shown in fig9 and 10 ) may be made to accommodate additional fasteners . fig1 , 12 and 13 show the installation of the clip 110 into a hollow structural member 111 that may be made , e . g ., from extruded aluminum or plastic . the member 111 has a wall 111 w with a shallow u cross sectional shape . slot s 1 in the wall 111 w receives the second and third panels 118 , 122 . when the clip 110 is rotated ( counterclockwise in these views ), the support wings 129 extend into slots s 2 a and s 2 b and the aperture 132 d aligns with aperture a 1 in 111 w and apertures 132 a 1 , 132 a 2 align with aperture a 2 in wall 111 w . because the clip 110 is partially inserted into the hollow member 111 from the outside and second leg 120 , first panel 114 and third leg 126 remain on the outside of the member 111 , the arrangement can be designated an “ outside mount ” of the clip 110 . when fully inserted into the slots s 2 a , s 2 b , the support wings 129 bear against the slots s 2 a , s 2 b and / or the interior 111 i of member 111 to resist torsional forces f 1 , f 2 ( see fig4 ) that may be exerted on the clip 110 . fig1 - 16 show an assembly 134 formed from members 111 , 113 and conjoined by clip 110 and fasteners 136 a - 136 e . the fasteners 136 a - 136 e may be “ blind fasteners ,” such as pop rivets that can be applied from one side of an assembly and have a head portion h and an expandable portion m , which is inserted through the aligned apertures , e . g ., a 1 , 132 a 1 , 132 a 2 and then expanded to enlarge the expandable portion m to a dimension larger than the apertures a 1 , 132 a 1 , 132 a 2 , clamping the member 111 to the clip 110 . the member 113 is similarly held to the clip 110 by the action of fasteners 136 c , 136 d and 136 e . other types of fasteners 136 may be used , such as machine or self - threading screws or bolts with mating nuts . fig1 and 18 show a clip 210 for assembling members 211 , 213 ( see fig2 ) in accordance with an embodiment of the present disclosure . the clip 210 could be described as having an l configuration with a first leg 212 having a flattened u shaped cross section . a second leg 220 extends at an angle , e . g ., 90 degrees from the first leg 212 , defining the bottom portion of the l shape . a third panel 221 extends back from a reverse curve 223 , such that the third panel 221 extends parallel to the second leg 220 . an upright panel 225 extends from curve 227 parallel to and spaced from first leg 212 by a spacing approximating the thickness of wall 211 w and ends in curve 229 . a forth panel 226 extends from curve 229 parallel to panels 220 and 221 . the clip 210 could be described as l shaped with a u shaped element composed of panels 221 , 225 and 226 attached to the bottom leg 220 , such that the bottom portion of the l is bifurcated . a pair of support wings 228 extend from opposite sides of the first leg 212 with a connected portion 228 c extending at an angle , e . g ., 90 degrees relative to the first leg 212 to a bend 228 b of , e . g ., 90 degrees from which a lip 228 l extends . holes 232 a - 232 e 2 permit the passage of fasteners like rivets , screws , bolts , etc . through the clip 210 . fig1 and 20 show the installation of the clip 210 into a hollow structural member 211 that may be made , e . g ., from extruded aluminum or plastic . the member 211 has a wall 211 w with a shallow u cross sectional shape . a slot s 1 in the wall 211 w accommodates the clip 210 allowing the leg 220 to project from a level above that of the edge 211 e of the member 211 and allowing the apertures a 1 and a 2 to align with holes 232 a and 232 b 1 / 232 b 2 ( 232 b 2 is not visible in this view ). the slot s 1 may extend up the wall 211 w to any selected extent , so long as the apertures a 1 , a 2 , which may occupy any selected position , are positioned to align with the apertures 232 a , 232 b 1 / 232 b 2 for given slot s 1 dimensions . because the clip 210 is slipped into the hollow member 211 via the slot and the spacing between panel 225 and leg 212 , the arrangement can be designated a “ slide mount ” of the clip 210 . when fully inserted into the slot s 1 and fastened by fasteners , as shown in fig2 , the support wings 228 , being complementarily shaped relative to the shallow u shaped wall 211 w , bear against the wall 211 w and / or the interior 2111 of the member 211 to resist torsional forces f 1 , f 2 that may be exerted on the clip 210 and / or members 211 , 213 . fig2 - 23 show an assembly 234 formed from members 211 , 213 and conjoined by clip 210 and fasteners 236 a - 236 e . the fasteners 236 a - 236 e may be “ blind fasteners ,” such as pop rivets that can be applied from one side of an assembly and have a head portion h , which is larger than the apertures a 1 , a 2 in the member 211 ( member 213 having similar apertures ) and an expandable portion m , which is inserted through the aligned apertures , e . g ., a 1 , 232 a and then expanded to enlarge the expandable portion m to a dimension larger than the aperture 232 a and clamping the member 211 to the clip 210 . the member 213 is similarly held to the clip 210 by the action of fasteners 236 c , 236 d and 236 e . other types of fasteners 236 may be used , such as machine or self - threading screws or bolts with mating nuts . fig2 and 25 show a clip 310 for assembling members 311 , 313 ( see fig2 ) in accordance with an embodiment of the present disclosure . the clip 310 could be described as having an l configuration with a first leg 312 having a stub 316 extending at an angle , e . g ., 90 degrees , from a first panel 318 . a second leg 320 extends at an angle , e . g ., 90 degrees from a second panel 322 , defining the bottom portion of the l shape , the second panel 322 depending from a reverse curve 324 extending from the first panel 318 , such that the second panel 322 extends parallel to the first panel 318 . the stub 316 extends from the first panel 318 parallel to the second leg 320 , bracing the position of the second leg relative to the second panel 322 . holes 332 a 1 - 332 d permit the passage of fasteners like rivets , screws , bolts , etc . through the clip 310 . the clip 310 features two holding tabs 317 a , 317 b that prevent the clip 310 from passing through a given slot in a hollow member when it is partially inserted therein to assemble a structure , as shall be described below . reliefs 319 a , 319 b , 321 a and 321 b at the reverse curve 324 , stub 316 and bend 323 remove the burr that is produced as a consequence of forming a bend at these locations . a burr could interfere with the insertion and rotation of the clip 310 in a close fitting slot in a member to be joined . the clip 310 is also radiused at 325 a and 325 b to facilitate insertion into a mating slot in a structural member , such as the rail of a door . fig2 , 27 and 28 show the installation of a pair of clips 310 a , 310 b into a hollow structural member 311 that may be made , e . g ., from extruded aluminum or plastic . the member 311 has a wall 311 w with a shallow u cross sectional shape . slots s 1 , s 2 in the wall 311 w receive the first legs 312 of clips 310 a , 310 b . when the clips 310 a , 310 b are inserted fully , the holding tabs 317 a , 317 b abut against the corresponding slot s 1 , s 2 , preventing the clip 310 from passing entirely through the slots s 1 , s 2 into the interior hollow 3111 of the hollow member 311 . when the clips 310 a , 310 b are rotated ( counterclockwise in these views ), the apertures 332 a 1 / 332 a 2 and 332 b 1 , 332 b 2 align with apertures a 1 , a 2 , a 3 , a 4 in wall 311 w . because the clips 310 a , 310 b are partially inserted into the hollow member 311 from the outside and second leg 320 , remains on the outside of the member 311 , the arrangement can be designated an “ outside mount ” of the clip 310 . fig2 - 31 show an assembly 334 formed from members 311 , 313 and conjoined by clips 310 a , 310 b and fasteners 336 a - 336 h . the fasteners 336 a - 336 h may be “ blind fasteners ,” such as pop rivets that can be applied from one side of an assembly . the member 313 is similarly held to the clips 310 a , 310 b by the action of fasteners 336 e - 336 h . other types of fasteners 336 may be used , such as machine or self - threading screws or bolts with mating nuts . the clips 310 a , 310 b may be used in pairs to join two members e . g ., 311 , 313 . one of the clips connects the upper part of the horizontal extrusion ( rail ) with the vertical extrusion , ( stile ), while the other clip joins the lower part of the horizontal extrusion ( rail ) with the vertical extrusion . since a pair of clips 310 a , 310 b can accommodate multiple rails of different dimensions by adjusting the position of the slots s 1 , s 2 and the resultant spacing between the clips 310 a , 310 b , the clips 310 a , 310 b could be described as “ universal .” for structures having less demanding requirements of strength and rigidity , a single clip 310 could be used to fasten two members 311 , 313 . it will be understood that the embodiments described herein are merely exemplary and that a person skilled in the art may make many variations and modifications without departing from the spirit and scope of the claimed subject matter . for example , while 90 degree assemblies are shown above , the clip 10 , 110 , 210 , 310 may have a shape other than a 90 degree l , wherein the lower portion of the l is oriented at an acute or obtuse angle relative to the upper portion of the l , so that members 11 , 13 may be joined at other than 90 degrees . all such variations and modifications are intended to be included within the scope of the appended claims . | 5 |
with reference to fig1 to 4 , the apparatus is constituted by a carousel which can rotate about a vertical central axis z and supports , on its peripheral region , a plurality of assemblies for molding frustum - shaped plastic caps ( closures ) ( see fig5 - 7 ). hereinafter , it is assumed that said caps a are composed of a frustum - shaped cup b which is provided with an internal thread c . each assembly is composed of an upper male mold half , generally designated by the reference numeral 1 , and by a lower female mold half , generally designated by the reference numeral 2 , which are mutually coaxial along an axis x which is parallel to the axis z . the female mold half 3 can be actuated against the male mold half 1 by means of a hydraulic jack , not shown . the male mold half 1 comprises a plate 3 which is screwed into a sleeve 5 by means of a tubular shank 4 ; said sleeve 5 is in turn screwed into the lower end of a hollow tube 5 a so as to form a single tubular stem 6 ( fig1 ). a pipe is inserted hermetically in the tubular shank 4 and defines a tubular interspace 8 together with the tubular stem 6 ( i . e ., with the sleeve 5 and the tube 5 a ). the sleeve 5 has , at its lower end , a portion 9 which tapers downward and is externally threaded ; the plate 3 is centered hermetically in said portion and forms , together with the tubular shank 4 , a chamber 10 which is connected to the interspace 8 through openings 11 of the tubular portion 4 . moreover , the chamber 10 , through openings 12 provided in the region of the shank 4 directly above the plate 3 , is connected to the inside of the pipe 7 . the portion 9 of the sleeve 5 and the plate 3 form the molding punch 13 , which produces the worm of the thread c inside the cap a . the upper end of the pipe 7 is connected hermetically in a seat 16 of a cylindrical body which is in turn screwed hermetically , by means of a threaded portion thereof , in a seat 15 formed at the upper end of the hollow tube 5 a . a narrow tube 17 lies coaxially inside the pipe 7 , protrudes out of the top of the pipe 7 and is inserted hermetically in a hole 18 of the body 14 . the narrow tube 17 , together with the pipe 7 , internally delimits a tubular channel 19 which is connected to the seat 16 . the lower end of the narrow tube 17 is inserted hermetically in a bush 20 ( fig3 ) which is in turn hermetically inserted in the bottom of the shank is 4 . the narrow tube 17 , through the axial hole 21 of the bush 20 , is connected to a plurality of holes 22 which are formed radially on the outside of the punch 13 through ports 23 constituted by openings provided in the centering region of the bell - shaped portion 9 between the edge of said portion and the plate 3 . the upper end of the narrow tube 17 is connected , through a hole 24 arranged diametrically to the hole 18 , to a supply of compressed air , which accordingly , after flowing through the narrow tube 17 , can exit through the radial holes 22 and the openings 23 . two axial holes 25 , 26 are formed in the body 14 , eccentrically with respect to the hole 18 , and are connected by means of couplings 27 , 28 to the delivery and the return of a coolant fluid . the hole 26 is connected to the interspace 8 , while the hole 25 is connected to the tubular channel 19 through a radial opening 29 . this provides a connection between the couplings 27 and 28 which allows recirculation of the coolant fluid . the upper portion 30 of the sleeve 5 , screwed onto the hollow tube 5 a , has a smaller diameter than the remaining portion , so as to form an external annular shoulder 31 . an axial slot 32 is formed in the portion 30 and is slidingly engaged by a key 33 which is rigidly coupled inside a tubular element 34 in which the stem 6 is slidingly guided with the portion 30 and the hollow tube 5 a . the tubular element 34 is provided with a flange 35 which is centered in a cylindrical case 37 by means of a lower annular lip 36 . the cylindrical case 37 is inserted in a cylindrical seat 38 a of a rotating body which belongs to the structure of the carousel . said body is constituted by a sort of rotating drum 38 which is mounted on a vertical shaft ( not shown ) whose axis is the rotation axis z of the carousel . the case 37 rests on the drum 38 with a shoulder 39 , so as to allow the mutual coaxial locking of the tubular element 34 and of the cylindrical case 37 by means of blocks 40 which are fastened onto the drum 38 by screws 41 . a compartment 42 is formed between the case 37 and - the tubular element 34 and accommodates a bush 43 which has an internal lip 44 at its lower end . a center bearing 45 is arranged at the top of the bush 43 and is guided between the wider portion of the case 37 and the tubular element 34 . a ring 46 of elastic material is placed between the flange 35 and the center bearing 45 , and a cylindrical spring 47 is interposed between the center bearing 45 and the lip 44 of the bush 43 . the stem 6 can move between a raised position and a lowered position . the raised position is determined by the abutment of the shoulder 31 against the lower end of the tubular element 34 by means of the lifting action applied to the stem 6 by an additional cylindrical spring 48 which rests on the flange 35 in a downward region and on a ring 49 in an upward region , said ring abutting against circular segments 50 which are recessed in a perimetric slot of the body 14 . the lowered position of the stem 6 is determined by a stationary cam 51 which , as will become apparent hereinafter from the description of the operation of the apparatus , acts on a free roller 52 which protrudes from a plate 53 which is applied to the body 14 which rests on the segments 50 . the plate 53 is provided with an arm 54 which , by means of a bearing 55 , can slide on a post 56 which rises vertically from the screw 41 on which it is screwed with the lower nut - shaped end 56 a . a sleeve 57 is accommodated in the portion of the seat 38 a arranged below the bush 43 , and its upper end is in contact with the lip 44 of the bush 43 . the sleeve 57 is supported so that it can rotate and slide axially in the seat 38 a by means of a bearing 58 and rotationally and axially supports the sleeve 5 by means of an additional bearing 59 . the sleeve 57 comprises a portion 57 a which protrudes below the drum 38 and ends with a collar 60 which is in sliding contact on the sleeve 5 and has , along its lower edge , teeth 61 for engagement on the edge of the cap a which is to be removed once molding has been completed . a bearing 63 is fixed above the collar 60 by means of a ring 62 , and a ring gear 64 is formed above said bearing . the ring gear 64 meshes with a gear 65 which can rotate , by means of a bearing 66 , on a pipe 67 which is inserted in a recess 68 of a rod 69 which passes through the drum 38 . a bolt 69 a is inserted in the pipe 67 and is screwed into the bottom of the recess 68 , on which the pipe 67 is fixed by a nut 70 . the rod 69 is mechanically connected to the sleeve 57 by a plate 71 which is fixed by the nut 70 against a collar 67 a of the pipe 67 and has a seat in which the outer ring of the bearing 63 is fixed by means of a ring 72 . accordingly , the axial movement of the rod 69 actuates the simultaneous axial movement of the sleeve 57 , while the ring gear 64 and the gear 65 remain mutually in mesh . the rod 69 can slide vertically , by means of a bearing 73 , in a jacket 74 which is inserted in a seat 75 of the drum 38 . the rod 69 protrudes upward with a shank 76 , screwed into a threaded hole of the rod 69 , and supports a cuff 78 arranged so as to be slideable on interposed bearings 77 . the cuff 78 has a shoulder 79 and is surmounted by a plate 80 which is centered on the edge of the cuff 78 with a peripheral lip 81 . a precompressed spring 82 rests on the plate 80 , and its top rests on a collar 83 of a bush 84 which is guided on a threaded end portion 76 a of the shank 76 . the collar 83 is pushed by the precompressed spring 82 against a bolt 85 which is screwed into the threaded end portion 76 a of the shank 76 so as to be able to adjust the precompression of the spring 82 . a ring 86 is screwed onto the cuff 78 until it abuts against the shoulder 79 , and a stem 87 protrudes from said ring and supports two rollers 88 and 89 . the roller 89 is engaged in a cam 90 which is rigidly coupled to the fixed structure of the apparatus and is therefore stationary with respect to the drum 38 . the roller 88 is guided in a vertical slot of a bracket ( not shown in the drawing ) which is fixed to the drum 38 and is designed to prevent the rotation of the shank 76 and of the rod 69 . the cam 90 has a circular path which is concentric to the rotation axis z of the carousel , so as to apply axial movements to the rod 69 and , by means of the connection provided by the plate 71 , to the sleeve 57 . the gear 65 meshes constantly with an idler gear 91 which is rotatably supported on a pivot 92 which protrudes downward from the drum 38 and is parallel to the rod 69 . the gear 91 , which as shown by the drawing is arranged on a rearward plane with respect to the plane of the gear 65 , has longer teeth than the gear 65 , so as to always remain in mesh with it even when the gear 65 moves away from the drum 38 in order to follow the movements of the rod 69 . a third gear 93 meshes with the gear 91 and is keyed , together with two friction wheels 94 , on a shaft 95 which is supported so that it can rotate below the drum 38 . fig3 illustrates only the upper part of the shaft 95 with the corresponding supporting bearing 96 , which is accommodated in a seat of the drum 38 . the friction wheels 94 are made of rubber - like material and are adapted to make contact with a track 97 which covers a certain angular portion outside the drum 38 and concentrically to the axis z . the track 97 is fixed , by means of bolts 98 and nuts 99 , to fixed parts 100 of the apparatus , so as to produce a radial thrust on the friction wheels 94 which is sufficient to turn them and , with them , the sleeve 57 by means of the gear train 93 , 91 and 65 . the operation of the described apparatus is as follows , during the rotation of the carousel , a dose p ( see fig1 ) of plastic material having a pasty consistency is deposited in the cavity of the female mold half 2 . during this step , the female mold half 2 is lowered with respect to the punch 13 , which by means of the spring 48 is actuated in the upward stop position determined by the abutment of the shoulder 31 of the stem 6 against the lower end of the tubular element 34 . the stationary cam 90 , which actuates the stroke of the rod 69 and therefore of the sleeve 57 , is shaped so that in this step the threaded portion 9 of the punch 13 lies below the collar 60 . by means of the hydraulic lifting of the female mold half 2 , the collar 60 abuts against an internal annular step of the female mold half 2 , the molding chamber is closed by the punch 13 and the stem 6 is lifted until the shoulder 31 abuts against the lower end of the tubular element 34 . therefore , the pressure applied to the female mold half 2 produces the gradual distribution of the plastic material in the molding chamber and the forming of the cap a ( see fig2 ). it should be observed that the thrust applied by the female mold half 2 to the collar 60 causes a movement of the bush 43 which compresses the elastic ring 46 . when the plastic material has reached an adequate hardening point , determined by feeding coolant liquid into the chamber 10 and into the chamber of the female mold half 2 , so that there is no further risk of plastic deformations , the descent of the female mold half 2 is actuated . however , when the female mold half 2 moves away , the cap a does not fall but remains attached to the punch 13 due to the thread . when the female mold half 2 has moved away and the molding assembly has again reached the position of fig1 the cam 90 actuates the descent of the rod 69 , which by means of the plate 71 draws downward with it the sleeve 57 . in this way , the collar 60 acts on the edge of the cap a which , by means of the thread , draws downward with it , with a stroke which is equal to the stroke of the rod 69 , the stem 6 ( see fig5 ), causing the compression of the spring 48 . at this point , in an appropriate angular position of the carousel , the friction wheels 94 engage the track 97 so as to start , by means of the gear train 93 , 91 , 65 and 64 , the rotation of the sleeve 57 in the direction for unscrewing the cap a from the portion 9 . the unscrewing of the cap is provided by the traction applied by the teeth 61 to the edge of the cap and by the simultaneous rise of the stem 6 caused by the return force applied by the spring 48 ( see fig7 ). since during this unscrewing step the material of the cap a has not yet solidified perfectly , in order to prevent the return force of the spring 48 from stripping the last turns of the thread , the cam 51 intervenes : by making contact with the roller 52 , said cam prevents a sudden upward movement of the stem 6 , allowing only its gradual rise as unscrewing of the cap advances ( see fig6 ). extraction of the cap from the punch 13 is conveniently facilitated by the injection of compressed air through the narrow tube 17 , the radial channels 22 and the openings 23 even before the cap unscrewing step begins . the injection of compressed air is adjusted by valve means which intervene when the female mold half 2 has separated from the punch 13 . the described apparatus is susceptible of numerous modifications and variations , all of which are within the scope of the same inventive concept . one of these is shown in fig8 in which the elements or parts that are identical or equivalent to those of the embodiment of fig1 to 4 are designated by the same reference numerals with the addition of an asterisk (*). fig8 shows the tubular stem 6 *, which supports , at its lower end , the shaped punch 13 * for forming cylindrical caps a *. the tubular stem 6 * can slide in a tubular element 34 * on which the sleeve 57 * is guided . by means of a bearing 58 *, the sleeve 57 * is guided in the provided seat of the drum 38 *. with respect to the version of fig1 to 4 , a ring gear 64 * can rotate by means of a bearing 101 on the lower portion of the sleeve 57 *, and a collar 60 * protrudes downward from said ring gear in sliding contact on the outer surface of the punch 13 *. the collar 60 * has , at the top , a circular plane 102 for contact with the lower edge of the sleeve 57 * and , in a downward region , a plurality of teeth 61 * for engagement on the edge of the cap a *. the ring gear 64 * meshes with a gear 65 * which is keyed on a tubular column 103 which is supported so that it can rotate and slide axially , by means of bearings 104 and 105 , in a guiding seat 106 of the drum 38 * which is parallel to the stem 6 * and is radially internal thereto with respect to the rotation axis z of the carousel . the tubular column 103 is driven through a plate 71 * which connects it to the sleeve 57 *. the plate 71 * has an opening for the passage of the sleeve 57 *; said opening is shaped so that its edge engages between two flanges 107 , 108 of the sleeve 57 * and produces a side - fit ( axial and rotary ) coupling with the sleeve 57 *. the angular arrangement of the sleeve 57 * with respect to the plate 71 * is provided by means of a pin 109 which is guided in a radial hole 110 of the plate 71 * and can move by acting on an external knob 111 in contrast with the action of a return spring 112 . the plate 71 * is rigidly coupled to the tubular column 103 , at the portion that lies between the gear 65 * and the lower face of the drum 38 *, by means of two thrust bearings 113 and 114 which allow the rotation of the tubular column 103 and the transfer of thrusts onto the plate 71 * and therefore onto the sleeve 57 *. the upper end of the tubular column 103 lies above the drum 38 *, and a pinion 115 is formed thereon ; said pinion is connected , by means of a gear train generally designated by the reference numeral 116 , to a source of motion . the pinion 115 has an axially extended set of teeth , so as to remain in mesh with the gears 116 during the axial movements of the tubular column 103 . a cylindrical rod 120 ( which corresponds to the parts 69 , 76 of the version of fig1 to 4 ) is rotatably supported , by means of a lower bearing 117 and an upper bearing 118 , in the tubular column 103 , and rests on the column by means of a flange 119 . the top of the rod 120 protrudes from the tubular column 103 , and a stem 87 * is radially fixed thereon and supports a follower roller 89 * of an axial cam 90 *. the cam 90 * is rigidly coupled to the fixed structure of the apparatus and is therefore stationary with respect to the drum 38 *, and its shape is circular and concentric with respect to the rotation axis z of the carousel . in order to keep the roller 89 * engaged on the profile of the cam 90 *, a roller 88 * is arranged on the stem 87 *, on the outside of the cam 90 *, and is guided in a vertical slot of a bracket ( not shown in the drawing ) which is rigidly coupled to the drum 38 * and is meant to prevent the rotation of the rod 120 . the cam 90 * positively actuates the downward movements of the sleeve 57 * only over an angle which is sufficient to remove the cap a * formed by the punch 13 *; over the remaining rotation angle , the sleeve 57 * can move upward in contrast with elastic abutment means . said means are constituted by a ring of elastic rubber - like material 46 * which is interposed between the flange 35 * of the tubular element 34 * and a center bearing 45 * which rests on a bush 43 * which is accommodated in the case 37 *. the bush 43 * has an internal lip 44 * on which a cylindrical spring 47 * rests , said spring being suitable to act against the center bearing 45 *. the operation of the described apparatus is the same as the operation of the embodiment of fig1 - 4 . in particular , when the female mold half has moved away from the punch 13 * and the cap a * is still attached to said punch , the cam 90 * actuates the descent of the rod 120 and starts the rotation of the tubular column 103 by means of the gear train 116 , so that the collar 60 * performs a descent and rotation which cause the unscrewing of the cap a * from the punch 13 *. it should be observed that the axial thrust on the rod 120 , actuated by the cam 90 * and transmitted to the collar 60 * by means of the plate 71 * and the sleeve 57 *, acts on the cap a *, which is actuated downward , drawing with it the punch 13 * and the stem 6 * and compressing the return spring 48 *. however , the simultaneous rotation of the collar 60 * causes the rotation of the cap a *, which by unscrewing from the punch 13 * allows it to rise due to the return force applied by the spring 48 *. a further embodiment of the present invention , shown in fig9 and 10 , has , instead of the track 97 , a toothed sector 121 which lies concentrically to the axis z and is such as to mesh directly with the gear 93 only at the rotation angle of the carousel in which unscrewing of the cap is provided . in order to allow meshing with the toothed sector 121 , the gear 93 supports a free roller 122 which is eccentric with respect to the rotation axis of the gear 93 and which , at the beginning of the toothed sector 121 , moves along an entry cam 123 which is shaped so as to turn the gear 93 so that its teeth can mesh with those of the toothed sector . likewise , at the exit of the toothed sector 121 a further cam 124 orientates the gear 93 in the angular position that allows the roller 122 to mate with the cam 123 . the kinematic connection of the toothed sector 121 with the gear 93 can be achieved , instead of directly as above - described , by means of an auxiliary gear which is keyed on the shaft 95 above the gear 93 . the disclosures in italian patent application no . bo2000a000256 from which this application claims priority are incorporated herein by reference . | 8 |
aspect 1 . a cellular population capable of inhibiting cancer , said cellular population modulated to express lower levels of nr2f6 as compared to non - manipulated cellular population , wherein said lower level of nr2f6 is associated with augmentation of il - 17 , wherein said il - 17 production is associated with reduction of tumor activity . aspect 2 . the cellular population of aspect 1 , wherein said cellular population capable of inhibiting cancer is an immune cell . aspect 3 . the cellular population of aspect 2 , wherein said immune cell is a t cell . aspect 4 . the cellular population of aspect 3 , wherein said t cell is activated with a mitogenic signal . aspect 5 . the cellular population of aspect 3 wherein said t cell possesses phosphorylated immunoreceptor signalling motifs ( itams ) aspect 6 . the cellular population of aspect 1 , wherein said il - 17 production is associated with activation of macrophages . aspect 7 . the cellular population of aspect 6 , wherein said activation of macrophages occurs in tumor associated macrophages . aspect 8 . the cellular population of aspect 7 , wherein said tumor associated macrophages express the enzyme arginase . aspect 9 . the cellular population of aspect 7 , wherein said tumor associated macrophages express the enzyme indolamine 2 , 3 deoxygenase . aspect 10 . the cellular population of aspect 8 , wherein said arginase expression is reduced by said il - 17 produced by said cellular population capable of inhibiting cancer . aspect 11 . the cellular population of aspect 9 , wherein said arginase expression is reduced by said il - 17 produced by said cellular population capable of inhibiting cancer . aspect 12 . the cellular population of aspect 1 , wherein said il - 17 production is associated with activation of neutrophils . aspect 13 . the cellular population of aspect 12 , wherein said activation of neutrophils is associated with il - 8 production . aspect 14 . the cellular population of aspect 12 , wherein said activation of neutrophils is associated with reduction of apoptosis of said neutrophils . aspect 15 . the cellular population of aspect 12 , wherein said activation of neutrophils is associated with enhanced ability to perform antibody associated cellular cytotoxicity . aspect 16 . the cellular population of aspect 12 , wherein said activation of neutrophils is associated with increased tumor cytotoxicity . aspect 17 . the cellular population of aspect 12 , wherein said activation of neutrophils is associated with decreased ability to secrete vegf . aspect 18 . the cellular population of aspect 12 , wherein said activation of neutrophils is associated with decreased ability to secrete egf . aspect 19 . the cellular population of aspect 12 , wherein said activation of neutrophils is associated with decreased ability to secrete pdgf . aspect 20 . the cellular population of aspect 1 , wherein said cellular population possesses ability to selectively migrate to hypoxic areas of the body . aspect 21 . the cellular population of aspect 20 , wherein said cellular population is capable of migrating to sdf - 1 aspect 22 . the cellular population of aspect 20 , wherein said cellular population is capable of migrating to cxcl - 10 . aspect 23 . the cellular population of aspect 21 , wherein said population expresses the receptor cxcr4 . aspect 24 . the cellular population of aspect 22 , wherein said population expresses the receptor cxcr3 . aspect 25 . the cellular population of aspect 20 , wherein said population is capable of migrating to vegf . aspect 26 . the cellular population of aspect 20 , wherein said population is capable of migrating towards angiopoietin . aspect 27 . the cellular population of aspect 1 , wherein said cellular population is peripheral blood mononuclear cells . aspect 28 . the cellular population of aspect 1 , wherein said cellular population is a lymphocyte . aspect 29 . the cellular population of aspect 1 , wherein said cellular population is a t cell . aspect 30 . the cellular population of aspect 1 , wherein said t cell is a cd4 cell . aspect 31 . the cellular population of aspect 30 , wherein said t cell is a th1 cell aspect 32 . the cellular population of aspect 31 , wherein said th1 cell is capable of secreting higher amounts of interferon gamma and less amounts of il - 4 , as compared to naïve t cells . aspect 33 . the cellular population of aspect 31 , wherein said th1 cells express higher amounts of stat4 as compared to naïve t cells . aspect 34 . the cellular population of aspect 31 , wherein said th1 cells express lower amounts of stat6 as compared to naïve t cells . aspect 35 . the cellular population of aspect 31 , wherein said th1 cells express higher amounts of t - bet as compared to naïve t cells . aspect 37 . the cellular population of aspect 29 , wherein said t cell is a naïve t cell . aspect 38 . the cellular population of aspect 29 , wherein said t cell is a gamma delta t cell . aspect 39 . the cellular population of aspect 29 , wherein said t cell is an nkt cell . aspect 40 . the cellular population of aspect 29 , wherein said t cell is a t regulatory cell . aspect 41 . the cellular population of aspect 40 , wherein said t regulatory cell is capable of suppressing proliferation of a naïve t cell activated with cd3 and cd28 binding antibodies . aspect 42 . the cellular population of aspect 40 , wherein said t regulatory cell is capable of suppressing maturation of dendritic cells . 43 . the cellular population of claim 42 , wherein said maturation is dendritic cells is upregulation of molecules selected from a group comprising of : cd80 ; cd40 ; cd86 ; and hla ii . aspect 44 . the cellular population of aspect 40 , wherein said t regulatory cell possesses expression of gitr ligand . aspect 45 . the cellular population of aspect 40 , wherein said t regulatory cell expresses neuropilin - 1 . aspect 46 . the cellular population of aspect 40 , wherein said t regulatory cell expresses ctla - 4 . aspect 47 . the cellular population of aspect 40 , wherein said t regulatory cell expresses cd25 . aspect 48 . the cellular population of aspect 40 , wherein said t regulatory cell expresses cd105 . aspect 49 . the cellular population of aspect 40 , wherein said t regulatory cell expresses membrane bound tgf - beta . aspect 50 . the cellular population of aspect 40 , wherein said t regulatory cell produces il - 10 . aspect 51 . the cellular composition of aspect 1 , wherein said inhibition of nr2f6 is achieved by means selected from a group comprising of : a ) antisense oligonucleotides ; b ) induction of rna interference ; c ) small molecule inhibitors ; d ) aptamers ; e ) gene - editing ; f ) ribozymes ; and g ) decoy oligonucleotides . aspect 52 . the cellular population of aspect 51 , wherein said antisense oligonucleotides are capable of blocking expression of nr2f6 through activation of rnase h . aspect 53 . the cellular population of aspect 52 , wherein said antisense oligonucleotides are 12 to 30 nucleotide bases in length and having a nucleotide sequence that is at least 90 % complementary to an equal length portion of the human nr2f6 gene but not to other sequences throughout the human genome . aspect 54 . the cellular population of aspect 52 , wherein wherein at least one internucleoside linkage is a modified internucleoside linkage . aspect 55 . the cellular population of aspect 54 , wherein each internucleoside linkage is a phosphorothioate internucleoside linkage . aspect 56 . the cellular population of aspect 53 , wherein at least one nucleoside comprises a modified sugar . aspect 57 . the cellular population of aspect 56 , wherein at least one modified sugar is a bicyclic sugar . aspect 58 . the cellular population of aspect 57 , wherein the at least one bicyclic sugar comprises a 4 ′- ch ( ch . sub . 3 )- o - 2 ′ bridge . aspect 59 . the cellular population of aspect 53 , wherein at least one modified sugar comprises a 2 ′- o - methoxyethyl . aspect 60 . the cellular population of aspect 53 , wherein at least one said nucleobase is a modified nucleobase . aspect 61 . the cellular population of aspect 60 , wherein the modified nucleobase is a 5 - methylcytosine . aspect 62 . the cellular population of aspect 51 , wherein said rna interference is induced by administration of a compound selected from a group comprising of : a ) single - stranded small interfering molecules ( ss - sirna ); b ) short interfering rna ( sirna ); c ) mirna ; and d ) short hairpin rna ( shrna ). aspect 63 . the cellular population of aspect 62 , wherein the sequence of said ss - sirna molecule is sufficiently complementary to the human nr2f6 mrna sequence to direct target - specific rnai and wherein the 5 ′ nucleotide is 5 ′ phosphorylated or is capable of being 5 ′ phosphorylated in situ or in vivo . aspect 64 . the cellular population of aspect 63 , wherein said ss - sirna is sufficiently complementary to a target nr2f6 mrna , said target nr2f6 mrna specifying the amino acid sequence of said nr2f6 protein . aspect 65 . the cellular population of aspect 64 , wherein said ssrna is modified such that said ss - sirna has increased in situ or in vivo stability as compared to a corresponding unmodified ss - sirna . aspect 66 . the cellular population of aspect 65 , wherein said modified ss - sirna is modified by the substitution of at least one nucleotide with a modified nucleotide . aspect 67 . the cellular population of aspect 66 , wherein in said ss - sirna the modified nucleotide is a sugar - modified nucleotide . aspect 68 . the cellular population of aspect 62 , wherein said sirna comprising a sense strand and an antisense strand , wherein the antisense strand has a sequence sufficiently complementary to a nr2f6 target mrna sequence to direct target - specific rnai . aspect 69 . the cellular population of aspect 62 , wherein said sirna comprising a sense strand and an antisense strand , wherein the antisense strand has a sequence sufficiently complementary to a nr2f6 target mrna sequence to direct target - specific rnai and wherein the sense strand or antisense strand is modified by the substitution of at least one internal nucleotide with a modified nucleotide , such that in vivo stability is enhanced as compared to a corresponding unmodified sirna or such that the target efficiency is enhanced compared to a corresponding unmodified sirna . aspect 70 . the cellular population of aspect 69 , wherein the modified nucleotide is selected from the group consisting of ( a ) a sugar - modified nucleotide , ( b ) a nucleobase - modified nucleotide , ( c ) a 2 ′- deoxy ribonucleotide and is present within the sense strand ( d ) a 2 ′- fluoro modified ribonucleotide , ( e ) a modified nucleotide is selected from the group consisting of a 2 ′- fluoro , 2 ′- amino and 2 ′- thio modified ribonucleotide , ( f ) modified nucleotides which are a 2 ′- fluoro modified ribonucleotide ( e . g ., 2 ′- fluoro uridine or 2 ′- fluoro cytidine ) and a 2 ′- deoxy ribonucleotide ( e . g ., 2 ′- deoxy adenosine or 2 ′- deoxy guanosine ), ( g ) a modified nucleotide is selected from the group consisting of 2 ′- fluoro - cytidine , 2 ′- fluoro - uridine , 2 ′- fluoro - adenosine , 2 ′- fluoro - guanosine , 2 ′- amino - cytidine , 2 ′- amino - uridine , 2 ′- amino - adenosine , 2 ′- amino - guanosine and 2 ′- amino - butyryl - pyrene - uridine , ( h ) modified nucleotide is selected from the group consisting of 5 - bromo - uridine , 5 - iodo - uridine , 5 - methyl - cytidine , ribo - thymidine , 2 - aminopurine , 5 - fluoro - cytidine , and 5 - fluoro - uridine , 2 , 6 - diaminopurine , 4 - thio - uridine ; and 5 - amino - allyl - uridine , or ( i ) a backbone - modified nucleotide . ( e . g ., contains a phosphorothioate group ). aspect 71 . the cellular population of aspect 69 , wherein the modified nucleotide is a backbone - modified nucleotide that contains a phosphorothioate group . aspect 72 . the cellular population of aspect 69 , wherein the sense strand is crosslinked to the antisense strand or wherein a 3 ′ oh terminus of the sense strand or antisense strand is modified . aspect 73 . the cellular population of aspect 69 , wherein said sirna is between about 10 and 50 residues in length , between about 15 and 45 residues in length , between about 20 and 40 residues in length , or between about 18 and 25 residues in length . aspect 74 . the cellular population of aspect 69 , wherein one strand of said sirna is comprised of the nucleotide sequence : 5 ′- gat ccg cat tac ggt gtc ttc acc ttc aag aga ggt gaa gac acc gta atg ctt ttt tct aga g - 3 ′ aspect 75 . the cellular population of aspect 69 , wherein one strand of said sirna is comprised of the nucleotide sequence : 5 ′- gat ccg cct ctg gac acg taa cct att caa gag ata ggt tac gtg tcc aga ggt ttt ttc tag ag - 3 ′. aspect 76 . a method of generating a tumor killing population of cells comprising admixing nr2f6 inhibited t cells with monocytes , allowing said t cells to induce monocyte activation and said monocytes to feedback activatory signals to said t cells . aspect 77 . the method of aspect 76 , wherein said monocytes are type 1 monocytes . aspect 78 . the method of aspect 76 , wherein said monocyte activatory signal produced by said t cells is il - 17 . aspect 79 . the method of aspect 76 , wherein said t cell activatory signal produced by said monocyte is il - 12 . the invention provides inhibition of nr2f6 as a means of stimulating antitumor activity through production of il - 17 . in one embodiment , il - 17 produced in response to downregulation of nr2f6 causes an increase in macrophage cytotoxic activity to tumor cells , upregulation of nk tumor cytotoxicity , and reduction of tumor volumes as a result of direct t cell cytotoxicity . the term “ oligonucleotide ” is intended to include unmodified dna or rna or modified dna or rna . for example , the nucleic acid molecules or polynucleotides of the disclosure can be composed of single - and double stranded dna , dna that is a mixture of single - and double - stranded regions , single - and double - stranded rna , and rna that is a mixture of single - and double - stranded regions , hybrid molecules comprising dna and rna that may be single - stranded or , more typically double - stranded or a mixture of single - and double - stranded regions . in addition , the nucleic acid molecules can be composed of triple - stranded regions comprising rna or dna or both rna and dna . the nucleic acid molecules of the disclosure may also contain one or more modified bases or dna or rna backbones modified for stability or for other reasons . “ modified ” bases include , for example , tritiated bases and unusual bases such as inosine . a variety of modifications can be made to dna and rna ; thus “ nucleic acid molecule ” embraces chemically , enzymatically , or metabolically modified forms . the term “ polynucleotide ” shall have a corresponding meaning . the term “ animal ” as used herein includes all members of the animal kingdom , preferably mammal . the term “ mammal ” as used herein is meant to encompass , without limitation , humans , domestic animals such as dogs , cats , horses , cattle , swine , sheep , goats , and the like , as well as wild animals . in an embodiment , the mammal is human . the term “ interfering rna ” or “ rnai ” or “ interfering rna sequence ” refers to double - stranded rna ( i . e ., duplex rna ) that targets ( i . e ., silences , reduces , or inhibits ) expression of a target gene ( i . e ., by mediating the degradation of mrnas which are complementary to the sequence of the interfering rna ) when the interfering rna is in the same cell as the target gene . interfering rna thus refers to the double stranded rna formed by two complementary strands or by a single , self - complementary strand . interfering rna typically has substantial or complete identity to the target gene . the sequence of the interfering rna can correspond to the full length target gene , or a subsequence thereof . interfering rna includes small - interfering rna ” or “ sirna ,” i . e ., interfering rna of about 15 - 60 , 15 - 50 , 15 - 50 , or 15 - 40 ( duplex ) nucleotides in length , more typically about , 15 - 30 , 15 - 25 or 19 - 25 ( duplex ) nucleotides in length , and is preferably about 20 - 24 or about 21 - 22 or 21 - 23 ( duplex ) nucleotides in length ( e . g ., each complementary sequence of the double stranded sirna is 15 - 60 , 15 - 50 , 15 - 50 , 15 - 40 , 15 - 30 , 15 - 25 or 19 - 25 nucleotides in length , preferably about 20 - 24 or about 21 - 22 or 21 - 23 nucleotides in length , and the double stranded sirna is about 15 - 60 , 15 - 50 , 15 - 50 , 15 - 40 , 15 - 30 , 15 - 25 or 19 - 25 preferably about 20 - 24 or about 21 - 22 or 21 - 23 base pairs in length ). sirna duplexes may comprise 3 ′ overhangs of about 1 to about 4 nucleotides , preferably of about 2 to about 3 nucleotides and 5 ′ phosphate termini . the sirna can be chemically synthesized or maybe encoded by a plasmid ( e . g ., transcribed as sequences that automatically fold into duplexes with hairpin loops ). sirna can also be generated by cleavage of longer dsrna ( e . g ., dsrna greater than about 25 nucleotides in length ) with the e . coli rnase iii or dicer . these enzymes process the dsrna into biologically active sirna . ( see , e . g ., yang et al ., pnas usa 99 : 9942 - 7 ( 2002 ); calegari et al ., pnas usa 99 : 14236 ( 2002 ); byrom et al ., ambion tech notes 10 ( 1 ): 4 - 6 ( 2003 ); kawasaki et al ., nucleic acids res . 31 : 981 - 7 ( 2003 ); knight and bass , science 293 : 2269 - 71 ( 2001 ); and robertson et al ., j . biol . chem . 243 : 82 ( 1968 )). preferably , dsrna are at least 50 nucleotides to about 100 , 200 , 300 , 400 or 500 nucleotides in length . a dsrna may be as long as 1000 , 1500 , 2000 , 5000 nucleotides in length , or longer . the dsrna can encode for an entire gene transcript or a partial gene transcript . the term “ sirna ” refers to a short inhibitory rna that can be used to silence gene expression of a specific gene . the sirna can be a short rna hairpin ( e . g . shrna ) that activates a cellular degradation pathway directed at mrnas corresponding to the sirna . methods of designing specific sirna molecules or shrna molecules and administering them are known to a person skilled in the art . it is known in the art that efficient silencing is obtained with sirna duplex complexes paired to have a two nucleotide 3 ′ overhang . adding two thymidine nucleotides is thought to add nuclease resistance . a person skilled in the art will recognize that other nucleotides can also be added . the term “ antisense nucleic acid ” as used herein means a nucleotide sequence that is complementary to its target e . g . a nr2f6 transcription product . the nucleic acid can comprise dna , rna or a chemical analog , that binds to the messenger rna produced by the target gene . binding of the antisense nucleic acid prevents translation and thereby inhibits or reduces target protein expression . antisense nucleic acid molecules may be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed with mrna or the native gene e . g . phosphorothioate derivatives and acridine substituted nucleotides . the antisense sequences may be produced biologically using an expression vector introduced into cells in the form of a recombinant plasmid , phagemid or attenuated virus in which antisense sequences are produced under the control of a high efficiency regulatory region , the activity of which may be determined by the cell type into which the vector is introduced . as used in this context , to “ treat ” means to ameliorate at least one symptom of the disorder . in some embodiments , a treatment can result in a reduction in tumor size or number , or a reduction in tumor growth or growth rate . examples of cellular proliferative and / or differentiative disorders include cancer , e . g ., carcinoma , sarcoma , metastatic disorders or hematopoietic neoplastic disorders , e . g ., leukemias . a metastatic tumor can arise from a multitude of primary tumor types , including but not limited to those of prostate , colon , lung , breast and origin . as used herein , the terms “ cancer ”, “ hyperproliferative ” and “ neoplastic ” refer to cells having the capacity for autonomous growth , i , e ., an abnormal state or condition characterized by rapidly proliferating cell growth . hyperproliferative and neoplastic disease states may be categorized as pathologic , i . e ., characterizing or constituting a disease state , or may be categorized as non - pathologic , i . e ., a deviation from normal but not associated with a disease state . the term is meant to include all types of cancerous growths or oncogenic processes , metastatic tissues or malignantly transformed cells , tissues , or organs , irrespective of histopathologic type or stage of invasiveness . “ pathologic hyperproliferative ” cells occur in disease states characterized by malignant tumor growth . examples of non - pathologic hyperproliferative cells include proliferation of cells associated with wound repair . the terms “ cancer ” or “ neoplasms ” include malignancies of the various organ systems , e . g ., affecting the nervous system , lung , breast , thyroid , lymphoid , gastrointestinal , and genito - urinary tract , as well as adenocarcinomas , which include malignancies such as most colon cancers , renal - cell carcinoma , prostate cancer and / or testicular tumors , non - small cell carcinoma of the lung , cancer of the small intestine and cancer of the esophagus . the term “ carcinoma ” is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas , gastrointestinal system carcinomas , genitourinary system carcinomas , testicular carcinomas , breast carcinomas , prostatic carcinomas , endocrine system carcinomas , and melanomas . in some embodiments , the disease is renal carcinoma or melanoma . exemplary carcinomas include those forming from tissue of the cervix , lung , prostate , breast , head and neck , colon and ovary . the term also includes carcinosarcomas , e . g ., which include malignant tumors composed of carcinomatous and sarcomatous tissues . an “ adenocarcinoma ” refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures . the term “ sarcoma ” is art recognized and refers to malignant tumors of mesenchymal derivation . the inhibition of nr2f6 according to the present invention can be used for immunotherapies in a cancer patient , in particular for the activation of the immune system or the innate immune system , specifically mediated by nk cells , through upregulation of il - 17 . in particular , the method according to the present invention may be employed in the patient for the treatment of cancer , the activation of nk cells according to the present invention may be combined with conventional therapies . many tumor therapies , such as radiation therapy , chemotherapy or the surgical removal of tumors have been established for years and are constantly being refined and improved . new therapies comprise immunotherapies and therapies that are directed against specific markers of tumor cells , in particular with the use of monoclonal antibodies . particularly the effect of the latter is largely dependent on the activity of nk cells that recognize the tumor cell - bound antibodies via general antibody determinants and consequently kill the tumor cell . the activation of the innate immune system via the effect of nk cells thus provides a further strategy that is able to complement and complete the already existing approaches in order to promote immune reactions on a broad scale , in particular for combating cancer cells . in particular , therapies that have a direct cytotoxic effect on tumor cells , such as chemotherapy or radiation therapy , are able to induce the expression of molecules of the mhc class and other immune - activating receptors , for example those of nkg2d ligands . these cellular changes are recognized by the cells of the innate immune system , in particular by nk cells , and lead to the activation thereof , by means of which it is possible to achieve a much stronger therapeutic effect owing to the synergy with the nk cell activation according to the present invention . preferably , the function of nr2f6 is reduced or inhibited by reducing or inhibiting the expression of nr2f6 mrna . the terms “ reduce / reduction ” or “ inhibit / inhibition ” relate to a reduction or inhibition of the function ( or expression ) of nr2f6 as compared to the unmodified natural function , optionally including the complete inhibition of said function . preferably , the function ( or expression ) is reduced by at least 30 %, 40 %, 50 %, 60 %, 70 %, 80 %, 90 % or 95 %. in preferred embodiments of the present invention , the reduction or inhibition of the function of nr2f6 is transient , i . e . the function is only temporarily reduced as described in the above and can therefore recover again , e . g . by consumption or degradation of inhibitors , such as nr2f6 sirna , or by restructuring or non - nr2f6 - impaired cells in vivo . the transient reduction of nr2f6 in immune cells can also be performed in a repetitive manner , e . g . until a therapeutic success has been achieved . preferably , the expression of nr2f6 is reduced or inhibited by the use of nr2f6 antisense rna or sirna . for this purpose , short dna and / or rna sequences that are complementary to one of the regions of the target ( nr2f6 ) mrna sequence are employed , so that hybridization and inactivation of the corresponding sequences will occur . these sequences preferably have a length of at least 15 , 18 , 20 , 22 , 25 , 28 , 30 , 35 , 40 , 50 , 60 , 70 , 80 , 90 , 100 , 120 , 140 , 160 , 180 or up to 200 bases until the length of the complete target sequence is reached , preferably up to 2500 , 2000 , 1500 , 1000 , 500 or 300 bases . preferably , the sequences of seq id nos . 1 , 2 , 3 , 4 , 5 , 6 , 7 and / or 8 are used . the function of nr2f6 can also be reduced or inhibited by a plurality of other known components , e . g . by the use of nr2f6 antagonists , inhibitors , in particular aptamers or intramers . according to the present invention , any antagonists or inhibitors that are capable of suppressing the effect or function of nr2f6 can be used to enhance the immunoreactivity of nk cells . for the inhibition of nr2f6 , substances may be used that either specifically inhibit the zinc finger activity or inhibit the intracellular association of nr2f6 with its interaction partners or inhibit the expression of nr2f6 . preferably , antagonists or inhibitors can be used for the preparation of a pharmaceutical agent for increasing the immunoreactivity of the nk cells according to the present invention . in particular augmentation of nk cells by virtue of il - 17 induction , which results in direct and indirect stimulation of nk cell activation . treatments of diseases with a suppressed or inefficient immune system , in particular cancer or chronic infections , are facilitated . according to the present invention it was found that the inhibition of nr2f6 together with further nk cell - stimulatory substances ( nk cell activators ) induces a synergistic effect that exceeds the effect that is to be expected based on the additive effects of the inhibition of nr2f6 and the activation of nk cells . therefore , the administration of the nr2f6 inhibitor or the inhibition of nr2f6 is preferably carried out together with a further nk cell - stimulatory substance ( nk cell activator ). in the following , the terms “ nk cell - stimulatory substance ”, “ nk cell - activating substance ” and “ nk cell activator ” are used interchangeably . such an nk cell - stimulatory substance is a substance that differs from the nr2f6 inhibitor according to the present invention . an nk cell - stimulatory substance according to the present invention is a substance which induces the activation or stimulation of nk cells in one or more suitable in vitro assays . preferably , the nk cell - stimulatory substance induces the production of ifn - gamma and / or tnf - alpha and / or the surface expression of cd107a by the nk cells in a manner independent of the inhibition of nr2f6 . such production of ifn - gamma and / or tnf - alpha and / or surface expression of cd107a can be measured using methods known in the art ( fauriat blood . 2010 mar . 18 ; 115 ( 11 ): 2167 - 76 ; dons &# 39 ; koi et al ., j . immunol . methods 2011 sep . 30 ; 372 ( 1 - 2 ): 187 - 95 ) or as is described in the examples of the present application . likewise , the effect of the nk cell - stimulatory agents may be tested by directly determining the cytotoxicity or “ killing activity ” of the nk cells ( as described in example 4 ; other suitable methods are well known in the art ( beano et al ., j . transl . med . 2008 may 16 ; 6 : 25 ; claus et al ., j . immunol . methods 2009 feb . 28 , 341 ( 1 - 2 ): 154 - 64 ; fujisaki et al ., cancer res . 2009 may 1 , 69 ( 9 ): 4010 - 7 ; cho et al ., clin . cancer res . 2010 aug . 1 , 16 ( 15 ): 3901 - 9 ), i . e . the cytotoxicity of nk cells and pbmcs , respectively , against specific target cells ( skbr3 tumor cells in example 4 ) is determined , e . g . by measuring the release of the enzyme ldh from the tumor cell cytosol as a measure for the degree of cell lysis . in a corresponding in vitro measurement , the nk cells are preferably activated or stimulated in order to be able to measure the effect of the inhibition of nr2f6 , e . g . by contacting with tumor cells ( e . g . k562 ) and / or by using a nk cell - stimulatory substance ( e . g . one or more cytokines , such as il - 2 and / or il - 12 ) and / or an antibody ( e . g . trastuzumab ( herceptin ®)). in a specific embodiment , the present invention relates to the co - administration of the nr2f6 inhibitor and an nk cell activator , in particular selected from an immune cell - stimulatory cytokine , e . g . a cytokine selected from the common gamma - chain cytokines , in particular il - 2 , il - 15 and il - 21 [ 13 , 14 ]; cytokines that stimulate both the cells of the adaptive and of the innate immune system , in particular il - 12 , il - 23 and il - 27 ; effector cell cytokines , such as il - 1 , il - 17 and il - 17 ; an interferon , in particular interferon - alpha ; or an interferon stimulator ; an antibody , in particular an antibody which recognizes tumor cell surface molecules and / or an antibody whose constant region is capable of binding to the corresponding fc receptor on nk cells ; or a tlr or pamp receptor ligand , in particular agonists , preferably of tlr - 1 [ 15 - 17 ], tlr - 2 [ 18 - 21 ], tlr - 3 [ 22 , 23 ], tlr - 7 [ 24 ], tlr - 8 [ 25 , 26 ], and tlr - 9 [ 27 , 28 ], as well as combinations of the above - mentioned nk cell activators . the terms “ simultaneous ” or “ together with ” or “ in combination with ” or “ combined with ” as used in the context of the administration of the substances according to the present invention refer to the administration of at least one nr2f6 inhibitor and at least one nk cell activator in a patient , which may be conducted in the form of one ( containing at least one nr2f6 inhibitor and at least one nk cell activator ) or more different pharmaceutical compositions ( one of which contains at least one nr2f6 inhibitor and the other at least one nk cell activator and optionally other pharmaceutical compositions ). if the administration is carried out using a plurality of different pharmaceutical compositions , the co - administration may be conducted simultaneously or sequentially . particularly preferably , the administration of the nr2f6 inhibitor is carried out in combination with at least one nk cell activator , in particular il - 2 , il - 15 , il - 12 , il - 23 , interferon , an interferon stimulator , imiquimod and other tlr7 / 8 agonists , e . g . resiquimod , sspolyu nucleotides , loxoribine , gardiquimod , cl075 , cl097 , cl264 , 3m002 , poly ( i : c ) oligonucleotides , cpg oligonucleotides , cd205 ligands or cd206 ligands , as well as combinations thereof . preferred combinations of nk cell activators that may be combined with the administration of the nr2f6 inhibitor comprise , e . g ., a cytokine of the common gamma - chain cytokines in combination with another of the above - mentioned nk cell activators ; or a cytokine of the both the adaptive and the innate immune system in combination with another of the above - mentioned nk cell activators . particularly preferred combinations are those involving a cytokine of the common gamma - chain cytokines and a cytokine of both the adaptive and the innate immune system , in particular il - 2 and il - 12 . according to the present invention , stimulation of anticancer immunity can be obtained by inhibition of nr2f6 while concurrently administering a cytokine of the common gamma - chain cytokines which is selected from the family of cytokines that share the so - called common cytokine receptor gamma - chain (. gamma .. sub . c or cd132 ) in their receptor complexes and consists of different members having a similar structure with four alpha - helical bundles . this family includes , e . g ., interleukin ( il )- 2 , il - 4 , il - 7 , il - 9 , il - 15 , il - 21 and thymic stromal lymphopoietin ( tslp ). an immune cell - stimulatory cytokine , a cytokine of both the adaptive and the innate immune system , an effector cell cytokine or an interferon stimulator according to the present invention are preferably selected from the group comprising il - 1 , il - 2 , il - 3 , il - 4 , il - 5 , il - 6 , il - 7 , il - 8 , il - 9 , il - 11 , il - 12 , il - 13 , il - 14 , il - 15 , il - 16 , il - 17a , il - 17f , il - 17 , il - 19 , il - 20 , il - 21 , il - 22 , il - 23 , il - 24 , il - 25 , il - 26 , il - 27 , il - 28 , il - 29 , il - 30 , il - 31 , il - 32 , il - 33 , il - 34 , il - 35 , ifn - alpha , ifn - beta , ifn - gamma , ifn - lambda , tnf - alpha and tnf - beta . in a particularly preferred embodiment , the present invention relates to the administration of a nr2f6 inhibitor in combination with il - 2 , optionally with one or more further nk cell activators , in particular il - 12 , il - 23 , ifn - alpha and / or ifn - beta . in a further particularly preferred embodiment , the present invention relates to the administration of a nr2f6 inhibitor in combination with ifn - alpha , optionally with one or more further nk cell activators , in particular il - 15 and / or il - 21 . in a further particularly preferred embodiment , the present invention relates to the administration of a nr2f6 inhibitor in combination with il - 12 , optionally with one or more further nk cell activators , in particular il - 15 and / or il - 7 . preferably , the nk cell - stimulatory substances used induce in nk cells the production of ifn - gamma and / or tnf - alpha and / or an increased surface expression of cd107a and / or an increased cytotoxicity against the target cells . ifn - alpha , il - 12 or il - 23 , for instance , induce particularly strong ifn - gamma responses in nk cells . surprisingly , it was now found that the activation of nk cells by the inhibition of nr2f6 with nk cell - stimulatory substances that induce the production of ifn - gamma evoke particularly strong synergistic effects that go far beyond the expected effect of the individual substances . preferably , the nr2f6 inhibitor is coupled to a ligand of an nk cell recognition molecule , e . g . an nk cell surface molecule . such a ligand can , for example , be a naturally occurring protein , a further biomolecule or a functional derivative thereof which is capable of binding to nk cells . in particular , such a ligand may be an antibody directed against an nk cell recognition molecule . according to the present invention , the nk cells are preferably specifically activated by the inhibition of nr2f6 in vivo , e . g . by coupling to a ligand of such an nk cell recognition molecule . the “ specific ” nk cell activation is to be understood as an effect on nk cells that is enhanced as compared to the non - specific , e . g . non - controlled or non - coupled , administration of a nr2f6 inhibitor , which may also have an effect in other cells . in particular , the “ specific ” nk cell activation is defined as an effect that is particularly directed to nk cells , as compared to the administration of a nr2f6 inhibitor alone ( without the co - administration of an nk cell activator ) or as compared to the administration of a nr2f6 inhibitor which is not coupled to a ligand of an nk cell recognition molecule . a nonspecific administration is carried out , e . g ., by simple administration of the inhibitor without an additional administration of nk cell stimulators or nk cell - specific modifications of the inhibitor achieved by coupling to an nk cell recognition molecule . by means of the specific nk cell activation it is possible to control the nk cell - mediated immune response according to the present invention ( innate immune system ) with less undesired side effects which may , e . g ., be caused by the adaptive immune system . in a further aspect , the present invention relates to a pharmaceutical composition comprising a nr2f6 inhibitor and an additional nk cell activator , as described above , in particular an immune cell - stimulatory cytokine , an interferon or an interferon stimulator , an antibody or a tlr or pamp receptor ligand . such a composition can be used for the above - mentioned purpose of inhibiting nr2f6 , either alone or in combination with further nk cell activators . nr2f6 silencing stimulates t cell 17 production in response to signal 1 and signal 2 activation peripheral blood mononuclear cells ( pbmc ) were extracted from healthy volunteers using the ficoll method . pbmc were resuspended in solution from nucleofector kit and program x - 01 following the amaxa guidelines for cellular transfection . in brief , up to 1 - 3 × 10 ( 7 ) cells where mixed with 1 . 5 mm of synthetic sirna sequences or scrambled control sequences ( dharmacon ) and were nucleofected with the amaxa nucleofector apparatus and immediately transferred into 37c prewarmed culture medium and cultured for a minimum of 24 hr before experimental analysis . cells were subsequently incubated with anti - cd3 anti - cd28 beads ( xcyte ) for 48 hours and il - 17 production was assessed by elisa . as shown in fig1 , augmentation of t cell il - 17 induced by anti - cd3 and anti - cd28 was achieved by inhibition of nr2f6 . | 2 |
throughout this description , and in the appended claims , the term “ subnet ” is intended to encompass sub - networks as defined by classless addressing . in particular , the term “ subnets ” refers to the edge of the network , i . e . “ network edge ”, that services the end user . while classless addressing allows subnets to be broken up in smaller pieces , these pieces generally service the same geographic area . it is well known that internet - connected machines which share a common subnet are typically geographically close . for example two machines with ip addresses 203 . 30 . 195 . 10 and 203 . 30 . 195 . 11 respectively , i . e . having common subnet address portions , can be reasonably expected to be geographically close or at least to service users in close geographical areas . from an implementation perspective , it is also well known that a large percentage of internet browsers use dynamic ip addresses , i . e . a personal computer will be allocated a different ip address , taken from a pool of possible addresses , each time that it connects to the internet . further , an operator of the personal computer may use different internet service providers ( isps ) to access the internet , and so be allocated a dynamic ip address from a different pool of ip addresses , at different times . fig1 , depicts the above - described scenario . with reference to fig1 , an internet user 5 makes use of personal computer 2 , to establish communication with either isp - a 4 or isp - b 6 . upon establishing communication , for example with isp - a 4 , the isp allocates an ip address ipa - ax to pc 2 . isp - a 4 then establishes communication between pc 2 and the internet 8 . according to a preferred embodiment of the present invention , a web - server 10 is provided that includes one or more processors that operate according to instructions coded in software product 11 to implement a method according to the present invention that will be described shortly . under control of software product 11 the web - server maintains a database 13 relating the identity of an operator 5 of pc 2 to its geographical location . for example , user 5 may have browsed to a webpage generated by server 10 . upon doing so webserver 10 determines pc 2 &# 39 ; s ip address from its connection with the pc and hence the subnet to which pc 2 is connected . once at the webpage user 5 may have filled in an online data - capture form presented on a web - page generated by web - server 10 that required the user to enter its location . upon doing so web - server 10 stores the user &# 39 ; s identity , e . g . username and password along with their current [ p address and geographical data in database table 12 . data such as this , which a user provides and which directly relates a subnet to a geographical location will be referred to as “ seed data ” in the present specification . suppose that some time later user 5 operates pc 2 to establish a connection to isp - b 6 so that pc 2 is allocated an ip address ( ipa ) being ipa - bx from ip address pool 9 . as before , pc 2 then browses the internet and revisits web - server 10 . upon user 5 of pc 2 logging in to the web - page presented by web - server 10 , the web - server checks to determine if ipa - bx is entered in database table 12 and , in particular , if it is already associated with the geographical location that user 5 had previously entered into the data capture form and which is also associated with ipa - bx . if ipa - ax is not already associated with the user &# 39 ; s geographical location then the subnet identifier portion of it is stored in table 12 against the geographical locale . fig2 is a flowchart of a method of operating web - server 10 according to an embodiment of the present invention . software application 11 contains instructions for one or more processors of web - server 10 to implement the method . at box 22 the web - server presents a logon web - page to user 5 of pc 2 . user 5 logs on , for example by entering a username and password . at box 24 the username is used to look up the user &# 39 ; s previously submitted geographical location from database table 12 . at box 26 a check is performed to determine if the remote user &# 39 ; s current subnet , as determined from the ip address provided by their connection to web - server 10 , is the same as previously employed by the user . if it is a different subnet address then it is recorded in table 12 against the retrieved geographical location . accordingly , table 12 has grown insofar as the approximate geographical location of another subnet has been added . it will be realised that the above method is based upon a number of assumptions . for example , the user of pc 2 is presumed to always log in with pcs that are in the same geographical locale . it is also assumed that the user submitted their correct geographical location into the data - capture form initially presented by web - server 10 so that the seed data is correct . the inventor has found that in practice these assumptions turn out to be correct in the majority of cases . furthermore , the more seed data that is collected the more readily apparent it becomes that a particular seed data entry is likely to be erroneous and so should be discarded . for example , the authenticity of a seed point of the seed data may be checked by collaboration within the seed points to determine which ones are correct . a lack of collaboration can then be taken to indicate incorrect entries . an alternative to the user supplying their location on a web form , as described above , is to deduce the user &# 39 ; s location upon them accessing web server 10 from a subnet whose location is already known . this location is then associated with the user and is referred to on further visits when the user &# 39 ; s subnet &# 39 ; s location is not known . this process may be carried out by analysing server log files ; such as , for example , those kept by an advertising server which uses cookies to identify visits from the same user . even without knowing any of the user &# 39 ; s locations the log file information can be used to group subnets that are used by the same user and hence likely to be geographically close to each other . once the subnets have been grouped it only remains to determine the geographical location of one subnet of each of these groups of subnets in order to determine the location of all of the others . those skilled in the art will understand that it is more straightforward to obtain the geographical location of some subnets than others within the same group . consequently , being able to associate a subnet whose location is known with one whose location is difficult to determine , by means of the methods described above , is highly advantageous . a further embodiment of the present invention will now be described initially with reference to fig3 . fig3 depicts a number of typical routers ra , rb , . . . , rn which each connect a cluster of subnets ca , cb , . . . , cn respectively to the internet in the usual fashion . each cluster is made up of a number of subnets . for example , cluster ca includes subnets sa 1 , sa 2 , sa 3 . the subnets of a particular cluster will tend to service a common geographical area . for example , cluster ca may service users located in houston texas whereas cluster cb may service users located in munich germany . according to an embodiment of the present invention there is also provided a web - server 30 that runs a router - to - subnet association software application 32 and maintains a database 34 having a table 35 that relates subnets to their associated router and in turn to an associated geographical location ( serviced by the router ). suppose that web - server 30 has access to seed data which identifies a user computer u 1 as being connected to subnet sa 1 , also indicates that sa 1 is located in houston and further identifies router ra as being the router that services subnet sa 1 . the identity of the subnet will be known from the connection data with web - server 30 , the geographical location of houston will have been captured when user u 1 originally filled out a data capture form presented by the web - server . the identity of router ra can be determined by a router identification method that will be explained later in the present description . subsequently another user u 2 , who is connected to subnet sa 2 and who has not hitherto been known to web - server 30 connects to the web - server . web - server 30 determines the identity of subnet sa 2 from u 2 &# 39 ; s ip address and also determines the identity of router ra . the web - server checks to see if it has an entry for ra in database table 35 . if it does then it looks up the corresponding geographical location . that geographical location is then associated with subnet sa 2 . consequently , it will be realised that if the web - server has access to seed data for a user connected to a subnet in any one of the clusters ca , cb , . . . , cn then upon another user , connected to a further subnet in the same cluster , connecting to the web - server , the further subnet &# 39 ; s geographical location can be inferred due to the fact that the two users share a common router . fig4 is a flowchart of the method that is implemented by the software application 32 that controls web - server 30 . at box 40 a connection is established between a remote user &# 39 ; s machine and web - server 30 . at box 42 the web - server determines the user &# 39 ; s subnet sx from the connection . at box 44 the web - server checks database table 35 to determine if the geographical location of subnet sx has been recently updated . if the geographical location of sx has not been recently updated , or has never been determined , then control diverts to box 46 . in the alternative the processing ends at box 45 . at box 46 the web - server determines the identity of the router rx that services subnet sx by using a method that will be described shortly . at box 48 the web - server checks to determine if there is an entry in database table 35 that relates router rx to a geographical location gx . that is , at this step a check is performed to determine whether or not a geographical service area for the router is already on record . those skilled in the art will realise that , in a minority of cases , the router &# 39 ; s physical geographical location may be different to that of the geographical location of its service area . however in practice this discrepancy has been found not to pose a problem as the router &# 39 ; s geographical service area rather than its geographical location is recorded . if there is an entry for rx then the web - server looks up its related geographical location gx and stores sx as being associated with gx in its database at box 54 . in the alternative , if there is no entry for router rx in table 35 then at box 50 the web - server simply stores sx as being associated with rx so that in future when the geographical location gx of router rx is known then subnet sx can be recorded as having geographical location gx at that time . a method for obtaining the router associated with a subnet according to an embodiment of the present invention will now be explained with reference to fig5 and the flowchart of fig6 . the method involves the use of a packet sniffer , depicted schematically as item 69 of fig5 . the packet sniffer is a virtual device created by packet sniffer software application 67 according to commonly known methods . packet sniffer 69 checks and processes ip packets 61 entering the web - server and also ip packets 63 leaving the web - server . the packets entering the web - server may have originated from remote machine usr 1 in response to that machine browsing to a web - page generated by webserver 30 . packet 101 is an example of such a packet . alternatively , the packets entering the web - server may be internet control messaging protocol ( icmp ) packets produced by routers r 1 , . . . , rn in response to packets from webserver 30 having insufficient time - to - live ( ttl ) values to reach their destination . examples of icmp packets are shown as items 103 , 105 and 107 in fig5 . packet sniffer 69 stores certain information about icmp packets in an icmp reply store 119 which is simply a database table . on the basis of the information that is stored the packet sniffer is able to determine the identity of the router r 1 closest to subnet 100 . packet sniffer application 67 is provided as a software product that bears instructions for one or more processors of web - server 30 to implement packet sniffer 69 and to cause it to execute a method , according to an embodiment of the present invention , that will now be described with reference to fig6 . at box 64 the sniffer application determines if a packet is incoming or outgoing . if the packet is incoming and is not an internet control message protocol ( icmp ) packet , for example packet 101 of fig5 , then at box 78 the sniffer application checks to determine whether or not the packets originating ip address , e . g . ipa of fig5 , and hence its subnet , is of interest . for example , if the identity of the router servicing subnet 100 of fig5 is unknown , then the originating ip address will be deemed to be of interest and the method will then proceed to box 80 . alternatively , if the originating address is not of interest then the program loops back to box 64 . at box 80 the time - to - live ( ttl ) of packet 101 is recorded along with its originating ip address , e . g . ipa , and a unique packet identifier . the process then loops back to box 64 . if at box 64 the packet being processed is an outgoing packet , e . g . packet 109 then the procedure progresses to box 66 . packet 109 , in the present example , comprises a packet generated by web - server 30 in response to the initial packet 101 from the usr 1 pc . packet 109 has a destination address ipa and contains spi data sufficient for it to be recognised by stateful routers , of routers r 1 , . . . , rn , as a legitimate packet that has been solicited by usr 1 . typically only the last few routers , e . g . router r 1 will be stateful . accordingly , the routers , including any stateful routers , will pass packet 109 to usr 1 . as previously mentioned , in response to the increase in available processing power of modern cpus and the demand for increased security , router manufactures have produced “ stateful ” routers being routers that keep track of the state of sessions at a higher level than has been the case in the past . server 30 is also programmed to assemble and transmit a number of probe packets 111 - 117 which are each based on solicited response packet 109 . each of the probe packets is substantially identical to packet 109 and so contains that packets spi data , except for having a varied ttl value . as will be seen , the probe packets are used to find the number of router hops to the router servicing subnet 100 , i . e . router r 1 . referring again to fig6 , at box 66 a check is performed to determine if the packets 109 destination ip address corresponds with an originating ip address in the packet data database table . if it does match an ip address in the packet data database table then at box 68 the minimum estimated ttl ( minttl ) to reach the ip address is calculated in a manner that will be explained shortly . at box 70 probe packets 111 - 117 of ip packet 109 are assembled . since the probe packets are copies of solicited reply packet 109 , save for their adjusted ttl values , they contain sufficient spi data to be passed by any stateful routers , e . g . r 1 , of the router chain r 1 , . . . , rn . at box 72 the utl of the first probe packet 111 is set to an adjusted ttl of minttl minus a shortfall . currently the inventor uses a shortfall value of 5 hops . a method for determining the shortfall value will be described later . the adjusted ttl is set to be incrementally greater for each of probe packets 113 - 117 so that at least one of the probe packets can be confidently expected to reach usr 1 and at least one can be expected to fall short . at box 74 both the original unaltered ip packet and the probe packets are transmitted over the internet . the process then loops back to box 64 . if , at box 64 an incoming packet , e . g . packet 103 , is found to be an icmp packet in response to one of the probe packets transmitted at box 74 , then at box 82 the original destination ip address is recovered from the ip header contained within the data section of the icmp reply . at box 84 the original 16 bit identification field of the ip header that is contained within the data section of the icmp reply is recovered . at box 86 the original ip address and the id field value are used to identify the probe packet which was transmitted at box 74 , that the icmp packet was generated in response to . if it is not possible to identify the probe packet then the procedure loops back to box 64 . if it is possible to successfully identify the probe packet then at box 88 the ttl and source ip address are recovered from the ip header of the icmp response packet . it should be noted that they are not recovered from the ip header contained within the data section . the source ip address will be the address of a router that replied to one of the cloned packets sent at box 74 . for example , the source ip address of packet 105 is “ r2 ipa ”. at box 90 the ttl and source ip address of the icmp response packet are stored for future reference . at box 92 the sniffer application waits for a suitable time , say five seconds , for any further icmp packet replies . in the present example the sniffer application receives icmp packets 105 and 107 . at box 94 the recorded icmp replies are examined to determine if there is sufficient data to identify the nearest router to the given subnet . the nearest router will be the router that has responded with the highest ttl before a nominal , say two , _number of null replies . in the present instance the nearest router to subnet 100 is r 1 . a null reply occurs when no icmp reply is received in response to a sent probe packet as is the case with packet 117 of fig5 . a null reply indicates that the probe packet reached the destination ip address . it will be realised that there are other conditions that may result in a null reply , for example packet loss , busy router , network anomaly etc . consequently , as previously discussed , a sufficient number of probe packets are sent at box 74 with incremented ttls to significantly increase the likelihood of identifying the correct router . if the nearest router to the subnet in question , e . g . r 1 in the example of fig5 , has been identified then at box 96 its particulars are recorded in a database table . the particulars in question include the destination subnet and / or ip address of the cloned packet , the nearest router &# 39 ; s ip address , and the minimum ttl required to reach that router . any subnets and the routers that service them that are incidentally discovered during the process are also recorded . the method for calculating the minttl that was mentioned previously in relation to box 68 will now be explained . firstly , it is assumed that the vast majority of users will be using an operating system that initially sets the ttl to either 32 , 64 , 128 or 256 hops . as the ttl is stored within the ip header as an 8 - bit field it is not possible for this value to be larger than 255 and therefore no user can be more than 256 hops away . if the ttl of the incoming packet is less than 32 , 64 , 128 , 256 then the estimated minimum ttl required to reach the originating ip address is 32 , 64 , 128 , 256 , less ttl of the incoming packets respectively . examples of estimated minimum ttl values required to reach the originating ip address are provided in table 1 . it will be noted that the sum of the entries in the first column and the third column equals the entry in the second column . the determination of the ttl offset value that was previously mentioned in relation to box 72 of fig6 will now be discussed . the inventor has found that the number of hops required to reach a destination address is often not the same as the number of return hops incurred by a packet traversing the network in the opposite direction . this is primarily because packets may travel a different path in each direction traversing both different routers and a different number of routers on each path . this is why the “ estimated minimum ttl is only an estimate and why a ttl offset is required . the ttl offset is used to back up and start mapping at a point which is likely to be equal or less than the minimum ttl required to reach the nearest router . this in turn allows efficient mapping , with a minimal number of packets being sent . however , in a small number of cases the estimated ttl less the offset will still be too high so that no icmp replies are elicited . in that case the probe packets &# 39 ; ttls are further reduced until such time that an icmp reply is received . it will be realised that a further advantage of a method according to an embodiment of the present invention is that it is very discreet insofar as it does not cause isps to mistakenly interpret the probe packets as an icmp attack because they are each based upon a solicited response packet . fig7 to 9 schematically illustrate three broad approaches to associating a geographical location with network data including a network edge ( e . g . “ subnet ”) address according to previously described preferred embodiments of the present invention . these diagrams may be taken to represent examples of the kind of data that might be stored in table 12 of fig1 . in fig7 seed data is stored in row 101 comprising the association of network data 100 , including network edge address a and user n with geographical location g . l . upon ascertaining new network data 102 comprising network edge address b and associated user n then user n , being common to both rows is taken to comprise pivot data 104 and geographical location g . l . is then copied to the lower row 106 so that it is associated with network address b . in fig8 seed data is stored in row 107 comprising the association of network data 108 , including network edge address a and user k , to geographical location g . l . subsequently new network data 110 , indicating that network address a is associated with user l , is ascertained and stored in row 112 . since network address a is common to both rows it comprises pivot data 114 and accordingly the geographical location g . l . is then copied to row 112 so that user l is also associated with geographical location g . l . in fig9 seed data is stored in row 116 associating network edge address a to a network support device ra , e . g . a router having address ra and to a geographical location g . l . subsequently , new network data 110 is ascertained indicating that network edge address b is also associated with network support device ra . since ra in the second row matches ra in the first row , the router address can be used as pivot data 120 . consequently address b is then associated with geographical address g . l . by copying g . l . to row 122 as indicated . the embodiments of the invention described herein are provided for purposes of explaining the principles thereof , and are not to be considered as limiting or restricting the invention since many modifications may be made by the exercise of skill in the art without departing from the scope of the appended claims | 7 |
“ pharmaceutically acceptable salt ” refers to those salts which retain the biological effectiveness and properties of the free bases and which are obtained by reaction with inorganic acids such as hydrochloric acid , hydrobromic acid , sulfuric acid , nitric acid , phosphoric acid , methanesulfonic acid , ethanesulfonic acid , p - toluenesulfonic acid , salicylic acid and the like . “ alkyl ” refers to a straight - chain , branched or cyclic saturated aliphatic hydrocarbon . typical alkyl groups include methyl , ethyl , propyl , isopropyl , butyl , isobutyl , tertiary butyl , pentyl , hexyl and the like . the alkyl group may be optionally substituted with one or more substituents selected from the group consisting of hydroxyl , cyano , or alkoxy . when the alky group is an r ′ substituent , it is a lower alkyl of from 1 to 6 carbons , more preferably 1 to 4 carbons . “ aryl ” refers to an aromatic group which has at least one ring having a conjugated pi electron system and includes carbocyclic aryl , heterocyclic aryl and biaryl groups . the aryl group may be optionally substituted with one or more substituents selected from the group consisting of halogen , trihalomethyl , hydroxyl , sh , oh , no 2 , amine , thioether , cyano , alkoxy , alkyl , and amino . examples of aryl groups include phenyl , napthyl and anthracyl groups . phenyl and substituted phenyl groups are preferred . “ heteroaryl ” refers to an aryl group having from 1 to 3 heteroatoms as ring atoms , the remainder of the ring atoms being carbon . heteroatoms include oxygen , sulfur , and nitrogen . thus , heterocyclic aryl groups include furanyl , thienyl , pyridyl , pyrrolyl , n - lower alkyl pyrrolo , pyrimidyl , pyrazinyl , imidazolyl and the like . all reactions were carried out in dry glassware under an atmosphere of argon unless otherwise noted . reactions were purified by column chromatography , under medium pressure using a biotage sp4 or by preparative high pressure liquid chromatography . 1 h nmr was recorded on a bruker 400 mhz instrument . spectra are reported as ppm δ and are referenced to the solvent resonances in cdcl 3 , dmso - d 6 or methanol - d 4 . all solvents were purchased from sigma - aldrich . reagents were purchased from sigma aldrich , bachem , akaal , fisher , alfa aesar , acros and anaspec . the following abbreviations are used methylene chloride ( dcm ), ethyl acetate ( ea ), hexanes ( hex ), dichloroethane ( dce ), dimethyl formamide ( dmf ), trifluoroacetic acid ( tfa ), tetrahydrofuran ( thf ), carbonyldiimidazole ( cdi ), dimethylaminopyridine ( dman ), triethylamine ( tea ), methyl trifluoromethanesulfonate ( meotf ), ( s )- 2 - amino - 6 -( bis - pyridin - 2 - ylmethyl - amino )- hexanoic acid ( dpk ), glutamic acid ( glu ), diisopropylethylamine ( diea ), benzyloxycarbonyl ( cbz ). the following compounds were all prepared in overall yields ranging from 20 - 40 % following the route depicted in scheme 1 . the first step , performed at 0 ° c . under inert conditions used the di - t - butyl ester of glutamic acid with cdi in the presence of base to form the intermediate glu - urea - imidazole derivative 2 . this intermediate was activated with meotf under basic conditions to afford the methylated imidazole 3 , which under inert conditions reacted readily with amines . the tert - butyl ester protecting groups were removed using 20 % tfa in dcm for 1 to 4 hour at room temperature . upon completion of the deprotection , the reactions were concentrated on a rotary evaporator or blown dry with nitrogen and purified on a silica column or recrystallized . the final products were tested in vitro and in vivo . l -( s )- 2 -[( imidazole - 1 - carbonyl )- amino ]- pentanedioic acid di - tert - butyl ester ( 2 ) to a suspension of di - t - butyl glutamate hydrochloride ( 15 . 0 g , 51 mmol ) in dcm ( 150 ml ) cooled to 0 ° c . was added tea ( 18 ml ) and dmap ( 250 mg ). after stirring for 5 min . cdi ( 9 . 0 g , 56 mmol ) was added and the reaction was stirred overnight with warming to room temperature . the reaction was diluted with dcm ( 150 ml ) and washed with saturated sodium bicarbonate ( 60 ml ), water ( 2 × 100 ml ) and brine ( 100 ml ). the organic layer was dried over sodium sulfate and concentrated to afford the crude product as a semi - solid , which slowly solidified upon standing . the crude material was triturated with hexane / ethyl acetate to afford a white solid which was filtered , washed with hexane ( 100 ml ) and dried to afford the desired product ( 15 . 9 g , 45 mmol , 88 %) as a white solid . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 7 . 63 ( s , 1h ), 7 . 00 ( br , 2h ), 6 . 31 ( d , 1h ), 4 . 02 ( m , 1h ), 2 . 19 ( m , 2h ), 1 . 86 ( m , 1h ), 1 . 67 ( m , 1h ), 1 . 39 ( s , 9h ), 1 . 38 ( s , 9h ). esms m / z : 354 ( m + h ) + . alternatively , the analogs can be prepared via the isocyanate generated in situ using triphosgene . this approach can be accomplished by either activation of the glutamate residue and coupling with a lysine residue ( route a ) or by activating the lysine residue and coupling it with the glutamate ( route b ) as shown in scheme 2 below . route a . in a round bottom flask 1 . 8 ml tea ( 13 . 2 mmol ) was combined with 1 . 8 grams ( 6 mmol ) l - glutamic acid di - tertbutyl ester hydrochloride in 20 ml dcm . this solution is added dropwise over 45 minutes to a solution of 10 ml dcm and triphosgene ( 0 . 7 g , 2 . 2 mmol ) at 0 ° c . after stirring an additional 30 min a solution of h - lys -( z )- o - t - butyl ester hcl ( 2 . 2 g , 6 mmol ) containing tea ( 1 . 8 ml , 13 mmol ) in 15 ml dcm was added in one portion . the solution was stirred for 1 hour . the reaction is concentrated , diluted with 50 ml ethyl acetate , washed 2n nahso4 ( 2 × 50 ml ), brine ( 50 ml ) and dried over sodium sulfate to yield a yellow oil . purification by column chromatography to afford the desired product as a clear oil which upon standing solidifies to a white solid ( 1 . 9 g , 54 %). route b . in a round bottom flask triphosgene ( 2 . 9 g , 10 mmol ) is suspended in dcm ( 50 ml ) and stirred at 0 ° c . a solution of h - lysine ( z ) freebase ( 9 . 1 g , 27 mmol ) and diea ( 10 . 4 ml , 60 mmol ) dcm ( 50 ml ) was added dropwise to the triphosgene solution over 2 . 5 hours . after 2 . 5 hours a solution of l - glutamic acid di - tertbutyl ester hydrochloride ( 8 g , 27 mmol ) containing dea ( 10 . 4 ml , 60 mmol ) dcm ( 50 ml ) was added in one portion and allowed to stir for 45 minutes . the reaction was concentrated to dryness , diluted with 150 ml ethyl acetate , washed with 2n nahso 4 ( 2 × 200 ml ), brine ( 150 ml ) and dried over sodium sulfate to yield a yellow oil . this oil was purified by column chromatography ( sio 2 ) to afford the desired product as a clear oil which upon standing solidifies to a white solid ( 12 . 0 g , 72 %). 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 34 ( m , 5h ), 5 . 33 - 5 . 28 ( m , 3h ), 5 . 08 ( d , j = 7 . 4 hz , 2h ), 4 . 38 - 4 . 29 ( m , 2h ), 3 . 15 ( m , 2h ), 2 . 32 - 2 . 01 ( m , 2h ), 1 . 90 - 1 . 50 ( m , 8h ), 1 . 43 - 1 . 40 ( m , 27h , t - bu &# 39 ; s ). esms m / z : 622 ( m + h ) + . 2 -[ 3 -( 5 - amino - 1 - tert - butoxycarbonyl - pentyl )- ureido ]- pentanedioic acid di - tert - butyl ester ( 4 ). to a solution of 2 -[ 3 -( 5 - benzyloxycarbonylamino - 1 - tert - butoxycarbonyl - pentyl )- ureido ]- pentanedioic acid di - tert - butyl ester ( 630 mg , 1 . 0 mmol ) in ethanol ( 20 ml ) was added ammonium formate ( 630 mg , 10 eqv ) followed by 10 % pd — c and the suspension was allowed to stand with occasional agitation overnight until complete . the reaction was filtered through celite and concentrated to afford the desired product ( 479 mg , 98 %) as a waxy solid . 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 15 - 6 . 0 ( bm , 4h , nh &# 39 ; s ), 4 . 29 ( m , 2h ), 3 . 02 ( m , 2h ), 2 . 33 ( m , 2h ), 2 . 06 - 1 . 47 ( m , 8h ), 1 . 45 - 1 . 40 ( m , 27h , t - bu &# 39 ; s ). esms m / z : 488 ( m + h ) + . in this series a tether is incorporated onto the side chain of glutamic acid or lysine prior to conjugation to form the urea dimer . in the example below the side chain carboxylic acid of one of the glutamic acids is modified into a tether to append a chelator , atom or functional group that is or contains a radionuclide ( scheme 4 ). to a solution of n — boc glutamic acid α - methyl ester boc - glu ( oh )- ome ( 960 mg , 3 . 7 mmol ) in dmf ( 6 ml ) cooled to 0 ° c . was added edc ( 845 mg , 1 . 3 eqv ) and tea ( 1 . 3 ml ). after stirring for 10 min the mono protected diamine n - cbz - 1 , 4 - diaminobutane hydrochloride salt ( 1 g , 3 . 8 mmol ) was added and the reaction is allowed to stir overnight with warming to room temperature . the crude reaction was diluted with ea ( 100 ml ) and washed with and washed with water ( 30 ml ), 5 % aq . citric acid ( 30 ml ), sat . sodium bicarbonate ( 30 ml ), water ( 30 ml ) and brine ( 30 ml ). the organic layer was dried over sodium sulfate and concentrated to afford the crude product as a thick syrup ( 2 . 1 g ). to the obtained syrup was added 4 n hcl in dioxane ( 10 ml ) and the reaction was stirred at room temperature for 3 h . concentration afforded a waxy solid ( 1 . 8 g ) as the hydrochloride salt . the salt was coupled to the activated l -( s )- 2 -[( imidazole - 1 - carbonyl )- amino ]- pentanedioic acid di - tert - butyl ester ( 2 ) as described in the preceding experimental sections to afford the desired fully protected dimer x ( 1 . 9 g ). this material was suspended in absolute etoh ( 20 ml ) excess ammonium formate ( 5 g ) added followed by 20 % pd ( oh ) 2 on carbon ( 100 mg ) and the suspension very gently agitated overnight to effect cleavage of the cbz protection group . filtration through celite and concentration afforded the desired free amine ( 1 . 4 g , 2 . 7 mmol , 73 %, 4 steps ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 41 ( br , 2h ), 7 . 36 9 br , 1h ), 6 . 44 ( bs , 1h ), 6 . 37 ( bs , 1h ), 4 . 37 - 4 . 29 ( m , 2h ), 3 . 71 ( s , 3h ), 3 . 20 - 1 . 50 ( m , 16h ), 1 . 45 ( s , 9h ), 1 . 43 ( s , 9h ). esms m / z : 517 ( m + h ) + . the protected intermediate was prepared by reductive amination using pyridine - 2 - carboxaldehyde as previously described . treatment with 2m lioh in meoh effected hydrolysis of the methyl ester . the methanol was removed and excess dcm : tfa ( 1 : 1 ) was added and the reaction stirred at room temperature overnight . the crude material was converted into the desired rhenium conjugate following the procedure described above . preparative hplc afforded the desired molecule ( 9 . 5 mg , 16 %). 1 h nmr ( 400 mhz , dmso - d 6 ) δ 8 . 78 ( m , 2h ), 8 . 31 ( br , 1h ), 7 . 95 ( m , 2h ), 7 . 59 ( m , 2h ), 7 . 39 ( m , 2h ), 6 . 60 - 6 . 33 ( m , 2h ), 4 . 89 ( m , 4h ), 4 . 00 ( m , 1h ), 3 . 76 ( m , 1h ), 3 . 20 - 1 . 2 ( m , 16h ) ( 3 co 2 h not seen ). esms 842 ( m − h ) + . the following compounds were all prepared in overall yields ranging from 20 - 40 % usin the route depicted in scheme 3 . the z - deprotected glu - urea - lysine was mixed with the appropriate aldehyde ( 0 . 9 equivalents ) at room temperature for one hour to form the □ chiff base intermediate . the □ chiff base was reduced using 1 equivalent of sodium triacetoxyborohydride . the compounds were deprotected using 50 % tfa in dcm for 1 hour at room temperature . upon completion , the reactions were concentrated on a rotary evaporator or were blown dry with nitrogen and extracted using methylene chloride and water . the water layer was evaporated to dryness to afford the deprotected product in 40 - 80 % yield . 4 - trimethylstannanyl - benzaldehyde ( 5 ). to a solution of 4 - iodobenzaldehyde ( 1 . 92 g , 8 . 27 mmol ) in dry dioxane ( 60 ml ) was added hexamethylditin ( 4 . 1 ml , 19 . 8 mmol ) followed by pd ( ph 3 p ) cl 2 ( 150 mg ) and the reaction mixture was heated for 3 h under reflux until judged complete . the reaction was filtered through celite and purified by column chromatography using hexanes / ethyl acetate ( 9 / 1 ) as eluent to afford ( 2 . 24 g , 98 %) as a clear oil . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 97 ( s , 1h ), 7 . 81 ( d , j = 7 . 8 hz , 2h ), 7 . 72 ( d , j = 7 . 8 hz , 2h ), 0 . 29 ( s , 9h ). esms m / z : 268 ( sn - cluster ). 2 -{ 3 -[ 1 - tert - butoxycarbonyl - 5 -( 4 - trimethylstannanyl - benzylamino )- pentyl ]- ureido }- pentanedioic acid di - tert - butyl ester ( 6 ). to a solution of 2 -[ 3 -( 5 - amino - 1 - tert - butoxycarbonyl - pentyl )- ureido ]- pentanedioic acid di - tert - butyl ester ( 150 mg , 0 . 31 mmol ) in dce ( 10 ml ) was added 4 - trimethylstannanyl - benzaldehyde ( 82 mg , 0 . 31 mmol ) followed by sodium triacetoxyborohydride ( 98 mg , 0 . 47 mmol ) and the reaction was stirred overnight at 40 ° c . the reaction was concentrated and purified by column chromatography using hexanes / ethyl acetate as eluent to afford the desired product ( 88 mg , 38 %) as a thick syrup which begins to solidify upon standing . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 7 . 48 ( d , j = 7 . 4 hz , 2h ), 7 . 30 ( d , j = 7 . 4 hz , 2h ), 6 . 27 ( m , 2h , nh &# 39 ; s ), 3 . 96 ( m , 4h ), 2 . 74 ( bm , 2h ), 2 . 21 ( m , 2h ), 1 . 87 ( m , 2h ), 1 . 65 - 1 . 19 ( m , 7h ), 1 . 35 ( m , 27h , t - bu &# 39 ; s ), 0 . 23 ( s , 9h ). esms m / z : 742 ( sn - cluster ). ( s , s )- 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid ( 7 ) ( mip 1033 ) the same experimental procedure as depicted in scheme 1 , yielded 8 % of 2 -[ 3 -( 5 - benzyloxycarbonylamino - 1 - tert - butoxycarbonyl - pentyl )- ureido ]- pentanedioic acid di - tert - butyl ester . the compound was deprotected using the previously described methods and purified by hplc to afford the desired product . 1 h nmr ( tri - t - butyl ester of z - protected amine ) ( 400 mhz , cdcl 3 ,) δ 12 . 2 ( s , 3h ), 6 . 4 ( s , 2h ), 4 . 15 ( m , 2h ), 3 . 45 ( m , 1h ), 2 . 75 ( bs , 1h ), 2 . 2 ( m , 4h ), 1 . 90 ( m , 2h ), 1 . 65 ( m , 2h ), 1 . 50 ( s , 2h ), 1 . 35 ( m , 2h ). esms m / z : 622 ( m − h )#. ( s )- 2 -( 3 , 3 - bis - pyridin - 2 - ylmethyl - ureido )- pentanedioic acid ( 8 ) ( mip 1025 ). the same experimental procedure as in the general synthesis , yielded 0 . 65 g , 48 % of 2 -( 3 , 3 - bis - pyridin - 2 - ylmethyl - ureido )- pentanedioic acid di - tert - butyl ester . the compound was deprotected using the previously described methods and purified by hplc to afford the desired product . 1 h nmr ( 400 mhz , dmso - d 6 ) δ , 12 . 0 ( bs , 2h ), 8 . 68 ( d , 2h ), 8 . 00 ( m , 2h ), 7 . 41 ( d , 4h ), 7 . 14 ( d , 1h ), 4 . 73 ( d , 4h ), 3 . 96 ( s , 1h ), 2 . 18 ( m , 2h ), 1 . 80 ( m , 2h ). ( s , s )- 2 -{ 3 -[ 3 -( bis - pyridin - 2 - ylmethyl - amino )- 1 - carboxy - propyl ]- ureido }- pentanedioic acid ( 9 ) ( mip 1028 ). the same experimental procedure as in the general synthesis in scheme 1 , yielded 0 . 16 g , 35 % of 2 -{ 3 -[ 3 -( bis - pyridin - 2 - ylmethyl - amino )- 1 - carboxy - propyl ]- ureido }- pentanedioic acid di - tert - butyl ester . the compound was deprotected using the previously described methods and purified by hplc to afford the desired product . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 4 ( br , 2h ), 9 . 37 ( s , 1h ), 8 . 52 ( d , 2h ), 7 . 80 ( t , 2h ), 7 . 14 ( dd , 4h ), 6 . 45 ( m , 2h ), 4 . 49 ( br , 4h ), 4 . 12 ( s , 1h ), 4 . 05 ( s , 1h ), 3 . 21 ( m , 2h ), 2 . 24 ( m , 2h ), 1 . 80 ( m , 2h ), 1 . 40 ( m , 2h ). esms m / z : ( diethyl ester ) 429 ( m ) + , 451 ( m + na ). ( s , s )- 2 -{ 3 -[ 5 -( bis - pyridin - 2 - ylmethyl - amino )- 1 - carboxy - pentyl ]- ureido }- pentanedioic acid ( 10 ) ( mip 1008 ). the same experimental procedure as in the general synthesis , yielded 0 . 09 g , 12 % of 2 -{ 3 -[ 5 -( bis - pyridin - 2 - ylmethyl - amino )- 1 - carboxy - pentyl ]- ureido }- pentanedioic acid di - tert - butyl ester . the compound was deprotected using the previously described methods and purified by hplc to afford the desired product . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 7 ( s , 2h ), 8 . 97 ( s , 1h ), 8 . 65 ( dd , 2h ), 7 . 91 ( dd , 2h ), 7 . 45 ( m , 4h ), 6 . 44 ( d , 1h ), 6 . 28 ( d , 1h ), 4 . 45 ( br , 4h ), 4 . 10 ( m , 2h ), 3 . 15 ( br , 2h ), 2 . 60 ( m , 2h ), 2 . 25 ( m , 2h ), 1 . 90 ( m , 2h ), 1 . 78 ( m , 2h ), 1 . 45 ( m , 2h ). ( s )- 2 -{ 3 -[ 1 - carboxy - 2 -( 4 - iodo - phenyl )- ethyl ]- ureido }- pentanedioic acid ( 11 ) ( mip - 1034 ). the same experimental procedure as in the general synthesis , yielded 0 . 038 g , 5 % of 2 -{ 3 -[ 1 - carboxy - 2 -( 4 - iodo - phenyl )- ethyl ]- ureido }- pentanedioic acid di - tert - butyl ester . the compound was deprotected using the previously described methods . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 40 ( s , 3h ), 7 . 65 ( dd , 2h ), 7 . 05 ( dd , 2h ), 6 . 30 ( m , 2h ), 4 . 25 ( s , 1h ), 4 . 05 ( s , 1h ), 2 . 90 ( m , 2h ), 2 . 2 ( m , 2h ), 1 . 80 ( m , 2h ). esms m / z : 429 ( m ) + , 451 ( m + na ). ( s , s )- 2 -{ 3 -[ 1 - carboxy - 5 -( 2 - iodo - benzylamino )- pentyl ]- ureido }- pentanedioic acid ( 12 ) ( mip 1035 ). the same general procedure , using the previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the compound was deprotected using the previously described methods ( 5 . 5 mg , 66 %). 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 4 ( s , 3h ), 8 . 8 ( s , 1h ), 7 . 94 ( m , 1h ), 7 . 5 ( m , 1h ), 7 . 16 ( t , 1h ), 6 . 38 ( m , 2h ), 4 . 15 ( m , 5h ), 3 . 06 ( s , 2h ), 2 . 85 ( s , 1h ), 2 . 2 ( m , 2h ), 1 . 90 ( m , 1h ), 1 . 70 ( m , 2h ), 1 . 50 ( s , 2h ), 1 . 35 ( m , 2h ). esms m / z : 536 ( m + h ) + . ( s , s )- 2 -{ 3 -[ 1 - carboxy - 5 -( 3 - iodo - benzylamino )- pentyl ]- ureido }- pentanedioic ( 13 ) ( mip 1089 ). the same general procedure , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di - t - butyl ester . the compound was deprotected using the previously described methods ( 4 . 1 mg , 53 %). 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 4 ( s , 3h ), 8 . 7 ( s , 2h ), 7 . 9 ( s , 1h ), 7 . 8 ( d , 1h ), 7 . 44 ( d , 1h ), 7 . 22 ( t , 1h ), 6 . 25 ( s , 2h ), 4 . 09 ( m , 5h ), 2 . 89 ( s , 1h ), 2 . 75 ( s , 1h ), 2 . 2 ( d , 2h ), 1 . 90 ( m , 2h ), 1 . 65 ( m , 2h ), 1 . 40 ( m , 2h ). ( s , s )- 2 -{ 3 -[ 1 - carboxy - 5 -( 4 - iodo - benzylamino )- pentyl ]- ureido }- pentanedioic ( 14 ) ( mip 1072 ). the same general procedure , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the compound was deprotected using the previously described methods ( 12 mg , 66 %). 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 4 ( bs , 3h ), 8 . 8 ( br , 1h ), 7 . 8 ( d , 2h ), 7 . 27 ( d , 2h ), 6 . 35 ( br , 2h ), 4 . 1 ( m , 4h ), 2 . 89 ( m , 2h ), 2 . 2 ( d , 2h ), 1 . 90 ( m , 2h ), 1 . 65 ( m , 4h ), 1 . 35 ( m , 2h ). esms m / z : 536 ( m + h ) + . ( s , s )- 2 -{ 3 -[ 1 - carboxy - 5 -( 4 - fluoro - benzylamino )- pentyl ]- ureido }- pentanedioic ( 15 ) ( mip 1090 ). the same general procedure , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the compound was deprotected using the previously described methods . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 4 ( br , 3h ), 8 . 7 ( br , 1h ), 7 . 5 ( m , 2h ), 7 . 3 ( m , 2h ), 6 . 35 ( m , 2h ), 4 . 1 ( m , 4h ), 2 . 9 ( m , 2h ), 2 . 2 ( d , 2h ), 1 . 90 ( m , 2h ), 1 . 60 ( m , 4h ), 1 . 35 ( m , 2h ). esms m / z : 428 ( m + h ) + , 450 ( m + na ). ( s , s )- 2 -{ 3 -[ 1 - carboxy - 5 -( 4 - bromo - benzylamino )- pentyl ]- ureido }- pentanedioic ( 16 ) ( mip 1094 ). the same general procedure , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . 1 hnmr ( tri t - butyl ester ) ( 400 mhz , cdcl 3 ) δ 7 . 52 ( d , 2h ), 7 . 32 ( d , 2h ), 6 . 28 ( m , 2h ), 3 . 98 ( m , 2h ), 2 . 55 ( t , 2h ), 2 . 48 ( t , 2h ), 2 . 22 ( m , 2h ), 1 . 85 ( m , 2h ), 1 . 62 ( m , 2h ), 1 . 45 ( m , 2h ), 1 . 37 ( s , 27h ), 1 . 28 ( m , 2h ) esms m / z : 642 ( m + h ) + . the compound was deprotected using the previously described methods . esms m / z : 474 ( m + h ) + . ( s , s )- 2 -{ 3 -[ 1 - carboxy - 5 -( 4 - iodo - benzoylamino )- pentyl ]- ureido }- pentanedioic acid ( 17 ) ( mip 1044 ). the same general procedure , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the compound was deprotected using the previously described methods . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 4 ( s , 3h ), 8 . 45 ( s , 1h ), 7 . 8 ( dd , 2h ), 7 . 6 ( dd , 2h ), 6 . 3 ( s , 2h ), 5 . 75 ( s , 1h ), 4 . 1 ( m , 4h ), 3 . 2 ( s , 2h ), 2 . 25 ( d , 2h ), 1 . 90 ( m , 1h ), 1 . 65 ( m , 2h ), 1 . 4 ( m , 2h ). in a round bottom flask 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester ( 300 mg , 0 . 62 mmol ) is suspended in water ( 10 ml ) and 1 , 4 dioxane ( 10 ml ) and tea ( 1 . 75 ml , 1 . 25 mmol ) was added followed by 4 - iodo - benzenesulfonyl chloride and the mixture stirred overnight at 50 ° c . the reaction mixture was evaporated to dryness , taken up in dcm and chromatographed over silica gel to afford the desired product ( 375 mg , 80 %) as a clear oil . the compound was deprotected using the previously described methods followed by hplc purification to afford the desired product mip - 1097 as a whiter solid ( 270 grams , 90 % yield ). 1 h nmr ( 400 mhz , dmso - d 6 ) δ 7 . 97 ( d , 2h ), 7 . 68 ( t , 1h ), 7 . 53 ( d , 2h ), 6 . 35 ( dd , 2h ), 4 . 10 ( m , 1h ), 4 . 00 ( m , 1h ), 2 . 65 ( m , 2h ), 2 . 22 ( m , 2h ), 1 . 9 ( m , 1h ), 1 . 7 ( m , 1h ), 1 . 55 ( m , 1h ), 1 . 45 ( m , 1h ), 1 . 35 ( m , 2h ), 1 . 25 ( m , 2h ), ( 3 co 2 h not seen ). esms m / z : 565 ( m + h ) + . in a round bottom flask 4 - iodo - phenyl isocyanate ( 100 mg , 0 . 41 mmol ) is dissolved in dcm ( 10 ml ) containing tea ( 0 . 057 ml , 0 . 4 mmol ). 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester ( 200 mg , 0 . 41 mmol ) was added and stirred for 3 hours . the reaction mixture was evaporated to dryness and the crude mixture taken up in methanol ( 5 ml ). dropwise addition to water ( 20 ml ) afforded a white precipitate which was collected and washed with water ( 20 ml ) and dried to afford the desired tri - tert butyl ester as a white solid which was deprotected directly using the previously described method to afford the desired product ( 158 mg , 53 %) as a white solid . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 8 . 51 ( s , 1h ), 7 . 5 ( d , 2h ), 7 . 22 ( d , 2h ), 6 . 3 ( t , 2h ), 6 . 16 ( t , 1h ), 4 . 05 ( m , 2h ), 3 . 05 ( m , 2h ), 2 . 24 ( m , 2h ), 1 . 9 ( m , 1h ), 1 . 68 ( m , 2h ), 1 . 52 ( m , 1h ), 1 . 38 ( m , 2h ), 1 . 28 ( m , 2h ), ( 3 co 2 h not seen ). esms m / z : 565 ( m + h ) + . malonic acid ( 2 . 2 g , 21 . 5 mmol ) and 3 - iodobenzaldehyde ( 5 g , 21 . 5 mmol ) were suspended in ethanol ( 50 ml ) and ammonium acetate ( 1 . 66 g , 21 . 5 mmol ) was added and the reaction heated to a reflux overnight . the reaction was cooled to room temperature filtered and washed with ethanol followed by ether and dried to afford the product ( 3 . 4 g , 11 . 6 mmol , 54 %) as a white solid . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 7 . 80 ( s , 1h ), 7 . 64 ( dd , j = 7 . 8 hz , 1h ), 7 . 42 ( dd , j = 7 . 6 hz , 1h ), 7 . 16 ( dd , j = 7 . 8 hz , 1h ), 7 . 14 ( dd , j = 7 . 6 hz , 1h ), 4 . 21 ( m , 1h ), 2 . 36 ( m , 2h ). to a suspension of (±)- 3 - amino - 3 -( 3 - iodo - phenyl )- propionic acid ( 3 . 1 g , 10 . 6 mmol ) in methanol was added thionyl chloride ( 0 . 95 ml , 12 . 7 mmol ) and the reaction was stirred at room temperature overnight . concentration followed by trituration with ether gives a white solid . the solid is filtered , washed with ether and dried to afford the desired product ( 3 . 5 g , 10 mmol , 95 %) as a white solid . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 8 . 79 ( br , 2h ), 8 . 01 ( s , 1h ), 7 . 74 ( d , j = 8 . 1 hz , 1h ). 7 . 57 ( d , j = 7 . 8 hz , 1h ), 7 . 21 ( dd , j = 8 . 1 , 7 . 8 hz , 1h ), 4 . 56 ( br , 1h ), 3 . 54 ( s , 3h ), 3 . 23 - 3 . 17 ( m , 1h ), 3 . 04 - 2 . 98 ( m , 1h ). 2 -[( imidazole - 1 - carbonyl )- amino ]- pentanedioic acid di - tert - butyl ester ( 370 mg , 1 . 05 mmol ) was dissolved in dce ( 10 ml ) and cooled to 0 ° c . meotf ( 142 μl , 1 . 25 mmol ) was added and the reaction was allowed to proceed for 20 min . (±)- 3 - amino - 3 -( 3 - iodo - phenyl )- propionic acid methyl ester ( 356 mg , 1 . 045 mmol ) was added and the reaction was allowed to warm to room temperature and then warmed to 55 ° c . and stirred overnight . the reaction was diluted with dcm ( 50 ml ) and washed with water ( 30 ml ), 5 % aq . citric acid ( 30 ml ), sat . sodium bicarbonate ( 30 ml ), water ( 30 ml ) and brine ( 30 ml ). the organic layer was dried over sodium sulfate and concentrated to afford the crude product . the product was purified by column chromatography to afford the desired product ( 303 mg , 0 . 51 mmol , 49 %) as a white foam . 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 66 ( s , 1h ), 7 . 57 ( d , j = 7 . 6 hz , 1h ), 7 . 29 ( s , 1h ), 7 . 07 - 7 . 02 ( m , 1h ), 5 . 74 ( br , 1h ), 5 . 17 ( br , 2h ), 4 . 30 ( m , 1h ), 3 . 63 ( s , 1 . 5h ), 3 . 62 ( s , 1 . 5h ), 2 . 88 - 2 . 76 ( m , 2h ), 2 . 38 - 2 . 24 ( m , 2h ), 2 . 10 - 2 . 00 ( m , 1h ), 1 . 90 - 1 . 80 ( m , 1h ), 1 . 46 ( s , 9h ), 1 . 44 ( s , 9h ). to a solution of (±) 2 -{ 3 -[ 1 -( 3 - iodo - phenyl )- 2 - methoxycarbonyl - ethyl ]- ureido }- pentanedioic acid di - tert - butyl ester ( 289 mg , 0 . 49 mmol ) was dissolved in methanol ( 3 ml ) and 2m lioh ( 0 . 5 ml ) was added and the reqaction stirred at room temperature overnight . the reaction was diluted with water ( 20 ml ) and the organic layer was extracted with ethyl acetate ( 2 × 20 ml ) then acidified with 1n hcl to ph ˜ 2 . the aqueous layer was extracted with ethyl acetate ( 3 × 20 ml ), dried over sodium sulfate and concentrated to afford the crude product ( 206 mg , 0 . 36 mmol , 73 %) as a white solid . to the crude material was added dcm ( 2 ml ) followed by tfa ( 2 ml ) and the reaction was stirred at room temperature overnight . concentration followed by recrystallization from ethyl acetate afforded the desired product ( 22 mg , 0 . 047 mmol , 10 %) as a white solid . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 39 ( br , 3h ), 7 . 64 ( br , 1h ), 7 . 56 ( m , 1h ), 7 . 30 ( bm , 1h ), 7 . 10 ( bm , 1h ), 6 . 72 ( bm , 1h ), 6 . 34 ( bm , 1h ), 4 . 94 ( br , 1h ), 4 . 03 ( bm , 1h ), 2 . 64 ( br , 2h ), 2 . 20 ( br , 2h ), 1 . 86 ( br , 1h ), 1 . 71 ( br , 1h ). esms m / z : 463 ( m − h ) + . ( s , s )- 2 -{ 3 -[ 1 - carboxy - 5 -( 2 - chloro - benzylamino )- pentyl ]- ureido }- pentanedioic ( 7 ) ( mip - 1137 ). the same general procedure as shown in scheme 1 , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di - t - butyl ester . the compound was deprotected using the previously described methods to yield the desired product ( 100 mg , 45 %) as an off - white solid . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 0 ( br , 3h ), 7 . 63 ( d , 1h ), 7 . 2 ( m , 2h ), 7 . 15 ( d , 1h ), 6 . 30 ( d , 2h ), 4 . 1 ( m , 4h ), 2 . 9 ( br , 2h ), 2 . 2 ( m , 2h ), 1 . 90 ( m , 2h ), 1 . 60 ( m , 4h ), 1 . 35 ( m , 2h ). esms m / z : 444 ( m + h ) + . ( s , s )- 2 -{ 3 -[ 1 - carboxy - 5 -( 3 - chloro - benzylamino )- pentyl ]- ureido }- pentanedioic ( 8 ) ( mip 1131 ). the same general procedure as shown in scheme 1 , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the compound was deprotected using the previously described methods to yield the desired product ( 200 mg , 90 %) as an off - white solid . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 8 . 9 ( br , 3h ), 7 . 6 ( s , h ), 7 . 43 ( m , 3h ), 6 . 39 ( br , 2h ), 4 . 1 ( m , 4h ), 2 . 9 ( br , 2h ), 2 . 2 ( m , 2h ), 1 . 90 ( m , 2h ), 1 . 60 ( m , 4h ), 1 . 35 ( m , 2h ). esms m / z : 444 ( m + h ) + . ( s , s )- 2 -{ 3 -[ 1 - carboxy - 5 -( 4 - chloro - benzylamino )- pentyl ]- ureido }- pentanedioic ( 9 ) ( mip 1135 ). the same general procedure as shown in scheme 1 , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the compound was deprotected using the previously described methods to yield the desired product as ( 10 mg , 66 %) as an off - white solid . esms m / z : 444 ( m + h ) + . ( s )- 2 -( 3 -(( r )- 5 -( benzylamino )- 1 - carboxypentyl ) ureido ) pentanedioic acid ( 10 ). ( mip - 1106 ). the same general procedure as shown in scheme 1 , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the compound was deprotected using the previously described methods to yield the desired product ( 5 mg , 47 %) as an off - white solid . esms m / z : 410 ( m + h ) + . in a round bottom flask phenyl isocyanate ( 100 mg , 0 . 84 mmol ) was dissolved in dcm ( 10 ml ) 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester ( 409 mg , 0 . 84 mmol ) was added and stirred for 3 hours . the reaction mixture was evaporated to dryness and the crude mixture was purified via flash column chromatography 2 : 1 hexanes / ethyl acetate to afford the tert - butyl ester as a white solid which was deprotected using tfa / ch 2 cl 2 affording the desired product . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 5 ( s , 3h ), 8 . 54 ( s , 1h ), 7 . 40 ( dd , 2h ), 7 . 26 ( dd , 2h ), 6 . 30 ( t , 2h ), 6 . 17 ( t , 1h ), 4 . 05 ( m , 2h ), 3 . 05 ( m , 2h ), 2 . 44 ( m , 2h ), 1 . 90 ( m , 1h ), 1 . 68 ( m , 2h ) 1 . 52 ( m , 1h ). 1 . 40 ( m , 2h ). 1 . 29 ( m , 2h ). esms m / z : 439 ( m + h ) + . in a round bottom flask 4 - bromo - phenyl isocyanate ( 100 mg , 0 . 50 mmol ) was dissolved in dcm ( 10 ml ). 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester ( 246 mg , 0 . 50 mmol ) was added and stirred for 3 hours . the reaction mixture was evaporated to dryness and the crude mixture was purified via flash column chromatography 2 : 1 hexanes / ethyl acetate to afford the tert - butyl ester as a white solid which was deprotected using tfa / ch 2 cl 2 affording the desired product 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 5 ( s , 3h ), 8 . 55 ( s , 1h ), 7 . 35 ( d , 4h ), 6 . 30 ( t , 2h ), 6 . 18 ( t , 1h ), 4 . 08 ( m , 2h ), 3 . 05 ( m , 2h ), 2 . 22 ( m , 2h ), 1 . 90 ( m , 1h ), 1 . 68 ( m , 2h ), 1 . 52 ( m , 1h ), 1 . 40 ( m , 2h ), 1 . 30 ( m , 2h ). esms m / z : 518 ( m + h ) + . in a round bottom flask 4 - chloro - phenyl isocyanate ( 100 mg , 0 . 65 mmol ) was dissolved in dcm ( 10 ml ) 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid , di - t - butyl ester ( 318 mg , 0 . 65 mmol ) was added and stirred for 3 hours . the reaction mixture was evaporated to dryness and the crude mixture was purified via flash column chromatography 2 : 1 hexanes / ethyl acetate to afford the tert - butyl ester as a white solid ( 470 mg , 96 %) which was deprotected using tfa / ch 2 cl 2 affording the desired product 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 5 ( s , 3h ), 8 . 35 ( s , 1h ), 7 . 40 ( dd , 2h ), 7 . 19 ( dd , 2h ), 6 . 30 ( t , 2h ), 6 . 10 ( t , 1h ), 4 . 08 ( m , 2h ), 3 . 05 ( m , 2h ), 2 . 32 ( m , 2h ), 1 . 90 ( m , 1h ), 1 . 68 ( m , 2h ), 1 . 52 ( m , 1h ), 1 . 40 ( m , 2h ), 1 . 30 ( m , 2h ). esms m / z : 474 ( m + h ) + . ( s )- 2 -( 3 -(( r )- 1 - carboxy - 5 -( yridine ne - 1 - ylmethylamino ) pentyl ) ureido ) pentanedioic acid . ( 14 ) ( mip - 1108 ). the same general procedure as shown in scheme a , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the compound was deprotected using the previously described methods to yield the desired product ( 51 mg , 70 %) as an off - white solid . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 8 . 9 ( br , 3h ), 7 . 95 ( m , 5h ), 7 . 6 ( m , 2h ), 6 . 35 ( br , 2h ), 4 . 1 ( m , 4h ), 2 . 9 ( br , 2h ), 2 . 55 ( m , 2h ), 2 . 25 ( m , 2h ), 1 . 70 ( m , 4h ), 1 . 3 ( m , 2h ). esms m / z : 460 ( m + h ) + . 2 -( 3 -{ 1 - carboxy - 5 -[ 3 -( 3 - iodo - benzyl )- ureido ]- pentyl }- ureido )- pentanedioic acid ( 15 ) ( mip - 101 ). the same general procedure as shown in scheme 2 , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the compound was deprotected using the previously described methods to yield the desired product . esms m / z : 579 ( m + h ) + . ( 19s , 23s )- 2 -( 4 - iodobenzyl )- 1 -( 4 - iodophenyl )- 13 , 21 - dioxo - 2 , 14 , 20 , 22 - tetraazapentacosane - 19 , 23 , 25 - tricarboxylic acid ( 16 ) ( mip - 1130 ). the same general procedure as shown in scheme a , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the compound was deprotected using the previously described methods to yield the desired product ( 8 . 3 mg , 10 %) as an off - white solid . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 7 . 8 ( d ), 7 . 3 ( d ), 6 . 3 ( dd ), 4 . 25 ( br ), 4 . 05 ( m ), 2 . 97 ( m ), 2 . 85 ( br ), 2 . 22 ( m ), 2 . 05 ( m ), 0 . 90 ( m ), 1 . 64 ( m ), 1 . 48 ( m ), 1 . 35 ( m ), 1 . 2 ( m ). esms m / z : 936 ( m + h ) + . the rhenium complexes of the saac - inhibitors are conveniently isolated from the reactions of the readily available precursor [ net 4 ] 2 [ re ( co ) 3 br 3 ] with the saac - inhibitor . since the donor sets provided by the saac terminus are well documented as effective chelators for the { m ( co ) 3 } + 1 core and have been designed to adopt the required facial arrangement about the metal site , the preparations of the complexes were unexceptional . the { re ( i )( co ) 3 } + system followed similar reaction chemistry to that of the tc - 99m tricarbonyl core . the use of [ net 4 ] 2 [ rebr 3 ( co ) 3 ], as the starting material led to facile formation of the fac -{ re ( co ) 3 ( l ) 3 } core . the [ net 4 ] 2 [ rebr 3 ( co ) 3 ] was readily derived from the [ rebr ( co ) 5 ]. the synthesis of the re ( i ) complexes was accomplished by reacting [ net 4 ] 2 [ rebr 3 ( co ) 3 ] with the appropriate tec ligand in the ratio of 1 : 1 . 2 in 10 ml of methanol . the reaction was allowed to heat at 80 ° c . for 4 hours . after cooling all of the following reaction products were all purified using a small silica column with yields ranging from 10 - 30 %. [ re ( co ) 3 {( 17r , 21s )- 11 , 19 - dioxo - 1 -( i yridine - 2 - yl )- 2 -( yridine - 2 - ylmethyl )- 5 , 8 - dioxa - 2 , 12 , 18 , 20 - tetraazatricosane - 17 , 21 , 23 - tricarboxylic acid }][ br ]. ( 17 ) ( mip - 1133 ). the peg2 dipyridyl compound , ( 17r , 21s )- 11 , 19 - dioxo - 1 -( yridine - 2 - yl )- 2 -( yridine - 2 - ylmethyl )- dioxa - 2 , 12 , 18 , 20 - tetraazatricosane - 17 , 21 , 23 - tricarboxylic acid was prepared employing the same general procedure as shown in scheme 1 , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the rhenium ester complex was prepared employing the same procedure as described in the general rhenium experimental . the compound was deprotected using the previously described methods to yield the desired product ( 2 mg , 20 %) as an off - white solid . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 8 . 8 ( d ), 8 . 00 ( dd ), 7 . 55 ( d ), 7 . 42 ( dd ), 6 . 45 ( s ), 3 . 95 ( m ), 3 . 4 - 3 . 6 ( m ), 2 . 45 ( m ), 1 . 25 ( m ), 1 . 1 ( m ), 0 . 8 ( m ). esms m / z : 931 ( m + h ) + . [ re ( co ) 3 {( 23r , 27s )- 17 , 25 - dioxo - 1 -( pyridin - 2 - yl )- 2 -( pyridin - 2 - ylmethyl )- 5 , 8 , 11 , 14 - tetraoxa - 2 , 18 , 24 , 26 - tetraazanonacosane - 23 , 27 , 29 - tricarboxylic acid }][ br ]. ( 18 ) ( km11 - 200 ). the peg4 dipyridyl compound ( 23r , 27s )- 17 , 25 - dioxo - 1 -( pyridin - 2 - yl )- 2 -( pyridin - 2 - ylmethyl )- 5 , 8 , 11 , 14 - tetraoxa - 2 , 18 , 24 , 26 - tetraazanonacosane - 23 , 27 , 29 - tricarboxylic acid was prepared employing the same general procedure as shown in scheme a , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the rhenium ester complex was prepared employing the same procedure as described in the general rhenium experimental . the compound was deprotected using the previously described methods to yield the desired product . ( 5 . 1 mg , 29 . 6 %) as a white solid . esms m / z : 1019 ( m + h ) + . [ re ( co ) 3 {( 35r , 39s )- 29 , 37 - dioxo - 1 -(□ yridine - 2 - yl )- 2 -(□ yridine - 2 - ylmethyl )- 5 , 8 , 11 , 14 , 17 , 20 , 23 , 26 - octaoxa - 2 , 30 , 36 , 38 - tetraazahentetracontane - 35 , 39 , 41 - tricarboxylic acid }][ br ]. ( 19 ) ( mip - 1132 ). the peg8 dipyridyl compound , ( 35r , 39s )- 29 , 37 - dioxo - 1 -( pyridin - 2 - yl )- 2 -( pyridin - 2 - ylmethyl )- 5 , 8 , 11 , 14 , 17 , 20 , 23 , 26 - octaoxa - 2 , 30 , 36 , 38 - tetraazahentetracontane - 35 , 39 , 41 - tricarboxylic acid was prepared employing the same general procedure as shown in scheme a , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the rhenium ester complex was prepared employing the same procedure as described in the general rhenium experimental . the compound was deprotected using the previously described methods to yield the desired product ( 8 . 0 mg , 30 . 4 %) as a white solid . esms m / z : 1195 ( m + h ) + . [ re ( co ) 3 {( 19r , 23s )- 13 , 21 - dioxo - 2 -(□ yridine - 2 - ylmethyl )- 2 , 14 , 20 , 22 - tetraazapentacosane - 1 , 19 , 23 , 25 - tetracarboxylic acid }] ( 20 ) ( mip - 1109 ). the c11 - pama compound , ( 19r , 23s )- 13 , 21 - dioxo - 2 -(□ yridine - 2 - ylmethyl )- 2 , 14 , 20 , 22 - tetraazapentacosane - 1 , 19 , 23 , 25 - tetracarboxylic acid was prepared employing the same general procedure as shown in scheme a , using previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the rhenium ester complex was prepared employing the same procedure as described in the general rhenium experimental . the compound was deprotected using the previously described methods to yield the desired product ( 3 . 0 mg , 75 %) as an off - white solid . esms m / z : 922 ( m + h ) + . table 1 below is a summary of synthesized psma inhibitors investigated . β - amino acid analogs of mip - 1072 , mip - 1095 , mip - 1027 specifically but the extension to other analogs such as the technetium conjugates as well as other halogen analogs is very desirable . we have no new examples to support this claim at this time . the properties of the group vii metals technetium and rhenium are very similar due to their periodic relationship . it was anticipated that the metals would demonstrate similar reaction chemistry , which is often the case for the tricarbonyl , nitrogen , and thiazole chemistry of these two metals . likewise , due to their similar size that stabilizes the spin paired d 6 electron configuration of m ( i ), perrhenate and pertechnetate have very similar reaction behaviors . synthesizing the rhenium - tecs allowed us a facile route to structurally characterize the products . the periodic relationship between tc and re indicates that tc - 99m radiopharmaceuticals can be designed by modeling analogous rhenium complexes . some of the new compounds were synthesized with macroscopic quantities of rhenium for characterization by conventional methods , including mass - spectrometry , 1 h and 13 c nmr spectrometry . following purification , the synthesized rhenium complexes were run through a hplc column for purification and identification of retention times to compare with tc reaction products . the rhenium - tec complexes were also crystallized . the rhenium complexes of the saac - inhibitors are conveniently isolated from the reactions of the readily available precursors { re ( co ) 3 ( h 2 o ) 3 } + 1 and [ net 4 ] 2 [ re ( co ) 3 br 3 ] with the saac - inhibitor . since the donor sets provided by the saac terminus are well documented as effective chelators for the { m ( co ) 3 } + 1 core and have been designed to adopt the required facial arrangement about the metal site , the preparations of the complexes were unexceptional . the { re ( i )( co ) 3 } + system followed similar reaction chemistry to that of the tc - 99m tricarbonyl core . the use of [ net 4 ] 2 [ rebr 3 ( co ) 3 ], as the starting material led to facile formation of the fac -{ re ( co ) 3 ( l ) 3 } core . the [ net 4 ] 2 [ rebr 3 ( co ) 3 ] was readily derived from the [ rebr ( co ) 5 ]. the synthesis of the re ( i ) complexes was accomplished by reacting [ net 4 ] 2 [ rebr 3 ( co ) 3 ] with the appropriate tec ligand in the ratio of 1 : 1 . 2 in 10 ml of methanol . the reaction was allowed to heat at 80 ° c . for 4 hours . after cooling all of the following reaction products were all purified using a small silica column with yields ranging from 10 - 30 %. [ re ( co ) 3 ( 2 -{ 3 -[ 3 -( bis - pyridin - 2 - ylmethyl - amino )- 1 - carboxy - propyl ]- ureido }- pentanediethyl ester )][ br ] ( 24 ). 1 h nmr ( 400 mhz , dmso - d 6 ) δ 8 . 65 ( dd , 2h ), 7 . 85 ( dd , 2h ), 7 . 7 ( dd , 4h ), 7 . 25 ( dd , 2h ), 6 . 42 ( dd , 1h ), 6 . 0 ( dd , 1h ), 4 . 5 ( m , 2h ), 4 . 16 ( m , 2h ), 3 . 80 ( m , 4h ), 2 . 45 ( m , 2h ), 2 . 0 ( dd , 2h ), 1 . 5 ( m , 4h ), 1 . 25 ( m , 6h ). esms m / z : 812 - 815 . [ re ( co ) 3 ( 2 -{ 3 -[ 5 -( bis - pyridin - 2 - ylmethyl - amino )- 1 - carboxy - pentyl ]- ureido }- pentanedioic acid )][ br ] ( 25 ) ( mip 1029 ). 1 h nmr ( 400 mhz , dmso - d 6 ) δ 12 . 6 ( s , 2h ), 8 . 91 ( s , 1h ), 8 . 63 ( dd , 2h ), 7 . 85 ( dd , 2h ), 7 . 75 ( dd , 4h ), 7 . 3 ( dd , 2h ), 6 . 44 ( d , h ), 6 . 28 ( d , 1h ), 4 . 45 ( s , 2h ), 4 . 10 ( m , 2h ), 3 . 15 ( s , 1h ), 2 . 60 ( m , 2h ), 2 . 25 ( m , 2h ), 1 . 90 ( m , 1h ), 1 . 78 ( m , 2h ), 1 . 45 ( m , 2h ). esms m / z : 770 - 774 . 2 -{ 3 -[ 1 - carboxy - 5 -( carboxymethyl - pyridin - 2 - ylmethyl - amino )- pentyl ]- ureido }- pentanedioic acid ( 26 ). the same general procedure , using the previously prepared and protected 2 -[ 3 -( 5 - amino - 1 - carboxy - pentyl )- ureido ]- pentanedioic acid di t - butyl ester . the compound was deprotected using the previously described methods ( 2 . 2 mg , 65 %). 1 h nmr ( 400 mhz , dmso - d 6 ) δ 8 . 65 ( d , 1h ), 7 . 91 ( dd , 1h ), 7 . 56 ( d , 1h ), 7 . 45 ( dd , 1h ), 6 . 31 ( m , 2h ), 4 . 34 ( s , 2h ), 4 . 08 ( m , 4h ), 3 . 10 ( m , 2h ), 2 . 24 ( m , 2h ), 1 . 95 ( m , 1h ), 1 . 68 ( m , 4h ), 1 . 5 ( m , 1h ), 1 . 22 ( m , 2h ). esms m / z : 469 ( m + h ) + . m + 1 469 . [ re ( co ) 3 ( 2 -{ 3 -[ 1 - carboxy - 5 -( carboxymethyl - pyridin - 2 - ylmethyl - amino )- pentyl ]- ureido }- pentanedioic acid )] ( 27 ). 1 h nmr ( 400 mhz , dmso - d 6 ) δ 8 . 75 ( d , 1h ), 8 . 13 ( dd , 1h ), 7 . 69 ( d , 1h ), 7 . 57 ( dd , 1h ), 6 . 45 ( m , 2h ), 4 . 75 ( m , 1h ), 4 . 50 ( m , 1h ), 4 . 20 ( m , 2h ), 3 . 61 ( m , 4h ), 3 . 15 ( m , 2h ), 2 . 38 ( m , 1h ), 2 . 0 ( m , 2h ), 1 . 75 ( m , 4h ), 1 . 62 ( m , 1h ), 1 . 25 ( m , 2h ). esms m / z 779 - 782 ( m + 2na ) + . the compounds of the general structure 3 were prepared in overall yields ranging from 20 - 40 % using the general route depicted in scheme a . the key synthetic intermediate ( 1 ) was reacted with the appropriate aldehyde at room temperature in for one hour to form the □ yridi base intermediate . the □ yridi base was not isolated but was reduced in situ with sodium triacetoxyborohydride . the t - butyl ester protecting groups were removed using 50 % tfa in dcm for 1 hour at room temperature . upon completion of the deprotection , the reactions were concentrated on a rotary evaporator and purified by hplc or flash chromatography to afford the desired products ( 3 ) in 40 - 80 % yield . the following compounds of the general structure 8 were prepared in overall yields ranging from 20 - 60 % by the route depicted in scheme b . the key synthetic intermediate ( 4 ) was reacted with the appropriate phenylisocyanate at room temperature to afford the desired protected intermediates ( 5 ) in good yields . the t - butyl ester protecting groups were removed in the presence of 50 % tfa in dcm for 1 hour at room temperature . upon completion , the reactions were concentrated on a rotary evaporator purified by hplc or recrystallization to afford the desired products ( 6 ) in 40 - 90 % yield . preparation of the 99m tc - labeled complexes were achieved by addition of 100 μl of a solution containing [ 99m tc ( co ) 3 ( h 2 o ) 3 ] + to 500 μl of 10 − 4 m solutions of the inhibitor - saac . the mixtures were heated at 70 ° c . for 30 min . the products were analyzed for their radiochemical purity by reverse - phase hplc . the stability of the radiolabeled compounds in solution and in serum were determined as a function of time and solution conditions . specifically , after radiolabeling and isolation , the product was stored at room temperature for 6 h after which hplc analysis was performed to check for degree of label retention , as well as potential product degradation . the reformation of tco 4 − and the presence of the reduced material tco 2 was analyzed . to assist in predicting the in vivo stability , ligand challenges were performed . specifically , the stabilities of the 99m tc complexes were investigated by incubating the hplc purified complexes in 5 % mouse serum at room temperature and 37 ° c . the ability of competing ligands , such as cysteine and dtpa , to extract tc - 99m from the complexes was studied by incubating the purified complexes with solutions ( pbs ph 7 . 2 ) containing competing ligands at final concentrations of 0 . 1 m . the results of the labeling competition studies demonstrated no degradation of the tc - 99m - complexes out to 6 hours in the serum or the competing ligands study . the results of the incubation at 37 ° c . after 6 hours are shown in fig2 . preparation of the iodine - 131 labeled compound n —[ n —[( s )- 1 , 3 - dicarboxypropyl ] carbamoyl ]- s - 3 - iodo - l - tyrosine ( i - 131 - dcit ) was achieved by addition of 100 ul of [ i - 131 ] nai in 0 . 1 n naoh to a pbs ( ph 7 . 2 ) solution containing dct ( 1 mg / ml ) in an iodogen tube ™ ( fisher scientific , pierce ). the mixture was vortexed for 3 minutes and stored at room temperature for 20 minutes . the stability of the radiolabeled compound in solution was determined as a function of time . specifically , after radiolabeling and isolation , the product was stored at room temperature for 48 h after which hplc analysis was performed to check for degree of label retention , as well as potential product degradation . the reformation of nai and the presence of the reduced iodates was analyzed . the results of the labeling stability study demonstrated no significant degradation of the i - 131 dcit out to 2 days at room temperature . the results of the study are shown in fig3 . preparation of the iodine - 131 labeled compound 2 -{ 3 -[ 1 - carboxy - 5 -( 4 - iodo - benzoylamino )- pentyl ]- ureido }- pentanedioic acid ( i - 131 - mip 1072 ) was achieved by addition of 100 ul of [ i - 131 ] nai in 0 . 1 n naoh with 30 μl methanol with 0 . 5 % acetic acid to a pbs ( ph 7 . 2 ) solution containing mip 1072 ( 1 mg / ml ) in an iodogen tube ( fisher scientific ). the mixture was vortexed for 3 minutes and stored at room temperature for 20 minutes . the stability of the radiolabeled compound in solution was determined as a function of time . specifically , after radiolabeling and isolation , the product was stored at 37 ° c . for 3 days after which hplc analysis was performed to check for degree of label retention , as well as potential product degradation . the reformation of nai and the presence of the reduced iodates was analyzed . the results of the labeling stability study demonstrated no significant degradation of the i - 13 11072 out to 3 days at room temperature in dmso , 10 % ethanol / saline , pbs ph 7 . 2 , and 6 % ascorbate / 3 % gentisic acid solution . the results of the study are shown in fig4 . the newly prepared saac - urea - glu conjugates were screened in a human prostate cancer cell binding assay using psma - positive , lncap cells , and psma - negative , pc3 cells . compounds demonstrating specific uptake or binding to psma - positive cells will be studied for tumor localization in vivo . in vitro cold screening assays verses 1 - 131 dcit . lncap and pc3 human prostate cancer cells were obtained from american type culture collection , rockville , md . lncap cells were maintained in rpmi - 1640 medium supplemented with 10 % fetal bovine serum ( fbs ). pc3 cells were grown in f12k medium supplemented with 10 % fbs . binding of the radiolabeled compound and competition with cold derivatives to lncap and pc - 3 cells was performed according to the methods of tang et al . ( tang , h . ; brown , m . ; ye , y . ; huang , g . ; zhang , y . ; wang , y . ; zhai , h . ; chen , x . ; shen , t . y . ; tenniswood , m ., prostate targeting ligands based on n - acetylated alpha - linked acidic dipeptidase , biochem . biophys . res . commun . 2003 , 307 , 8 - 14 ) with appropriate modifications . cells were plated in 12 - well plates at approximately 4 × 10 5 cells / well and incubated for 48 hours in a humidified incubator at 37 ° c ./ 5 % carbon dioxide prior to addition of compound . each unique saac - urea - glu conjugate was prepared and diluted in serum - free cell culture medium containing 0 . 5 % bovine serum albumin ( bsa ) in combination with 3 nm i - 131 dcit ( known inhibitor ). total binding was determined by incubating i - 131 dcit without test compound . plates were incubated at room temperature for 1 hour . cells were removed from the plates by gently pipetting and transferred to eppendorf tubes . samples were microcentrifuged for 15 seconds at 10k × g . the medium was aspirated and the pellet was washed twice by dispersal in fresh assay medium followed by microcentrifugation . cell binding of i - 131 dcit was determined by counting the cell pellet in an automated gamma counter . nonspecific binding was determined as the counts associated with the cells after incubating with 2 um nonradiolabeled compound or 2 - phosphonomethyl - pentanedioic acid ( pmpa ). the control compounds are depicted below . the two key compounds for the binding assays , are shown above : the i - dcit ( kozikowski et al ) and 2 - phosphonomethyl - pentanedioic acid ( pmpa - right ), a potent inhibitor with ic 50 = 6 nm . ( ii ) in vitro dose screening . i - 131 dcit bound specifically to lncap cells and not pc3 cells as is evident by the counts displaceable by nonradiolabeled compound or pmpa in lncap cells only ( fig5 ). binding constants were determined by incubating lncap cells with various amounts of nonradiolabeled dcit in the presence of a constant amount of i - 131 dcit and dividing by the specific activity of each solution to determine the number of fmoles compound bound ( fig6 ). the kd was determined to be 264 nm and bmax was 254 fmoles . compounds mip - 1008 and mip - 1033 which at 2 um competed with i - 131 dcit for binding to lncap cells , were retested at various doses to determine ic - 50 values ( fig7 and 8 ). while mip - 1072 , mip - 1095 , and mip - 1097 displayed ic50 values & lt ; 50 nm compounds mip - 1008 and mip - 1033 exhibited ic - 50s of 98 nm and 497 nm , respectively . compounds mip - 1025 , mip - 1028 , and mip - 1029 did not compete for binding ( table 1 ). in order to confirm the results of the scatchard analysis of fig7 indicating mip - 1072 internalization into lncap cells , the rate of uptake of mip - 1072 in lncap cells was monitored . each well was dosed with 100 nm mip - 1072 ( 2 uci / well ) at 4 ° c . and 37 ° c . binding to psma reached equilibrium after 15 min as evidenced by the plateau in the curve at 4 ° c . the cells incubated at 37 ° c . continued to internalize mip - 1072 after equilibrium had been reached . this result , fig1 , confirms the scatchard and indicates that mip - 1072 is indeed internalized . pooled male rat liver microsomes ( 1 mg / ml , bd biosciences ), nadph regenerating system ( 1 . 3 mm nadp , 3 . 3 mm glucose 6 - phosphate and 0 . 4 u / ml glucose 6 - phosphate dehydrogenase , bd biosciences ) and test compound ( 50 μm mip - 1072 , 50 μm dct , and 100 μm phenacetin ) were added to 0 . 1 m potassium phosphate buffer ( ph 7 . 4 ) in order to monitor the catastrophic degradation of the test compounds . the mixture was incubated at 37 ° c . and at the indicated time ( 0 , 15 , 60 min ) the reaction was stopped by the addition of an equal volume of ice cold methanol ( 500 μl ). the resulting slurry was then centrifuged at 21 , 000 × g for 10 min and the supernatant was collected and injected onto an agilent lcms model msd sl using a 95 : 5 water : acetonitrile ( with 0 . 1 % formic acid ) to 40 : 60 water : acetonitrile ( with 0 . 1 % formic acid ) gradient and monitoring for the parent ion only in single ion mode . the results , shown in fig1 a and 11b , are expressed as degradation of the parent ion with respect to the 0 min time point . the stability of mip - 1072 was assessed using rat liver microsomes . mip - 1072 ( 50 μm ) and phenacetin ( 100 μm ) were incubated with rat liver microsomes at 37 ° c . for the indicated time . phenacetin was used as a control substance that is known to be metabolized . mip - 1072 was not degraded by the rat liver microsomes during the incubation period . however , phenacetin was degraded by 22 % after a 60 min incubation . the lead compound , mip 1072 , was i - 131 - labeled for tissue distribution studies in mice with both lncap ( psma positive ) and pc3 ( psma negative ) tumors implanted . the compound was radiolabeled by the route shown below . the tissue biodistribution results , were consistent with the in - vitro data , and demonstrated significant uptake in the lncap ( psma positive ) tumors . the results also displayed a high degree of specificity with very little activity in the pc3 ( psma negative ) tumors . a graph depicting the mice distribution is shown below ( fig1 ). the biological assessment using n —[ n —[( s )- 1 , 3 - dicarboxypropyl ] carbamoyl ]- s - 3 - iodo - l - tyrosine ( i - 131 - dcit ) verses “ cold ” complexes proved to be a rapid first screen , followed by dose curves to determine accurate ic 50 values . the lead series of compounds that exhibited ic 50 values & lt ; 50 nm . in vivo data of the lead series demonstrated high affinity , with 3 % id / g accumulating in the lncap tumors , and high specificity with the lncap - to - pc3 ratio exceeding 15 - to 1 . lncap cell lysis protocol 2 confluent t75 flasks wash cells off the plate by pipetting up and down with media . wash with 0 . 32 m sucrose , re - centrifuge re - suspend cell pellet in 1 ml 50 mm tris - hcl , ph 7 . 4 , 0 . 5 % triton x - 100 centrifuge at 14000 rpm for 1 min to precipitate nuclei remove supernatant and divide into 50 ul aliquots store at − 80 c since using detergent in lysis step , make working reagent , a ′ by adding 20 ul of reagent s to each 1 ml of reagent a that will be needed for the run . ( if a precipitate forms , warm and vortex ) combine 25 μl standard / unknown , 100 μl a ′, 800 μl reagent b in duplicate . mix rxn buffer : 50 mm tris - hcl , ph 7 . 4 , 20 mm cocl 2 , 32 mm nacl make cold naag ( 100 mm stock ) dilute 1 / 100 in rxn buffer for 1 mm combine 600 ul buffer and lncap cell lysate ( 200 μg ) pre - incubate 37 c for 3 min pre - incubate rxn buffer and lncap cell lysate for 3 min at 37 c add 6 μl of 1 mm naag ( for 1 μm final conc ) spiked with 1 , 000 , 000 cpm of 3 h - naag ( 100 μl of 1 mm naag + 10 μl of 3h - naag ( 10 μci )). for competition add pmpa . at indicated time , stop reaction by removing 100 ul of the reaction - mix and adding an equal volume of ice cold 0 . 25 m kh 2 po 4 , ph 4 . 3 to stop the rxn apply ½ of mixture to 250 mg ag 50w - x4 cation exchange column ( 200 - 400 mesh , h + form , swell resin with di h2o prior to use ). save the other ½ for counting . wash column with 500 μl 1 : 1 rxn buffer / 0 . 25mkh 2 po 4 count 100 ul of the load , elution and reaction ( diluted 1 : 6 ) to minimize quenching time = 0 control values will be subtracted from experimental time points results expressed as pmol 3 h - glutamate formed / min / mg protein grant says inc only 10 min to ensure linearity , although luthi - carter , et al ( j pharm exp therap 1998 286 ( 2 )) says 2 hours still no effect on linearity and less than 20 % of the substrate consumed compounds of the present can be used to inhibit naaladase for therapeutic treatments . diseases that could be receptive to naaladase treatment include painful and sensory diabetic neuropathy , neuronal damage and prostate cancer , schizophrenia , colorectal cancer , inflammation , amyotrophic lateral schlerosis , or diabetic neuropathy . the present compounds can also be used an analgesic . guidance for the modeling of such therapeutic treatments can be found in goodman & amp ; gilman &# 39 ; s the pharmacological basis of therapeutics , mcgraw hill , 10 edition , 2001 , pharmaceutical preformulation and formulation : a practical guide from candidate drug selection to commercial dosage form , crc , 2001 and handbook of pharmaceutical excipients , apha publications , 5 edition , 2005 . the ability of non - radioactive analogs to compete with 131 i - dcit for binding to psma was tested in the psma positive human prostate cancer cell line , lncap cells . lncap cells ( 300 , 000 cells / well ) were incubated for 1 hour with 3 nm [ 131 i ]- dcit in the presence of 1 - 10 , 000 mm mip - 1072 in rpmi - 1640 medium supplemented with 0 . 5 % bovine serum albumin , then washed and counted in a gamma counter . all documents cited in this specification including patent applications are incorporated by reference in their entirety . the direct binding of 123 i - mip - 1072 to prostate cancer cells was examined ( fig1 ). lncap cells , or the psma negative cell line , pc3 cells , were incubated in rpmi - 1640 medium supplemented with 0 . 5 % bovine serum albumin for 1 hour with 3 nm 123 i - mip - 1072 alone , or in the presence of 10 μm unlabeled mip - 1072 , or 10 μm 2 -( phosphonomethyl )- pentanedioic acid ( pmpa ), a structurally unrelated naaladase inhibitor . cells were washed and counted in a gamma counter . the affinity constant ( k d ) of mip - 1072 was determined by saturation binding analysis ( fig1 ). lncap cells were incubated for 1 hour with 30 - 100 , 000 pm 131 i - mip - 1072 in hbs ( 50 mm hepes , ph 7 . 5 , 0 . 9 % sodium chloride ) at either 4 ° c . or 37 ° c . in the absence or presence of 10 μm unlabeled mip - 1072 ( to determine non - specific binding ). cells were then washed and the amount of radioactivity was measured on a gamma counter . specific binding was calculated as the difference between total binding and nonspecific binding . the affinity constant ( k d ) of the interaction of mip - 1072 with psma on lncap cells was determined by saturation binding analysis performed by titrating 123 i - mip - 1072 ( 3 pm - 1 , 000 nm ) in the presence and absence of an excess of non - radiolabeled mip - 1072 ( 10 μm ). a k d of 4 . 8 nm , and bmax of 1 , 490 fmoles / 10 6 cells at 4 ° c . was determined by nonlinear regression analysis using graph pad prism software ( fig1 ). the k d was not significantly different at 37 ° c ., 8 . 1 nm . the bmax , however , was greater at 37 ° c . than at 4 ° c . ; 1 , 490 vs . 4 , 400 fmol / 10 6 cells , respectively , indicating internalization of mip - 1072 . the results below are representative of two independent analyses . the ability of mip - 1072 to internalize in lncap cells was confirmed by an acid wash assay ( fig1 ). lncap cells were incubated in hbs with 100 nm 123 i - mip - 1072 for 0 - 2 hours at 4 and 37 ° c . at the indicated time the media was removed and the cells were incubated in mild acid buffer ( 50 mm glycine , 150 mm nacl , ph 3 . 0 ) at 4 ° c . for 5 minutes . after the brief incubation the cells were centrifuged at 20 , 000 × g for 5 minutes . the supernatant and cell pellet were counted in a gamma counter . in order to confirm the results of the saturation binding analysis indicating mip - 1072 internalization into lncap cells , we monitored the rate of uptake of mip - 1072 in lncap cells . each well was dosed with 100 nm mip - 1072 ( 2 uci / well ) at 4 ° c . and 37 ° c . binding to psma reached equilibrium after 15 min as evidenced by the plateau in the curve at 4 ° c . the cells incubated at 37 ° c . continued to internalize mip - 1072 after equilibrium had been reached . the results show a time dependent , acid insensitive increase in radioactivity associated with the pellet at 37 ° c . but not at 4 ° c ., indicating that 123 i - mip - 1072 is internalized at 37 ° c . but not at 4 ° c . ( fig1 ). a quantitative analysis of the tissue distribution of 123 i - mip - 1072 was performed in separate groups of male ncr nude −/− mice bearing psma positive lncap xenografts ( approximately 100 - 200 mm 3 ) administered via the tail vein as a bolus injection ( approximately 2 μci / mouse ) in a constant volume of 0 . 05 ml . the animals ( n = 5 / time point ) were euthanized by asphyxiation with carbon dioxide at 0 . 25 , 1 , 2 , 4 , 8 , and 24 hours post injection . tissues ( blood , heart , lungs , liver , spleen , kidneys , adrenals , stomach , large and small intestines ( with contents ), testes , skeletal muscle , bone , brain , adipose , and tumor ) were dissected , excised , weighed wet , transferred to plastic tubes and counted in an automated γ - counter ( lkb model 1282 , wallac oy , finland ). to compare uptake of 123 i - mip - 1072 in lncap versus pc3 tumors , and to demonstrate that the compound was on mechanism via competition with 2 -( phosphonomethyl )- pentanedioic acid ( pmpa ), some mice bearing either lncap or pc3 xenografts were pretreated with 50 mg / kg pmpa 5 minutes prior to injection with 123 i - mip - 1072 and selected tissues were harvested at 1 hour post injection . mip - 1072 , uptake and exposure was greatest in the kidney and lncap xenograft which express high levels of psma . peak uptake in the kidney was 158 ± 46 % id / g at 2 hours and the lncap xenograft was 17 ± 6 % id / g at 1 hours ( fig2 ). uptake in these target tissues was rapid , whereas the washout was slower in the lncap xenograft . 123 i - mip - 1072 was demonstrated to be on mechanism in vivo as evidenced by the localization to psma expressing lncap tumors but not pc3 tumors which do not express psma ( fig2 ). in addition , both the tumor and kidneys were blocked by pretreating the mice with pmpa , a potent inhibitor of psma . | 0 |
reference will now be made in detail to the presently preferred embodiments of the invention , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to like elements throughout . embodiments of the invention relate to an extension cord which is operated by a remote control , and a housing attached to the extension cord which is used to house the remote control . by locating the housing on the extension cord itself , and adapting the housing to securely , but removably , receive the remote control , a user would be less likely to lose the remote control . a remote control unit 100 is used to turn on / off power to sockets 108 ( not pictured in fig1 a ). fig1 b is a top view of the extension cord . a plug 104 is plugged into an electrical outlet ( not pictured ), typically located on a wall . a first section of a power cord 106 connects the plug 104 to a base 102 . the base 102 is used to house the remote control unit 100 . the base comprises a hollow portion 101 inside the base which is sized to receive the remote control unit 100 . the hollow portion 101 also comprises a housing floor 103 , which is a surface that is recessed below an outer surface of the base 102 . when the remote control unit 100 is inserted into the hollow portion 101 , the remote control unit 100 will rest on the housing floor 103 . the hollow portion 101 comprises a hole 105 which can be used by an operator to dislodge the remote control unit 100 when the remote control unit 100 is secured inside the base 102 . this can be done by the operator pressing his or her finger through the hole 105 , thereby pushing the remote control unit 100 out of the base 102 . a second section of the power cord 107 connects the base 102 to the sockets 108 ( not pictured in fig1 b ). the first section of the power cord 106 and the second section of the power cord 107 are typically part of the same cord and there is no interruption of the cord or the conductive material throughout the cord . the cord passes through , or under , the base 102 . fig2 is a side view of the remote control and extension cord . a remote control unit 100 is pictured alongside a base 102 . the base is connected to a cord which has a first section 106 and a second section 107 . fig3 is an orthogonal view of the remote control outside of the extension cord . the base 102 comprises a hollow portion 101 which comprises a hole 105 . the base is attached to first section of a cord 106 which is attached to a plug 104 . the base 102 is also attached to a second section of a cord 107 which is in turn connected to sockets 108 . the hollow portion 101 is the ovular portion which is really not a physical structure at all since it is a hollow portion . on the bottom of the hollow portion 101 is the housing floor 103 , which the remote control unit 100 rests on when the remote control unit 100 is secured inside the base ( see fig4 ). the remote control unit 100 is used to turn power on and off to the sockets . the remote control unit 100 can turn all of the sockets 108 on or off . alternatively , the remote control unit 100 can be used to turn individual sockets on and off . the remote control unit 100 would typically comprise an internal battery ( not pictured ) and a transmitter , as known in the art . the base 102 can comprise a battery ( or other power source ) to power a receiver ( not pictured ) which would detect a signal from the remote control unit 100 . illustrated is the remote control unit 100 separated from the base 102 . in this configuration , the user is free to walk around the room and operate the unit ( e . g ., turn power to the socket ( s ) on / off ). fig4 is an orthogonal view of the remote control inserted inside the extension cord . when the user is done operating the remote control unit 100 , the operator may wish to secure the remote control unit 100 in the base 102 for safekeeping ( which would prevent the remote control unit 100 from being lost ). the hollow portion 101 ( shown in fig3 ) is sized and adapted to allow the remote control unit 100 to make a snug fit therein . the housing floor 103 ( show in fig3 ) is used to support the remote control unit 100 so that the remote control unit 100 cannot be inserted any deeper into the base 102 . once inserted , the remote control unit 100 would remain inside due to internal physical force , until removed by the operator . the many features and advantages of the invention are apparent from the detailed specification and , thus , it is intended by the appended claims to cover all such features and advantages of the invention that fall within the true spirit and scope of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation illustrated and described , and accordingly all suitable modifications and equivalents may be resorted to , falling within the scope of the invention . | 7 |
the device according to the present invention will now be described in detail according to a particular , non - limiting embodiment ; this description being made with reference to the annexed drawings . fig1 shows a complete device for applying wax according to the invention . this device comprises a body 10 and an applicator head 12 attached to said body . this body 10 is made in a known manner out of plastic . the shape is obtained by extrusion blow molding , for example . a preform or parison made of plastic material is placed in a mold and the body is formed by molding , possibly by blowing air under pressure . in this case , the body 10 has a substantially cylindrical shape with upper 14 and lower 16 ends , fig2 . this hollow body 10 comprises an open neck 18 placing the inner volume of the body 10 out in the open , this open neck being provided with an outer screw thread 20 , as shown in fig2 , located on a shoulder 22 , constituting the upper end 14 of the body 10 . the lower end 16 remains opened after being removed from the mold so as to enable the filling of the device according to the invention with the product to be dispensed , epilation wax in the present case . the filling is carried out with a covering of said open neck 18 with a conventional cap , the applicator head 12 being made separately and mounted immediately before use , in lieu of the cap . once the body has been filled , this body 10 is sealed at the lower end 16 by flattening followed by border to border welding , constituting a segment substantially equal to the diameter of the body before flattening , measured perpendicular to this end . the body 10 can have a different shape than that illustrated , the drawn shape having , however , satisfactory design and ergonomics while providing a suitable capacity . the nature of the plastic material used is compatible with the wax which it contains so that , on the one hand , the wax does not adhere and , on the other hand , it allows the wax to be placed at the temperature of use , as explained later . the head 12 is composed of two pieces , shown in detail in fig3 , 4 , and 5 , namely a base 26 and a movable applicator 28 . the base 26 in fig3 and 4 comprises a peripheral envelope 30 with an open housing 32 having a substantially rectangular shape . the housing 32 thus comprises two longitudinal lateral surfaces 34 - 1 and 34 - 2 and two transverse lateral surfaces 36 - 1 and 36 - 2 and a bottom 38 . the longitudinal lateral surfaces 34 - 1 and 34 - 2 each have an arc - shaped upper border with a large radius of curvature , whereas the two transverse lateral surfaces 36 - 1 and 36 - 2 have rectilinear borders . generally , the edge of these 4 borders is rounded and the angles also have a curvature in order to avoid any harm to the skin during application as will be explained later . each of the longitudinal lateral surfaces 34 - 1 and 34 - 2 is provided , perpendicular to the apex of the arch , with a groove 40 - 1 and 40 - 2 ( fig6 ), open toward the free border of each of the surfaces and closed toward the inside of the housing , the shape being semi - circular . each groove 40 - 1 and 40 - 2 bears , immediately perpendicular to the border of said longitudinal lateral surface 34 - 1 and 34 - 2 , a lip 42 - 1 and 42 - 2 , having a triangular section , with a slope oriented toward the bottom 38 of the housing , facilitating the insertion and blocking the removal . thus , each groove 40 - 1 and 40 - 2 is delimited to form a bearing 44 - 1 and 44 - 2 . the bottom 38 of the housing is flat with a channel perpendicular to the angles between said bottom and the transverse and longitudinal lateral surfaces . the bottom 38 bears at its center a hole 46 for communication between the body 10 and the open housing 32 . under the bottom 38 , as shown in detail in fig6 also , a skirt 46 is provided comprising a screw thread 48 , produced by molding , adapted to cooperate in a sealed manner with the external screw head 20 of the open neck 18 . the movable applicator 28 is a wheel 50 comprising a peripheral rolling surface 52 and two domed surfaces 54 - 1 and 54 - 2 . this wheel 50 is provided with two cylindrical tabs 56 - 1 and 56 - 2 projecting perpendicularly to the rotation axis , forming a rotating shaft , arranged on both sides of the median plane . these tabs 56 - 1 and 56 - 2 have a shape adapted to cooperate in rotation with the bearings 44 - 1 and 44 - 2 of the longitudinal lateral walls 34 - 1 and 34 - 2 provided to receive them . the surface 52 for peripheral rolling of the wheel 50 comprises transverse grooves 58 having a sinusoidal cross - section , if the succession of grooves on the periphery in the median plane is considered . the depth of these grooves depends on the properties of the wax at application temperature as will be explained later . therefore , assembling the head is simple since the wheel 50 is inserted in the open housing 32 , the tabs 56 - 1 and 56 - 2 are in abutment on the lips 42 - 1 and 42 - 2 and an additional pressure causes the passage of the tabs beyond the lips to lodge themselves by ratcheting in bearings 44 - 1 and 44 - 2 . the tabs are thus maintained in these bearings and are free in rotation . the base 26 bearing the movable applicator 28 can thus be screwed on the body 10 . the three pieces are thus assembled to form the device according to the invention shown in fig1 . the device according to the invention is filled with a suitable wax , particularly , but not exclusively , sugar - based . to use it , the body 10 of the device is placed in a water bath , for example , or in any other hot water container with a conventional cap , the cap being advantageously oriented downward . the applicator head 12 is mounted only at the time of use . the first advantage is to dissolve the possible wax drippings resulting from a previous use . in parallel , the volume of wax contained is heated to the temperature suited to its application . it then suffices to unscrew the conventional cap to mount the applicator head by screwing and placing the wheel in contact with the skin on the area to be epilated , and then roll the wheel by translational displacement while maintaining pressure to deposit the wax on the desired area . the wheel ensures the dosage at the same time as the spreading . indeed , placing the wheel 50 in rotation makes it possible to circulate the wax coming from the body 10 which passes through the hole 46 to come out in the space situated between the wheel and the bottom 38 . the wheel functions as a mini wheel with blades , the blades being the transverse grooves 58 which ensure the distribution of wax at a suitable volume . similarly , the grooves in contact with the wax applied onto the skin allow for latching which sets said wheel into rotation , regulating the thickness of the applied wax . it must be noted that the contours can be followed precisely since the transverse borders do not hinder the maneuvers . the longitudinal lateral borders , being substantially perpendicular to the rotational axis of the wheel 50 are not a hindrance either . the wheel 50 is thus clear over more than half its circumference , which makes it very accessible . it must be noted that the wheel 50 rotates freely by creating in the open housing 32 a passage adapted for the wax to be expelled via the hole 46 . it must also be noted that the domed surfaces 54 - 1 and 54 - 2 prevent the wax from exiting the space created between one or the other of the lateral transverse surfaces 36 - 1 and 36 - 2 and the peripheral rolling surface 52 of the wheel , according to the displacement direction of the device . this allows a very precise , even dosing , with no gaps , proportional to the translational movement and thus proportional to the length of application . in order to feed the wheel to dose the quantity of wax , a slight pressure must be exerted on the flexible body 10 . it must be noted here also that even if the exerted pressure is accidentally substantial , the volume distributed cannot be substantial since the static flow is very limited since the wheel must rotate to free the necessary applicable volume . at the end of use , the applicator head 12 is disassembled , then rinsed for a future application and the body 10 receives the conventional cap again to ensure the remaining volume of wax is preserved . during the next use , the device is again ready to be put back in service by proceeding with the same steps as those carried out during the first use . | 0 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.