text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
the novel compounds encompassed by the instant invention can be described by general formula 1a - 1 : r 1 , r 2 , r 3 , r 4 and r 7 , r 8 and r 9 are the same or different and represent hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; where x carbon , r 6 represents hydrogen , halogen , hydroxy , lower alkyl having 1 - 6 carbon atoms , or lower alkoxy ; and where x is nitrogen , r 6 represents an electron pair ; where y is carbon , r 10 represents hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; and where y is nitrogen , r 10 represents an electron pair ; where z is carbon , r 11 represents hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy , or phenyl optionally substituted with one or two groups selected from hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; and when z is nitrogen , r 11 represents an electron pair ; r 12 and r 13 taken together may represent ( cr x r y ) s where s is an integer of from 1 - 6 and r x and r y independently represent hydrogen or lower alkyl ; r 7 and r 8 together may represent a benzo ring optionally substituted with up to four substitutents selected from hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; and r 14 , r 15 , r 16 and r 17 are the same or different and represent hydrogen or lower alkyl . r 1 , r 2 , r 3 , r 4 and r 7 , r 8 and r 9 are the same or different and represent hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; where x is carbon , r 6 represents hydrogen , halogen , hydroxy , lower alkyl having 1 - 6 carbon atoms , or lower alkoxy ; and where x is nitrogen , r 6 represents an electron pair ; where y is carbon , r 10 represents hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; and where y is nitrogen , r 10 represents an electron pair ; where z is carbon , r 11 represents hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy , or phenyl optionally substituted with one or two groups selected from hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; and when z is nitrogen , r 11 represents an electron pair ; r 12 and r 13 taken together represent ( ch 2 ) s where s is an integer of from 1 - 6 ; r 7 and r 8 together may represent a benzo ring optionally substituted with up to four substitutents selected from hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy . r 1 , r 2 , r 3 , r 4 and r 7 , r 8 and r 9 are the same or different and represent hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; where x carbon , r 6 represents hydrogen , halogen , hydroxy , lower alkyl having 1 - 6 carbon atoms , or lower alkoxy ; and where x is nitrogen , r 6 represents an electron pair ; where y is carbon , r 10 represents hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; and where y is nitrogen , r 10 represents an electron pair ; r 7 and r 8 together optionally represent a benzo ring optionally substituted with up to four substitutents selected from hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy . preferred compounds of formula 3 are those where m is 2 , 3 or 4 . particularly preferred compounds of formula 3 are those where m is 2 or 3 ; r 1 , r 2 , r 3 , r 4 are hydrogen ; r 7 and r 9 are hydrogen and r 8 is hydrogen , hydroxy , halogen or alkoxy . more particularly preferred compounds of formula 3 are those where m is 2 or 3 ; r 1 , r 2 , r 3 , r 4 are hydrogen ; r 16 is hydrogen or methyl ; r 7 and r 9 are hydrogen ; and r 8 is hydrogen , hydroxy or methoxy . still other preferred compounds of formula 3 are those where m is 2 or 3 ; x and y independently represent methylene optionally substituted with lower alkyl , preferably methyl ; r 1 , r 2 , r 3 , r 4 are hydrogen ; r 16 is hydrogen or methyl ; r 7 and r 9 are hydrogen and r 8 is hydrogen , hydroxy or methoxy . r 1 , r 2 , r 3 , r 4 and r 7 , r 8 and r 9 are the same or different and represent hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; where y is carbon , r 10 represents hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; and where y is nitrogen , r 10 represents an electron pair ; r 7 and r 8 together may represent a benzo ring optionally substituted with up to four substitutents selected from hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy . preferred compounds of formula 4 are those where m is 2 , 3 or 4 . particularly preferred compounds of formula 4 are those where m is 2 or 3 ; and r 1 , r 2 , r 3 , r 4 are hydrogen ; r 7 and r 9 are hydrogen ; and r 8 is hydrogen , hydroxy , halogen or alkoxy . more particularly preferred compounds of formula 4 are those where m is 2 or 3 ; and r 1 , r 2 , r 3 , r 4 are hydrogen ; r 7 and r 9 are hydrogen ; and r 8 is hydrogen , hydroxy or methoxy . r 1 , r 2 , r 3 , r 4 and r 7 , r 8 and r 9 are the same or different and represent hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; where x carbon , r 6 represents hydrogen , halogen , hydroxy , lower alkyl having 1 - 6 carbon atoms , or lower alkoxy ; and where x is nitrogen , r 6 represents an electron pair ; where y is carbon , r 10 represents hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; and where y is nitrogen , r 10 represents an electron pair ; r 7 and r 8 together optionally represent a benzo ring optionally substituted with up to four substitutents selected from hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy . preferred compounds of formula 5 are those where m is 2 , 3 or 4 and n is 0 . particularly preferred compounds of formula 5 are those where r 12 is hydrogen or alkyl ; m is 2 , n is 0 ; z is ch 2 ; r 1 , r 2 , r 3 , r 4 are hydrogen ; r 7 and r 9 are hydrogen ; and r 8 is hydrogen , hydroxy , halogen or alkoxy . more particularly preferred compounds of formula 5 are those where r 12 is hydrogen or methyl ; m is 2 ; n is 0 ; z is ch 2 ; and r 1 , r 2 , r 3 , r 4 are hydrogen ; r 7 and r 9 are hydrogen ; and r 8 is hydrogen , hydroxy or methoxy . r 1 , r 2 , r 3 , r 4 and r 8 are the same or different and represent hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; r 6 and r 10 independently represent hydrogen , halogen , hydroxy , lower alkyl , or lower alkoxy ; preferred compounds of formula 6 are those where m is 2 , 3 or 4 and n is 0 . particularly preferred compounds of formula 6 are those where r 12 is hydrogen or alkyl ; m is 2 , n is 0 ; z is ch 2 ; r 1 , r 2 , r 3 , r 4 are hydrogen ; and r 8 is hydrogen , hydroxy , halogen or alkoxy . more particularly preferred compounds of formula 6 are those where r 12 is hydrogen or methyl ; r 6 is hydrogen ; r 10 is hydrogen or lower alkoxy , preferably methoxy ; m is 2 ; n is 0 ; z is ch 2 ; and r 1 , r 2 , r 3 , r 4 are hydrogen ; and r 8 is hydrogen , hydroxy or methoxy . r 1 , r 2 , and r 3 independently represent hydrogen , halogen , hydroxy , alkyl , alkoxy , alkylthio , amino , monoalkylamino , dialkylamino , cyano , nitro , trifluoromethyl or trifluoromethoxy ; r 6 is hydrogen or c 1 - c 6 alkyl , more preferably r 6 is hydrogen , methyl or ethyl ; a represents an alkylene group of 2 to 5 carbon atoms optionally substituted with one or more alkyl groups having from 1 to 4 carbon atoms ; m is 0 or an integer of from 1 to 2 ; and y and z are the same or different and represent either carbon or nitrogen ; and r 4 and r 5 independently represent hydrogen , halogen , alkyl , alkoxy , alkylthio , hydroxy , amino , monoalkylamino , dialkylamino , cyano , nitro , trifluoromethyl or trifluoromethoxy . r 1 , r 2 , and r 3 independently represent hydrogen , halogen , hydroxy , alkyl , alkoxy , alkylthio , amino , monoalkylamino , dialkylamino , cyano , nitro , trifluoromethyl or trifluoromethoxy ; r 6 is hydrogen or c 1 - c 6 alkyl , more preferably r 6 is hydrogen , methyl or ethyl ; a represents an alkylene group of 2 to 5 carbon atoms optionally substituted with one or more alkyl groups having from 1 to 4 carbon atoms ; m is 0 or an integer of from 1 to 2 ; x and y are the same or different and represent either carbon or nitrogen ; and r 4 and r 5 independently represent hydrogen , halogen , alkyl , alkoxy , alkylthio , hydroxy , amino , monoalkylamino , dialkylamino , cyano , nitro , trifluoromethyl or trifluoromethoxy . r 1 , r 2 , and r 3 independently represent hydrogen , halogen , hydroxy , alkyl , alkoxy , alkylthio , amino , monoalkylamino , dialkylamino , cyano , nitro , trifluoromethyl or trifluoromethoxy ; r 6 is hydrogen or c 1 - c 6 alkyl , more preferably r 6 is hydrogen , methyl or ethyl ; a represents an alkylene group of 2 to 5 carbon atoms optionally substituted with one or more alkyl groups having from 1 to 4 carbon atoms ; m is 0 or an integer of from 1 to 2 ; and r 1 , r 2 , and r 3 independently represent hydrogen , halogen , hydroxy , alkyl , alkoxy , alkylthio , amino , monoalkylamino , dialkylamino , cyano , nitro , trifluoromethyl or trifluoromethoxy ; r 6 is hydrogen or c 1 - c 6 alkyl , more preferably r 6 is hydrogen , methyl or ethyl ; a represents an alkylene group of 2 to 5 carbon atoms optionally substituted with one or more alkyl groups having from 1 to 4 carbon atoms ; m is 0 or an integer of from 1 to 2 ; y and x are the same or different and represent either carbon or nitrogen ; and r 4 and r 5 independently represent hydrogen , halogen , alkyl , alkoxy , alkylthio , hydroxy , amino , monoalkylamino , dialkylamino , cyano , nitro , trifluoromethyl or trifluoromethoxy . preferred compounds of formula 10 are those where a is alkylene of from 2 - 4 carbon atoms . more preferred compounds of formula 10 are those where a is alkylene of from 2 - 4 carbon atoms ; r 1 , r 2 , and r 3 are hydrogen ; r 6 is hydrogen or c 1 - 2 alkyl , and r 4 and r 5 independently represent hydrogen , hydroxy , halogen or alkoxy . particularly preferred compounds of formula 10 are those where a is alkylene of from 2 - 4 carbon atoms ; r 1 , r 2 , and r 3 are hydrogen ; r 6 is hydrogen or c 1 - 2 alkyl , y and x are both nitrogen , and r 4 and r 5 independently represent hydrogen , hydroxy , halogen or alkoxy . other particularly preferred compounds of formula 10 are those where a is alkylene of from 2 - 4 carbon atoms ; r 1 , r 2 , and r 3 are hydrogen ; r 6 is hydrogen or c 1 - 2 alkyl , y is carbon and x is nitrogen , and r 4 and r 5 independently represent hydrogen , hydroxy , halogen or alkoxy . still other particularly preferred compounds of formula 10 are those where a is alkylene of from 2 - 4 carbon atoms ; r 1 , r 2 , and r 3 are hydrogen ; r 6 is hydrogen or c 1 - 2 alkyl , y and x are carbon , and r 4 and r 5 independently represent hydrogen , hydroxy , halogen or alkoxy . r 1 , r 2 , and r 3 independently represent hydrogen , halogen , hydroxy , alkyl , alkoxy , alkylthio , amino , monoalkylamino , dialkylamino , cyano , nitro , trifluoromethyl or trifluoromethoxy ; r 6 is hydrogen or c 1 - c 6 alkyl , more preferably r 6 is hydrogen , methyl or ethyl ; a represents an alkylene group of 2 to 5 carbon atoms optionally substituted with one or more alkyl groups having from 1 to 4 carbon atoms ; m is 0 or an integer of from 1 to 2 ; and r 1 , r 2 , and r 3 independently represent hydrogen , halogen , hydroxy , alkyl , alkoxy , alkylthio , amino , monoalkylamino , dialkylamino , cyano , nitro , trifluoromethyl or trifluoromethoxy ; r 6 is hydrogen or c 1 - c 6 alkyl , more preferably r 6 is hydrogen , methyl or ethyl ; a represents an alkylene group of 2 to 5 carbon atoms optionally substituted with one or more alkyl groups having from 1 to 4 carbon atoms ; m is 0 or an integer of from 1 to 2 ; y and x are the same or different and represent either carbon or nitrogen ; and r 4 and r 5 independently represent hydrogen , halogen , alkyl , alkoxy , alkylthio , hydroxy , amino , monoalkylamino , dialkylamino , cyano , nitro , trifluoromethyl or trifluoromethoxy . preferred compounds of formula 12 are those where a is alkylene of from 2 - 4 carbon atoms . more preferred compounds of formula 12 are those where a is alkylene of from 2 - 4 carbon atoms ; r 1 , r 2 , and r 3 are hydrogen ; r 6 is hydrogen or c 1 - 2 alkyl , and r 4 and r 5 independently represent hydrogen , hydroxy , halogen or alkoxy . particularly preferred compounds of formula 12 are those where a is alkylene of from 2 - 4 carbon atoms ; r 1 , r 2 , and r 3 are hydrogen ; r 6 is hydrogen or c 1 - 2 alkyl , y and x are both nitrogen , and r 4 and r 5 independently represent hydrogen , hydroxy , halogen or alkoxy . other particularly preferred compounds of formula 12 are those where a is alkylene of from 2 - 4 carbon atoms ; r 1 , r 2 , and r 3 are hydrogen ; r 6 is hydrogen or c 1 - 2 alkyl , y is carbon and x is nitrogen , and r 4 and r 5 independently represent hydrogen , hydroxy , halogen or alkoxy . still other particularly preferred compounds of formula 12 are those where a is alkylene of from 2 - 4 carbon atoms ; r 1 , r 2 , and r 3 are hydrogen ; r 6 is hydrogen or c 1 - 2 alkyl , y and x are carbon , and r 4 and r 5 independently represent hydrogen , hydroxy , halogen or alkoxy . in those formulas where more than one of the same substituent appears , e . g ., alkyl , those substituents are the same or different . representative compounds of the present invention , which are encompassed by formula 1 , include , but are not limited to the compounds shown below in table 1 and their pharmaceutically acceptable salts . non - toxic pharmaceutically acceptable salts include salts of acids such as hydrochloric , phosphoric , hydrobromic , sulfuric , sulfinic , formic , toluene sulfonic , hydroiodic , acetic and the like . those skilled in the art will recognize a wide variety of non - toxic pharmaceutically acceptable addition salts . the present invention also encompasses the acylated prodrugs of the compounds of formula 1 . those skilled in the art will recognize various synthetic methodologies which can be employed to prepare non - toxic pharmaceutically acceptable addition salts and acylated prodrugs of the compounds encompassed by formula 1 . by “ aryl ” and “ ar ” is meant an aromatic carbocyclic group having a single ring ( e . g ., phenyl ), multiple rings ( e . g ., biphenyl ), or multiple condensed rings in which at least one is aromatic , ( e . g ., 1 , 2 , 3 , 4 - tetrahydronaphthyl , naphthyl , anthryl , or phenanthryl ), which can optionally be unsubstituted or substituted with e . g ., halogen , lower alkyl , lower alkoxy , lower alkylthio , trifluoromethyl , lower acyloxy , aryl , heteroaryl , and hydroxy . by “ alkyl ” and “ lower alkyl ” is meant straight and branched chain alkyl groups having from 1 - 6 carbon atoms . in mono - and dialkylamino groups as used herein , the alkyl groups are independently c 1 - c 6 alkyl groups . by “ lower alkoxy ” and “ alkoxy ” is meant straight and branched chain alkoxy groups having from 1 - 6 carbon atoms . by “ alkylthio ” is meant groups of the formula — sr where r is c 1 - c 6 alkyl . by “ heteroaryl ” is meant 5 , 6 , or 7 membered aromatic ring systems having at least one hetero atom selected from the group consisting of nitrogen , oxygen and sulfur . examples of heteroaryl groups are pyridyl , pyrimidinyl , pyrrolyl , pyrazolyl , pyrazinyl , pyridazinyl , oxazolyl , furanyl , quinolinyl , isoquinolinyl , thiazolyl , and thienyl , which can optionally be unsubstituted or substituted with e . g ., halogen , lower alkyl , lower alkoxy , lower alkylthio , trifluoromethyl , lower acyloxy , aryl , heteroaryl , and hydroxy . by alkylsulfonyl is meant a sulfonyl group substituted with a lower alkyl group . by arylalkylsulfonyl is meant a sulfonyl group substituted with an arylalkyl group . by aminosulfonyl is meant a sulfonyl group substituted with an amino group . by alkylaminosulfonyl is meant a sulfonyl group substituted with a lower alkylamino , or di - lower alkylamino group . representative examples of bridged 4 - phenyl - 2 - aminomethylimidazoles according to the invention are shown in table 1 below . pellets of cos cells containing recombinantly produced d2 or d3 receptors from african green monkey were used for the assays . the sample is homogenized in 100 volumes ( w / vol ) of 0 . 05 m tris hcl buffer at 4 ° c . and ph 7 . 4 . the sample is then centrifuged at 30 , 000 × g and resuspended and rehomogenized . the sample is then centrifuged as described and the final tissue sample is frozen until use . the tissue is resuspended 1 : 20 ( wt / vol ) in 0 . 05 m tris hcl buffer containing 100 mm nacl . incubations are carried out at 48 ° c . and contain 0 . 4 ml of tissue sample , 0 . 5 nm 3 ii - ym 09151 - 2 and the compound of interest in a total incubation of 1 . 0 ml . nonspecific binding is defined as that binding found in the presence of 1 mm spiperone ; without further additions , nonspecific binding is less than 20 % of total binding . the binding characteristics of examples of this patent for the d2 and d 3 receptor subtypes are shown in table 2 for rat striatal homogenates . clonal cell lines expressing the human dopamine d 4 receptor subtype were harvested in pbs and the cells centrifuged and the pellets stored at − 80 ° c . until used in the binding assay . the pellets were resuspended and the cells lysed at 4 ° c . in 50 mm tris ph 7 . 4 buffer containing 120 mm nacl , 1 mm edta and 5 mm mgcl 2 . the homogenate is centrifuged at 48000 × g for 10 minutes at 4 ° c . the resulting pellet is resuspended in fresh buffer and centrifuged again . after resuspension of the pellet in fresh buffer a 100 ml aliquot is removed for protein determination . the remaining homogenate is centrifuged as above , the supernatant removed and the pellet stored at 4 ° c . until needed at which time it is resuspended to a final concentration of 625 mg / ml ( 250 mg per sample ) with 50 mm tris buffer ( ph 7 . 4 ) and 120 mm nacl just prior to use . incubations were carried out for 60 minutes at 25 ° c . in the presence of 0 . 1 nm [ 3 h ] ym - 09151 - 2 . the incubation was terminated by rapid filtration through whatman gf / c filters and rinsed with 2 × 4 ml washes of chilled 50 mm tris ( ph 7 . 4 ) and 120 mm nacl . non - specific binding was determined with 1 mm spiperone and radioactivity determined by counting in an lkb beta counter . binding parameters were determined by non - linear least squares regression analysis , from which the inhibition constant ki could be calculated for each test compound . the binding characteristics of some examples of this invention are shown in table 3 for the dopamine d 4 binding assay . in general , compounds of the accompanying examples were tested in the above assay , and all were found to possess a ki value for the displacement of [ 3 h ] ym - 09151 - 2 from the human dopamine d 4 receptor subtype of below 500 nm . some specific data is indicated in table 3 . pellets of cos cells containing recombinantly produced d 2 or d 4 receptors from african green monkey were used for the assays . the sample is homogenized in 100 volumes ( w / vol ) of 0 . 05 m tris hcl buffer at 4 ° c . and ph 7 . 4 . the sample is then centrifuged at 30 , 000 × g and resuspended and rehomogenized . the sample is then centrifuged as described and the final tissue sample is frozen until use . the tissue is resuspended 1 : 20 ( wt / vol ) in 0 . 05 m tris hcl buffer containing 100 mm nacl . incubations are carried out at 48 ° c . and contain 0 . 4 ml of tissue sample , 0 . 5 nm 3 h - ym 09151 - 2 and the compound of interest in a total incubation of 1 . 0 ml . nonspecific binding is defined as that binding found in the presence of 1 mm spiperone ; without further additions , nonspecific binding is less that 20 % of total binding . the binding characteristics of examples of this patent for the d 2 and d 4 receptor subtypes are shown in table 1 for rat striatal homogenates . the compounds of general formulas 1 may be administered orally , topically , parenterally , by inhalation or spray or rectally in dosage unit formulations containing conventional non - toxic pharmaceutically acceptable carriers , adjuvants and vehicles . the term parenteral as used herein includes subcutaneous injections , intravenous , intramuscular , intrasternal injection or infusion techniques . in addition , there is provided a pharmaceutical formulation comprising a compound of general formula 1 and a pharmaceutically acceptable carrier . one or more compounds of general formula 1 may be present in association with one or more non - toxic pharmaceutically acceptable carriers and / or diluents and / or adjuvants and if desired other active ingredients . the pharmaceutical compositions containing compounds of general formula 1 may be in a form suitable for oral use , for example , as tablets , troches , lozenges , aqueous or oily suspensions , dispersible powders or granules , emulsion , hard or soft capsules , or syrups or elixirs . compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents , flavoring agents , coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations . tablets contain the active ingredient in admixture with non - toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets . these excipients may be for example , inert diluents , such as calcium carbonate , sodium carbonate , lactose , calcium phosphate or sodium phosphate ; granulating and disintegrating agents , for example , corn starch , or alginic acid ; binding agents , for example starch , gelatin or acacia , and lubricating agents , for example magnesium stearate , stearic acid or talc . the tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period . for example , a time delay material such as glyceryl monosterate or glyceryl distearate may be employed . formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent , for example , calcium carbonate , calcium phosphate or kaolin , or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium , for example peanut oil , liquid paraffin or olive oil . aqueous suspensions contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions . such excipients are suspending agents , for example sodium carboxymethylcellulose , methylcellulose , hydropropylmethylcellulose , sodium alginate , polyvinylpyrrolidone , gum tragacanth and gum acacia ; dispersing or wetting agents may be a naturally - occurring phosphatide , for example , lecithin , or condensation products of an alkylene oxide with fatty acids , for example polyoxyethylene stearate , or condensation products of ethylene oxide with long chain aliphatic alcohols , for example heptadecaethyleneoxycetanol , or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate , or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides , for example polyethylene sorbitan monooleate . the aqueous suspensions may also contain one or more preservatives , for example ethyl , or n - propyl p - hydroxybenzoate , one or more coloring agents , one or more flavoring agents , and one or more sweetening agents , such as sucrose or saccharin . oily suspensions may be formulated by suspending the active ingredients in a vegetable oil , for example arachis oil , olive oil , sesame oil or coconut oil , or in a mineral oil such as liquid paraffin . the oily suspensions may contain a thickening agent , for example beeswax , hard paraffin or cetyl alcohol . sweetening agents such as those set forth above , and flavoring agents may be added to provide palatable oral preparations . these compositions may be preserved by the addition of an anti - oxidant such as ascorbic acid . dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent , suspending agent and one or more preservatives . suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above . additional excipients , for example sweetening , flavoring and coloring agents , may also be present . pharmaceutical compositions of the invention may also be in the form of oil - in - water emulsions . the oily phase may be a vegetable oil , for example olive oil or arachis oil , or a mineral oil , for example liquid paraffin or mixtures of these . suitable emulsifying agents may be naturally - occurring gums , for example gum acacia or gum tragacanth , naturally - occurring phosphatides , for example soy bean , lecithin , and esters or partial esters derived from fatty acids and hexitol , anhydrides , for example sorbitan monoleate , and condensation products of the said partial esters with ethylene oxide , for example polyoxyethylene sorbitan monoleate . the emulsions may also contain sweetening and flavoring agents . syrups and elixirs may be formulated with sweetening agents , for example glycerol , propylene glycol , sorbitor or sucrose . such formulations may also contain a demulcent , a preservative and flavoring and coloring agents . the pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleaginous suspension . this suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above . the sterile injectable preparation may also be sterile injectable solution or suspension in a non - toxic parentally acceptable diluent or solvent , for example as a solution in 1 , 3 - butanediol . among the acceptable vehicles and solvents that may be employed are water , ringer &# 39 ; s solution and isotonic sodium chloride solution . in addition , sterile , fixed oils are conventionally employed as a solvent or suspending medium . for this purpose any bland fixed oil may be employed including synthetic mono or diglycerides . in addition , fatty acids such as oleic acid find use in the preparation of injectables . the compounds of general formula 1 may also be administered in the form of suppositories for rectal administration of the drug . these compositions can be prepared by mixing the drug with a suitable non - irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug . such materials are cocoa butter and polyethylene glycols . compounds of general formula 1 may be administered parenterally in a sterile medium . the drug , depending on the vehicle and concentration used , can either be suspended or dissolved in the vehicle . advantageously , adjuvants such as local anaesthetics , preservatives and buffering agents can be dissolved in the vehicle . dosage levels of the order of from about 0 . 1 mg to about 140 mg per kilogram of body weight per day are useful in the treatment of the above - indicated conditions ( about 0 . 5 mg to about 7 g per patient per day ). the amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration . dosage unit forms will generally contain between from about 1 mg to about 500 mg of an active ingredient . it will be understood , however , that the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed , the age , body weight , general health , sex , diet , time of administration , route of administration , and rate of excretion , drug combination and the severity of the particular disease undergoing therapy . the compounds of the invention may be prepared by the reactions shown below in scheme 1 . those having skill in the art will recognize that the starting materials may be varied and additional steps employed to produce other compounds encompassed by the present invention . where the a ring is as defined above and nr a r b represens the group wherein cr ′ r ″, k , r 11 , r 12 , r 13 , ar , and m and n are as defined above . a compound of formula 1 , or a pharmaceutically acceptable acid addition salt thereof may be prepared according to the reaction scheme 2 . wherein r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , n , m , w , y and z are as defined above for formula 1b . as shown , an isoquinoline of general structure iv , possessing an appropriate leaving group l at the 1 position , may be reacted with a primary or secondary amine of general structure v in the presence of a base to afford a compound of formula i as the desired product . where they are not commercially available , the compounds of general structure iv may be prepared by procedures analogous to those described in the literature . compounds of general structure v are either known or capable of being prepared by the methods known in the art . those having skill in the art will recognize that the starting materials may be varied and additional steps employed to produce compounds encompassed by the present invention . the invention is further illustrated by the following examples which are not to be construed as limiting the invention in scope or spirit to the specific procedures and compounds described therein . to a solution of trimethyloxonium tetrafluoroborate ( 2 . 20 g , 14 . 9 mmol ) in ( ch 2 cl 2 , 20 ml ) was added a solution of phthalimidine ( 1 . 8 g , 13 . 5 mmol ) in ch 2 cl 2 ( 20 ml ) and the solution was stirred for 24 h . the solvent was evaporated in vacuo and the residue was dissolved in chloroform ( 80 ml ). to this solution was added 1 -( aminoethyl )- 4 -( 2 - pyrimidinyl ) piperazine ( 2 . 08 g , 9 . 0 mmol ) followed by triethylamine ( 5 ml ). the solution was boiled under reflux overnight and then the solvent was evaporated in vacuo to afford a semisolid residue . the residue was dissolved in water ( 100 ml ) and extracted with ethyl acetate ( 3 × 100 ml ) to remove unreacted phthalimidine and primary amine . the aqueous solution was adjusted to about 20 % naoh by slow addition of aqueous 50 % naoh and then extracted with chloroform ( 2 × 100 ml ). the combined chloroform extracts were dried ( k 2 co 3 ) and evaporated to give 1 as a pale yellow oil ( 2 . 9 g , quantitative ). the hydrobromide salt was crystallized from hot ethanol . to a solution of trimethyloxonium tetrafluoroborate ( 1 . 10 g , 7 . 45 mmol ) in ( ch 2 cl 2 , 10 ml ) was added a solution of phthalimidine ( 0 . 9 g , 6 . 75 mmol ) in ch 2 cl 2 ( 10 ml ) and the solution was stirred for 24 h . the solvent was evaporated in vacuo and the residue was dissolved in chloroform ( 40 ml ). to this solution was added 3 -( aminopropyl )- 4 -( 2 - pyrimidinyl ) piperazine ( 1 . 1 g , 4 . 5 mmol ) followed by triethylamine ( 5 ml ). the solution was boiled under reflux overnight and then the solvent was evaporated in vacuo to afford a semisolid residue . the residue was dissolved in water ( 50 ml ) and extracted with ethyl acetate ( 3 × 50 ml ) to remove unreacted phthalimidine and primary amine . the aqueous solution was adjusted to about 20 % naoh by slow addition of aqueous 50 % naoh and then extracted with chloroform ( 2 × 50 ml ). the combined chloroform extracts were dried ( k 2 co 3 ) and evaporated to give 2 as a pale yellow oil ( 0 . 75 g , 38 %). the hydrobromide salt crystallized from hot ethanol : mp 149 - 150 ° c . ; base 1 h - nmr ( cdcl3 ) 8 . 38 ( d , 2h ), 7 . 3 - 7 . 5 ( m , 5h ), 6 . 55 ( t , 1h ), 4 . 62 ( s , 2h ), 3 . 9 ( m , 4h ), 3 . 63 ( m , 2h ), 2 . 63 ( m , 6h ), 1 . 8 ( m , 2h ). the following compounds are prepared essentially according to the procedures set forth above in examples 1 and 2 . a mixture of n -( 2 - bromoethyl ) phthalimide ( 17 . 2 g , 0 . 068 mole ), 1 -( 5 - fluoropyrimidin - 2 - yl ) piperazine ( 12 . 4 g , 0 . 068 mole ) and potassium carbonate ( 18 . 8 g , 0 . 14 mole ) in dimethyl formamide ( 150 ml ) was heated at 80 ° c . for 14 hours under a nitrogen atmosphere . after cooling , the reaction mixture was poured into water ( 1 l ) and ether . ( 1 l ). the heterogeneous mixture was then filtered to remove solids and the layers separated . the aqueous layer was further extracted with ether ( 2 × 300 ml ). the combined organic layers were dried ( na 2 so 4 ) and concentrated to provide a yellow solid ( 16 . 9 g ). the solid were refluxed under nitrogen in hydrazine hydrate ( 100 ml ) for 3 h . after cooling the solution was poured into 30 % potassium carbonate solution ( 50 ml ) and extracted with methylene chloride . the organic extracts were dried ( na 2 so 4 ) and concentrated to give an orange semisolid ( 9 . 7 g ). this material was dissolved in methanol ( 5 ml ) and combined with a methanolic solution ( 10 ml ) of fumaric acid ( 5 g ). isopropanol was added ( 50 ml ) and the mixture was concentrated on a hot plate to a volume of 20 ml . upon cooling the yellow crystals of fumarate salt were collected ( 8 . 72 g , m . p . 193 - 194 ° c .). a solution of 1 -( 5 - fluoropyrimidin - 2 - yl )- 4 -( 2 - aminoethyl ) piperazine ( 500 mg ) in xylene ( 15 ml ) was treated with 1 - chloroisoquinoline ( 430 mg ) and potassium carbonate ( 300 mg ). the mixture was refluxed under n 2 overnight . after cooling the solution was diluted with diethyl ether ( 200 ml ) and washed with water ( 3 × 50 ml ). the organic layer was then extracted with a aqueous solution of 10 % acetic acid . the aqueous extract was then washed with ether ( 50 ml ), basified with 50 % naoh solution and extracted with chloroform . the chloroform layer was dried ( na 2 so 4 ) and evaporated to give the product as an oil which was purified by preparative thin layer chromatography eluting with 10 % methanol in chloroform . the resulting white solid was dissolved in isopropanol : ethanol ( 3 ml ), treated with 48 % hbr until acidic . the off - white crystalline hydrobromide salt was collected by filtration ( 0 . 012 g , mp 285 - 288 ° c .). the following compounds are prepared essentially according to the procedures set forth above , and , in particular , the procedures of examples 4 and 5 . the disclosures in this application of all articles and references , including patents , are incorporated herein by reference . the invention and the manner and process of making and using it are now described in such full , clear , concise and exact terms as to enable any person skilled in the art to which it pertains , to make and use the same . it is to be understood that the foregoing describes preferred embodiments of the present invention and that modifications may be made therein without departing from the spirit or scope of the present invention as set forth in the claims . to particularly point out and distinctly claim the subject matter regarded as invention , the following claims conclude the specification . | 2 |
as shown in fig1 , a vise 100 ( such as , but not limited to , a conventional 6 - inch single station vise ) may include a plurality of jaws 102 , 104 , such as a moveable jaw 102 and a fixed jaw 104 , which may be used to hold a work piece 120 ( shown in phantom ). an exemplary jaw plate 10 , 12 according to the present disclosure may be mounted to each of the vise jaws 102 , 104 using , for example socket head cap screws . the jaw plates 10 , 12 may be sized to fit any vise 100 having a standard bolt pattern . parallels 106 , 108 may be attached to the jaw plates 10 , 12 . fig2 and 3 a - 3 c depict an exemplary pin stop jaw plate 10 according to the present disclosure . the exemplary pin stop jaw plate 10 includes mounting holes 14 , 16 for mounting the jaw plate 10 to the fixed jaw 104 . mounting holes 14 , 16 may have chamfered edges and may include portions having different diameters . back face 20 may be mounted against fixed jaw 104 . in addition , pin stop jaw plate 10 may include a slot 82 , which may be located adjacent to a bottom edge of the jaw plate 10 , for attachment of a parallel 106 , 108 or another similar device , such as a mill angle . exemplary parallels 106 , 108 may be installed and removed without tools using only the operator &# 39 ; s finger pressure , for example . in an exemplary embodiment , holes 22 , 24 , 26 , 28 , 30 , 32 , 34 , 36 , 38 are located on front face 18 of jaw plate 10 . each of holes 22 , 24 , 26 , 28 , 30 , 32 , 34 , 36 , 38 houses a pin 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 . in fig2 , pin 44 is shown in an extended position ( pin 44 extends substantially beyond front face 18 ) while the remaining pins 40 , 42 , 46 , 48 , 50 , 52 , 54 , 56 are shown in the retracted position ( pins 40 , 42 , 46 , 48 , 50 , 52 , 54 , 56 do not extend beyond front face 18 ). while the exemplary embodiment shown in fig2 includes nine holes housing nine pins in a horizontal linear arrangement , it is within the scope of the disclosure include more or fewer pins in a linear or other arrangement . for example , one or more pins may be spaced vertically relative to each other . see , for example , fig6 and 7 , which show alternative exemplary arrangements of pins . fig6 shows jaw plate 210 which includes 9 holes 222 , 224 , 226 , 228 , 230 , 232 , 234 , 236 , 238 ( each housing a corresponding pin similar to pin 250 ) in addition to mounting holes 214 and 216 . the 9 holes 222 , 224 , 226 , 228 , 230 , 232 , 234 , 236 , 238 are arranged along two vertically separated , parallel lines 208 , 209 on face 218 of jaw plate 210 . fig7 shows another alternative exemplary arrangement in which holes 322 , 324 , 326 , 328 , 330 , 332 , 334 , 336 , 338 are arranged linearly on face 318 of jaw plate 310 along line 308 . holes 340 , 342 are located vertically beneath hole 330 between mounting holes 314 , 316 along line 309 . in this exemplary embodiment , lines 308 , 309 are non - parallel and intersect at hole 330 , although it is within the scope of the disclosure for such non - parallel lines to intersect at any position either on or not on face 318 . each of the holes 322 , 324 , 326 , 328 , 330 , 332 , 334 , 336 , 338 , 340 , 342 may include a pin , such as pin 341 . generally , it is within the scope of the disclosure to locate one or more holes at any location on jaw plate 10 and it is not necessary that any or all of the holes is arranged linearly . fig3 a - 3c depict an exemplary jaw plate 10 without pins 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 installed . each of holes 22 , 24 , 26 , 28 , 30 , 32 , 34 , 36 , 38 connects to one of holes 23 , 25 , 27 , 29 , 31 , 33 , 35 , 37 , 39 , which may have a larger diameter than holes 22 , 24 , 26 , 28 , 30 , 32 , 34 , 36 , 38 . as shown in fig3 b and 3c , the location where a hole 22 , 24 , 26 , 28 , 30 , 32 , 34 , 36 , 38 joins a hole 23 , 25 , 27 , 29 , 31 , 33 , 35 , 37 , 39 having a different diameter may form a shoulder 21 . an exemplary jaw plate 10 may also include holes 68 , 70 , which may be partially or fully threaded and / or may include portions having different diameters . holes 68 and 70 may be used , for example , for attaching an additional work stop or aligning the jaw . see , for example , fig8 which shows a side work stop 101 mounted to jaw plate 10 using hole 68 . some corners of jaw plate 10 may be chamfered , such as chamfers 76 , 78 . further , other holes , such as holes 72 , 74 , may be provided and may include thread portions and / or portions having different diameters . holes 72 , 74 may be used , for example , for securing or affixing a parallel attachment 108 to the jaw plate 10 . fig4 a and 4b depict an exemplary pin 40 , which is identical to pins 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 in an exemplary embodiment . while the exemplary pins 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 are all identical , it is within the scope of the disclosure to utilize pins of more than one shape and / or size ( as well as corresponding holes of other shapes and / or sizes ) in an embodiment . exemplary pin 40 includes a front end 58 and a back end 60 . pin 40 is a stepped pin in that it includes a narrow section 62 ( sized to fit through hole 22 ) and wide section 64 ( sized to fit through hole 23 ). o - ring 80 ( shown in phantom in fig4 a and not shown in fig4 b ) is sized to provide a friction fit within hole 23 such that pin 40 is slidable within holes 22 , 23 , but does not move without an externally applied force . other exemplary embodiments may include friction members other than an o - ring , and any friction member may be mounted to either or both of the pin and the jaw plate . it is within the scope of the disclosure to incorporate one or more pins having non - circular cross sections . further , it is within the scope of the disclosure to incorporate other pin retaining devices ( such as , but not limited to , set screws and spring detent mechanisms ) in addition to or in place of the o - rings or other friction members to resist undesired movement of the pins within the jaw plate . fig5 a and 5b depict the operation of an exemplary embodiment . in fig5 a , pin 40 is in the retracted position such that front end 58 does not extend beyond front face 18 of jaw plate 10 ( front end 58 may be flush with front face 18 or may be recessed ). in fig5 b , pin 40 is in the extended position such that front end 58 and part of narrow section 62 extend beyond front face 18 . pin 40 may be moved between the retracted and extended positions as desired by a user by applying a generally axial force to pin 40 by pushing on either of front end 58 or back end 60 . in an exemplary embodiment , the travel of pin 40 in the direction of its front end 58 may be limited by wide portion 64 contacting shoulder 21 . when mounted to a vise 100 , one or more of pins 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 of jaw plate 10 may function as a built - in work stop . the narrow section 62 protruding through the front face 18 of the jaw plate 10 may provide a known and repeatable location for a work piece 120 held within the vise 100 . see fig1 , which shows pin 44 extended and functioning as a work stop , and fig8 , which shows pin 46 extended and functioning as a work stop . more than one pin 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 may be extended if desired . for example , fig9 shows pins 46 , 50 extended when using the vise 100 is used to hold two work pieces 320 , 420 . utilizing built - in pins 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 may eliminate the need to employ a separate work stop , and it may allow easily repeatable positioning of the work piece 120 . in addition , in some exemplary embodiments , the pins 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 may be extended or retracted without tools using only force applied by an operator &# 39 ; s finger . it is within the scope of the disclosure to utilize another work stop in conjunction with one or more of the built - in pins 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 . for example , fig8 shows a side work stop ( which may be attached to hole 68 , for example ) and pin 46 holding work piece 320 . further , because the locations of the pins 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 on the jaw plate 10 may be known to a machine programmer , the machine programmer may use the known positions of the pins as starting points for programming a machine tool . in an exemplary embodiment depicted in fig3 a , the pins 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 are located 0 . 225 inches below the top edge of the jaw plate ( 1 . 625 inches above the bottom edge of the jaw plate ) and are spaced horizontally 0 . 688 inches , 1 . 375 inches , 2 . 062 inches , and 2 . 750 inches from center pin 48 . the pins 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 ( or jaw plate 10 ) may be labeled with identifying indicia such as , but not limited to , the letters 11 shown in fig1 . a machine programmer may provide set - up instructions to a machine operator including which of the pins 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 should be extended when machining a particular work piece 120 . exemplary jaw plates may be constructed from hardened steel or other suitable materials . pins 40 may also be constructed from a steel or other suitable material . o - rings and other friction members may be constructed from appropriate materials , such as elastic materials . it is within the scope of the disclosure to utilize a pin stop jaw plate on other workholding devices such as , but not limited to , other types of vises . further , it is within the scope of the disclosure to utilize a jaw plate 10 having pins 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 on one or more of the moveable jaws 102 and fixed jaws 104 in a vise 100 . for example , a jaw plate 10 having one or more pins 40 , 42 , 44 , 46 , 48 , 50 , 52 , 54 , 56 may be utilized in each of the two stations in a two station vise . in certain embodiments , jaw plates , parallels , and similar workholding components may include nonrectangular portions ( such as , but not limited to , angled portions ) for holding nonrectangular work pieces and / or for holding work pieces in orientations other than in parallel with the vise jaws and / or the supporting surface . while exemplary embodiments have been set forth above for the purpose of disclosure , modifications of the disclosed embodiments as well as other embodiments thereof may occur to those skilled in the art . accordingly , it is to be understood that the disclosure is not limited to the above precise embodiments and that changes may be made without departing from the scope . likewise , it is to be understood that it is not necessary to meet any or all of the stated advantages or objects disclosed herein to fall within the scope of the disclosure , since inherent and / or unforeseen advantages may exist even though they may not have been explicitly discussed herein . | 1 |
referring now in detail to the figures , there is shown in fig1 a portable toilet shelter 10 that is constructed in accordance with the present invention . uniquely , the portable toilet shelter is hinged along each of its four corners 12 with flexible hinge strips 14 . preferably , as shown in fig2 the flexible hinge strips 14 are fastened to the portable toilet shelter 10 with rivets 16 , but may also be integrally fastened thereto using any other method including thermoforming or heat lamination techniques . the novel and unobvious aspects of the present invention apply not only to toilet shelters , but also apply to any other types of portable shelters . other types of portable shelters include but are not limited to changing rooms , hand wash stations , first aid buildings , and the like . preferably , and as better shown in fig3 the toilet shelter generally includes a base 18 , a commode , tank , or toilet unit 20 mounted to the base 18 , a loop enclosure 22 circumscribing the base , and a roof 24 mounted to the loop enclosure 22 . the base 18 is preferably constructed of wood , such as from a standard square pallet . the base 18 also preferably includes a non - skid floor material as a sanitary top surface of the base 18 . alternatively , the base 18 can be produced from plastic or any other cost - effective material . a toilet seat 26 is mounted to the toilet unit 20 and a urinal 28 is mounted either to a portion of the loop enclosure 22 or is mounted directly to the toilet unit 20 itself . nonetheless , the urinal 28 drains to the toilet tank 20 as is well known in the art , such as with a flexible tube . a stackpipe 20 a extends upward from the toilet unit 20 and out of the roof of the toilet shelter . such base 18 and toilet unit 20 construction is well - known in the art and is consistent with porta - john ® brand portable toilets . alternatively , it is possible to not use the base 18 at all , or rather , use level ground as the base 18 . circumscribing the base 18 , the loop enclosure 22 is preferably constructed of a loop of walls including a front end wall 30 , a back end wall 32 , and left and right side walls 34 and 36 connected therebetween . the term loop is not limited herein to only circular or closed loop structures . those skilled in the art will appreciate that each of the individual walls are preferably made of polyethylene , but can alternatively be made from wood or any other cost effective material . as is well known , the front end wall 30 includes a door 38 to permit access to the interior of the portable toilet shelter 10 through the front end wall 30 . located between the base 18 and the loop enclosure 22 at each of the four corners 12 are four angled supports 40 , as also shown in fig4 and 7 . the angled supports 40 are preferably fastened to the inside of the loop enclosure 22 with a hook and loop fastener material 40 a , as shown in the enlarged view of fig4 . accordingly , the angled supports 40 act as gussets to help rigidify the inside of the loop enclosure 22 at the corners 12 thereof . additionally , the angled supports 40 snugly locate the base 18 within the loop enclosure 22 . [ 0032 ] fig5 illustrates another aspect of the present invention wherein the toilet unit 20 includes a tank portion 42 having a lid 44 pivotably connected thereto by hinges 46 . this fliptop arrangement facilitates improved waste removal from the tank portion 42 and enables storing the urinal 28 within the tank portion 42 for better transportability of the portable toilet shelter 10 . [ 0033 ] fig6 illustrates a portable toilet shelter 110 according to an alternative embodiment of the present invention wherein the roof 24 and a floor 48 are hingedly connected to the loop enclosure 22 with flexible hinge strips 14 . the hinged roof 24 and floor 48 facilitate assembly and disassembly , and increase the strength of the portable toilet shelter 110 by integrating the components thereof . the floor 48 also provides an improved barrier against entry by vermin such as small mice and rats that can squeeze through spaces between the base and walls of prior art structures . as best shown between fig6 and 7 , the front end wall 30 of the loop enclosure 22 further includes top and bottom longitudinal ends 30 a and 30 b , an inward surface 30 c , and left and right vertical edges 30 d and 30 e . similarly , the back end 32 wall includes top and bottom longitudinal ends 32 a and 32 b , an inward surface 32 c and left and right vertical edges 32 d and 32 e . the left side wall 34 also includes top and bottom longitudinal ends 34 a and 34 b , an inward surface 34 c , and front and rear vertical edges 34 d and 34 e . finally , the right side wall 36 includes top and bottom longitudinal ends 36 a and 36 b , an inward surface 36 c , and front and rear vertical edges 36 d and 36 e . as shown , the right vertical edge 30 e of the front end wall 30 extends longitudinally parallel with and transversely normal to the front vertical edge 36 d of the right side wall 36 , and the rear vertical edge 36 e of the right side wall 36 extends longitudinally parallel with and transversely normal to with the right vertical edge 32 e of the back end wall 32 . similarly , the left vertical edge 32 d of the back end wall 32 extends longitudinally parallel with and transversely normal to the rear vertical edge 34 e of the left side wall 34 , and the front vertical edge 34 d of the left side wall 34 extends longitudinally parallel with and transversely normal to with the left vertical edge 30 d of the front end wall 30 to establish the loop . to close the loop , the walls 30 , 32 , 34 , and 36 are interconnected by the flexible hinge strips 14 , which are preferably composed of fabric woven from any durable and flexible material such as nylon . alternatively , the flexible hinge strips 14 could be constructed in any other cost effective manner , such as with sheet material , wire , some types of metal hinges , or any other flexible material . it is contemplated that the loop enclosure 22 not always be fixedly closed by the flexible hinge strips 14 . in other words , it is possible to have one of the flexible hinge strips 14 be easily removably attached to one of the four walls 30 , 32 , 34 , and 36 , to permit the loop enclosure 22 to be completely unfurled to a flat state . at the bottom of the loop enclosure 22 , the bottom longitudinal ends 30 b , 32 b , 34 b , and 36 b of each of the walls 30 , 32 , 34 , and 36 together define a bottom end 50 of the loop enclosure 22 , circumscribe the base 18 , and can be fastened to the base 18 by any well known method such as using screws , x - tree fasteners , and the like . however , when using the angled supports 40 it is not necessary to fasten the loop enclosure 22 to the base 18 , since the angled supports 40 frictionally interpose the loop enclosure 22 and the base 18 to provide sufficient stability for the portable toilet shelter 10 . likewise , the roof 24 mounts to the loop enclosure 22 either independently or hingedly to complete the portable toilet shelter 10 . the top longitudinal ends 30 a , 32 a , 34 a , and 36 a of each of the walls 30 , 32 , 34 , and 36 together define a top end 52 of the loop enclosure 22 . the roof 24 is mounted to the top end 52 of the loop enclosure 22 , preferably circumscribing the top end 52 as shown and being fastened with screws , x - tree fasteners , or the like . the roof 24 is a substantially square piece , preferably formed from polyethylene and includes a stackpipe vent 24 a . disassembly and assembly of the portable toilet shelter 10 is easier than prior art structures and requires only about five minutes by an experienced service person . the portable toilet shelter 10 is more easily disassembled than the toilet shelters of the prior art . the roof 24 is removed by unscrewing or shearing off the fasteners , lifting the roof 24 off the top end 42 of the loop enclosure 22 , and loading the roof 24 to a truck . alternatively , according to the portable toilet shelter 110 of fig6 the roof 24 can be pivotably lifted off the top longitudinal end 52 of the loop enclosure 22 . then , the loop enclosure 22 is lifted away from the base 18 and is placed on its side permitting it to automatically fold flat on the ground , as depicted by fig8 and 9 . as shown in fig9 when the loop enclosure is placed on its side and permitted to collapse , the front and back end walls 30 and 32 fold relatively toward respective side walls 34 and 36 . in other words , the walls 30 , 32 , 34 , and 36 collapse toward one another such that the inside surface 30 c of the front end wall 30 overlays one of the inside surfaces 34 c or 36 c of one of the side walls 34 or 36 , while the inside surface 32 c of the back end wall 32 overlays the other of the inside surfaces 34 c or 36 c of the side walls 34 or 36 . additionally and alternatively according to the collapsed portable toilet shelter 110 of fig9 a , the roof 24 and floor 48 can be collapsed and folded together with the loop enclosure 22 . finally , once the loop enclosure 22 is set aside or loaded to a truck , the emptied toilet unit 20 is removed from the base 18 and loaded to a truck and the base 18 is then lifted from the ground and loaded to a truck . accordingly , the compact collapsed loop enclosure 22 can be stacked in any convenient manner to maximize the number of units transportable by a truck . as used herein , the term overlay is synonymous with superimpose and is not limited herein to exact matching alignment of one wall over another . rather , the term means that one wall substantially covers another with surface area misalignment permissible . the portable toilet shelter 10 is also easier to assemble than toilet shelters of the prior art . first , the base 18 is positioned on level ground . then the toilet unit 20 is mounted atop the base 18 . next , the loop enclosure 22 is easily opened from its collapsed condition a shown in fig9 to a self - supporting condition by spreading the walls away from one another . consequently , the side walls 34 and 36 are positioned substantially parallel to one another , the end walls 30 and 32 positioned substantially parallel to one another , and thus the side walls 34 and 36 are substantially transverse to the end walls 30 and 32 . the angled supports 40 are removably fastened to the inside of corners 12 of the bottom end 50 of the loop enclosure 22 for rigidity . from this self - supporting position , the loop enclosure 22 is lifted over the toilet unit 20 and the bottom end 50 is easily aligned with the perimeter of the base 18 such that the bottom end 50 of the loop enclosure 22 circumscribes the base 18 and angled supports 40 . thus , it is not necessary to struggle with prior art bi - fold side walls , by trying to keep the bi - fold sides fully open and straight so as to align with the perimeter of the base . as such , the present invention is easier to assemble and therefore takes less time to do so . once the loop enclosure 22 is firmly in place , the roof 24 is placed to the top end 52 of the loop enclosure 22 and is fastened thereto . finally , the stackpipe 20 a is attached to the toilet unit 20 . according to the alternative embodiment of fig6 and 9a , the portable toilet enclosure 110 is assembled first by opening the loop enclosure 22 such that the walls are substantially square to one another . the floor 48 is then flipped into place at the bottom end 50 of the loop enclosure 22 . then the angled supports 40 are removably fastened to the inside of corners 12 at the bottom end 50 of the loop enclosure 22 . the base 18 is then inserted into the loop enclosure 22 through the door 38 and placed on the floor 48 inside of the angled supports 40 . the toilet unit 20 is then dropped into the loop enclosure 22 either through the open top end 52 or through the door 38 . the roof 24 is then flipped over into place such that it circumscribes the top end 52 of the loop enclosure 22 . finally , the stackpipe 20 a is attached to the toilet unit 20 . while the present invention has been described in terms of a preferred embodiment , it is apparent that other forms could be adopted by one skilled in the art . in other words , the teachings of the present invention encompass any reasonable substitutions or equivalents of claim limitations . for example , the structure , materials , sizes , and shapes of the individual components could be modified , or substituted with other similar structure , materials , sizes , and shapes . one specific example includes using a tri - fold design , or other geometry , instead of the quad - fold design disclosed herein . those skilled in the art will appreciate that other applications , including those outside of the portable toilet shelter industry , are possible with this invention . accordingly , the present invention is not limited to only portable toilet shelters and the scope of the present invention is to be limited only by the following claims . | 4 |
fig2 a is a view showing the schematic arrangement of a semiconductor exposure apparatus according to a preferred embodiment of the present invention . in this exposure apparatus , a mark for pre - alignment is detected using an off - axis scope 6 . a pattern for exposure is formed on a reticle 1 . the pattern is illuminated with , e . g ., an i - line or excimer laser light source of an illumination system ( not shown ) and projected onto a wafer 5 through a projecting lens 2 . pre - alignment is performed after the wafer 5 is placed on a wafer chuck 4 on an x - y stage 3 by a wafer conveyor apparatus ( not shown ). since the wafer 5 is placed on the wafer chuck 4 at the accuracy depending on the conveyor apparatus , the alignment accuracy is low . hence , accurate wafer position measurement cannot be directly started . to do this , a pre - alignment ( coarse alignment ) mark on the wafer is observed with the off - axis scope 6 arranged outside the projecting lens 2 , the optical image of the mark is photoelectrically converted by a ccd camera 7 , and then the position information of the mark is detected by a pre - alignment image processing unit 8 . in the pre - alignment image processing unit 8 , the photoelectrically converted video signal is converted into digital information by an a / d conversion unit 71 , and the pre - alignment mark position is detected by an image processor 72 having an image memory . it is advantageous when both the x - and y - coordinates can be detected by one mark . for this reason , the pre - alignment mark has the same shape as that of the mark 100 shown in fig6 a . the position of the x - y stage 3 when the pre - alignment mark image is captured is accurately measured by a laser interferometer 12 . on the basis of the mark position shift and the position of the x - y stage 3 , a controller 9 accurately measures the shift amount of the wafer 5 placed on the chuck 4 . the x - y stage 3 is driven by a stage driving unit 13 . in this embodiment , a case wherein dark field illumination is employed as illumination for the off - axis scope 6 will be described . in dark field illumination , scattered light from an edge position of the mark step difference is received by the ccd camera 7 . the present invention can also be applied to bright field illumination . fig1 shows the flow of image processing ( position detection processing ) for executing pre - alignment in a position detection apparatus according to the preferred embodiment of the present invention and a semiconductor exposure apparatus using the position detection apparatus . first , the vector correlation method ( s 100 , s 101 , s 102 ) will be described . in step s 100 , the image processor 72 executes edge extraction processing for an image captured by the ccd camera 17 . in edge extraction processing , both the edge information of the mark image and attribute information representing that the edge information is associated with the upper , lower , right , or left side of the mark image are simultaneously acquired . in this embodiment , edge information ( solid lines in fig4 b to 4 e ) are made to correspond to attribute information (“ over ”, “ under ”, “ left ”, and “ right ” in fig4 b to 4 e ) and extracted for four directions of the upper , lower , left , and right sides of an actual edge of the mark image . edge information may be made to correspond to attribute information and acquired not only for the four directions of the upper lower , left , and right sides of an actual edge , but also for , e . g ., four directions that respectively make an angle of 45 ° with the above four directions , i . e ., a total of eight directions . alternatively , edge information may be made to correspond to attribute information and acquired according to another rule . in step s 101 , the mark image is searched on the basis of edge information and attribute information corresponding to the edge information . searching means detection of an approximate position of the mark image . in searching the mark image , the degree of matching between the edge information extracted in step s 100 and a template specified by the attribute information corresponding to the edge information is occasionally calculated while moving the template within a predetermined region , and the center coordinates of the mark ( center coordinates of the template ), at which the maximum degree of matching is obtained , are determined . each template is formed from feature points of interest corresponding to attribute information , to which attention must be paid in comparison with the edge information extracted from the mark image . to calculate the degree of matching , the edge information ( e . g ., fig4 b ) extracted in step s 100 is compared to corresponding feature points of interest ( e . g ., fig5 b ) in the template to determine whether the two pieces of information match , and the comparison results are evaluated . more specifically , the degree of matching is calculated by comparing the edge information shown in fig4 b with the feature points of interest of the template shown in fig5 b , the edge information shown in fig4 c with the feature points of interest of the template shown in fig5 c , the edge information shown in fig4 d with the feature points of interest of the template shown in fig5 d , and the edge information shown in fig4 e with the feature points of interest of the template shown in fig5 e , while changing the center coordinates ( position of +) and evaluating the number of matches obtained . the center coordinates of a template , at which the maximum degree of matching is obtained , is detected as the position of the mark image . it is determined in step s 102 whether the mark position search is successful . more specifically , when the matching result ( maximum degree of matching ) has a value equal to or larger than a threshold value for detection determination , it is determined that mark position detection is successful , and the position of the mark is precisely measured in step s 103 . mark position search fails in step s 102 when 1 ) the matching result ( maximum degree of matching ) has a value smaller than the threshold value for detection determination or 2 ) a degree of matching equal to or higher than the level of threshold value for detection determination is obtained at a plurality of mark positions , and one of them cannot be selected . processing of a characteristic feature of the present invention starts from step s 104 . if mark position search fails , the flow advances to the loop , including step s 104 , to change parameters for detection , i . e ., to adjust one or both of the edge extraction processing parameter and the threshold value for detection determination , and edge extraction ( s 100 ), mark position search ( s 101 ), and detection determination ( s 102 ) are performed again . the repetitive loop of parameter change and search is controlled on the basis of the number of times or conditions set in advance . if it is determined that the mark position cannot be accurately detected any more evenly by repeating the repetitive loop , a detection error occurs . actual processing according to the flow will be described next with reference to fig3 and 4 a to 4 e . first , vector correlation will be described . in edge extraction in step s 100 , scattered light from the mark 100 is received and photoelectrically converted by the ccd camera 7 , then a / d - converted by the a / d conversion unit 71 , and stored in the image memory of the processor 72 . an image signal along a given scanning line ( row ) of the stored image is represented by xi . since this embodiment employs dark field illumination , the image signal xi has a certain value at the mark edge position and a value of black level at the remaining portions . a signal obtained by differentiating the image signal xi is a differential signal xid . when the scanning line is traced from the left to the right , the differential signal xid becomes positive at the leading edge portion of the image signal xi and negative at the trailing edge portion . a threshold value th1 is set on the positive side of the differential signal xid . when the differential signal xid is binarized using the threshold value th1 as a reference , a left edge signal le is obtained . in a similar way , when a threshold value thr is set on the negative side of the differential signal xid , and the signal xid is binarized using the threshold value thr as a reference , a right edge signal re is obtained . the left edge signal le represents the left edge position of the mark image , and the right edge signal re represents the right edge position of the mark image . when the above processing is executed for all scanning lines , pieces of edge information representing the left edge positions of the mark image and pieces of edge information representing the right edge positions are obtained . an image signal along a vertical line ( column ) on the image memory is represented by yi . like the image signal xi , the image signal yi is traced from the lower side to the upper side , and a differential signal yid is generated . when the differential signal yid is binarized using threshold values thu and tho , an under edge signal ue and over edge signal oe are obtained . the under edge signal ue represents the under edge position of the mark image , and the over edge signal oe represents the over edge position of the mark image . when the above processing is executed for all vertical lines , pieces of edge information representing the under edge positions of the mark image and pieces of edge information representing the over edge positions are obtained . in fig4 a , edge information representing the right edge positions , edge information representing the left edge positions , edge information representing the over edge positions , and edge information representing the under edge positions all of the mark 100 are synthesized and two - dimensionally illustrated . in this embodiment , as edge position images ( edge information and attribute information ), edge information associated with attribute information “ over ” shown in fig4 b , edge information associated with attribute information “ under ” shown in fig4 c , edge information associated with attribute information “ left ” shown in fig4 d , and edge information associated with attribute information “ right ” shown in fig4 e are stored in the processor 72 as independent information . a mark image search ( s 101 ) is performed by matching calculation of templates stored in advance and edge position images ( edge information ) shown in fig4 b to 4 e . fig5 a to 5 e are views for explaining the templates . since the positions of the over , under , left , and right edges relative to the mark center ( cross ) are known , the templates are registered as layouts shown in fig5 b to 5 e in which feature portions of the mark are indicated by open circles . that is , the templates can be determined on the basis of the shape of the mark to be formed on the wafer . fig5 a shows the synthesized image of the four registered templates shown in fig5 b to 5 e . in this embodiment , the position of an open circle is called a feature point of interest , and a set of points of interest is called a template . in each template of this embodiment , feature points of interest are defined on only one of the side edges of the mark . for example , in the template shown in fig5 b , the feature points of interest are defined on only the over edges of the mark . matching calculation in a mark image search is performed by determining whether , e . g ., the pieces of edge information shown in fig4 b are present at the positions of open circles in fig5 b with reference to the mark center ( cross ). in a similar way , fig4 c and fig5 c , fig4 d and fig5 d , and fig4 e and fig5 e are compared to determine whether the pieces of edge information shown in fig4 c to 4 e are present at the position of open circles in fig5 c to 5 e , respectively . when the edge information is present at all the hollow bullet positions , the degree of matching is 100 %. if some hollow bullet positions have no edge information , the degree of matching is lower than 100 %. the above matching calculation is performed for the entire edge images while changing the mark center coordinates , and mark center coordinates at which the degree of matching is highest are finally extracted , thereby completing the search . the feature points of interest shown in fig5 b to 5 e are defined by thinning out points and designating two points that define specific edges . even when the number of feature points of interest is increased , no effect is obtained unless they express the characteristic feature of the mark shape . if the feature points of interest are densely defined , the degree of matching becomes low due to various reasons , and the mark image may not be detected . especially , when the mark is damaged , the degree of matching often extremely lowers . for this reason , a high detection rate can be stably obtained by setting thinned out feature points of interest , as described above . when the maximum degree of matching obtained by the above - described search is lower than the level of threshold value for determination , the coordinates at which the maximum degree of matching is obtained may not indicate the correct mark position . in this case , edge information extraction may not be optimum . hence , preferably , the threshold values th1 , thr , thu , and tho used for extraction of mark edge information are corrected , the edge information data are generated again , and the search is repeated . for example , when the threshold values th1 , thr , thu , and tho for edge extraction are originally relatively large , no edge information is obtained from a low - contrast mark image . hence , the degree of matching in the search is low , and mark detection determination is impossible . preferably , the edge information of the mark is detected while gradually decreasing the threshold value for edge extraction . this makes it possible to obtain a sufficient degree of matching in the search . as another example , when there are a plurality of coordinates at which a degree of matching higher than the level of threshold value for determination , the mark position cannot be determined . in this case as well , the mark position can be reliably determined by increasing the determination threshold value and repeating edge information generation and search . the position detection parameter , such as the threshold value for edge extraction or threshold value for determination , can be efficiently changed by storing , e . g ., a value determined according to the immediately preceding search processing result ( degree of matching ) in the memory and using the value as the base ( e . g ., initial value ) for detection parameter determination of the next time . for precise detection ( s 103 ) after the end of the mark image search , the mark position can be determined at an accuracy beyond the pixel resolution by , e . g ., a method of obtaining the barycenter on the basis of the luminance distribution with an origin set at the center coordinates of the a / d - converted image found by the search . in this embodiment , edge extraction is performed immediately after image reception . processing of performing noise removal filtering before edge extraction to lower the noise level in advance and to prevent any unnecessary edge information , or forming a bold line image as edge information to correct deformation in mark size or omission of edges , is also effective . processing of adjusting the noise removal parameter or bold line formation parameter is also effective . addition of the above processing results in an increase in the detection rate in the mark search . in the first embodiment , the position detection apparatus of the present invention and the semiconductor exposure apparatus using the position detection apparatus are applied to pre - alignment using the off - axis scope 6 . however , the processing of the mark position search is not limited to pre - alignment using off - axis . fig2 b shows the second embodiment in which the position detection apparatus of the present invention is applied to a ttr detection system for detecting a mark on a wafer 5 or stage through a reticle 1 in a semiconductor exposure apparatus . to detect a mark in the ttr detection system , exposure light is used . for example , in a semiconductor exposure apparatus using an excimer laser , a ccd camera 7 and laser 21 are synchronized by a sync signal generator 20 to emit a laser beam only during the light storage time of the ccd camera 7 . for the photoelectrically converted mark image , the mark position search is done by the same method as that in the first embodiment , and after the search , an accurate mark position can be calculated . in an i - line exposure apparatus , since the light source is not a laser , synchronization between image reception and the illumination system is unnecessary . for this reason , the mark position search can be done , and accurate mark position calculation can be performed after the search , as in the first embodiment . in reticle alignment for alignment of the reticle 1 with respect to a projecting lens 2 , as well , the same processing as that in the first embodiment can be performed for a mark search . fig2 c shows the third embodiment of the present invention , in which the position detection apparatus of the present invention is applied to a ttl detection system for detecting the mark position on a wafer 5 or stage 3 through a projecting lens 2 , without interposing a reticle 1 in a semiconductor exposure apparatus . in ttl , as well , the mark search and position determination can be performed by the same method as that of the first embodiment , except that the mark image sensing method is different . as has been described above , in this position detection apparatus according to the preferred embodiment of the present invention and the semiconductor exposure apparatus using the position detection apparatus , the edge information of a mark image is extracted in correspondence with attribute information , the edge information is compared with a corresponding template in units of partial edges on the basis of the attribute information , and the obtained comparison result is evaluated , thereby determining the mark position . since it can be determined at a high probability in units of partial edges whether a partial edge ( e . g ., fig4 b ) and a template ( e . g ., fig5 b ) corresponding to the edge match , the probability of mark position detection becomes higher than that of the prior art , in which it is determined whether the entire mark image matches the template . hence , according to this embodiment , the position of the image of a mark with degradation or a defect generated in manufacturing a high density semiconductor device , e . g ., a low - contrast mark image , a noisy mark image , or a mark image obtained by sensing a defect generated in the wafer process can be more stably detected . as a consequence , in this position detection apparatus and semiconductor exposure apparatus using the position detection apparatus , by repeating pattern matching while adjusting one or both of the edge extraction parameter and parameter used to determine the matching result in accordance with the result of template matching , the image of a mark with degradation or a defect can be more reliably detected . the present invention is not limited to the above embodiments , and various changes and modifications can be made within the spirit and scope of the present invention . therefore , to apprise the public of the scope of the present invention , the following claims are made . | 6 |
browsing a virtual environment is facilitated by providing the user with two different views of the virtual environment simultaneously : a first or primary view to the front and a second view to the rear or side . the concept is similar to a virtual rearview mirror but with some important enhancements , which will be explained in this description . [ 0012 ] fig1 is a functional block diagram of a display system in accordance with an illustrative embodiment of the invention . in fig1 controller 105 communicates via data bus 110 with memory 115 , display buffer 120 , and input device 125 . display buffer 120 outputs image data to display driver 130 , which controls display 135 . memory 115 comprises random access memory ( ram ) 140 , a portion of which may be allocated to virtual environment application 145 . virtual environment application 145 further comprises modules 150 , 155 , and 160 . module “ recenter view ” ( 150 ) changes the first view on display 135 to coincide with a selected sub - region in the second view . module “ provide information ” ( 155 ) provides information about a selected sub - region of the second view . module “ adjust second view ” ( 160 ) adjusts the magnification factor or viewing angle of the second view . controller 105 may be a general purpose microprocessor or a dedicated graphics accelerator . input device 125 may be any device capable of indicating a particular location on display 135 and issuing command requests . examples include a mouse , trackball , digital tablet , or eye - movement - detection interface . a command request may be issued by the pressing of a button on input device 125 or other suitable gesture . fig2 a - 2 e illustrate various ways in which display 135 may be divided into a first region containing a first view of a virtual environment and a second region containing a second view of the virtual environment in accordance with an illustrative embodiment of the invention . in fig2 a - 2 e , display 135 is divided into first region 205 and second region 210 . first region 205 contains a first ( e . g ., front ) view of the virtual environment . second region 210 contains a second view of the virtual environment substantially opposite in direction of the first view or to the side with respect to the first view . fig2 a - 2 e illustrate that second region 210 may vary in shape , size , position , and orientation . the configurations shown are only examples , however ; many other configurations are possible . in some embodiments , the user may dynamically select from among various sizes , shapes , positions , and orientations for second region 210 to fit a particular situation . the viewing angle and magnification factor of the second view shown within second region 210 may also be adjusted . for example , in a pc implementation , input device 125 is typically a two - button mouse . right clicking within second region 210 may invoke module “ adjust second view ” ( 160 ), causing a user interface control to appear for setting the viewing angle and magnification factor of the second view . these features provide the user with greater flexibility in finding objects or information of interest in the virtual environment . [ 0016 ] fig3 a and 3b are illustrations of a simple virtual environment in accordance with an illustrative embodiment of the invention . fig3 a is a top view of a virtual environment 300 containing cubic objects a , b , and c . a perspective rendering of virtual environment 300 from the point of view of an observer at point 305 is shown in fig3 b . in fig3 b , objects a and b are visible in the first view within first region 205 . object c , although behind the observer , is visible in the second view within second region 210 . in this example , the angle of view for the second view is toward the rear with respect to the first view . although , in this example , the second view in second region 210 is similar to a virtual rearview mirror , the text label “ c ” is shown in readable form instead of mirror imaged , as would occur in a model of a true reflection . this is an important distinction between the illustrative embodiment in fig3 b and the virtual rearview mirror included in some racing car simulators , for example . virtual environments often include “ signs ” containing text such as those pictured in fig3 b . being able to read such text is advantageous to a user attempting to browse a virtual environment . [ 0017 ] fig4 a and 4b illustrate ways in which a user may interact with sub - regions of the second view of virtual environment 300 in accordance with an illustrative embodiment of the invention . in fig4 a , a pointing cursor 405 associated with input device 125 hovers over object c in the second view of virtual environment 300 . the hovering gesture may invoke module “ provide information ” ( 155 ), causing callout 410 to appear . callout 410 may contain a description or other information regarding object c . if the user takes the further step of issuing a command request ( e . g ., selecting object c ), module “ recenter view ” ( 150 ) may be invoked , causing the first view shown within first region 205 to be recentered on object c and the second view to be updated accordingly , as shown in fig4 b . in this example , the viewing angle , magnification factor , or both of the second view may be adjusted to display both objects a and b within the second view , as explained above . [ 0018 ] fig5 is a flowchart of the operation of the display system shown in fig1 in accordance with an illustrative embodiment of the invention . fig5 summarizes the concepts discussed in connection with fig2 - 4 . at 505 , first and second views of virtual environment 300 are displayed within first region 205 and second region 210 , respectively , of display 135 . if a request is received at 510 to adjust the size , shape , position , or orientation of second region 210 , module “ adjust second view ” ( 160 ) is activated to perform the adjustment at 515 . otherwise , control proceeds to 520 . if an interaction with the second view is detected at 520 , control proceeds to 525 . otherwise , control skips to 545 . input such as a pointer cursor hovering over a sub - region of the second view at 525 may invoke module “ provide information ” ( 155 ) to provide a text message about the indicated sub - region at 530 . in other embodiments , the information provided at 530 may be audio instead of text . if a command request from input device 125 is detected at 535 , control proceeds to 540 , where module “ recenter view ” ( 150 ) is invoked to recenter the first view within first region 205 to coincide with the selected sub - region of the second view , and the second view is updated accordingly . if a request to exit virtual environment 300 is received at 545 , the process terminates at 550 . otherwise , control returns to 505 . applications for the present invention are numerous and diverse . the invention may be applied advantageously , for example , to distance learning ; virtual libraries , museums , and shops ; recreation and entertainment such as video games ; 3 - d chat rooms ; military and corporate training ; and the browsing of databases , including those containing only text . the foregoing description of the present invention has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed , and other modifications and variations may be possible in light of the above teachings . the embodiments were chosen and described in order to best explain the principles of the invention and its practical application to thereby enable others skilled in the art to best utilize the invention in various embodiments and various modifications as are suited to the particular use contemplated . it is intended that the appended claims be construed to include other alternative embodiments of the invention except insofar as limited by the prior art . | 6 |
embodiments of the present invention provide a method for forming a wlcsp target so as to package chips , wafers , wafer parts or half finished packaging targets with different sizes through the wlcsp on a machine station with an individual size . the detailed description will be given below with reference to the drawings . as shown in fig1 , with respect to an aspect of the present invention , that is , how to package a wafer with a larger size through the wlcsp on a wlcsp apparatus with a smaller size , one embodiment of the present invention provides a method for forming a wlcsp target , including the following steps . at s 601 , a wafer part formed by dicing a whole wafer or as a result of wafer cracking , and a second substrate for bonding , are provided . the wafer part includes at least two chips . at s 602 , the side of the wafer part , which is opposite to the side including a circuit , is bonded to a first substrate . at s 603 , a portion of the wafer part that extends beyond the first substrate is removed . at s 604 , the side of the wafer part including the circuit is bonded to the second substrate . at s 601 , the wafer part 100 as shown in fig2 and the second substrate for bonding 110 as shown in fig3 are provided . the wlcsp is different from the conventional packaging technologies in which a single chip is packaged . the advantage of the wlcsp lies in that multiple chips are packaged on a wafer scale so as to improve the efficiency and lower the cost . thus , the wafer part 100 includes at least two chips 101 . the wafer part 100 may be formed by dicing a whole wafer or as a result of cracking of a whole wafer , and may have a regular or irregular shape . the method for dicing the wafer is known to those skilled in the art and descriptions thereof are omitted here . as mentioned above , a crack often occurs during the wafer fabrication . if the wlcsp is performed to a wafer with a crack , the crack may be prolonged . in order to address this problem , the wafer may be diced with reference to the crack so as to remove a portion of the wafer with the crack and keep the wafer part 100 without the crack . hence , the wafer part with the crack is removed through dicing and the wlcsp is performed to the wafer part without the crack . in this way , the yield of the chip fabrication is improved . the second substrate for bonding 110 provided in step s 601 includes a third substrate 111 and cavity walls 112 as shown in fig3 . the third substrate 111 may be in a circular shape matching the shape of the machine station of the wlcsp apparatus . the third substrate 111 may be made of glass so that the third substrate 111 is flat and transparent . it is understood by those skilled in the art that the third substrate 111 may also be made of another material , such as silicon . on one side of the third substrate 111 , multiple ring - like cavity walls 112 may be provided . the shape of the area enclosed by the cavity walls 112 , which is slightly larger than the area of the chip 101 , is similar to that of the chip 101 . the arrangement of and the spacing between the cavity walls 112 on the third substrate 111 correspond to those for the chips 101 on the wafer part 100 . thus , in the subsequent process of bonding the wafer part 100 to the second substrate 110 , the chips 101 on the wafer part 100 may be accommodated respectively in the cavities formed by the cavity walls 112 . in order to improve the efficiency of the wlcsp and lower the cost , the size of the second substrate 110 should not be too small . preferably , the diameter of the circumcircle of the second substrate 110 is equal to or larger than 100 mm , that is , the diameter of the circular third substrate 111 on the second substrate 110 is at least 4 inches . according to the conventional wlcsp technology , each chip on the wafer part is subsequently subjected to wafer level cutting or plasma etching so as to form a sloping side wall to be deposited with a conductive metal layer . because the side wall is formed to be sloping , if the wafer part 100 is thick , the area of a side of the cut wafer part on which bumps are to be formed will be too small , that is , the space for accommodating the bumps will be too small . in order to avoid this problem , the wafer part 100 is further thinned . the thinning process is known to those skilled in the art and descriptions thereof are omitted here . the thinning process may be performed immediately after step s 601 or at any step as described below in conjunction with a specific embodiment . in order to increase the production efficiency of the wlcsp and lower the packaging cost , multiple wafer parts 100 may be arranged to occupy the second substrate 110 as far as possible , as shown in fig4 . then , the multiple wafer parts 100 are bonded to the second substrate 110 in a subsequent step . to combine multiple wafer parts 100 together according to an embodiment , or provide a support for the wafer part 100 and facilitate the bonding between the wafer part 100 and the second substrate 110 in the subsequent steps , step s 602 may be performed . as shown in fig5 , the side of the wafer part 100 opposite to the side on which a circuit 102 is formed is bonded to a first substrate 120 through a first adhesive layer 121 . the first substrate 120 may be in a circular shape so as to match the second substrate 110 in the subsequent processes . the first substrate 120 may be a silicon first substrate . because of the high heat dissipation capability of the silicon first substrate , the requirement for heat dissipation during the process of packaging or during the process of application of the chips after packaging can be satisfied . the first substrate 120 may also be made of another material which can provide a support for the wafer part 100 and exhibits a certain level of transparency , such as glass . optionally , the first substrate 120 may also be made of another material which can provide the support . according to another embodiment , a step for further dicing the wafer part 100 needs to be performed so as to meet the requirement for the recombination . then , step s 603 is performed . the portion of the wafer part 100 which extends beyond the first substrate 120 is removed . the profile of the wafer part 100 or the multiple wafer parts 100 after the recombination may go beyond the profile of the first substrate 120 , which is disadvantageous for the subsequent packaging operations . thus , the step for removing the portion of the wafer part 100 or the multiple wafer parts 100 which extends beyond the profile of the first substrate 120 may be performed . then , step s 604 may be performed , where the side of the wafer part 100 on which the circuit 102 is formed is bonded to the second substrate 110 , and the structure as shown in fig6 is formed . the second adhesive for bonding the wafer part 100 to the second substrate 110 includes epoxy resin , polyimide , bcb resin and bt resin . the second adhesive is used for the bonding as well as insulation and sealing . when the bonding is performed , the chips 101 on the wafer part 100 are accommodated respectively in the cavities formed by the cavity walls 112 on the base 110 . thus , a structure for sealing the circuits 102 on the chips 101 is formed by the wafer part 100 and the second substrate 110 in combination . depending on different requirements for packaging the chips , sometimes the first substrate 120 needs to be removed . in other words , a step for removing the first substrate 120 needs to be performed after step s 604 . if the first substrate 120 needs to be removed in the subsequent processes , the adhesive layer 121 for bonding the wafer part 100 to the first substrate 120 is formed by an adhesive whose adhesion can be reduced or eliminated , such as a uv adhesive and a wax adhesive . the adhesion of the uv adhesive may be reduced significantly or eliminated after being exposed to uv light . the adhesion of the wax adhesive may also be reduced significantly after being heated to a predetermined temperature . according to different requirements for the packaging , the step for thinning the wafer part 100 may be performed after the first substrate 120 is removed . according to the present invention , the chip 101 is used in a broad concept and includes an integrated circuit chip such as a processor , a memory and a controller , an optical sensor chip such as a ccd and a cmos image sensor , another sensor chip such as a heat sensor chip and a motion sensor chip , and a micro electro - mechanical system ( mems ) chip . in other words , the circuit 102 in the chip 101 may include an optical sensor , a heat sensor , a motion sensor or an mems chip . with respect to another aspect of the present invention , i . e . how to recombine chips , wafer parts or half finished packaging targets each having a smaller size into a wlcsp target having a larger size , one embodiment of the present invention provides a method for forming a wlcsp target as shown in fig7 , including the following steps . at step s 701 , at least two recombination units and a first substrate are provided . the recombination units includes a single chip , a wafer part including at least two chips and a half finished packaging target which has been subjected to at least one previous step of packaging . at step 702 , the side of each of the recombination units , which is opposite to the side including a circuit , is bonded to the first substrate to form a wlcsp target . according to one embodiment of the present invention , the step for forming a half finished packaging target in step s 701 at least includes : bonding a wafer to a second substrate to form a two - layer structure ; and dicing the two layer structure into half finished packaging targets . the structure and material of the second substrate to be bonded to the wafer are similar to those described in conjunction with step s 601 . in the step for dicing the two - layer structure , the two - layer structure may be diced into half finished packaging targets each including one or more chips . the method for forming the half finished packaging targets is not so limited . those skilled in the art can appreciate that , the half finished packaging target formed at any step during the packaging may be used as a recombination unit , no matter whether the half finished target has been diced or not , how many chips are included in the half finished packaging target and how large the half finished packaging target is . then , step s 702 is performed , where the side of each of the recombination units , which is opposite to the side including the circuit , is bonded to the first substrate to form a wlcsp target . those skilled in the art can appreciate that , during the wlcsp , performance of the subsequent steps may be facilitated in the case that the chips are arranged in array . thus , at step s 702 , the recombination units may be arranged in array on the first substrate . after step s 702 , the chips are recombined to cover substantially the whole wafer . hence , the focus of this embodiment is how to perform the wlcsp to at least two chips formed by dicing the wafer . in the case that each of the recombination units is a single chip , a wafer part including at least two chips or a half finished packaging target which has not been bonded to the second substrate , the method further includes the following step after step s 702 : bonding the recombination units to the second substrate . the performance of this step and the structure and material for it are similar to those described in conjunction with step s 601 and descriptions thereof are omitted here . in steps s 701 - s 702 , for the details of the forming of the wafer part , the type of the chip , the size of the first substrate , the adhesive and other steps such as the step of removing the first substrate and the step of thinning , reference may be made to those described in conjunction with steps s 601 - s 604 . those skilled in the art can appreciate that , the technical solution including a step of dicing the wafer into multiple chips before step s 701 may also be used to deal with one of the aspects of the present invention , i . e . how to package a wafer with a larger size on a wlcsp apparatus with a smaller size . as shown in fig8 - 14 , the method for packaging the wlcsp target formed according to one embodiment of the present invention includes the following steps . as shown in fig8 , the side of each of chips 801 in the wlcsp target , which is opposite to the side including a circuit , is cut , so that a side wall inclining to the side including the circuit is formed on each of the chips 801 and a chip pad 802 is exposed . as shown in fig9 , an insulation layer 803 is coated over one side of the chips 801 in the wlcsp target until the chips 801 are covered . a support layer 804 and a solder block layer 805 are formed over the insulation layer . as shown in fig1 , the support layer 804 , the insulation layer 803 , the pads 802 and cavity walls 806 are etched at the boundary between the chips 801 until the third substrate 807 is exposed to form a trench . as shown in fig1 , an intermediate metal layer 808 is formed over the solder block layer 805 and the trench . the intermediate metal layer 808 is electrically connected with the pads 802 . the intermediate metal layer 808 on the support layer is patterned . as shown in fig1 , a mask layer 809 is formed over the intermediate metal layer 808 . the mask layer 809 is patterned until part of the intermediate metal layer 808 is exposed . thus , mask via holes are formed . as shown in fig1 , metal bumps 810 are formed in the mask via holes . as shown in fig1 , the third substrate is diced along the axis of the bottom of the trench and individual complete chip packaging structures are formed . it should be emphasized that the above - described embodiments , particularly the preferred embodiments , are merely possible examples of the present invention . many variations and modifications may be made thereto without departing from the spirit and scope of the invention . all such modifications and variations are intended to be included within the scope of this disclosure as defined by the following claims . | 7 |
the improvement in accordance with the present invention will first be described with reference to fig1 in the case of a device for thermal regulation of an enclosure of the type described in european patent 4 , 233 granted to the present applicant . as illustrated in fig1 this device essentially includes a temperature - measuring circuit designated by the reference a and a heating circuit designated by the reference b . the measuring circuit a is made up of one or a number of heat - sensitive elements or temperature sensors r 4 connected in series . these sensors are included in one arm of a resistor bridge , the three other arms of which carry resistors r 1 , r 2 , r 3 . one of the diagonals of the bridge is supplied with direct - current voltage and accordingly receives a voltage vb at the bridge point p while the opposite point q of the diagonal is grounded . the ends xy of the other bridge diagonal are connected to the two inputs of an operational amplifier z having a negative feedback loop which is provided with a resistor r 5 and the arrangement of which will be explained in detail hereinafter . the heating circuit b includes a chain of transistors which are connected in series through their emitters and collectors and are designated by the references t l to t n . these transistors are mounted as voltage regulators . the base of the transistors t l to t n are maintained at a constant potential by a bridge formed by a resistor and zener diode such as the bridge r &# 39 ; n and cr n in the case of the transistor t n . the transistor t c which is mounted in series with the transistor t l performs the function of control transistor . the base of the transistor t c is connected to the output of the operational amplifier z through a voltage - dividing bridge ra - rb having the intended function of providing a coupling link , taking into account the particular conditions of biasing of the amplifier z . this voltage - dividing bridge has a suitable ratio and serves to reduce the residual output voltage of the amplifier to its low level in order to attain a value below the base cutoff voltage of the transistor t c . by connecting the transistor t c as an emitter - follower , its base voltage is restored to the level of its emitter and , since this latter is connected to ground through an emitter resistor r 9 , the current i of the chain of transistors t c , t l to t n is determined by the variations in base voltage of the transistor t c which can contribute to heating of the enclosure in the same manner as the other transistors . in accordance with the present invention , the resistor r 5 of the negative feedback loop of the output amplifier z is connected between the emitter resistor r 9 and the inverting input of the operational amplifier z . by means of this arrangement , the voltage at the terminals of the emitter resistor r 9 is proportional to the voltage on the inverting input of the amplifier z . furthermore , the regulating system is no longer dependent to any extent on the electrical parameters of the transistor t c and the current gain is related to the values of the resistors r 1 , r 2 , r 5 and r 9 , thus permitting good reproducibility of the system . moreover , the operation of the circuit described in the foregoing is identical with the operation described in european patent 4 , 233 which has been cited earlier and to which reference may usefully be made . it is further apparent to those versed in the art that all the modifications made in the heating circuit as described in european patent 4 , 233 can be incorporated in the present invention , particularly in regard to the current - limiting circuit consisting of a transistor amplifier which is driven by a signal applied to its base and related to the current to be limited and which in turn produces action by means of its collector on the base of the control transistor t c . two other embodiments of the present invention will now be described with reference to fig2 and 3 . in these two embodiments , the temperature - measuring circuit has been modified with a view to incorporating a regulating device having proportional - plus - integral - plus - derivative action as described in french patent application 82 19584 granted to the present applicant . as illustrated in fig2 a positive voltage va is supplied to a stabilized - voltage generator 1 , the output voltage vb of which is intended to supply a resistor bridge and five operational amplifiers a 0 to a 4 . the resistor bridge has a resistor r 3 , the voltage vb being applied to a first end of this resistor and a measuring voltage vth being applied to the second end which is connected to one end of at least one thermistor ctn having a negative temperature coefficient , the opposite end of which is grounded . the measuring voltage vth is thus a decreasing function of temperature . in addition , the voltage vb is also supplied to a second arm of the bridge formed by the resistor r 1 which is mounted between the voltage vb and a midpoint or node having a reference voltage vref . this node is connected to a resistor r 2 , the opposite terminal of which is connected to ground . a decoupling capacitor c 1 is provided between the nodes x and y of the two arms of the resistor bridge . furthermore , the voltage vth is sent to an operational amplifier a 0 mounted as a voltage follower . the output of the amplifier a 0 is sent to the inverting inputs of three parallel - connected operational amplifiers a 1 , a 2 , a 3 , the forward - bias noninverting inputs of which receive the reference voltage vref . the three operational amplifiers a 1 , a 2 , a 3 are intended to be employed respectively for the proportional , integral and derivative corrections and are constructed in the manner described in french patent application 82 19584 . in consequence , the amplifier a 1 has proportional action , the amplifier a 2 has integral action and the amplifier a 3 has derivative action . the outputs of the amplifiers a 1 , a 2 , a 3 are connected respectively through three resistors r 10 , r 11 , r 12 to the inverting terminal of an output operational amplifier a . sub . 4 , the forward - bias noninverting input of which receives the output of the amplifier a 0 . in accordance with the present invention , the amplifier a 4 is provided with a negative feedback loop consisting of a resistor r 5 which is mounted between the emitter resistor r 9 of the control transistor t c and the inverting input of the amplifier a 4 . in order to compensate for the voltage drop at the terminals of the resistor r 5 , the output of the generator 1 is connected through the resistor r 13 to the inverting input of the amplifier a 4 . the operation of this circuit is identical with the operation of the regulating device described in french patent application 82 19584 . however , as a result of the negative - feedback loop circuit arrangement , the voltage at the terminals of the resistor r 9 is proportional to the sum of the signals delivered by the amplifiers a 1 , a 2 , a 3 and of the voltage vb and the current gain is solely related to the values of the resistors r 10 , r 11 , r 12 , r 13 , r 5 and r 9 , thus making it possible to obtain good reproducibility of the circuit since it is no longer dependent on the electrical parameters of the control transistor t c . as shown in fig2 and 3 , the heating circuit has also been modified with respect to the heating circuit described in european patent 4 , 233 or in french patent application 82 19584 . in fact , the bases of the heating transistors t 1 , t 2 , t n are connected in this case to a common voltage - dividing bridge made up of resistors r &# 39 ; 1 , r &# 39 ; 2 , r &# 39 ; 3 , r &# 39 ; n which are mounted between the common node of resistors r 5 and r 9 and the supply voltage v 4 . the advantage of this arrangement lies in the achievement of a reduction both in the number of components to be wired and in power consumption since the bridge is made up only of resistors in series . furthermore , biasing of the different transistors is referenced with respect to the voltage at the terminals of the emitter resistor r 9 , the object thus contemplated being to compensate the collector - emitter voltage of each transistor as a function of the heating current . it should further be noted that the control transistor t c is mounted in series with the transistor t l . the base of the transistor t c is connected to the output of the output amplifier a 4 through a voltage - dividing bridge r a - r b , the intended function of which is to provide a connection which takes into account the particular conditions of biasing of the amplifier a 4 . in addition , a transistor t l is mounted between the base and the emitter of the control transistor t c , with the result that the base of the transistor t l is connected to the emitter of the transistor t c , the emitter of the transistor t l is connected to ground and the collector of the transistor t l is connected to the base of the transistor t c . moreover , as mentioned in french patent application 83 16549 in the name of the present applicant , the transistors t c , t 1 , t 2 , t n will preferably be transistors of the darlington type in order to reduce the current in the resistor bridge r &# 39 ; 1 to r &# 39 ; n . in fig3 there is shown an alternative embodiment of the regulating device of fig2 . in this case , the derivative - action operational amplifier a 1 has been replaced by a &# 34 ; follower - differentiator &# 34 ; amplifier a &# 39 ; 1 , the output voltage of which is equal to the sum of its input voltage and of its derivative . the amplifier a &# 39 ; 1 is positioned at the output of the proportional - action amplifier a 3 . this makes it possible to employ a biased chemical capacitor for the &# 34 ; follower - differentiator &# 34 ; amplifier , thus permitting an appreciable reduction in overall size and cost of the circuit . the other parts of the circuit shown in fig3 are identical with the circuit of fig2 particularly in regard to the improvements achieved by the present invention . in accordance with another distinctive feature of the present invention as shown in fig4 the inverting input of the output operational amplifier a 4 is connected through a fixed resistor r 22 to the output of a differential amplifier a 5 , the forward - bias noninverting input of which receives the reference voltage vref and the inverting input of which receives a bias voltage e . this characteristic feature is applicable both to the embodiment of fig2 and to the embodiment of fig3 . the operation of the regulating device has been described in the foregoing except for this improvement , the operation of which will now be explained . it has thus become apparent that , under conditions of regulation , the differential voltage of the measuring bridge composed of the resistors r 1 , r 2 , r 3 and of the thermistor ctn is zero . in consequence , the voltage v 0 at the output of the operational follower amplifier a 0 is equal to the voltage at the node y , namely the reference voltage vref . the result thereby achieved is that the voltage v 1 at the output of the operational amplifier a 1 is equal to the voltage v 0 since the differential voltage at the input of the amplifier a 3 is zero . since the output amplifier a 4 operates in the linear mode , the voltage on its noninverting input is equal to the voltage on its inverting input . furthermore , the transfer function of the differential amplifier a 5 is given by the following equation : with all the parameters given above , it is possible to compute the voltage v 2 at the output of the operational amplifier a 2 as a function of the voltages v 0 , v 1 , v 6 and e by applying the milmann theorem to the inverting input of the output operational amplifier a 4 . the following equation is accordingly obtained : ## equ1 ## in accordance with the present invention , saturation of the integral - action amplifier a 2 is prevented by choosing the value of the constant g with a view to ensuring that the voltage v 2 at the output of the amplifier a 2 is not dependent on the volta v 0 . to this end , the term between brackets must accordingly be zero and we obtain : ## equ2 ## thus the output voltage of the integral - action amplifier a 2 is now dependent on only two terms : v 6 which is a function of the heating current , e which is a voltage to be chosen as a function of j in order to set the operating point of the integral - action amplifier a 2 . in another embodiment which is illustrated in fig5 the differential amplifier a 5 is replaced by an operational amplifier a &# 39 ; 5 associated with two resistors r 21 and r 20 . more specifically , the resistor r 20 is connected between the bias voltage e and the inverting input of the amplifier a &# 39 ; 5 while the resistor r 21 is connected between the output and the inverting input of the amplifier a &# 39 ; 5 . in this case , the transfer function of the amplifier a &# 39 ; 5 is given by the following equation : ## equ3 ## by comparing this equation with equation v 5 : g . v 0 - j . e , we obtain : ## equ4 ## hence the relation which gives the voltage v 2 at the output of the amplifier a 2 as a function of v 0 , v 6 and e . ## equ5 ## should it be found desirable to ensure that the voltage v 2 not dependent on the voltage v 0 , we accordingly obtain : ## equ6 ## thus the voltage v 2 is now dependent only on v 6 and on e . in this case , it is the voltage source e which will establish the operating point of the integral - action amplifier a 2 . it will be readily apparent to those versed in the art that all alternative forms of construction described in european patent 4 , 233 and in french patent applications 82 19584 and 83 16549 are equally applicable to the present application . | 6 |
fig1 shows a side view of the bilevel bicycle storage system , herein referred to as the doubleparker . the doubleparker has enough space to store two bicycles , one above the other . a lower receiver 10 is fixed to the floor within an enclosure l 2 enclosure 12 . the enclosure 12 has an upper door 14 and a lower door 16 attached with hinges to the front of the enclosure 12 , see fig8 . the enclosure 12 has generally level upper floor panel 18 ( see fig9 and 10 ) which separates the storing spaces from each other and also prevents water and soil from the upper storing space from dripping down onto the bicycle stored below . in another embodiment , the pair of storing spaces do not have a joint enclosure 12 , but each storing space is contained within its own enclosure , which can be stacked and secured on top of each other . an upper receiver 20 , which is shown it loading and unloading position in fig1 , is provided for in the upper level of the doubleparker . for loading and unloading a bicycle the upper receiver 20 is pulled out of the enclosure 12 and tilted downward so that the proximal end 22 of the upper receiver 20 is directed to the floor . a foot 24 is arranged below the proximal end 5 to prevent damage to the upper receiver 20 or the floor when the upper receiver 20 is lowered . in fig1 a bicycle is shown secured into the upper receiver 20 . in this position the upper receiver 20 is easily lifted with a handle 26 . the upper receiver 20 is raised into a generally horizontal position to insert the upper receiver 20 into the enclosure 12 . in this manner the enclosure 12 can be secured and two bicycles stored , loaded and unloaded on top of each other in the enclosure 12 . fig2 shows a top view of the upper receiver 20 . components within the upper receiver . 20 are also visible through the upper receiver . a mounting frame 28 is provided to connect to the upper receiver 20 , whereby the mounting frame 28 is fixed to a vertical support 30 which is attached to the floor . in another embodiment , the upper floor 18 between the two storing spaces can serve as a support for the mounting frame 28 instead of the vertical support 30 . in this case the upper floor 18 would be fixed to the enclosure 12 . a tension pulley axle 32 is positioned horizontally on the proximal end of the mounting frame 28 , upon which a front guide roller 34 and a tension pulley 36 are mounted . the proximal end of the mounting frame 28 is the end closest to the front of the enclosure 12 and the doors 14 , 16 . a rear guide roller 38 is mounted on a rear guide roller axle 40 which in turn is horizontally attached near the midpoint of the mounting frame 28 . the upper receiver 20 travels forward and back on the rear guide roller 40 and front guide roller 34 . the guide rollers 34 , 40 engage a pair of guide rails 42 inside the top and bottom walls of the upper receiver 20 . in fig2 one guide rail 42 is represented by the dashed line parallel to the longitudinal axis of the upper receiver 20 . the tension pulley 36 is mounted on the tension pulley axle 32 next to the front guide roller 34 . a retraction cable 44 is wound around the tension pulley 36 and the free end of the retraction cable 44 is attached inside the upper receiver 20 at the proximal end 22 . a tension pulley spring ( not shown ) is attached to the tension pulley 36 and the tension pulley axle 32 and acts to wind the retraction cable 44 onto the tension pulley 36 . the tension pulley spring may be integrated into the tension pulley 36 so that they are a single unit , or they may be separate pieces . when the upper receiver 20 is pulled out of the enclosure 12 , then the retraction cable 44 is pulled taut against the tension pulley spring . thus , sufficient tension is available to assist the user in inserting the upper receiver 20 into the enclosure 12 . in other embodiments , the tension pulley 36 and spring are mounted to the enclosure 12 or other suitable support inside the enclosure 12 . alternatively , the tension pulley 36 and spring may be mounted to the upper receiver 20 with the pulley 36 located near the midpoint of the cable 44 . the two free ends of the retraction cable 44 are fixed to the proximal end 22 of the upper receiver 20 and an immovable position that is beyond the distal end of the upper receiver 20 when the upper receiver is fully retracted . a pivot link 46 , shown as a flat bar , is arranged between the mounting frame 28 and the upper receiver 20 . one end of the pivot link 46 is connected to the mounting frame 28 by a pivot shaft 48 . the guide roller axle 40 is attached to the other end of the pivot link 46 . the rear guide roller 38 is mounted to the guide roller axle 40 . the upper receiver 20 moves parallel to its longitudinal axis and along the pivot link 46 by the rear guide roller 38 . the pivot link 46 serves to guide the upper receiver 20 longitudinally and secures it against excessive lateral motion . the pivot link 46 also aids in lifting the upper receiver 20 . a tag line 50 runs from a tag anchor 52 on the mounting frame 28 to a levelling spring 54 attached to the enclosure 12 or another fixed location near the distal end of the mounting frame 28 . in between the levelling spring 54 and the tag anchor 52 , the tag line 50 is routed around a deflection pulley 56 , mounted to the pivot link 46 opposite the pivot shaft 48 , and an idler pulley 58 mounted to the mounting frame 28 . when the upper receiver 20 is pulled out of the enclosure 12 and the proximal end 22 is lowered , the pivot link 46 pivots clockwise around the pivot shaft 48 . the displacement of the pivot link 46 pulls the tag line 50 tight against the levelling spring 54 . in this manner , a restoring force is created , which helps lift the upper receiver 20 to horizontal , whether unloaded or loaded with a bicycle . the amount of support to the upper receiver 20 is easily adjusted by varying the strength or preload of the tension pulley spring and the levelling spring 54 . this can be accomplished by the manufacturer or user . multiple springs may be used in either or both positions if needed to provide an appropriate tension . bicycles are usually loaded and secured into the receivers 10 , 20 in the travelling direction so that the front wheels of both bicycles in fig1 are both arranged to the left , farthest into the enclosure 12 . a wheel bail 60 is pivotally attached to the upper receiver 20 to hold the front wheel of the bicycle straight . the wheel bail 60 is biased by a bail spring 62 as shown in fig1 and 3 and thus rests against the front wheel of the bicycle secured in the upper receiver 20 . the spring - mounted and flexible nature of the wheel bail 60 enables it to adjust to and partially encompass the bicycle wheel . in fig2 , the wheel is shown in cross - section . the wheel bail 60 can be constructed out of a plate stock or out of a wire material , whereby it can exhibit material - based elasticity . the wheel bail 60 can thus be pivoted about its root against in order to adapt to various diameters of bicycle wheels or to adapt to various overall bicycle lengths . fig3 shows the interaction of the wheel bail 60 with a bicycle wheel . fig3 shows the wheel bail 60 in two different positions . it can take on these two positions and an infinite number of intermediate positions in adjusting itself to the dimensions of various bicycles . the bicycle can be pushed as far as a bail limiter ( not shown ) when storing a bicycle in the upper receiver 20 , as shown in the position to the right of the wheel bail 60 in fig3 . the bicycle is automatically returned to the proximal end 22 of the upper receiver 20 due to the spring tension on the wheel bail 60 until the rear wheel of the bicycle rests against the wheel lock 78 , explained below . this equilibrium position of the wheel bail 60 is represented by the position to the left in fig3 . the upper receiver 20 has a channel built into its upper surface . the channel has a u - shaped or v - shaped cross - section to guide the wheels of the bicycle along the upper receiver 20 . two side flanks 66 are attached near the proximal end 22 of the upper receiver 20 , see fig1 . these flanks 66 can be made from bar stock to form an open support framework or out of metal as complete sheets to form a wall . the flanks 66 enable the extremely reliable positioning and retention of the rear wheel in the upper receiver 20 . the wheel bail 60 ensures that the rear wheel is located in the area of the flanks 66 . as described earlier , the wheel bail 60 presses the bicycle toward the proximal end 22 of the upper receiver 20 and the flanks 66 . in the area of the proximal end 22 of the upper receiver 20 a wheel lock 78 is shown . the wheel lock 78 captures the bicycle wheel at the proximal end 22 of the upper receiver 20 . as shown the wheel lock 78 is in the form of a cross - beam , which stretches across the channel atop the upper receiver 20 and against the spokes of the bicycle wheel . the low level of the wheel lock 78 above the upper receiver 20 aids in securing the bicycle in the upper receiver 20 , and also ensures that the bicycle is close to the proximal end 22 of the upper receiver 20 an additional security feature is effected by slots or apertures through the flanks 66 , through which a u - lock or a chain lock can be threaded . this provides protection against theft and safely fixes the bicycle in the upper receiver 20 . the necessary slots or apertures are readily evident , especially when flanks 66 are made of curved round bar stock . fig5 shows a cross - section of the upper receiver 20 and pivoting mechanism lying flat in the storing position . the rear guide roller 38 is mounted on the guide roller axle 40 , which extends from the pivot link 46 to the inside of the upper receiver 20 . the groove - shaped u or v section of the upper receiver 20 is easily seen . the pivot link 46 is rotatably attached to the mounting frame 28 by the pivot shaft 48 . the deflection pulley 56 can be seen behind the pivot shaft 48 in fig5 . the deflection pulley 56 is located behind the pivot shaft 48 in fig5 . in fig4 it is shown that the box profile of the upper receiver 20 can be open to the side opposite from the mounting frame 28 . fig4 shows that the bail spring 62 has a direct effect on the wheel bail 60 . in one embodiment the bail spring 62 is offset from the root or pivot point of the wheel bail 60 , closer to the proximal end 22 of the upper receiver 20 , so that the wheel bail 60 is forced into a position resting against the bicycle . in another embodiment , the bail spring 62 is generally concentric with the root or pivot point of the wheel bail 60 . the lower part of the upper receiver 20 , which has a generally box - shaped profile , has upper and lower guide rails 42 which project inwards as presented in fig6 . these guide rails 42 form a track for the rear guide roller 38 and the front guide roller 34 , which each have a circumferential groove for receiving the guide rails 42 to guide the upper receiver parallel to the mounting frame 28 . when the upper receiver 20 is moved between its loading and unloading position and its storing position , it travels on the guide rollers 34 , 38 and the guide rails 42 . if the upper receiver 20 has a generally closed profile , elongated slots in the side of the upper receiver 20 will provide for the movement between the upper receiver 20 and the guide rollers 34 , 38 . the tension pulley axle 32 and the guide roller axle 40 extend through these elongated slots . in fig5 , the pivot link 46 is shown in a horizontal position , parallel to the upper receiver 20 . in this position , the pivot link 46 lies against the lower , horizontal section of a support bracket 68 , so that the weight of the upper receiver 20 , on which a bicycle could possibly be loaded , is supported not only by the tension pulley axle 32 , the pivot shaft 48 and guide roller axles 34 , 38 , but also extensively by the support bracket 68 on the mounting frame 28 . fig6 shows a line system of doubleparkers , whereby the enclosures 12 have doors both above 14 and below 16 , which are lockable using locks 72 . this bicycle storing system can be operated by means of a terminal 74 set up among the enclosures 12 . the shown storing system or similar storing systems can be run fully automatically with few personnel . in such a system , the period of usage of each individual storing space is automatically registered , i . e . the elapsed time since the storing space was locked . the terminal or main controls attached to the terminal have a storage memory , which stores the time when every single storing space was locked , or if any storing spaces are not locked . when a user wants to open a specific locked storing space , he must register at the terminal 74 first , identify the storing space and prove his right of access to the storing space . these three steps can be carried out by numerous actions , or just one single transaction , i . e . by using a key or access card or something similar , which the user can have checked at an appropriate reader or sensor at the terminal 74 . the fee for use is dependent on the period of use for the identified storing space and can be displayed to the user at the terminal . payment of a fee for use can be made directly at the terminal or at one of the connected pay stations by using coins , bills or tokens or by cashless payments using debit or credit cards , or by providing account data and an id - code . a data transfer from the terminal to a bank or other organization can be carried out depending on the required method of payment . this may be accomplished through a wired or wireless system . after payment is accepted , the appropriate storing space is automatically unlocked so that the user can open the door or the locking device of this storing space and remove his bicycle from the storing space . a cabled or wireless data transfer from the terminal 74 to the main controls is provided via a telephone line or wireless communication system . the main controls can be a great distance away from a storing system — even hundreds of miles away . in this manner it is possible to run numerous storing systems from a collective main control system with few personnel . technical information can be evaluated in the main control system , i . e . all errors or defects registered by sensors , so that service personnel can be sent to the storing system to repair and eliminate the defect or error . sensory - detected information can also be stored and evaluated for business management reasons , i . e . it can be determined if any storing space is empty or if a bicycle is secured in the storing system , so that the utilization of the storing system can be evaluated for business management reasons . invoices can also be drawn up in the main control system and sent to users , when , for example , long - term customers who do not need to pay directly at the terminal 74 , but are billed at regular intervals , i . e . monthly . fig7 shows a closer view of a single doubleparker , where both doors 14 , 16 are closed . fig8 shows a doubleparker during the loading or unloading of the upper storing space . the wheel bail 60 and further details of the upper receiver 20 are not presented in this figure . a lean - against bracket 88 and clamps 78 are shown as an alternative to the wheel bail 60 and flanks 66 . the lean - against bracket 88 is made of round pipe or tubing . in the preferred embodiment , the bracket 88 includes a protective cover made of a soft material , like pvc , in order to prevent damage to the bicycle frame . the bracket 88 aids in the security of the bicycle during loading , unloading and in the parking position . the leaning bracket 88 extends the entire length of the upper receiver 20 so that standard commercially - purchased chains or u - locks can be used to attach the bicycle to the bracket 88 in a number of user - defined positions . the lean - against bracket 88 is designed in such a way that the bicycle can be pushed into the upper or lower receiver until it is stable . fig9 shows a doubleparker with two open doors , whereby both bicycles are shown in their storing position . the floor 18 is visible immediately below the upper receiver 20 . the enclosure 12 may be clad or covered with a wide variety of suitable materials based upon decorative or functional requirements . in another embodiment , the lower storing space can be constructed so that the door 16 is curved or bent inward above its center , and with a matching profile on the enclosure 12 , so that the top of the door 16 goes beneath the interior of the upper storing space . in this embodiment the pivot point near the proximal end of the mounting frame 28 is at the front edge of the enclosure 12 . any inward curve or bend in the front of the lower storing space would thus enable the upper receiver 20 to slant downward just above the bend , without interfering with the door 16 of the lower storing space . in another embodiment , the upper receiver 20 is slidingly mounted to a guide bar 76 . the guide bar 76 is slidingly mounted in turn to the mounting frame 28 . the upper receiver 20 can be moved along the guide bar 76 so that the upper receiver 20 and the bicycle can be telescoped into the guide bar 76 and the guide bar 76 telescoped into the mounting frame 28 . a much shorter overall length of the mounting frame 28 and the upper receiver 20 may be employed by telescoping them together . minimal space is required for storing a bicycle in such a system . the telescoping feature of the upper receiver 20 within the guide bar 76 allows for the upper receiver 20 to lower earlier as it is pulled out of the enclosure 12 . it is not necessary to pull out the entire upper receiver 20 from the enclosure 12 and then lower the upper receiver 20 to the loading and unloading position only when the pivot point is near the leading edge of the enclosure . the telescoping feature of the guide bar 76 and the upper receiver 20 provides for easier handling of the upper receiver 20 and an early lowering of the upper receiver 20 so that easier handling is enabled for the customer when loading and unloading . fig1 , 11 and 12 show a two - part bicycle retention clamp 78 that attaches to the receivers 10 , 20 . the clamp 78 uses the weight of the bicycle to secure the bicycle automatically , so that it cannot roll backward . the clamp 78 can be made of round stock , fig1 , or plate and sheet stock , fig1 and 11 . clamp 78 movement occurs as the bicycle enters the elongated hole 80 in the receiver 10 , 20 due to its own weight . a pair of clamp arms 82 pivot about a pair of hinge points 84 outside the receiver 10 , 20 on a pair of clamp mounts 94 . a pair of actuator arms 70 overlap inside the elongated hole 80 so that the bicycle wheel acts upon the clamp arms 82 uniformly . a pair of clamp pads 86 bear against the bicycle wheel in response to the weight of the bicycle upon the actuator arms 70 . the clamp 78 opens to release the wheel when the bicycle wheel is lifted out of the elongated hole 80 in the receiver 10 , 20 . retention roller 90 may be employed to prevent shifting . the clamp 78 can be used in all rail - like facilities in which the bicycle is pushed on or into the system . on the lower level , where a determination of the bicycle in the receiver is perhaps not necessary due to handling or security considerations , this locking device may still be provided for additional safety to hold the bicycles reliably . the clamp 78 may be incorporated into a security system to protect against theft . the clamp 78 can be devised as a mechanical self - locking device , so that the clamp automatically goes from open to locked when a bicycle is pushed into the storing system . a simple mechanical lock may be used with the lock apertures 92 on each clamp arm 82 . the clamp 78 can be controlled using appropriate sensors as well . as soon as the bicycle is in the “ parking position ” the bicycle is automatically locked . additional sensors monitor the parking time and user identification by means of software , hardware and clock timers . the clamp 78 can be opened again by means of payment or other arrangement . fig1 shows a side view of a three - level bicycle parking system , here in referred to as the tripleparker 100 . three bikes a , b , c are shown mounted on the tripleparker system 100 . the bike c at the lowest level is easily rolled onto the lower rack 112 via a process that is described above . bicycle b , in the middle level , is supported on an extendable rack 114 that also deflects downward for easy loading and unloading of bike b . bicycle a is suspended above bikes b and c by a pair of cables 115 that are attached to a shuttle 116 . the shuttle 116 travels along a track mechanism 118 that is attached to the ceiling or another support . shuttle 116 ′ is the same shuttle as shuttle 116 , but is shown at the opposite end of track 118 and ready to load or unload bicycle a ′. bicycle a ′ is also the same as bicycle a . a control box 120 , 120 ′ is shown suspended from shuttle 116 , 116 ′ to control the position of the shuttle 116 , 116 ′ along track 118 . the control box 120 , 120 ′ also controls the cables 115 , 115 ′ that lift and lower the bicycle a , a ′. the control system may be set up to permit the cables 115 to be lowered only when the shuttle 116 is in the position shown by shuttle 116 ′. fig1 shows a front view of the tripleparker 100 . notice that the bicycles c and b , in the first level 112 and the second level 114 , may be staggered in elevation to eliminate the possibility of handlebars becoming entangled . the mounting positions 112 , 114 are assembled to incorporate this elevation stagger through minor manufacturing variances . fig1 is an elevated perspective view of the lift mechanism for the upper level of the tripleparker system 100 . the track 118 is mounted within a housing 122 to shield the track mechanism 118 and to provide a simplified means to mount the track overhead . in the embodiment shown , the control box 120 is replaced with a control handle 124 and loop 126 . the control handle 124 is manipulated by pulling or twisting to direct the shuttle 16 along the track 118 . motion of the shuttle 116 can be powered via an electric motor or similar means . the loop 126 is attached to an enclosed gear - reduction mechanism to raise and lower the cable 115 and any attached bicycle a . fig1 is a side view of the lift mechanism for the upper level of the tripleparker system 100 . the housing 122 in this embodiment enclosed the shuttle 116 , but the cables 115 are seen extending downward from the concealed shuttle 116 . in this view the track 118 and housing 122 are slightly shortened for illustration purposes . a cable spacer 128 is attached to the cables 115 and keeps them properly separated and weighted to assure proper functioning , even without the weight of a bicycle a , and also prevents tangling of the cables 115 . a handlebar hook 130 and a seat hook 132 are attached to the cables 115 and make it very easy to quickly attach a bicycle a . fig1 is a side view of an alternative embodiment of the second level of the tripleparker 100 . this is mechanism is distinct in several ways from that described in fig1 above . this embodiment still uses the vertical support 30 and the mounting frame 28 as seen in fig1 , but the upper receiver 20 is mounted to the mounting frame 28 using an entirely different mechanism . this mounting mechanism , shown in fig1 , enables the upper receiver 20 to be extended along and parallel to the mounting frame 28 for a predetermined distance at which point the proximal end 22 of the upper receiver 28 is deflected downward toward the floor . this enables easy loading and unloading of bicycles . fig1 is a front end view of the mounting frame 128 . the mounting frame 28 includes a u - shaped channel 134 , a pair of deflection rails 136 , a pair of fulcrum rollers 138 and a support roller 140 . the upper receiver 20 , shown in cross - section in this view , includes an inverted - u channel that is parallel to the u - channel of the mounting frame 28 so as to conceal the fulcrum rollers 138 and support roller 140 . the upper receiver 20 rides directly on the support roller 140 inside the top of the inverted - u . the upper receiver 20 also includes two pairs of parallel rails 141 which are also parallel to the length of the upper receiver 20 , which envelope the fulcrum rollers 138 , thereby providing three points of support for the movable upper receiver 20 assembly . fig1 is a side view of the mounting frame 128 . the deflection rails 136 are parallel to the length of the upper receiver 28 except near the fulcrum rollers 138 , where the deflection rails 136 curve smoothly upward . the upper receiver 20 is in the retracted position , which is evident because the upper receiver 20 is level and parallel to the mounting frame 28 , and the deflection roller 142 , which is attached to one end of the upper receiver 20 is at the distal end of the deflection rails 136 . fig2 is a view through the assembled mounting frame 28 with the upper receiver 20 attached . in this view the upper receiver 20 is extended and deflected downward . the upper receiver 20 is easily extended and rolls on the deflection roller 142 , the fulcrum rollers 138 and the support roller 140 . as the upper receiver 20 is extended to a predetermined position , the deflection roller 142 encounters the upwardly curved portion of the deflection rails 136 , which forces the distal end of the upper receiver 20 upward . the support roller 140 is mounted to a deflection lever 146 which is attached to the mounting frame 28 via a fulcrum bolt 144 . the deflection lever 146 rotates to accommodate the upward deflection of the distal end of the upper receiver 20 , thus , the support roller 140 is deflected downward along with the proximal end of the upper receiver 20 . this is exemplified in fig1 as upper receiver 20 ′. some resistance should be provided to prevent the upper receiver 20 from falling in an uncontrolled manner towards its extended and deflected position . for this purpose a gas spring ( not shown ) is mounted between spring mounts 147 and 148 . spring mount 147 is anchored to a fixed position inside the mounting frame 28 . spring mount 148 is attached to the deflection lever 146 opposite from the support roller 140 . as the upper receiver 20 is deflected downward , the deflection lever 146 is rotated so that the spring mount 148 is moved away from spring mount 147 . the gas spring acts to resist this movement and provides a restorative force to the deflection lever 146 , and thereby the upper receiver 20 . the gas spring thus damps the motion of the upper receiver 20 and aids in returning the upper receiver 20 to its level and retracted position . | 4 |
reference is now made to fig1 which illustrates a telephone intercom system constructed and operated in accordance with a preferred embodiment of the present invention . the system includes a telephone line 10 , which is directly connected to a central office providing dtmf / pulse service , as is the case in most domestic and small business installations in the u . s . a . connected to the telephone line 10 , as in most existing telephone installations , is an internal telephone line 12 , to which are connected a plurality of telephone plug sockets 13 . associated with each plug socket is a conventional dtmf / pulse telephone instrument 14 . each telephone instrument 14 is preferably connected to a corresponding telephone plug socket via an intercom function device 16 , typically by means of two wires in conventional 4 - wire telephone plus and sockets ( not shown ). in accordance with a preferred embodiment of the invention , devices 16 provide the following principal functions : 1 . enable a user of a given telephone instrument 14 to call any other telephone instrument 14 to which a device 16 is connected , simply by a dtmf / pulse input . 2 . enable an outside caller to directly reach a particular telephone instrument 14 to which a device 16 is connected . 3 . enable a user to use the telephone line as a power source . in accordance with one embodiment of the invention there may be provided apparatus 11 for suppressing a busy signal during intercom use , when such use extends beyond four seconds . this apparatus is typically connected in series between the central office telephone line 10 and the internal telephone line 12 , as illustrated in fig1 . an example of such apparatus is illustrated in fig4 and described hereinbelow . the apparatus is operative to decouple the internal telephone lines from the central office once intercom use extends beyond four seconds . alternatively , if it is assumed that intercom use will not extend beyond 30 seconds , apparatus 11 may be eliminated . reference is now made to fig2 which is a generalized block diagram illustration of intercom function device 16 . the intercom function device 16 comprises receiving and unit identification circuitry 20 which is operative to receive an incoming dtmf / pulse tone combination representing dialing from another subscriber and which provides a digital output representing a single digit dialed number . unit select circuitry 22 , which cooperates with user code dip switches 24 , determines whether the incoming single digit dialed number corresponds to the preset single digit identification code of a given device 16 which is coupled to a given telephone extension . if the single digit dialed number corresponds to the single digit number of the device 16 , unit select circuitry 22 provides an output to dial and number check circuitry 26 which indicates whether another single digit number has been dialed thereafter . receiving circuit 20 also provides an output indication of the receipt of a dialed single digit number to line in use identification and amount of numbers dialed determination circuitry 28 , which is operative to reset a delay circuit 30 , each time that a dialed single digit number is received . the delay circuit 30 is operative to provide an output indication to a ring select circuit 32 , providing an and function , when four seconds have passed from receipt of an initial single digit number without a further number having been received . such an event indicates intended intercom use . in response to simultaneous receipt of inputs from delay circuit 30 and from dial and number check circuit 26 , ring select circuitry provides a ring actuation output signal to a time of ring circuit 34 , which determines the frequency and duration of a ring which indicates to a user , an intercom call . the output of circuit 34 may be provided to a ringer 36 in the device 16 or alternatively to a ringer in the telephone instrument 14 . when the telephone instrument 14 connected to device 16 is picked up , an appropriate voltage is received by circuit reset circuitry 38 , which resets circuitry 26 and circuitry 28 , eliminating their outputs to ring select circuitry 32 . reference is now made to fig3 which is a schematic illustration of the apparatus of fig2 . each element of the block diagram of fig2 is indicated by dashed lines on the schematic of fig3 . component values for the schematic of fig3 are as follows : reference is now made to fig4 which illustrates apparatus for suppressing the busy signal from the central office . the circuitry is essentially identical to that of fig2 with the removal of circuitry 34 and 36 and its replacement by a relay 40 which decouples the internal telephone lines downstream of apparatus 11 from the central office in response to an output of circuitry 32 , until the telephone handset goes off - hook . relay 40 receives a reset input from ring sense relay reset circuitry 42 , which is described , together with relay 40 , in detail in fig5 and which receives an input from the telephone line in response to ringing from a dialed input from outside the system . reference is now made to fig5 which is a schematic illustration of elements 40 and 42 in the apparatus of fig4 . the values for the various components are identical to those provided hereinabove in connection with fig3 . the additional capacitor c14 has a value of 47 microfarads . reference is now made to fig6 which is a block diagram illustration of an alternate embodiment of the intercom function device according to the present invention . the intercom function device of this embodiment comprises power - supply circuitry 101 which is operating the device and provides the power to the dtmf / pulse receiver circuit 102 and to the &# 34 ; asic &# 34 ; pulse receiver and identification circuit 103 . the power supply also provides reset signal to the pulse receiver identification circuit 103 . unit select circuitry 103 , which cooperates with user code dip switches 104 , determines whether the incoming single digit dialed number corresponds to the preset single digit identification code of a given intercom function device which is coupled to a given telephone extension . when the telephone instrument connected to the device is picked up , an appropriate voltage is received by the power supply 101 providing voltage to circuitry 102 and 103 . when the power supply senses line is in use , it operates circuitry 102 and 103 . the two circuits are waiting to receive a digit by pulse or tone , and if the digit received is the same as the user code 104 , and it is the only digit received , circuitry 103 will operate the buzzer 105 . the preferred buzzer is a 3 - 5 v piezoelectric disc internal buzzer . reference is now made to fig7 which is the power supply block diagram . rectifier circuit 106 provides dc voltage which is checked by circuitry 107 to find out if the line voltage drops below 17 v . if the line voltage is below 17 v , voltage regulation circuit 111 is operated and provides current to the system . the current is approximately 2 . 5 - 3 milliampere ( 3 - 5 v ). circuitry 108 is checking if the line voltage dropped below 5 v . if so , circuitry 108 will send an off signal to circuitry 111 and shut off the power . circuitry 109 will send an off signal to circuitry 111 if the hand set is off the hook . pulse transfer circuit 110 will provide pulse to the system without interference . circuitry 106 and 107 provide the reset signal 113 and tone signal 114 to the system . reference is now made to fig8 which is the asic floating chart . when digit input 117 is received by first digit sensor 118 there are two options : ( a ) if a second digit appears then &# 34 ; no &# 34 ; signal will be sent to circuitry 118 and 119 , this signal will reset circuitry 120 and disable the timer in circuitry 121 ; ( b ) if only one digit appears and it reaches the extension id code in circuitry 119 , a &# 34 ; yes &# 34 ; signal will be sent to circuitry 120 , which , after four seconds , will operate the buzz signal for a period of ten seconds . if a star digit received by circuitry 122 , it will reset circuitry 118 , so that any digit after the star will be considered as the first digit . in the same way , circuit 122 will change the timer in circuit 120 from four seconds to 0 . 5 seconds , which means that circuit 120 will send buzz signal immediately after the digit appears . reference is now made to fig9 which is a schematic illustration of the power supply . each element of the block diagram of fig7 is indicated by dashed lines on the schematic illustration of fig9 . it will be understood that the circuitry of fig6 - 9 is operative during the first four seconds when a single digit dtmf / pulse number is received , for deciding that the number represents and intercom actuation number , rather than a normal dialed number . this decision is made on the basis of whether or not another dialed number is deemed to have been received . reference is now made to fig1 , which is the circuit diagram of the complete electronic circuitry of the invention . the circuit in fig1 includes the exact parts that are required to make the invention work . specifically , the circuit includes , in addition to the power supply , a dtmf / pulse receiver named um - 92870 - cm and an asic integrated circuit named bk - 1956 . reference is now made to fig1 , which is the graphical illustration of the problem in the u . s . a . the graphical illustration shows the manner in which the fcc lab in the united states checks the units that are connected to a telephone line . one of the tests is to raise the voltage line from 0 to 100 linearly and from 100 to 0 . the results of this test preferably shows a constant line resistance of the unit . but , when the unit senses that the line voltage is dropping immediately from 48 v ( volt dc ) to 6 - 16 v ( volt ), the power supply of the unit becomes active and the unit is in operation mode . reference is now made to fig1 , which is the circuit diagram for one embodiment of the complete electronic circuitry for use in the u . s . a . the circuit diagram of fig1 is almost identical as the basic circuit diagram of fig1 , with the same changes in the power supply as were made in fig1 . additionally , integrated circuits ff1 and ff2 are the controllers for the activity illustrated in fig1 . additionally , a 3 v battery is added to the power supply to permit use for at least five years and to assist the circuit in passing the test . reference is now made to fig1 , which is the circuit diagram of an alternate embodiment of complete electronic circuitry for use in the u . s . a . the circuit diagram is almost identical to the basic circuit diagram of fig1 , with the same changes made to the power supply . integrated circuits ff1 and ff2 are the controllers for the activity illustrated in fig1 . it will be appreciated by persons skilled in the art that the present invention is not limited by what has been particularly shown and described hereinabove . rather , the scope of the present invention is defined only by the claims which follow . | 7 |
fig1 shows an in ( ga 1 - x al x ) p sch semiconductor laser device which is an example of this invention . the semiconductor laser device 1 has a multiquantum well structure , and is produced as follows : on the ( 100 ) face of an n - gaas substrate ( carrier density si = 1 × 10 18 cm - 3 ) 2 , an n - gaas or n - in 0 . 5 ga 0 . 5 p buffer layer ( si = 1 × 10 18 cm - 3 , the thickness thereof being 0 . 5 μm ) 3 , an n - in 0 . 5 ( ga 0 . 4 al 0 . 6 ) 0 . 5 p cladding layer ( si = 1 × 10 18 cm - 3 , the thickness thereof being 1 . 3 μm ) 4 , a non - doped superlatticed optical guiding layer 5 , a non - doped active layer 6 which has a multi - quantum well structure , a non - doped superlatticed optical guiding layer 7 , and a p - in 0 . 5 ( ga 0 . 4 al 0 . 6 ) 0 . 5 p cladding layer ( be = 1 × 10 18 cm - 3 , the thickness thereof being 1 . 3 μm ) 8 are successively grown . then , in another growth chamber , a p - gaas cap layer ( be = 1 × 10 18 cm - 3 , the thickness thereof being 0 . 5 μm ) 9 is grown on the cladding layer 8 . as shown in fig2 the superlatticed optical guiding layer 5 has an alternative lamination of fifty in 0 . 5 ( ga 0 . 9 al 0 . 1 ) 0 . 5 p layers ( the thickness of each layer being 15 å ) 5a and fifty in 0 . 5 ( ga 0 . 4 al 0 . 6 ) 0 . 5 p layers ( the thickness of each layer being 10 å ) 5b , resulting in a total thickness of 1250 å . as shown in fig4 the active layer 6 has a multi - quantum well structure which consists of an alternative lamination of three superlatticed barrier layers ( the thickness being 60 å ) 12 and four in 0 . 5 ( ga 0 . 9 al 0 . 1 ) 0 . 5 p quantum well layers ( the thickness being 100 å ) 13 . each of the barrier layers 12 , as illustrated in fig5 has an alternative lamination of three in 0 . 5 ( ga 0 . 4 al 0 . 6 ) 0 . 5 p layers ( the thickness of each layer being 10 å ) 10 and two in 0 . 5 ( ga 0 . 9 al 0 . 1 ) 0 . 5 p layers ( the thickness of each layer being 15 å ) 11 . as shown in fig3 the superlatticed optical guiding layer 7 has an alternative lamination of fifty in 0 . 5 ( ga 0 . 4 al 0 . 6 ) 0 . 5 p layers ( the thickness of each layer being 10 å ) 7b and fifty in 0 . 5 ( ga 0 . 9 al 0 . 1 ) 0 . 5 p layers ( the thickness of each layer being 15 å ) 7a , resulting in a total thickness of 1250 å . fig6 shows the distribution of the al composition in the principle portions of the semiconductor laser device of this example . this semiconductor laser device can be produced by mbe using five cells for group iii elements , i . e ., one in cell , two al cells , and two ga cells . the semiconductor laser device can emit a laser beam with a wavelength of 650 nm and has a threshold current level of 0 . 5 ka / cm 2 or less . fig7 shows the distribution of the al composition of another example of the semiconductor laser device of this invention which can be produced in the same manner except that the active layer 6 consists of a non - doped in 0 . 5 ( ga 0 . 9 al 0 . 1 ) 0 . 5 p single - quantum well layer . this semiconductor laser device also can be produced by mbe using five cells for group iii elements . the semiconductor laser device can emit a laser beam with a wavelength of 650 nm and has a threshold current level of 0 . 5 ka / cm 2 or less . fig8 shows the distribution of the al composition of a further example of the semiconductor laser device of the invention . in this example , the optical guiding layers 5 and 7 shown in fig1 are not formed . the active layer 6 has an alternative lamination of four in 0 . 5 ( ga 0 . 9 al 0 . 1 ) 0 . 5 p quantum well layers ( the thickness of each layer being 70 1 / 8 ) 13 and three superlatticed barrier layers 12 . each of the superlatticed barrier layers 12 consists of an alternative lamination of three in 0 . 5 ( ga 0 . 4 al 0 . 6 ) 0 . 5 p layers ( the thickness of each layer being 5 å ) and two in 0 . 5 ( ga 0 . 9 al 0 . 1 ) 0 . 5 p layers ( the thickness of each layer being 8 å ). the total thickness of the active layer 6 which has a multi - quantum well structure is 373 å . this semiconductor laser device also can be produced by mbe using five cells for group iii elements , and can emit a laser beam with a wavelength of 650 nm and has a threshold current level of 0 . 5 ka / cm 2 or less . in the above - mentioned examples 1 and 2 , the optical guiding layers 5 and 7 have a superlatticed structure in which the layers 5a , 5b , 7a and 7b have a uniform thickness or period . the thickness of each of these layers may be changed so that their equivalent energy gaps decrease gradually along the direction from the cladding layer 4 or 8 to the active layer 6 , resulting in forming the optical guiding layers 5 and 7 as grin optical waveguide layers . as the barrier layers 12 can be formed in almost the same manner as the superlatticed optical guiding layers 5 and 7 , the barrier layers 12 in the example 1 also are formed so as to have a superlatticed structure . however , this is not essential in this invention , and the barrier layers 12 may be formed in the same manner as the barrier layers 23 shown in fig9 . when an sch multi - quantum well semiconductor laser device having inalp cladding layers and ingap quantum well layers is to be produced , only three cells for group iii elements ( one in cell , one al cell , and one ga cell ) are required . it is understood that various other modifications will be apparent to and can be readily made by those skilled in the art without departing from the scope and spirit of this invention . accordingly , it is not intended that the scope of the claims appended hereto be limited to the description as set forth herein , but rather that the claims be construed as encompassing all the features of patentable novelty that reside in the present invention , including all features that would be treated as equivalents thereof by those skilled in the art to which this invention pertains . | 1 |
there are a great many possible implementations of the invention , too many to describe herein . some possible implementations that are presently preferred are described below . it cannot be emphasized too strongly , however , that these are descriptions of implementations of the invention , and not descriptions of the invention , which is not limited to the detailed implementations described in this section but is described in broader terms in the claims . one implementation is illustrated in fig2 and 15 - 17 . a front electrode 14 includes three monitoring electrodes 20 positioned equidistant from a central stimulation electrode 18 . all three monitoring electrodes 20 and the stimulation electrode 18 are supported on a common assembly . a back electrode 12 includes only a stimulation electrode 16 , but may optionally also include one or more integrated monitoring electrodes as well . the active area of the stimulation electrode is about 10 cm in diameter . the active area of each monitoring electrode is about 2 cm in diameter . the edge of each monitoring electrode active area is spaced about 1 cm from the edge of the adjacent stimulation electrode active area . various constructions are possible for the electrode pad assemblies . fig1 - 17 show one possible construction . materials have been chosen that provide resiliency and compliance to the skin surface . fig1 shows the electrode assembly configured to be applied to the front of the chest . a foam cover ( or backing ) layer 24 ( e . g ., voltek volara ™) extends fully across the back of the electrode ( top surface facing up away from patient ). each of the three monitoring electrodes is formed by securing a nickel plated brass snap 21 to an agcl post 22 through an opening in the cover layer ( alternatively a lead wire may be connected to the monitoring electrodes ). below that is a foam frame layer 28 , which has an opening through which each of the agcl posts ( agcl plated glass filled abs ) contact a porous foam sponge 23 , which is impregnated with ecg gel 35 ( e . g ., pharmaceutical innovations ™). the stimulation electrode 18 is provided by a conductive plate 29 ( e . g ., tin ) in the center of the electrode assembly . the conductive plate is supported beneath the foam frame layer 28 . beneath the conductive plate , and making conductive contact with the patient , is a conductive layer 30 , e . g ., a solid gel such as a hydrogel ( e . g ., ludlow ™ 63t hydrogel ). at one edge , a portion 38 of the conductive plate extends through an opening in the foam frame layer , and is mechanically and electrically connected at 25 to a wire lead 26 . wire lead 26 extends to an electrical connector 40 , to which the wire lead 26 from the back electrode assembly is also connected . various alternatives may be used for the conductive , skin - contacting layers 23 , 30 . thee include , but are not limited to , solid conductive gels ( e . g ., hydrogel ), a porous material filled with a liquid gel , and a porous material soaked in a conductive solution such as saline . fig1 shows the electrode assembly configured to be applied to the back of the chest . it has a similar construction to that of the front electrode , except that it lacks monitoring electrodes , and has a rectangular , rather than circular , stimulation electrode . conductive plate 33 is supported on the underside of a foam backing layer 32 . a conductive layer 34 , e . g ., solid gel such as the same hydrogel as used in the front stimulation electrode , makes contact with the patient . a portion 38 of the conductive plate extends through an opening in backing layer 32 , and is connected to wire lead 26 . an insulator foam backing layer 31 covers the portion 38 of the conductive plate that extends to the top of foam backing layer 32 . in the implementation of fig2 and 15 - 17 , the monitoring electrodes 20 are all positioned the same distance from the stimulation electrode 18 . if the electrical currents flowing between the stimulation electrodes are approximately equal in all directions then the artifact measured by each monitoring electrode will be similar and cancel when a potential difference is formed by subtracting the signals . but placing the monitoring electrodes at equal distances from the stimulation electrode is no guarantee that the measured stimulus artifact will be the same in all three monitoring electrodes . transmission factors , monitoring electrode impedance , the path of current flow , the shape of the electric field , and other variables can influence measured artifact . some of the transmission factors , e . g ., respiration and blood flow , may be time varying . current flow can be influenced by surface properties and anatomical structures in the body . however , positioning the monitoring electrodes equal distances from the stimulation electrode may be sufficient in many cases , as it may result in stimulus artifacts that are sufficiently closely matched as to reduce the level of artifact to an acceptable level in the differential signal ( the difference in potential between two monitoring electrodes ). and the remaining artifact can optionally be reduced further using other methods described below . alternatively , the monitoring electrode spacing can be adjusted based on modeling current flows , experimental results , or a priori knowledge of the transmission factors involved . circuitry in the electrode or in the medical device doing the monitoring may equalize the artifact measured at each electrode by changing a gain or impedance , or by using other known techniques . forming the sum of two monitoring electrodes with artifacts of similar magnitude but opposite polarity will also reduce artifact , e . g ., the sum of monitoring electrodes relative to a common reference where one is positioned near the positive and one near the negative stimulation electrodes . in the implementation of fig2 and 15 - 17 , three monitoring electrodes are provided for the front electrode assembly , which is positioned over the heart . the back electrode assembly does not have any monitoring electrodes . other implementations may use different numbers of monitoring electrodes on the front assembly , and monitoring electrodes could be included on the back assembly . measuring a potential difference requires at least two electrodes . integration of three monitoring electrode with the stimulation electrode over the heart has at least two benefits . first , many ecg monitors use a third electrode to drive common mode signals back to the patient , to improve signal quality in the presence of large common mode signals such as power line interference . if the third electrode is only used for this common mode rejection purpose , its location relative to the stimulation electrode is less important . second , ecg monitors for three - lead monitoring generally display the potential difference between a selected electrode pair . these differences are called lead i , lead ii , and lead iii when the electrodes are positioned in conventional locations on the right and left arms as well as the left leg . the monitoring electrodes in the invention do not represent the standard leads , but still provide three possible potential differences , from which the operator of the ecg monitor may select . the operator may select the view which is most clinically relevant or contains the least artifact during cardiac pacing . in implementations in which three potential differences between pairs of electrodes are sought , the locations of all three monitoring electrodes can be selected to improve artifact cancellation ( e . g ., each may be equidistant from the central stimulation electrode ), so that a choice can be made as to the best two electrodes to use for canceling the stimulus artifact . more than three monitoring electrodes may also be provided . the monitoring hardware may be configured to detect the artifact - reducing electrode assembly . if it recognizes such an electrode assembly , the hardware may process signals differently and / or change labeling on displays , strip chart recorders , storage devices and external interfaces . the change in labeling will prevent those reviewing the signals from trying to interpret them as a standard electrode configuration ( e . g ., standard 3 - lead ). the electrode assembly identification would typically be made through the monitoring portion of the assembly rather than through the stimulation portion , because in some implementations electrical stimulation is allowed to continue even if a switch is made to standard monitoring electrodes when time permits . various methods may be used to identify the electrode assembly , including , for example , the following : ( 1 ) specific resistances between connector pins are detected by the monitor ; ( 2 ) voltages , currents , or specific waveforms input to the monitor from the electrode assembly ; ( 3 ) interfaces to nonvolatile memory or a microprocessor contained within the electrode connector or assembly ; ( 4 ) pulling unused monitoring channels to specific voltages ( currents , or known waveforms ) that can be used to identify the cable . an example of the fourth option is connecting a three lead ecg cable to a 10 wire monitor with a special electrode connector so that certain unused inputs are shorted to ground while others are shorted to a specified voltage . any condition that is unlikely to occur without the connector in place can be used for identification . fig1 illustrates the physics underlying the ability of some implementations to cancel much of the stimulus artifact from the ecg signal . a stimulus is applied to the patient ( represented by the dashed line rectangle ) using a pair of stimulus electrodes ( therapy pads ). current flows from one therapy pad to another along varying current paths . the figure shows the overly simplified case of there being just three current paths , with one monitoring electrode positioned along each of two of the paths . resistors are shown along the current paths to represent the resistance experienced by current flowing along particular paths . the values of the resistors are dependent on the placement of the electrodes , and the physical properties of the patient , and the values of the resistors may be time varying ( e . g ., as the result of respiration ). each monitoring electrode records some potential owing to the current flowing during a therapy pulse . after the pulse , the therapy pads may remain polarized . the polarization equalizes over time , and the monitoring electrodes record the potential difference due to the polarization . if the polarization has an equal effect on both monitoring electrodes , then the effect of the polarization ( what we have called the stimulus artifact ) will cancel , and the differential signal will be due to the electrical activity within the body such as the ecg . another possible implementation is shown in fig3 . the monitoring electrodes 20 are supported on a common assembly separate from ( but , in this example , surrounding ) the stimulation electrode 18 . in fig3 the common assembly is an annular in shape to surround a circular stimulation electrode , but other shapes may be used . an advantage of the shapes used in fig3 is that they help guarantee that the monitoring electrodes are equally spaced from the stimulation electrode . two of the monitoring electrodes are positioned to be equidistant from the stimulation electrode . the third monitoring electrode ( at the top of the figure ) is shown in a position slightly away from an equidistant location . if the third electrode is not used to form an ecg signal , but is used only for common mode rejection purposes , then it is not necessary that it be equidistant . in other implementations , in which it was sometimes desirable to use the third electrode for forming an ecg signal , it may be decided to place it in an equidistant location just as the other two monitoring electrodes . other methods may also be suitable for positioning the electrodes . they may be positioned at set distances from the therapy pad using constant length cables or other physical connection to the therapy pad that allows easy placement at a pre - determined distance . fig4 illustrates one implementation in which placement of the monitoring electrodes around the stimulation electrode is regulated by the length of electrode lead wires extending from the central stimulation electrode . when the wires are fully extended in a radial direction , the electrode positions will be equidistant from the stimulation electrode . similarly , the wires may be slightly different lengths in order to equalize artifact based on a priori knowledge of the current flow . alternatively , the separation between monitoring and stimulation electrodes could be prescribed by a mechanical element ( e . g ., a mechanical cable ), rather than by the electrical leads . the electrodes might initially be affixed ( prior to their extension ) to the therapy pad by an adhesive or a mechanical device ( i . e . clip , velcro , etc ). another implementation is shown in fig6 . three groups of multiple monitoring electrodes — with the electrodes in each group being at different locations relative to the stimulation electrode — are shown . in fig6 , there are two monitoring electrodes 20 in each of group a , b and c . analog or digital signal processing may be used to produce a combination of the electrodes in a group , so that when the difference between the processed ( or weighted ) combinations from two groups is taken the artifact is better cancelled in the differential signal . this method provides compensation for irregularities in the current flow or electric field originating from the stimulation electrode , and may be time - varying to compensate for time - varying parameters such as respiration . more than two electrodes may be provided in each group . not all locations will require forming a weighted combination of a plurality of electrodes . good electrode placements for artifact rejection may not be ideal for analysis of monitored signals . e . g ., they may not provide a standard clinical ecg signal . signal processing may be used to derive or synthesize improved or more clinically standardized looking waveforms from the actual monitoring electrodes . this may be accomplished by , in effect , creating a derived ( or synthesized ) monitoring electrode from combinations of actual monitoring electrodes . a block diagram of one cardiac pacing implementation of this procedure is shown in fig7 . signals 90 from monitoring electrodes ( e . g ., ones of the type shown in fig2 ) may optionally be combined with signals from one ( or both ) stimulation electrode ( which during intervals between stimulation pulses can also serve as a monitoring electrode ). a signal processing block 92 produces estimates 94 of standard ecg vectors that are more familiar to the user than potential differences formed directly from the nonstandard electrode locations of fig2 . a preferred implementation is to transform the signals from the monitoring electrodes ( and optionally the stimulation electrode ) into ecg signals comparable to what would have been detected using the standard 3 - lead placement of ecg electrodes ( two near the arms , and one near a leg ). to perform the transformation , the coefficients of a linear transformation matrix are derived from a statistically meaningful population of patients , from whom ecg measurements have been taken at both the new monitoring electrode ( and stimulation electrode ) locations and the conventional 3 - lead locations . a least squares fit is done to derive coefficients of the linear transformation matrix . the prior art taught several methods of synthesizing leads from a reduced or alternate set of electrodes . for instance , dower &# 39 ; s easi system ( u . s . pat . no . 5 , 711 , 304 ) used five electrodes in non - standard locations on the body to synthesize an estimate of the 12 - lead ecg . dower placed the electrodes far apart on the body in locations selected for ease of placement and 12 - lead synthesis . the prior art also taught transformations from implanted leads to standardized leads . implanted electrodes are fixed in position . it is possible to attach standard surface electrodes to the patient and derive the optimal transform . fig1 and the following discussion provide one mathematical basis for the lead synthesis . the figure shows a round stimulation ( pacing / defibrillation ) electrode surrounded by three equidistant monitoring electrodes , each spaced from the others at 120 degree angles . the objective of lead synthesis is to convert the monitoring signals from these nonstandard locations to estimates of the standardized lead i , lead ii , and lead iii difference signals that would be derived from electrodes positioned at the standard right arm ( ra ), left arm ( la ), and left leg ( ll ) locations and also shown in the figure . the signals from the nonstandard monitoring locations can be represented by a matrix x containing samples from the monitored electrodes as column vectors . these signals are high pass filtered or processed so that their mean value is zero . in the example set out below , x is an n × 2 matrix where n represents the number of samples and two columns are formed from three ecg electrodes . since the electrodes need a reference voltage , two independent ecg vectors ( v n ) may be produced from these three monitoring electrodes ( e n ). the third vector may be derived from the other two as follows and is omitted from matrix x to avoid a singular or ill - conditioned system of equations below v 3 = v 1 − v 2 = e 1 − e 2 −( e 1 − e 3 )= e 1 − e 3 the desired standardized signals can be represented by a matrix y containing each of the output signals as column vectors with the mean removed , for instance an n × 3 matrix where columns 1 , 2 , and 3 represent leads i , ii , iii respective . the goal of lead synthesis is to find a transformation matrix c such that [ x 11 x 12 x 21 x 22 x 31 x 32 ⋮ ⋮ x n 1 x n 2 ] [ c 11 c 12 c 13 c 21 c 22 c 23 ] = [ y 11 y 12 y 13 y 21 y 22 y 23 y 31 y 32 y 33 ⋮ ⋮ ⋮ y n 1 y n 2 y n 3 ] the squared error between measured ecg vectors y and estimated ecg vectors ŷ can be calculated as ŷ is the estimate of y and can be calculated using the following equation . the optimal transformation matrix c will generally vary from patient to patient and is based on the relative placement of the electrode assembly and the standard three lead electrodes . however , c can be estimated from a database of known ecg signals and used generically . the operator may have the ability to switch between the sampled ecg vectors and the synthesized leads so the most usefull view may be selected . fig1 illustrates an example of monitoring signals . the signals in the column labeled “ custom leads ” are potential differences measured from a nonstandard electrode configuration such as fig2 . the column labeled “ standard leads i , ii , iii ” are measured by monitoring electrodes such as the ones in fig1 . the far right column includes estimates of the standard leads synthesized from the nonstandard signals by a matrix transformation . although not exactly the same as the signals from standardized locations , they are close enough in appearance for many clinical purposes such as calculation of heart rate . the monitoring and stimulation electrodes may vary in composition . rather than use a conductive polymer material ( sometimes called , “ solid gel ” or “ hydrogel ”) for both types of electrodes , liquid gel could be used for the monitoring electrodes , and conductive polymer material only for the stimulation electrodes . this has the advantage of better impedance and signal quality shortly after applying the monitoring electrodes to the skin . conductive polymer pads typically require time for the skin to warm the gel and reduce impedance , whereas liquid gel does not suffer from such delays . many situations including emergency cardiac pacing or defibrillation are time critical and there may be an advantage to using liquid gels . it may also be advantageous in some circumstances to use liquid gels ( or other conductive agents ) for the stimulation electrodes . for instance , a liquid gel may be beneficial if the stimulation electrode is intended for cardiac pacing only . other applications may require electrodes ( stimulation or monitoring ) with a conductive surface ( s ) but no gel . conductive gel or electrode paste may be applied to the conductive surface or to the skin as needed . this is generally the preferred method for re - usable ecg or eeg electrodes . electrode assemblies containing more than one electrode ( e . g ., a stimulation 18 and one or more monitoring electrodes 20 ) may include multiple conductors ( e . g ., tin layers ) that contact the skin through a common gel ( polymer pad or other ) layer . fig1 shows such an implementation . two therapy pad assemblies are used for stimulation . each pad assembly includes a stimulation electrode , and at least one of the pad assemblies includes one or more monitoring electrodes . electrical current is driven between the conductive plates of the stimulation electrodes ; the plates are in electrical contact with the skin through a conductive gel . during the electrical stimulus a potential difference exists between the plates . the polarization of the plates may persist for some time after the stimulus . measuring small changes in voltage between the plates of the stimulation electrodes may be difficult because of the relatively large potential differences . but the potential difference between the plate of a stimulation electrode and the plate of an adjacent monitoring electrode is less than the difference between the plates of two stimulation electrodes , and thus monitoring small voltage changes is more feasible . the relative positions of the stimulation and monitoring electrodes may be determined by the measurements of interest , for instance across the heart . if the same conductive gel sheet covers the plates of the stimulation electrode and the plate of the monitoring electrode then the polarization effect will be similar and the differential signal will be less contaminated with artifact . in some implementations in which the same electrode assembly has more than one type of gel , a vapor barrier may be provided to retard moisture transfer from one gel to another . the electrode assemblies are typically sealed within a package until use , but while this retards moisture from leaving the interior of the sealed package , it does not prevent moisture transfers within the assembly . a lower moisture gel such as a hydrogel may absorb water from a second ( e . g . liquid gel or different hydrogel ) electrode over the life of the packaged electrode . a vapor barrier inside the package may be used to seal one gel type from the other to increase shelf life . the vapor barrier may be implemented in a variety of ways including the method described by dupelle and white in u . s . pat . nos . 6 , 453 , 205 and 6 , 280 , 463 , in which a sealed cup is used to contain a liquid gel . the vapor barrier may be made from commonly used materials such as mylar and aluminum . an aluminum thin film layer may be deposited by the so - called thermal evaporation method whereby aluminum wire is evaporated onto a heated crucible in a vacuum chamber . some implementations may use an inert material that is non conductive , such as a thin film deposition of siox ( typically via sputter deposition ). other vapor barriers may also be used . an exploded cross - sectional view of an electrode with a vapor barrier 50 is shown in fig2 ( patient contact surface at top ). the outer surface of the electrode is made from a layer of adhesive backed closed cell foam 52 such as voltek volara . a second layer of insulating foam 54 creates recessed wells for the monitoring ( ecg ) electrodes . a thin vapor barrier 50 surrounds the ecg well and adheres to the surrounding foam . the ecg electrode wire may be riveted ( 56 ) through an insulated vapor barrier to maintain the seal . alternately , the vapor barrier may be a conductive metal such as tin and the wire may be soldered or otherwise connected directly to the vapor barrier . the entire electrode assembly is placed on a release liner 58 ( e . g ., silicon impregnated polyethylene ). peeling off the release liner also uncovers the ecg electrodes since the top of the vapor barrier has a stronger bond to the liner than it does to the bottom part of the vapor barrier . the vapor barrier may be constructed in various ways , but one possibility is shown in fig2 , wherein two layers of polyester ( e . g ., mylar ) and aluminum are bonded face to face . fig9 shows one possible analog electrical circuit that can be used to implement artifact rejection . the signal from each of two monitoring electrodes ( electrode 1 and electrode 2 ) is buffered through inverting amplifiers a 1 and a 3 , respectively . the buffered signal is fed through a low pass filter , which may be tuned using a variable capacitor to change the time constant . although a variable capacitor 60 is shown in the circuit , a variable resistor or some other combination of tunable circuit elements may be used . the filters may be set to adjust for different delays in the two input signals so that most of the energy from the artifact will cancel when the signals are subtracted . fig9 also shows variable gain amplifiers a 2 and a 4 , which allow the signal from each electrode to be scaled so that the magnitude of the artifact is similar in both signals and will cancel when subtracted in the output amplifier a 5 . with sufficient signal to noise ratio ( snr ), only one programmable gain amplifier is needed , provided it can attenuate the signal as well as amplify it . one example of scaling is an implementation in which two monitoring vectors p 1 and p 2 are calculated from the signals detected at three electrodes , as follows . the constants c 1 and c 2 may be selected in some implementations so that the magnitude of the artifact in the two monitoring vectors p 1 , p 2 are approximately equal so that the artifact cancels in the scaled output y . in other implementations , one of the vectors is used without being scaled ( so that no constant is necessary ). fig2 shows an example of how the artifact may be reduced in some implementations with a 100 ma stimulus . the unscaled difference signals ( vectors ) p 1 and p 2 ( the top two signals ) both contain appreciable artifact . but the scaled difference signal ( bottom signal ) has a substantially reduced artifact , less than in either of the original difference signals . the constants c 1 and / or c 2 may be derived mathematically by comparing the artifact or may be tuned by the operator ( e . g . by twisting a dial ) to minimize artifact . the scaling may affect the shape of the resultant monitoring signal ( e . g ., it may not have magnitudes relevant for diagnostic purposes ), but it may be useful for determining heart rate or the general shape of the ecg . the scaling may be implemented in hardware or software , and the constants may be positive or negative depending on the direction of the artifact in each monitored difference signal ( vector ). to make it possible for the circuitry to adapt quickly to new patients and new electrodes , some implementations would use digitally controlled components such as ( but not limited to ) programmable gain amplifiers , digitally controlled variable resistors , and capacitors or inductors that can be switched in or out of the circuit ( e . g ., with analog switches ). manually adjustable components may also be used , and set by the operator . the signal processing shown in fig9 may alternatively be implemented using digital or software processing of the sampled signal , or with a combination of analog and digital signal processing . the circuit is preferably designed so that the artifact will not saturate the input amplifiers or converters during periods of interest for monitoring . digital signal processing may allow for more flexibility in delaying or processing the signals . digital processing requires sampling the raw signals from each electrode relative to a common reference . complex filters and / or adaptive gain estimates may also be used in either a digital or analog implementation . another technique for reducing the artifact in the differential signal acquired from two monitoring electrodes is adjusting the input impedance in the electrical circuit that detects the potential at the monitoring electrodes . the artifact will be minimized if the impedance of each monitoring electrode is equal . electrode impedance can be directly measured or estimated from the artifact . the impedance can be measured by applying a therapy pulse at low or full power , or by using sine waves , chirps , or other arbitrary waveforms suitable for this purpose . the resulting voltage or current waveform measured at each monitoring electrode ( or between the two electrodes ) can be used to estimate the impedance ( or impedance mismatch ). one implementation of an impedance balancing circuit is shown in fig5 , in which the level of the stimulus artifact at the two electrodes is better equalized , thereby reducing the level of artifact in the differential signal . by balancing the impedance of the monitoring electrodes , it may not be necessary to connect a patient drive electrode to assist in common mode rejection . the circuit in fig5 shows two monitoring electrodes 70 , 72 ( upper left ) and a patient drive electrode 74 ( lower left ). each electrode is shown as an rc element , and it should be noted that these values may vary over time ( e . g ., from respiration ). the conductive gel &# 39 ; s contact with the skin may be different at each electrode , resulting in an impedance imbalance between electrodes . the monitored signal is typically of small magnitude compared to the stimulus artifact and other common mode signals such as power line interference . during or shortly after a stimulation pulse , two monitoring electrodes positioned at the same potential in the electric field between the two stimulation electrodes will measure a very large common mode signal as the result of the polarization on the two stimulation electrodes , i . e ., the stimulus artifact . but the circuit measuring the difference between the two monitoring electrodes may not reject the large stimulus artifact if the impedances are not properly balanced . several methods are known in the art for canceling common mode signals , and these may be applied to improve cancellation of the stimulus artifact . each of the leads running to the stimulation and monitoring electrodes has a cable shield 76 surrounding it . the circuit drives the cable shield with the common mode signal through amplifier a 1 . this reduces the effect of cable capacitance by maintaining signal and shield at similar potentials . the shield drive is also integrated and inverted by a 2 and driven back to the patient . this has the effect of reducing common mode signals by moving the reference level of the circuit close to the common mode of the patient . currents due to common mode signals may flow from the patient through various return paths including the patient or shield drive . circuit elements may be adjusted to correct for imbalances in electrode impedance to reduce common mode signals . the figure shows variable resistors and capacitors controlled by an impedance compensation circuit 78 . the impedance matching circuit may be simpler to implement if placed directly between the two monitoring electrodes , but this may require complex cabling and not be as practical . impedance matching elements may include components commonly used in the art , including ( but is not limited to ) trim pots , manually - adjustable capacitors , digitally - controlled variable resistors or capacitors , or one or more rc elements with analog switches . inductors or other passive components may also be used . the impedance compensation controller may include a mix of analog and / or digital processing . the impedance may be measured directly by applying a current to the patient in the form of sine waves , chirps , or therapy pulses at full or reduced intensity . there are other methods well known in the state of the art . it may also be measured indirectly by estimating the imbalance from power line interference or artifact from pulses delivered during therapy . the controller adjusts the digitally controller circuit elements and may monitor changes in common mode artifact . alternately , the impedance may be adjusted manually by the operator of the device , but this may be time consuming and require some expertise not shared by all device operators . various arrangements of cables and connectors can be used for connecting the stimulation ( therapy pads ) and monitoring electrodes to their associated medical device ( e . g ., a combined cpr prompting , defibrillation , and pacing device ). for example , the therapy electrodes may be wired to a therapy connector . the wires may be made from any electrically conductive material and may be permanently attached to the electrodes or may attach to some or all of the electrodes using a connector . a connector allows the wires to be reused but may be less reliable and takes time for connection . it has the disadvantage of allowing the operator to make a mistake by forgetting to connect a wire or by connecting a wire to the wrong electrode . the monitoring electrodes may be wired to a monitoring connector . the therapy and monitoring connectors may be physically separate or combined into a unified connector . the unified connector may be one piece or made up of a monitoring connector and therapy connector that can come apart or move in such a way that one or both of the connectors will be attached to the medical device . this may be accomplished with wires permanently attached to the electrodes and running individually , or attached together in a single cable , to a connector . attaching the single connector to the medical devices ensures that all connections are properly made . however , this requires a separate input on the medical device for standard leads to be connected , and an internal switching mechanism capable of selecting between electrodes or displaying both sets of leads . alternatively , separate connectors may be used for the therapy pad and monitoring electrodes . this has the advantage of allowing the operator to replace one or both of these cables with other monitoring electrodes or pads , and eliminates the need for a switching mechanism . this type of cabling may allow the electrodes to be used on devices not originally designed for this purpose . some of the multi - lead cable constructions shown in the application of peter a . lund et al ., entitled , “ medical cable ”, filed on even date herewith ( and herein incorporated by reference ), may be used in some implementations . to simplify cabling and reduce cost , therapy pad wires may be shared with the monitoring electrodes in certain applications . this is especially relevant where pulses are applied to the therapy pads for short durations , and monitoring is not required during this time . switching circuitry or non - linear circuit elements including but not limited to , diodes or gas discharge tubes may be used for this purpose . a possible implementation of a shared wire electrode assembly is shown in fig8 . diodes 81 , 82 allow the flow of current to the stimulation electrode 85 ( which conducts to the patient through gel layer 86 ) but block a reverse flow of current back to the monitoring channel during the monitoring phase following stimulation . using diodes oriented in both directions allows the delivery of biphasic stimulation waveforms while preventing polarizations ( e . g . of less than a diode drop ) from being measured by the monitoring circuit . more than one diode may be used in either direction to split high currents or for fault tolerance . optionally , a resistor 83 or high impedance monitoring electrode 84 may reduce current flow through the monitoring electrode 84 during therapy . implementations such as that of fig8 , as well as other shared wire implementations , have the advantages of reduced clutter and reduced chance of wrong connections . in some implementations , the elimination of additional cables may also reduce overall manufacturing cost . the configuration shown in fig1 uses a plurality ( two shown ) of stimulation electrodes 18 of one polarity . current flows from one positive stimulation electrode 16 to two negative stimulation electrodes 18 . in other implementations both the positive and negative stimulation electrodes could be divided into two or more electrodes . a monitoring electrode 20 is positioned in the center ( but not in contact with ) each negative stimulation electrode . if both of the negative stimulation electrodes are positioned so that each receives ( sinks ) approximately the same current , the artifact measured by the two monitoring electrodes will be approximately equal and will thus cancel when the difference is taken between the two electrodes . another configuration using a plurality of stimulation electrodes 18 of the same polarity is shown in fig1 . in this implementation , an electrode of one polarity is divided into three stimulation electrodes 18 ( even more separate electrodes could be used ), and the other polarity is handled by just a single electrode 16 ( but alternatively this polarity could , also , be handled by a plurality of electrodes ). the multiple stimulation electrodes of the same polarity have separate conductive plates ( e . g ., tin ), and may have a common conductive gel underlying them , or separate gel areas . all three of the stimulation electrodes are used together during stimulation , and two of the stimulation electrodes are also used for monitoring ( as shown by the left and right electrodes leading to the differential amplifier ). the two electrodes used for monitoring are positioned across the heart and aligned to produce an ecg vector of interest . these two electrodes may be smaller than the central electrode . using the two stimulation electrodes for monitoring is possible because the polarization on the two electrodes is approximately equal and of the same polarity . the three electrodes may be part of one assembly , or be split into two or three assemblies for flexibility in placement . the combined area of the three electrodes is made sufficient for the therapy being delivered ( e . g ., defibrillation or pacing ). still another implementation is shown in fig1 . here the central electrode has been eliminated , and one stimulation polarity is divided into two electrodes 18 positioned at two sides of the heart , and aligned to produce an ecg vector of interest . both electrodes are using during stimulation , and monitoring is done by forming the difference between the two electrodes . the stimulus artifact may be mitigated further using analog or digital signal processing . such processing may include adaptive blanking of the artifact where filter inputs , displays , or strip chart recorders are blanked , zeroed , or otherwise modified during the artifact . an algorithm or adaptive method may be used to adjust the blanking time based on the measured signals . this may allow the operator to view more of the monitored signal if the artifact is cancelled quickly and to prevent confusing artifacts from being displayed if the artifact takes longer to dissipate . many other implementations other than those described above are within the invention , which is defined by the following claims . | 0 |
with reference to fig1 a signal compressing apparatus has an input terminal 1 a connected to the input side of an a / d converter 1 . the output side of the a / d converter 1 is connected to the input side of a signal processing circuit 2 . a switch 4 b has a movable contact and first and second fixed contacts . the movable contact of the switch 4 b is selectively connected to either the first fixed contact or the second fixed contact thereof . the movable contact of the switch 4 b is connected to the output side of the signal processing circuit 2 . the first fixed contact of the switch 4 b leads to the input side of a cd - rom encoding circuit 4 a . the second fixed contact of the switch 4 b leads to the input side of a dvd encoding circuit 6 . a switch 4 c has a movable contact and first and second fixed contacts . the movable contact of the switch 4 c is selectively connected to either the first fixed contact or the second fixed contact thereof . the first fixed contact of the switch 4 c is connected to the output side of the cd - rom encoding circuit 4 a . the second fixed contact of the switch 4 c is connected to the output side of the dvd encoding circuit 6 . the movable contact of the switch 4 c leads to an apparatus output terminal 4 d . also , the movable contact of the switch 4 c leads to the input side of a cd encoding circuit ( a cd - da encoding circuit ) 5 . the output side of the cd encoding circuit 5 is connected to an apparatus output terminal 5 a . the switches 4 b and 4 c cooperate to select either the cd - rom encoding circuit 4 a or the dvd encoding circuit 6 as an effective circuit . a signal generator 3 a outputs a clock signal having a frequency of 44 . 1 khz . a signal generator 31 outputs a clock signal having a frequency of 48 khz . a signal generator 3 c outputs a clock signal having a frequency of 88 . 2 khz . a signal generator 3 d outputs a clock signal having a frequency 96 khz . a switch 1 b has a movable contact , and first , second , third , and fourth fixed contacts . the movable contact of the switch 1 b is selectively connected to one of the first , second , third , and fourth fixed contacts thereof . the movable contact of the switch 1 b leads to a clock input terminal of the a / d converter 1 . the first , the second , third , and fourth fixed contacts of the switch 1 b are connected to the output terminals of the signal generators 3 a , 3 b , 3 c , and 3 d , respectively . the switch 1 b selects one of the output signals of the signal generators 3 a , 3 b , 3 c , and 3 d , and transmits the selected signal to the a / d converter 1 as a sampling clock signal . a switch 7 a has a movable contact , and first , second , third , fourth , fifth , and sixth fixed contact . the movable contact of the switch 7 a is selectively connected to one of the first , second , third , fourth , fifth , and sixth fixed contacts thereof . the movable contact of the switch 7 a leads the cd - rom encoding circuit 4 a . the first , second , third , fourth , fifth , and sixth fixed contacts of the switch 7 a are connected to taps or nodes in a series resistor combination 7 b , respectively . the series resistor combination 7 b is connected across a fixed - dc - voltage source 7 c . the switch 7 a selects one of six different voltages available in the series resistor combination 7 b , and feeds the selected voltage to the cd - rom encoding circuit 4 a . for example , the switch 7 a can be operated by a user . operation of the signal compressing apparatus of fig1 can be changed among six different modes . the six different levels of the voltage signal fed via the switch 7 a to the cd - rom encoding circuit 4 a are assigned to the six different modes of operation of the apparatus of fig1 respectively . accordingly , the switch 7 a serves as a operation - mode selecting switch , and the voltage signal fed via the switch 7 a to the cd - rom encoding circuit 4 a represents an apparatus operation mode desired and selected by the user . thus , the voltage signal fed via the switch 7 a to the cd - rom encoding circuit 4 a is also referred to as the mode signal . as will be made clear later , the switches 1 b , 4 b , and 4 c are linked to the switch 7 a . an analog audio signal is inputted to the a / d converter 1 via the apparatus input terminal 1 a . the a / d converter 1 changes the input analog audio signal into a corresponding digital audio signal in response to the sampling clock signal fed via the switch 1 b . specifically , the a / d converter 1 periodically samples the input analog audio signal at a sampling frequency decided by the frequency of the sampling clock signal . the a / d converter 1 changes or quantizes every sample of the input analog audio signal into a corresponding digital audio signal segment ( a corresponding audio data piece ) with a predetermined quantization bit number . the predetermined quantization bit number is equal to , for example , 16 or 20 . the a / d converter 1 outputs the resultant digital audio signal ( referred to as the first digital audio signal ) to the signal processing circuit 2 . generally , the input analog audio signal is composed of 2 - channel signals . the input analog audio signal may be composed of 4 - channel signals , or 6 - channel signals . the signal processing circuit 2 includes a dsp ( digital signal processor ), a microcomputer , or a similar device having a combination of an input / output port , a processing section , a rom , and a ram . the signal processing circuit 2 operates in accordance with a program stored in the rom . the signal processing circuit 2 is programmed to compress the first digital audio signal into a second digital audio signal according to a predetermined signal - compression technique including an orthogonal transform process . the predetermined signal - compression technique may also include a huffman encoding process . in this case , the orthogonal transform process may be omitted from the predetermined signal - compression technique . for example , the predetermined signal - compression technique is selected from among known signal - compression techniques . the signal processing circuit 2 outputs the second digital audio signal ( the compression - resultant digital audio signal ) to the cd - rom encoding circuit 4 a or the dvd encoding circuit 6 via the switch 4 b . the cd - rom encoding circuit 4 a generates auxiliary information signals ( sub information signals ) in response to the mode signal . the auxiliary information signals includes a sync signal and a header signal . specifically , the cd - rom encoding circuit 4 a generates at least a sync signal and a header signal for every sector with respect to a recording medium ( a cd - rom ). when the cd - rom encoding circuit 9 a is selected by the switch 4 b , the cd - rom encoding circuit 4 a receives the second digital audio signal from the signal processing circuit 2 . the cd - rom encoding circuit 4 a combines the sync signal , the header signal , and the second digital audio signal in response to the mode signal on a time - division multiplexing basis for every sector with respect to a recording medium ( a cd - rom ). the combination - resultant digital audio signal is of a predetermined format equal to one of the cd - rom signal formats . the combination - resultant digital audio signal is also referred to as the composite digital audio signal . during combining the signals , the cd - rom encoding circuit 4 a places the second digital audio signal in a time range corresponding to a user data area in every sector with respect to a recording medium ( a cd - rom ). when the cd - rom encoding circuit 4 a is selected by the switch 4 c , the cd - rom encoding circuit 9 a outputs the combination - resultant digital audio signal ( the composite digital audio signal ) to the apparatus output terminal 4 d and the cd encoding circuit 5 . the dvd encoding circuit 6 generates a header signal for every pack . when the dvd encoding circuit 6 is selected by the switch 4 b , the dvd encoding circuit 6 receives the second digital audio signal from the signal processing circuit 2 . the dvd encoding circuit 6 combines the header signal and the second digital audio signal on a time - division multiplexing basis for every pack . the combination - resultant digital audio signal is of a predetermined format equal to the dvd signal format . the combination - resultant digital audio signal is also referred to as the composite digital audio signal . during combining the signals , the dvd encoding circuit 6 places the second digital audio signal in a time range corresponding to a user data area or a packet area in every pack . when the dvd encoding circuit 6 is selected by the switch 4 c , the dvd encoding circuit 6 outputs the combination - resultant digital audio signal ( the composite digital audio signal ) to the apparatus output terminal 4 d and the cd encoding circuit 5 . the cd encoding circuit 5 converts the output signal of the cd - rom encoding circuit 4 a or the output signal of the dvd encoding circuit 6 into a digital audio signal of a predetermined format equal to the cd - wo ( compact disc write once ) format or the cd - da format . the cd encoding circuit 5 feeds the digital audio signal of the cd - wo format or the cd - da format to the apparatus output terminal 5 a . for example , the cd encoding circuit 5 subjects the output signal of the cd - rom encoding circuit 4 a or the output signal of the dvd encoding circuit 6 to a circ ( cross interleave reed - solomon code ) encoding process according to the cd - wo standards or the cd - da standards . the cd encoding circuit 5 outputs the encoding - resultant digital audio signal to the apparatus output terminal 5 a . specifically , the cd encoding circuit 5 generates an error correction signal in response to the output signal of the cd - rom encoding circuit 4 a or the output signal of the dvd encoding circuit 6 , and adds the error correction signal to the output signal of the cd - rom encoding circuit 4 a or the output signal of the dvd encoding circuit 6 . the error correction signal uses a cross interleave reed - solomon code . the cd encoding circuit 5 feeds the addition - resultant signal to the apparatus output terminal 5 a . operation of the signal compressing apparatus of fig1 can be changed among six different modes . during the first mode of operation , the switch 1 b selects the output signal of the signal generator 3 a which has a frequency of 44 . 1 khz . the switch 1 b transmits the selected signal to the a / d converter 1 as a sampling clock signal . accordingly , during the first mode of operation , the frequency of the signal sampling by the a / d converter 1 is equal to 44 . 1 khz . during the first mode of operation , the switches 4 b and 4 c select the cd - rom encoding circuit 4 a . in this case , the cd - rom encoding circuit 4 a generates a sequence of a sync signal , a header signal , a sub header signal , a user data block , and an edc signal in response to the mode signal and the second digital audio signal for every sector with respect to a recording medium ( a cd - rom ). the user data block contains the second digital audio signal . during the first mode of operation , a 1 - sector - corresponding segment of the composite digital audio signal generated by the cd - rom encoding circuit 4 a has a form such as shown in fig2 . the user data block has 2 , 324 bytes . during the second mode of operation , the switch 1 b selects the output signal of the signal generator 3 c which has a frequency of 88 . 2 khz . the switch 1 b transmits the selected signal to the a / d converter 1 as a sampling clock signal . accordingly , during the second mode of operation , the frequency of the signal sampling by the a / d converter 1 is equal to 88 . 2 khz . during the second mode of operation , the switches 4 b and 4 c select the cd - rom encoding circuit 4 a . in this case , the cd - rom encoding circuit 4 a generates a sequence of a sync signal , a header signal , a sub header signal , a user data block , and an edc signal in response to the mode signal and the second digital audio signal for every sector with respect to a recording medium ( a cd - rom ). the user data block contains the second digital audio signal . during the second mode of operation , a 1 - sector - corresponding segment of the composite digital audio signal generated by the cd - rom encoding circuit 4 a has a form such as shown in fig2 . the user data block has 2 , 324 bytes . during the third mode of operation , the switch 1 b selects the output signal of the signal generator 3 a which has a frequency of 44 . 1 khz . the switch 1 b transmits the selected signal to the a / d converter 1 as a sampling clock signal . accordingly , during the third mode of operation , the frequency of the signal sampling by the a / d converter 1 is equal to 44 . 1 khz . during the third mode of operation , the switches 4 b and 4 c select the cd - rom encoding circuit 4 a . in this case , the cd - rom encoding circuit 4 a generates a sequence of a sync signal , a header signal , and a user data block in response to the mode signal and the second digital audio signal for every sector with respect to a recording medium ( a cd - rom ). the user data block contains the second digital audio signal . during the third mode of operation , a 1 - sector - corresponding segment of the composite digital audio signal generated by the cd - rom encoding circuit 4 a has a form such as shown in fig3 . the user data block has 2 , 336 bytes . during the fourth mode of operation , the switch 1 b selects the output signal of the signal generator 3 c which has a frequency of 88 . 2 khz . the switch 1 b transmits the selected signal to the a / d converter 1 as a sampling clock signal . accordingly , during the fourth mode of operation , the frequency of the signal sampling by the a / d converter 1 is equal to 88 . 2 khz . during the fourth mode of operation , the switches 4 b and 4 c select the cd - rom encoding circuit 4 a . in this case , the cd - rom encoding circuit 4 a generates a sequence of a sync signal , a header signal , and a user data block in response to the mode signal and the second digital audio signal for every sector with respect to a recording medium ( a cd - rom ). the user data block contains the second digital audio signal . during the fourth mode of operation , a 1 - sector - corresponding segment of the composite digital audio signal generated by the cd - rom encoding circuit 4 a has a form such as shown in fig3 . the user data block has 2 , 336 bytes . during the fifth mode of operation , the switch 1 b selects the output signal of the signal generator 3 b which has a frequency of 48 khz . the switch 1 b transmits the selected signal to the a / d converter 1 as a sampling clock signal . accordingly , during the fifth mode of operation , the frequency of the signal sampling by the a / d converter 1 is equal to 48 khz . during the fifth mode of operation , the switches 4 b and 4 c select the dvd encoding circuit 6 . in this case , the dvd encoding circuit 6 generates a sequence of a header signal and a user data block ( a packet or packets ) in response to the second digital audio signal for every pack . the user data block ( the pack or packets ) contains the second digital audio signal . during the fifth mode of operation , a 1 - pack - corresponding segment of the composite digital audio signal generated by the dvd encoding circuit 6 has a form such as shown in fig4 . the user data block has 2 , 034 bytes . it should be noted that in this specification , a dvd may be another disc in a dvd family such as a dvd - rom , a dvd - wo , and a dvd - ram . during the sixth mode of operation , the switch 1 b selects the output signal of the signal generator 3 d which has a frequency of 96 khz . the switch 1 b transmits the selected signal to the a / d converter 1 as a sampling clock signal . accordingly , during the sixth mode of operation , the frequency of the signal sampling by the a / d converter 1 is equal to 96 khz . during the sixth mode of operation , the switches 4 b and 4 c select the dvd encoding circuit 6 . in this case , the dvd encoding circuit 6 generates a sequence of a header signal and a user data block ( a packet or packets ) in response to the second digital audio signal for every pack . the user data block ( the pack or packets ) contains the second digital audio signal . during the sixth mode of operation , a 1 - pack - corresponding segment of the composite digital audio signal generated by the dvd encoding circuit 6 has a form such as shown in fig4 . the user data block has 2 , 034 bytes . the apparatus output terminal 4 d can be connected to a transmission line in , for example , a communication network . in this case , the output signal of the cd - rom encoding circuit 4 a or the dvd encoding circuit 6 can be fed to the transmission line before being transmitted therealong . the apparatus output terminal 4 d can be connected to a pre - mastering apparatus or a mastering apparatus for a cd - rom or a dvd . in this case , the output signal of the cd - rom encoding circuit 4 a or the dvd encoding circuit 6 can be fed to the pre - mastering apparatus or the mastering apparatus before being recorded thereby on a pre - master disc or a master disc for a cd - rom or a dvd . the apparatus output terminal 4 d can be connected to a recording apparatus . in this case , the output signal of the cd - rom encoding circuit 4 a or the dvd encoding circuit 6 can be fed to the recording apparatus before being recorded thereby on a recording medium such as a magnetic tape or a magnetic disc . fig5 shows a drive apparatus 8 for a cd - wo 9 . the drive apparatus 8 can be connected to the output terminal 5 a in fig1 . in this case , the output signal of the cd encoding circuit 5 can be fed to the drive apparatus 8 before being recorded thereby on the cd - wo 9 . fig6 shows a second embodiment of this invention which is similar to the embodiment of fig1 - 5 except for the following design change . the embodiment of fig6 uses a signal processing circuit 2 a instead of the signal processing circuit 2 in fig1 . an analog audio signal inputted to the a / d converter 1 is composed of 2 - channel signals . the input analog audio signal may be composed of 4 - channel signals , or 6 - channel signals . the signal processing circuit 2 a includes a dsp ( digital signal processor ), a microcomputer , or a similar device having a combination of an input / output port , a processing section , a rom , and a ram . the signal processing circuit 2 a operates in accordance with a program stored in the rom . the signal processing circuit 2 a receives the first digital audio signal from the a / d converter 1 . the signal processing circuit 2 a is programmed to process the first digital audio signal into a second digital audio signal according to a predetermined signal - compression technique including an orthogonal transform process . the predetermined signal - compression technique may also include a huffman encoding process . in this case , the orthogonal transform process may be omitted from the predetermined signal - compression technique . the signal processing by the signal processing circuit 2 a is implemented block by block . here , “ block ” corresponds to a predetermined number “ 2 m ” of data pieces of the first digital audio signal per channel . specifically , the signal processing circuit 2 a subjects a set of 2 m data pieces of the first digital audio signal to orthogonal transform , thereby generating a signal representing the frequency spectrum of the first digital audio signal . the signal processing circuit 2 a divides the resultant frequency - spectrum signal into signals in different frequency bands by a filtering process . the signal processing circuit 2 a normalizes and quantizes each of the frequency - band signals . the signal processing circuit 2 a generates helper information representing the conditions of the normalization ( for example , the normalization level or the normalization bit number ) and the conditions of the quantization . the signal processing circuit 2 a combines the normalization / quantization - resultant signals and the helper information . the signal processing circuit 2 a subjects the combination - resultant signal to an allocation process . the signal processing circuit 2 a outputs the allocation - resultant signal to the switch 4 b . the signal processing circuit 2 a may subject the combination - resultant signal to a huffman encoding process . in this case , the signal processing circuit 2 a subjects the encoding - resultant signal to an allocation process . the signal processing circuit 2 a outputs the allocation - resultant signal to the switch 4 b . fig7 shows a third embodiment of this invention which is similar to the embodiment of fig1 - 5 except for the following design change . the embodiment of fig7 uses a signal processing circuit 2 b instead of the signal processing circuit 2 in fig1 . the signal processing circuit 2 b includes a dsp ( digital signal processor ), a microcomputer , or a similar device having a combination of an input / output port , a processing section , a rom , and a ram . the signal processing circuit 2 b operates in accordance with a program stored in the rom . the signal processing circuit 2 b receives the first digital audio signal from the a / d converter 1 . the signal processing circuit 2 b is programmed to process the first digital audio signal into a second digital audio signal according to a predetermined signal - compression technique . fig8 shows a flow of operation of the signal processing circuit 2 b . it should be noted that fig8 does not show the hardware structure of the signal processing circuit 2 b . with reference to fig8 a block 22 subjects an input signal ( that is , the first digital audio signal from the a / d converter 1 ) to a windowing process and an orthogonal transform process . preferably , the orthogonal transform process is of the mdct ( modified discrete cosine transform ) type . the resultant data representing orthogonal transform coefficients are divided by the block 22 into coefficient - representing data pieces corresponding to different frequency bands respectively . a block 23 following the block 22 decides scale factors for the coefficient - representing data pieces corresponding to the frequency bands respectively . the block 23 normalizes the coefficient - representing data pieces in response to the decided scale factors respectively . the block 23 informs a block 27 of the decided scale factors . a block 24 following the block 23 quantizes the normalization - resultant data pieces in response to variable quantization factors ( variable quantization steps ). the bock 24 may implement the quantization - resultant data pieces to entropy encoding . a block 25 following the block 23 calculates desired code amounts ( desired bit numbers ) from the normalization - resultant data pieces for the frequency bands respectively . the minimum audible limit characteristics and the masking effects of a predetermined auditory sensation model are used in calculating the desired code amounts . a block 26 following the block 25 calculates desired quantization factors ( desired quantization steps ) from the desired code amounts for the frequency bands respectively . the block 26 informs the block 24 of the desired quantization factors ( the desired quantization steps ). the block 24 quantizes the normalization - resultant data pieces in response to quantization factors equal to the desired quantization factors . the block 26 informs the block 27 of the desired quantization factors as actual quantization factors used by the block 24 . the block 27 follows the block 24 . the block 27 generates helper information such as header information . the block 27 combines the quantization - resultant data pieces , the information of the scale factors , the information of the quantization factors , and the helper information into a bit stream which is an output signal of the signal processing circuit 2 b . fig9 is a flowchart of a segment of the program which corresponds to the blocks 24 , 25 , and 26 in fig8 . signal processing by the blocks 24 , 25 , and 26 is implemented frame by frame . here , “ frame ” is a predetermined time interval . as shown in fig9 a first step s 1 of the program segment decides first quantization bit numbers ( first quantization factors ) for the frequency bands respectively . regarding the normalization - resultant data pieces , the step s 1 estimates generated bit numbers in response to the decided first quantization bit numbers for the frequency bands respectively . the step s 1 calculates a total bit number which equals the sum of the estimated bit numbers . a step s 2 following the step s 1 calculates an available bit number in the current frame . a step s 3 following the step 32 compares the calculated total bit number and the calculated available bit number to decide whether or not a code amount is insufficient . when the total bit number is greater than the available bit number , that is , when a code amount is insufficient , the program advances from the step s 3 to a step s 4 . otherwise , the program advances from the step s 3 to a step s 8 . the step s 4 calculates band powers p [ i ] which are equal to the square of the scale factors for the frequency bands respectively . here , “ i ” denotes a variable integer for identifying the frequency bands . the step s 4 calculates masking curves m [ i ] from the calculated band powers p [ i ] in accordance with the minimum audible limit characteristic and the masking effects of a predetermined auditory sensation model . specifically , the masking curves m [ i ] are given by the convolution of model - based reference curves r [ i ] and the band powers p [ i ]. a step s 5 following the step s 4 calculates standard noise levels n [ i ] from the minimum audible limits abs [ i ] and the masking curves m [ i ] for the frequency bands respectively . for example , the calculation of the standard noise levels n [ i ] uses an equation given as : where “ max ” denotes an operator for selecting the greater of the values in the brackets . a step s 6 subsequent to the step s 5 distributes deleted bits ( that is , bits to be deleted ) to the frequency bands according to the following rules . first one of the deleted bits is allocated to the frequency band having the highest standard noise level . then , the standard noise level corresponding to this frequency band is reduced by a predetermined level . subsequently , second one of the deleted bits is allocated to the frequency band having the highest standard noise level . then , the standard noise level corresponding to this frequency band is reduced by the predetermined level . these processes are iteratively executed until a final one of the deleted bits is allocated . in other words , first one of the deleted bits is allocated to the frequency band having the highest standard noise level . second one of the deleted bits is allocated to the frequency band having the second highest standard noise level . third one of the deleted bits is allocated to the frequency band having the third highest standard noise level . these processes are iteratively executed until a final one of the deleted bits is allocated . during these processes , when one of the deleted bits is allocated to a frequency band , the standard noise level corresponding to this frequency band is decreased by a predetermined level . generally , the shape of the distribution of the deleted bits is similar to the shape formed by the standard noise levels n [ i ]. the block s 6 corrects the first quantization bit numbers ( the first quantization factors ) into second quantization bit numbers ( second quantization factors ) in response to the distribution of the deleted bits to the frequency bands respectively . after the step s 6 , the program advances to a step s 7 . the step s 8 allocates surplus bits to the frequency bands . the step s 8 sets second quantization bit numbers ( second quantization factors ) equal to the first quantization bit numbers ( the first quantization factors ) for the frequency bands respectively . after the step s 8 , the program advances to the step s 7 . the step s 7 quantizes the normalization - resultant data pieces in response to the second quantization factors ( the second quantization bit numbers ) of the frequency bands respectively . after the step s 7 , the current execution cycle of the program segment ends . as shown in fig1 , the standard noise level varies frequency - band to frequency - band even in the case where the noise level of the original signal is fixed independent of the frequency bands . the stepwise line formed by the standard noise levels is shaped according to the auditory sensation model . the deleted bits are distributed to the frequency bands according to the standard noise levels . therefore , it is possible to effectively suppress a decrease in tone quality in auditory sensation which would be caused by the quantization . fig1 shows a fourth embodiment of this invention which is similar to the embodiment of fig7 - 10 except for design changes indicated hereinafter . the embodiment of fig1 uses a signal processing circuit 2 c instead of the signal processing circuit 2 b in fig7 . the signal processing circuit 2 c includes a dsp ( digital signal processor ), a microcomputer , or a similar device having a combination of an input / output port , a processing section , a rom , and a ram . the signal processing circuit 2 c operates in accordance with a program stored in the rom . the signal processing circuit 2 c receives the first digital audio signal from the a / d converter 1 . the signal processing circuit 2 c is programmed to process the first digital audio signal into a second digital audio signal according to a predetermined signal - compression technique . fig1 is a flowchart of a segment of the program in the signal processing circuit 2 c . generally , the program segment in fig1 is iteratively executed . as shown in fig1 , a first step s 11 of the program segment fetches information of used code amounts in all time intervals composing an object term . for example , the object term corresponds to the time length of a tune represented by an input audio signal or the sum of the time lengths of all tunes for one disc . the step s 11 calculates a mean code amount tm among the used code amounts . the step s 11 fetches information of a desired code amount td . a step s 12 following the step s 11 compares the mean code amount tm and the desired code amount td to decide whether an insufficient condition or a surplus condition occurs in code amount . when the mean code amount tm is greater than the desired code amount td , that is , when a surplus condition occurs , the program advances from the step s 12 to a step s 13 . otherwise , the program advances from the step s 12 to a step s 19 . the step 513 calculates the deviation ( the difference ) δ which is equal to the used code amount minus the desired code amount td for each of the time intervals . the step s 13 quantizes the deviation - δ - representing data piece in response to a predetermined quantization step width ( a predetermined quantization step size ) st for each of the time intervals . the quantization step width ( the quantization step size ) st is expressed in bit number . the step s 13 generates a histogram related to the deviations δ . a step s 14 following the step s 13 calculates the deviation sum sm in negative ranges of the histogram and the deviation sum sp in positive ranges of the histogram according to equations given as : sm = ∑ i = min - 1 histogram [ i ] · i · st sp = ∑ i = 1 max histogram [ i ] · i · st where “ i ” denotes an index of the histogram , and “ min ” and “ max ” denote an index minimum limit and an index maximum limit respectively . a step s 15 subsequent to the step s 14 calculates the ratio “ sm /( sm + sp )”. the step s 15 compares the calculated ratio with a predetermined value bd equal to , for example , 0 . 33 . when the calculated ratio is equal to or greater than the predetermined value bd , the program advances from the step s 15 to a step s 16 . otherwise , the program advances from the step s 15 to a step s 17 . the step s 16 sets an offset value ofs of the histogram to “ 0 ”. after the step s 16 , the program advances to a step s 18 . the step s 17 sets the offset value ofs so that the ratio “ sm /( sm + sp )” will be equal to or greater than the predetermined value bd . after the step s 17 , the program advances to the step s 18 . for each of the time intervals , the step s 18 compares the deviation δ with the product of the offset value ofs and the quantization step width st . when the deviation δ is equal to or smaller than the product “ ofs · st ”, the step s 18 calculates a code amount adjustment value ( a code amount corrective value ) adj from the offset value ofs and the quantization step width st according to the following equation . when the deviation δ is greater than the product “ ofs · st ”, the step s 18 calculates the code amount adjustment value ( the code amount corrective value ) adj according to the following equation . the step s 18 calculates the code amount adjustment value ( the code amount corrective value ) adj for each of the time intervals . after the step s 18 , the current execution cycle of the program segment ends . for each of the time intervals , the step s 19 calculates the code amount adjustment value ( the code amount corrective value ) adj from the mean code amount tm and the desired code amount td according to the following equation . after the step s 19 , the current execution cycle of the program segment ends . with reference to fig1 , the code amount adjustment value ( the code amount corrective value ) adj varies as a function of the deviation δ . specifically , in a range where the deviation δ is positive , the code amount adjustment value ( the code amount corrective value ) adj increases as the deviation δ increases . fig1 is a flowchart of another segment of the program in the signal processing circuit 2 c . the program segment in fig1 is executed frame by frame . as shown in fig1 , a first step s 21 of the program segment decides first quantization bit numbers ( first quantization factors ) for the frequency bands respectively . regarding the normalization - resultant data pieces , the step s 21 estimates generated bit numbers in response to the decided first quantization bit numbers for the frequency bands respectively . the step s 21 calculates a total bit number which equals the sum of the estimated bit numbers . a step s 22 following the step s 21 fetches information of the code amount adjustment value ( the code amount corrective value ) adj for the current frame . a step s 23 subsequent to the step s 22 decides whether or not the code amount adjustment value ( the code amount corrective value ) adj is negative . when the code amount adjustment value ( the code amount corrective value ) adj is negative , the program advances from the step s 23 to a step s 24 . otherwise , the program advances from the step 323 to a step s 28 . the step s 24 calculates band powers p [ i ] which are equal to the square of the scale factors for the frequency bands respectively . here , “ i ” denotes a variable integer for identifying the frequency bands . the step s 24 calculates masking curves m [ i ] from the calculated band powers p [ i ] in accordance with the minimum audible limit characteristic and the masking effects of a predetermined auditory sensation model . specifically , the masking curves m [ i ] are given by the convolution of model - based reference curves r [ i ] and the band powers p [ i ]. a step s 25 following the step s 24 calculates standard noise levels n [ i ] from the minimum audible limits abs [ i ] and the masking curves m [ i ] for the frequency bands respectively . for example , the calculation of the standard noise levels n [ i ] uses an equation given as : where “ max ” denotes an operator for selecting the greater of the values in the brackets . a step s 26 subsequent to the step s 25 distributes deleted bits ( that is , bits to be deleted ) to the frequency bands according to the following rules . first one of the deleted bits is allocated to the frequency band having the highest standard noise level . then , the standard noise level corresponding to this frequency band is reduced by a predetermined level . subsequently , second one of the deleted bits is allocated to the frequency band having the highest standard noise level . then , the standard noise level corresponding to this frequency band is reduced by the predetermined level . these processes are iteratively executed until a final one of the deleted bits is allocated . in other words , first one of the deleted bits is allocated to the frequency band having the highest standard noise level . second one of the deleted bits is allocated to the frequency band having the second highest standard noise level . third one of the deleted bits is allocated to the frequency band having the third highest standard noise level . these processes are iteratively executed until a final one of the deleted bits is allocated . during these processes , when one of the deleted bits is allocated to a frequency band , the standard noise level corresponding to this frequency band is decreased by a predetermined level . generally , the shape of the distribution of the deleted bits is similar to the shape formed by the standard noise levels n [ i ]. the block s 26 corrects the first quantization bit numbers ( the first quantization factors ) into second quantization bit numbers ( second quantization factors ) in response to the distribution of the deleted bits to the frequency bands respectively . after the step s 26 , the program advances to a step s 27 . the step s 28 allocates surplus bits to the frequency bands . the step s 28 sets second quantization bit numbers ( second quantization factors ) equal to the first quantization bit numbers ( the first quantization factors ) for the frequency bands respectively . after the step s 28 , the program advances to the step s 27 . the step s 27 quantizes the normalization - resultant data pieces in response to the second quantization factors ( the second quantization bit numbers ) of the frequency bands respectively . after the step s 27 , the current execution cycle of the program segment ends . fig1 shows an apparatus for an optical disc 101 which can be selected from among various discs such as a cd - da , a cd - rom , and a cd - rom - audio . the apparatus of fig1 includes a spindle motor 102 , an optical head 103 , a spindle motor servo section 104 , a focusing tracking servo section 105 , and a servo control circuit 106 . the spindle motor servo section 104 is connected between the spindle motor 102 and the servo control circuit 106 . the focusing tracking servo section 105 is connected between the optical head 103 and the servo control circuit 106 . the optical disc 101 can be placed into and out of a normal position within the apparatus of fig1 . the spindle motor 102 serves to rotate the optical disc 101 placed in the normal position . the spindle motor servo section 104 controls the spindle motor 104 in response to an output signal of the servo control circuit 106 to implement control of the rotational speed of the optical disc 101 . the focusing tracking servo section 105 controls the optical head 103 in response to output signals of the servo control circuit 106 to implement focusing control of the optical head 103 and tracking control of the optical head 103 . the optical head 103 is electrically connected to an rf amplifier 107 followed by a reproducing decoder 108 . during a playback mode of operation of the apparatus of fig1 , the optical head 103 reads out information from the optical disc 101 , and outputs an rf signal representing the read - out information . the output signal of the optical head 103 is amplified by the rf amplifier 107 . the amplification - resultant signal is outputted from the rf amplifier 107 to the reproducing decoder 108 . the reproducing decoder 108 subjects the output signal of the rf amplifier 107 to efm demodulation , thereby recovering data corresponding to the information recorded on the optical disc 101 . the optical head 103 is electrically connected to a laser drive section 109 following a recording encoder 110 . during a recording mode of operation of the apparatus of fig1 , the recording encoder 110 subjects recorded data ( data to be recorded ) to efm modulation . the recording encoder 110 outputs the modulation - resultant signal to the laser drive section 109 . the optical head 103 generates a laser light beam . the optical head 103 applies the laser light beam to the optical disc 101 . the laser drive section 109 controls the power or the intensity of the laser light beam in response to the output signal of the recording encoder 110 so that information corresponding to the recorded data can be recorded on the optical disc 101 . the servo control circuit 106 is connected to the reproducing decoder 108 , the recording encoder 110 , and a cpu 117 . the servo control circuit 106 adjusts the spindle motor servo section 104 and the focusing tracking servo section 105 in response to output signals of the reproducing decoder 108 , the recording encoder 110 , and the cpu 117 . a signal processing circuit 111 is connected to the reproducing decoder 108 and the recording encoder 110 . the signal processing circuit 111 is connected to apparatus output terminals 112 a and 112 b via an output circuit 112 . an apparatus input terminal 113 a is connected to the signal processing circuit 111 via an input circuit 113 . during the playback mode of operation of the apparatus of fig1 , the reproducing decoder 108 outputs the recovered data to the signal processing circuit 111 . the signal processing circuit 111 processes the recovered data . the signal processing circuit 111 outputs the processing - resultant data to the output circuit 112 . the output circuit 112 has a section which separates the processing - resultant data into audio data and video data . the output circuit 112 has a first d / a converter which changes the audio data into a corresponding analog audio signal . the output circuit 112 feeds the analog audio signal to the apparatus output terminal 112 a . the output circuit 112 has a second d / a converter which changes the video data into a corresponding analog video signal . the output circuit 112 feeds the analog video signal to the apparatus output terminal 112 b . during the recording mode of operation of the apparatus of fig1 , an input analog audio signal to be recorded travels to the input circuit 113 via the apparatus input terminal 113 a . the input circuit 113 has an a / d converter which changes the input analog audio signal into a corresponding digital audio signal . the input circuit 113 feeds the digital audio signal to the signal processing circuit 111 . the signal processing circuit 111 processes the digital audio signal into recorded data ( data to be recorded ). the signal processing circuit 111 outputs the recorded data to the recording encoder 110 . as previously explained , the cpu 117 is connected to the servo control circuit 106 . the cpu 117 is also connected to a cpu 114 , an operation unit 115 , and a display unit 116 . operation of the apparatus of fig1 is changeable among different modes including the playback mode and the recording mode . the operation unit 115 has keys for selecting and designating one out of the different modes of operation of the apparatus of fig1 . the keys in the operation unit 115 can be operated by a user . the operation unit 115 informs the cpu 117 of the currently designated operation mode . the operation unit 115 has a button for selecting and designating one out of different formats . the button in the operation unit 115 can be operated by the user . the operation unit 115 informs the cpu 117 of the currently designated format . the cpu 117 has a combination of an input / output port , a processing section , a rom , and a ram . the cpu 117 operates in accordance with a program stored in the rom . the cpu 117 is programmed to implement the following processes . the cpu 117 transfers the information of the currently designated operation mode and the information of the currently designated format to the cpu 114 . the cpu 117 communicates with the servo control circuit 106 . the cpu 117 communicates with the cpu 114 . the cpu 117 generates a display signal in response to the information from the operation unit 115 , information from the servo control circuit 106 , and information from the cpu 114 . the cpu 117 outputs the display signal to the display unit 116 . the display signal is indicated by the display unit 116 . as previously indicated , the cpu 114 is connected to the cpu 117 . the cpu 114 is also connected to the signal processing circuit 111 . the cpu 114 has a combination of an input / output port , a processing section , a rom , and a ram . the cpu 114 operates in accordance with a program stored in the rom . the cpu 114 is programmed to control the signal processing circuit 111 in response to information from the cpu 117 . the signal processing circuit 111 includes a cd - da encoder 120 a , a cd - da decoder 120 b , a cd - rom encoder 121 , a cd - rom decoder 122 , switches 123 and 124 , an orthogonal transform / huffman encoder 125 , an orthogonal transform / huffman decoder 126 , and switches 127 and 128 . the input side of the cd - da decoder 120 b is connected to the output side of the reproducing decoder 108 . the output side of the cd - da decoder 120 b is connected to the input side of the cd - rom decoder 122 . the output side of the cd - da decoder 120 b is also connected to the cpu 114 . the switch 124 has a movable contact and fixed contacts “ a ” and “ b ”. the switch 124 has a control terminal . the switch 124 is changeable among three different states in response to a signal fed to the control terminal . when the switch 124 assumes a first state , the movable contact thereof connects with the fixed contact “ a ” thereof and disconnects from the fixed contact “ b ” thereof . when the switch 124 assumes a second state , the movable contact thereof connects with the fixed contact “ b ” thereof and disconnects from the fixed contact “ a ” thereof . when the switch 124 assumes a third state , the movable contact thereof connects with neither the fixed contact “ a ” thereof nor the fixed contact “ b ” thereof . the control terminal of the switch 124 is connected to the cpu 114 . the fixed contact “ a ” of the switch 124 leads from the output side of the cd - rom decoder 122 . the fixed contact “ b ” of the switch 124 leads from the output side of the cd - da decoder 120 b . the movable contact of the switch 124 leads to the input side of the orthogonal transform / huffman decoder 126 . the switch 128 has a movable contact and fixed contacts “ c ” and “ d ”. the switch 128 has a control terminal . the switch 128 is changeable among three different states in response to a signal fed to the control terminal . when the switch 128 assumes a first state , the movable contact thereof connects with the fixed contact “ c ” thereof and disconnects from the fixed contact “ d ” thereof . when the switch 128 assumes a second state , the movable contact thereof connects with the fixed contact “ d ” thereof and disconnects from the fixed contact “ c ” thereof . when the switch 128 assumes a third state , the movable contact thereof connects with neither the fixed contact “ c ” thereof nor the fixed contact “ d ” thereof . the control terminal of the switch 128 is connected to the cpu 114 . the fixed contact “ c ” of the switch 128 leads from the output side of the orthogonal transform / huffman decoder 126 . the fixed contact “ d ” of the switch 128 leads from the movable contact of the switch 124 . the movable contact of the switch 128 leads to the input side of the output circuit 112 . the output side of the orthogonal transform / huffman decoder 126 is connected to the cpu 114 . the switch 127 has a movable contact and fixed contacts “ g ” and “ h ”. the switch 127 has a control terminal . the switch 127 is changeable among three different states in response to a signal fed to the control terminal . when the switch 127 assumes a first state , the movable contact thereof connects with the fixed contact “ g ” thereof and disconnects from the fixed contact “ h ” thereof . when the switch 127 assumes a second state , the movable contact thereof connects with the fixed contact “ h ” thereof and disconnects from the fixed contact “ g ” thereof . when the switch 127 assumes a third state , the movable contact thereof connects with neither the fixed contact “ g ” thereof nor the fixed contact “ h ” thereof . the control terminal of the switch 127 is connected to the cpu 114 . the movable contact of the switch 127 leads from the output side of the input circuit 113 . the fixed contact “ h ” of the switch 127 leads to the input side of the orthogonal transform / huffman encoder 125 . the switch 123 has a movable contact and fixed contacts “ e ” and “ f ”. the switch 123 has a control terminal . the switch 123 is changeable among three different states in response to a signal fed to the control terminal . when the switch 123 assumes a first state , the movable contact thereof connects with the fixed contact “ e ” thereof and disconnects from the fixed contact “ f ” thereof . when the switch 123 assumes a second state , the movable contact thereof connects with the fixed contact “ f ” thereof and disconnects from the fixed contact “ e ” thereof . when the switch 123 assumes a third state , the movable contact thereof connects with neither the fixed contact “ e ” thereof nor the fixed contact “ f ” thereof . the control terminal of the switch 123 is connected to the cpu 114 . the movable contact of the switch 123 leads from the fixed contact “ g ” of the switch 127 and the output side of the orthogonal transform / huffman encoder 125 . the fixed contact “ e ” of the switch 123 leads to the input side of the cd - da encoder 120 a . the fixed contact “ f ” of the switch 123 leads to the input side of the cd - rom encoder 121 . the output side of the cd - rom encoder 121 is connected to the input side of the cd - da encoder 120 a . the output side of the cd - da encoder 120 a is connected to the input side of the recording encoder 110 . the cpu 114 is programmed to control the switches 123 , 124 , 127 , and 128 in the signal processing circuit 111 as follows . it is assumed that the user designates the recording mode of operation of the apparatus of fig1 by actuating the operation unit 115 . in this case , the user also designates the format by actuating the operation unit 115 . generally , the designated format corresponds to the standards of an optical disc 101 set in the normal position within the apparatus of fig1 . the operation unit 115 informs the cpu 117 that the recording mode of operation is currently designated . also , the operation unit 115 informs the cpu 117 of the currently designated format . the cpu 117 transfers the information of the currently designated operation mode and the currently designated format to the cpu 114 . when the cpu 114 is informed that the recording mode of operation is currently designated , the cpu 114 sets the switches 124 and 128 in their third states . in this case , the movable contact of the switch 124 separates from both the fixed contacts “ a ” and “ b ” thereof while the movable contact of the switch 128 separates from both the fixed contacts “ c ” and “ d ” thereof . therefore , none of the orthogonal transform / huffman decoder 126 , the cd - rom decoder 122 , and the cd - da decoder 120 b is connected to the output circuit 112 . the cpu 114 recognizes the currently designated format . when the currently designated format agrees with the cd - da format , the cpu 114 controls the switches 123 and 127 so that the movable contact of the switch 123 connects with the fixed contact “ e ” thereof and the movable contact of the switch 127 connects with the fixed contact “ g ” thereof . therefore , the cd - da encoder 120 a is connected to the input circuit 113 while the cd - rom encoder 121 and the orthogonal transform / huffman encoder 125 are disconnected from the input circuit 113 . when the currently designated format agrees with the cd - rom format , the cpu 114 controls the switches 123 and 127 so that the movable contact of the switch 123 connects with the fixed contact “ f ” thereof and the movable contact of the switch 127 connects with the fixed contact “ g ” thereof . therefore , the cd - rom encoder 121 is connected to the input circuit 113 while the orthogonal transform / huffman encoder 125 is disconnected from the input circuit 113 . when the currently designated format agrees with the cd - rom - audio format , the cpu 114 controls the switches 123 and 127 so that the movable contact of the switch 123 connects with the fixed contact “ f ” thereof and the movable contact of the switch 127 connects with the fixed contact “ h ” thereof . therefore , the orthogonal transform / huffman encoder 125 is connected to the input circuit 113 while the cd - rom encoder 121 is connected to the orthogonal transform / huffman encoder 125 . during the recording mode of operation of the apparatus of fig1 , the servo control circuit 106 adjusts the spindle servo section 104 to optimize the rotational speed of the spindle motor 102 , that is , the rotational speed of the optical disc 101 . in addition , the servo control circuit 106 adjusts the focusing tracking servo section 105 to optimize focusing and tracking conditions of the optical head 103 relative to the optical disc 101 . at a start of the recording mode of operation of the apparatus of fig1 , the cpu 117 informs the servo control circuit 106 of a desired initial position of the optical head 103 relative to the optical head 101 . the servo control circuit 106 adjusts the focusing tracking servo section 105 in response to the positional information from the cpu 117 , thereby setting the optical head 103 in a position equal to the desired initial position . during the recording mode of operation of the apparatus of fig1 , the servo control circuit 106 adjusts the focusing tracking servo section 105 to move the optical head 103 from the initial position to scan the optical disc 101 . during the recording mode of operation of the apparatus of fig1 , an input analog audio signal to be recorded travels to the input circuit 113 via the apparatus input terminal 113 a . the input circuit 113 changes the input analog audio signal into a corresponding digital audio signal . in the case where the currently designated format agrees with the cd - da format , the digital audio signal is transmitted from the input circuit 113 to the cd - da encoder 120 a . the cd - da encoder 120 a subjects the digital audio signal to a circ ( cross interleave reed - solomon code ) encoding process according to the cd - da standards . the cd - da encoder 120 a outputs the encoding - resultant digital audio signal to the recording encoder 110 as recorded data ( data to be recorded ) of the cd - da format . specifically , the cd - da encoder 120 a generates an error correction signal in response to the digital audio signal , and adds the error correction signal to the digital audio signal . the error correction signal uses a cross interleave reed - solomon code . the cd - da encoder 120 a outputs the addition - resultant signal to the recording encoder 110 . the recording encoder 110 subjects the recorded data of the cd - da format to the efm modulation . the recording encoder 110 outputs the modulation - resultant signal to the laser drive section 109 . the optical head 103 generates a laser light beam . the optical head 103 applies the laser light beam to the optical disc 101 . the laser drive section 109 controls the power or the intensity of the laser light beam in response to the output signal of the recording encoder 110 so that information corresponding to the recorded data of the cd - da format is recorded on the optical disc 101 . furthermore , toc information related to the recorded data is generated , and the toc information is recorded on an inner area of the optical disc 101 . during the recording mode of operation of the apparatus of fig1 , when the currently designated format agrees with the cd - rom format , the digital audio signal is transmitted from the input circuit 113 to the cd - rom encoder 121 . the cd - rom encoder 121 subjects the digital audio signal to a cd - rom encoding process including an interleaving process according to the cd - rom ( xa ) standards . the cd - rom encoder 121 outputs the process - resultant digital audio signal to the cd - da encoder 120 a . the cd - da encoder 120 a subjects the output signal of the cd - rom encoder 121 to the circ encoding process . the cd - da encoder 120 a outputs the encoding - resultant digital audio signal to the recording encoder 110 as recorded data ( data to be recorded ) of the cd - rom format . the recording encoder 110 subjects the recorded data of the cd - rom format to the efm modulation . the recording encoder 110 outputs the modulation - resultant signal to the laser drive section 109 . the optical head 103 applies the laser light beam to the optical disc 101 . the laser drive section 109 controls the power or the intensity of the laser light beam in response to the output signal of the recording encoder 110 so that information corresponding to the recorded data of the cd - rom format is recorded on the optical disc 101 . furthermore , toc information related to the recorded data is generated , and the toc information is recorded on the inner area of the optical disc 101 . during the recording mode of operation of the apparatus of fig1 , when the currently designated format agrees with the cd - rom - audio format , the digital audio signal is transmitted from the input circuit 113 to the orthogonal transform / huffman encoder 125 . the orthogonal transform / huffman encoder 125 subjects the digital audio signal to orthogonal transform and a huffman encoding process to compress the digital audio signal . the orthogonal transform / huffman encoder 125 outputs the resultant digital audio signal to the cd - rom encoder 121 . the cd - rom encoder 121 subjects the output signal of the orthogonal transform / huffman encoder 125 to the cd - rom encoding process including the interleaving process . the cd - rom encoder 121 outputs the process - resultant digital audio signal to the cd - da encoder 120 a . the cd - da encoder 120 a subjects the output signal of the cd - rom encoder 121 to the circ encoding process . the cd - da encoder 120 a outputs the encoding - resultant digital audio signal to the recording encoder 110 as recorded data ( data to be recorded ) of the cd - rom - audio format . the recording encoder 110 subjects the recorded data of the cd - rom - audio format to the efm modulation . the recording encoder 110 outputs the modulation - resultant signal to the laser drive section 109 . the optical head 103 applies the laser light beam to the optical disc 101 . the laser drive section 109 controls the power or the intensity of the laser light beam in response to the output signal of the recording encoder 110 so that information corresponding to the recorded data of the cd - rom - audio format is recorded on the optical disc 101 . furthermore , toc information related to the recorded data is generated , and the toc information is recorded on the inner area of the optical disc 101 . it is assumed that the user places an optical disc 101 in the normal position within the apparatus of fig1 , and then designates the playback mode of operation of the apparatus of fig1 by actuating the operation unit 115 . the operation control unit 115 informs the cpu 117 that the playback mode of operation is currently designated . in this case , the cpu 117 starts the apparatus of fig1 to operate in the playback mode . during the playback mode of operation of the apparatus of fig1 , the servo control circuit 106 adjusts the spindle servo section 104 to optimize the rotational speed of the spindle motor 102 , that is , the rotational speed of the optical disc 101 . in addition , the servo control circuit 106 adjusts the focusing tracking servo section 105 to optimize focusing and tracking conditions of the optical head 103 relative to the optical disc 101 . on the other hand , the optical head 103 reads out information from the optical disc 101 , and outputs an rf signal representing the read - out information . the output signal of the optical head 103 is amplified by the rf amplifier 107 . the amplification - resultant signal is outputted from the rf amplifier 107 to the reproducing decoder 108 . the reproducing decoder 108 subjects the output signal of the rf amplifier 107 to the efm demodulation , thereby recovering data corresponding to the information recorded on the optical disc 101 . the reproducing decoder 108 outputs the recovered data to the cd - da decoder 120 b . the cd - da decoder 120 b subjects the output signal of the reproducing decoder 108 to a circ decoding process ( an error correction process ). the cd - da decoder 120 b outputs the decoding - resultant signal to the cpu 114 and the cd - rom decoder 122 . at a start of the playback mode of operation of the apparatus of fig1 , the cpu 117 informs the servo control circuit 106 of a desired initial position of the optical head 103 relative to the optical head 101 . the servo control circuit 106 adjusts the focusing tracking servo section 105 in response to the positional information from the cpu 117 , thereby setting the optical head 103 in a position equal to the desired initial position . in this case , the desired initial position corresponds to a starting end of an inner area of the optical disc 101 . during the start of the recording mode of operation of the apparatus of fig1 , the servo control circuit 106 adjusts the focusing tracking servo section 105 to move the optical head 103 from the initial position to read out toc information from the inner area of the optical disc 101 . the cd - da decoder 120 b outputs reproduced toc information to the cpu 114 . the cpu 114 transfers the toc information to the ram within the cpu 117 . generally , toc information contains four control bits q 1 , q 2 , q 3 , and q 4 . among them , the control bit q 2 is used as an indication of the type of a related optical disc 101 . specifically , the control bit q 2 being “ 0 ” indicates that the related optical disc 101 agrees with a cd - da . the control bit q 2 being “ 1 ” indicates that the related optical disc 101 agrees with a cd - rom or a cd - rom - audio . it should be noted that some of cd - rom &# 39 ; s are devoid of toc information . also , some of cd - rom - audios are devoid of toc information . fig1 is a flowchart of a segment of the program in the cpu 114 . the program segment in fig1 relates to the playback mode of operation of the apparatus of fig1 . as shown in fig1 , a first step s 101 of the program segment reads out toc information from the ram within the cpu 117 . a step s 102 following the step s 101 decides whether or not the toc information is present , that is , whether or not the toc information has been successfully read out from the optical disc 101 . when the toc information is present , that is , when the toc information has been successfully read out from the optical disc 101 , the program advances from the step s 102 to a step s 103 . otherwise , the program advances from the step s 102 to a step s 107 . the step s 103 decides whether or not the control bit q 2 in the toc information is “ 1 ”. when the control bit q 2 is “ 1 ”, the program advances from the step s 103 to the step s 107 . when the control bit q 2 is “ 0 ”, the program advances from the step s 103 to a step s 105 . in this case , it is decided that the optical disc 101 agrees with a cd - da . data recorded on a cd - rom or a cd - rom - audio has a sync signal of a first type . data recorded on a cd - da has a sync signal of a second type different from the first type . the step s 103 may decide whether or not a sync signal of the first type is present in reproduced data . in this case , when a sync signal of the first type is not present , it is decided that the optical disc 101 agrees with a cd - da . the step s 105 controls the switches 124 and 128 so that the movable contact of the switch 124 will connect with the fixed contact “ b ” thereof while the movable contact of the switch 128 will connect with the fixed contact “ d ” thereof . in this case , the cd - da decoder 120 b is connected to the output circuit 112 while the cd - rom decoder 122 and the orthogonal transform / huffman decoder 126 are disconnected from the output circuit 112 . a step s 106 following the step s 105 controls the cpu 117 so that information will be reproduced from first and later tracks on the optical disc 101 . in this case , the cd - da decoder 120 b outputs reproduced data to the output circuit 112 . after the step s 106 , the current execution cycle of the program segment ends . the step s 107 controls the cpu 117 so that information will be reproduced from the first track on the optical disc 101 . the step s 107 receives reproduced data from the cd - da decoder 120 b which represents the first - track information . when the optical disc 101 agrees with a cd - rom - audio , the first - track information has cd - rom - audio code words rather than cd - rom code words . when the optical disc 101 agrees with a cd - rom , the first - track information has cd - rom code words rather than cd - rom - audio code words . a step s 108 subsequent to the step s 107 decides whether or not the first - track information has cd - rom - audio code words . when the first - track information has cd - rom - audio code words , the program advances from the step s 108 to a step s 109 . in this case , it is decided that the optical disc 101 agrees with a cd - rom - audio . when the first - track information does not have any cd - rom - audio code words , the program advances from the step s 108 to a step s 117 . the step s 109 controls the switch 124 so that the movable contact of the switch 124 will connect with the fixed contact “ a ” thereof . in this case , the orthogonal transform / huffman decoder 126 is connected to the cd - rom decoder 122 . a step s 111 following the step s 109 controls the cpu 117 so that check data will be read out from a given track on the optical disc 101 . in this case , the cd - da decoder 120 b outputs reproduced check data to the cd - rom decoder 122 . the cd - rom decoder 122 subjects the reproduced check data to a cd - rom decoding process including a de - interleaving process ( an inverse interleaving process ). the cd - rom decoder 122 outputs the process - resultant data to the orthogonal transform / huffman decoder 126 . the orthogonal transform / huffman decoder 126 subjects the output signal of the cd - rom decoder 122 to inverse orthogonal transform and a huffman decoding process . the orthogonal transform / huffman decoder 126 outputs the resultant data to the cpu 114 as decoding - resultant data corresponding to the reproduced check data . the step s 111 receives the decoding - resultant data from the orthogonal transform / huffman decoder 126 which corresponds to the reproduced check data . a step s 113 subsequent to the step s 111 decides whether or not the decoding - resultant data corresponding to the reproduced check data is normal . when the decoding - resultant data is normal , the program advances from the step s 113 to a step s 115 . otherwise , the program advances from the step s 113 to a step s 126 . the step s 115 controls the switch 128 so that the movable contact of the switch 128 will connect with the fixed contact “ c ” thereof . in this case , the orthogonal transform / huffman decoder 126 is connected to the output circuit 112 . a step s 116 following the step s 115 controls the cpu 117 so that information will be reproduced from second and later tracks on the optical disc 101 . in this case , the cd - da decoder 120 b outputs reproduced data to the cd - rom decoder 122 . the cd - rom decoder 122 subjects the reproduced data to the cd - rom decoding process including the de - interleaving process . the cd - rom decoder 122 outputs the process - resultant data to the orthogonal transform / huffman decoder 126 . the orthogonal transform / huffman decoder 126 subjects the output signal of the cd - rom decoder 122 to the inverse orthogonal transform and the huffman decoding process . the orthogonal transform / huffman decoder 126 outputs the resultant data to the output circuit 112 . after the step s 116 , the current execution cycle of the program segment ends . the step s 117 decides whether or not the first - track information has cd - rom code words . when the first - track information has cd - rom code words , the program advances from the step s 117 to a step s 118 . in this case , it is decided that the optical disc 101 agrees with a cd - rom . when the first - track information does not have any cd - rom code words , the program advances from the step s 117 to the step s 126 . the step s 118 controls the switches 124 and 128 so that the movable contact of the switch 124 will connect with the fixed contact “ a ” thereof while the movable contact of the switch 128 will connect with the fixed contact “ d ” thereof . in this case , the cd - rom decoder 122 is connected to the output circuit 112 while the cd - da decoder 120 b and the orthogonal transform / huffman decoder 126 are disconnected from the output circuit 112 . a step s 125 following the step s 118 controls the cpu 117 so that information will be reproduced from the first and later tracks on the optical disc 101 . in this case , the cd - da decoder 120 b outputs reproduced data to the cd - rom decoder 122 . the cd - rom decoder 122 subjects the reproduced data to the cd - rom decoding process including the de - interleaving process . the cd - rom decoder 122 outputs the process - resultant data to the output circuit 112 . after the step s 125 , the current execution cycle of the program segment ends . the step s 126 controls the cpu 117 so that the cpu 117 will output a given display signal to the display unit 116 . the given display signal is indicated by the display unit 116 . the given display signal represents that information can not be normally reproduced from the optical disc 101 . in other words , the given display signal represents a failure of the reproduction of information from the optical disc 101 . after the step s 126 , the current execution cycle of the program segment ends . it should be noted that the cd - rom encoder 121 and the cd - rom decoder 122 may be replaced by a dvd encoder ( a dvd packing encoder ) and a dvd decoder ( a dvd unpacking decoder ), respectively . in this case , the step s 117 in fig1 is modified to refer to mpeg code words rather than cd - rom code words . fig1 shows a sixth embodiment of this invention which is similar to the embodiment of fig1 except for the following design changes . the embodiment of fig1 includes a cpu 114 a instead of the cpu 114 in fig1 . the embodiment of fig1 includes a switch 128 a instead of the switch 128 in fig1 . the embodiment of fig1 includes an mpeg decoder 129 . the embodiment of fig1 includes an input circuit 113 b instead of the input circuit 113 in fig1 . the embodiment of fig1 is able to handle an optical disc 101 which can be selected from among various discs such as a cd - da , a cd - rom - audio , and a video - cd . a first input side of the input circuit 113 b is connected to an apparatus input terminal 113 c . a second input side of the input circuit 113 b is connected to an apparatus input terminal 113 d . the output side of the input circuit 113 b is connected to the movable contact of the switch 127 . during the recording mode of operation of the apparatus of fig1 for a video - cd , an input analog audio signal is fed to the input circuit 113 b via the apparatus input terminal 113 c . in addition , an input analog video signal is fed to the input circuit 113 b via the apparatus input terminal 113 d . the input circuit 113 b has a first a / d converter which changes the input analog audio signal into a corresponding digital audio signal . the input circuit 113 b has a second a / d converter which changes the input analog video signal into a corresponding digital video signal . the input circuit 113 b has a section which combines the digital audio signal and the digital video signal into a composite digital signal . the input circuit 113 b outputs the composite digital signal to the movable contact of the switch 127 . the cpu 114 controls the switches 123 and 127 so that the output signal of the input circuit 113 b will bypass the orthogonal transform / huffman encoder 125 and will travel to the cd - rom encoder 121 . the switch 128 a has a movable contact and fixed contacts “ c ”, “ d ”, and “ j ”. the switch 128 a has a control terminal . the switch 128 a is changeable among four different states in response to a signal fed to the control terminal . when the switch 128 a assumes a first state , the movable contact thereof connects with the fixed contact “ c ” thereof and disconnects from the fixed contact “ d ” and “ j ” thereof . when the switch 128 a assumes a second state , the movable contact thereof connects with the fixed contact “ d ” thereof and disconnects from the fixed contacts “ c ” and “ j ” thereof . when the switch 128 a assumes a third state , the movable contact thereof connects with the fixed contact “ j ” thereof and disconnects from the fixed contacts “ c ” and “ d ” thereof . when the switch 128 a assumes a fourth state , the movable contact thereof connects with none of the fixed contacts “ c ”, “ d ”, and “ j ” thereof . the control terminal of the switch 128 a is connected to the cpu 114 a . the fixed contact “ c ” of the switch 128 a leads from the output side of the orthogonal transform / huffman decoder 126 . the fixed contact “ d ” of the switch 128 a leads from the movable contact of the switch 124 . the fixed contact “ j ” of the switch 128 a leads from the output side of the mpeg decoder 129 . the movable contact of the switch 128 a leads to the input side of the output circuit 112 . the input side of the mpeg decoder 129 leads from the movable contact of the switch 124 . the output side of the mpeg decoder 129 is connected to the cpu 114 a . fig1 is a flowchart of a segment of a program in the cpu 114 a . the program segment in fig1 is similar to the program segment in fig1 except for the following design changes . with reference to fig1 , a step s 117 a which replaces the step s 117 in fig1 decides whether or not the first - track information has video - cd code words . when the first - track information has video - cd code words , the program advances from the step s 117 a to a step s 118 a . in this case , it is decided that the optical disc 101 agrees with a video - cd . when the first - track information does not have any video - cd code words , the program advances from the step s 117 a to the step s 126 . the step s 118 a controls the switch 124 so that the movable contact of the switch 124 will connect with the fixed contact “ a ” thereof . in this case , the mpeg decoder 129 is connected to the cd - rom decoder 122 . a step s 120 a following the step s 118 a controls the cpu 117 so that information will be read out from a second track on the optical disc 101 . in this case , the cd - da decoder 120 b outputs reproduced data to the cd - rom decoder 122 which corresponds to the second - track information . the cd - rom decoder 122 subjects the reproduced data to the cd - rom decoding process including the de - interleaving process . the cd - rom decoder 122 outputs the process - resultant data to the mpeg decoder 129 . the mpeg decoder 129 subjects the output signal of the cd - rom decoder 122 to an mpeg decoding process . the mpeg decoder 129 outputs the decoding - resultant data to the cpu 114 a which corresponds to the second - track information . the step s 120 a receives the decoding - resultant data from the mpeg decoder 129 which corresponds to the second - track information . a step s 122 a subsequent to the step s 120 a decides whether or not the decoding - resultant data corresponding to the second - track information is normal . when the decoding - resultant data is normal , the program advances from the step s 122 a to a step s 124 a . otherwise , the program advances from the step s 122 a to the step s 126 . the step s 124 a controls the switch 128 a so that the movable contact of the switch 128 a will connect with the fixed contact “ j ” thereof . in this case , the mpeg decoder 129 is connected to the output circuit 112 . a step s 125 a following the step s 124 a controls the cpu 117 so that information will be reproduced from second and later tracks on the optical disc 101 . in this case , the cd - da decoder 120 b outputs reproduced data to the cd - rom decoder 122 . the cd - rom decoder 122 subjects the reproduced data to the cd - rom decoding process including the de - interleaving process . the cd - rom decoder 122 outputs the process - resultant data to the mpeg decoder 129 . the mpeg decoder 129 subjects the output signal of the cd - rom decoder 122 to the mpeg decoding process . the mpeg decoder 129 outputs the decoding - resultant data to the output circuit 112 . after the step s 125 a , the current execution cycle of the program segment ends . it should be noted that the cd - rom encoder 121 and the cd - rom decoder 122 may be replaced by a dvd encoder ( a dvd packing encoder ) and a dvd decoder ( a dvd unpacking decoder ), respectively . in this case , the step s 117 a in fig1 is modified to refer to mpeg code words rather than video - cd code words . fig1 shows a seventh embodiment of this invention which is similar to the embodiment of fig1 except for the following design changes . the embodiment of fig1 includes an orthogonal transform encoder 125 a instead of the orthogonal transform / huffman encoder 125 in fig1 . the embodiment of fig1 includes an orthogonal transform decoder 126 a instead of the orthogonal transform / huffman decoder 126 in fig1 . the orthogonal transform encoder 125 a implements only orthogonal transform on received data . the orthogonal transform decoder 126 a implements only inverse orthogonal transform on received data . it should be noted that the cd - rom encoder 121 and the cd - rom decoder 122 may be replaced by a dvd encoder ( a dvd packing encoder ) and a dvd decoder ( a dvd unpacking decoder ), respectively . fig2 shows an eighth embodiment of this invention which is similar to the embodiment of fig1 except for the following design changes . the embodiment of fig2 includes an orthogonal transform encoder 125 a instead of the orthogonal transform / huffman encoder 125 in fig1 . the embodiment of fig2 includes an orthogonal transform decoder 126 a instead of the orthogonal transform / huffman decoder 126 in fig1 . the orthogonal transform encoder 125 a implements only orthogonal transform on received data . the orthogonal transform decoder 126 a implements only inverse orthogonal transform on received data . it should be noted that the cd - rom encoder 121 and the cd - rom decoder 122 may be replaced by a dvd encoder ( a dvd packing encoder ) and a dvd decoder ( a dvd unpacking decoder ), respectively . fig2 shows a ninth embodiment of this invention which is similar to the embodiment of fig1 except for the following design changes . the embodiment of fig2 includes a huffman encoder 125 b instead of the orthogonal transform / huffman encoder 125 in fig1 . the embodiment of fig2 includes a huffman decoder 126 b instead of the orthogonal transform / huffman decoder 126 in fig1 . the huffman encoder 125 b implements only a huffman encoding process on received data . the huffman decoder 126 b implements only a huffman decoding process on received data . it should be noted that the cd - rom encoder 121 and the cd - rom decoder 122 may be replaced by a dvd encoder ( a dvd packing encoder ) and a dvd decoder ( a dvd unpacking decoder ), respectively . fig2 shows a tenth embodiment of this invention which is similar to the embodiment of fig1 except for the following design changes . the embodiment of fig2 includes a huffman encoder 125 b instead of the orthogonal transform / huffman encoder 125 in fig1 . the embodiment of fig2 includes a huffman decoder 126 b instead of the orthogonal transform / huffman decoder 126 in fig1 . the huffman encoder 125 b implements only a huffman encoding process on received data . the huffman decoder 126 b implements only a huffman decoding process on received data . the embodiment of fig2 includes a switch 127 a instead of the switch 127 in fig1 . the embodiment of fig2 includes a cpu 114 b instead of the cpu 114 a in fig1 . the embodiment of fig2 includes an mpeg decoder 130 . the switch 127 a has a movable contact and fixed contacts “ g ”. “ h ”, and “ k ”. the switch 127 a has a control terminal . the switch 127 a is changeable among four different states in response to a signal fed to the control terminal . when the switch 127 a assumes a first state , the movable contact thereof connects with the fixed contact “ g ” thereof and disconnects from the fixed contacts “ h ” and “ k ” thereof . when the switch 127 a assumes a second state , the movable contact thereof connects with the fixed contact “ h ” thereof and disconnects from the fixed contacts “ g ” and “ k ” thereof . when the switch 127 a assumes a third state , the movable contact thereof connects with the fixed contact “ k ” thereof and disconnects from the fixed contacts “ g ” and “ h ” thereof when the switch 127 a assumes a fourth state , the movable contact thereof connects with none of the fixed contacts “ g ”, “ h ”, and “ k ” thereof . the control terminal of the switch 127 a is connected to the cpu 114 b . the fixed contact “ g ” of the switch 127 a leads to the movable contact of the switch 123 . the fixed contact “ h ” of the switch 127 a leads to the input side of the huffman encoder 125 b . the fixed contact “ k ” of the switch 127 a leads to the input side of the mpeg encoder 130 . the movable contact of the switch 127 a leads from the output side of the input circuit 113 b . the output side of the mpeg encoder 130 is connected to the movable contact of the switch 123 . it is assumed that the user designates the recording mode of operation of the apparatus of fig2 by actuating the operation unit 115 . in this case , the user also designates the format by actuating the operation unit 115 . generally , the designated format corresponds to the standards of an optical disc 101 set in the normal position within the apparatus of fig2 . the operation unit 115 informs the cpu 117 that the recording mode of operation is currently designated . also , the operation unit 115 informs the cpu 117 of the currently designated format . the cpu 117 transfers the information of the currently designated operation mode and the currently designated format to the cpu 114 b . when the currently designated format agrees with the video - cd format , the cpu 114 b controls the switches 123 and 127 a so that the movable contact of the switch 123 connects with the fixed contact “ f ” thereof and the movable contact of the switch 127 a connects with the fixed contact “ k ” thereof . therefore , the mpeg encoder 130 is connected to the input circuit 113 b while the huffman encoder 125 b is disconnected from the input circuit 113 b . in this case , the digital signal is transmitted from the input circuit 113 b to the mpeg encoder 130 . the mpeg encoder 130 subjects the digital signal to an mpeg encoding process to compress the digital signal . the mpeg encoder 130 outputs the resultant digital signal to the cd - rom encoder 121 . the cd - rom encoder 121 subjects the output signal of the mpeg encoder 130 to the cd - rom encoding process including the interleaving process . the cd - rom encoder 121 outputs the process - resultant digital signal to the cd - da encoder 120 a . the cd - da encoder 120 a subjects the output signal of the cd - rom encoder 121 to the circ encoding process . the cd - da encoder 120 a outputs the encoding - resultant digital signal to the recording encoder 110 as recorded data ( data to be recorded ) of the video - cd format . the recording encoder 110 subjects the recorded data of the video - cd format to the efm modulation . the recording encoder 110 outputs the modulation - resultant signal to the laser drive section 109 . the optical head 103 applies the laser light beam to the optical disc 101 . the laser drive section 109 controls the power or the intensity of the laser light beam in response to the output signal of the recording encoder 110 so that information corresponding to the recorded data of the video - cd format is recorded on the optical disc 101 . furthermore , toc information related to the recorded data is generated , and the toc information is recorded on the inner area of the optical disc 101 . it should be noted that the cd - rom encoder 121 and the cd - rom decoder 122 may be replaced by a dvd encoder ( a dvd packing encoder ) and a dvd decoder ( a dvd unpacking decoder ), respectively . fig2 shows an eleventh embodiment of this invention which is similar to the embodiment of fig1 except for the following design changes . the embodiment of fig2 includes a cpu 114 d instead of the cpu 114 in fig1 . the cpu 114 d is connected to the cd - da encoder 120 a . the embodiment of fig2 includes a compression encoder 125 c , an expansion decoder 126 c , and switches 127 b and 128 b . the embodiment of fig2 is able to handle an optical disc 101 which can be selected from among various discs such as a cd - da and a cd - rom - audio . the switch 127 b has a movable contact and fixed contacts “ g ”, “ h 1 ”, “ h 2 ”, and “ h 3 ”. the switch 127 b has a control terminal . the switch 127 b is changeable among five different states in response to a signal fed to the control terminal . when the switch 127 b assumes a first state , the movable contact thereof connects with the fixed contact “ g ” thereof and disconnects from the fixed contacts “ h 1 ”, “ h 2 ”, and “ h 3 ” thereof . when the switch 127 b assumes a second state , the movable contact thereof connects with the fixed contact “ h 1 ” thereof and disconnects from the fixed contacts “ g ”, “ h 2 ”, and “ h 3 ” thereof . when the switch 127 b assumes a third state , the movable contact thereof connects with the fixed contact “ h 2 ” thereof and disconnects from the fixed contacts “ g ”, “ h 1 ”, and “ h 3 ” thereof . when the switch 127 b assumes a fourth state , the movable contact thereof connects with the fixed contact “ h 3 .” thereof and disconnects from the fixed contacts “ g ”, “ h 1 ”, and “ h 2 ” thereof . when the switch 127 b assumes a fifth state , the movable contact thereof connects with none of the fixed contacts “ g ”, “ h 1 ”, “ h 2 ”, and “ h 3 ” thereof . the control terminal of the switch 127 b is connected to the cpu 114 d . the fixed contact “ g ” of the switch 127 b leads to the input side of the cd - rom encoder 121 . the fixed contact “ h 1 ” of the switch 127 b leads to a first input side of the compression encoder 125 c . the fixed contact “ h 2 ” of the switch 127 b leads to a second input side of the compression encoder 125 c . the fixed contact “ h 3 ” of the switch 127 b leads to a third input side of the compression encoder 125 c . the movable contact of the switch 127 b leads from the output side of the input circuit 113 . the output side of the compression encoder 125 c is connected to the input side of the cd - rom encoder 121 . the switch 128 b has a movable contact and fixed contacts “ c 1 ”, “ c 2 ”, “ c 3 ”, and “ d ”. the switch 128 b has a control terminal . the switch 128 b is changeable among five different states in response to a signal fed to the control terminal . when the switch 128 b assumes a first state , the movable contact thereof connects with the fixed contact “ c 1 ” thereof and disconnects from the fixed contact “ c 2 ”, “ c 3 ”, and “ d ” thereof . when the switch 128 b assumes a second state , the movable contact thereof connects with the fixed contact “ c 2 ” thereof and disconnects from the fixed contacts “ c 1 ”, “ c 3 ”, and “ d ” thereof . when the switch 128 b assumes a third state , the movable contact thereof connects with the fixed contact “ c 3 ” thereof and disconnects from the fixed contacts “ c 1 ”, “ c 2 ”, and “ d ” thereof . when the switch 128 b assumes a fourth state , the movable contact thereof connects with the fixed contact “ d ” thereof and disconnects from the fixed contacts “ c 1 ”, “ c 2 ”, and “ c 3 ” thereof . when the switch 128 b assumes a fifth state , the movable contact thereof connects with none of the fixed contacts “ c 1 ”, “ c 2 ”, “ c 3 ”, and “ d ” thereof . the control terminal of the switch 128 b is connected to the cpu 114 d . the fixed contact “ c 1 ” of the switch 128 b leads from a first output side of the expansion decoder 126 c . the fixed contact “ c 2 ” of the switch 128 b leads from a second output side of the expansion decoder 126 c . the fixed contact “ c 3 ” of the switch 128 b leads from a third output side of the expansion decoder 126 c . the fixed contact “ d ” of the switch 128 b leads from the output side of the cd - rom decoder 122 . the movable contact of the switch 128 b leads to the input side of the output circuit 112 . in addition , the movable contact of the switch 128 b is connected to the cpu 114 d . the input side of the compression decoder 126 c is connected to the output side of the cd - rom decoder 122 . as shown in fig2 , the compression encoder 125 c includes an orthogonal transform encoder 125 p , and huffman encoders 125 q and 125 r . the input side of the orthogonal transform encoder 125 p is connected to the fixed contact “ h 1 ” of the switch 127 b . the output side of the orthogonal transform encoder 125 p is connected to the input side of the cd - rom encoder 121 . the input side of the huffman encoder 125 q is connected to the fixed contact “ h 2 ” of the switch 127 b . the output side of the huffman encoder 125 q is connected to the input side of the orthogonal transform encoder 125 p . the input side of the huffman encoder 125 r is connected to the fixed contact “ h 3 ” of the switch 127 b . the output side of the huffman encoder 125 r is connected to the input side of the cd - rom encoder 121 . as shown in fig2 , the expansion decoder 126 c includes an orthogonal transform decoder 126 p , and huffman decoders 126 q and 126 r . the input side of the orthogonal transform decoder 126 p is connected to the output side of the cd - rom decoder 122 . the output side of the orthogonal transform decoder 126 p is connected to the fixed contact “ c 1 ” of the switch 128 b . the input side of the huffman decoder 126 q is connected to the output side of the orthogonal transform decoder 126 p . the output side of the huffman decoder 126 q is connected to the fixed contact “ c 2 ” of the switch 128 b . the input side of the huffman decoder 126 r is connected to the output side of the cd - rom decoder 122 . the output side of the huffman decoder 126 r is connected to the fixed contact “ c 3 ” of the switch 128 b . the button in the operation unit 115 can also be used in selecting and designating one out of three different signal processing types , that is , first , second , and third processing types . it is assumed that the user designates the recording mode of operation of the apparatus of fig2 by actuating the operation unit 115 . in this case , the user also designates the format and the processing type by actuating the operation unit 115 . generally , the designated format corresponds to the standards of an optical disc 101 set in the normal position within the apparatus of fig2 . the operation unit 115 informs the cpu 117 that the recording mode of operation is currently designated . also , the operation unit 115 informs the cpu 117 of the currently designated format and the currently designated processing type . the cpu 117 transfers the information of the currently designated operation mode , the currently designated format , and the currently designated processing type to the cpu 114 d . when the currently designated format agrees with the cd - rom format , the cpu 114 d controls the switch 127 b so that the movable contact of the switch 127 b connects with the fixed contact “ g ” thereof . therefore , the cd - rom encoder 121 is connected to the input circuit 113 while the compression encoder 125 c is disconnected from the input circuit 113 . in this case , the output signal of the input circuit 113 travels the cd - rom encoder 121 while bypassing the compression encoder 125 c . the cd - rom encoder 121 subjects the output signal of the input circuit 113 to the cd - rom encoding process including the interleaving process . the cd - rom encoder 121 outputs the process - resultant digital signal to the cd - da encoder 120 a . the cd - da encoder 120 a subjects the output signal of the cd - rom encoder 121 to the circ encoding process . the cd - da encoder 120 a outputs the encoding - resultant digital signal to the recording encoder 110 as recorded data ( data to be recorded ) of the cd - rom format . the recording encoder 110 subjects the recorded data of the cd - rom format to the efm modulation . the recording encoder 110 outputs the modulation - resultant signal to the laser drive section 109 . the optical head 103 applies the laser light beam to the optical disc 101 . the laser drive section 109 controls the power or the intensity of the laser light beam in response to the output signal of the recording encoder 110 so that information corresponding to the recorded data of the cd - rom format is recorded on the optical disc 101 . furthermore , toc information related to the recorded data is generated , and the toc information is recorded on the inner area of the optical disc 101 . a consideration will be given of the case where the user designates the recording mode of operation of the apparatus of fig2 and also designates the format and the processing type . when the designated format agrees with the cd - rom - audio format and the designated processing type agrees with the first processing type , the cpu 114 d controls the switch 127 b so that the movable contact of the switch 127 b connects with the fixed contact “ h 1 ” thereof . therefore , the output signal of the input circuit 113 travels the compression encoder 125 c via the fixed contact “ h 1 ” of the switch 127 b . in this case , the orthogonal transform encoder 125 p in the compression encoder 125 c subjects the output signal of the input circuit 113 to a data - compression encoding process using orthogonal transform . the orthogonal transform encoder 125 p in the compression encoder 125 c outputs the resultant signal to the cd - rom encoder 121 . the cd - rom encoder 121 subjects the output signal of the compression encoder 125 c to the cd - rom encoding process including the interleaving process . the cd - rom encoder 121 outputs the process - resultant digital signal to the cd - da encoder 120 a . the cd - da encoder 120 a subjects the output signal of the cd - rom encoder 121 to the circ encoding process . the cd - da encoder 120 a outputs the encoding - resultant digital signal to the recording encoder 110 as recorded data ( data to be recorded ) of the cd - rom - audio format . the recording encoder 110 subjects the recorded data of the cd - rom - audio format to the efm modulation . the recording encoder 110 outputs the modulation - resultant signal to the laser drive section 109 . the optical head 103 applies the laser light beam to the optical disc 101 . the laser drive section 109 controls the power or the intensity of the laser light beam in response to the output signal of the recording encoder 110 so that information corresponding to the recorded data of the cd - rom - audio format is recorded on the optical disc 101 . furthermore , toc information related to the recorded data is generated , and the toc information is recorded on the inner area of the optical disc 101 . the cpu 114 d controls the cd - da encoder 120 a so that an information piece representing the use of the first processing type will be added to the toc information . a further consideration will be given of the case where the user designates the recording mode of operation of the apparatus of fig2 and also designates the format and the processing type . when the designated format agrees with the cd - rom - audio format and the designated processing type agrees with the second processing type , the cpu 114 d controls the switch 127 b so that the movable contact of the switch 127 b connects with the fixed contact “ h 2 ” thereof . therefore , the output signal of the input circuit 113 travels the compression encoder 125 c via the fixed contact “ h 2 ” of the switch 127 b . in this case , the huffman encoder 125 q in the compression encoder 125 c subjects the output signal of the input circuit 113 to a huffman encoding process . the huffman encoder 125 q outputs the resultant signal to the orthogonal transform encoder 125 p in the compression encoder 125 c . the orthogonal transform encoder 125 p subjects the output signal of the huffman encoder 125 q to the data - compression encoding process using the orthogonal transform . the orthogonal transform encoder 125 p in the compression encoder 125 c outputs the resultant signal to the cd - rom encoder 121 . the cd - rom encoder 121 subjects the output signal of the compression encoder 125 c to the cd - rom encoding process including the interleaving process . the cd - rom encoder 121 outputs the process - resultant digital signal to the cd - da encoder 120 a . the cd - da encoder 120 a subjects the output signal of the cd - rom encoder 121 to the circ encoding process . the cd - da encoder 120 a outputs the encoding - resultant digital signal to the recording encoder 110 as recorded data ( data to be recorded ) of the cd - rom - audio format . the recording encoder 110 subjects the recorded data of the cd - rom - audio format to the efm modulation . the recording encoder 110 outputs the modulation - resultant signal to the laser drive section 109 . the optical head 103 applies the laser light beam to the optical disc 101 . the laser drive section 109 controls the power or the intensity of the laser light beam in response to the output signal of the recording encoder 110 so that information corresponding to the recorded data of the cd - rom - audio format is recorded on the optical disc 101 . furthermore , toc information related to the recorded data is generated , and the toc information is recorded on the inner area of the optical disc 101 . the cpu 114 d controls the cd - da encoder 120 a so that an information piece representing the use of the second processing type will be added to the toc information . a sill further consideration will be given of the case where the user designates the recording mode of operation of the apparatus of fig2 and also designates the format and the processing type . when the designated format agrees with the cd - rom - audio format and the designated processing type agrees with the third processing type , the cpu 114 d controls the switch 127 b so that the movable contact of the switch 127 b connects with the fixed contact “ h 3 ” thereof . therefore , the output signal of the input circuit 113 travels the compression encoder 125 c via the fixed contact “ h 3 ” of the switch 127 b . in this case , the huffman encoder 125 r in the compression encoder 125 c subjects the output signal of the input circuit 113 to a huffman encoding process . the huffman encoder 125 r in the compression encoder 125 c outputs the resultant signal to the cd - rom encoder 121 . the cd - rom encoder 121 subjects the output signal of the compression encoder 125 c to the cd - rom encoding process including the interleaving process . the cd - rom encoder 121 outputs the process - resultant digital signal to the cd - da encoder 120 a . the cd - da encoder 120 a subjects the output signal of the cd - rom encoder 121 to the circ encoding process . the cd - da encoder 120 a outputs the encoding - resultant digital signal to the recording encoder 110 as recorded data ( data to be recorded ) of the cd - rom - audio format . the recording encoder 110 subjects the recorded data of the cd - rom - audio format to the efm modulation . the recording encoder 110 outputs the modulation - resultant signal to the laser drive section 109 . the optical head 103 applies the laser light beam to the optical disc 101 . the laser drive section 109 controls the power or the intensity of the laser light beam in response to the output signal of the recording encoder 110 so that information corresponding to the recorded data of the cd - rom - audio format is recorded on the optical disc 101 . furthermore , toc information related to the recorded data is generated , and the toc information is recorded on the inner area of the optical disc 101 . the cpu 114 d controls the cd - da encoder 120 a so that an information piece representing the use of the third processing type will be added to the toc information . fig2 is a flowchart of a segment of a program in the cpu 114 d . the program segment in fig2 relates to the playback mode of operation of the apparatus of fig2 . as shown in fig2 , a first step s 201 of the program segment reads out toc information from the ram within the cpu 117 . a step s 207 following the step s 201 controls the cpu 117 so that information will be reproduced from the first track on the optical disc 101 . the step s 207 receives reproduced data from the cd - da decoder 120 b which represents the first - track information . a step s 208 subsequent to the step s 207 decides whether or not the first - track information has cd - rom - audio code words . when the first - track information has cd - rom - audio code words , the program advances from the step s 208 to a step s 250 . in this case , it is decided that the optical disc 101 agrees with a cd - rom - audio . when the first - track information does not have any cd - rom - audio code words , the program advances from the step s 208 to a step s 217 . the step s 250 decides which of the first , second , and third processing types is used by referring to the toc information . when the first processing type is used , the program advances from the step s 250 to a step s 251 a . when the second processing type is used , the program advances from the step s 250 to a step s 251 b . when the third processing type is used , the program advances from the step s 250 to a step s 251 c . the step s 251 a controls the switch 128 b so that the movable contact of the switch 128 b will connect with the fixed contact “ c 1 ”. the step s 251 b controls the switch 128 b so that the movable contact of the switch 128 b will connect with the fixed contact “ c 2 ”. the step s 251 c controls the switch 128 b so that the movable contact of the switch 128 b will connect with the fixed contact “ c 3 ”. a step s 252 following the steps s 251 a , s 251 b , and s 251 c controls the cpu 117 so that information will be reproduced from second and later tracks on the optical disc 101 . in this case , the cd - da decoder 120 b outputs reproduced data to the cd - rom decoder 122 . the cd - rom decoder 122 subjects the reproduced data to the cd - rom decoding process including the de - interleaving process . the cd - rom decoder 122 outputs the process - resultant data to the expansion decoder 126 c . the orthogonal transform decoder 126 p in the expansion decoder 126 c subjects the output signal of the cd - rom decoder 122 to a data - expansion decoding process using inverse orthogonal transform . the orthogonal transform decoder 126 p in the expansion decoder 126 c outputs the resultant signal to the fixed contact “ c 1 ” of the switch 128 b and also the huffman decoder 126 q in the expansion decoder 126 c . the huffman decoder 126 q in the expansion decoder 126 c subjects the output signal of the orthogonal transform decoder 126 p to a huffman decoding process . the huffman decoder 126 q in the expansion decoder 126 c outputs the resultant signal to the fixed contact “ c 2 ” of the switch 128 b . the huffman decoder 126 r in the expansion decoder 126 c subjects the output signal of the cd - rom decoder 122 to a huffman decoding process . the huffman decoder 126 r in the expansion decoder 126 c outputs the resultant signal to the fixed contact “ c 3 ” of the switch 128 b . when the movable contact of the switch 128 b connects with the fixed contact “ c 1 ” thereof , the output signal of the orthogonal transform decoder 126 p in the expansion decoder 126 c travels to the output circuit 112 . when the movable contact of the switch 128 b connects with the fixed contact “ c 2 ” thereof , the output signal of the huffman decoder 126 q in the expansion decoder 126 c travels to the output circuit 112 . when the movable contact of the switch 128 b connects with the fixed contact “ c 3 ” thereof , the output signal of the huffman decoder 126 r in the expansion decoder 126 c travels to the output circuit 112 . after the step s 252 , the current execution cycle of the program segment ends . the step s 217 decides whether or not the first - track information has cd - rom code words . when the first - track information has cd - rom code words , the program advances from the step s 217 to a step s 224 . in this case , it is decided that the optical disc 101 agrees with a cd - rom . when the first - track information does not have any cd - rom code words , the program advances from the step s 217 to the step s 226 . the step s 224 controls the switch 128 b so that the movable contact of the switch 128 b will connect with the fixed contact “ d ” thereof . in this case , the cd - rom decoder 122 is connected to the output circuit 112 while the expansion decoder 126 c is disconnected from the output circuit 112 . a step s 225 following the step s 224 controls the cpu 117 so that information will be reproduced from the first and later tracks on the optical disc 101 . in this case , the cd - da decoder 120 b outputs reproduced data to the cd - rom decoder 122 . the cd - rom decoder 122 subjects the reproduced data to the cd - rom decoding process including the de - interleaving process . the cd - rom decoder 122 outputs the process - resultant data to the output circuit 112 . after the step s 225 , the current execution cycle of the program segment ends . the step s 226 controls the cpu 117 so that the cpu 117 will output a given display signal to the display unit 116 . the given display signal is indicated by the display unit 116 . the given display signal represents that information can not be normally reproduced from the optical disc 101 . in other words , the given display signal represents a failure of the reproduction of information from the optical disc 101 . after the step 3226 , the current execution cycle of the program segment ends . it should be noted that the cd - rom encoder 121 and the cd - rom decoder 122 may be replaced by a dvd encoder ( a dvd packing encoder ) and a dvd decoder ( a dvd unpacking decoder ), respectively . in this case , the step s 217 in fig2 is modified to refer to mpeg code words rather than cd - rom code words . fig2 shows a twelfth embodiment of this invention which is similar to the embodiment of fig2 except for the following design changes . the embodiment of fig2 includes a cpu 114 e instead of the cpu 114 d in fig2 . the embodiment of fig2 includes a switch 128 d instead of the switch 128 b in fig2 . the embodiment of fig2 includes an mpeg decoder 129 . the embodiment of fig2 is able to handle an optical disc 101 which can be selected from among various discs such as a cd - rom - audio and a video - cd . the switch 128 d has a movable contact and fixed contacts “ c 1 ”, “ c 2 ”, “ c 3 ”, “ d ”, and “ i ”. the switch 128 d has a control terminal . the switch 128 d is changeable among six different states in response to a signal fed to the control terminal . when the switch if 128 d assumes a first state , the movable contact thereof connects with only the fixed contact “ c 1 ” thereof . when the switch 128 d assumes a second state , the movable contact thereof connects with only the fixed contact “ c 2 ” thereof . when the switch 128 d assumes a third state , the movable contact thereof connects with only the fixed contact “ c 3 ” thereof . when the switch 128 d assumes a fourth state , the movable contact thereof connects with only the fixed contact “ d ” thereof . when the switch 128 d assumes a fifth state , the movable contact thereof connects with only the fixed contact “ i ” thereof . when the switch 128 b assumes a sixth state , the movable contact thereof connects with none of the fixed contacts “ c 1 ”, “ c 2 ”, “ c 3 ”, “ d ”, and “ i ” thereof . the control terminal of the switch 128 d is connected to the cpu 114 e . the fixed contact “ c 1 ” of the switch 128 d leads from the first output side of the expansion decoder 126 c . the fixed contact “ c 2 ” of the switch 128 d leads from the second output side of the expansion decoder 126 c . the fixed contact “ c 3 ” of the switch 128 d leads from the third output side of the expansion decoder 126 c . the fixed contact “ d ” of the switch 128 d leads from the output side of the cd - rom decoder 122 . the fixed contact “ i ” of the switch 128 d leads from the output side of the mpeg decoder 129 . the movable contact of the switch 128 d leads to the input side of the output circuit 112 . the input side of the mpeg decoder 129 is connected to the output side of the cd - rom decoder 122 . the output side of the mpeg decoder 129 is connected to the cpu 114 e . fig2 is a flowchart of a segment of a program in the cpu 114 e . the program segment in fig2 is similar to the program segment in fig2 except for the following design changes . with reference to fig2 , a step s 217 a which replaces the step s 217 in fig2 decides whether or not the first - track information has video - cd code words . when the first - track information has video - cd code words , the program advances from the step s 217 a to a step s 220 a . in this case , it is decided that the optical disc 101 agrees with a video - cd . when the first - track information does not have any video - cd code words , the program advances from the step s 217 a to the step s 226 . the step s 220 a controls the cpu 117 so that information will be read out from a second track on the optical disc 101 . in this case , the cd - da decoder 120 b outputs reproduced data to the cd - rom decoder 122 which corresponds to the second - track information . the cd - rom decoder 122 subjects the reproduced data to the cd - rom decoding process including the de - interleaving process . the cd - rom decoder 122 outputs the process - resultant data to the mpeg decoder 129 . the mpeg decoder 129 subjects the output signal of the cd - rom decoder 122 to an mpeg decoding process . the mpeg decoder 129 outputs the decoding - resultant data to the cpu 114 e which corresponds to the second - track information . the step s 220 a receives the decoding - resultant data from the mpeg decoder 129 which corresponds to the second - track information . a step s 222 a subsequent to the step s 220 a decides whether or not the decoding - resultant data corresponding to the second - track information is normal . when the decoding - resultant data is normal , the program advances from the step s 222 a to a step s 224 a . otherwise , the program advances from the step s 222 a to the step s 226 . the step s 224 a controls the switch 128 d so that the movable contact of the switch 128 d will connect with the fixed contact “ i ” thereof . in this case , the mpeg decoder 129 is connected to the output circuit 112 . a step s 225 a following the step s 224 a controls the cpu 117 so that information will be reproduced from second and later tracks on the optical disc 101 . in this case , the cd - da decoder 120 b outputs reproduced data to the cd - rom decoder 122 . the cd - rom decoder 122 subjects the reproduced data to the cd - rom decoding process including the de - interleaving process . the cd - rom decoder 122 outputs the process - resultant data to the mpeg decoder 129 . the mpeg decoder 129 subjects the output signal of the cd - rom decoder 122 to the mpeg decoding process . the mpeg decoder 129 outputs the decoding - resultant data to the output circuit 112 . after the step s 225 a , the current execution cycle of the program segment ends . it should be noted that the cd - rom encoder 121 and the cd - rom decoder 122 may be replaced by a dvd encoder ( a dvd packing encoder ) and a dvd decoder ( a dvd unpacking decoder ), respectively . in this case , the step s 217 a in fig2 is modified to refer to mpeg code words rather than video - cd code words . | 7 |
a standard reticle structure characteristic of the prior art is shown in perspective view in fig1 . the insulating substrate 101 is coated on one of its major surfaces with a conductive light - absorbing film 102 into which is etched a pattern , herein referred to as the image area 103 . the image area 103 is surrounded by a clear space 104 , herein referred to as the gully , which separates the image area 103 from the continuous border , herein referred to as the guard ring 105 . film 102 preferably is made by a deposition process , which is known in the art . all the features 103 , 104 , and 105 are made by etching the film 102 during manufacture of the reticle . sometimes , the conductive light - absorbing film is coated with an anti - reflection layer to improve optical performance in the lithography tool . this does not affect the interaction of the reticle with electric fields . an embodiment of the invention is shown in plan view in fig2 . one or more electric field sensing features 201 are placed in gully 104 between the image area 103 and the guard ring 105 . these features preferably are defined on the surface of the reticle when the mask pattern is written and are created when the film 102 is etched to form features 103 , 104 , and 105 . since an electric field that penetrates the reticle may come from any direction , preferably , multiple sensor structures are positioned around the periphery of the image area 103 . preferably , the number of structures so placed is sufficient to adequately sense all incident electric field directions relative to the reticle , but is kept to a minimum so that induced current passing through and between the sensing features 201 is not averaged over a large number of the sites , which would reduce the magnitude of the effect on each individual feature . that is , the effect of an electric field is maximized on as few as possible of the sensing features 201 , thereby maximizing the visibility of changes to the features with the lowest possible strength of electric field interacting with the reticle . the operation of the sensing features is explained in reference to fig3 a and 3b . fig3 a represents a cross - section through the reticle at the place indicated by the dotted line 3 a - 3 a in fig2 . dashed line 301 represents the potential gradient or the electric field that would be present across the gully 104 when the reticle is placed into an environment containing an electric field . the direction of the field is arbitrary . with no features in the gully 104 , the potential gradient and the electric field across the gully is represented by the gradient of the graph 301 in the lower section of the figure . features 103 and 105 are at different induced potentials due to the presence of the external electric field . when the sensing feature 201 is placed into the gully in such a situation , as shown in fig3 b , it will adopt a potential which is intermediate between the potentials of 103 and 105 . thus , the potential gradient or electric field strength 304 at the gully region 104 , which is already the most sensitive area of the reticle , is amplified by the presence of the sensing features . if the field strength and induced potential differences within the image area 103 are below the level where significant changes are caused to the reticle image features , this amplification of the same electric field by the sensing features in the gully may render them liable to change . hence , they may indicate the existence of a hazard in the reticle handling environment before significant damage is caused to the reticle image area 103 . the sensing feature 201 in fig2 and 3 contains at least one conductive body 201 which partially spans the gully 104 between the image area 103 and the guard ring 105 . however , other variants of the sensing feature are possible . such an alternative preferred embodiment is shown in fig4 . in this embodiment , the sensing feature 400 comprises four parts , 401 , 402 , 403 , and 404 , spatially oriented so that they will respond differently to environmental electric fields passing at different angles across the gully 104 . the central intersection 401 of these four structures forms a convenient target for use in an automated inspection microscope . such an image can be automatically inspected and compared against the previous inspection image stored in a database . any variation in the appearance of this feature will indicate that the reticle has been exposed to an electric field , and the image area 103 should be inspected carefully for possible damage . a flow chart illustrating an example of the method 500 that would apply to this form of inspection regime is given in fig5 . at 502 , the reticle is inspected to establish its condition , and particularly the condition of the sensing features , before use . a determination of whether the sensing features are damaged is made at 504 and , if there is no damage , the result is recorded in a reticle log and the reticle is used for a prescribed period and the process returns to 504 where it is redetermined if the features are damaged . if damage is found in the sensing features at any point , the process proceeds to 510 . the inspection images are recorded and at 516 an investigation is initiated to identify and correct the source of risk the pattern area is also inspected for damage at 510 . if damage to the image features is detected at 520 , the reticle is directed to 530 for repair or scrap . if the image features are not damaged , the inspection result is recorded in the reticle log at 522 , the reticle is then used for a prescribed period , and then reinspected . the prescribed period of use may be set for a shorter period when , for example , there have been recent changes to a manufacturing process , and then for a longer period once the problem areas have been worked out in a manufacturing process . if a change in the image features is found at 526 , the program returns to 510 and the cycle is repeated . if there is no change in the sensing features , the program returns to 522 where it is again used and reinspected . in this way , a rapid assessment may be conducted of the condition of a reticle with regard to any electrostatic hazard it may have experienced since its last inspection . minimal data processing is required , with reduction of the need to regularly inspect the entire image area of the reticle . hence , the process will occupy a minimum amount of inspection tool time and operator workload . at the same time , it is more sensitive to damage , since damage to the sensing areas is easier to detect . since the same sensing features may be printed on all reticles , the process can be automated and the above processes can be incorporated into software instructions in a computer program on a computer readable medium . there has been described apparatus and methods for quickly and effectively determining if a reticle has suffered esd or efm damage . it should be understood that the particular embodiments shown in the drawings and described within this specification are for purposes of example and should not be construed to limit the invention which will be described in the claims below . further , it is evident that those skilled in the art may now make numerous uses and modifications of the specific embodiment described , without departing from the inventive concepts . for example , it is also evident that the steps recited may , in some instances , be performed in a different order ; or equivalent structures and processes may be substituted for the various structures and processes described ; or a variety of different precursors may be used . consequently , the invention is to be construed as embracing each and every novel feature and novel combination of features present in and / or possessed by the reticle protection and damage determination processes , the devices to perform such functions , and electronic device manufacturing methods described . | 6 |
as a preliminary matter , it will readily be understood by one having ordinary skill in the relevant art (“ ordinary artisan ”) that the present invention has broad utility and application . furthermore , any embodiment discussed and identified as being “ preferred ” is considered to be part of a best mode contemplated for carrying out the present invention . other embodiments also may be discussed for additional illustrative purposes in providing a full and enabling disclosure of the full scope of the present invention that is contemplated . moreover , many embodiments , such as adaptations , variations , modifications , and equivalent arrangements , will be implicitly disclosed by the embodiments described herein and fall within the scope of the present invention . accordingly , while the present invention is described herein in detail in relation to one or more embodiments , it is to be understood that this disclosure is illustrative and exemplary of the present invention , and is made merely for the purposes of providing a full and enabling disclosure of the present invention . the detailed disclosure herein of one or more embodiments is not intended , nor is to be construed , to limit the scope of patent protection afforded the present invention , which scope is to be defined by the claims and the equivalents thereof . it is not intended that the scope of patent protection afforded the present invention be defined by reading into any claim a limitation found herein that does not explicitly appear in the claim itself . thus , for example , any sequence ( s ) and / or temporal order of steps of various processes or methods that are described herein are illustrative and not restrictive . accordingly , it should be understood that , although steps of various processes or methods may be shown and described as being in a sequence or temporal order , the steps of any such processes or methods are not limited to being carried out in any particular sequence or order , absent an indication otherwise . indeed , the steps in such processes or methods generally may be carried out in various different sequences and orders while still falling within the scope of the present invention . accordingly , it is intended that the scope of patent protection afforded the present invention is to be defined by the appended claims rather than the description set forth herein . additionally , it is important to note that each term used herein refers to that which the ordinary artisan would understand such term to mean based on the contextual use of such term herein . to the extent that the meaning of a term used herein - as understood by the ordinary artisan based on the contextual use of such term - differs in any way from any particular dictionary definition of such term , it is intended that the meaning of the term as understood by the ordinary artisan should prevail . furthermore , it is important to note that , as used herein , “ a ” and “ an ” each generally denotes “ at least one ,” but does not exclude a plurality unless the contextual use dictates otherwise . thus , reference to “ a picnic basket having an apple ” describes “ a picnic basket having at least one apple ” as well as “ a picnic basket having apples .” in contrast , reference to “ a picnic basket having a single apple ” describes “ a picnic basket having only one apple .” when used herein to join a list of items , “ or ” denotes “ at least one of the items ,” but does not exclude a plurality of items of the list . thus , reference to “ a picnic basket having cheese or crackers ” describes “ a picnic basket having cheese without crackers ”, “ a picnic basket having crackers without cheese ”, and “ a picnic basket having both cheese and crackers .” finally , when used herein to join a list of items , “ and ” denotes “ all of the items of the list .” thus , reference to “ a picnic basket having cheese and crackers ” describes “ a picnic basket having cheese , wherein the picnic basket further has crackers ,” as well as describes “ a picnic basket having crackers , wherein the picnic basket further has cheese .” referring now to the drawings , embodiments of the present invention are next described . the following description of the embodiments is merely exemplary in nature and is in no way intended to limit the invention , its implementations , or uses . turning now to the drawings , fig1 illustrates a perspective view of an automatic paper towel dispenser apparatus 10 in accordance with one embodiment of the present invention . the apparatus 10 dispenses common , readily available , perforated paper towels . furthermore , the apparatus has a learning capability , giving it the ability to detect and dispense towels of varying lengths , including full sheets , half sheets , multiple sheets , and abnormally sized sheets . therefore , a wide variety of perforated towels can be used with the apparatus , including any brand or length available at retail . fig2 is an isometric view of the apparatus 10 and fig3 is a perspective view of the apparatus 10 . fig2 shows the top drive mechanism 12 of the towel dispenser apparatus 10 . fig3 shows the apparatus with the front cover 14 removed , displaying the battery holder 16 and control circuitry 18 . preferably , the apparatus 10 may be powered by either batteries 20 ( as shown in fig3 ) or an ac / dc adapter 22 ( such as the one illustrated in fig1 ). the apparatus 10 is intended to be mounted under kitchen cabinetry , or on the underside of any sufficiently sized shelf . four screws 24 interface with thread inserts in the main structure of the dispenser 10 . installation involves drilling four holes , positioned with a supplied template . some features have been included to allow a level of installation customization . kitchen cabinets are constructed in a number of ways . if a recess exists under a cabinet , the dispenser can be mounted with the supplied spacers 13 . these spacers slide onto the screws . they can be stacked and combined to achieve three height offsets for the dispenser . furthermore , if spacers are used , a gap between the dispenser and underside of the cabinet may be visible from some angles . to address this aesthetic issue , trim tabs 50 have been designed into the exterior side covers of the apparatus 10 . these trim tabs 50 are simply molded with the side covers , and can be folded over or snapped off at scores 52 ( or otherwise bent ) as desired in order to accommodate spacing between the top panel of the apparatus and the bottom of the underside of the cabinet . as an alternative to the spacers , it is contemplated that a bracket may be used for mounting the dispenser . use of the device begins by deciding on the source of power . four d batteries 20 can be used to supply the necessary 6v input , or a 6v , 3 . 5a ac / dc adapter 22 can be connected via a standard 5 mm input jack , as illustrated in fig1 . if the ac / dc adapter 22 is selected , power from the batteries 20 is interrupted , protecting the circuitry 18 from over voltage damage . specifically , plugging in the connector of the adapter into the housing of the dispenser apparatus 100 breaks the battery circuit , thereby preventing parallel connection of the batteries and ac / dc supply . an off the shelf dc jack with a ground interrupt loop , kobiconn 163 - mj21 - ex , provides this switching protection . fig7 - 9 are photographs showing steps in a sequence of installing toweling into an automatic paper towel dispenser apparatus 100 in accordance with an embodiment of the invention . fig1 a and 14b collectively illustrate a block diagram describing operational logic that is implemented in the automatic paper towel dispenser apparatus 100 ; and fig1 a is an electronic schematic diagram for control circuitry that may be utilized in automatic paper towel dispenser apparatus in accordance with at least one embodiment of the invention . fig1 b is an alternative electronic schematic diagram for control circuitry that may be utilized in automatic paper towel dispenser apparatus in accordance with at least one other embodiment of the invention , wherein , inter alia , a single position sensor is utilized . a latch mechanism is released to open apparatus 100 . this latch is operated by a sliding pull handle located on the underside of the front section of the dispenser . fig7 shows the apparatus 100 in the open position and ready to accept a roll of paper towels . the lower driver roller moves with the towel carrier . this feature greatly simplifies installation of the toweling . in conventional dispensers , tensioning devices and a convoluted feeding route need to be understood by the operator . in apparatus 100 , the operator simply installs a roll of towels with the first towel draped over the lower drive roller and closes the device . there is no requirement for the toweling to be threaded through any path defined by rollers and tensioning devices . included in the rotating towel carrier subassembly is a magnet that interfaces with a hall — effect transducer resident on the main circuit board . output from the hall - effect transducer notifies the micro controller of the position of the towel carrier door . each time the door is opened , the device is reset . upon closing the door , the microcontroller initiates a “ length learn ” program sequence . with particular regard to the “ length learn ” program sequence , the apparatus 100 first retracts the toweling until output from the “ s 1 ” positioning reflective ir sensor indicates that no paper is present , i . e ., that a leading edge of the toweling has been sensed . this reflective sensor is located at the front and top of the dispensing slot . it is mounted to the main circuit board , and protrudes through an opening that keeps it flush with the dispensing slot top surface . in at least some preferred implementations , a surface opposite the reflective sensor includes one or more holes or openings to prevent reflections off of dispenser components from being an issue . position of the towel &# 39 ; s edge has now been determined . preferably , a known length , such as twelve inches of paper towel , is then dispensed although a greater length may be dispensed , especially if the user desired dispensing of more than one towel at a time . the length of toweling that is dispensed is determined by driving the motor in the forward direction a predetermined number of encoder counts , or “ drive length units ”. length corresponds to counts . counts correspond to both edges of openings in a slotted wheel axially mounted to the top roller shaft . output from a slot type ir sensor , tt optek opb89it51z , is used by the microcontroller to count . in a preferred implementation , there are 32 counts per revolution with a 16 slot wheel . a pause in the program , referred to as the “ tear time interval ”, allows an operator to interact with the dispenser . towel length for all subsequent dispensing is determined by tearing off a length of towel at any desired perforated position . “ tear time interval ” concludes and the dispenser again retracts until the reflective ir sensor detects the leading edge of the toweling . while reversing , the microcontroller again uses the encoder to count openings in the slotted wheel , sometimes referred to as an encoder pinwheel . “ retract length units ”, reverse counts , are used to determine “ learned towel length ”, whereupon the “ length learn ” program sequence is completed . the learned towel length or l tl is determined by subtracting the retract length units or rlu from the drive length units or dlu . it further will be appreciated that technology other than an encoder pinwheel may be used as an alternative for measuring the extent to which the toweling is extended or retracted by the motor . for example , the technology conventionally found in an optical mouse may be utilized , which includes a tiny camera that takes thousands of pictures per second to determine position and speed . conventionally , the optical mouse uses a very small light emitting diode more commonly referred to as an led which is red in color . this led bounces light off of a mouse pad or desk surface onto a cmos ( complementary metal oxide semiconductor ). in the context of the present invention , this same technology may be used to determine the extent of the toweling that is extended or retracted . in operation , the led produces a red light that is emitted onto the toweling surface . the light is reflected off the surface back to the cmos sensor . the cmos sensor sends each image that is reflected back to a dsp ( digital signal processor ) for analysis . using the thousands of images ( taken at hundreds of times per second ) that the cmos sends to the dsp for analysis , the dsp is able to detect both patterns and images and can determine if the toweling has moved , at what distance it has moved , and at what speed . yet another alternative technology includes that found in laser - based optical mice , which technology piggy backs off of the led optical mouse . the laser based optical mouse works similar to the led based optical mouse . it uses a laser instead of a led . the benefit is that because it uses a laser beam , the mouse can track much better , giving the user ultimately better response times , tracking and the ability for such a mouse to be used on even more surfaces . in the context of the present invention , it is believed that use of such laser technology would provide greater precision and accuracy in determining the extent of the toweling that is extended or retracted . furthermore , the housing in the area of the detection of the toweling surface preferably is dark and contrasts well with the toweling so as to better define the leading edge of the toweling for detection , whether the ir , optical or laser technology is used . after the ltl is learned , the operator engages the “ hand wave ” sensor to dispense a towel . the reflective ir sensor shown in the drawings is interfaced with through a lens located in the center of the front fascia panel . the sensor emitter and detector are mounted directly to the main circuit board . therefore , they do not move with the removable fascia panel . as a result , their placement , and proper installation of the fascia panel , is important to check for correct operation . after the “ length learn ” sequence is completed , the dispenser &# 39 ; s micro controller enters a program that constantly looks at the “ hand wave ” sensor for output . some level of ambient ir light is always present . also , people and objects may continually pass in front of the device with no intention of initiating towel dispensing . preferably , “ hand wave ” sensor output voltage is sampled and compared to avoid false initiation . the sample rate may be every 10 milliseconds , for example . when an operator or user intends to dispense a towel , “ hand wave ” sensor voltage is substantially higher than ambient for a determined number of samples . at this point the motor is driven forward the “ learned towel length ”. to accommodate possible additional towels being desired by the user , the program delays for one tenth of the “ tear time interval ”, then reviews the “ hand wave ” sensor output . if a hand is still present , the toweling is extended an additional l tl . this additional dispensing sub - sequence will continue until a hand is no longer detected by the “ hand wave ” sensor . when a hand is no longer detected by the “ hand wave ” sensor , the “ tear time interval ” is initiated , during which the operator is expected to tear off the desired paper towels from the dispensed toweling . after the “ tear time interval ”, the motor is driven in reverse until the positioning sensor “ s 1 ” again detects the leading edge ( i . e ., presumed new leading edge ) of the toweling . alternatively , the motor is driven forward the number of desired ltls ( e . g ., 1 ltl , 2 l tls , or 3l tls ), plus a predetermined additional extent . the predetermined extent may be , for example , a distance between the point at which the leading edge of the toweling is detected by the sensor , and a point exterior of the housing and proximate to area at which the toweling exits the housing . in accordance with this alternative , a line of perforations should be found each time a towel is dispensed at a point exterior of the housing and proximate the area at which the toweling exits the housing . as such , a small extent of the toweling following separation of the dispensed towels will be left extending outside of the housing and will be retracted back into the housing to the point at which the leading edge of the toweling is detected by the sensor . in accordance with this alternative , an operator will be able to clearly observe the particular line of perforations along which the tear is made . normal dispensing by the apparatus continues until all the towels on the roll have been dispensed , or until a dispensing error occurs . all errors result in the bi - color indicator led lighting red . an operator must open the device to reset the error condition . after any error , the “ length learn ” program will run again and the operator must teach the dispenser the desired dispense length . reliable paper feeding , without a specific paper to optimize the system around , is not trivial . variations in thickness , friction coefficient , strength , surface area , and cross section must all be accommodated . moreover , paper is removed by pulling with sufficient force to break the roll at a perforation , and this force also must be accommodated . several features have been designed to prevent malfunction , improve paper feed ability , and reliable operation . in particular , at least three main reliability features are provided in the apparatus 100 that are intended to prevent malfunction , improve paper feed ability , and reliable operation . furthermore , it should be understood that , while embodiments of the invention may include only one or two - or none - of these features , other embodiments of the invention may include all three of these features . the first reliability feature of the mechanism allows the upper drive roller to travel vertically . two springs hold the roller in its lowest position . when the towel carrier is closed , the lower drive roller dictates the upper drive roller &# 39 ; s position . this addresses different towel thicknesses that will tend to push the upper roller to slightly different positions . with the spring loaded drive roller , thickness variations throughout the roll are constantly accounted for . this also addresses inherent manufacturing dimensional variation , within tolerances , that otherwise affects feed reliability , especially when injected molding with plastics . the second reliability feature prevents unwanted movement of one or both rollers . both rollers in this dispenser are driven . they are directly linked together ( or directly interconnected ) by a pair of axially mounted end gears . these gears have fairly large and forgiving tooth geometry . this is important , because of the unique ability to separate the rollers during paper installation . opening the rollers enough for the entire roll to pass between them separates the gears completely . they must re - mesh , without damage or perceived difficulty , when the dispenser is closed . the third reliability feature is software based . during the “ tear time interval ” the motor has a percentage of the stall current applied in reverse . this applies force to the drive mechanism , preventing its movement , and allowing a very positive feel as the towel &# 39 ; s perforation is broken by the user pulling on the toweling portion extending from the housing . indeed , even slow and consistent pull on the extended toweling does not further extend toweling from the dispenser due , at least in part , to the application of reverse current . yet another automatic paper towel dispenser apparatus 200 in accordance with an embodiment of the invention is illustrated in fig1 a through 23b . operation and structure of apparatus 200 is similar to those disclosed above . of additional note , fig2 a and fig2 b illustrate the open area within the housing , over the space for receiving a roll of paper towels , into which area toweling that is retracted into the housing may be directed . moreover , if too much toweling is retracted into this area , the excess toweling likely falls out of the back of the apparatus , thereby avoiding possible jamming of the apparatus 200 . to this end , the back of the housing preferably is open when the door is closed , as shown in fig2 a and fig2 b . additional description of structure and functionality in accordance with one or more embodiments will now be provided , first with reference to the exemplary flowchart of fig2 , and then with reference to fig2 - 34 . in one or more embodiments , an automatic paper towel dispenser apparatus is configured to , after learning how long a paper towel of a paper towel roll is , dispense one or more paper towels via a dispensing opening . such dispenser apparatus includes a hand wave sensor configured to sense the wave of a user &# 39 ; s hand . the dispenser apparatus is configured such that , when a firsthand wave is detected at step 1002 , toweling begins to be advanced at step 1004 by providing current to a motor assembly configured to drive the dispensing of toweling . as the toweling is advanced , a leading edge of the toweling , i . e . a leading edge of the first paper towel , is detected at step 1006 by a reflective sensor the toweling travels past prior to passing through the dispensing opening . this reflective sensor preferably operates by determining whether emitted light is reflected by toweling , e . g . white toweling . following detection of this leading edge , an extent determined based on a learned length of toweling is advanced at step 1008 . the advancing of exactly this extent is preferably provided via use of a slot sensor . the slot sensor comprises an emitter , a detector disposed opposite the emitter , and a rotatable disc disposed therebetween . the rotatable disc includes a plurality of slots disposed therein . as toweling is advanced , the rotatable disc rotates , and , as the slots and non - slot sections pass between the emitter and receptor , light emitted by the emitter is intermittently received by the receptor . the slot sensor is configured to determine , based on the intermittent reception of light by the receptor , the amount of rotation of the rotatable disc , and thus the amount of toweling advanced . once , following detection of the leading edge , the desired extent of toweling based on a learned length of toweling has been advanced , current is drawn from the motor assembly to halt dispensing at step 1010 . in at least some embodiments , upon halting of dispensing , a perforated line separating the first paper towel from a next paper towel is disposed at , on , under , and / or proximate to the reflective sensor . in at least some other embodiments , an additional offset is added to or subtracted from a learned towel length such that such perforated line is disposed upstream of , or downstream of , the reflective sensor . preferably , the dispenser apparatus is further configured such that , following halting of dispensing , a first time period begins at step 1012 . this time period is preferably measured by a timer , and preferably lasts around one second . at any time prior to the end of this time period , a subsequent hand wave will trigger advancement of an additional extent of toweling based on a learned length . preferably , such a subsequent hand wave will also result in the resetting or restarting of the first time period , thereby providing additional time for yet another hand wave , although , in at least some embodiments , this is not the case . in this way , a user is able to trigger dispensing of any number of paper towels that they wish , via , for example , that number of hand waves , or by continually leaving their hand in front of the hand wave sensor until a desired number of paper towels have been dispensed . in an embodiment , during this first time period , an indicator disposed proximate the hand wave sensor displays a first color , e . g . red . preferably , following expiration of this first time period , a second time period begins . this second time period is preferably also measured by a timer , and preferably lasts around four seconds . during this second time period , hand waving by the user does not trigger the dispensing of any additional paper towels . in an embodiment , during this second time period , an indicator disposed proximate the hand wave sensor displays a second color , e . g . orange . this second time period is intended to allow a user to tear off one or more dispensed paper towels . it will be appreciated that , when a user goes to tear off one or more dispensed paper towels , force applied by the user could cause the withdrawal of additional toweling from the dispenser apparatus , barring any mechanism for the prevention of such additional withdrawal . in an embodiment , the slot sensor is utilized in combination with the motor assembly to mitigate , or prevent , any such withdrawal , via the use of a “ fight sequence ”. preferably , the slot sensor is utilized to determine whether additional toweling has been withdrawn , via the detection of rotation of the rotatable disc of the slot sensor . in the event of such rotation , current , having an opposite polarity to that described hereinabove ( sometimes referred to herein as reverse polarity current ), is preferably provided to the motor assembly to return the slot sensor to its prior position ( e . g . the position it was in prior to rotation of the slot sensor caused by a user attempting to tear off one or more dispensed paper towels ). the second time period is represented by step 1016 . upon expiration of the second time period , the reflective sensor disposed proximate the dispensing opening determines whether or not toweling is sensed at step 1018 . if the reflective sensor senses toweling , then the toweling is retracted by providing reverse polarity current to the motor assembly at step 1020 . the toweling is preferably retracted until the reflective sensor no longer senses toweling . following this , the dispenser apparatus is ready to once again detect a user &# 39 ; s initial hand wave at step 1002 . fig2 - 34 illustrate an exemplary dispensing sequence for a paper towel dispenser apparatus in accordance with one or more embodiments of the invention . fig2 illustrates a paper towel dispenser apparatus . to dispense toweling , a user triggers a hand wave sensor of the dispenser apparatus using their hand , as illustrated in fig2 . upon detecting the user &# 39 ; s hand via the hand wave sensor , the dispenser apparatus dispenses a learned towel length . after dispensing the learned towel length , the dispenser apparatus determines whether the user &# 39 ; s hand is still present , or if the user has waved his hand again . if so , the dispenser apparatus dispenses an additional learned towel length . in this way , a user can effect dispensing of multiple learned towel lengths by leaving his hand in front of the hand wave sensor , as illustrated in fig2 - 29 . once the user ceases triggering the hand wave sensor via their hand , then the dispenser apparatus will cease dispensing additional learned towel lengths . upon this occurring , the dispenser apparatus will begin waiting a tear time interval , thereby allowing the user to tear off one or more sheets of dispensed toweling . fig3 illustrates a user tearing off a single sheet of dispensed toweling after dispensing a plurality of sheets of toweling . upon expiration of the tear time interval , the sheets that were dispensed , but not tom off by the user , are retracted back into the dispenser apparatus , as illustrated in fig3 - 34 . based on the foregoing description , it will be readily understood by those persons skilled in the art that the present invention is susceptible of broad utility and application . many embodiments and adaptations of the present invention other than those specifically described herein , as well as many variations , modifications , and equivalent arrangements , will be apparent from or reasonably suggested herein , without departing from the substance or scope of the present invention . accordingly , while the present invention has been described herein in detail in relation to one or more preferred embodiments , it is to be understood that this disclosure is only illustrative and exemplary of the present invention and is made merely for the purpose of providing a full and enabling disclosure of the invention . the foregoing disclosure is not intended to be construed to limit the present invention or otherwise exclude any such other embodiments , adaptations , variations , modifications or equivalent arrangements , the present invention being limited only by the claims appended hereto and the equivalents thereof . | 0 |
the ability to see both symbolic and numeric results enhances the user experience in many educational scenarios , and enables the user to perform work more quickly with fewer errors . even when users need only the symbolic results for their work , seeing the numeric results gives users a rough idea of the magnitude of the result . this information can be especially helpful when the result is quite large or quite small and scientific notation is used in numeric display . as illustrated in fig2 , a student 202 enters a mathematical expression 204 , “ 3 50 − 1 ” into a calculator 206 . various embodiments of the present invention display contemporaneously a symbolic result 208 “ 717897987691852588770248 ,” and a numeric result 210 “ 7 . 17898 · 10 23 .” the contemporaneous display of symbolic result 208 and numeric result 210 provides the student 202 with a deeper mathematical insight than displaying only the symbolic result 208 or only the numeric result 210 . additionally , there is educational value in the display of the numeric result 210 contemporaneously with the symbolic result 208 to give the student 202 a sense of the magnitude of the symbolic result 208 . fig3 a illustrates an exemplary user interface contemporaneously displaying the symbolic result 208 and a numeric result 210 . the input 204 , the symbolic result 208 , and the numeric result 210 are shown in a user interface screen 302 . the user interface screen 302 presents three lines of information . the first line is designated as input and the value of the input is the mathematical expression 204 “ 3 50 − 1 ”. the second line is designated as symbolic and adjacent to this designation is the symbolic result 208 “ 717897987691852588770248 ”. the third line includes the designation numeric and the associated numeric result is “ 7 . 17898 · 10 23 .” a glance at the symbolic result informs the user that the number is 24 digits long . note that the symbolic result provides the exact number , whereas the numeric result provides an approximation . fig3 b illustrates another exemplary user interface . a user interface screen 304 has three lines of information . the first line is designated as input and contains a mathematical expression “√{ square root over ( 18 )}+√{ square root over ( 12 )}−√{ square root over ( 125 )}”. the mathematical expression is resolved on the second line designated as symbolic , which displays a symbolic result “− 5 ·√{ square root over ( 5 )}+ 2 √{ square root over ( 3 )}+ 3 ·√{ square root over ( 2 )}”. the numeric result equivalent to the symbolic result is shown on the third line designated as numeric with a value of “− 3 . 473598 .” even if the symbolic result is all that a user needs , the numeric result of the user interface screen 304 shows that the result is a negative number which could be valuable information to the user and save the user from doing an additional comparison . many pieces of conventional mathematical software that are capable of symbolic calculations show symbolic results by default and users have to issue special commands to get the numeric results . using various embodiments of the present invention , users no longer need to remember a command or perform extra steps to see numeric results when symbolic results become available . even in the case where the user desires to see only symbolic results , the presentation of the numeric results may aid in better mathematical understanding of the symbolic results . the contemporaneous display of both a symbolic result and the numeric result permits the symbolic result to be seen as an intermediary step to get the numeric result , which can confirm users &# 39 ; calculations . for example , fig3 c illustrates another user interface screen 306 , which includes a first line designated as input and the input mathematical expression “ log 1000 100000 .” the mathematical expression shown at the input line is resolved into a symbolic result shown on the second line designated as symbolic and the symbolic result is “ 5 / 3 ”. the third line designated as numeric displays a numeric result , which , in this case , is “ 1 . 666667 ,” and is an approximation of the symbolic result “ 5 / 3 ” shown on the second line . for instance , fig3 c illustrates the symbolic representation of the input at 5 / 3 . in this example , even if the numeric result “ 1 . 666667 ” is what the user needs , seeing the symbolic result 5 / 3 reassures the user that the input is correct according to the laws of logarithms . various embodiments of the present invention can show combinations of numeric results and symbolic results when a few of the symbolic results do not have sufficient information to resolve to numeric results . see fig3 d . a user interface screen 308 includes a first line designated as input which displays a mathematical expression “ sin ({ 0 , 45 , 90 , x })”. the mathematical expression indicates the application of the sine trigonometric function to each of the angles enclosed by the curly brackets and delimited by the commas . the second line designated as symbolic displays a symbolic result in the execution of the sine trigonometric function , with the values “ ( { 0 , 1 2 , 1 , sin ( x ) } ) ” . related numeric results are shown on the third line designated as numeric with the values “{ 0 , 0 . 707107 , 1 , sin ( x )}”. because the symbol x cannot yet be resolved , the application of the sine trigonometric function causes the symbolic result “ sin ( x )” to be displayed along with numeric results “ 0 ,” “ 0 . 707107 ,” and “ 1 ”. user interface screens 302 - 308 ( see fig3 a - 3d ) are presented using a format 310 illustrated as fig3 e in which the input mathematical expression is shown on a line above a symbolic result , which in turn is shown on a second line , and the numeric result , which is shown on the third line . fig3 f illustrates another format permutation 312 for displaying the input , symbolic result , and numeric result . the format permutation 312 displays the input superjacent to the symbolic result and the numeric result . the symbolic result is shown adjacent to the numeric result . fig3 g illustrates another format permutation 314 for displaying the input , symbolic result , and numeric result . the input mathematical expression is shown adjacent to the symbolic result , which in turn is shown adjacent to the numeric result . fig3 h illustrates as yet a further format permutation 316 for displaying the input , numeric result , and symbolic result . the symbolic result is shown subjacent to the input which is shown adjacent to the numeric result . permutations 310 - 316 as shown in fig3 e - 3h are a few of many suitable format permutations for contemporaneously presenting the symbolic result together with the numeric result , and are not meant to be limiting . other suitable format permutations are possible . fig4 a - 4d illustrate a method 400 for contemporaneously displaying symbolic and numeric calculations . from a start block , the method 400 proceeds to block 402 where the user , such as a student , enters a mathematical expression into a calculator . the calculator performs a calculation to resolve the mathematical expression into a symbolic result at block 404 . next , the method 400 proceeds to decision block 406 where a test is performed to determine whether the symbolic result contains a list or a matrix . if the answer to the test at decision block 406 is no , the method 400 proceeds to a continuation terminal (“ terminal a 1 ”). otherwise , the answer to the test at decision block 406 is yes , and the method 400 proceeds to another continuation terminal (“ terminal a4 ”). from terminal a 1 ( fig4 b ), the method 400 proceeds to decision block 408 where a test is performed to determine whether there are one or more unknown variables . if the answer to the test at decision block 408 is yes , the method selectively displays the symbolic result and not the numeric result . see block 410 . the method 400 then terminates execution . if the answer to the test at decision block 408 is no , the method performs numeric calculation based on the symbolic result . see block 412 . the method 400 then proceeds to another continuation terminal (“ terminal a3 ”). from terminal a 3 ( fig4 c ) the method 400 proceeds to decision block 414 where another test is performed to determine whether the numeric result is an error , infinity , or not a number (“ nan ”). if the answer to the test at decision block 414 is yes , the method 400 proceeds to another continuation terminal (“ terminal a2 ”), where it loops back to block 410 and the above - identified processing steps are repeated . otherwise , the answer to the test at decision block 414 is no , and the method proceeds to decision block 416 where another test is performed to determine whether the display of the numeric and symbolic results is identical . if the answer is yes to the test at decision block 416 , the method proceeds to terminal a 2 where it loops back to block 410 and the above - identified processing steps are repeated . otherwise , the answer to the test at decision block 416 is no , and the method presents both a symbolic result and numeric result . see block 418 . the method 400 then terminates execution . from terminal a 4 ( fig4 d ), the method 400 proceeds to block 420 , where the method determines whether to display numeric results for each element of the list or matrix by executing various steps previously discussed . a test is performed at decision block 422 to determine whether any numeric result in the list or matrix should be displayed . if the answer to the test at decision block 422 is yes , the method 400 presents both a symbolic result and a numeric result . see block 424 . next , at block 426 , for elements in the list or matrix that should only be displayed symbolically , the method 400 shows the symbolic results in the numeric display of the list or matrix . the method then terminates execution . if the answer to the test at decision block 422 is no , the method 400 proceeds to another continuation terminal (“ terminal a2 ”), where it loops back to block 410 and the above - identified processing steps are repeated . there are also many situations where both symbolic and numeric results are needed by the user , who must perform two steps to get them both in conventional mathematical software . for each user input ( assuming no error in the input ), various embodiments of the present invention echo the user input and display the symbolic result . when the numeric result is available and if it is appropriate to show it , various embodiments of the present invention also display the numeric result . when the target audience includes students , it is preferred that the user interfaces label the symbolic and numeric results as output and decimal output , respectively , to avoid confusion . while the preferred embodiment of the invention has been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention . | 6 |
as already set forth above , fig1 schematically illustrates a basic circuit diagram for the interconnection of the individual components of an exemplary embodiment of the invention . according to fig1 an electro - optical modulator m contains a monomode light waveguide modulator 1 and a pressure - sensitive signal generator 2 . light power l is supplied to the monomode light waveguide modulator over an input light waveguide 3 . modulated light power l &# 39 ; is withdrawn from the monomode light waveguide modulator 1 over an output light waveguide 4 . an electrical signal s which is emitted by the pressure - sensitive signal generator 2 as a result of the influence of a pressure p is supplied over an electrical output 21 , 22 of the pressure - sensitive signal generator 2 to an electrical input 11 , 12 of the monomode light waveguide modulator 1 . viewed electrically , the electro - optical modulator is a capacitor having a capacitance of approximately 50 pf with which the light transmission is controlled , i . e . modulated , by applying a voltage . the input of the electrooptical modulator is capacitively high - resistant and thus ideally suited for the connection of a pressure - sensitive signal generator having a high output impedance . the monomode light waveguide modulator can be advantageously executed as a directional coupler modulator , as a controllable y - branching or as a mach - zehnder modulator . such components are known per se , cf . for example , baues , p . &# 34 ; integrierte optische richtkoppler &# 34 ;, elektronik - anzeiger 9 ( 1977 ), no . 3 , pp . 19 - 22 ; somekh , s ., garmire , e ., yarif , a , garvin , h . l ., hunsperger , r . g . : &# 34 ; channel optical waveguide directional couplers &# 34 ;, appl . phys . lett . 22 ( 1973 ), pp . 46 - 47 ; papuchon , m ., combemale , y ., mathieu , x ., ostrowsky , d . b ., reiber , l ., roy , a . m ., sejourne , b ., werner , w . : &# 34 ; electrically switched optical directional coupler &# 34 ;, cobra . appl . phys . lett . 27 ( 1975 ), pp . 289 - 291 ; schmidt , r . v ., kogelnik , h . : &# 34 ; electro - optically switched coupler with stepped δβ - reversal using ti - diffused linbo 3 waveguides &# 34 ;, appl . phys . lett . 28 ( 1976 ) pp . 503 - 506 ; kogelnik , h ., schmidt , r . v : &# 34 ; switched directional couplers with alternating δβ &# 34 ;, trans . ieee qe - 12 ( 1976 ), pp . 396 - 401 ; sasaki , h ., de la rue , r . m . : &# 34 ; electro - optic y - junction modulator / switch &# 34 ;, electronics letters 12 ( 1976 ), pp . 459 - 460 ; keil , r ., aurchacher , f . ; &# 34 ; mach - zehnder waveguide modulators in ti - diffused linbo 3 &# 34 ;, sfeb 9 ( 1980 ), no . 1 , pp . 26 - 31 ; kaminow , j . p . : &# 34 ; optical waveguide modulators &# 34 ;, ieee mtt - 23 ( 1975 ), pp . 57 - 70 ; and taylor , h . f . : &# 34 ; optical switching and modulation in parallel dielectric waveguides &# 34 ;, i . appl . phys . 44 ( 1973 ), pp . 3257 - 3262 . the pressure - sensitive signal generator can be , for example , an electrical voltage modulator or an electrical current modulator . according to a further development of the invention , the signal generator 2 can be an acousto - electrical transducer . according to a further development of the invention , such an acousto - electrical transducer can be a transducer operating according to the piezo effect . a particularly advantageous application for an electro - optical modulator constructed in accordance with the present invention provides that the transducer operating according to the piezo effect is a piezo - microphone . the structure and manner of operation of a piezo - microphone are known per se cf ., for example , siemens - zeitschrift 46 ( 1972 ), no . 4 , pp . 207 - 209 , martin , e ., muller , e . : &# 34 ; fernsprechpiezomikrofon ts 71 &# 34 ;, cf . fig2 . such a component operating in accordance with the piezo effect can be constructed , as is known , of various materials such as , for example , specific types of ceramic , foils and the like . however , the principle of the present invention likewise allows the acousto - electrical transducer to be a transducer operating in accordance with the magneto - electrical transformation principle . moreover , according to another further development of the invention , it is provided that the acousto - electrical transducer is constructed as an elektret microphone . an advantageous , further use application for the present invention provides that the signal generator 2 is a pressure sensor for measuring dynamic or static pressure forces . it is provided according to a further advantageous development of the invention that a voltage transformer 1020 is provided in a manner known per se for matching the impedances of the light deflector 1 and the signal generator 2 . this voltage transformer 1020 can , for example , be constructed as a transformer operating according to the electromagnetic principle , cf . fig2 . as also schematically illustrated in fig2 by way of a pair of shunts 7 , 8 , if matching is not necessary , the transformer 1020 can be omitted . the input light waveguide 3 can advantageously be executed as a monomode light waveguide . a further advantageous development of the invention provides that an output light waveguide 4 , which is realized as a so - called thick core fiber , is employed in order to achieve a low transmission loss . as already set forth briefly above , fig2 schematically illustrates a basic circuit arrangement of an exemplary embodiment of a particularly advantageous possibility of use of an electro - optical modulator constructed in accordance with the present invention , namely in the realization of an electro - optical microphone for a telephone instrument connected to a central device only over light waveguides . as shown on the drawing , a telephone instrument 6 is connected to an exchange device 5 over light waveguides 30 and 40 . in a manner known per se , the exchange device 5 contains an electro - optical transducer 530 for converting an electrical input power signal e into light power l and , accordingly , contains an opto - electrical transducer 540 for the conversion of an outputtable light power l &# 39 ; into an electrical output power signal e &# 39 ; the piezo - microphone 20 , or some other suitable pressure - sensitive signal generator , is exposed to an acoustic pressure sd . the arising electrical signal s is supplied over an electrical output 201 , 202 to an electrical input 101 , 102 of a monomode light waveguide modulator 10 . the monomode light waveguide modulator 10 modulates the light power signal l supplied thereto into the output light power signal l &# 39 ; by means of the electrical signal s . the monomode light waveguide modulators 1 and 10 illustrated in fig1 and 2 are , as individual components , components which are known per se , as has already been discussed above . fig2 illustrates that the electro - optical modulator is a component of the telephone instrument 6 connected to the exchange device 5 over the light waveguides 30 , 40 and that the telephone instrument 6 exhibits no electrical connection whatsoever to the exchange device 5 and likewise exhibits no external power supply whatsoever . it is provided according to an advantageous further development of the invention that the monomode light waveguide modulator 10 , together with an acoustic pressure - sensitive signal generator , for example , the microphone 20 , is spatially accommodated in a hand set 7 for the telephone instrument 6 ( fig3 ) and that an input light waveguide and an output light waveguide extend within a hand set cord 3040 which is disposed between the telephone instrument 6 and the hand set 7 . as shown in fig2 however , the monomode light waveguide modulator 10 can also be advantageously accommodated within the telephone instrument 6 itself . thereby , the electrical output 202 , 202 of the acoustic pressure - sensitive signal generator , namely of the microphone 20 , is connected to the electrical input 101 , 102 of the monomode light waveguide modulator 10 in a conventional manner , namely over two electrical conductors which are in the hand set cord . such an arrangement is particularly advantageous with regard to the mechanical structure , the saving of weight in the hand set , the realization of the optical connections to the light deflector , among other things . as already explained , a voltage transformer 1020 is inserted , as needed , between the electrical output of the pressure - sensitive signal generator and the electrical input of the monomode light waveguide modulator for the purpose of matching of the impedances of the two modulator components . as is known , the light generation at the input of the overall device can occur in various manners , for example by means of luminescent diodes , laser diodes or other lasers of any desired type . fig4 illustrates an oscillogram of an input signal 80 and of an output signal 81 of a laboratory arrangement in order to demonstrate the operability of the principle of the invention . in addition to the advantageous use of an electro - optical modulator constructed in accordance with the invention in a telephone instrument , advantageous use possibilities are also given whereever pressure forces are to be measured or are to be monitored , and where the advantageous property of signal transmission signals with light conduction , namely the insensitivity to electrical or magnetic disruptive influences is to be exploited . according to an advantageous further development of the invention , the overall capacitance c ges of these arrangements , as illustrated in fig5 can be subdivided into a plurality of individual capacitances c which are then to be interconnected in series for the purpose of matching the capacitances of the electro - optical modulator and piezo - microphone or , respectively , elektret microphone . the voltage arising at each individual capacitance as a result of the sound is multiplied in accordance with the plurality of individual capacitances . the piezo - microphone can consist of ceramic , for example , vibrit , or of a synthetic piezo film , for example , pvf 2 . the elektrets employed can likewise be synthetic films . a possibility for the realization of the electrode subdivision can be seen by way of excerpt in fig5 . a round wafer consisting of piezo or elektret material mat is provided with triangular electrodes el or , respectively , el &# 39 ; on the top and bottom surfaces . the electrodes taper towards the center of the wafer , and as indicated , they are connected in series . the series connection of electrodes is known per se . for example , the same is disclosed in the german pat . no . 2 , 314 , 420 with respect to a piezo - electrical key . although we have described our invention by reference to particular illustrative embodiments thereof , many changes and modifications of the invention may become apparent to those skilled in the art without departing from the spirit and scope of the invention . we therefore intend to include within the patent warranted hereon all such changes and modifications as may reasonably and properly be included within the scope of our contribution to the art . | 6 |
5 g bacto tryptone 5 g bacto soytone 5 g meat digest 2 . 5 g yeast digest 0 . 5 g ascorbic acid 0 . 25 g mgso 4 19 g disodium - β - glycerolphosphate in 1 l deionized h 2 0 1 ml 2 × m1 0 . 5 ml 2 m sucrose 50 μl 20 % glucose 40 μl 1 m mgcl 2 4 μl 1 m cacl 2 406 μl h 2 o 60 g na 2 hpo 4 30 g kh 2 po 4 , 10 g nh 4 cl 5 g nacl . 50 mm co 3 - buffer 2 mm mgso 4 0 . 1 mm cacl 2 0 . 5 % casiton ( difco ) 0 . 5 % glucose in 1 liter h 2 o l . lactis mg1363 is a plasmid and prophage free derivative of the l . lactis strain ncdo 712 ( gasson , 1983 ). both the murine as well as the human egf ( accession number x04571 for hegf and nm 010113 for megf ) are available in the public databases at the national center for biotechnology information ( accession number x04571 for hegf and nm — 010113 for megf ). the coding sequences were adapted to optimize the expression in lactococcus . on the base of these sequences , primer sets were designed to assemble the optimized coding sequences of both hegf and megf . at the 3 ′ end of the coding sequence , a spei restriction site was introduced . the primers are shown in table 1 ( hegf ) and table 2 ( m egf ). 1 μl of each oligonucleotide is added to 10 μl taq buffer , 8 μl 2 mm mg 2 + , 2 μl 0 . 5 mm xtp , 5 u taq dna polymerase ( boehringer , mannheim , germany ) and 1 u pfu dna polymerase ( promega , madison , usa ). the reaction mixture is added up to 100 μl with water . the pcr reaction is carried out for 300 seconds at 94 ° c ., followed by 30 times the cycle of 45 seconds at 94 ° c ., 30 seconds at 48 ° c . and 30 seconds at 72 ° c ., with a final step of 10 seconds at 15 ° c . after the assembly , hegf and megf are amplified in a pcr mixture containing 1 μl vent dna - polymerase ( new england biolabs , beverly , usa ), 10 μl taq buffer , 4 μl 0 . 5 mm xtp , 5 μl 0 . 5 μm of each primer , 1μl template dna , 1 μl mm mg 2 so 4 and 74 μl h 2 o . in the case of hegf , hegf01 and hegf06 were used as primer ; for megf , megf01 and megf06 were used . for hegf , the same temperature schedule was used as for the first step . in the case of megf , the hybridization step was carried out at 52 ° c . in stead of 48 ° c . after the assembly , the size of the optimized gene fragments was confirmed on a 2 % agarose gel . spei cut assembled egf ( both for hegf and megf ) is ligated into a naei and spei digested pt1nx ( steidler et al ., 1995 ), resulting in pt1hegf and pt1megf . a schematic overview of the construction of pt1hegf is shown in fig1 . plasmids are transformed into competent cells of l . lactis by electroporation . 50 μl of cells are electroporated in a precooled cuvet of 2 mm , at 25 μf , 2 . 5 kv and 400 ω ( bio - rad electroporator ). l . lactis is made competent by growing a 1 / 100 dilution of a saturated culture , in 200 ml gm17 with 2 . 5 % glycine , until an od 600 of 0 . 5 ( wells et al ., 1993 ). after electroporation , 1 ml of recuperation medium is added , and the cells are incubated for 1 . 5 hour at 28 ° c . cells are plated on gm17 solid medium , comprising 5 μg / ml erythromycin . for the transformation of l . casei , plasmid is isolated from l . lactis on a qiagen - tip 100 , according to the instructions of the manufacturer . the dna is transformed into competent l . casei cells . l . casei cells are made competent by growing a 1 / 50 dilution of an overnight culture in 50 ml mrs ( oxoid ltd ., basingstoke , hampshire , england ) with 1 % glycine at 37 ° c ., untill an od 600 of 0 . 6 . the cells are harvested and washed twice with 10 ml 5 mm na 3 po 4 ph 7 . 4 , 1 mm mgcl 2 , and resuspended in 500 μl electroporation buffer ( 0 . 3 m sucrose , 5 mm na 3 po 4 ph 7 . 4 , 1 mm mgcl 2 ). 10 μl of dna is added to 50 μl of competent cells and the electroporation is carried out in a biorad electroporator . after electroporation , 450 μl mrs is added and the cells are incubated for two hours at 37 ° c . cells are plated on mrs agar with 5 μg / ml erythromycin . the presence of the plasmid is confirmed using pcr . the transformed l . lactis strains mg1363 [ pt1nx ], mg1363 [ pt1megf ] and mg1363 [ pt1hegf ] are pitched in 5 ml gm17 comprising 5 μg / ml erythromycin , and grown overnight at 30 ° c . this preculture is diluted 1 / 100 in 5 ml gm17 with erythromycin , and incubated for three hours at 28 ° c . the culture is centrifuged and resuspended in bm9 expression medium , and incubated overnight at 28 ° c . the transformed l . casei strains are grown under similar conditions , but using mrs as preculture , and bm9 as expression medium . to the culture supernatant , 1 / 10 volume sodium desoxycholate is added , and the mixture is kept on ice for 10 minutes . 1 / 10 of volume 100 % tca is added and the mixture is incubated on ice for 15 minutes . after centrifugation , the pellet is dissolved in 50 μl h 2 o and 50 μl 1 m tris - hcl ph 9 . 5 . the proteins are analyzed on a 20 % laemmli protein gel . detection is carried out using a western blot , with mouse polyclonal anti hegf and rabbit anti megf as primary antibodies . alkaline phosphatase labeled anti - mouse and anti - rabbit secondary antibodies were from southern biotechnology ( birmingham , usa ). the results are summarized in fig2 . in vivo testing of mice , using the transformed lactic acid bacteria strains in order to assess the effect of the transformed lactic acid bacteria and the growth of the villi and the gut adsorption , seven groups of balb / c mice ( iffa credo cr broekman / sulzfield ) were treated either with a megf or hegf expressing lactic acid bacterium strain . l . lactis and l . casei transformed with an empty vector pt1nx , or with bm9 medium was given to mice as a negative control . 600 μl of l . casei is pitched in 15 ml mrs with 10 μg / ml erythromycin . in the case of l . lactis , gm17 is used instead of mrs , and only 5 μg / ml erythromycin is used for selection . l . casei is incubated overnight at 37 ° c ., for l . lactis , 30 ° c . is used . the overnight culture is harvested by centrifugation , and the pellet is resuspended in 1 . 5 ml bm9 expression medium . 100 μl of this solution is supplied daily , for a period of four weeks . at the end of the experiment , the mice are sacrificed and the intestine is isolated . the tissue is fixated in buffered formaldehyde and thin sections are colored using hematoxylin and eosin g , for microscopic analysis of the villi . the length of the villi is measured at several points to obtain a representative average . all sections were taken from the terminal ileum . the results are summarized in fig3 . l . casei [ pt1hegf ], especially , has a positive effect on villus growth and should promote gut absorption . carpenter c . d ., ingraham h . a ., cochet c ., walton g . m ., lazar c . s ., sodawski j . m ., rosenfeld m . g . and gill g . n . ( 1991 ) structural analysis of the transmembrane domain of the epidermal growth factor receptor . j . biol . chem . 266 , 5750 - 5755 . chaet m . s ., arya g ., ziegler m . m . and warner b . w . ( 1994 ) epidermal growth factor enhances intestinal adaptation after massive small bowel resection . j . pediatr . surg . 29 , 1035 - 1039 . chaet m . s ., arya g ., ziegler m . m . and warner b . w . ( 1994 ) epidermal growth factor enhances intestinal adaptation after massive small bowel resection . j . pediatr . surg . 29 , 1035 - 1039 . dunn j . c ., parungo c . p ., fonkalsrund e . w ., mcfadden d . w . and ashley s . w . ( 1997 ) epidermal growth factor selectively enhances functional enterocyte adaptation after massive small bowel resection . j . surg . res . 67 , 90 - 93 . gasson m . j . ( 1983 ) plasmid complements of streptococcus lactis ncdo 712 and other lactic streptococci after protoplast - induced curing . j . bacteriol . 154 , 1 - 9 . gu y ., wu z . h ., xie j . x ., jin d . y . and zhuo h . c . ( 2001 ) effects of growth hormone ( rhgh ) and glutamine supplemented parenteral nutrition on intestinal adaptation in short bowel rats . clin . nutr . 20 , 159 - 166 . hardin j . a ., chung b ., o &# 39 ; loughlin e . v . and gal , d . g . ( 1999 ) the effect of epidermal growth factor on brush border surface area and function in the distal remnant following resection in the rabbit . gut 44 , 26 - 32 . helmrath m . a ., shin c . e ., fox j . w ., erwin c . r . and warner b . w . ( 1988 ) adaptation after small bowel resection is attenuated by sialoadenectomy : the role for endogenous epidermal growth factor . surgery 124 , 848 - 854 . jeppesen p . b ., hartmann b ., hansen b . s ., thulesen j ., holst j . j ., mortensen p . b . ( 1999 ) impaired meal stimulated glucagon - like peptide 2 response in ileal resected short bowel patients with intestinal failure . gut 45 , 559 - 563 . jeppesen p . b ., hartmann b ., thulesen j ., graff j ., lohmann j ., hansen b . s ., tofteng f ., poulsen s . s ., madsen j . l ., holst j . j . and mortensen p . b . ( 2001 ) glucagon - like peptide 2 improves nutrient absorption and nutritional status in short - bowel patients with no colon . gastroenterology 120 , 806 - 815 . lukish j ., schwartz m . z ., rushin j . m . and riordan g . p . ( 1997 ) a comparison of the effect of growth factors on intestinal function and structure in short bowel syndrome . j . pediatr . surg . 32 , 1652 - 1655 . marti u ., burwen s . j . and jones a . l . ( 1989 ) biological effects of epidermal growth factor , with emphasis on the gastrointestinal tract and liver : an update . hepatology 9 , 126 - 138 . o &# 39 ; loughlin e ., winter m ., shun a ., hardin j . a . and gall d . g . ( 1994 ) structural and functional adaptation following jejunal resection in rabbits : effect of epidermal growth factor . gastroenterology 107 , 87 - 93 . opleta - madsen k ., hardin j . and gall d . g . ( 1991 ) epidermal growth factor upregulates intestinal electrolyte and nutrient transport . am . j . physiol . 260 , g807 - 814 . pearson p . y ., o &# 39 ; connor d . m . and schwartz m . z . ( 2001 ) novel effect of leptin on small intestine adaptation . j . surg . res . 97 , 192 - 195 . piiper a ., stryjek - kaminska d ., stein j ., caspary w . f . and zeuzem s . ( 1994 ) tyrphostins inhibit secretagogue - induced 1 , 4 , 5 - ip3 production and amylase release in pancreatic acini . am . j . physiol . 266 g363 - 371 . playford r . j ., marchbank t ., calnan d . p ., calam j ., royston p ., batten j . j . and hansen h . f . ( 1995 ) epidermal growth factor is digested to smaller , less active forms in acidic gastric juice . gastroenterology 108 , 92 - 101 . scott r . b ., kirk d ., macnaughton w . k . and meddings j . b . ( 1998 ) glp - 2 augments the adaptive response to massive intestinal resection in rat . am . j physiol . 275 , g911 - 921 . swaniker f ., guo w ., diamond j . and fonkalsrud e . w . ( 1996 ) delayed effects of epidermal growth factor after extensive small bowel resection . j . pediatr . surg . 31 , 56 - 60 . wells j . m ., wilson p . w . and le page r . w . ( 1993 ) improved cloning vectors and transformation procedure for lactococcus lactis . j . appl . bacteriol . 74 , 629 - 636 . zhou x ., li y . x ., li n . and li j . s . ( 2001 ) effect of bowel rehabilitative therapy on structural adaptation of remnant small intestine : animal experiment . world j . gastroenterol . 7 , 66 - 73 . | 0 |
referring now to the drawings , fig1 is a top view of a motor vehicle 10 showing right hand passenger side door 12 in a partially open position . fig2 is an enlarged perspective view taken in the direction of arrow &# 34 ; 2 &# 34 ; shown in fig1 wherein an upper hinge assembly 14 and a lower hinge assembly 16 are depicted supporting the right hand side door 12 . fig3 is an enlarged exploded perspective view of the upper and lower hinge assemblies of fig2 wherein a portion of a vehicle body hinge post or pillar 18 is shown in phantom including a longitudinally extending mounting panel 20 . the body panel 20 is adapted to removably support upper body mounting plate 22 of the upper hinge assembly 14 and lower body mounting plate 22 &# 39 ; of the lower hinge assembly 16 . with reference to fig4 - 8 , the upper lift - off hinge assembly 14 as illustrated includes an upper door - half sub - assembly 26 together with its upper body mounting plate 22 . the upper hinge door - half sub - assembly 26 comprises a hat - shaped door mounting plate 28 and a link plate 30 pivotally connected together by a pintle pin 32 and locked in position by a snap ring 33 . the door mounting plate 28 is formed with an upper arm 34 and lower arm 36 horizontally disposed in parallel relation with the arms joined adjacent their distal ends by a vertically extending connecting strap portion 38 oriented parallel to door side panel 39 . the proximate ends of each door mounting plate arm 34 and 36 are bent outwardly at a right angle forming upper and lower mounting ears 40 and 42 , respectively , adapted for flush contact with door frame vertical panel 44 . it will be noted in fig7 that inner surface 46 of the strap portion 38 defines a stop surface operative to contact an angled edge of the link plate 30 defining the full - open travel of the door 12 . as seen in fig7 and 8 the link plate 30 comprises a vertically disposed base wall 50 having a through - bore 52 , adjacent one vertical side edge 53 . the base wall 50 is formed integral with an upper horizontally disposed full flange 54 and lower partial flange 55 extending parallel to the full flange 54 and adjacent its other vertical edge 56 of the base wall 50 . aligned bores 57 and 58 are provided in the upper full flange 54 and the lower partial flange 55 , respectively . upon the pintle pin 32 being inserted in hole 59 of the door plate upper arm the pin 32 is journally received in aligned journal bearings 60 and 61 , fitted in respective bores 57 and 58 , prior to extending through holes 62 in the lower arm and locked by snap ring 33 . it will be noted in fig7 and 8 that angled edge 64 of the link plate upper flange 54 slopes outwardly from its one transverse smaller side edge 66 such that the upper flange 54 , as viewed in plan ( fig7 ), has a trapezoid shape . as seen in fig6 the link plate upper flange undersurface 68 has a cylindrical coupling dowel 70 extending vertically downwardly therefrom with its lower end 72 rounded in a bullet - like manner . in fig7 and 8 it will be noted that the body mounting plate 22 is l - shaped in horizontal section providing a body mounting long leg 74 and a link attaching short leg portion 76 . the long leg 74 has an attachment hole 78 for alignment with a first body panel mounting elongated slot 80 . the long 74 leg also has an elongated slot - shaped aperture 82 adapted for alignment with a body panel second mounting hole 84 . in the disclosed embodiment a threaded stud 86 is pre - assembled in the body mounting plate hole 78 , as by welding , while the slotted aperture 82 and aligned hole 84 are adapted to receive a threaded bolt 88 by the assembly line installer . the upper door plate has its ears 40 and 42 fixed to the door frame panel 44 by means of their elongated slots 90 being aligned with associated door frame holes 91 for the reception of threaded bolts 92 . it will be appreciated that the elongated slots 80 and 82 allow for lateral adjustment of the body plate 22 on the body panel 20 . with reference to fig6 - 8 it will be seen that the door mounting plate 28 has its upper arm 34 provided with a keyway 94 adapted to be aligned with a subjacent keyway 96 in the link plate upper full flange 54 . upon the door 12 being pivoted through a predetermined angle to its full - open stop position , shown in fig5 the door mounting plate stop surface 46 contacts the link plate angled edge 64 . in the preferred embodiment the door 12 is moved through an acute angle of about 76 degrees to its full - open fig5 position whereby the keyways 94 and 96 are aligned to receive a locking key 98 . upon the insertion of the key 98 in its associated keyways 94 and 96 the door plate 28 and its link plate 30 are locked in their fig7 position against relative rotation . fig7 and 8 show the body mounting plate 22 short leg 76 having a through bore 99 aligned with internally threaded bore 100 of nut 102 welded to the inner surface of the short leg . the body mounting plate includes upper and lower horizontal webs 106 and 108 , respectively . the upper web 106 is provided with a coupling dowel hole 110 sized for the snug reception of the link plate depending coupling dowel 70 without radial play upon the flush contact of short leg outer surface 112 with inner surface 114 of the link plate base wall 50 . the location of the link plate coupling dowel 70 and the body plate coupling hole 110 are such that with the mutually opposed surfaces 112 and 114 in flush contact the principal axis of the coupling dowel 70 is readily aligned on the center of the coupling hole 110 . thus , the door 12 and attached link plate 30 are adapted to be guided vertically downwardly enabling the seating of the dowel 70 in the aligned coupling hole 110 . at the conclusion of the door and link plate vertical travel the body plate short leg hole 99 and nut threaded bore 100 are aligned with the link plate base wall hole 52 . upon engagement of a single machine threaded bolt 120 in threaded bore 100 tightening of the bolt draws together the mutually opposed surfaces 112 and 114 interlocking the body and link plates 22 and 30 in positive fixed engagement . it is a feature of the present invention that the locked door - half sub - assembly 26 , fixed to the door 12 by bolts 98 , is designed in one application to be advanced laterally toward the body mounting plate 22 by automated door conveying means such as a robot , indicated schematically by robot arms 122 and 124 in fig3 . the movement of the robot , of course , would be electronically governed in a programmed manner by suitable control means indicated by box 126 . reference may be made to u . s . pat . no . 4 , 685 , 208 to sekiraku disclosing one form of automated apparatus suitable for use with the present the disclosure of which is incorporated by reference herein . with reference to fig3 it will be noted that the body mounting plate has a portion of its short leg 76 and a portion of its lower web 108 notched - out at 128 providing clearance for movement of the door mounting plate 28 when the door is swung open or closed . referring now to the fig9 - 13 the lower lift - off hinge assembly 16 includes a lower door - half sub - assembly 26 &# 39 ; and a lower body mounting plate 22 &# 39 ;. as the upper and lower door - half sub - assemblies and the upper and lower body mounting are substantially the same in design and operation like numerals will be used to indicate like or similar components with the lower hinge components being primed . the lower door - half hinge sub - assembly 26 &# 39 ; comprises a door mounting plate 28 &# 39 ; and a link plate 30 &# 39 ; pivotally connected together by a pintle pin 32 &# 39 ; and locked in assembly by snap ring 33 &# 39 ;. the lower door mounting plate 28 &# 39 ; is formed with an upper arm 34 &# 39 ; and a lower arm 36 &# 39 ; horizontally disposed in parallel relation with the arms connected adjacent their distal ends by a vertically extending strap connecting portion 38 &# 39 ; oriented parallel to the door side panel 39 . the proximate end of each door mounting plate arm 34 &# 39 ; and 36 &# 39 ; is bent outwardly to form upper and lower right - angled mounting ears 40 &# 39 ; and 42 &# 39 ;, respectively , adapted for flush contact with the door frame vertical panel 44 . with reference to fig1 and 13 the link plate 30 &# 39 ; comprises a vertically disposed base wall 50 &# 39 ; having a through - bore 52 &# 39 ; located adjacent one vertical side edge 53 &# 39 ;. the base wall 50 is formed with an upper horizontally disposed upper full flange 54 &# 39 ; and lower partial flange 55 &# 39 ; extending parallel to the full flange 54 &# 39 ;. it will be noted that the partial flange 55 &# 39 ; is located adjacent the other vertical side edge 56 &# 39 ; of the base wall 50 &# 39 ;. aligned holes 57 &# 39 ; and 58 &# 39 ; are provided in the upper full flange 54 &# 39 ; and the lower partial flange 55 &# 39 ;, respectively . upon the pin 32 &# 39 ; being inserted in the hinge door mounting plate upper arm hole 59 &# 39 ;, the pin 32 &# 39 ; is journally received in aligned journal bearings 60 &# 39 ; and 61 &# 39 ;, fitted in respective holes 57 &# 39 ; and 58 &# 39 ; of the link plate 30 &# 39 ;, prior to positioning the pin 32 &# 39 ; in link plate lower arm hole 62 &# 39 ; and locked by snap ring 33 &# 39 ;. as mentioned with respect to the upper hinge assembly 14 angled edge 64 &# 39 ; causes the link plate upper flange 54 &# 39 ; to be trapezoidal - shaped in plan . it will be seen in fig1 and 13 that upper full flange undersurface 68 &# 39 ; has an elongated cylindrical dowel 70 &# 39 ; extending vertically downwardly therefrom with its lower free end 72 &# 39 ; rounded in a bullet - like manner . as seen in fig1 and 13 the hinge body mounting plate 22 &# 39 ; is generally l - shaped in horizontal section providing a body mounting long leg 74 &# 39 ; and a short leg 76 &# 39 ; adapted for attachment with link plate 30 &# 39 ;. the long leg 74 &# 39 ; includes hole 78 &# 39 ; for alignment with a body panel first mounting elongated slot 80 &# 39 ; and an elongated or slot - shaped aperture 82 &# 39 ; in the body plate 22 &# 39 ; is adapted for alignment with a second body panel mounting hole 84 &# 39 ;. as with the upper hinge assembly 14 the hole 78 &# 39 ; has a threaded stud 86 &# 39 ; fixed therein , as by welding , while the slotted aperture 82 &# 39 ; and aligned panel hole 84 &# 39 ; are adapted to receive a threaded machine bolt 88 &# 39 ;. the door mounting plate 28 &# 39 ; of the door - half sub - assembly 26 &# 39 ; is fixed to the door frame panel 44 by means of the mounting ears 40 &# 39 ; and 42 &# 39 ; having elongated slots 90 &# 39 ; adapted for alignment with associated door frame holes 91 &# 39 ; so as to receive threaded bolts 92 &# 39 ;. with reference to fig1 - 13 the door mounting plate 28 &# 39 ; has its upper arm 34 &# 39 ; provided with a keyway 94 &# 39 ; adapted to be aligned with a subjacent keyway 96 &# 39 ; in the link plate upper flange 54 &# 39 ; upon the door 12 being pivoted through a predetermined angle to its full - open shown in fig1 . as best seen in fig1 - 13 , a torsion bar 130 is mounted in preloaded condition on the body mounting plate 22 &# 39 ; of the lower hinge assembly 16 for hold - open purposes . the hold - open torsion bar 130 arrangement is disclosed generally in u . s . pat . nos . 3 , 729 , 772 and 3 , 870 , 361 . two spaced scalloped detent rollers 132 and 134 are shown to which a deflectable portion 136 , parallel to principal portion 138 of the torsion bar 130 , is flexed in the door opening and closing movements . upon the roller 132 deflecting portion 136 , the door 12 is held open releasably in its intermediate check or partially open position . deflection of the portion 136 by roller 134 places the door in its second full open check position . the torsion bar 130 has a lower radius arm 140 that is bent upwardly and has a free end 142 abutting a mounting portion flange 144 . as the attachment procedure for the lower hinge sub - assembly 26 &# 39 ; to the lower body mounting plate 22 &# 39 ; is exactly the same as for the upper hinge sub - assembly 26 to the upper body mounting plate 22 and reference may be made to the foregoing description of the upper hinge assembly 14 . during automotive assembly , the vehicle door 12 is partially assembled and the upper hinge sub - assembly 26 and the lower hinge sub - assembly 26 &# 39 ; are affixed thereto by securing the upper hinge door mounting plate 22 and the lower hinge door mounting plate 22 &# 39 ; to the door panel 44 . fig1 and 15 disclose a modified door mounting plate 22 &# 34 ; adapted for attachment to a narrower body pillar . it will be noted in fig1 that short leg portion 76 &# 34 ; is located intermediate the ends of the long leg 74 &# 34 ;. thus , the dowel receiving hole 110 &# 34 ; is located intermediate the stud 86 and the bolt 88 which is a predetermined distance further forward on the vehicle body than the dowel hole 110 shown in fig7 . the advantage of the fig1 modification is that a larger door opening is possible with the modified body plate 22 &# 34 ;. while preferred embodiments of the invention have been illustrated and described , this is only for the purpose of illustration , and it is to be understood that various modifications in structure will occur to a person skilled in the art . | 4 |
the copolymers of the present invention preferably have a t g of at least 180 ° c . when such copolymers contain more than one comonomer copolymerized with pdd , the value of s is less than 1 . the especially preferred copolymers of the present invention have a t g of at least 220 ° c . when those copolymers contain more than one comonomer copolymerized with pdd , the value of s is significantly less than 1 , for example , 0 . 8 or less . all the principal monomers used in this invention are known to the art . the perfluoro ( alkyl vinyl ethers ) ( f ) include perfluoro ( methyl vinyl ether ), perfluoro ( ethyl vinyl ether ), and perfluoro ( n - propyl vinyl ether ). the ethers g ) include , i . a ., methyl perfluoro ( 3 , 6 - dioxa - 4 - methyl - 8 - nonenoate ) ( further referred to as eve ) represented by the following formula ## str2 ## and perfluoro ( 4 - methyl - 3 , 6 - dioxa - 7 - octenyl ) sulfonyl fluoride ( further referred to as psepve ) represented by the following formula ## str3 ## tfe is made in large quantities by e . i . du pont de nemours and company ; other suitable representative monomers are available from the following sources : vf 2 , chlorotrifluoroethylene ( ctfe ), hexafluoropropylene ( hfp ), vinyl fluoride , and trifluoroethylene from scm specialty chemicals , gainesville , fl ; perfluoro ( methyl vinyl ether ) ( pmve ), and perfluoro ( propyl vinyl ether ) ( ppve ) are made as described in u . s . pat . no . 3 , 180 , 895 ; ( eve ) is made as described in u . s . pat . no . 4 , 138 , 740 ; and psepve is made as described in u . s . pat . no . 3 , 282 , 875 . pdd is described in the above - mentioned u . s . patent pat . no . 3 , 978 , 030 . it has now been discovered that pdd can be copolymerized with any one or more of the above - named monomers to amorphous copolymers . the amorphous copolymers of the present invention , are soluble at room temperature in perfluoro ( 2 - butyltetrahydrofuran ), which is a commercial solvent available from 3m company under the tradename fc - 75 . in addition , they have the following outstanding combination of properties : the first four characteristic properties of the copolymers of the present invention are particularly advantageous in applications where the polymer must bear a load at an elevated temperature because of their chemical inertness and excellent dielectric properties , they also are suitable for a number of specialized electrical applications . also , because of their chemical inertness , good optical properties , and good physical properties , they are suitable for the manufacture of optical lenses . the polymers of this invention can also be filled or reinforced with solid substances to make composite materials . the additives include , i . a ., graphite , graphite fibers , aramid fibers , mica , wollastonite , glass fibers , etc . fibrous material may be in the form of loose fibers , fabrics , or mats . such composite materials show enhancement of desirable properties such as modulus , for example . films of the amorphous copolymers of this invention are useful when thermally laminated to other polymeric films or metal foils . a laminate of the amorphous copolymers of this invention with copper foil is a superior substrate for flexible circuit production because the copolymer bonds directly with the copper without the necessity for an intervening adhesive . conventional copper / adhesive / polyimide / adhesive / copper structures for electronic circuit substrates have the deficiency of high dielectric constant material next to copper . this limits the ultimate speed of the electronic circuit . a laminate of copper / amorphous copolymer / copper permits very high circuit speeds because the amorphous copolymer film has a low dielectric constant ( 2 . 1 ) and can be thermally bonded directly to circuit copper . a thermal laminate of amorphous copolymer / polyimide / amorphous copolymer is useful as an electronic circuit substrate . compared to polyimide film itself , this laminate is a superior circuit substrate because ( a ) it may be thermally bonded to copper foil without adhesive ; ( b ) the low water absorption of the amorphous copolymer gives the substrate greater dimensional stability in humid environments ; and ( c ) the low dielectric constant of the amorphous copolymer allows the fabrication of a high speed circuit . a thermal laminate of amorphous copolymer / polyimide is useful as a vacuum bag for the curing of parts such as helicopter blades made from carbon fiber reinforced thermoset . the high glass transition temperature , thermal stability and low surface energy of the amorphous copolymer give the laminate excellent release properties when this side is placed against the thermoset part to be cured . the polyimide layer of the laminate provides strength to prevent pinholing when the bag enclosing the thermoset part is evacuated and raised to curing temperature . after curing and cooling the laminate is easily separated from the part . a thermal laminate containing film of amorphous copolymer as its outer faces and a film of oriented polypropylene as the core is useful as a low - cost film structure with outstanding chemical resistance and stain resistance combined with excellent mechanical properties . such laminates can be used to protect sensitive instruments from environmental damage . pipe , tubing and fittings which are made from or lined with the amorphous copolymer of this invention prevent the contamination of the process liquid with metal ions , plasticizer , or degradation products from the fluid handling system . such fluid handling components are of very high purity , are inert to most common chemicals , and are easily fabricated by injection molding , extrusion , machining from stock . alternatively , fluid handling system components may be fabricated from metal , glass , or other plastic and subsequently lined with amorphous copolymer of this invention by solution coating , dispersion coating , or electrostatic powder coating . in addition to pipe , tubing and fittings , other useful fluid handling articles made from the amorphous copolymers of this invention are pump housings , pump impellers , valve bodies , valve stems , valve seals , diaphragms , tanks , trays , pipettes , laboratory vessels . such articles are especially useful in semiconductor processing fluid handling systems where parts - per - billion purity is required in process water and chemicals . also , in molecular biology research laboratories where extreme purity is required , and microgram quantities must be completely released from the vessels in which they are handled , the fluid handling articles made from the amorphous copolymer of this invention are particularly useful . the amorphous copolymers of this invention are particularly useful when fabricated into articles to transport materials and components through chemical treatment processes . for example in the manufacturing process for semiconductor chips the silicon wafers must be transported through a series of chemical treatment steps ; the containers in which the silicon wafers are carried must be chemically inert to prevent contamination of the chips , and they must be rigid and dimensionally stable to permit precise automatic positioning at each stage of the process . compared to the conventional fluoroplastics used for such wafer carriers , e . g ., the copolymer of tetrafluoroethylene and perfluoro ( propyl vinyl ether ), the amorphous copolymers of the present invention have greater rigidity and greater dimensional stability . this advantage makes possible the fabrication of larger wafer carriers , e . g , baskets to hold silicon wafers of 30 cm in diameter ; wafer carriers made from conventional fluoroplastics are too low in flexural modulus to be useful for wafers larger than about 15 cm in diameter . other conveying system components for which articles made from the amorphous copolymers of the present invention are especially well suited are guide rails , conveyor belt links , bearings and rollers , clamps , racks , hooks , positioning pins , robot arm jaws and fingers , gears , cams and similar mechanical parts which must be precisely engineered , have good high temperature mechanical properties , retain dimensions , be chemically pure and chemically inert . conveying system components made from the amorphous copolymers of this invention exposed to corrosive chemicals or ultrapure water are superior to all conventional fluoroplastics because of the superior high temperature mechanical properties and dimensional stability of the polymers of this invention . the low dielectric constant ( 2 . 1 ) and low coefficient of thermal expansion of the amorphous copolymers of this invention make them especially useful as dielectrics in electrical and electronic applications . for example , the dielectric used between the separate circuit layers in high speed digital multi - layer circuit boards must be very low in dielectric constant and be very dimensionally stable from - 20 ° c . up to soldering temperature of approximately 225 ° c . polyimide is dimensionally stable but has a high dielectric constant (& gt ; 3 ); in addition it is susceptible to atmospheric moisture ; the amorphous copolymers of this invention do not have these deficiencies , and multi - layered circuits which have this polymer as a dielectric between circuit layers are capable of greater speed and greater circuit density . the low moisture absorption , outstanding chemical resistance , purity , thermal stability , and dimensional stability of the amorphous copolymers of this invention make them especially suited for the protection of sensitive electronic circuits and components . unlike conventional fluoroplastics the polymers of the present invention can be dissolved to form coating and encapsulating solutions . for example , a so - called &# 34 ; smart connector &# 34 ; may be encapsulated by dipping it , pins up , in a solution of the amorphous copolymer of example 1 and evaporating the fc - 75 solvent to leave a protective film of polymer to exclude environmental water and corrosive chemicals . in another embodiment the polymers of this invention may be used instead of a thin layer of gold , so - called &# 34 ; gold flash &# 34 ;, to protect electronic connectors from corrosion from atmospheric chemicals . whole electronic or electro - optic circuits may be encapsulated by the amorphous copolymers of this invention by a solution coating process , which is not possible with conventional fluoropolymers because of their insolubility in practical solvents . it is well known that aqueous dispersions of conventional fluoropolymers may be used to impregnate and encapsulate articles such as glass fabric and metal parts ; however , the application of such dispersions is limited to substrates which can tolerate the high baking temperatures (& gt ; 200 ° c .) required to fuse the fluoroplastic into a pinhole - free coating . in contrast to aqueous dispersions of conventional fluoroplastics , solutions of the amorphous copolymers of the present invention may be applied to temperature sensitive substrates such as electronic circuits or electronic components made from thermoplastics , and the solvent evaporated at moderate temperature ( 100 ° c . or less ) to leave a protective polymer film without the necessity of high temperature baking to fuse the polymer . as the amount of pdd in the copolymers of the present invention increases , the tg also increases , although not necessarily in a linear fashion . tg is determined by differential scanning calorimetry ( dsc ) according to astm method d - 3418 . examination of the dsc curve shows only a second order transition and no first order transition , indicating the absence of crystallinity . the relative proportions of the comonomers in the copolymer can be determined by fluorine - 19 nuclear magnetic resonance spectroscopy ( 19 f nmr ). the proportion of hydrogen - containing monomers can be determined by proton nmr together with 19 f nmr . the proportions of comonomers in some copolymers also can be determined by x - ray fluorescence ( xrf ), e . g . using a philips electronic instruments 1404 xrf spectrometer . calibration of x - ray fluoroescence intensity as a function of weight % oxygen and fluorine can be accomplished using three polymer samples of known composition which bracket the anticipated fluorine and oxygen content of the unknown pdd copolymers . the copolymers of pdd with the fluoromonomers of this invention are readily melt - processible , so that they can be fabricated into articles by such techniques as , e . g ., injection molding and extrusion . furthermore , they have low refractive indices , which is a particularly desirable feature for optical fiber cladding . since they are soluble in fc - 75 , they can be conveniently applied to substrates , such as optical fibers or flexible or rigid circuit boards , from solution to give thin polymer layers . furthermore , films of these copolymers are clear and transparent , compared with hazy or translucent films of crystalline polymers . for this reason , the amorphous copolymers of the present invention are suitable for such applications as , for example , windows for chemical reactors , especially for processes using or manufacturing hydrogen fluoride . it is to be noted that , while pdd homopolymers also are amorphous and have good chemical properties , they are not readily melt - fabricable because of some degradation occurring at the high processing temperatures required . copolymerization is carried out in the presence of a free radical generator at a temperature suitable for the initiator chosen . well agitated pressure equipment and a nontelogenic solvent or diluent should be used , preferably one that has sufficient volatility to permit easy removal from the polymer . this invention is now illustrated by the following examples of certain preferred embodiments thereof , where all parts , proportions , and percentages are by weight , unless otherwise indicated . most tg &# 39 ; s were determined using du pont differential thermal analyzer model 1090 with 910 or 912 dsc modules . all units have been converted to si units . a mixture of 5 . 0 g of pdd , 0 . 100 g of 4 , 4 &# 39 ;- bis ( t - butylcyclohexyl ) peroxydicarbonate , and 40 . 0 g of 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane was placed in a pressure tube . the mixture was thoroughly degassed , sealed , and placed in a constant temperature bath at 30 ° c . for 20 hours . the polymerization mixture appeared as a thick , translucent slurry of polymer particles dispersed in 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane . the volatile material was removed by distillation , and the polymer residue was dried at 150 ° c . for 20 hours to give 4 . 7 g of pdd homopolymer . the products of four identical runs were combined . the polymer had two glass transition temperatures , at 333 and 350 ° c . the pdd homopolymer could not be melt - fabricated by compression molding without some degradation ( evidenced by gas evolution ). moldings could be obtained within the temperature range 355 °- 370 ° c . above 370 ° c ., the degradation was quite noticeable ; below 350 ° c ., the polymer flow was insufficient for producing moldings , and coalescense to a homogeneous test slab was not achieved . pdd homopolymer could be cast from perfluoro ( 2 - butyltetrahydrofuran ) solution . that material had good physical properties ( e . g ., high modulus ) but this technique is impractical for thick parts . a 2 - liter vertical reactor equipped with a four - bladed impeller type agitator was charged with 1500 ml of deoxygenated , deionized water , 3 . 75 g of ammonium perfluorononanoate surfactant , and 4 . 70 g of ammonium sulfite . the reactor was pressurized with chlorotrifluoroethylene ( ctfe ), then vented . with the agitator running at 600 rpm , 25 ml of a 7 % ammonium persulfate ( aps ) solution in water was introduced into the reactor heated to 60 ° c . ; next , an initial charge of 2 . 63 g of ctfe and 16 g of pdd was added . after the mixture had been stirred for 30 minutes , continuous feed of 5 . 25 g / hr of ctfe , 32 g / hr of pdd ( ctfe / pdd mole ratio of 0 . 344 ) and 10 ml / hr of aps solution was begun and continued for 4 . 5 hours . the reactor was cooled to 30 ° c ., and a dispersion containing 9 . 4 % of solids was recovered . concentrated nitric acid ( 15 ml ) was added to the dispersion in a blender and agitated . the dispersion separated into a water phase and a copolymer phase . the copolymer was filtered off , dried in an oven at 110 ° c . for 24 hours , and further dried in a vacuum oven at 110 ° c . to remove any traces of water . the copolymer was next fluorinated for 6 hours at 100 ° c . with a 25 : 75 fluorine / nitrogen mixture in a reactor which had been evacuated and purged with nitrogen . the total gas flow amounted to 0 . 132 part of fluorine per part of copolymer the reactor was then purged with nitrogen and cooled . the granulated amorphous copolymer , which was recovered , had a single glass transition temperature of 174 ° c . its composition was 19 . 7 mole % ctfe and 80 . 3 mole % pdd . a copolymer of pdd and ctfe was prepared in the same manner as described in example 1 , except that the initial charge consisted of 2 . 66 g of ctfe and 16 g of pdd ( ctfe / pdd mole ratio of 0 . 348 ). the dispersion recovered from the polymerization reactor contained 9 . 03 % solids . the resulting copolymer was fluorinated as described in example 1 . it was amorphous , with a single tg of 184 ° c . and had a monomer composition of ctfe / pdd of 23 : 77 mole %. a cold 200 ml hastelloy ( tm ) c shaker tube was charged with 30 g of 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane , 6 g ( 0 . 0246 mole ) of pdd , 0 . 02 g of 4 , 4 &# 39 ;- bis ( t - butylcyclohexyl ) peroxydicarbonate , and 1 g ( 0 . 00237 mole ) of eve . the tube was evacuated while cold and flushed several times with nitrogen , then agitated 12 hours at 40 ° c . the resulting dipolymer was collected and dried 24 hours at 100 ° c . in a vacuum oven at 20 . 3 kpa pressure . the yield of dipolymer was 4 . 5 g ( 64 % conversion ). the dipolymer was amorphous , had a tg of l86 . 7 ° c ., and contained 90 . 8 mole % of pdd , as determined by 19 f nmr spectroscopy . its inherent viscosity was 0 . 0735 m 3 / kg , as measured at 27 ° c . in a 3 . 33 kg / m 3 solution in fc - 75 . sup .®. a cold 240 ml hasteloy ( tm ) c shaker tube was charged with 50 g of 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane and 10 g ( 0 . 041 mole ) of pdd , 0 . 1 g of 30 4 , 4 &# 39 ;- bis ( t - butylcyclohexyl ) peroxydicarbonate . the tube was evacuated cold and was charged with 2 g ( 0 . 0133 mole ) of hexafluoropropene . the tube was agitated at 60 ° c . for 2 hours and at 70 ° c . for 2 hours . the resulting dipolymer was collected and dried at 130 ° c . in a vacuum oven for 10 hours . a white dipolymer powder , 7 . 4 g ( 62 % conversion ) was obtained . the dipolymer was amorphous , had a tg of 265 °- 270 ° c ., and contained 94 . 6 mole % pdd . the inherent viscosity of the dipolymer was 0 . 0293 m 3 / kg , as measured at 23 ° c . in a 3 . 33 kg / m 3 solution in fc - 75 . sup .®. a 500 ml creased , jacketed flask equipped with a mechanical stirrer , nitrogen sparger , and syringe inlet was charged with 200 ml of water and 1 . 02 g of ammonium perfluorononanoate . the flask was warmed up to dissolve ammonium perfluorononanoate and then cooled to room temperature . concentrated ammonium hydroxide ( 3 ml ), sodium sulfite ( 0 . 85 g , 0 . 0067 mole ), pdd ( 25 g , 0 . 1025 mole ), and perfluoro ( n - propyl vinyl ether ) ( 11 . 7 g , 0 . 044 mole ) were charged into the flask in that order . the contents of the flask were stirred at 500 rpm . potassium persulfate ( 0 . 90 g , 0 . 0033 mole ) was injected into the flask . the reaction mixture was stirred overnight ( total reaction time 21 . 5 hours ). the resulting coagulum was filtered off , and the remaining latex was diluted with methanol , then coagulated with 20 g of magnesium sulfate in 100 ml of water . the resulting dipolymer was collected , washed three times with a methanol / water mixture , and dried overnight . the dry dipolymer weighed 12 . 6 g . the inherent viscosity of this amorphous copolymer was 0 . 0904 m 3 / kg , as measured at 30 ° c . in a 3 . 33 kg / m 3 solution in fc - 75 . sup .®, and its tg was 228 ° c . the approximate mole fraction of pdd in this dipolymer is 92 %. a cold 240 ml hastelloy ( tm ) c shaker tube was charged with 80 g of 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane , 15 g ( 0 . 0615 mole ) of pdd , 2 g ( 0 . 00474 mole ) of eve and 0 . 05g of 4 , 4 &# 39 ;- bis ( t - butylcyclohexyl ) peroxydicarbonate . the tube was sealed , evacuated while cold , and was charged with 0 . 8 g (± 0 . 2 g ) ( 0 . 008 mole ) of tfe . the tube was agitated at 40 ° c . for 12 hours . the resulting terpolymer was collected and dried 20 hours in a vacuum oven at 120 ° c . a white resin 10 . 5 g ( 59 % conversion ) was obtained . this terpolymer was amorphous and had a tg of 162 ° c . the inherent viscosity of the terpolymer was 0 . 0734 m 3 / kg , as measured at 25 ° c . in a 3 . 33 kg / m 3 solution in fc - 75 . sup .®. the terpolymer had a composition of pdd / tfe / eve = 79 . 5 / 16 . 5 / 4 . 0 ( mole %) as determined by f - 19 nmr spectroscopy . a 2 - liter horizontal reactor equipped with a paddle stirrer was charged with 1150 ml of deionized water , 4 g of ammonium perfluorononanoate , and 1 . 25 g of ammonium sulfite . with the stirrer turning at 70 rpm , an initial charge of 14 g of perfluoro ( methyl vinyl ether ) ( pmve ) and 32 g of pdd ( pmve / pdd mole ratio of 0 . 643 ) was introduced into the reactor heated to 65 ° c . then , 30 ml of a 1 % ammonium persulfate solution ( aps ) in water was added . the mixture was stirred at 65 ° c . for 10 minutes , after which a continuous feed of 20 g / hr of pmve , 48 g / hr of pdd , and 30 ml of the aps solution was begun and continued for 6 hours . the reactor was cooled to 30 ° c . a dispersion containing 11 . 5 % of solids was recovered . the dispersion was coagulated by addition of 10 ml of concentrated nitric acid in a blender , separating into a water phase and a copolymer phase . the copolymer was dried 24 hours at l05 . c in an oven at normal pressure and then at 100 ° c . in a vacuum oven to remove any traces of water . the copolymer was then fluorinated at 100 ° c . for 6 hours in a previously evacuated and nitrogen - purged reactor with a 25 : 75 fluorine / nitrogen mixture , which was passed at the total rate of 0 . 085 part of fluorine per part of copolymer . the resulting amorphous copolymer had a single tg of 173 ° c . and had a monomer composition of pmve / pdd of 13 : 87 mole %. a 2 liter horizontal polymerization kettle equipped with a paddle type aqitator was charged with a solution of 1100 g of demineralized water containing 2 . 0 g of ammonium sulfite and heated to 60 ° c . the polymerization kettle was evacuated to 68 kpa . to the evacuated polymerization kettle were added 50 ml of 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane and 8 . 0 g of asahi glass &# 34 ; surfion &# 34 ; s111s fluorosurfactant ( which is essentially ammonium perfluorononanoate ). with the agitator still off , 26 . 7 ml ( 42 . 7 g , 0 . 175 mole ) of pdd was pressured into the polymerization kettle to give a pressure of 90 kpa . then 13 . 5 g ( 0 . 116 mole ) of ctfe was added , raising the pressure to 207 kpa . the mole fraction of ctfe in the monomer charge thus was 39 . 9 %. after both monomers were added , agitation was begun at a rate of 200 rpm and a 1 % aqueous solution of ammonium persulfate initiator was added at a rate of 150 ml / hr . after 36 minutes of feeding the initiator at this rate , reactor pressure had dropped to 179 kpa , indicating that polymerization had begun . at this point , ammonium persulfate addition was reduced to a feed rate of 60 ml / hr . pdd was now fed at a continuous rate of 51 . 7 ml / hr ( 82 . 7 g / hr , 0 . 34 mole / hr ), and ctfe monomer was fed at a continuous rate of 26 . 7 g / hr ( 0 . 23 mole / hr ) until a total of 155 ml ( 248 g , 1 . 02 mole ) of pdd and 80 . 1 g ( 0 . 69 mole ) of ctfe had been added after the initial pressure drop . the mole fraction of ctfe in the continuously fed monomer thus was 40 . 4 %. addition of both monomers and initiator was stopped at this time . after a further pressure drop to 158 kpa , the polymerization kettle was vented and the contents were recovered . the resulting cooled latex weighed 1 , 732 g and had a solids content of 19 . 8 %. an additional 554 ml of deionized water was added to dilute the latex to 15 % solids . the diluted latex was transferred to a 5 l jacketed flask equipped with a mechanical paddle stirrer . the stirrer was turned at 350 rpm while 25 ml of concentrated ( 16 m ) nitric acid was added rapidly . the dispersion gradually thickened to a gel . stirring was stopped for 15 minutes . when stirring was resumed at 350 rpm , 86 ml of 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane was poured into the flask at a rate of 300 ml / min . the gel immediately separated into copolymer and water phases . stirring was continued for 15 minutes , after which the temperature was raised at a rate of 2 . 5 ° c ./ min to 45 ° c . by circulating hot water through the jacket of the flask . a nitrogen purge was begun in the flask to aid in solvent removal . stirring at 45 ° c . was continued for 1 hour to remove the bulk of the solvent , and then the temperature was raised to 75 ° c . at a rate of 2 . 5 ° c ./ minute . a dip tube with filter cloth at the bottom was placed into the flask , and water was pumped out of the flask with a peristaltic pump at the rate of 45 ml / minute . fresh water was added to the flask at the same rate in order to keep the volume approximately constant . this washing was continued for about 2 hours , or until the ph of the effluent water was 7 as determined with an indicator paper . at this point , water addition was stopped and all but about 50 ml of water was removed from the flask . twenty - five ml of triethylamine was added to the flask , and the contents were allowed to stir at 77 ° c . under reflux for 12 hours . the solid copolymer was then recovered by vacuum filtration , washed twice with 100 ml aliquots of demineralized water , then dried in a vacuum oven for 12 hours at 100 ° c . the yield was 230 g of light brown polymer with a glass transition temperature of i49 ° c ., corresponding to a ctfe content of 35 mole percent . the ctfe content was determined from a calibration curve of tg vs . ctfe content , where ctfe content had been obtained by chlorine analysis . | 2 |
the stabilization wedge shown in the figures and described herein is particularly suitable for use in combination with a therapeutic boot , such as the boot 10 illustrated in fig1 . as disclosed in u . s . pat . no . 7 , 798 , 984 , issued sep . 21 , 2010 , the entire contents of which are incorporated herein by reference , the boot 10 includes a leg engaging portion and a foot engaging portion and a leg - accepting aperture extending along the front side of the boot . the boot 10 includes hook - and - loop fastener segments 12 and 14 that may be coupled with the stabilization wedge shown in the figures , as is described below in more detail . a stabilization block 20 is shown in fig2 and 3 , and an alternative embodiment stabilization block 22 is shown in fig4 and 5 . the block 20 shown in fig2 and 3 differs from the block 22 shown in fig4 and 5 in the particular cross - sectional configuration . as shown in fig3 , the block 20 is generally trapezoidal in cross - section , while the block 22 shown in fig4 and 5 is generally triangular in cross section . other shapes of the blocks 20 and 22 will be apparent to one skilled in the art , and the invention is not limited to simply a trapezoidal or triangular cross - section . a tether 30 is secured to and extends from both block 20 and block 22 . the tether 30 shown in the figures comprises an elongated strap 24 , and may be secured to the respective block 20 or 22 by any means , such as sonic welding , adhesives , or any other means of forming a permanent connection between the block 20 or 22 and the elongated strap 24 . the strap 24 shown in the drawings is generally flexible , and can be made of any suitable material , such as plastic or fabric . the block 20 or 22 shown in the drawings is substantially rigid , and can be formed of any suitable material , such as high density foam , plastic or the like . as shown in the drawing figures , the blocks 20 and 22 are elongated and for fastening to the boot 10 , a fastener is provided in the form of a pair of spaced fastener elements 26 and 28 on the strap 24 . the fastener elements 26 and 28 complement the fastener segments 12 and 14 , thus one of the segments 12 and 14 or elements 26 and 28 is preferably a hook element , while the other of the fastener segments 12 and 14 and fastener elements 26 and 28 is a loop element . thus , when the block 20 or 22 is applied to the boot 10 as illustrated in the drawing figures , the hook and loop elements engage and hold the block 20 or 22 in place . as shown in the figures , the fastener elements 26 and 28 are located substantially at opposite ends of the strap 24 . the spacing of the fastener elements 26 and 28 is such to advantageously engage the fastener segments 12 and 14 . as illustrated , the fastener element 26 is located proximate the stabilization block 20 or 22 , and the fastener element 28 is located on the elongated strap 24 opposite the fastener element 26 . while the fastener elements 26 and 28 shown in the figures are hook - and - loop fastener segments to advantageously engage the hook - and - loop fastener segments 12 and 14 , other types of fastener elements can be employed , as will be evident to one skilled in the art . permanent fasteners , such as adhesives , can be utilized , as well as other types of temporary connection to the boot , such as various kinds of fasteners . the type of connection will be dictated by whether the user wishes a more permanent type of connection , or a readily removable type of connection . as is evident from the figures and the disclosure herein , the stabilization block 20 or 22 may be used on either side of the boot 10 . if desired , the blocks 20 or 22 can be doubled , that is , instead of a single block proximate the fastener element 26 , there can be a second block proximate the fastener element 28 . thus , both sides of the boot 10 can be stabilized if needed . the shape of the block 20 or 22 can vary depending upon the nature of the boot 10 and the use in connection with the boot . while two types of blocks 20 and 22 have been illustrated and described , it will be evident that other shapes will perform the stabilization functions as explained . it should be noted that the disclosure is not limited to the embodiment described and illustrated as examples . a large variety of modifications have been described and more are part of the knowledge of the person skilled in the art . these and further modifications as well as any replacement by technical equivalents may be added to the description and figures , without leaving the scope of the protection of the disclosure and of the present patent . | 0 |
in the drawings reference numeral 30 is alternatively related to the counter or controller . the physical arrangement of counter and controller could be at the same positions although their functions are different . fig1 shows a probe 18 according to the present invention while fig2 is a schematic illustration of a display and analyzer unit 10 for intra - cranial pressure measurement . a connecting cable 12 is connected to this unit 10 and , via a plug connector 14 which serves as coupler , to a catheter 16 . a probe head 20 is disposed on the distal end of the catheter 16 . the probe head 20 is inserted via an opening 24 into a patient &# 39 ; s skull 22 . the probe head 20 is located here between the dura mater and the cranial bones for measuring the epidural pressure . the probe 18 comprises a piezo crystal as pressure transducer , together with a bridge circuit , in a manner known per se . the bridge circuit is supplied with power via leads extending within the catheter 16 , with the unit 10 serving as energy source . a window 26 is formed in the connector 14 to permit an unobstructed view of a light - emitting diode 28 inside the connector 14 . fig3 is a schematic block diagram illustrating components inside the part 14 b of the connector 14 . a counter / controller means 30 , which cooperates with the light - emitting diode 28 and a switch 32 , is connected to the input side of the bridge circuit . the counter / controller means 30 is connected to the energy source of the bridge circuit via line 34 and via line 36 . alternatively a controller means can be used instead of the counter means . a voltage supplied by the energy source serves to operate a microprocessor 38 that cooperates with a memory 40 . the microprocessor 38 and the memory 40 are parts of the counter means 30 disposed inside the part 14 b of the connector 14 . the counter / controller means 30 comprises moreover data lines 42 and 44 connected to a data input 46 and a data output 48 . a predetermined number is input into the counter / controller means 30 via the data lines , and when this number is reached the switch 32 is actuated . the predetermined number is set by means of a computer . the measuring signals of the bridge circuit are transmitted via the lines 50 and 52 to the unit 10 . prior to the start of operation of the probe 18 , a predetermined number is input via the data lines 42 and 44 into the counter / controller means 30 , for instance twenty operational applications . furthermore , a period is specified via the data lines 42 and 44 , from which onwards a respective counting operation is to be performed . for example , when a voltage is applied to the lines 34 and 36 for at least half an hour , a counting operation is triggered . the counter / controller means 30 hence counts the number of operational applications , i . e . the pressure measurements , of the probe 18 . an operational application is then defined in such a way that a voltage must be applied to the lines 34 and 36 for at least half an hour . when the voltage has been applied for more than half an hour a counting operation is triggered . the counting operation then decrements from the specified number one unit at a time , so that the number of remaining operational applications is stored in the memory 40 . furthermore , the total number of operational applications is detected , which means that after each operational application the number is incremented by one and then separately stored in the memory 40 . the number of operational applications still remaining up to actuation of the switch 32 is indicated by a string of flashing signals via the light - emitting diode 28 . the switch 32 is illustrated in fig3 in a state in which the probe has not yet reached the predetermined number of operational applications . as soon as the specified number of operating applications is reached the switch 32 is closed to short the lines 34 and 36 . with this switching the bridge circuit is rendered inoperative and the probe 18 can no longer be used for tonometric applications . the user must then return the probe 18 to the manufacturer for calibration . after calibration , the manufacturer sets anew the specified number via the setting means 42 and 44 , so that the switch 32 will be opened again and the probe 18 is switched again into its state ready for operation . the counter / controller means 30 moreover comprises a data input 46 and a data output 48 via which the contents of the memory 40 can be read , which means that the manufacturer can establish how often the probe 18 has been in operation altogether and how often calibration has been performed . apart therefrom , additional data is stored in the memory 40 , specifically the customer number , the serial number , the data of delivery , the name of the person calibrating the probe 18 and the data of calibration , the date of last calibration of the probe , and similar information . the predetermined number of the counter / controller means 30 may be set and the operation of the probe 18 resumed via the data lines 42 and 44 and the data input 46 and the data output 48 , with the switch 32 then resuming its open position illustrated in fig3 . a series resistor 54 is inserted in line 34 — plus — so that the monitor of the display and analyzer unit 10 will not be affected . the probe 18 is made of a temperature - resistant and biologically compatible material and is adapted for complete autoclaving , together with the catheter 16 . the invention ensures in a simple manner that an electric counter / controller means 30 with small dimensions can be realized in the probe 18 , via which the predetermined number of operational applications is indicated . the switch 32 serves to prevent the probe 18 from being operative beyond the specified number of operating applications . | 0 |
referring now to fig1 there is shown therein a flow chart of a series of logical steps which take place in a web application at a server station . in step 1 a user request for a login screen is received and processed . the login screen will typically be a form page with a so - called &# 34 ; forms and field &# 34 ; feature . this page , as well as subsequent pages , will be transmitted to the user in html . the information required to complete the forms page , including data such as a user id and a password , is entered by the user on his screen and when the forms page is completed it is sent to the server and the information is captured there . this capture step is shown as step 2 in fig1 . in step 3 the server checks the veracity of the password provided by the user and if this is correct then in step 4 , shown as &# 34 ; authorize user &# 34 ;, authorizes the preparation of the next page , which typically will be a link page . the link page is generated by building up a html file for sending to the user . this operation , step 5 , is the last step of fig1 . for this step , in addition to encoding the information required to display the link page at the user , further information , consisting of the current time ( box 6 ) and the user &# 39 ; s calling address ( box 7 ) as now available at the server , having already been sent there by the user , is also provided . the way in which step 5 functions is shown in more detail in fig2 . referring now to fig2 a signal from the &# 34 ; authorize user &# 34 ; step ( shown as step 4 in fig1 ) initiates the operation of fig2 . first a standard html page header is generated ( box 8 ) and then the required data string for the link page is built up ( box 9 ). this string includes as a minimum the user &# 39 ; s id and password . to this is added the current time at the server from box 6 and user identification in the form of the user &# 39 ; s internet address from box 7 . the whole data string is then encrypted using a suitable encryption technique or algorithm , for example rsa or des , as shown in box 10 . the encrypted data string is used in box 11 to build a service url for transmission to the user . the service url comprises the service address of the client , a separator ( in html this is the symbol &# 34 ;?&# 34 ;) and the encrypted data string from box 10 . this url is sent to the client as shown in box 12 for interpretation by his browser and then display at his station . the final part of the transmission is a standard page finish in html form ( box 13 ). an example of an html file representing the last item of fig1 and built up as detailed in fig2 is set out in table 1 below . the following line from table 1 gives the relevant data in which a time stamp and a location stamp is embedded . the section in bold carries the encrypted stamps : the link page can have any number of encrypted strings , and in fact it is typical for there to be more than one . this gives the user a menu of options to choose from . several such strings are provided in table 1 . table 1______________________________________typical html file with encrypted data______________________________________ & lt ; html & gt ;& lt ; header & gt ;& lt ; title & gt ; ncr internet banking : main menu & lt ;/ title & gt ;& lt ;/ header & gt ;& lt ; body background =&# 34 ; money . gif &# 34 ;& gt ;& lt ; center & gt ;& lt ; h1 & gt ; ncr internet banking services & lt ;/ h1 & gt ;& lt ; p & gt ;& lt ; img width = 480 height = 5 src =&# 34 ; line115 . jpg &# 34 ;& gt ;& lt ; p & gt ;& lt ;/ center & gt ;& lt ; center & gt ;& lt ; h2 & gt ; select a service ----& lt ;/ h2 & gt ;& lt ; p & gt ;& lt ; img width = 480 height = 5 src =&# 34 ; line115 . jpg &# 34 ;& gt ;& lt ; p & gt ;& lt ; table colspan = 2 & gt ;& lt ; td & gt ;& lt ; h2 & gt ; img src =&# 34 ; cc2 . gif &# 34 ;& gt ; href =&# 34 ; webfin03 . exe ? 1 + bgfbadxbje \ 11 . bje \ 11xihe &# 39 ; fn4ah &# 34 ;& gt ; balanceinquiry4a & gt ;& lt ;/ td & gt ;& lt ; td & gt ;& lt ; h2 & gt ; img src =&# 34 ; cc2 . gif &# 34 ;& gt ;& lt ; a href =&# 34 ; webfin04 . exe ? 1 + bgfbadxbje \ 11 . bje \ 11xihe &# 39 ; fn4ah &# 34 ;& gt ; account statements & lt ;/ a & gt ;& lt ;/ td & gt ;& lt ; tr & gt ;& lt ; td & gt ;& lt ; h2 & gt ; img src =&# 34 ; cc2 . gif &# 34 ;& gt ;& lt ; a href =&# 34 ; webfin05 . exe ? 1 + bgfbadxbje \ 11 . bje \ 11xihe &# 39 ; fn4ah &# 34 ;& gt ; fundstransfer & lt ;/ a & gt ;& lt ;/ td & gt ;& lt ; td & gt ;& lt ; h2 & gt ; img src =&# 34 ; cc2 . gif &# 34 ;& gt ;& lt ; a href =&# 34 ; webfin06 . exe ? 1 + bgfbadxbje \ 11 . bje \ 11xihe &# 39 ; fn4ah &# 34 ;& gt ; billpayment & lt ;/ a & gt ;& lt ;/ td & gt ;& lt ;/ table & gt ;& lt ; center & gt ;& lt ; p & gt ;& lt ; h2 & gt ;& lt ; img src =&# 34 ; cc2 . gif &# 34 ;& gt ;& lt ; a href =&# 34 ; web . sub .-- fin . htm &# 34 ;& gt ; exit & lt ;/ a & gt ;& lt ;/ h2 & gt ;& lt ; p & gt ;& lt ; center & gt ;& lt ; p & gt ;& lt ; img width = 480 height = 5 src =&# 34 ; line115 . jpg &# 34 ;& gt ;& lt ; p & gt ;& lt ; h3 & gt ;© technology development division 1995 , 1996 & lt ; br & gt ; ncr ( scotland ) ltd .& lt ;/ h3 & gt ;& lt ;/ body & gt ; ______________________________________ on receipt of the data signal set out in table 1 at the client station the user has the opportunity to request information from the server which is of a sensitive nature , often , as in the example of table 1 , with a menu choice of several sensitive items . in the example shown in table 1 the client can make a bank balance inquiry and / or instruct the transfer of funds . when the client sends a request signal to the server station for information or action , as the case may be , the signal pattern of table 1 is such that the data string encrypted in box 10 of fig2 has no recognizable delimiter and hence is returned automatically to the server from the client as part of his request signal . what now happens at the server is set out in fig3 . the request signal is received in step 14 as a data string . the received string is decrypted in step 15 . in box 16 the decrypted data string is parsed to extract the location stamp and the time stamp . both of these stamps were previously generated at the server station by insertion in step 9 . the caller ip address included in the request signal just received as part of the html protocol ( and held in box 17 ) is checked in box 18 . this checking operation consists of a comparison of the caller &# 39 ; s address with the location stamp that was extracted in box 16 . if the two addresses are identical the caller &# 39 ; s address is validated , in which case an approval signal is provided to box 19 . if the caller &# 39 ; s address is invalid an &# 34 ; invalid &# 34 ; message is provided to box 20 . likewise the time stamp contained in the data string that was built up in step 9 is extracted from the received and decrypted data string in step 16 and sent to box 21 . here it is checked against a real time signal at the server station held in box 22 and supplied from there to box 21 . if the difference in the two times is less than a preset amount ( say 15 minutes ) an approval signal is provided to box 19 . otherwise an &# 34 ; invalid &# 34 ; signal is provided to box 20 . if two approval signals are provided to box 19 then the requested service page is sent . the new page can of course be handled as set out in fig1 and 2 . if box 20 receives two &# 34 ; invalid &# 34 ; signals then an appropriate rejection message is sent to the caller station . use of a time stamp as described above enables a form of &# 34 ; time - out &# 34 ; protection to be used to prevent a user leaving his station logged on and therefore his web page accessible to others in his absence . use of a location stamp gives protection to prevent anyone else using the viewed or stored data available at a legitimate client station from another station . it will be understood that the data protection method and apparatus described above can be used with any other form of data protection . | 7 |
a typically encountered problem is presented in fig1 . a radio communication system comprises both a receiver and a transmitter ( fig1 ), which are typically located near each other ( co - located or co - site ). the radio receiver antenna 100 receives not only the desired signal , but also undesired interfering signals broadcast from one or more nearby transmit antennas 160 , and potentially even deliberate jamming signals 170 . the receiver is , of course , designed to detect weak signals , with a low - noise amplifier lna 110 and a sensitive receiver chain 120 , finally ending with baseband signals that may be converted to digital form and processed by a digital signal processor 130 . in contrast , the transmitter chain 140 generates large signals which are amplified in a high - power amplifier hpa 150 . even a small fraction of the large transmit signal can saturate elements within the receiver . the receiver , including but not limited to the lna 110 , has an amount of nonlinearity which may give rise to intermodulation distortion , and thus spurs from interfering signals . fig2 a and 2b present examples of the power spectral density p ( f ) comprising both the signal ( s ) of interest and larger interferers . one or more large interferers 210 tend to generate intermodulation spurs and / or saturate the quantizer front end of a digital radio system ( see fig2 a ), and while one approach is to filter these large signals from the received signal spectrum p ( f ), that approach is limited when multiple interferers 230 overlap a wide low power band of interest 220 , as shown in fig2 b . multiple transmitters make the problem even worse . these high power transmit signal interferences result in reduction in a spur - free dynamic range and / or saturation of the otherwise high dynamic range receiver . while one common sense approach to this problem is to physically separate the receive antenna from the transmit antenna , on platforms such as aircraft , helicopters , spacecraft , ships , and building tops , such a solution may not be possible . the problem is further aggravated by the fact that the military tactical communication systems are rapidly migrating towards wide bandwidths ( hundreds of mhz to a few ghz ), supporting multiple narrowband and broadband waveforms . as a consequence , the number of interferers in the wide receive band continue to rise . co - site interference manifests itself in three forms : 1 . small signal of interest in the presence of large interfering signal ; 2 . small signal of interest in the presence of a large number of signals of comparable power ; and the worst problems tend to occur through a large in - band interferer that drives the receiver into saturation . that is , some electronic circuits have a distortion which increases with signal amplitude , and thus larger signals can produce exponentially more distortion than smaller ones . this creates non - linear distortions or spurs , preventing detection of much smaller signals - of - interest . spurs also occur from in - band intermodulation products from large out - of - band interferers . the presence of these spurious signals and other interferers prevents full usage of the receiver spectrum . for example , to meet a particular sfdr requirement , e . g ., to properly demodulate a signal within specification , the bandwidth of the receiver may be limited based on the existence of relatively high amplitude spurs at the edge of the band . all these effects severely limit functionality of rf receivers . the following difficulties arise from the inability of current communication systems to reject , cancel , or tolerate interference : poor spectrum efficiency and wasted available spectrum leads to compromise of information capacity . the number of frequency hoppers supported on a platform is limited , resulting in fewer channels of secure , jam - resistant communication . small signals - of - interest cannot be detected , therefore low - probability of intercept signaling is affected . degraded signal detection and characterization permits complex signals to go undetected , and results in shorter communication range . dynamic frequency and bandwidth allocation schemes are very limited or not permitted , leading to longer operational planning time and reduced agility in battle situations . the situation is even worse for surveillance ( e . g . signal intelligence or “ sigint ”) receivers . these very wideband receivers , attempting to listen for weak signals , can be rendered useless by large co - site interferers . often one has to resort to the extremely undesirable solution of shutting down the sigint receiver for short periods of time to combat the self - jamming from co - located high - power transmitters , compromising the effectiveness of the entire system . to maximize the utilization of dynamic range , it is preferable to have an interference - free architecture where all the sources of interference are eliminated before they reach the receiver . since the conventional method of bandpass filters is generally unable to achieve the desired levels of accuracy , it is preferred to have an interference cancellation architecture , where a copy or representation of the interference signal , equal in amplitude but of reversed polarity ( called the cancellation signal ) is added to the received signal . in effect , the interference signal and cancellation signal are nulled , leaving the desired signal to be digitized by the receiver . there are known approaches to active signal cancellation , of which the architecture in fig3 is one example . this shows a conventional iq ( in - phase and quadrature ) receiver 300 , where the input signal to the antenna 305 comprises both the desired rf signal and a larger interfering signal . this signal passes through a bandpass filter 310 , and is combined ( added ) in a combiner 315 with a cancellation signal generated by the cancellation signal synthesizer 350 , indicated by the dashed box in fig3 . this synthesizer is designed similarly to a conventional iq transmitter ( and indeed , in some cases a transmit signal can be used directly , reducing required hardware components ), with variable phase shifter 385 and variable amplifier / attenuator 390 adjusted to cancel the interferer to the greatest degree in the combined signal that goes toward the lna 320 . note that both the receiver and the cancellation synthesizer are largely analog , with the only digital processing occurring at baseband . this architecture works well when the interferer is a single static narrow - band signal . however , this approach is much less effective when there are multiple or dynamically changing interferers covering a wide band , particularly if the band covers an octave or more in frequency . in particular , phase shifts are not well defined across a broad band ; one needs to deal with true time shifts instead . a typical architecture of the current technology is presented is fig4 . this approach carries out most of the processing in the digital domain using oversampled signals , and is intrinsically broad band . for example , the receiver 400 converts the analog signal to digital immediately after the lna 420 , using an rf adc 425 that samples at multi - gigahertz frequencies . this adc 425 is , for example , an rsfq delta - sigma converter . such a converter may operate , for example , at 40 gigasamples per second , or higher . this digital signal is then split digitally using a digital splitter 430 and directed to the i and q channels . the down - conversion is carried out using a digital local oscillator dlo 435 and a 90 - degree digital phase shifter 438 together with a pair of digital downconverters ( ddc 440 ) that generate a digital baseband signal for the digital baseband receiver 445 . further , the cancellation signal synthesizer is also fully digital , using another dlo 465 and 90 - degree phase shifter 270 and a pair of digital upconverters 460 that operate at multi - gigahertz rates . as shown in fig4 , key elements of this basic approach are a digital time delay 480 and a digital amplitude adjuster 485 . finally , the digital - rf ™ signal is converted to analog using an rf dac 490 . this analog rf cancellation signal is combined with the signal from the antenna in an analog combiner ( adder ) 415 , to yield the residual receive signal . the residual receive signal may be analyzed based on the digital baseband signal , and used to control the cancellation signal synthesizer , for example to adjust the digital time delay 480 and the digital amplitude adjuster 485 . in addition , in some cases , the residual receive signal may include a complex correlated interference pattern . after a highest amplitude component of the signal is modeled , the residual receive signal may be analyzed for correlated interference , which may be used to adjust a digital lookup table , which is then used based on the dlo 435 to generate a better analog cancellation signal , e . g ., one that results in a residual receive signal with a lower amount of interference - derived power . it is to be understood that the interference cancellation approach of fig4 can be directly extended to the synthesis of multiple interfering signals , or equivalently a broadband interfering signal that comprises the sum of several such signals , where such combination may be implemented in digital or analog domains . this simple looking approach necessitates ultrafast digital electronics that allows high precision gain matching and true - time delay adjustment for frequency independent subtraction of the interfering signal . digital - rf ™ technology , realized today with ultrafast superconductor electronics , is an ideal candidate to perform a wideband interference cancellation . below the desired features for an interference - free architecture are tabulated along with the proposed solutions . however , it is noted that depending on the required performance , other technologies may be used to implement the system . a preferred implementation of the present technology for cancelling co - site interference using superconducting technology is presented in fig5 . here , the ultrafast digital processing may be carried out using niobium superconducting integrated circuits cooled to deep cryogenic temperatures near 4 k , using a cryocooler . the receive antenna 500 also receives a small fraction α of the signal transmitted by the transmit antenna 590 , which represents interference which should be cancelled by a cancellation signal from the cancellation synthesizer . the bandpass filter 505 and lna 510 may be implemented using components cooled to an intermediate temperature of about 70 k , also available from the same cryocooler . the filter may be comprised of high - temperature superconductors ( such as cuprate materials ), and the lna may be optional , depending on the strength of the input signal . these cooled receiver components should permit reduced noise and hence higher receiver sensitivity . at the output of the lna , the rf signal 515 can be expressed as s r + αg 1 s t , where s r is the desired receive signal , and αg 1 s t is the interference signal . this signal then goes to the flux subtractor circuit 520 , where it is combined with the cancellation signal 525 . the flux subtractor circuit represents a superconductor implementation of the analog combiner 415 in fig4 . ( that this is identified as a subtractor rather than an adder is immaterial , since one can merely switch the terminals of a transformer coil in fig6 .) if the gain and timing of the cancellation signal 525 in fig5 are adjusted correctly , then the cancellation signal g 2 s t should cancel the signal coupled from the transmitter , resulting in the desired receive signal 530 as simply s r . note that the receive signal 530 is immediately converted to a digital - rf ™ signal by adc 535 , before downconversion using a digital downconverter 540 , as shown by rf adc 425 in fig4 . fig5 is simplified , and does not explicitly show a digital iq receiver with a two - phase iq digital local oscillator as in fig4 , but this is a known technique in digital - rf ™ receivers , which is implied . similarly , the digital - rf ™ transmitter in fig5 also shows a digital upconverter 550 , with a two - phase digital local oscillator as in fig4 implied but not explicitly shown . the transmitter in fig5 also shows a digital - rf ™ predistorter circuit ( the dynamic digital equalizer block 560 ) that digitally compensates for nonlinear distortion in the amplifier chain ( digital amplifier 565 , analog amplifier amp 570 , and high power amplifier hpa 575 ), where the compensation may be dynamically adjusted by sampling the transmitted output using predistorter feedback circuit 585 . this is similar to that described in more detail in u . s . pat . no . 7 , 313 , 199 , expressly incorporated herein by reference . assuming that most of the nonlinear distortion in fig5 may be associated with hpa 575 , the synthesized transmit signal 555 samples the digital - rf ™ signal before predistortion . the amplitude and timing of this synthesized cancellation signal may be digitally adjusted in the digital - rf ™ gain and delay module 595 , before being further amplified in digital amplifier 565 and amp 570 . in the present example , it is assumed that these adjustments may be essentially static , given a fixed coupling between the transmitter and the receiver . note also that the rf - dac 490 in the transmitter and the synthesizer of fig5 are not explicitly shown . in one implementation , the digital - rf ™ signal may be , for example , a fast oversampled sequence of single - bit pulses , and the conversion to analog may be obtained , for example , by low - pass filtering the single - bit pulsetrain before amp 570 in both the transmitter and synthesizer . in another implementation , a multi - bit digital - rf ™ signal may be converted to an analog rf signal in a multi - bit rf dac before amp 570 . wideband interference cancellation may thus be achieved through use of digital - rf ™, true time delay components for frequency independent subtraction . high precision gain matching may be achieved through digitally controlled gain , using a digital look - up table and digital amplifier for precise amplitude matching . an analog combiner 415 with linear phase response and optimal noise performance may be achieved through use of a flux subtractor 520 , a device which uses passive superconducting niobium transformers for interference cancellation ( fig6 and 7 ). since the cryocooler operating at a temperature of 4 k is already present for the digital sampling and processing , this requires little additional hardware to take advantage of the low noise and ideal flux transfer characteristics of superconductors . as indicated in fig7 , this transformer structure may be implemented using a thin - film niobium process , using a multi - turn primary coil 700 and a quarter - turn secondary coil 710 , with a hole in the superconductor ground plane 720 to enhance the mutual inductance between primary and secondary coils . the design of a flux subtractor as shown in fig7 ( originally intended for a subranging adc ) has a limited current carrying capability and therefore may be suboptimal for certain transmit signal cancellation applications because of the potentially high power signals involved . although superconductors themselves are capable of carrying large currents , the fabrication process preferably employed is a thin film process which necessitates large metal widths for transformer turns , to increase the current carrying capability . however larger metal widths increase the parasitic inductances and parasitic capacitances that may lower the cutoff frequency to only a few ghz . therefore , the design shown is useful for a range of applications , but an optimized design or different design of the flux subtractor may be used for different regimes of operation , for example , large signal amplitude transmit signal cancellation . see , u . s . pat . nos . 6 , 509 , 853 , 5 , 939 , 881 ; mukhanov , o . a . ; gupta , d . ; kadin , a . m . ; semenov , v . k ., “ superconductor analog - to - digital converters ”, proceedings of the ieee , volume 92 , issue 10 , october 2004 page ( s ): 1564 - 1584 , each of which is expressly incorporated herein by reference . while the static transmit signal cancellation architecture of fig5 is successful to an extent in mitigating the co - site interference , it relies on manual calibration of delay and gain adjustment of the cancellation signal . any mismatches in the delay and gain adjustment directly affect the accuracy of cancellation . moreover , the static cancellation architecture is largely insensitive to the environmental changes which necessitate periodic calibration of the delay and gain of the cancellation signal . the self - calibrating interference cancellation architecture of fig8 is a further improved architecture that overcomes the limitations of the static interference cancellation architecture for co - site interference . active self - calibrating cancellation may be achieved through use of a digital correlator 800 , which correlates receiver output with a source of interference for gain and phase matching of the cancellation signal . this uses digital - rf ™ cross - correlation at multi - ghz frequencies , as described in u . s . pat . no . 7 , 280 , 623 , expressly incorporated herein by reference . the correlator approach of fig8 may also be extended as in fig9 to multiple interference adaptive cancellation and enemy jammer interference cancellation through digitally controlled cancellation , with individual self - calibrated subtraction for each source of interference . this may include correlation of receiver output to waveforms from a template library ( 910 ), to cancel known external sources of interference . as discussed above , a template stored in a rewritable lookup table ( for example , implemented with rsfq non - destructive readout ( ndro ) cells ) may also be adaptively defined to reduce the power associated with the interference in the residual receive signal . in one embodiment of the technology , the interference problem is analyzed to identify the multiple sources of interference and a system architecture is provided to adaptively cancel all substantial sources of interference with a high precision canceller ; thereby enabling detection of weak signals at the environmental noise limit . typically , the interferer model must produce a cancellation signal in real time , since faithful storage of the received signal with the interferer present , and then later analyzing the stored signal to eliminate the effects of interference is generally untenable . therefore , in the case of dynamic interferers , a model of the interferer must respond immediately , or nearly so , to changes in the interferer signal . it is noted that , in similar fashion to interference cancellation , the technique may also be used to increase the effective dynamic range of the receiver for signals of interest . that is , if strong signal components of the signal of interest can be modeled and cancelled , the receiver dynamic range can then be allocated to the difference signal , i . e ., received spectrum absent the predicted signal ( s ) of interest . thus , weak , closely spaced , sideband signals can be demodulated in the presence of a strong carrier signal . likewise , in some cases , a signal of interest may act as an interferor to another signal of interest . in that case , the cancellation of a signal of interest early in the receiver signal chain is preferably associated with digital logic in the receiver to reconstruct or correct the cancelled signal later for appropriate analysis and / or demodulation . in the embodiment shown in fig8 , the adc modulator 535 output is cross - correlated with the digital - rf ™ transmit signal 555 in a digital correlator 800 . the output of the digital correlator specifies the amount of transmit signal interference carried to the receiver . this correlated output can be iteratively used to adjust the gain and delay of the cancellation signal until high precision interference rejection is achieved . a programmable digital delay 810 using shift registers can be used to precisely match the delay , and a digital look - up table 820 can be used to modify the gain . the lookup table may store data representing a sine wave , to cancel a narrowband signal , or in some embodiments , the lookup table may also define a waveform different than a sine wave . the input to the look - up table is the n - bit digital word , which serves as an address for the corresponding output word . for each of the n (= 2 n ) possible numbers , the look - up table will have stored an ( n + m )- bit word . the additional m - bits allow adjustment of gain of the cancellation signal . the number of bits in the look - up table would determine the precision of adjustment that can be accomplished . an interface block between the correlator and the look - up table ( not shown in fig8 ) may be provided to perform or control a self - calibration of the gain and delay of the cancellation signal . the self - calibration procedure consists of an adaptive algorithm that can be used to calculate the accuracy of cancellation from the cross - correlated outputs and accordingly make corrections to the delay and gain adjustment by providing appropriate inputs to the programmable delay and digital look - up table . this process of self - calibration is continuous , thereby achieving enhanced immunity to environmental changes to deliver high precision interference cancellation . in a system with multiple transmitters on a common platform , a part of transmit energy from all collocated transmitters is coupled to the receive antenna . apart from the co - site interferers from transmit antennas 590 , there may be other sources of interference 900 ( with signal contribution 131 to receive antenna 500 ), such as a jamming signal from the enemy , which can saturate the receiver or produce distortion , and degrade the system performance to unacceptable levels . in order to have a sufficiently interference - free architecture , all significant sources of interference should be identified and appropriate cancellation provided for each significant source . this may necessitate generation of multiple cancellation signals , each with its appropriate gain and delay matching . fig9 shows such a multiple interferer adaptive cancellation architecture . s t1 to s tn are the digital - rf ™ transmit signals of the n co - located transmitters . each of these transmit signals is digitally correlated with the receiver output to calculate the part of individual transmit signal being coupled to the receiver . the output of the correlator determines the gain and delay compensation for individual transmit cancellation paths . the receiver output is also correlated with existing waveforms in the template library to identify other source of interference like enemy jammers , and appropriate compensation is provided to cancel out the interference . all the digital - rf ™ cancellation signals for individual sources of interference are either summed together digitally ( in a digital combiner , not shown ) or converted to analog and summed together in an analog signal combiner 930 , and are subtracted from the received signal in the flux subtractor 520 . depending on the cross correlator output , the process iteratively adjusts the delay and gain of the cancellation signal in the individual subtraction paths . consequently , the process adaptively achieves high precision interference cancellation . the waveform template library 910 can be periodically updated with known sources of interference . the high dynamic range analog to digital converter ( adc ) utilizing large signal subtraction or cancellation addresses one of the major problems of modern sigint systems — large co - site interference . it is especially challenging for rf designs that seek to meet the requirements for high dynamic range in a wideband system . it is capable of removing the highest level signals ( including agile emitters ) while preserving the system &# 39 ; s minimum detectable signal thresholds . it also provides methods of protection of sensitive amplifiers and components that are well tested , and minimize re - radiation back through the antenna . the overall architecture is consistent with existing sigint systems that divide the band into segments and apply design solutions specific to those frequency segments . the proposed solution further permits the use of legacy experience in dealing with high power in - band and out - of - band interferers . the present technology provides a way to achieve a high spur - free dynamic range ( sfdr ) direct rf receiver that enables accurate detection of small signals by providing enhanced immunity to high power in - band ( or out of band ) interference . exploiting the high spur - free dynamic range of the analog - to - digital converter front - end , the system can discriminate smaller signals with a superconductor receiver , while simultaneously digitizing much larger signals . a superconducting delta - sigma adc has demonstrated a 104 db sfdr in 10 mhz instantaneous bandwidth . the present technology seeks to extend the effective dynamic range further , well beyond what any other known technology can achieve . | 7 |
in accordance with the present invention there is provided a technique by which multiple photographs can be digitally stored and merged to provide a single larger photograph , such as illustrated in fig1 herein . in accordance with the present invention this system includes a mounting substrate 20 , such as illustrated in fig7 and 8 , with preferably triangular supporting ribs . the digital storing of the photographs allows a mixing or merging step to take place to provide a composite photograph . this composite photograph is then scored at separate sequential photograph segments and mounted upon the mounting substrate . a viewing of the mounted composite shows one photograph at one lateral side and the other photograph at the opposed lateral side . fig1 is an illustration of a first photograph a . fig2 is an illustration of a second photograph b . one of the purposes of the present invention is to have the ability to replicate these photographs in a different format such as the format illustrated in fig1 wherein one of the photographs is viewed from the left as indicated by arrow l and the other photograph is observed from the right as indicated by the arrow r . it can be seen from fig1 that the composite photograph c is illustrated as viewed directly from the front . this particular composite photograph is meant to be mounted to the mounting substrate 20 that is described in detail hereinafter . by this particular mounting arrangement , when one views the photograph mounted on the substrate at a left angular position one can observe , for example , photograph b . similarly , when one observes the mounting substrate with the photograph attached at a right angular position as indicated in fig1 , this is a viewing of photograph a . these physical observation angles are approximately 45 degrees or preferably slightly less than 45 degrees at an angle , to be described hereinafter , that is in a range of 40 - 43 degrees . for a further understanding of the respective photograph viewing positions refer also to fig1 a which is basically a plan view showing the main planar substrate at 20 and the three viewing angles indicated by a line of sight l 1 wherein photograph b is viewed , as depicted in fig1 at the right ; a line of sight r 1 wherein photograph a is viewed , as depicted in fig1 at the left ; and a direct line of sight c 1 wherein the composite photograph can be viewed , as depicted in fig1 at the center . reference is now made to fig3 and 4 which are basically replications of fig1 and 2 , respectively . however , for illustration purposes , photograph a includes score lines la and photograph b includes score lines lb . these score lines are illustrated for the purpose of separating each of the photographs into multiple segments sa and sb , respectively . in accordance with the concepts of the present invention , these segments sa and sb are then sequentially generated as per the composite photograph c of fig5 . it can be readily observed in fig5 that the respective segments sa and sb from fig3 and 4 alternate in sequence across the breadth br of the diagram of fig5 . these segments correspond in total to the total of the segments of fig3 and 4 combined . these may also be referred to as segments sa 1 to sa n related to photograph a and segment sb 1 to sb n related to photograph b . for simplicity in fig5 the different segments are shown in alternating herring bone patterns , but it is understood that a different pattern from respective photographs is found in each separate segment . this is illustrated in the top left corner of fig5 . in accordance with the present invention , the photographs such as illustrated in fig1 and 2 are each considered as digitally stored . in this regard refer to the block diagram of fig1 that shows photo a and photo b as coupled to the computer device 30 . the device 30 may be any one of a number of different computer processing machines . computer 30 has the capability of receiving and storing the respective photos a and b as indicated by respective digital storage devices 32 and 34 . also illustrated in fig1 is a mixer or multiplexer 36 that is capable of providing the composite photograph of fig5 with the alternating images at segments sa and sb . this composite signal is illustrated at the output 38 in fig1 . thus , in accordance with the present invention , the photographs a and b are meant to be digitally configured as depicted in fig1 . the composite signal c , as indicated previously , represents the composite photograph of fig5 . in accordance with one embodiment of the present invention this photograph c can simply be printed out on a conventional printer and then scored on each of the score lines 10 . alternatively , a template 15 as illustrated in fig6 with the score lines 16 demarcated thereon may be employed . the template 15 is used as the printing media and thus when the composite signal is printed out , it is formed on the template 15 having the score lines already existing and demarcating between the different segments sa and sb . reference is now made to fig7 for an illustration of the mounting substrate 20 of the present invention . the mounting substrate 20 may have a size slightly larger than the boundaries of the composite photograph of fig5 . in this regard refer also to the perspective view of fig9 showing an additional peripheral frame area 25 where some type of a frame ( not shown ) may be attached and associated with the photograph and template . in fig7 the diagram of the mounting substrate is illustrated by three spaced apart rows 23 with each row containing sequential triangular - shaped ribs 24 . refer also to the cross - sectional view of fig8 taken along line 8 - 8 of fig7 . in an alternate embodiment of the present invention , as illustrated in fig7 a , rather than using three spaced apart and separate rows 23 , one could provide a mounting substrate 20 with a single saw - tooth pattern 24 a in which the triangular ribs each extend transversely across substantially the entire width of the mounting substrate 20 . fig8 is a fragmentary cross - sectional view taken along line 8 - 8 of fig7 for the purpose of illustrating the construction of the triangular ribs 24 . fig8 a is an enlarged fragmentary cross - section of the substrate and photograph with an adhesive therebetween . fig8 and 8a illustrate the substrate supporting ribs at 24 ; the folded composite photograph at 17 ; and the adhesive at 14 . as illustrated in fig7 , a series of these triangular ribs in essentially a saw - tooth pattern is disposed in separate rows 23 . this series of triangular ribs 24 is aligned so that each of the peaks of the ribs is in alignment from row to row . for the embodiment of fig7 a with a single rib construction all peaks are in alignment . fig8 illustrates a preferred angle of these ribs as angle x . this angle is preferably slightly less than 45 degrees and may be in a range of 40 - 43 degrees . the fragmentary cross - sectional view of fig8 a also illustrates an adhesive at 14 which represents the means by which the scored photograph c is mounted to the mounting substrate 20 . in this regard , refer to the perspective view of fig9 which illustrates the composite photograph c as mounted to the mounting substrate 20 such as with the use of an adhesive of some type . the adhesive may be applied uniformly or may be applied only at certain locations . the adhesive is to be applied sufficiently so as to hold the composite photograph effectively against and to all of the ribs of the mounting substrate 20 . in fig9 a herring bone pattern is used in order to simplify the diagram . however , each of the different alternating segments of the actual photograph segments is illustrated . the illustration of fig5 may be construed as a point where the composite photograph is essentially in a planar state . however , for the proper mounting of the composite photograph , the photograph c is to be scored along lines 10 and essentially folded along those score lines into a series of sequential triangular pieces , as depicted in fig9 . as indicated previously , the diagram of fig1 is meant to illustrate basically three different viewing angles of the finally mounted photograph on the mounting substrate 20 . fig1 a is a further schematic illustration in a plan view showing the left and right viewing angles for the respective photos to be observed . the mounting substrate 20 is substantially planar . however , as illustrated in fig1 and 10a , by viewing from the left at , for example , a 45 degree angle to the mounting substrate , one observes substantially only photograph b . on the other hand , by viewing the substrate to the right at , for example , a 45 degree angle to the mounting substrate as also illustrated in fig1 , one observes substantially only photograph a . fig1 and 10a also illustrate a direct frontal observation which is of the composite photograph c which includes alternating photograph segments that are thus then all observed , although this observation has each segment observed at an angle . photograph c is not considered as a meaningful photograph to observe in that it is a mixture of both photograph segments . as the observe moves from a center position either right or left , once the observer reaches an angle around 45 degrees then only the one photograph is observed ; photograph a from the right and photograph b from the left . as the observer moves closer to this 45 degree position the respective photograph becomes more complete and clear . again , reference has been made previously to fig1 that shows photographs a and b as well as the respective storage devices 32 and 34 . these storage devices 32 and 34 along with the mixer or multiplexer 36 are considered as part of a conventional computer system 30 . the output from the multiplexer or mixer 36 is representative of the composite and sliced photographs as is illustrated in fig5 . as part of the process , the generated composite photograph c is then scored and folded . the following step is to then apply the scored and folded composite photograph to the mounting substrate 20 illustrated in fig7 . fig9 depicts the composite photograph c so mounted and also depicts a peripheral frame portion 25 about the entire periphery of the substrate that may receive a frame ( not shown ). reference is now also made to fig1 that is a more detailed diagram of the imaging system for creating the photograph composite that is viewable from alternate positions . in fig1 there are shown photographs a and b , respectively at 42 and 44 . fig1 also depicts the two registers for digitally storing these photographs , as the respective storage devices or registers 46 and 48 . in the block diagram of fig1 after the registers 46 and 48 , there are respective segment registers or controllers 50 and 52 . each of the controllers 50 and 52 stores respective digital segments of each stored photograph . the outputs of the respective controllers 50 , 52 lead to the mixer or multiplexer 54 , as in the diagram of fig1 . the devices 46 , 48 , 50 and 52 , along with the mixer or multiplexer 54 are considered as part of a conventional computer system . the output from the multiplexer or mixer 54 connects , as shown in fig1 , to the output digital storage device 56 . the output from the device 56 is representative of the composite and sliced photographs , such as is illustrated in fig5 . as part of the process , the generated composite photograph c is then scored and folded . the following step is to then apply the scored and folded composite photograph to the mounting substrate 20 illustrated in fig7 . fig9 depicts the composite photograph c so mounted and also depicts a peripheral frame portion 25 about the entire periphery of the substrate that may receive a frame ( not shown ). having now described one preferred embodiment of the present invention , it should be apparent to those skilled in the art that numerous other embodiments and modifications thereof are contemplated as falling within the scope of the present invention as defined by the appended claims . | 6 |
the present invention was made as a result of research in the effects of alloying elements on the strength , non - magnetic properties , and corrosion resistance of cr - mn - n low ni stainless steels . the high strength non - magnetic stainless steel of this invention needs to satisfy , firstly , a magnetic permeability less than 1 . 01 and a high work - hardenability required to provide a hardness exceeding hv 500 . the γ phase of the high strength non - magnetic stainless steel should be stable even when a high - level drawing is done . secondly , the high strength non - magnetic stainless steel should contain a large amount of manganese and nitrogen and little nickel to obtain work hardenability , yet the corrosion resistance , hot - workability , and ductility after drawing of the stainless steel do not decrease . the high strength non - magnetic stainless steel has an optimal composition of such alloying elements as carbon , manganese , chromium , nitrogen , and nickel . the present invention has found that the magnetic permeability is determined by mn equivalent obtained by the following equation after having researched the effects of such alloying elements as manganese , carbon , chromium , nichel , nitrogen , and silicon on the magnetic permeability : the present invention has also formed that the mn equivalent is required to be equal to or more than 30 in order to obtain a magnetic permeability equal to or less than 1 . 01 at a drawing rate ( percentage of a reduction of area ) of 60 % as illustrated in fig2 . fig1 shows effects of mn equivalent and ni amount on the hardness after 60 % drawing , c + n content being constant at 0 . 47 %. the hardness decreases as the ni amount or mn equivalent increases . the mn equivalent should be equal to or less than 33 and the ni amount needs to be equal to or less than 1 . 0 % in order to obtain a hardness more than hv 500 . further , it is preferable to keep the mn equivalent at the minimum required to obtain non - magnetic property because the hot - workability , hardness after drawing and ductility decrease as the mn equivalent increases . fig3 and 4 show the relationship of s content and the corrosion resistance and ductility after drawing for a steel containing 0 . 12 % c , 0 . 61 % si , 14 . 5 % mn , 17 % cr , 0 . 8 % ni , and 0 . 35 % n . and , it is apparent from fig3 and 4 that the decrease of the s content decreases corrosion loss in weight and increases elongation . the corrosion loss of 0 . 4 g / m 2 . hr and elongation more than 5 % comparable to those of sus304 can be obtained by keeping the s amount equal to or less than 0 . 005 %. 0 . 40 - 0 . 55 % ( c + n ) content and equal to or less than 1 . 0 % ni are kept to obtain a high work - hardenability , such as a hardness exceeding hv 500 . to stabilize the γ phase , the magnetic permeability is kept less than 1 . 01 by keeping mn equivalent between 30 and 33 . further , to compensate the decreases of corrosion resistance due to the decrease of ni , of the hot - workability and of the ductility after drawing by the increase of n amount , the s amount is kept equal to or less than 0 . 005 % and the mn equivalent is kept equal to or less than 33 . thereby , a corrosion resistance , hot - workability and ductility after drawing comparable to those of sus 304 are obtained . the steel of the present invention comprises by weight , not more than 0 . 2 % carbon , not more than 1 . 00 % silicon , 14 - 16 % manganese , not more than 0 . 005 % sulfer , 0 . 2 - 1 . 0 % nickel , 15 - 19 % chromium , 0 . 30 - 0 . 40 % nitrogen , said carbon and said nitrogen constituting 0 . 40 - 0 . 55 % and manganese equivalent being 30 - 33 , the reminder being iron together with impurities . in addition , the steel contains when necessary not more than 0 . 1 % aluminum , not more than 0 . 020 % phosphorus and not more than 0 . 0050 % oxygen to further improve the corrosion resistance , hot - workability and ductility after drawing . the steel of the present invention is provided with a high work - hardenability . this steel may be required to be work - hardened to stably obtain hardness more than hv 500 . the steel of the present invention was work - hardened by 50 - 70 % drawing as indicated in fig5 . in addition , the steel is annealed at low - temperature 250 - 550 ° c . when an additional strength is desired . fig6 shows the relationship between low temperature annealing and the tensile strength and hardness of the steels after drawing . in fig6 the steel at room temperature was not annealed . the reason for limiting the composition of the steel of the present invention is explained hereunder . carbon is an element which contributes to the work hardenability and also stabilizes the γ phase . the maximum content of c is limited to 0 . 20 %. the corrosion resistance degrades when the c content exceeds 0 . 20 %. the si content which is required for deoxidizing is limited to 1 . 00 %. when contained more than necessary , silicon causes an imbalance of δ / γ and degradation in hot workability . the minimum content of manganese , one of the main elements of the steel of this invention is 14 %. manganese contributes to the work - hardenability , the stabilization of the γ phase , thereby making the γ phase with a high work - hardenability , and increasing the n solid solution . the minimum content of manganese is determined to be 14 %. the mn content is required to be not less than 14 % to obtain these effects . while , the maximum content of manganese is limited to 16 %. when the mn content exceeds 16 %, mn over - stabilizes the γ phase and causes the work - hardenability of γ phase to decrease . also , hot workability and corrosion resistance are decreased . the maximum s content is the steel of the present invention is 0 . 005 %. s decreases the corrosion resistance , hot - workability of the steel of this invention and the ductility of drawn steel . for this reason , the s content in the steel is required to be minimal . and , preferably the s content should be kept to equal to or less than 0 . 001 %. the minimum ni content should be 0 . 2 %. ni stabilizes the γ phase and should constitute at least 0 . 2 % of the steel by weight . if the ni content exceeds 1 . 0 %, the work - hardenability of the γ phase and the solid solution of n is decreased . therefore , the maximum ni content should be 1 . 0 %. the minimum cr content should be 15 %. cr , another main element of the steel of this invention , increases the steel &# 39 ; s corrosion resistance , the work - hardenability of the phase , the stabilization of the γ phase during drawing , and an increase of solid solution of n . and , the cr content is required to be more than 15 % to obtain these effects . if the cr content increases , it cause the disruption of the δ / γ balance at high temperature and a degradation of hot - workability . therefore , the cr content should be 19 % at most . nitrogen , which facilitates the stabilization of the γ phase , work - hardenability , and corrosion resistance should contain more than 0 . 30 % of the steel . when the n content exceeds 0 . 40 %, however , nitrogen causes a sharp degradation of the hot - workability , and blow holes develop as the steel ingot solidifies . therefore , the n content should not exceed 0 . 40 %. the maximum content of phosphorus and oxygen should be 0 . 020 % and 0 . 0050 % respectively . phosphorus and oxygen degrade the corrosion resistance , hot workability and ductility after drawing , and must be kept at minimal levels . preferably , the steel should contain less than 0 . 015 % phosphorus and 0 . 0040 % oxygen . the maximum al content should be 0 . 10 %. aluminum improves the corrosion resistance , the hot - workability , and ductility after drawing . when the al content exceeds 0 . 10 %, aluminum , however , degrades hot - workability . the features of the steel of this invention become more apparent hereunder from the comparison between embodiments of this invention and conventional steels , and comparative steels . table 1 shows the chemical compositions of the steel employed for the comparison . in table 1 , steels a - f are conventional steels ; steel a is sus420j2 , steel b is astm xm - 28 , steel c is astm xm - 29 , steel d is astm xm - 31 , steel e is 205 , and steel f is sus304 , steels g - j are comparative steels , and steels k - q are sample steels of the present invention . table 1__________________________________________________________________________chemical composition ( weight %) mnc si mn p s ni cr n al o c + n equivalent__________________________________________________________________________a 0 . 310 . 46 0 . 75 0 . 027 0 . 010 0 . 08 12 . 87 0 . 01 0 . 008 0 . 0083 0 . 32 12 . 5b 0 . 080 . 62 12 . 63 0 . 025 0 . 011 1 . 83 17 . 55 0 . 36 0 . 008 0 . 0075 0 . 44 29 . 8c 0 . 040 . 59 13 . 12 0 . 031 0 . 011 3 . 17 18 . 24 0 . 33 0 . 010 0 . 0078 0 . 37 30 . 6d 0 . 100 . 67 15 . 98 0 . 029 0 . 010 0 . 08 17 . 81 0 . 40 0 . 009 0 . 0081 0 . 50 32 . 6e 0 . 170 . 63 15 . 56 0 . 030 0 . 010 1 . 37 17 . 48 0 . 33 0 . 011 0 . 0087 0 . 50 33 . 5f 0 . 050 . 54 1 . 67 0 . 026 0 . 012 9 . 20 18 . 35 0 . 01 0 . 011 0 . 0073 0 . 06 19 . 6g 0 . 120 . 64 17 . 34 0 . 028 0 . 008 0 . 58 17 . 46 0 . 34 0 . 010 0 . 0079 0 . 46 33 . 6h 0 . 100 . 58 14 . 53 0 . 025 0 . 015 0 . 07 14 . 77 0 . 38 0 . 008 0 . 0072 0 . 48 29 . 8j 0 . 120 . 46 14 . 82 0 . 027 0 . 009 0 . 64 17 . 43 0 . 25 0 . 010 0 . 0079 0 . 37 29 . 5k 0 . 100 . 63 14 . 36 0 . 024 0 . 002 0 . 69 17 . 56 0 . 33 0 . 010 0 . 0088 0 . 43 30 . 2l 0 . 130 . 58 14 . 82 0 . 027 0 . 004 0 . 43 15 . 83 0 . 36 0 . 008 0 . 0071 0 . 49 30 . 9m 0 . 160 . 67 14 . 47 0 . 023 0 . 003 0 . 87 16 . 24 0 . 35 0 . 008 0 . 0068 0 . 51 31 . 6n 0 . 120 . 72 15 . 76 0 . 022 0 . 001 0 . 63 16 . 46 0 . 31 0 . 008 0 . 0055 0 . 43 31 . 2p 0 . 120 . 62 14 . 39 0 . 015 0 . 002 0 . 79 16 . 68 0 . 35 0 . 011 0 . 0038 0 . 47 30 . 8q 0 . 150 . 57 14 . 76 0 . 012 0 . 002 0 . 65 17 . 29 0 . 33 0 . 081 0 . 0028 0 . 48 31 . 5__________________________________________________________________________ table 2__________________________________________________________________________hardness ( hv ) after magnetic corrosionafter low temperature permeability resistance elongation hot - drawing annealing ( μ ) ( g / m . sup . 2 · hr ) (%) workability__________________________________________________________________________a 520 -- not less than 10 2 . 21 -- ob 470 495 1 . 012 0 . 55 6 oc 435 450 1 . 008 0 . 52 8 od 525 550 1 . 003 0 . 60 3 xe 495 520 1 . 003 0 . 56 4 xf 415 445 2 . 15 0 . 42 5 og 495 520 1 . 003 0 . 52 4 xh 560 581 1 . 021 1 . 15 4 xj 492 518 1 . 019 0 . 67 4 xk 515 540 1 . 008 0 . 05 8 ol 532 550 1 . 005 0 . 32 6 om 521 549 1 . 004 0 . 17 7 on 503 521 1 . 003 0 . 04 8 op 510 541 1 . 006 0 . 08 9 oq 515 525 1 . 003 0 . 10 8 o__________________________________________________________________________ table 2 shows the hardness magnetic permeability , corrosion resistance , ductility , and hot - workability of steels a - q . shown in table 1 . the hardness , magnetic permeability , corrosion resistance and ductility of the steels are measured after drawing ( percentage of a reduction of area 60 %) and after a low temperature annealing at 400 ° c . for 20 minutes . the corrosion resistance was measured as the corrosion weight loss of each of the steels which were immersed in an 3 . 5 % nacl + 2 % h 2 o 2 aqueous solution at 40 ° c . for 48 hours . the hot - workability was measured whether or not the occurrence of cracks in the steels when 300 kg ingots of the steel were pressed . o indicates those steels in which cracks did not occur , and x indicates those steels in which cracks occurred . the conventional steel a is superior in the hardness hv 520 after 60 % drawing , but is inferior in the magnetic permeability which far exceeding 1 . 010 and the corrosion resistance which far exceeding 0 . 50 g / m 2 · hr . the conventional steel b is superior in the ductility and hot - workability , yet the steel b is inferior in the hardness which is hv 470 , magnetic permeability 1 . 012 and corrosion resistance 0 . 55 g / m 2 · hr . the conventional steel c is superior in magnetic permeability , yet inferior in hardness which is hv 435 and corrosion resistance 0 . 52 g / m 2 · hr . the conventional steel d is superior in hardness and magnetic permeability , yet inferior in corrosion resistance , ductility , and hot - workability . the conventional steel e is superior in hardness hv 520 after a low temperature annealing and magnetic permeability which is 1 . 003 , yet inferior in corrosion resistance , ductility , and hot - workability . the conventional steel f is superior in corrosion resistance , ductility and hot - workability , yet inferior in hardness which is hv 415 , magnetic permeability which is 2 . 15 . none of the conventional steels can provide a high level of hardness , a low magnetic permeability and a high corrosion resistance together . the steel g is superior in magnetic permeability and corrosion resistance , yet inferior in hot - workability and hardness which is hv 495 after drawing because of a decrease in work - hardenability of the γ phase due to a large amount of mn content , 17 . 34 %. the comparative steel h is superior in hardness , but inferior in magnetic permeability which is 1 . 021 and corrosion resistance which is 1 . 15 g / m 2 · hr because of a low mn equivalent 29 . 8 and a low cr which is 14 . 77 %. the comparative steel j is inferior in hardness which is hv 492 , magnetic permeability which is 1 . 019 and corrosion resistance which is 0 . 67 g / m 2 · hr because of a low manganese equivalent 29 . 5 and a low nitrogen 0 . 25 %. the steels k - q of the present invention contain an optimal amount of mn , c , cr , ni , n and an mn equivalent of 30 - 33 , thereby the steels k - q possess hardnesses exceeding hv 500 after drawing and more than hv 520 after a low temperature annealing . the magnetic permeabilities of steels k - g are less than 1 . 010 after 60 % drawing , and corrosion losses by weight less than 0 . 50 g / m hr . the steels k - q are satisfactory in hardness , magnetic permeability , corrosion resistance and superior in ductility and hot - workability . the steels of the present invention possess a magnetic permeability comparable to astm xm - 29 . 31 and a corrosion resistance comparable to sus304 , and a superiority in ductility and hot workability as set forth above . therefore , the steels of this invention and the method for manufacturing the same can be effectively employed for high strength non - magnetic stainless steels used for micro - shafts of vtr &# 39 ; s and electromagnetic valves . | 8 |
referring to the drawings and in particular to fig1 there is illustrated a solid fuel / oil fired &# 34 ; wet - back &# 34 ; shell boiler which comprises a cylindrical shell 10 with front and rear end plates 11 and 12 respectively and mounted on a base 13 . positioned within the shell 10 is a furnace tube 14 of generally cylindrical form and to which solid fuel is fed through a conduit 15 which extends through the shell 10 into the furnace tube 14 . in the example under discussion the furnace tube is provided at its inlet end 16 with a nozzle of an oil burner , not shown , associated with a boiler air supply duct 17 . primary air is fed into the bottom of the furnace tube 14 through a duct 18 which branches from the duct 17 , so as to pass up through the grate 19 as shown by the arrows a and to be described in more detail hereinafter . the products of combustion pass from the furnace tube 14 , as shown by the arrows b , into a reversing chamber 20 from which they pass through a series of smoke tubes 21 arranged parallel to the axis of the furnace tube 14 to a chamber 22 at the front of the boiler . there is a further series of smoke tubes 23 extending from the front of the boiler to a chamber 24 at the rear of the boiler and this chamber contains a grit arrester 25 for separating grit from the combustion products which then pass through a flue 26 . referring now particularly to fig2 provided within the furnace tube 14 beneath the grate 19 are a pair of spaced parallel ash removing conveyor screws only one of which is shown at 30 in fig2 . the front part 31 of the screw shown in fig2 has a left hand threaded whilst the rear part 32 has a right hand thread . the front part of the other screw conveyor has a right hand thread and the rear part a left hand thread . the conveyor screws 30 are arranged to be driven by a chain drive 33 from an electric motor 34 . upon rotation of the screws , which are rotated in opposite directions by the chain drive , ash falling through the grate 19 , as hereinafter to be described , is conveyed to a discharge point at which there is an opening 35 provided in the furnace tube 14 and through a downwardly extending tube 36 into a pneumatic ash removing duct 37 . the grate 19 is made in two halves . the right hand half , as viewed in the direction of the arrow x in fig2 is shown in its closed position in fig2 whilst part of it is shown in its open position in fig3 . part of the left hand half is illustrated in closed position in scrap section in fig4 . the right hand grate comprises a lower set of fire bars 40 which are fixed relative to a support structure 39 , see fig2 and 11 , provided in the furnace tube 14 and an upper set of fire bars 41 which are mounted for longitudinal sliding movement relative to the fire bars 40 and are connected to a support assembly 42 slidably supported in the furnace tube 14 on guide rails 39a , see fig1 . the support structure 42 is connected by a pivot pin 43 to a connecting rod 44 mounted on an eccentric 45 on a shaft 46 driven through a clutch unit 47 from a fly wheel 48 which is driven through a belt drive 49 from an electric motor 50 . referring now particularly to fig5 to 7 each fire bar 51 of the upper set of fire bars 41 is of generally inverted channel section as best shown in fig5 and includes downwardly and inwardly inclined side faces 51a , an inclined upper surface 52 , tapered air supply passages 53 and semi - circular air supply slots 54 at the lower end of each side face 51a . the passages 53 are tapered so as to avoid clogging of the passages and the inclined surface 52 is provided so as to improve the scraping action of the fire bars as hereinafter to be described in more detail . the fire bars 51 are provided with transversely extending mounting parts 55 for spacing the fire bars apart and tie rods , not shown , extend through bores 55a in the mounting parts 55 to connect them to the support structure 42 . the lower set of fire bars 40 comprise , referring to fig8 to 10 , a plurality of bars 60 of generally rectangular configuration in cross section but having downwardly and inwardly inclined side faces 61 , which , like the inclined side faces 51a of the upper fire bars are provided to prevent or to reduce the possibility of ash clogging between the bars . each bar 60 is provided with a longitudinally extending passageway 62 within which is received a steel insert 63 which defines a passageway for steam . at one end each bar 60 is provided with a head portion 64 in which is formed a transversely extending passageway 65 in which a further , steel tube insert 66 is engaged having an opening 67 for communication with the interior of the type 63 . at the other end of the bar the passageway 62 is closed , by means not shown . at spaced intervals along the length of the fire bar are provided transversely extending passages , not shown , which communicate with the side surfaces 61 of the bar and which are arranged so as to be staggered in adjacent fire bars . steam is supplied to the tube 66 through a manifold 68 see fig2 . a steam lance 70 is also provided in the furnace tube 14 beneath the grate 19 . the bars 60 are connected together and to the support structure 39 by tie rods which extend within the tube 66 and a passage 71 at the other end of the bar . the left hand grate , partly shown in fig4 is similar in construction to the right hand grate except that , as shown in fig2 and 4 the position of the upper and lower fire bars is staggered . in use , when the furnace is operating with solid fuel fed through the supply conduit 11 the fuel falls onto the grate 19 and forms a fire bed which burns thereon . when it is desired to de - ash the fire bed and this may be done at predetermined intervals for example , after a predetermined number of rotations of the solid fuel supply screw . firstly , the motor 50 is energised to drive the fly wheel 48 up to the desired speed of rotation . the primary air supply fan is switched off at the same time . the reason for this is that when the upper and lower sets of fire bars are operated so as to open the grate it is desirable to restrict the air flow therethrough as otherwise the fire would be blown out through the thus formed openings . the clutch 47 is then operated to cause the upper set of fire bars 41 to be reciprocated from the closed position shown in fig2 to the open position shown in fig3 and back to the closed position . this reciprocatory movement causes a slice of ash to be scraped from the bottom of the fire bed , the inclined surfaces 52 of the upper fire bars 50 facilitating the slicing of a predetermined thickness of ash from the base of the fire bed and the ash is permitted to fall through the openings formed when the upper set of fire bars 41 is moved to the left , in fig2 so that they temporarily do not obturate the openings between the lower fire bars . the speed of the reciprocation is adjustable and permits adjustment of the amount of ash removed but is in all cases sufficiently fast so that whilst ash is removed the fire bed is not distributed and so that the fire bed does not pass through the openings formed in the grate . a typical speed of reciprocation is at the rate of 140 cycles per minute . it is envisaged that only a single cycle would be performed for each de - ashing operation but if desired one or more cycles may be performed . after the cycle has been completed the primary air supply fan is again energised and the motor so de - energised . the ash conveyor screws 30 are then rotated to convey the ash to the discharge opening 35 and hence to fall through the tube 36 into the pneumatic ash removal duct 37 . during operation of the furnace steam is fed into the fire bed through the manifold 68 and passageways described hereinbefore in the lower fire bars 60 and also , if desired , through the steam lance 70 . this prevents clinker formation in the fire bed as the steam reacts with the carbon to form carbon monoxide which is an endothermic reaction and so cools the fire and in addition causes physical cooling of the fire . because the temperature of the fire is thus lowered clinkering is prevented and this is important because the ash removing device of the present invention does not facilitate removal of slab clinker , i . e . clinker of the size greater than that which will pass through the space between the bars of the grate . although the invention has been described applied to a solid fuel oil fired boiler it may be applied to any boiler or other apparatus having a solid fuel fire . | 5 |
an electric insulator of this invention , an electric insulation device using the electric insulator , and a method for producing a cathode ray tube using the electric insulator are described below referring to fig3 through fig5 . fig3 shows an electric insulator of this invention . fig3 a gives a view of the electric insulator , and fig3 b shows the cross sectional view along a — a line of fig3 a . fig4 illustrates the procedure for attaching the electric insulator of fig3 onto the stem base . fig4 a gives a view of the electric insulator of fig3 . fig4 b gives a view of the electric insulator viewing from the stem side . fig4 c is a stem base attached with an electric insulator of this invention . fig5 illustrates the structure of an electric insulation device of this invention of the neck of cathode ray tube in which electric insulation between several stem pins including a high voltage stem pin is effected using the electrical insulator shown in fig3 or the stem base shown in fig4 . fig5 a gives a view of the device . fig5 b shows the cross sectional view along a — a line in fig5 a . fig5 c shows a cross sectional view of the stem of neck structuring the cathode ray tube . the components common to those in the figures of the related art , such as the electric device of the high voltage inter - stem pin in a cathode ray tube , have the same reference numbers with each other . the following is the description of an electric insulator of the first embodiment in the present invention . referring to fig3 the electric insulator 20 of this invention is formed to a disc having a thickness described below . the disc has a throughhole 21 for receiving a tip 4 at the center , and has throughholes 22 a , 22 b , 22 c , etc . for receiving stem pins 3 a , 3 b , 3 c , etc . including the high voltage stem pin 3 b , at an each corresponding position . those throughholes may be formed at a time when the electric insulator 20 is punched from a large flat electric insulator using a forming die . the punching of the throughhole 21 for the tip is preferably carried out to have a cross slit 23 at the inner periphery of the throughhole 21 . the electric insulator 20 with that type of slit 23 makes the insertion of tip 4 into the throughhole 21 easy and assures close contact of the outer periphery of the tip 4 with the inner periphery of the throughhole 21 , which ensures the electric insulation . the electric insulator 20 is a clay - like silicone compound . an example of that type of silicon compound uses “ putty - stock smx - 5999 ” made by fuji polymer co . ltd . as the basic component . by mixing a plasticizer to “ putty - stock smx - 5999 ”, an electric insulator 20 having an adequate degree of plasticity is obtained . fig3 shows an example of the electric insulator 20 having the tip - throughhole 21 , the pin - throughholes 22 a , 22 b , 22 c , etc ., and the slit 23 . an electric insulator may otherwise simply be formed by punching a silicone compound to the outside diameter , and it is pressed to the tip 4 of the neck 1 and to the stem pins 3 a , 3 b , 3 c , etc . to open these throughholes using a compression force , and then mounting it to the stem 2 . nevertheless , an electric insulator 20 which forms the throughholes shown in fig3 in advance has an advantage that the tip 4 and the stem pins 3 a , 3 b , 3 c , etc . are easily mounted without defecting the shape of the insulator . the inventors carried out further extensive study and invented the stem base 40 with electric insulator , which is the second invention shown in fig4 c . the stem base 40 with electric insulator is formed by attaching the electric insulator 20 shown in fig4 a ( fig3 ) to the stem base 30 to integrate them . the material of the stem base 30 may be a high insulation resin such as polycarbonate which is used in prior art . as illustrated in fig4 b , the stem base 30 consists of : a tip - throughhole 32 which is opened at the center of the disc base plate 31 and which accepts the tip 4 ; pin - throughholes 33 a , 33 b , 33 c , etc . including for the high voltage stem pin 3 b , which are arranged along the peripheral pitch circle on the base plate 31 and which receive stem pins 3 a , 3 b , 3 c , etc . at each corresponding position ; and the tip acceptor 34 and an acceptor for high voltage stem pin 35 locating on the side not facing the stem 2 of the base plate 31 to protect the tip 4 of the neck 1 . the stem base 30 has no skirt 14 which is seen on the stem base 10 of prior art . the skirt 14 may be formed at need . however , this invention uses a clay - like electric insulator 20 and is not the type of paste electric insulator 5 , so there is not possibility of sagging of the insulator . therefore , no skirt 14 is required in this invention . moreover , elimination of the skirt 14 allows an easy production of the stem base 40 with the electric insulator , which stem base 40 is described below . the following is the third embodiment of the present invention . the stem base 40 with electric insulator is formed by attaching the electric insulator 20 shown in fig3 to the stem base 30 in advance while aligning each of the tip - throughhole 21 , pin - throughholes 22 a , 22 b , 22 c , etc . with the tip - throughhole 32 , pin - throughholes 33 a , 33 b , 33 c , etc . on the stem base 30 , respectively . in other words , the stem base 40 with electric insulation has an integrated structure of the electric insulator 20 and the stem base 30 . when this type of stem base 40 with electric insulation is prepared in advance , the production line of cathode ray tubes at an assembly plant is shortened , and a special advantage is given in automatic mounting of the stem base 40 with electric insulation to the stem 2 as described before . furthermore , even if the assembly is carried out manually , the workability should be significantly improved . accordingly , as illustrated in fig5 the stem base 40 with electric insulation of this invention is attached to the evacuated neck 1 of a cathode ray tube under a compression force while aligning the tip - throughhole 32 with the tip - throughhole 21 on the mating electric insulator 20 and aligning each pin - throughholes 33 a , 33 b , 33 c , etc . with the pin - throughholes 22 a , 22 b , 22 c , etc . on the mating electric insulator 20 , and with the stem pins 3 a , 3 b , 3 c , etc ., respectively , and while pressing down on the stem base 40 with electric insulation at the mating state to firmly contact the stem 2 . the compression force is described later . in this manner , the inter - stem insulation is performed using the electric insulation device shown in fig5 a and fig5 b . otherwise , the electric insulator 20 shown in fig3 may be directly mounted on the stem pins , 3 a , 3 b , 3 c , etc . and the tip 4 of the stem 2 , and may further accept the stem base 30 as shown in fig4 b or the stem base 10 of prior art . however , if the stem base 40 with electric insulation of this invention shown in fig2 c is used , the mounting can be performed by a robot , which means that the production line of cathode ray tubes is automated . either electric insulator of this invention may be used to enhance the curing by the heat of cathode aging ( 80 - 120 ° c .) after mounting the electric insulator to the stem 2 at room temperature as described before . since the electric insulator of this invention has a clay - like property , the amount of included solvent is quite small compared with the paste electric insulator of the prior art . as a result , the generation of bubbles in the curing stage due to the heat is minimized , and the required breakdown voltage is secured . the following is experimental examples of the clay - like silicone compound electric insulator of this invention . the clay - like silicone compound used had the following properties . the experiments were conducted with various thickness , t , of the electric insulator 20 shown in fig3 b . the clay - like silicone compound having the above listed properties was formed in a forming die to prepare the electric insulator 20 having the diameter of 22 mm , the pin - throughhole spacing of 4 mm corresponding to the spacing of stem pins 3 a and 3 b and of stem pins 3 b and 3 c . the electric insulator 20 was mounted to the stem 2 to measure the dielectric breakdown voltage between stem pins . the result is summarized in table 1 . the term “ degree of plasticity ” means that the rate of shrinking of the sample thickness determined by sandwiching the clay - like silicone compound of 10 mm square between glass plates and by applying a compression force of 10 kg * f . the term “ adhesive force ” means the adhesive force determined by sandwiching the sample between a glass plate and the stem base 30 shown in fig4 b and by applying a compression force of 10 kg • f . the depth , d , of the recess 2 a on the stem 2 shown in fig5 c , which recess generated during the closing stage of the cathode ray tube , was normally in a range of from 0 . 3 to 0 . 5 mm . an electric insulator 20 having the thickness of 0 . 5 mm had a tendency of incapable of absorbing the recess 2 a and degraded the dielectric breakdown voltage . when the thickness of the electric insulator 20 exceeds 2 . 0 mm , the thickness was too large and a loose mount occurred . in both cases , a preferable thickness of the electric insulator 20 was in a range of from 0 . 8 to 2 . 0 mm . the clay - like silicone compound used had the following properties . the experiments were conducted with various degree of plasticity of the electric insulator 20 shown in fig3 . the clay - like silicone compound having the above listed properties was formed in a forming die to prepare the electric insulator 20 having the diameter of 22 mm , and the pin - throughhole spacing of 4 mm corresponding to the spacing of stem pins 3 a and 3 b and of stem pins 3 b and 3 c . the dielectric electric insulator 20 was mounted to the stem 2 to measure the breakdown voltage between stem pins . the result is summarized in table 2 . the experimental results showed a tendency that an electric insulation having a lower degree of plasticity ( excess hardness ) could not absorb the recess 2 a of the stem 2 as observed in experimental example 1 , and likely left bubbles in the insulator , and degraded the breakdown voltage . as described above , the electric insulator of this invention induces no degradation of dielectric breakdown voltage between stem pins nor fracture caused by unwelcome phenomena such as the generation of bubbles or irregular application of resin which are the disadvantages of conventional rtv resin . consequently , the electric insulator of this invention does not suffer a discharge between pins and fully utilizes the electric characteristics inherent to silicon compound . in addition , the electric insulator of this invention can form the pin - throughholes and tip - throughhole simultaneously by punching the form in a forming die , which allows the mass - production of electric insulators which are easy to mount on stems . furthermore , the stem base with the electric insulator of this invention is easily handled manually , as described before , and is mounted by a mechanical means , and allows an automatic mounting . accordingly , this invention provides various effects as described above . the detailed description given above used a cathode ray tube as an example . this invention , however , is not limited to the cathode ray tube , and naturally deals with the electric insulation between electrodes of electric equipment such as between electrodes of a high voltage transformer actuating under a high voltage . | 7 |
for a better understanding of the present invention , the prior art is described with reference to drawing fig1 a , 1b , 1c and 2 . fig1 a , 1b , and 1c illustrate a prior art device in which two metal lead frames are used for fabricating a semiconductor device . fig1 a and 1b ( taken along line ib -- ib of fig1 a ) illustrate a die paddle 4 that is formed as part of a first lead frame 2 and that is tied to carriers 6 with tie bars 8 . the first lead frame 2 comprises carriers 6 running along two longitudinal sides of the first lead frame itself . the second lead frame 12 is provided with alignment holes 10 . the carriers 6 are bent to differentiate the levels of the die paddle 4 in relation to the ends of the carriers 6 . fig1 c illustrates a second lead frame 12 comprising carriers 16 running along two longitudinal sides of the second lead frame itself and provided with alignment holes 14 , a plurality of leads 18 consisting of an inner lead portion 18a and an outer lead portion 18b , and dam bars 20 tying the leads 18 to each other and to the carriers 16 . in the fabrication of a semiconductor device , referring to drawing fig1 a , 1b , 1c , and 2 ( which illustrates a mold used in the double lead frame assembly process ), a semiconductor die 22 is bonded onto the die paddle 4 . an insulating film 24 may be bonded onto the top surface of the die 4 to insulate the semiconductor die 22 . the inner lead portions 18a of second lead frame 12 are connected to an active surface of semiconductor die 22 by means of wire bonding 28 . first lead frame 2 is then fixed to second lead frame 12 by welding a portion of the carrier 6 of first lead frame 2 to a portion of the carrier 16 of second lead frame 12 . this particular assembly requires a particular mold adopted for receiving two lead frames , as illustrated in fig2 . as can be seen from fig2 a mold 26 comprising an upper half 26a and a lower half 26b holds carriers 6 and 16 of lead frames 2 and 12 , respectively . an alternative embodiment of the prior art device shown in drawing fig1 a , 1b , 1c , and 2 comprises the same assembly steps described before , except that die paddle 4 is not formed as part of a first lead frame 2 . instead , die paddle 4 and tie bars 8 are welded directly onto a tie - receiving portion formed on the second lead frame 12 . due to the exclusion of the carrier 6 and alignment holes 10 of lead frame 2 , this alternative embodiment requires specialized equipment to locate , align and weld the tie bars 8 to the tie - receiving portion of the alternative second lead frame 12 . in contrast to the prior art , fig3 and 4 illustrate a first embodiment of a first lead frame 30 according to the present invention . the first lead frame 30 is made from any metallic material , non - metallic material , or any combinations thereof , which exhibit desirable properties with respect to , for example , thermal conductivity , coefficient of thermal expansion , heat dissipation , strength , and formability . well known examples of such materials ( used alone or in combination ) include alloy 42 , copper , aluminum , silver , ceramic compounds , organic and inorganic silicone based compounds , plastic compounds , and glass - epoxy based organic materials , reinforced organic materials , etc . referring to fig3 the first lead frame 30 comprises first carriers 32 running along the two longitudinal sides of the first lead frame and further is provided with alignment holes 34 thereon . a die paddle 36 is connected to first carriers 32 by means of tie bars 38 . the die paddle 36 has sufficient length and width to easily accommodate semiconductor chips or dice of varying sizes and shapes . tie bar cut zones 40 and attachment tabs 42 are provided on tie bars 38 for use in assembling the semiconductor device , as more fully set forth below ( see fig7 a to 7f ). attachment tabs 42 consist of co - planar extensions emanating from the tie bars , each attachment tab 42 being substantially larger and / or wider than the tie bar 38 to which the attachment tab 42 is connected , although the attachment tab 42 may be any desired size and / or configuration suitable for use . tie bar cut zones 40 consist of preweakened , cutaway or recessed portions located between the tabs 42 and the first carriers 32 on the tie bars 38 . as can be seen from fig4 the tie bars 38 are bent downwardly , so as to position the die paddle 36 in a substantially horizontal arrangement with and at a lower level in relation to the first carriers 32 and first lead frame 30 . because the degree of pitch in the bend , as well as the length and width of the tie bars 38 , is dependent on the height of the semiconductor chip or die to be placed on the die paddle 36 , the tie bars 38 will correspondingly vary with regard to shape and angle of bend in order to accommodate a wide variety of semiconductor device shapes and sizes . inclusion of first carriers 32 and alignment holes 34 permit the use of existing equipment used in single lead frame processes to accomplish the attachment of the semiconductor device 44 ( fig5 ) onto the die paddle 36 . fig5 illustrates a semiconductor device 44 having bond pads 46 placed in a linear arrangement on an active surface of the semiconductor device 44 . it is understood that any semiconductor device having various arrangements of bond pads known in the art can be used . it will also be understood that the semiconductor device 44 is not limited with respect to length , width , thickness , or material composition . fig6 illustrates a second lead frame 48 according to the present invention . the second lead frame 48 comprises second carriers 50 running along the two longitudinal sides of the second lead frame 48 , alignment holes 52 , a plurality of leads 54 consisting of an inner lead portion 54a and an outer lead portion 54b , dam bars 56 tying the leads 54 to each other and to second carriers 50 , and attachment tab receiving portions 58 having apertures 58 &# 39 ; therein . each attachment tab receiving portion 58 is formed being of substantially the same size and shape as the attachment tab 42 , or at least as large and substantially the same shape with which it is to be attached , although , the attachment tab 42 and tab receiving portion 58 to which it is attached may have any suitable desired size and shape depending upon the geometry and size of the semiconductor device , the die paddle , and the lead frame . the second lead frame 48 can be made from any metallic material , non - metallic material , or any combinations thereof which exhibit desirable properties with respect to , for example , electrical conductivity , coefficient of thermal expansion , strength , and formability which are compatible with , although preferably a different or separate material from , the first lead frame 30 , but yet compatible therewith and with the semiconductor device 44 . well known examples of such materials ( used alone or in combination ) include , but are not limited to , alloy 42 , copper , aluminum , and silver . attachment tab receiving portions 58 , having apertures 58 &# 39 ; therein , preferably consist of co - planar , flat extensions of the second carriers 50 . alignment holes 34 and 52 can be formed in a variety of shapes and positions with the purpose of accommodating particular types of equipment used both to align and weld the first lead frame 30 to the second lead frame 48 , as further described below . alignment holes 34 and 52 preferably consist of uniformly shaped , extruded sections of first and second carriers 32 and 50 . fig7 a to 7f illustrate a method of fabricating a semiconductor device according to the present invention . referring to fig7 a , the semiconductor device 44 is attached or bonded onto the die paddle 36 of the first lead frame 30 using a conventional single lead frame process and equipment . as previously described , the first lead frame will comprise a die paddle 36 of sufficient size and sufficient depth ( in relation to the first carriers 32 ) to accommodate a preselected semiconductor chip of a particular length , height , and width . the semiconductor device 44 can be bonded onto the die paddle 36 with , for example , silver paste , polyamide , or any other means of bonding known in the art . an insulating film ( e . g . silicon tape or polyamide ) can be applied to the top or active surface of the semiconductor device 44 , excluding the electrodes or bond pads 46 , to electrically and physically insulate the semiconductor device 44 against damage resulting from direct contact with leads 54 during a subsequently described wire bonding process . referring to fig7 b and 7c , once the semiconductor device 44 has been bonded to the die paddle 36 , the first and second lead frames are aligned by superimposing a bottom surface of the second lead frame 48 onto a top surface of the first lead frame 30 and by aligning alignment holes 34 of lead frame 30 with the corresponding alignment holes 52 of the second lead frame 48 . in the resulting alignment , the inner lead portions 54a of the second lead frame 48 overlap the semiconductor device 44 . the attachment tabs 42 of the first lead frame 30 are then attached or welded or bonded to the tab receiving portions 58 of the second lead frame 48 . it is understood that any suitable adhering or welding processes known in the art , such as spot welding , heat pressure welding , adhesive taping , polyamide bonding , etc . can be used . a cross - sectional view of the assembled and interconnected dual lead frame structure is illustrated in fig7 c . referring to fig7 d and 7e , once the alignment and adhering steps are completed , the first carriers 32 of the first lead frame 30 are removed from the die paddle 36 , tie bars 38 , and attachment tabs 42 by severing or cutting the tie bar cut zones 40 ( shown in fig3 and fig7 b ) of the first lead frame 30 using any suitable severing or cutting tool which can extend through apertures 58 &# 39 ; of attachment tab receiving portion 58 in the second lead frame 48 . the first carriers 32 of the first lead frame 30 are discarded , leaving an intact second lead frame 48 including a die paddle 36 which is connected to the attachment tab receiving portion 58 of the second lead frame 48 by means of the tie bars 38 and attachment tabs 42 . thus , the present step in the method converts the double lead frame assembly of the prior &# 34 ; align and weld &# 34 ; step into a single lead frame assembly in order to facilitate the use of conventional single lead frame equipment in conducting the subsequent wire bonding step of the assembly process . a cross - sectional view of the assembled and interconnected single lead frame structure with attached die paddle 36 is illustrated in fig7 e . as illustrated in fig7 f , the bond pads 46 of the semiconductor device 44 and the inner lead portions 54a of the leads 54 are then interconnected by any suitable means of wire bonding 60 ( e . g . gold wire bonding ). fig8 illustrates a cross - sectional view of a conventional mold , adapted for receiving a single lead frame , and the single lead frame assembly of fig7 f . upon completion of the wire bonding stage , the assembled and interconnected single lead frame structure including the second lead frame 48 , the die paddle 36 , the semiconductor device 44 , and the wire bonds 60 are set in a transfer mold 66 , which comprises an upper half 66a and a lower half 66b . the mold 66 includes a mold space having a portion thereof running along the dam bars 56 ( not shown in fig8 ) and near the second carriers 50 of the second lead frame 48 , as illustrated by dashed line 62 in fig7 f . thus , the mold space containing the portion of the assembly comprising the die paddle 36 , the semiconductor device 44 , the inner lead portions 54a of the leads 54 , and the wire bonds 60 , is then filled with a thermosetting polymer such as , for example , an epoxy resin . upon completion of the molding process , the second carriers 50 and sections of the dam bars 56 located between leads 54 of the second lead frame 48 are removed , so as to separate the molded body and the outer lead portions 54b and form a molded semiconductor device assembly . such removal can be accomplished with a press or other known suitable means . subsequent steps may include bending of the outer lead portions 54b , metal plating , and any other desired conventional steps . fig9 illustrates a further embodiment of the present invention in which die paddles of differing thicknesses are employed to assist in dissipation of heat via heat conduction . usually , heat generated in operation of the semiconductor device is dissipated via heat conduction through leads to a circuit board and into portions of the molded package itself . heat dissipation can be improved by diffusing the generated heat in a direction away from the semiconductor device and toward one or more external surfaces of the package . as previously discussed , one method of improving heat dissipation is through the selection of die paddle materials having an optimum quality for heat conduction . however , such limitations are avoided in the lead frame assembly of the present invention through the use of dissimilar materials in the manufacture of the first and second lead frames . the embodiment illustrated in fig9 also differs from the embodiment of fig8 in that the inner lead portions 54a of the leads 54 do not overlap or extend over the active surface of the semiconductor device 44 . it is understood that the inner lead portions 54a of the leads 54 can be of varying lengths , so as to permit any desired overlap of the die paddle 36 , semiconductor device 44 , or neither , i . e ., no over lap of the active surface of the semiconductor device at all ( as demonstrated in the present examples ). as previously stated , fig9 illustrates another embodiment of the present invention in which a die paddle 36 is used as a heat sink , the die paddle 36 having a thickness sufficient that the bottom surface thereof contacts , if desired , a portion of the mold die forming the mold space . in operation , heat generated in a semiconductor device 44 is dissipated through the leads connected thereto , the thermosetting polymer forming the semiconductor die package , and the semiconductor die paddle . the preferred heat sinks for use in the present invention comprise laminated metal sandwiches commonly referred to as copper - clad invar and copper - clad molybdenum . fig1 illustrates a semiconductor device 144 having bond pads 146 placed in a linear arrangement on two opposing sides on the active surface of the device 144 . it is understood that any semiconductor device having various arrangements of bond pads known in the art can be used . it will also be understood that the semiconductor device 144 is not limited with respect to length , width , thickness , or material composition . referring to fig1 , the first lead frame 130 of a second embodiment of the present invention comprises first carriers 132 running along the two longitudinal sides of the first lead frame and further is provided with alignment holes 134 thereon . a die paddle 136 is connected to first carriers 132 by means of tie bars 138 . the die paddle 136 has sufficient length and width to easily accommodate semiconductor chips or dice of varying sizes and shapes . tie bar cut zones 140 and attachment tabs 142 are provided on tie bars 138 for use in assembling the semiconductor device as described hereinbelow . attachment tabs 142 consist of co - planar extensions emanating from the tie bars , each attachment tab 142 being substantially larger and / or wider than the tie bar 138 to which the attachment tab 142 is connected , although the attachment tab 142 may be any desired size and / or configuration suitable for use . tie bar cut zones 140 consist of preweakened , cutaway or recessed portions located between the attachment tabs 142 and the first carriers 132 on the tie bars 138 . as previously described hereinbefore , the tie bars 138 are bent downwardly , so as to position the die paddle 136 in a substantially horizontal arrangement with and at a lower level in relation to the first carriers 132 and first lead frame 130 . because the degree of pitch in the bend , as well as the length and width of the tie bars 138 , are dependent on the height of the semiconductor chip or die to be placed on the die paddle 136 , the tie bars 138 will correspondingly vary with regard to shape and angle of bend in order to accommodate a wide variety of semiconductor device shapes and sizes . inclusion of first carriers 132 and alignment holes 134 permit the use of existing equipment used in single lead frame processes to accomplish the attachment of the semiconductor device 144 onto the die paddle 136 . fig1 illustrates a second lead frame 148 according to a second embodiment of the present invention . the second lead frame 148 comprises second carriers 150 running along the two longitudinal sides of the second lead frame 148 , alignment holes 152 , a plurality of leads 154 consisting of an inner lead portion 154a , which does not overlap the die paddle or the active surface of a semiconductor device , and an outer lead portion 154b , dam bars 156 tying the leads 154 to each other and to second carriers 150 , and attachment tab receiving portions 158 having apertures 158 &# 39 ; therein . each attachment tab receiving portion 158 is formed being of substantially the same size and shape as the attachment tab 142 , or at least as large and substantially the same shape with which it is to be attached , although , the attachment tab 142 and attachment tab receiving portion 158 to which it is attached may have any suitable desired size and shape , depending upon the geometry and size of the semiconductor device , the die paddle , and the lead frame . the second lead frame 148 can be made from any metallic material , non - metallic material , or any combinations thereof , which exhibit desirable properties with respect to , for example , electrical conductivity , coefficient of thermal expansion , strength , and formability which are compatible with , although preferably a different or separate material from , the first lead frame 130 , but yet compatible therewith and with the semiconductor device 144 . well known examples of such materials ( used alone or in combination ) include , but are not limited to , alloy 42 , copper , aluminum , and silver . attachment tab receiving portions 158 having apertures 158 &# 39 ; therein preferably consist of co - planar , flat extensions of the second carriers 150 . alignment holes 134 and 152 can be formed in a variety of shapes and positions with the purpose of accommodating particular types of equipment used both to align and weld the first lead frame 130 to the second lead frame 148 , as further described below . alignment holes 134 and 152 preferably consist of uniformly shaped extruded sections of first and second carriers 132 and 150 . fig1 illustrates the assembled first lead frame 130 and second lead frame 148 according to the second embodiment of the present invention . the semiconductor device 144 is attached or bonded onto the die paddle 136 of the first lead frame 130 using a conventional single lead frame process and equipment . as previously described , the first lead frame will comprise a die paddle 136 of sufficient size and sufficient depth ( in relation to the first carriers 132 ) to accommodate a preselected semiconductor chip of a particular length , height , and width . the semiconductor device 144 can be bonded onto the die paddle 136 with , for example , silver paste , polyamide , or any other means of bonding known in the art . once the semiconductor device 144 has been bonded to the die paddle 136 , the first and second lead frames 130 , 148 are aligned by superimposing a bottom surface of the second lead frame 148 onto a top surface of the first lead frame 130 and by aligning alignment holes 134 of lead frame 130 with the corresponding alignment holes 152 of the second lead frame 148 . in the resulting alignment , the inner lead portions 154a of the second lead frame 148 extend adjacent two of the edges of the semiconductor device 144 . the attachment tabs 142 of the first lead frame 130 are then attached or welded or bonded to the tab receiving portions 158 of the second lead frame 148 . it is understood that any suitable adhering or welding processes known in the art , such as spot welding , heat pressure welding , adhesive taping , polyamide bonding , etc . can be used . once the alignment and adhering steps are completed , the first carriers 132 of the first lead frame 130 are removed from the die paddle 136 , tie bars 138 , and attachment tabs 142 by severing or cutting the tie bar cut zones 140 using any suitable severing or cutting tool which can extend through apertures 158 &# 39 ; of attachment tab receiving portion 158 in the second lead frame 148 . the carriers 132 of the first lead frame 130 are discarded , leaving an intact second lead frame 148 including a die paddle 136 which is connected to the attachment tab receiving portion 158 of the second lead frame 148 by means of the tie bars 138 and attachment tabs 142 . thus , the present step in the method converts the double lead frame assembly of the prior &# 34 ; align and weld &# 34 ; step into a single lead frame assembly in order to facilitate the use of conventional single lead frame equipment in conducting the subsequent wire bonding step of the assembly process . next , the inner lead portions 154a are subsequently connected by wires 200 to the appropriate bond pads 146 on the active surface of the semiconductor device 144 . the wires 200 may be bonded to the inner portions 154a and bond pads 146 by any suitable means , such as wire bonding . it will be understood that changes , additions , deletions , and modifications as described hereinbefore may be made to the present invention which fall within the scope thereof . | 7 |
fig1 is a block diagram of a system 100 that multiplexes storage of back - up data . the system 100 includes client computers 102 , 112 , 118 and disks 104 , 114 , 120 , respectively coupled by buses 106 , 116 , 122 . the system 100 further includes a server computer 108 coupled to the client computers 102 , 112 , 118 via a network 110 . those skilled in the art will recognize that the present invention may be implemented on non - network computer systems also . the server computer 108 is coupled via bus 126 to storage unit 124 . the storage unit 124 includes tape drives 128 , 130 which are also coupled to bus 126 . the buses 106 , 116 , 122 , 126 conform to small computer system interface ( scsi ) parallel interface standards ( also known as ansi x 3 t 9 . 2 ). the network 110 conforms to iso / osi ( international standards organization / open system interconnection ) standards and transmission control protocol / internet protocol ( tcp / ip ) standards . the client computers 102 , 112 , 118 may contain one of several operating systems , such as nt ® ( a registered trademark of microsoft inc . of redmond , wash . ), macintosh ® ( a registered trademark of apple computer , inc . of cupertino , calif . ), netware ® ( a registered trademark of novell , inc . of orem , utah ), or unix ®. each client computer 102 , 112 , 118 has a back - up archive ( bkar ) process ( not shown ) for reading data from its disk 104 , 114 , 120 and sending the data across the network 110 to the server computer 108 . the data sent from a client computer to a server computer for back - up is referred to as “ back - up data .” the server computer writes the back - up data into the storage unit 124 . the server computer 108 is comparable in capabilities to sparccenter 2000 machines , manufactured by sun microsystems of mountain view , calif . the sparccenter 2000 ™ machines run solaris ® ( a registered trademark of sun microsystems , inc . of mountain view , calif .) a unix ® based multitasking operating system available from sunsoft corp . those skilled in the art will recognize that various platforms from other vendors , such as windows nt , are also acceptable . the server computer 108 contains processes for concurrently receiving backup data from the client computers 102 , 112 , 118 and multiplexing the back - up data onto the tape drives within the storage unit 124 at the highest rate of speed that the storage unit 124 can handle . the multiple data streams also enable the bkar process within the client computers to take advantage of any extra server computer 108 capacity or network 110 bandwidth that may be available . the server computer 108 is further discussed with reference to fig2 . the storage unit 124 is a conventional non - volatile information storage device , such as a tape stacker , a tape library , a tape carousel , a robotics device or an optical jukebox . while “ tape ” is the storage medium discussed throughout this specification , those skilled in the art recognize that other storage media may be used . the storage unit 124 includes a set of tape drives 128 , 130 each available for reading and writing a tape inserted therein . preferably , the number of tape drives 128 , 130 may range from as few as one to as many as 10 or more . fig2 is a block diagram of a server computer 108 . the server computer 108 includes a processing unit 202 , an input device 204 , an output device 206 , a network interface 208 , an internal memory 210 , and a storage unit interface 216 , each coupled via a bus 218 . the internal memory 210 includes a program memory 212 and a shared memory 214 . additionally , the network interface 208 is coupled to the network 110 and the storage unit interface 216 is coupled to the bus 126 . elements 202 , 204 , 206 , 208 , and 216 are conventionally known . however within the internal memory 210 , the program memory 212 contains program instructions which are not conventionally known and the shared memory 214 contains data structures which are also not conventionally known . the processing unit 202 executes program instructions which are read from the program memory 212 . the input device 204 includes a keyboard and / or mouse for input of commands and data to the processing unit 202 . the output device 206 is a display monitor for displaying information received from the processing unit 202 . the network interface 208 provides the server computer 108 with a communications link with the client computers 102 , 112 , 118 over the network 110 . the network interface 208 includes a hardware interface , generally implemented as a network interface card ( nic ), which is not shown . the nic provides necessary signal translation between the server computer 108 and the network 110 . the storage unit interface 216 preferably provides an interface for routing data to and receiving data from the storage unit 124 . the program memory 212 stores computer readable program instructions for controlling how the processing unit 202 accesses , transforms , and outputs data , as described in detail below with reference to fig5 . the program memory 212 preferably comprises both a volatile and a non - volatile portion . those skilled in the art will recognize that in alternate embodiments the program memory 212 could be supplemented with other computer useable mediums , including a compact disk , a hard drive or a memory card . the shared memory 214 provides a set of memory buffers for storing backup data received from the client computers 102 , 112 , 118 . during back - ups , each client computer 102 , 112 , 118 is preferably assigned its own dedicated memory buffer area within the shared memory 214 . the shared memory 214 is also used for exchanging data between multiple processes stored within the program memory 212 . fig3 is a block diagram of the shared memory 214 within the server computer 108 of fig2 . the shared memory 214 stores a set of memory blocks 302 , 308 , 310 and a set of buffer availability flags 312 . each memory block is dedicated to a respective client computer from which the server computer 108 is configured to receive back - up data . thus , client “ 1 ” computer memory block 302 is dedicated to receive back - up data only from the client “ 1 ” computer 102 ; client “ 2 ” computer memory block 308 is dedicated to receive back - up data only from the client “ 2 ” computer 112 ; and client “ n ” computer memory block 310 is dedicated to receive back - up data only from the client “ n ” computer 118 . in the preferred embodiment , each memory block 302 , 308 , 310 consists of four 64 kbyte buffers 304 for a total of 256 kbytes of memory . however , a user may reconfigure the size and number of buffers 304 within the memory blocks 302 , 308 , 310 . the buffer availability flags 312 indicate which buffers 304 in blocks 302 , 308 , 310 contain new data . if a buffer availability flag 304 is set to “ empty ,” then there is no new back - up data in that particular buffer . if the buffer availability flag 304 is set to “ full ,” then there is new back - up data in that buffer . fig4 is a block diagram of a data structure for a buffer 304 within the memory block 302 of fig3 . the buffer 304 stores a client identification ( id ) tag 402 for identifying the client computer 102 , 112 , 118 with which back - up data 404 is associated . in the case where each buffer 304 is 64 k in size , the client identification ( id ) tag 402 is preferably allotted 0 . 5 kbytes of memory and the back - up data 404 is allotted 63 . 5 kbytes of memory . each buffer 304 temporarily stores the data received from one of the client computers 102 , 112 , 118 over the network 110 . fig5 is a dataflow diagram of the system 100 of fig1 . a back - up scheduler unit 502 , a back - up tape manager ( bptm ) 504 and an operating system are stored in the program memory 212 . the operating system is preferably either a unix ® or windows nt ® based multitasking operating system , for providing network services and controlling the configuration and usage of the hardware and software resources of server computer 108 according to the programs stored in the back - up scheduler unit 502 and the bptm 504 . the back - up scheduler unit 502 tailors the multiplexed data back - up process to the performance capabilities of an individual set of client / server computer resources . preferably , at least the following four parameters are configurable . the first parameter is a maximum number of client computers 102 , 112 , 118 having data which can be backed - up and multiplexed onto any single tape drive 128 , 130 within the storage unit 124 . this parameter is set based on the ability of server computer 108 to handle concurrent jobs . each client computer 102 , 112 , 118 requiring that its data be backed - up by the server computer 108 is defined by the server computer 108 as a “ job .” the second parameter is a maximum number of jobs from a given schedule that can be multiplexed onto any one drive . this value is set individually for each schedule within a class . a “ class ” is a collection of client computers with similar back - up needs . a “ schedule ” defines how the client computer is to be backed - up ( i . e . a full - back - up or an incremental - back - up ) and how many jobs it may be associated with . each class has a set of back - up “ schedules ” associated with it . thus , a client computer back - up job corresponds to a “ client computer ” and “ schedule ” within a given “ class .” a single drive may accept jobs from different schedules so long as the maximum number of client computers 102 , 112 , 118 backed - up per tape drive 128 , 130 is not exceeded . the third parameter is a maximum number of jobs that may be run concurrently for any given class . the fourth parameter is a maximum number of client computer back - up jobs that may be concurrently run from any single client computer 102 , 112 , 118 . while a preferred set of configuration parameters have been discussed , those skilled in the art will be aware of other parameters that need to be configured . the back - up tape manager ( bptm ) 504 is comprised of multiple reading processes 506 , a writing process 508 , and a de - multiplexing process 510 . in the preferred embodiment , the server computer 108 creates one reading process for receiving back - up data from each of the client computers 102 , 112 , 118 . thus if there are three client computers , the server will create three reading processes . these reading processes 506 preferably operate concurrently . each reading process monitors the network 110 for back - up data packets from the reading process &# 39 ; s assigned client computer 102 , 112 , 118 and inserts the data into a next available circular buffer within the client computer &# 39 ; s assigned memory block 302 , 308 , 310 . for example , if a reading process identifies a data packet from the client “ 1 ” computer 102 , then the reading process looks within the client “ 1 ” memory block 302 for a buffer availability flag within the buffer availability flags 312 set to “ empty .” when an “ empty ” buffer is found , the reading process creates a client id tag 402 for the data packet , asks the network to place the data packet into the memory buffer , and sets the buffer availability flag to “ full .” the writing process 508 is in communication with the reading processes 506 and copies each client computer 102 , 112 , 118 back - up data from its dedicated memory block 302 , 308 , 310 buffer to be multiplexed with data from the other client computers onto a tape within one of the tape drives 128 , 130 . first , the writing process 508 requests that the back - up scheduler unit 502 assign a tape drive 128 , 130 for receiving a new set of back - up data . next , the writing process 508 writes a “ tape header ” and a “ client back - up header ” corresponding to the client computer 102 , 112 , 118 from which the back - up data in the memory blocks 302 , 308 , 310 is to be received . the “ tape header ” initializes a blank tape with a set of conventional tape drive information . the “ client back - up header ” indicates that back - up data for a particular client computer exists on this particular tape . next , the writing process 508 scans through all of the buffers within each of the memory blocks 302 , 308 , 310 looking for buffer availability flags which are set to “ full .” upon finding a “ full ” buffer , the writing process 508 copies the client id tag 402 and the back - up data 404 from the buffer of memory blocks 302 , 308 , and 310 onto the tape in one of the tape drives 128 , 130 . after the data has been copied to tape , the writing process 508 sets the buffer availability flag to “ empty ” and resumes scanning for other buffers with their buffer availability flags set to “ full .” since the writing process 508 just copies to tape data from whichever buffers happen to be “ full ,” the back - up data from any one client computer may be randomly distributed throughout the tape and intermixed with back - up data from all of the other client computers that the server computer 108 services . if a buffer is in the process of being filled by a reading process 506 , the server computer 108 preferably does hot wait for the buffer to be filled , rather the server computer 108 keeps skipping onto a next buffer which may already be full of data to be backed - up . during the course of the multiplexing process , new client computers may have their data scheduled to be backed - up to tape . in such a case , the back - up scheduler unit 502 determines if any configuration parameters might be violated by adding the new client computer to the back - up schema . if none of the configuration parameters would be violated , the back - up scheduler unit 502 initiates a new client computer to transmit its back - up data to the server computer 108 . the bptm 504 also sets aside a new memory block and creates a new reading process 506 for the new client computer . the writing process 508 writes a new “ client back - up header ” to the tape and writes the new client computer &# 39 ; s back - up data to tape in the same manner as discussed above . the de - multiplexing process 510 processes requests to retrieve back - up data that has been multiplexed on a source tape . to begin , a user selects a backed - up file to either be restored to a client computer 102 , 112 , 118 via the network 110 or to be duplicated onto a destination tape . the client identification tag of computers 102 , 112 , and 118 is then identified and passed to the de - multiplexing process 510 . next , the de - multiplexing process 510 reads the tape looking at the client id tag within each set of multiplexed data on the source tape . if the client id tag within the set of multiplexed data matches the chosen client id tag , the de - multiplexing process 510 discards the client id tag from the set of multiplexed data and either transmits the remaining data block to the requesting client computer 102 , 112 , 118 or writes the data block to a destination tape . the resulting image produced is a completely restored copy of the file . preferably the restored image is in a tar format . fig6 is a block diagram of a data format 600 for multiplexing back - up data to tape . the data format 600 is comprised of a tape header 602 , a tape mark 603 , client ( back - up ) headers 604 , 606 , 624 and multiplexed data entries 608 , 614 , 616 , 618 , 620 , 622 , 626 , 628 , 630 , 632 . each multiplexed data entry ( e . g ., 608 ) includes a client id tag 610 and a data block 612 . in the example tape shown in fig6 from time t 0 through t n − 7 , only back - up data from the client “ 1 ” computer 102 and the client “ 2 ” computer 112 were being received and multiplexed to tape . of that data , the client “ 1 ” computer 102 had several back - up data entries 608 , 614 , 618 , 622 written to the tape , and the client “ 2 ” computer 112 had several back - up data entries 616 , 620 written to tape . then at time t n − 7 , client “ n ” computer 118 started to back - up its data to tape . as a result , the tape mark 603 and client back - up headers 604 , 606 , 624 were written to tape . subsequently , the client “ n ” computer 118 stored three back - up data entries 626 , 630 , 632 to tape , while client “ 1 ” computer 102 stored back - up data entry 628 . fig7 is a flowchart of a method for configuring the server computer 108 for multiplexed data back - up . the method begins in step 702 where a user commands the back - up scheduler unit 502 to limit the number of client computers whose back - up data can be multiplexed onto a single tape drive 128 , 130 . next , in step 704 , a user commands the back - up scheduler unit 502 to limit the number of jobs assigned to a tape drive 128 , 130 for a given schedule . for example , if tape drive 128 already has four active jobs , and a schedule of client computer 102 has a limit of at most four jobs that it may be backed - up together with , then the client computer 102 can not be added to the multiplexing for tape drive 128 . in step 706 , a user commands the back - up scheduler unit 502 to limit the number of jobs that may be run concurrently for any given class . in step 708 , a user commands the back - up scheduler unit 502 to limit the number of back - up jobs that may be received from a single client computer . after step 708 , the preferred method of configuration ends . fig8 is a flowchart of a method for reading back - up data . the method begins in step 802 where if the reading process 506 determines that a buffer availability flag is set to empty , the method proceeds to step 804 , otherwise the method ends . next , in step 804 , the reading process 506 receives back - up data over the network 110 from a client computer 102 , 112 , 118 . in step 806 , the reading process 506 , first , routes the back - up data of computers client 102 , 112 , and 118 to a buffer within a memory block 302 , 308 , 310 whose buffer availability flag is set to “ empty ,” second , attaches a client identification ( id ) tag 402 to the back - up data , and third , sets the buffer availability flag to “ full .” after step 806 , the reading process is complete . fig9 is a flowchart of a method for writing back - up data . the method begins in step 902 where the writing process 508 within the back - up tape manager 504 scans all of the buffers within each of the memory blocks 302 , 308 , 310 looking for buffer availability flags which are set to “ full .” in step 904 , if a buffer availability flag is set to “ full ,” the method proceeds to step 906 , else the method returns to step 902 . in step 906 , the writing process 508 writes a “ tape header ” 602 to the tape in a tape drive 128 , 130 , if one does not yet exist . the tape header contains a conventional set of information associated with putting data onto a tape . in step 908 , the writing process 508 writes a “ client back - up header ” 604 , 606 , 624 to the tape , if one does not yet exist . in step 910 , the writing process 508 copies the client identification tag 402 and the back - up data 404 from the buffer onto the tape and resets the buffer availability flag to “ empty .” after step 910 , the writing process is complete . fig1 is a flowchart of a method for adding a new client computer 102 , 112 , 118 to the multiplexed data back - up process . the method begins in step 1002 where the back - up scheduler 502 schedules a new client computer to send back - up data to the server computer 108 . next , in step 1004 , the back - up scheduler 502 queries the back - up scheduler unit 502 to determine whether the addition of a new client computer will violate any of the configuration parameters . if there will be a violation , the preferred method ends , else it proceeds to step 1006 . in step 1006 , the back - up tape manager ( bptm ) 504 begins multiplexing back - up data from the new client computer onto one of the tapes in a tape drive 128 , 130 . after step 1006 , the preferred method ends . fig1 is a flowchart of a method for de - multiplexing data from a multiplexed back - up tape . the method begins in step 1102 where de - multiplexing process 510 of bptm 504 receives a chosen client id tag corresponding to a client computer 102 , 112 , 118 whose back - up data is to be either restored to the client computer 102 , 112 , 118 or duplicated to a destination tape . in step 1104 , the de - multiplexing process 510 reads a client id tag 610 from a next set of multiplexed data 608 stored on a source tape . in step 1106 , if the de - multiplexing process 510 determines that the chosen client id tag corresponds to the client id tag 610 just read from the source tape , then the method proceeds to step 1108 , else the method returns to step 1104 . in step 1108 , the de - multiplexing process 510 deletes the client id tag 610 from the set of multiplexed data 608 . in step 1109 , if the back - up data is being restored to a client computer , the de - multiplexing process 510 transmits the data block 612 from within the set of multiplexed data 608 to the client computer 102 , 112 , 118 over the network 110 . in step 1110 , if the back - up data is being duplicated , the de - multiplexing process 510 writes the data block 612 from within the set of multiplexed data 608 to a destination tape . in step 1112 , the de - multiplexing process 510 checks to see whether any more sets of multiplexed data are left to read from the source tape . if there are , the method returns to step 1104 , else the method ends . while the present invention has been described with reference to certain preferred embodiments , those skilled in the art will recognize that various modifications may be provided . variations upon and modifications to the preferred embodiments are provided for by the present invention , which is limited only by the following claims . | 7 |
a total of 516 unrelated taiwanese pd subjects ( 45 . 0 % females ) were recruited from the neurology clinics of chang gung memorial hospital ( cgmh ). all patients were diagnosed with probable idiopathic pd by two neurologists specialized in movement disorders ( y .- r . wu and c .- m . chen ). subjects with prior history of multiple cerebrovascular events or other causes of parkinsonian symptoms ( e . g . brain injury or tumor , encephalitis , antipsychotic medication ) were excluded . the mean age at onset ( aao ) of pd was 62 . 0 ± 11 . 5 years , ranging between 19 and 93 years . a group of 516 normal controls without neurodegenerative diseases were recruited from the same ethnic community . control subjects ( 50 . 2 % females ) had mean age at examination of 60 . 9 ± 12 . 3 years , ranging between 20 and 92 years . all examinations were performed after obtaining written informed consent from patients and control individuals . genomic dna was extracted from peripheral blood lymphocytes using the standard protocols . for pd patients with onset ≧ 50 ( n = 80 , mean age at onset 43 . 7 ± 0 . 7 years , 33 . 7 % females ), rna was extracted using paxgene blood rna kit ( preanalytix ). the rna was dnase ( stratagene ) treated , quantified , and reverse - transcribed to cdna using high capacity cdna reverse transcription kit ( applied biosystems ). using polymerase chain reaction ( pcr ) with designed primers and conditions ( table 1 ), the 1955 - bp amplified fbxo7 cdna was gel purified and sequenced directly using the abi prism 3130 genetic analyzer ( applied biosystems ). athe psti restriction site was created by pcr using a mismatch primer . for y52c amplification , the underlines in the primer sequence and enzyme recognition site indicate the mismatch nucleotide and polymorphic site , respectively . for cdna cloning , the underlines in the primer sequence indicate the introduced hindiii and agei restriction sites . the y52c variants were verified by genomic dna pcr and sequencing . for population screening , the y52c was examined using the psti restriction enzyme as shown in table 1 . the digested pcr products were visualized with ethidium bromide after electrophoresis on 2 . 2 % agarose gel . using the designed primers ( as shown in table 1 ) to remove translation termination codon , the full - length fbxo7 cdna fragments from an individual heterozygous for y52c were cloned into pgem - t easy vector ( promega ) and sequenced . the 1 . 7 kb hindiii ( added in the forward primer )- agei ( added in the reverse primer ) fragment were removed from pgem - t easy vector and ligated into the corresponding sites of pegfp — n1 ( clontech ) to generate wild - type and y52c fbxo7 cdna in - frame fused to the egfp gene . human embryonic kidney ( hek )- 293 ( atcc no . crl - 1573 ) cells were cultivated in dulbecco &# 39 ; s modified eagle &# 39 ; s medium containing 10 % fetal bovine serum in a 37 ° c . humidified incubator with a 5 % co 2 atmosphere . cells were plated into 6 - well ( 6 × 10 5 / well ) dishes , grown for 20 hr and transfected by the lipofection method ( gibcobrl ) with the egfp - tagged fbxo7 constructs ( 4 μg / well ). the cells were grown for another 48 hr . to evaluate the stability of fbxo7 protein , protein synthesis inhibitor cycloheximide ( 200 μg / ml ) was added 24 hr after transfection for 0 , 6 , 12 , 24 , 36 , and 48 hr before protein preparation . for visualizing intracellular fbxo7 - egfp protein , transfected cells on coverslips were stained with 4 ′- 6 - diamidino - 2 - phenylindole ( dapi ) to detect nuclei . the stained cells were examined for dual fluorescent imaging using a leica tcs confocal laser scanning microscope . for total protein preparation , cells were lysed in hypotonic buffer ( 20 mm hepes ( ph 7 . 4 ), 1 mm mgcl 2 , 10 mm kcl , 1 mm dtt , and 1 mm edta ( ph 8 . 0 )) containing the protease inhibitor mixture ( sigma ). after sonication and sitting on ice for 20 min , the lysates were centrifuged at 14 , 000 × g for 30 min at 4 ° c . protein concentrations were determined using the bio - rad protein assay kit and albumin referred as standards . total proteins ( 25 μg ) were electrophoresed on 10 % sds - polyacrylamide gel and transferred onto nitrocellulose membrane ( schleicher and schuell ) by reverse electrophoresis . after being blocked , the membrane was stained with anti - fbxo7 ( 1 : 3000 dilution , abnova ), anti - traf2 ( 1 : 500 dilution , santa cruz ), anti - tubulin ( 1 : 10000 dilution , genetex ), anti - neomycin ( 1 : 1000 dilution , millipore ), anti - gapdh ( 1 : 1000 dilution , mdbio ), or anti - actin ( 1 : 10000 dilution , millipore ) antibody . the immune complexes were detected using horseradish peroxidase - conjugated goat anti - mouse ( jackson immunoresearch ) or goat anti - rabbit ( rochland ) igg antibody ( 1 : 10000 dilution ) and immobilon ™ western chemiluminescent hrp substrate ( millipore ). the sh - sy5y - derived flp - in host cells and flp - in ™ t - rex ™ system ( invitrogen ) was used to generate stably induced sh - sy5y cell lines exhibiting tetracycline - inducible expression of wild - type and y52c fbxo7 . briefly , the sh - sy5y host cells were co - transfected with pog44 plasmid ( constitutively expressed the flp recombinase ) and pcdna5 / frt / to - fbxo7 - egfp plasmid according to the supplier &# 39 ; s instructions . these cell lines were grown in medium containing 5 μg / ml blasticidin and 100 μg / ml hygromycin . doxycycline ( dox , 5 μg / ml ) was added to induce egfp - tagged fbxo7 expression for two days . the proteins were prepared for western blotting using antibody to fbxo7 or actin as described . neuronal phenotypes were examined after induced differentiation with retinoid acid ( 10 μm ) and induced expression of fbxo7 for 7 to 21 days . the genotype frequency data and the expected genotypic frequency under random mating were computed and chi - square tested for hardy - weinberg equilibrium using standardized formula . the genotype and allele association analysis was carried out using the chi - square test . odds ratios with 95 % confidence intervals ( 95 % ci ) were calculated to test association between genotype / allele and disease . differences in functional assays were analyzed by two tailed student &# 39 ; s t - test . the values of p & lt ; 0 . 05 were considered significant . we modeled the three dimensional structures of the wild type and y52c fbxo7 proteins by comparative methods and energy minimization using the program swiss - model . the 2 . 9 - å coordinate set for the crystal structure of human ubc protein ( pdb code 2zvo , chain a ) served as the template for modeling the residue 1 - 79 of human fbxo7 . the energy computation was done with the gromos96 implementation of swiss - pdbviewer . the resulting fbxo7 three - dimensional models were manipulated and rendered in pymol ( the pymol molecular graphics system , version 1 . 2r3pre , schrödinger , llc ). with reference to fig1 a , there is shown the chromatograms of direct cdna sequencing of y52c . substitution that caused change in the peptide sequence was identified : a a155g substitution leading to an amino acid change from tyrosine to cysteine in position 52 . the variant was confirmed using pcr - restriction fragment length polymorphism ( rflp ) method as shown in fig1 b . according to fig1 c , y52c is not evolutionary conserved in the known mammalian homologues of the fbxo7 protein . a case - control study in a cohort of pd patients ( n = 516 ) and ethnically matched controls ( n = 516 ) was conducted to assess the association of y52c with the risk of pd . the genotype and allele distributions of the snp in patients and controls are displayed in table 2 . as shown in table 2 , y52c genotype frequency confirmed to be in the hardy - weinberg equilibrium . the frequency of ag genotype ( 0 . 8 % vs . 2 . 3 %, p = 0 . 046 ) or g allele ( 0 . 4 % vs . 1 . 2 %, p = 0 . 046 ) was significantly lower in pd patients than the controls . when odds ratios of the at - risk genotype / allele were calculated , y52c ag genotype or g allele demonstrated a trend toward decrease in risk of developing pd ( odds ratio : 0 . 33 , 95 % confidence interval : 0 . 09 - 0 . 95 , p = 0 . 055 ˜ 0 . 056 ). meta - analysis combining our patient and control subjects as well as the population in luo &# 39 ; s study yielded results with statistically significant difference in genotype ( 0 . 9 % vs . 2 . 8 %, p = 0 . 012 ) and allele ( 0 . 5 % vs . 1 . 4 %, p = 0 . 012 ) distribution between patients and controls . the negative association of the y52c ag genotype or g allele with pd was significant ( odds ratio : 0 . 32 - 0 . 33 , 95 % confidence interval : 0 . 12 - 0 . 77 , p = 0 . 016 - 0 . 017 ). with reference to fig2 a , although y52c fbxo7 protein displayed nuclear and cytosolic staining pattern similar to wild type , a stronger signal was observed with y52c . to further examine the transiently expressed fbxo7 - egfp fusion proteins , protein blotting with fbxo7 antibody was performed . as shown in fig2 b , while no specific band was detected with vector - transfected cells , fbxo7 - egfp fusion proteins in the expected size range for wild - type and y52c constructs were observed . however , the protein expression levels of y52c was increased compared with the wild - type ( 211 %, p = 0 . 016 ). the stability of y52c variant was further examined in a cycloheximide ( 200 μg / ml ) chase experiment . while the wild - type protein was degraded to 68 %, 18 %, 11 %, 9 % and 7 % left after 6 , 12 , 24 , 36 , and 48 hr of protein synthesis blocking , reduced rates of decay were observed for y52c variant ( 90 %, 78 %, 72 %, 52 %, and 21 % remained , respectively ) ( fig2 c ). to understand the structure - based information of y52c polymorphism in fbxo7 , homology modeling of wild type and y52c fbxo7 was performed . after energy minimization , the modeled structures for wild type and y52c were shown in fig3 . the potential energies of wild - type and y52c variant were − 2463 . 854 and − 2471 . 736 kcal / mol , respectively , indicating y52 fbxo7 exhibited a more stable feature than wild type . according to hydrogen - bond ( h - bond ) computing analysis , the h - bond interaction of tyr54 and cys52 was shown . through binding and mediating ubiquitin conjugation to traf2 , fbxo7 was identified as a negative regulator of nf - κb signalling . to assess y52c &# 39 ; s effect on traf2 abundance , wild - type or y52c fbxo7 cdna plasmid was transfected into hek - 293 cells and protein blottings with traf2 and fbxo7 antibodies were performed as shown in fig4 a - 4b . referring to fig4 a , wild - type or y52c cdna transfection significantly increase fbxo7 abundance ( 3 . 11 ˜ 7 . 11 folds , p = 0 . 000 ) while compared with the endogenous fbxo7 level . between wild - type and y52c fbxo7 , the y52c level was significantly higher than that of wild - type ( 6 . 15 ˜ 7 . 11 vs . 3 . 11 ˜ 4 . 01 , p = 0 . 001 ). accompanying that , traf2 protein abundance was significantly decreased in wild type or y52c fbxo7 cells ( 0 . 69 ˜ 0 . 0 . 89 , p = 0 . 008 ˜ 0 . 001 ) as shown in fig4 b . in y52c cells , the traf2 expression level was significantly lower than that of wild - type cells ( 0 . 69 ˜ 0 . 70 vs . 0 . 80 ˜ 0 . 89 , p = 0 . 010 ). in addition , anti - actin and anti - neomycin antibodies were used as loading and transfection controls in fig4 c . to test the effect of y52c on neuronal phenotype , we constructed flp - in sh - sy5y cells with wild - type or y52c fbxo7 - egfp expression in an inducible fashion . with regard to fig5 a , immunoblot analysis shows that the fbxo7 protein level was significantly increased in y52c cells as compared to that of wild type cells after induction with doxycycline (+ dox ) for 2 days ( 128 %, p = 0 . 042 ). compared to the non - induced cells (− dox ), traf2 abundance was significantly decreased in both wild type ( 100 % vs . 120 %, p = 0 . 024 ) and y52c ( 87 % vs . 128 %, p = 0 . 022 ) fbxo7 - egfp expressed cells . the difference of traf2 abundance between wild type and y52c fbxo7 - egfp expressed cells was also significant ( 100 % vs . 87 %, p = 0 . 042 ). these fbxo7 cells were induced for differentiation with retinoic acid for 7 to 21 days . representative fluorescence microscopy images of cells differentiated for 21 days are shown in fig5 b . significant more total outgrowth in y52c cells was observed compared to wild type cells after differentiation for 7 ˜ 21 days ( 131 ˜ 165 %, p = 0 . 014 ˜ 0 . 000 ). although the present invention has been explained in relation to its preferred embodiment , it is to be understood that many other possible modifications and variations can be made without departing from the spirit and scope of the invention as hereinafter claimed . | 2 |
according to an aspect of the present invention , there is provided a technology capable of preventing the adverse influences on the laser characteristics by the stress , while providing the regions 129 to be fixed on the submount by the solder at the aforementioned positions to sufficiently suppress the temperature rise of the stripe waveguides 113 of the aforementioned array laser . the semiconductor laser is formed by soldering a laser chip 124 and a submount 125 . the laser chip 124 includes : an active layer ( as designated by reference numeral 106 in fig1 ) made of a first semiconductor layer and formed over a semiconductor substrate ; cladding layers ( as designated by reference numerals 102 and 107 in fig1 ) made of second and third semiconductor layers having conductive - types different from each other and disposed to sandwich the active layer therebetween ; a plurality of stripe waveguide structures ( as designated by reference numeral 113 in fig1 ) arranged in parallel on the semiconductor substrate face ; and electrodes 116 insulated electrically from each other to feed currents independently to the individual stripe waveguides 113 and arranged in parallel with the stripe waveguides 113 . the submount 125 includes : an electrode layer 127 and a solder layer 128 provided in parallel with each electrode 116 of the laser chip 124 to energize each electrode 116 therethrough and to be adhered with the laser chip face on which the laser structure is formed . in the laser chip 124 of the semiconductor laser , the regions 129 are provided to be fixed on the submount 125 by soldering . in at least portion of the regions 129 , the stress absorbing layers 121 is provided for absorbing the stress which is generated in the cooling process from a solder solidifying temperature to the room temperature due to the thermal expansion coefficient difference between the submount and the semiconductor substrate . the stress absorbing layers 121 are provided by forming gaps 120 in the electrodes or by using a metal 202 such as in having a yielding limit stress of 5 mpa or less or an organic material such as a photoresist 301 . if the stress absorbing layers 121 are formed all over the laser chip , there is also provided a stress suppressing effect . however , the heat generated in the stripe waveguide 113 is dissipated through the stress absorbing layers 121 of a poor thermal conductivity . therefore , in this case , the temperature rise of the stripe waveguide 113 becomes high . according to an aspect of the present invention , there is provided a semiconductor laser array , which can prevent the stress , as generated in the cooling procedure from the solder solidifying temperature to the room temperature due to the thermal expansion coefficient difference between the submount and the semiconductor substrate when assembling the array - type semiconductor laser , from affecting the stripe waveguide 113 adversely , and which is excellent in the heat dissipation and has a thermal stability in the optical output for enduring its use as a printer light source . if the distance from the region to be fixed on the submount by soldering it to the stripe waveguide 113 is 10 μm or less , the heat to be dissipated through the electrodes is so sufficient as to satisfy the characteristics as the printer array laser . at this time , the regions 129 fixed on the submount by soldering them , as shown in fig1 , are formed to have the stress absorbing layers 121 for absorbing the stress to be generated due to the thermal expansion coefficient difference between the submount 125 and the laser chip 124 , so that the stripe waveguide 113 can be prevented from being influenced by the stress , deteriorated in the reliability or adversely affected by the dispersion of the wavelength . those stress absorbing layers 121 can be prepared by forming the gold - plated layer selectively to form the gaps 120 in the metal electrode , or by using a highly plastic metal layer such as the in 202 or a highly plastic organic member such as the resist layer 301 between the metal electrode of the stationary portion and the semiconductor layer . the electrodes across the stress absorbing layers 121 are shaped to bulge higher than the peripheral region of the stripe waveguide 113 , and only those regions become the regions 129 to be selectively fixed on the submount at the soldering time . it is , therefore , to suppress the dispersion of the stress of the stripe waveguide 113 due to the assembling dislocation , thereby manufacturing elements having regular characteristics . this stress - absorbing layer 121 is harder to transfer the heat than a highly conductive material such as gold . according to this structure , however , the main heat conduction passage is a shorter transverse heat conduction through the electrodes 116 . as a result , the quantity of heat to escape from the region 129 fixed on the submount by soldering it to the submount 125 through the stress - absorbing layer 121 is so small that no large deterioration occurs in heat radiation . the specific modes of embodiments of the invention are described in the following . the first embodiment manufactures an array - type semiconductor laser apparatus , as shown in fig1 , which supports a semiconductor laser chip 124 having two independently drivable stripe waveguides 113 in a common chip and which is soldered to a submount 125 having a function to dissipate the heat generated in the laser chip . this structure is made at first , as shown in fig2 , by laminating , by a metal organic chemical vapor deposition method on an n - type gaas ( n = 1 × 10 18 cm − 3 ) substrate 101 off by 10 degrees in a direction [ 011 ] from a plane ( 100 ): an n - type ( al 0 . 7 ga 0 . 3 ) 0 . 5 in 0 . 5 p ( n = 1 × 10 18 cm − 3 ) cladding layer 102 having a thickness of 1 . 8 μm ; a multiple quantum well active layer 106 having a well number 3 and composed of a ( al 0 . 5 ga 0 . 5 ) 0 . 5 in 0 . 5 ) p - light confinement layer ( non - dope ) 103 , a strained quantum well layer ( non - doped ) 104 having a thickness of 5 nm , and a ( al 0 . 5 ga 0 . 5 ) 0 . 5 in 0 . 5 ) barrier layer ( non - dope ) 105 having a thickness of 5 nm ; a p - type first cladding layer 107 made of p - type ( al 0 . 7 ga 0 . 3 ) 0 . 5 in 0 . 5 p ( p = 7 × 10 17 cm 3 ) and having a thickness of 0 . 08 μm ; a p - type etching stop layer 108 made of p - type ga 0 . 5 in 0 . 5 p ( p = 7 × 10 17 cm − 3 ) and having a thickness of 5 nm ; a p - type second cladding layer 109 made of an ( al 0 . 7 ga 0 . 3 ) 0 . 5 in 0 . 5 p ( p = 7 × 10 17 cm − 3 ) and having a thickness of 1 . 2 μm ; a p - type oxidation - retarding layer 110 made of p - type ga 0 . 5 in 0 . 5 p ( p = 7 × 10 17 cm − 3 ) and having a thickness of 0 . 01 μm ; and a p - gaas cap layer ( p = 3 × 10 18 cm − 3 ) 111 having a thickness of 4 μm , thereby forming a double hetero - structure . next , a sio 2 film of a thickness of 200 nm is deposited on the double hetero - substrate by a thermal cvd method . after this , by the photolithography technology , the sio 2 film is formed into a stripe shape having a longitudinal direction in the [ 01 (− 1 )] direction , thereby forming a sio 2 film 112 . herein , the [ 011 ] direction and the [ 01 (− 1 )] direction are different from each other by 90 degrees . the sio 2 protecting film 112 has a stripe shape of a width of 2 microns arranged at an interval of about 30 μm , and is repeatedly formed in a pair of two over the wafer at an interval equal to the width of the laser chip . next , by executing the following working process , that wafer is formed into a structure shown in fig3 . at first , by using the aforementioned stripe sio 2 protecting film 112 ( as shown in fig2 ) as a mask , a dry etching or a reactive ion etching is performed to such a position as to leave the p - type second cladding layer 109 of about 0 . 05 μm over the etching stop layer 108 . the layer left over the etching stop layer is removed by a wet etching , to form the stripe waveguide structures 113 having a ridge - shaped sectional shape . after the sio 2 protecting film 112 left over the ridge was removed , a plasma cvd method is used to form a sio 2 film 114 all over the surface . in this embodiment , the film thickness of the sio 2 film 114 is made to or less than 250 nm . this embodiment may use another insulating film other than the sio 2 film . the sio 2 film 114 has , over the stripe waveguide structures 113 , the opening 115 , in which the p - gaas contact layer 111 contacts a p - side electrode 116 formed over the sio 2 film 114 . the p - side electrode 116 is formed by depositing a ti ( titanium ) evaporated electrode ( although not shown ) and an au ( gold ) evaporated electrode ( although not shown ) sequentially in the recited order by using an eb evaporation method . in this embodiment , a barrier metal layer may also be formed between the ti evaporated electrode and the au evaporated electrode by using pt ( platinum ). the p - side electrode 116 of the structure thus made is formed into the shape , as shown in fig4 , by using the photolithography technology and an ion milling technology . as shown in fig4 , the p - side electrode 116 has such a region ( or an electrode separating region 117 ) between the two stripe waveguide structures 113 as is cleared of the electrode having a width of 15 μm , and such stripe electrode regions 118 on the two sides of the stripe waveguide structure 113 that the p - side electrode 116 is formed into a stripe shape having a width of 2 microns . next , a thick gold electrode is formed over the p - side electrode 116 of that shape by using an electrolytic plating technology . at first , first gold - plated electrodes 119 are formed by using the electrolytic plating technology over a resist covering the region including the ridge - shaped waveguide and having a width of 50 μm . at this time , the gold is not deposited on the portion , from which the p - side electrode 116 is eliminated , but the gold deposited on the remaining portion of the electrode extends transversely , too , in the stripe electrode regions 118 so that it is combined with the gold deposited on the adjoining electrodes , thereby forming a shape , in which the p - side electrode 116 covers the eliminated region , excepting the gaps 120 . the electrodes thus involving those gaps 120 is easily deformed , in case a stress is applied from the outside , to absorb the stress thereby functioning as stress - absorbing layers 121 . after the resist covering the stripe waveguides 113 was once eliminated , the electrode separating region 117 left between the two stripe waveguides 113 is covered with a resist , and is again formed with a second plated electrode 122 by an electrolytic plating . the first plated electrodes and the second plated electrode are made to have a film thickness of 3 μm individually . the process thus far described forms the semiconductor wafer having a sectional structure shown in fig5 . the semiconductor wafer thus having that laser structure formed is polished to a thickness of 100 μm to form a back electrode 123 , and is cleaved to a length of 300 μm in a resonator direction . the semiconductor wafer is divided to a width of 250 μm thereby manufacturing the array type semiconductor laser chip 124 . in the submount 125 of this embodiment , on the other hand , there are formed over an aluminum nitride substrate 126 tiptau electrodes 127 which correspond to the electrodes of the array type semiconductor laser chip 124 , and over which ausn solder patterns 128 are formed . the array type semiconductor laser chip 124 thus manufactured is assembled with its junction face being downward on the submount , as shown in fig1 . at this time , the portion , in which the stress - absorbing layer is made higher at its electrode surface from the wafer face than the region around the stripe waveguides 113 by the two gold plating steps . at the soldering time , that portion acts as regions 129 to be soldered and fixed to the submount . in the first embodiment , the plated electrodes 119 having the gaps 120 were used at the electrolytic plating time as the stress - absorbing layers 121 for preventing the stress from the submount from being transmitted to the stripe waveguide structures 113 . similar functions can be realized not only by the plated electrodes having the gaps 120 but also by in electrodes buried in the gold electrodes , for example . as the second embodiment , an example , in which the electrodes involving those in electrodes are used as the stress - absorbing layers 121 , is described with reference to fig6 . in this embodiment , too , the process up to the step of forming the stripe waveguides 113 is performed as in the first embodiment . subsequent to this step , an eb evaporation method or the like is used to evaporate ti ( titanium ) evaporated electrodes ( although not shown ), pt ( platinum ) evaporated electrodes , au ( gold ) evaporated electrodes ( although not shown ) and pt ( platinum ) are evaporated sequentially in the recited order , thereby forming a p - side electrode 201 . subsequently , the resist layer formed by the photolithography technology is evaporated with in by using the eb evaporation method , and the unnecessary portions are eliminated by a lift - off method , to form an in electrode 202 . this in electrode 202 has a thickness of about 2 μm , and a pt ( platinum ) electrode 203 is also formed thereover . the pt ( platinum ) electrode 203 has a function to prevent the in electrode from being alloyed with the peripheral gold . the gold - plated electrode 122 is formed on that structure by using an electrolytic plating method , and the p - side electrode 201 is eliminated from the regions which are not covered with the gold - plated electrode 122 and the in electrode 202 , thereby forming the electrode separating region 117 for insulating the stripe waveguides 113 from each other . the semiconductor wafer having the laser structure thus formed is polished to a thickness of 100 μm thereby forming the back electrode 123 , and is cleaved to a length of 300 μm in the resonator direction . the semiconductor wafer is divided to a width of 250 μm into a laser chip . in the submount 125 of this invention , on the other hand , there are formed over the aluminum nitride substrate 126 the tiptau electrodes 127 which correspond to the pattern of the semiconductor laser , and over which the ausn solder patterns 128 are formed . the semiconductor laser chip thus manufactured is assembled with its junction face being downward on that submount . the in electrode 202 has a higher plasticity than that of the gold electrode , and is deformed by a stress as low as about 5 mpa , so that it can absorb most of the stress generated due to the difference between the coefficients of thermal expansion between the semiconductor and the submount , thereby reducing drastically the stress to be transmitted to the stripe waveguide 113 . in the second embodiment , the in electrode is used as the stress - absorbing layer . however , the thermal conduction from the laser chip is mostly made through the gold plated electrode , so that the stress - absorbing layer can also be realized by a structure , in which a material other than a metal such as a photoresist is buried in the plated electrode . a structure , which is formed by this method , as shown in fig7 , is described as the third embodiment . this embodiment exemplifies the example , in which an electrode involving a resist layer 301 is used as the stress - absorbing layer 121 . in this embodiment , too , the process up to the step of forming the semiconductor substrate and the stripe waveguides 113 is performed as in the first embodiment . subsequent to this step , the eb evaporation method or the like is used to evaporate the ti ( titanium ) evaporated electrodes ( although not shown ), the pt ( platinum ) evaporated electrodes and the au ( gold ) evaporated electrodes ( although not shown ) are evaporated sequentially in the recited order , thereby forming the p - side electrode 116 . subsequently , the photolithography method is used to the photo - resist layer 301 is formed in the shape , as shown in fig7 . a gold electrode 302 is evaporated on the structure , and the gold - plated electrode 122 is then formed on that structure by using the electrolytic plating method , and the p - side electrode 116 is eliminated from the regions which are not covered with the gold - plated electrode 122 and the photoresist 310 , thereby forming the electrode separating region 117 for insulating the stripe waveguides 113 from each other . the semiconductor wafer having the laser structure thus formed is polished to a thickness of 100 μm thereby forming the back electrode 123 , and is cleaved to a length of 300 μm in the resonator direction . after a facet coating film was formed , the semiconductor wafer is divided to a width of 250 μm into the laser chip 124 . in the submount 125 of this invention , on the other hand , there is formed over the aluminum nitride substrate 126 the tiptau electrodes 127 which correspond to the pattern of the semiconductor laser , and over which the ausn solder patterns 128 are formed . the semiconductor laser chip thus manufactured is assembled with its junction face being downward on that submount . the resist layer 301 has a higher plasticity than that of the gold electrode , and is deformed by a stress as low as about 5 mpa , so that it can absorb most of the stress generated due to the difference between the coefficients of thermal expansion between the semiconductor and the submount , thereby reducing drastically the stress to be transmitted to the stripe waveguide 113 . the foregoing embodiments have been applied to the two - beam array having the two stripe waveguides 113 . this embodiment is an example applied to a multi - element array laser of four elements . in this multi - element array , it is difficult to form a solder - junction region between the adjoining stripe waveguides 113 . in this embodiment , the peripheral region of the stripe waveguide 113 is used as the solder - junction region having the two gold - plated layers , between which a space is formed into the stress - absorbing layer 121 . in this embodiment , too , the process up to the step of forming the semiconductor substrate and a ridge - shaped waveguide is performed as in the first embodiment . however , the stripe waveguides 113 are formed at four portions on the single chip , as shown in fig8 . subsequent to this step , the eb evaporation method or the like is used to evaporate the ti ( titanium ) evaporated electrodes ( although not shown ), the pt ( platinum ) evaporated electrodes and the au ( gold ) evaporated electrodes ( although not shown ) are evaporated sequentially in the recited order , thereby forming the p - side electrode 116 . in the periphery of 20 μm of a light emitting region , there is formed a band - shaped first plated electrode 401 , over which a ti ( titanium ) evaporated electrode 402 . subsequently , the cvd technology and the photolithography technology are used to form a band - shaped sio 2 film 403 in the periphery of about 8 μm of the stripe waveguide 113 . if an electrolytic plating is further applied to that structure , the gold is deposited on the region other than that which is covered with the photoresist and the sio 2 film , thereby forming a second gold - plated electrode 404 . however , the narrow and thin sio 2 film is buried in the second gold - plated electrode 404 thereby forming the dual electrode having the gaps 120 therein . this structure is reversed from the first to the third embodiments in that the position to be fixed by the soldering operation is located in the periphery of the stripe waveguide 113 . however , this embodiment and the foregoing embodiments employ the common concept in that the heat generated in the stripe waveguide 113 diffuses transversely of the gold - plated electrode layer , and in that the solder - fixed portion is not adhered directly to the semiconductor of the stripe waveguide 113 thereby forming a space for absorbing the stress . the semiconductor laser chip 124 thus formed is assembled with its junction face being downward on that submount 125 , which is made of the aluminum nitride 126 including the tiptau electrodes 127 and the ausn solder patterns 128 corresponding to the four array elements , as shown in fig8 . the first embodiment has been described on the example , in which the stress - absorbing layer for relaxing the stress and the gold electrode for dissipating the heat are separately formed . by a selective power feed at the gold plating time , however , a similar structure can also be formed by only one plating step . fig9 shows the shape of the p - side electrode 116 , before the gold plating , for realizing that step . this shape is substantially similar to that of the p - side electrode 116 of the first embodiment , as shown in fig4 . however , the shape is characterized in that the stripe electrode regions 118 and p - side electrodes 501 in the peripheries of the stripe waveguides are so separated for every chips as are not electrically connected with the adjoining chips . with this constitution , at the beginning of the gold - plating step , the electric current flows exclusively through plating feeder electrodes 502 connected electrically with the whole wafer through the adjoining chip patterns , thereby plating the same . as this plating step advances , the deposited gold contacts to plate the stripe electrode regions 118 and the p - side electrodes 501 in the peripheries of the stripe waveguides although they are electrically separated at the beginning . as a result , only the stress - absorbing layer 121 involving the gaps for relaxing the stress , as shown in fig1 , and the regions having dense electrodes formed thereover and the stress - absorbing structure 121 become higher than the remaining region so that the regions 129 to be fixed on the submount by soldering them can be formed by the single plating step . the semiconductor wafer having the laser structure thus formed is polished to a thickness of 100 μm thereby forming the back electrode , and is cleaved to a length of 300 μm in the resonator direction . after the facet coating film was formed , the semiconductor wafer is divided to a width of 250 μm into the laser chip 124 . in the submount 125 of this embodiment , on the other hand , the tiptau electrode 127 corresponding to the pattern of the semiconductor laser is formed over the aluminum nitride substrate 126 , and the ausn solder patterns 128 are formed on the tiptau electrode 127 . the semiconductor laser chip 124 thus formed is assembled with its junction face being downward on that submount 125 . | 7 |
when a failure caused by increase in optical - loss has occurred in an optical component in an optical amplifier , a light output may be decreased or the ratio of the power of a spontaneous emission light ( amplified spontaneous emission : ase ) component to the power of a signal component may be increased . the ratio of the power of the ase component to the power of the signal component may be increased based on an increase in a transmission path loss between optical amplifiers . therefore , based on a power ratio between the signal component and the ase component , another factor other than the optical amplifier may be detected as the abnormality of the optical amplifier . fig1 illustrates an example of the hardware configuration of an optical amplifier . an optical amplifier 1 includes optical branching couplers 10 , 11 , 12 , and 21 , photodiodes ( pd ) 13 , 14 , 24 , and 25 , an excitation light source ( ps ) 15 , an optical coupler 16 , and a rare - earth doped fiber 17 . the optical amplifier 1 includes an equalizer ( eq ) 18 , optical isolators 19 and 20 , and band pass filters ( bpf ) 22 and 23 . the optical amplifier 1 includes an abnormality detection circuit 30 and a control circuit 31 . the abnormality detection circuit 30 and the control circuit 31 may include a logic circuit such as an application specific integrated circuit ( asic ) or a field - programming gate array ( fpga ). the abnormality detection circuit 30 and the control circuit 31 may also include amplifier circuits and analog - digital converter circuits , used for reading the detection signals of the photodiodes 13 , 14 , 24 , and 25 , and a digital - analog converter circuit and a drive circuit , used for driving the excitation light source 15 . in the drawing , the photodiode , the excitation light source , the equalizer , and the band pass filter may be expressed as “ pd ”, “ ps ”, “ eq ”, and “ bpf ”, respectively . the hardware configuration illustrated in fig1 is just exemplified , and the configuration thereof may be arbitrary . the photodiode 13 detects and supplies , to the control circuit 31 , the optical power of the input optical signal of the optical amplifier 1 , which has branched from the optical branching coupler 10 . the photodiode 14 detects and supplies , to the control circuit 31 , the optical power of the output optical signal of the optical amplifier 1 , which has branched from the optical branching coupler 11 and passed through the optical coupler 12 . the control circuit 31 feedback - controls the excitation light source 15 so that a ratio in optical power between the input optical signal and the output optical signal , for example , an optical gain , becomes a given level . the optical coupler 16 multiplexes and causes signal light , input from the optical branching coupler 10 through the optical isolator 19 , and excitation light from the excitation light source 15 , to enter the rare - earth doped fiber 17 . the equalizer 18 equalizes the wavelength characteristic of the signal light amplified by the rare - earth doped fiber 17 . to the equalizer 18 , a transmission characteristic is assigned whose characteristic is opposite to the gain - wavelength characteristic of the rare - earth doped fiber 17 according to a population inversion rate corresponding to a preliminarily defined optical gain . the output of the equalizer 18 passes through the optical isolator 20 and the optical branching coupler 11 and is output from the optical amplifier 1 . the output optical signal of the optical amplifier 1 having branched from the optical branching coupler 11 is caused to further branch by the optical branching coupler 12 and enters the optical branching coupler 21 . the optical branching coupler 21 causes the incident light to further branch and enter the band pass filters 22 and 23 . the band pass filters 22 and 23 individually extract and input the wavelength components of different wavelengths λ1 and λ2 to the photodiodes 24 and 25 . the photodiodes 24 and 25 detect the optical powers of these incident lights , for example , the wavelength components of the wavelengths λ1 and λ2 in the output optical signal of the optical amplifier 1 , and supplies the optical powers to the abnormality detection circuit 30 . based on the optical powers of these wavelength components , the abnormality detection circuit 30 detects the abnormality of an optical signal , which has occurred based on the failure caused by increase in optical - loss of an optical component in the optical amplifier 1 . fig2 a and fig2 b illustrate examples of an output spectrum . fig2 a illustrates the output spectrum of the optical amplifier 1 . the output spectrum of the optical amplifier 1 includes a plurality of signal components 35 , . . . , and 36 and an ase component 37 . when the failure caused by increase in optical - loss of an optical component within the optical amplifier 1 has occurred , the signal components 35 , . . . , and 36 become reduced . for example , when a faulty optical component is an optical component between the optical branching coupler 11 and the rare - earth doped fiber 17 , the control circuit 31 increases the gain of the rare - earth doped fiber 17 so as to maintain output light power . therefore , the ase component is increased . this state is illustrated in fig2 b . as illustrated in fig2 b , the ase component having been increased based on the failure caused by increase in optical - loss of the optical component has a characteristic of decreasing with an increase in a wavelength . fig3 illustrates an example of a gain - wavelength characteristic . in fig3 , the gain - wavelength characteristics of a rare - earth doped fiber are illustrated in various population inversion rates . in the wavelength bands of a c band ( 1530 to 1565 nm ) and an l band ( 1565 nm to 1625 nm ) used in optical communication , a gain decreases with an increase in a wavelength , and that tendency increases in a state where the population inversion rate is larger . when , at the time of the failure caused by increase in optical - loss of the optical component , the gain of the rare - earth doped fiber has increased , for example , the population inversion rate has increased , equalization due to the equalizer 18 becomes insufficient . therefore , a gain - wavelength characteristic occurs where a gain decreases with an increase in a wavelength , and the power of the ase component decreases with an increase in a wavelength . fig4 a and fig4 b illustrate examples of the spectrum of wavelength - multiplexed signal light . in fig4 a and fig4 b , the spectra of wavelength - multiplexed signal light are individually illustrated that are subjected to a small transmission path loss and a large transmission path loss . as illustrated in fig4 a and fig4 b , the ratio of a signal to ase decreases with an increase in the transmission path loss . a characteristic may not occur where the ase component decreases in a long wavelength region such as when the population inversion rate of the rare - earth doped fiber has increased . based on a ratio in optical power between the wavelength components of the different wavelengths λ1 and λ2 in the light amplified by the rare - earth doped fiber 17 , the abnormality detection circuit 30 detects the abnormality of an optical signal . fig5 a , fig5 b , and fig5 c illustrate examples of the spectrum of equalized light . fig5 a illustrates the pattern diagram of the spectrum of light amplified by the rare - earth doped fiber 17 and equalized by the equalizer 18 . the light equalized by the equalizer 18 is led into the band pass filters 22 and 23 by the optical branching couplers 11 , 12 , and 21 , and only the wavelength components of the wavelengths λ1 and λ2 are individually extracted . fig5 b and fig5 c individually illustrate the pattern diagrams of the spectra of the wavelength components of the wavelengths λ1 and λ2 extracted by the band pass filters 22 and 23 . the optical power p1 and the optical power p2 of the wavelength components of the wavelengths λ1 and λ2 are detected by the photodiodes 24 and 25 , and input to the abnormality detection circuit 30 . based on the optical power p1 and the optical power p2 , the abnormality detection circuit 30 determines whether or not the ase component decreases with an increase in a wavelength . when the ase component decreases with an increase in a wavelength , the abnormality detection circuit 30 detects the failure caused by increase in optical - loss of an optical component . for example , when an optical power ratio r = p1 / p2 is larger than a predetermined threshold value , the abnormality detection circuit 30 detects the failure caused by increase in optical - loss of an optical component . fig6 a and fig6 b illustrate examples of the pass bands of the band pass filters 22 and 23 . so as to extract the wavelength components of the wavelengths λ1 and λ2 , the band pass filters 22 and 23 individually cause only the wavelength regions of the wavelengths λ1 and λ2 to pass therethrough . the λ1 and λ2 may also be set in wavelength regions including no signal component . for example , in fig6 a and 6b , the wavelength λ1 may be a wavelength shorter than a wavelength region including a signal component , and the wavelength λ2 may be a wavelength longer than the wavelength region including the signal component . fig6 c illustrates an example of an equalization characteristic . in fig6 c , the equalization characteristic of the equalizer 18 is illustrated . an equalization region due to the equalizer 18 covers the wavelengths λ1 and λ2 . therefore , a difference between the optical power p1 and the optical power p2 becomes large in a state where the failure caused by increase in optical - loss of an optical component does not occur , and the failure caused by increase in optical - loss of an optical component may not be erroneously detected . fig7 illustrates an example of an abnormality detection circuit . the abnormality detection circuit 30 includes power detection signal reception units 40 and 41 , a comparison unit 42 , a determination unit 43 , and an alarm output unit 44 . the power detection signal reception units 40 and 41 receive , from the photodiodes 24 and 25 , power detection signals indicating the values p1 and p2 of the optical power of the wavelengths λ1 and λ2 . the comparison unit 42 compares the values p1 and p2 of the optical power of the wavelengths λ1 and λ2 with each other , and calculates a ratio r = p1 / p2 of the optical power p1 to the optical power p2 . when the optical power ratio r exceeds a threshold value th , the determination unit 43 determines that the ase component decreases with an increase in a wavelength and an abnormality has occurred in an optical signal based on the occurrence of the failure caused by increase in optical - loss of an optical component . when the optical power ratio r does not exceed the threshold value th , the determination unit 43 may not determine that an abnormality has occurred in an optical signal . when the abnormality of an optical signal has been detected , the alarm output unit 44 outputs a predetermined alarm signal indicating that the failure caused by increase in optical - loss of an optical component has occurred and an abnormality has occurred in an optical signal . the alarm signal may be a visual signal visually giving notice of the occurrence of an abnormality . for example , the alarm signal may be the flashing of a lamp or an led or the displaying of a message or an icon due to an image display device or a character display device . the alarm signal may also be an audible signal such as a message or a buzzer , which audibly gives notice of the occurrence of an abnormality . the alarm signal may also be an electromagnetic signal used for interrupting the operation of the optical amplifier 1 or notifying another device of the occurrence of an abnormality . fig8 illustrates an example of the operation of an optical amplifier . a series of operations illustrated in fig8 may also include a plurality of procedures . in an operation aa , the optical branching couplers 11 , 12 , and 21 cause the light amplified by the rare - earth doped fiber 17 to branch and be led into the band pass filters 22 and 23 . in an operation ab , the band pass filters 22 and 23 individually extract only the wavelength components of the wavelengths λ1 and λ2 from within the incident light . in an operation ac , the photodiodes 24 and 25 detect the optical power p1 and the optical power p2 of the wavelength components of the wavelengths λ1 and λ2 . in an operation ad , the comparison unit 42 calculates the ratio r = p1 / p2 of the optical power p1 to the optical power p2 . in an operation ae , the determination unit 43 determines whether or not the optical power ratio r exceeds the threshold value th . when the optical power ratio r exceeds the threshold value th ( the operation ae : y ), the processing proceeds to an operation ag . when the optical power ratio r does not exceed the threshold value th ( the operation ae : n ), the processing proceeds to an operation af . in an operation af , the determination unit 43 determines that an optical component is normal . the processing returns to the operation aa . in the operation ag , the determination unit 43 determines that the failure caused by increase in optical - loss of an optical component has occurred and an optical signal is abnormal . the processing proceeds to an operation ah . in the operation ah , the alarm output unit 44 outputs the predetermined alarm signal . the processing returns to the operation aa . it is determined whether the abnormality of an optical signal detected based on an increase in the ase component is caused by the failure of an optical component within the optical amplifier or caused by another factor . therefore , the false detection of an optical signal abnormality occurring in the optical amplifier may be reduced , and it may be easy to specify a failure point . the wavelengths λ1 and λ2 whose optical power values are compared in the comparison unit 42 may be wavelengths within a wavelength region including no signal component . fig9 a and fig9 b illustrate examples of a wavelength region . in fig9 a , wavelength regions including no signal component are illustrated . the wavelengths λ1 and λ2 may be selected from a region r 21 whose wavelength is shorter than the wavelength of a wavelength region r 1 including a signal and a region r 22 whose wavelength is longer than the wavelength of the wavelength region r 1 including the signal . in fig9 b , wavelength regions including no signal component are illustrated . a wavelength region r 23 including no signal component may be provided in , for example , a region sandwiched between wavelength regions r 11 and r 12 including a signal . for example , the wavelengths λ1 and λ2 may be wavelengths located between the wavelength regions r 11 and r 12 including the signal . a wavelength region including the signal may be temporally switched , and the values p1 and p2 of the optical power may be detected during a time period when no signal is included in the wavelengths λ1 and λ2 . for example , in the wavelength bands of an o band ( 1260 to 1360 nm ) and an s band ( 1460 nm to 1530 nm ), at the time of the failure caused by increase in optical - loss of an optical component , the power of the ase component increases with an increase in a wavelength . therefore , in an optical amplifier used in these wavelength bands , when the ase component increases with an increase in a wavelength , the abnormality detection circuit 30 may determine that an abnormality has occurred in an optical signal based on the occurrence of the failure caused by increase in optical - loss of an optical component . for example , when the ratio r = p2 / p1 of the optical power p2 to the optical power p1 has exceeded a threshold value , the abnormality detection circuit 30 may determine that an abnormality has occurred in an optical signal based on the occurrence of the failure caused by increase in optical - loss of an optical component . in any case of a case where the power of the ase component decreases with an increase in a wavelength and a case where the power of the ase component increases with an increase in a wavelength , the abnormality detection circuit 30 may also detect the occurrence of the failure caused by increase in optical - loss of an optical component . for example , in accordance with the wavelength - intensity characteristic of the ase component included in light amplified by the rare - earth doped fiber 17 and equalized by the equalizer 18 , the abnormality detection circuit 30 may also detect the occurrence of the failure caused by increase in optical - loss of an optical component . for example , when a ratio between the optical power p1 and the optical power p2 has exceeded a predetermined acceptable range , it may be determined that an abnormality has occurred in an optical signal based on the occurrence of the failure caused by increase in optical - loss of an optical component . when , in place of the ratio between the optical power p1 and the optical power p2 , a difference between the optical power p1 and the optical power p2 has exceeded a threshold value , it may be determined that an abnormality has occurred in an optical signal based on the occurrence of the failure caused by increase in optical - loss of an optical component . the band pass filters 22 and 23 individually detecting the wavelength components of λ1 and λ2 may be separated filters and may also be integrated filters . fig1 illustrates an example of the hardware configuration of an optical amplifier . an optical amplifier 1 includes an input port 50 , optical branching couplers 51 , 52 , 60 , 61 , 62 , and 90 , and photodiodes 53 , 54 , 63 , 64 , 93 , and 94 . the optical amplifier 1 includes excitation light sources 55 and 65 , optical couplers 56 and 66 , rare - earth doped fibers 57 and 67 , and an output port 70 . the optical amplifier 1 includes an equalizer 58 , optical isolators 59 and 69 , a variable optical attenuator 68 , and band pass filters 91 and 92 . the optical amplifier 1 includes amplifier circuits 71 , 72 , 73 , 74 , 95 , and 97 and analog - digital converter circuits 75 , 76 , 77 , 78 , 96 , and 98 . the optical amplifier 1 includes drive circuits 79 , 80 , and 83 and digital - analog converter circuits 81 , 83 , and 84 . the optical amplifier 1 includes an automatic gain control circuit 100 , an automatic level control circuit 101 , and an abnormality detection circuit 102 . the automatic gain control circuit 100 , the automatic level control circuit 101 , and the abnormality detection circuit 102 include logic circuits such as asics or fpgas . in the drawing , an analog - digital converter circuit , a digital - analog converter circuit , automatic gain control , and automatic level control may be expressed as “ adc ”, “ dac ”, “ agc ”, and “ alc ”, respectively . a variable optical attenuator may be expressed as “ voa ”. a preceding - stage optical amplification unit may include the optical branching couplers 51 and 52 , the photodiodes 53 and 54 , the excitation light source 55 , the optical coupler 56 , the rare - earth doped fiber 57 , the optical isolator 59 , and the automatic gain control circuit 100 . the preceding - stage optical amplification unit may also include the amplifier circuits 71 and 72 , the analog - digital converters 75 and 76 , the drive circuit 79 , and the digital - analog converter 81 . the photodiodes 53 and 54 detect and supply , to the automatic gain control circuit 100 , the optical power of the input light and the optical power of the output light of the preceding - stage optical amplification unit , which have branched from the optical branching couplers 51 and 52 . the automatic gain control circuit 100 feedback - controls the excitation light source 55 so that a ratio in optical power between the input light and the output light of the preceding - stage optical amplification unit becomes a given level . the optical coupler 56 multiplexes and causes signal light , input from the optical branching coupler 51 through the optical isolator 59 , and excitation light from the excitation light source 55 , to enter the rare - earth doped fiber 57 . the amplifier circuits 71 and 72 amplify the detection signals of the photodiodes 53 and 54 , and the analog - digital converters 75 and 76 convert the amplified detection signals into digital signals , and supply the digital signals to the automatic gain control circuit 100 . the digital - analog converter 81 converts the control signal of the excitation light source 55 , output by the automatic gain control circuit 100 , into a driving signal having an analog form . the drive circuit 79 amplifies and supplies the driving signal to the excitation light source 55 . a subsequent - stage optical amplification unit may include the optical branching couplers 60 , 61 , and 62 , the photodiodes 63 and 64 , the excitation light source 65 , the optical coupler 66 , the rare - earth doped fiber 67 , the optical isolator 69 , and the automatic gain control circuit 100 . the subsequent - stage optical amplification unit may also include the amplifier circuits 73 and 74 , the analog - digital converters 77 and 78 , the drive circuit 80 , and the digital - analog converter 82 . the photodiode 63 detects and inputs , to the automatic gain control circuit 100 , the optical power of the subsequent - stage optical amplification unit , which has branched from the optical branching coupler 60 . the photodiode 64 detects and inputs , to the automatic gain control circuit 100 , the optical power of the output light of the subsequent - stage optical amplification unit , which has branched from the optical branching coupler 61 and passed through the optical branching coupler 62 . the automatic gain control circuit 100 feedback - controls the excitation light source 65 so that a ratio in optical power between the input light and the output light of the subsequent - stage optical amplification unit becomes a given level . the optical coupler 66 multiplexes and causes signal light , input from the optical branching coupler 60 through the optical isolator 69 , and excitation light from the excitation light source 65 , to enter the rare - earth doped fiber 67 . the amplifier circuits 73 and 74 amplify the detection signals of the photodiodes 63 and 64 , and the analog - digital converters 77 and 78 convert the amplified detection signals into digital signals , and supply the digital signals to the automatic gain control circuit 100 . the digital - analog converter 82 converts the control signal of the excitation light source 65 , output by the automatic gain control circuit 100 , into a driving signal having an analog form . the drive circuit 80 amplifies and supplies the driving signal to the excitation light source 65 . the equalizer 58 equalizes the wavelength characteristic of the signal light amplified by the rare - earth doped fibers 57 and 67 . to the equalizer 58 , transmission characteristics are assigned whose characteristics are opposite to the gain - wavelength characteristics of the rare - earth doped fibers 57 and 67 according to population inversion rates corresponding to preliminarily defined optical gains . in the optical amplifier 1 , the voa 68 is disposed between the preceding - stage amplification unit and the subsequent - stage amplification unit ( an interstage voa configuration ). based on the power of the output light of the optical amplifier 1 , detected by the photodiode 64 , the automatic level control circuit 101 increases or decreases the attenuation of the optical signal , and hence , maintains the output light of the optical amplifier 1 at a given level . the digital - analog converter 84 converts the control signal of the voa 68 , output by the automatic level control circuit 101 , into a driving signal having an analog form . the drive circuit 83 amplifies and supplies the driving signal to the voa 68 . the output optical signal of the optical amplifier 1 having branched from the optical branching coupler 61 is caused to further branch by the optical branching coupler 62 and enters the optical branching coupler 90 . the optical branching coupler 90 causes the incident light to further branch and enter the band pass filters 91 and 92 . the band pass filters 91 and 92 individually extract and input the wavelength components of the different wavelengths λ1 and λ2 to the photodiodes 93 and 94 . the photodiodes 93 and 94 detect the optical powers of these incident lights , for example , the wavelength components of the wavelengths λ1 and λ2 in the output optical signal of the optical amplifier 1 , and supplies the optical powers to the abnormality detection circuit 102 . the amplifier circuits 95 and 97 amplify the detection signals of the photodiodes 93 and 94 . the analog - digital converters 96 and 98 convert the amplified detection signals into digital signals , and supply the digital signals to the abnormality detection circuit 102 . based on the optical powers of these wavelength components , the abnormality detection circuit 102 detects the abnormality of an optical signal , which has occurred based on the failure caused by increase in optical - loss of an optical component in the optical amplifier 1 . the processing of the abnormality detection circuit 102 may be substantially the same as or similar to the processing of the abnormality detection circuit 30 illustrated in fig7 and fig8 . when the input light has been reduced based on the abnormal loss of a transmission path fiber transmitting light to enter the optical amplifier 1 , the optical amplifier 1 having the interstage voa configuration may maintain the level of the output light at a given level by changing the attenuation of the voa 68 . therefore , the level of the output light may be maintained at a given level without changing the signal gains of the rare - earth doped fibers 57 and 67 in the preceding - stage amplification unit and the subsequent - stage amplification unit . when the abnormal loss of the transmission path has occurred and the attenuation of the voa 68 has been reduced , the ase component of the output light of the optical amplifier 1 increases and the ratio of a signal to ase decreases , as illustrated in fig4 b . since the signal gains of the rare - earth doped fibers 57 and 67 do not change from gains in a state where an abnormality does not occur , a characteristic of becoming smaller in a long wavelength region may not occur in the ase component . therefore , the abnormality detection circuit 102 may not determine that the loss - increase failure of an optical component has occurred . when the failure caused by increase in optical - loss of an optical component has occurred , the characteristic of becoming smaller in a long wavelength region occurs in the ase component of the output light of the optical amplifier 1 . therefore , the abnormality detection circuit 102 may determine that the failure caused by increase in optical - loss of an optical component has occurred , and may determine that an abnormality has occurred in the optical signal . when the abnormality of an optical signal has occurred in an optical amplifier having an interstage voa configuration , it may be determined whether the abnormality of the optical signal is caused by the failure of an optical component within the optical amplifier or caused by another factor . therefore , the false detection of an optical signal abnormality occurring in the optical amplifier may be reduced , and it may be easy to specify a failure point . all examples and conditional language recited herein are intended for pedagogical purposes to aid the reader in understanding the invention and the concepts contributed by the inventor to furthering the art , and are to be construed as being without limitation to such specifically recited examples and conditions , nor does the organization of such examples in the specification relate to a showing of the superiority and inferiority of the invention . although the embodiments of the present invention have been described in detail , it should be understood that the various changes , substitutions , and alterations could be made hereto without departing from the spirit and scope of the invention . | 7 |
fig1 shows a side view of a hockey skate 2 having a boot 4 of the traditional type having a lower boot portion 6 and an upper boot portion 8 . a tongue 10 is positioned within an opening of the skate and the skate is tightened about a user &# 39 ; s foot using the two series of eyelets provided either side of the skate and tensioning the lace 12 . if the boot extension arrangement 20 was not present , two additional eyelets of the one series of eyelets would be visible at the upper portion of the upper boot . these eyelets are presently covered by the boot extension arrangement 20 which extends forwardly of the conventional securement position 19 of the lace and provides a series of forward eyelets 40 adjacent the front edge of the boot extension arrangement . these forward eyelets 40 as shown have three eyelets and the eyelets are vertically spaced . the vertical separation of these eyelets allows the user to select the number of eyelets he wishes to use to customize the flexion channel 30 defined between the achilles tendon guard 60 and the tongue 10 . the flexion channel 30 includes a length between the achilles guard 60 and the tongue 10 indicated as 32 . with the boot extension arrangement as shown in fig1 a user can modify conventional skates to customize the length of the flexion channel 30 and this has been found to significantly impact the skating characteristics of the user . the boot extension arrangement is shown as mechanically secured to the upper two eyelets of the conventional series of eyelets of a hockey skate and each extension member at the forward portion 26 thereof includes the series of forward eyelets 40 where adjacent eyelets of the series are vertically spaced . the vertical separation allows the mouth of the flexion channel 30 to vary lowering a front edge thereof if desired . also the eyelets can be used in combination . as perhaps best shown in fig4 the boot extenders 22 are mechanically fastened to the upper boot 8 and extend the boot forward while still allowing inward curvature or deflection of boot narrowing and eventually determining a closed from of the flexion channel 30 . these extenders are not merely lace extenders as they cooperate and extend the upper boot portion and assist in providing lateral stability or stiffness . for example , a user may choose to only use the bottom pair of eyelets , or the bottom pair in combination with the middle eyelets , or all three pairs of eyelets . a user may also experiment using only the middle or upper eyelets . if the user only uses the lower pair of eyelets the length of the flexion channel 30 is generally lengthened and thus he can bend his leg farther forward before encountering . it has been found that the upper portion 8 of the conventional hockey skate is quite stiff and provides excellent side to side rigidity and stability for the skater . the boot extension members 22 are also of a relatively stiff material ( i . e . similar to that of the boot ) and thus form an extension of the boot and do not readily bend towards each other but rather deflect towards each other under the influence of the lace as the boot would deflect . this arrangement generally keeps the flexion channel 30 open until restricted by the laces . there is some deflection of the boot extension members towards each other at the forward edge and depending upon the tension applied to the laces , this adjustment is also variable by the user . as perhaps best shown in fig4 the boot extenders 22 are mechanically fastened to the upper boot 8 and extend the boot forward while still allowing inward curvature or deflection of boot narrowing and eventually determining a closed front of the flexion channel 30 . these extenders are not merely lace extenders as they cooperate and extend the upper boot portion and assist in providing lateral stability or stiffness . the boot extension members preferably are of a plastic that can be heated to allow some bending or curvature and then cooled . this provides for further customization by a supplier or the end user . a preferred material for the boot extension members is supplied by dupont under the mark delrin 100 st ™. the particular placement of the eyelets in a conventional boot at the upper portion of the boot ( i . e . the top two or three eyelets ) does vary from hockey skate to hockey skate . to accommodate this , the extension members 22 include at a rear edge of the extension member a single port , namely the upper port , for receiving a mechanical fastener and a slot type aperture 55 therebelow for receiving a second mechanical fastener . in this way the slot 55 provides flexibility to accommodate the different spacing and positioning of the eyelets that is encountered from skate to skate . the preferred length of the extension members 22 is approximately 1 . 5 inches and this provides a very significant modification of the flexion channel 30 . we have also found that these extension members can be sold in a shorter length ( i . e . approximately 1 inch ) and this will provide approximately 15 degrees of additional flexion whereas the longer member provides approximately 25 degrees of flexion forward . the distance between the top edge and the bottom edge of the boot extenders 22 is preferably about 1 . 25 to 1 . 5 inches . the rearward ports of the extension member provide firm securement of the member to the upper portion of the hockey boot and thus the extension members form extension portions of the boot and have similar type characteristics . the two securement points avoid pivoting of the extension member and the series of forward eyelets provide for significant adjustment by the end user to experience the skate at different adjustment points and determine a position that the particular user finds both advantageous and acceptable . as shown these members preferably extend the upper boot position either side thereof and provide some lateral stability due to the significant size top to bottom and the positive attachment at two or more points to function in the manner of the upper boot . the thickness of the extenders is similar to the walls of the upper boot and are not prone to buckling or folding . movement of the extenders towards one another during lace tightening is transmitted back to the upper boot together with some deflection of the extenders . the particular material of the extension members must react to relative cold conditions that may occur playing hockey outside , for example , as well as much warmer temperatures that are experienced in the later part of the season . the delrin 100 st ™ material is quite durable with respect to shocks and will not crack during normal use . other similar materials can be used . the materials used for existing molded plastic hockey skates may also be suitable . in a preferred embodiment , the extension arms are made to be integral with the hockey boot and can also be made such that the upper portion of the boot is of a different material than the lower boot portion . it is desirable that the particular type of plastic used can also be adjusted or modified by the end user by heating of the plastic by placing the extension member in boiling water and / or providing low heat such as by a hair dryer it is possible to bend the plastic , and the typical modifications are to bend it slightly inwardly providing a desired curvature , however it is also possible to deflect it in the vertical plane perhaps to open up the upper edge , for example . once the member has been appropriately adjusted by the user , it is cooled and set and generally retains that shape unless it is reheated and adjusted again . as shown in the drawings it is not only lengthening the flexion channel but also providing some of the same type of side to side stability for the extend flexion channel . in contrast the lower boot portion and the lace system is primarily about securement and comfort . fig3 shows a hockey boot with the two extension members applied or secured either side of the boot . it has been shown without the lace extending through the eyelets for clarity . the end user would select the appropriate eyelets he wishes to establish his particular length of the flexion channel and typically this is done merely by performance evaluation and / or comfort evaluation by the user . in fig5 , an extension measurement 100 is shown that is helpful in using the boot extenders on a particular boot . the boot stock measurement 104 is the measurement from the heel to the vertical line that passes through the forward most extension point 106 where the user &# 39 ; s shin is restrained by the laces . typically the 55 degree angle is a good base point . the boot stock measurement varies by the user . the extender length is then determined by measuring from the top eyelet 102 to point 106 . in most cases this is about 1 inch . the spaced vertical eyelets allow the user to adjust around this average setting . modern skates are now very stiff and if tied in the conventional manner the angle of flexion is very restricted due to the stiffness of the boots . the extenders allow additional bend and contribute to lateral stiffness in the extended structure . these extenders use the stiffness of the upper portion of the boot to allow the extenders to pull the sides of the upper portion inwardly ( providing side support ) while extending the amount of flex . it can be appreciated that during skating a dynamic movement and deflection of the upper portion of the boot occurs and the extenders in combination with the boot maintain lateral stiffness . building the component into a boot is advantageous as there are no separate connection members ( possible point of weakness ) and the product is more efficient , lighter and comfortable . it has been found that there are very significant increases in skate performance such as increased stride length , more power , expanded mobility , enhanced ankle flexion , greater knee bend and better balance to name a number of the improvements . fig4 shows a lower portion of a user with two skates and the extent that one leg is significantly bent while the other one is more vertical . the present invention provides a simple and effective approach for allowing a user to modify a conventional hockey skate or to modify the structure of a conventional hockey boot in a new manner that is integrated with the boot to provide a much greater flexion channel than conventional hockey skates . this approach of extending the upper portion of a boot is also useful in other stiff skates such as figure skates , speed skates and roller blades . the hockey skate application is perhaps more demanding and difficult . although various preferred embodiments of the present invention have been described herein in detail , it will be appreciated by those skilled in the art , that variations may be made thereto without departing from the appended claims . | 0 |
a pre - reaction chamber controls the chemistry of a plasma - based processing apparatus independently of the charge effects at a wafer surface by de - coupling the gas phase reactions from the surface phase reactions . the pre - reaction chamber provides operable environments that are generally undesirable to the surface phase chemistry of the wafer ( e . g ., high temperature , high plasma power , high pressure , etc .) but desirable to the gas phase formation of preferred reactants for the processing of the wafer . referring to fig1 one exemplary embodiment of a plasma - based processing apparatus incorporating a pre - reaction plasma processing chamber is shown at 10 and is hereinafter referred to as “ apparatus 10 .” apparatus 10 comprises the pre - reaction plasma processing chamber 12 ( hereinafter “ pre - reaction chamber 12 ”) disposed in fluid communication with a gas intake manifold 14 , a power source 16 disposed in operable communication with 12 , and wafer plasma processing chamber 18 disposed in fluid communication with pre - reaction chamber 12 . a wafer 17 is disposed at wafer plasma processing chamber 18 via an electrostatically coupled chuck 19 . feedstock gas phase reactants are received into gas intake manifold 14 from reactant sources ( e . g ., vessels 20 ) disposed in fluid communication with gas intake manifold 14 . a reactive material 22 is disposed within pre - reaction chamber 12 . a gas distribution plate 24 is preferably disposed intermediate pre - reaction chamber 12 and wafer plasma processing chamber 18 . preferably , power source 16 is a source of microwave radiation . the flow of the gas phase reactants from vessels 20 to gas intake manifold 14 generally dictates the operation of pre - reaction chamber 12 . discharge from gas intake manifold 14 is received by pre - reaction chamber 12 . although three vessels 20 are shown as being disposed in fluid communication with gas intake manifold 14 to provide reactant feedstock in accordance with the desired product of the wafer process , any number of vessels may provide any number of reactant feedstocks for apparatus 10 . pre - reaction chamber 12 is an ex - situ module of apparatus 10 that comprises a pressurizable vessel capable of sustaining a plasma environment in which reactive material 22 is disposed . reactive material 22 comprises a material capable of preventing the etching of the wafer material when adsorbed by the molecules of the gas phase reactants and subsequently disposed on the wafer surface . reactive material 22 further comprises the etch stop layer and preferably comprises photoresist , oxide , silicon nitride , or other stop layers , combinations of the foregoing materials , or the like . maintaining a plasma environment in pre - reaction chamber 12 and contacting the gas phase reactants with a sacrificial film of reactive material 22 provides for the pre - loading of the gas phase reactants . subjecting the pre - loaded gas phase reactants to energy derived from power source 16 provides for the generation of a feedstock of reactive radicals for use in the subsequent plasma - based process of wafer plasma processing chamber 18 . generally , the reactive radicals are generated by subjecting the pre - loaded gas phase reactants to high power microwave radiation . the reactive radicals generated are preferably fluorine , carbon , nitrogen , and oxygen radicals , which are generated in accordance with the equations the above listed reactive species ( as well as others not listed ) are produced at plasma energies that are higher than the plasma energies capable of being withstood by the wafer substrate . the pre - reactive system allows for the formation of such reactive species in an aggressive upstream plasma reactor without the consequent high electron flux to the wafer , electrostatic charging of the wafer , or the detrimental effects associated with high electron flux and electrostatic charging . because the gas phase reactants are pre - loaded by their contact with reactive material 22 , the actual partial pressures of the reactants in pre - reaction chamber 12 substantially represents the partial pressures that provide saturation of the gases in wafer plasma processing chamber 18 and inhibit production of volatiles from material disposed on the wafer in wafer plasma processing chamber 18 . because wafer plasma processing chamber 18 can then be operated at any regime satisfactory to the wafer processing requirements , operational parameters related to the generation of gas phase radicals are irrelevant . thus , on - wafer performance is not compromised at the expense of the providing of gas phase reactants to wafer plasma processing chamber 18 . for example , if sio 2 is being used for a masking material , reactions of the type can be employed in the prereactor chamber 12 to form a mixture saturated with siof which in turn is fed into wafer plasma processing chamber 18 . in the wafer plasma processing chamber , the partial pressure of siof may then be adequate to limit the erosion of sio 2 in the wafer plasma processing chamber 18 . although apparatus 10 is shown as comprising a single pre - reaction chamber 12 module , it should be understood that apparatus 10 may comprise multiple gas phase reactant chambers that may or may not be pre - reaction chambers . in an apparatus in which multiple gas phase chambers provide the gas phase chemistry , each can be independently controlled to provide increased control of the surface phase chemistry at a wafer surface via an increased level of de - coupling of the gas - and surface phase chemistries . in particular , increasing the amount of control ( increased de - coupling ) allows for enhanced tuning of the apparatus to allow for the most efficient use of semiconductor materials . discharge from pre - reaction chamber 12 comprises a stream of pre - loaded radicals that is received by gas distribution plate 24 . gas distribution plate 24 mixes the pre - loaded radicals and allows for their uniform distribution to wafer plasma processing chamber 18 . because of the pre - loading of the gas phase reactants and the generation of radicals in pre - reaction chamber 12 , partial pressures of the product constituents is established prior to the introduction of the gases into wafer plasma processing chamber 18 . control ( not shown ) provided to gas distribution plate 24 alters the flow of pre - loaded gas phase reactants to wafer plasma processing chamber 18 without providing a penalty resulting from the heating of the wafer , the deposition of excessive plasma material , the excessive charging of the plasma , or a similar problem . additional reactant feedstocks may be added to gas distribution plate 24 from a source ( e . g ., a vessel 21 ) as needed according to the desired product of the particular plasma - based processing of the wafer . the pre - loaded gas phase reactants are then fed to wafer plasma processing chamber 18 , which provides for the dissocation , ionization , and excitation of the molecules of the gas phase reactants . generation of cf 2 in a low - power reaction for its subsequent implantation into a wafer structure is effected by the equation because the gas phase electron chemistry in pre - reaction chamber 12 is independent of the wafer conditions in wafer plasma processing chamber 18 , the gas phase reactions are effectively de - coupled from the surface phase reactions ( the wafer chemistry ). because the surface phase reactions ( on the wafer ) are not present in pre - reaction chamber 12 , there are no limits on the surface flux or surface chemistry in pre - reaction chamber 12 . therefore , the wafer does not experience excessive charging or thermal flux . by de - coupling the gas - and surface phase reactions utilizing apparatus 10 , radical / ion densities for different feedstock gases can also be independently tuned to mitigate the problem of differential charging . by eliminating or at least minimizing the amount of differential charging of radicals or ions , the anisotropy associated with sheath - directed ion bombardment can be controlled to result in an effective process of utilizing a plasma to etch self - aligned contacts at a wafer surface . referring now to fig2 one exemplary embodiment of a wafer is shown at 30 . wafer 30 comprises self - aligned contacts 32 , a nitride liner 34 disposed over self - aligned contacts 32 , an oxide layer 36 disposed over nitride liner 34 , a dielectric polymer coating 38 disposed over oxide layer 36 at facing corners of each contact element , and a resistive layer 40 disposed at oxide layer 36 . utilizing the apparatus as described with reference to fig1 to provide for the separation of the gas - and surface phase reactions allows for minimization of the buildup of charge between resistive layer 40 and oxide layer 36 , which in turn minimizes the deflection of positively charged ions from the incoming anisotropic ion flux ( indicated by arrows 42 ) to the facing corners of each contact element . by minimizing the bombardment of the corners of each contact element 32 , erosion of the corners and tapering of the gates ( spaces between contacts 32 ) is minimized , which in turn preserves the integrity of dielectric polymer coating 38 and minimizes contact resistance and the occurrences of shorting of the componentry disposed at the wafer . minimization of differential charging of the wafer layers may further be utilized to reduce the amount of distortion of trench profiles on the wafer surface . one type of trench profile distortion results from the deflection of ion flux in the direction of the corners of an etched feature . referring now to fig3 a trench structure is shown at 50 . a resistive layer 52 is disposed over an oxide layer 54 . by de - coupling the gas - and surface phase reactions of the reactants utilizing the apparatus as described above with reference to fig1 the buildup of charge between resistive layer 52 and oxide layer 54 is kept at a minimum . thus , deflection of ion flux ( indicated by arrow 42 ) to a corner 56 of trench structure 50 is avoided or at least minimized , which in turn allows the structural integrity of a bottom surface 58 ( e . g ., a nitride layer ) of trench structure 50 to be maintained . as can be seen , the de - coupling of the gas phase reactivity and the surface phase chemistry allows the two phases of the overall plasma - based process to be tuned independently , thereby enabling for the operation of the apparatus in a larger process parameter space . by having the ability to allow for the independent tuning of the apparatus , both low power reactions and high power reactions can be effectively carried out without resulting in a compromise of the power requirements of the apparatus . further , in systems in which the desired end product requires a more aggressive plasma regime , the gas phase reactants can be accordingly treated in the pre - reaction chamber without detrimentally affecting the sensitive or expensive wafer material in the main plasma processing chamber . while preferred embodiments have been shown and described , various modifications and substitutions may be made thereto without departing from the spirit and scope of the invention . accordingly , it is to be understood that the present invention has been described by way of illustration and not limitation . | 7 |
the following detailed description is merely exemplary in nature and is not intended to limit the invention or the application and uses of the invention . furthermore , there is no intention to be bound by any expressed or implied theory presented in the preceding technical field , background , brief summary or the following detailed description . a zener diode triggered bipolar transistor electrostatic discharge ( esd ) protection circuit similar to that shown in fig1 is capable of being formed on both existing and future wafer process flows . in general , cost is a factor in the design of an esd protection circuit . typically , an electrostatic discharge protection circuit is made from process steps and masks that exist in the wafer flow . the use of extra mask or wafer process steps to optimize performance of the esd protection circuit performance is rarely justified due to the increased cost of manufacture . another variable affecting the cost of esd protection circuit is the size of the structure for a given performance level . esd protection circuits can take up a substantial amount of silicon area . a reduction in the area of an esd protection circuit can decrease the cost to manufacture by minimizing the die area . fig4 is a cross - sectional view of an electrostatic discharge ( esd ) protection circuit 300 in accordance with the present invention . esd protection circuit 300 prevents an electrostatic discharge from damaging an integrated circuit . in general , an esd protection circuit is placed at each input / output ( i / o ) of an integrated circuit . esd protection circuit 300 is enabled by an esd event to dissipate the energy of the discharge before circuitry of the integrated circuit is damaged . for example , complementary metallic oxide semiconductor ( cmos ) transistors have a thin gate oxide that is easily damaged by a high voltage pulse . in an embodiment of the structure , an esd event is shunted to ground through esd protection circuit 300 such that the peak voltage and duration of the esd event is reduced to a level that does not damage circuitry of the integrated circuit . esd protection circuit 300 includes a terminal 400 and a terminal 410 . in an embodiment of the structure , terminal 400 couples to an i / o of the integrated circuit and terminal 410 couples to ground . esd protection circuit 300 comprises a zener diode and a bipolar transistor . the zener diode is coupled across the collector - base junction of the bipolar transistor similar to that shown in fig1 . in an embodiment of esd protection circuit 300 , the bipolar transistor is a vertical npn transistor having a collector coupled to terminal 400 , a base , and an emitter coupled to terminal 410 . the zener diode has a cathode and anode respectively coupled to the collector and the base of the transistor . in an embodiment of esd protection circuit 300 , the integrated structure is formed in an n - type epitaxial layer 320 that overlies a p - type substrate 310 . an isolation region defines the active area for esd protection circuit 300 . in an embodiment of esd protection circuit 300 , the isolation region is a p - type region 340 formed in epitaxial layer 320 . p - type region 340 is a deep p - type region that extends from a surface of epitaxial layer 320 into substrate 310 . in an embodiment of the device , p - type region 340 is formed in a ring shape that isolates and defines the active area of esd protection circuit 300 as epitaxial layer 320 interior to the ring shape . it should be noted that esd protection circuit 300 is not limited to p - type region 340 but can be fabricated using other isolation strategies such as a deep trench filled with dielectric material or undoped polysilicon that are well known to one skilled in the art . substrate 310 and p - type region 340 are coupled to ground . an n - type buried layer 330 partially underlies epitaxial layer 320 in the active area . buried layer 330 is formed at the approximate interface between substrate 310 and epitaxial layer 320 . an n - type region 350 is formed in epitaxial layer 320 . n - type region 350 extends from a surface of epitaxial layer 320 to n - type buried layer 330 . epitaxial layer 320 within the boundary set up by n - type region 350 and n - type buried layer 330 is the collector of the transistor . n - type region 350 and n - type buried layer 330 are heavily doped to form a low resistance path for collector current of the vertical npn transistor . in an embodiment of esd protection circuit 300 , n - type region 350 is formed in a ring shape . buried layer 330 underlies epitaxial layer 320 interior to the ring shape of n - type region 350 . in an embodiment of the transistor , an n - type region 360 is formed in n - type region 350 for coupling to metal interconnect that couples terminal 400 of esd protection circuit 300 to an i / o of the integrated circuit . a p - type base region 430 is formed in the active area within the interior of the ring shape of n - type region 350 . base region 430 is formed in epitaxial layer 320 and spaced a predetermined distance from n - type region 350 . a p - type region 390 is formed at a surface of epitaxial layer 320 overlying a boundary between base region 430 and epitaxial layer 320 . p - type region 390 couples to p - type base region 430 and has a higher doping concentration than p - type base region 430 . the zener diode of esd protection circuit 300 comprises n - type region 350 , epitaxial layer 320 , and p - type region 390 . an n - type emitter region 370 is formed in base region 430 . a p - type region 420 is formed into base region 430 . in an embodiment of the transistor , p - type region 420 is formed in a ring shape that surrounds emitter region 370 . p - type region 420 extends from the surface into base region 430 . the depth of p - type region 420 is selected to redirect current from a lateral surface flow to a more vertical current flow . in general , p - type region 420 redistributes the current from an esd event much deeper and more uniformly through base region 430 thereby reducing failure due to non - uniform current flow and current crowding . the resistance in the current flow path is also reduced by p - type region 420 . in general , the depth of p - type region 420 is greater than 30 % of the depth of base region to ensure that a substantial amount of the current flow is redistributed below the surface . reducing the current density greatly increases the energy that esd protection circuit 300 can dissipate before failure as will be shown hereinbelow . in an embodiment of the transistor , a p - type region 380 is formed in p - type region 420 for coupling to metal interconnect that couples to emitter region 370 and ground . a doping concentration of region 420 is higher than base region 430 . similarly , a doping concentration of region 380 is higher than region 420 . one embodiment of the transistor is described hereinbelow . base region 430 is formed having a depth of approximately 2 . 8 microns and a doping concentration of approximately 2e16 atoms / cm 3 . p - type region 420 is formed to a depth of approximately 2 microns into base region 430 . this gives p - type region 420 a substantial subsurface area that more uniformly distributes current flow in base region 430 to prevent high current densities at the surface . p - type region 420 has a doping concentration intermediate to base region 430 and p - type region 380 of approximately 3e16 atoms / cm 3 . p - type region 380 is heavily doped having a doping concentration of approximately 1e20 atoms / cm 3 or higher . p - type region 380 is formed on the surface of p - type region 420 , typically having a depth of approximately 0 . 2 microns . under normal operating conditions ( no esd event ), the transistor and zener diode are disabled . normal operating voltages applied to terminal 400 are insufficient to break down the zener diode . the base - emitter junction of the transistor comprising base region 430 and emitter region 370 are both coupled to ground . the base - emitter junction is not forward biased in this state , thus the transistor is off . in general , esd protection circuit 300 does not represent a significant load to signals applied to the i / o common to terminal 400 . the zener diode sets a voltage at which esd protection circuit 300 is enabled . as mentioned previously , the zener diode comprises n - type region 350 , epitaxial layer 320 , and p - type region 390 . the breakdown voltage of the zener diode is a function of doping concentration and the spacing between n - type region 350 and p - type region 390 . epitaxial layer 320 is fully depleted prior to the zener diode voltage breakdown . the breakdown voltage of the zener diode is selected based on the type of transistors or devices being protected on the integrated circuit wafer process flow . typically , the breakdown voltage is selected to be greater than the operating voltage of the integrated circuit to prevent false triggering under normal operation . in general , esd protection circuit 300 acts as a voltage clamp to an esd event . an esd event couples a voltage impulse that can measure thousands of volts to circuitry coupled to an i / o of an integrated circuit . esd protection circuit 300 clamps the voltage to a value that does not damage the circuitry of the integrated circuit and dissipates the energy of the pulse in a short period of time . an esd event coupled to terminal 400 couples the voltage impulse to n - type region 350 . p - type region 390 is initially coupled to ground through base region 430 . an impact ionization current is generated as the voltage across the zener diode approaches the zener breakdown voltage of the device . the impact ionization current causes avalanche breakdown to occur in the zener diode ( at the breakdown voltage of the device ). the impact ionization current is coupled from p - type region 390 into base region 430 . p - type region 420 provides subsurface current paths that uniformly redistributes the impact ionization current from the surface of base region 430 . current crowding is greatly reduced . p - type region 420 creates a redistribution of bipolar currents from the surface to flow in a more vertical manner thereby reducing power dissipation in the surface region . the impact ionization current from the zener diode increases corresponding to the rising voltage of the esd event . the impact ionization current in base region 430 produces a voltage that forward biases the base - emitter junction of the transistor due to the inherent resistance of the region . the enabled transistor is a high current gain device . a portion of the impact ionization current is base current to the transistor . the transistor multiplies the base current by the current gain ( β ) of the vertical transistor and sinks current corresponding to the esd event . the enabled transistor clamps the voltage of the esd event from rising and dissipates the energy the impulse . fig5 is a graph of a transmission pulse line characteristics corresponding to esd protection circuit 300 of fig4 . in general , transmission pulse line testing provides a pulse similar to an esd event to the esd protection circuit under test . the data shown is for an esd protection circuit measuring 52 . 5 microns on a side . in particular , the esd protection circuit has parameters similar to that described hereinabove . more specifically , base region 430 is approximately 2 . 8 microns deep . p - type region 430 is formed approximately 2 microns deep in base region 430 . the doping concentration of p - type region 430 is approximately an order of magnitude more than the doping concentration of base region 430 . the voltage and current coupled to the esd protection circuit is monitored . voltage is displayed on the x - axis of the graph and current on the y - axis of the graph . an initial voltage impulse is clamped to a voltage magnitude less than 50 volts as the zener diode comprising n - type region 350 , n - type epitaxial layer 320 , and p - type region 390 breaks down providing impact ionization current to base region 430 . the impact ionization current enables the transistor by creating a voltage drop in base region 430 that forward biases the base - emitter junction . a portion of the impact ionization current is base current that is multiplied by the current gain of the transistor thereby rapidly shunting current of the esd event through a low impedance path to ground . the voltage at terminal 400 continues to fall to approximately the breakdown voltage of the zener diode plus a base - emitter junction voltage . the test equipment measures the maximum current that can be handled by esd protection circuit 300 before failure . the point of failure is represented by dot 510 on the curve which corresponds to a current slightly greater than 8000 milliamperes . esd protection circuit 300 as tested has the same area as the prior art esd protection circuit tested in fig3 . note that esd protection circuit 300 has greater than twice the current handling capability of the prior art esd protection circuit . moreover , a difference in failure mechanism occurs that shifts from the base to the collector of the transistor ( at 8000 milliamperes the failure occurs at the collector of the transistor ). the increase in maximum current that can be handled by esd protection circuit 300 directly translates to better protection against higher energy esd events . a further benefit of esd protection circuit 300 is that the cell size can be reduced while providing the same benefit of the prior art esd protection circuit thereby reducing the die size of the integrated circuit . esd protection circuit 300 is easily implemented in many common wafer process flows without the need of extra processing steps . furthermore , the design is robust and scalable from a processing perspective thereby allowing it to be used in future generation process flows . fig6 is a top view of an esd protection circuit 300 in accordance with the present invention . the top view is representative of the ring shapes described in fig4 . p - type region 340 is formed in a ring shape that isolates esd protection circuit 300 from other devices ( not shown ) of the integrated circuit . the active area in which esd protection circuit 300 is formed is interior to p - type region 340 . p - type region 340 is coupled to ground . n - type region 350 is formed in a ring shape in the active area and contacts the buried layer ( not shown ) underlying the base region of the transistor . p - type region 390 is formed in a ring shape interior to the ring shape of n - type region 350 . the zener diode comprises p - type region 390 , the epitaxial layer ( not shown ), and n - type region 350 . p - type region 390 couples to the base region ( not shown ). p - type region 420 is interior to the ring shape of p - type region 390 . finally , emitter region 370 is interior to the ring shape of p - type region 370 . in general , esd protection circuit 300 is a symmetrical structure . while at least one exemplary embodiment has been presented in the foregoing detailed description , it should be appreciated that a vast number of variations exist . it should also be appreciated that the exemplary embodiment or exemplary embodiments are only examples , and ate not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing the exemplary embodiment or exemplary embodiments . it should be understood that various changes can be made in the function and arrangement of elements without departing from the scope of the invention as set forth in the appended claims and the legal equivalents thereof . | 7 |
now the present invention will be clarified in detail by embodiments thereof shown in the attached drawings . fig1 is a schematic view of an electrophotographic color image recording apparatus embodying the present invention . referring to fig1 a sheet cassette 21 contains a stack of image transfer paper or sheets p . a sheet feed roller 22 , positioned above and at the downstream side in the transport direction of said cassette 21 , is driven by an unrepresented clutch , and advances said sheets p one by one from the cassette 21 when rotated . guide members 23 , 24 are so positioned as to guide the transfer sheet p , extracted from the cassette 21 , toward registration rollers 25 , 26 . a sheet feed sensor 37 , for detecting the passing of the transfer sheet p is provided at a determined position of the guide members 23 , 24 . the registration rollers 25 , 26 control the transportation of the transfer sheet p fed from the sheet feed unit . the registration rollers 25 , 26 are controlled by an unrepresented clutch mechanism and advance the transfer sheet p through guide members 27 , 28 toward a support means comprising a transfer drum 29 at such timing that a gripper 30 on the rotating transfer drum 29 can grip said sheet p . said gripper 30 , provided on the external periphery of the transfer drum 29 , is usually closed for example with a biasing spring and positioned approximately at the external periphery of said transfer drum 29 , but is radially opened to the outside by an unrepresented gripper cam provided in the transfer drum 29 , in case of gripping the transfer sheet pi . an attraction charger 31 , provided in the transfer drum 29 , causes electrostatic attraction of the transfer sheet p onto the transfer drum 29 . a transfer charger 32 causes transfer of a toner image , formed on a photosensitive drum 33 , onto the transfer sheet p gripped on the transfer drum 29 . after the image transfer , the transfer sheet p is guided by a conveyor belt 34 to a fixing unit 40 , and , after image fixation by fixing rollers 38 , 39 , is discharged to a tray 35 positioned outside the apparatus . a sheet discharge sensor 36 , for detecting the sheet discharge , is provided at a determined position in the discharge part of the fixing unit 40 . fig2 schematically shows a control system employed in the apparatus shown in fig1 . in fig2 there are provided a central processing unit ( cpu ) 41 for controlling various component units in response to the signals from the sheet feed sensor 37 etc . ; a random access memory ( ram ) 42 for storing the status etc . of the component units ; and a read - only memory ( rom ) 43 for storing microinstructions for causing the cpu 41 to execute control procedures as shown in fig3 to 6 in the control of component units . there are further provided a registration roller driving circuit 44 for driving the registration rollers 25 , 26 ; a transfer drum driving circuit 45 for driving the transfer drum 29 ; a photosensitive drum driving circuit 46 for driving the photosensitive drum 33 ; a conveyor belt driving circuit 47 for driving the conveyor belt 34 , and a fixing roller driving circuit 48 for driving the fixing rollers 38 , 39 . now there will be given an explanation on the control procedure of the present embodiment while making reference to flow charts shown in fig3 to 6 . fig3 is a flow chart of a main image recording sequence in a continuous operation of forming monocolor images with the image recording apparatus shown in fig1 ; fig4 is a flow chart of an interruption sequence in case of an abnormality in the transportation in the sheet feed unit during an image transfer ; fig5 is a flow chart of an interruption sequence in case of an abnormality in the transportation in the fixing unit during an image transfer ; and fig6 is a flow chart of an interruption sequence in case of an abnormality in the transportation during a final mono - color image formation . referring to fig3 when an image forming operation is started in a step 100 , a succeeding step 101 executes initialization for the image forming process , for example resetting a control variable n , for counting the number of image formations , to zero . a step 102 then activates the driving circuits , thus starting the photosensitive drum 33 , transfer drum 29 , conveyor belt 34 and fixing rollers 38 , 39 . simultaneously unit operations for the electrophotographic process , such as charging , exposure , development etc . are activated around the photosensitive drum 33 . a step 103 starts the rotation of the feed roller 22 to advance an uppermost sheet p1 , of the stacked transfer sheets p in the cassette 21 , into the apparatus and toward the registration rollers 25 , 26 through the guide members 23 , 24 . the sheet feed sensor 37 detects the passing of the sheet p1 , and a step 104 identifies whether such detection has been made by the sensor 37 . in case the sheet feed sensor 37 does not detect the transfer sheet p1 within a determined time due to a jamming in the sheet feeding , the program proceeds to a step 140 to immediately stop all the driven parts , and a step 141 then displays an error message on an unrepresented display unit . then , when the operator has removed the jammed sheet and reset the apparatus , the program returns from a step 142 to the step 102 , and the image recording is re - started when a copy start key is actuated . on the other hand , if the transfer sheet p1 is detected by the sheet feed sensor 37 , a step 105 stops the rotation of the sheet feed roller 22 . in this state the leading end of the transfer sheet p1 has already reached the nip of the registration rollers 25 , 26 . a subsequent step 106 starts the rotation of the registration rollers 25 , 26 at a determined rotational angle of the transfer drum 29 in such a manner that the transfer sheet p1 can reach the gripper 30 rotating with the transfer drum 29 . the transfer sheet p1 is gripped , at the leading end thereof , by the gripper 30 in a step 107 , and reaches an image transfer position , between the photosensitive drum 33 and the transfer charger 32 , by the rotation of the transfer drum 29 , while said sheet p1 being attracted to the external periphery of said drum 29 by the attraction charger 31 . a succeeding step 108 activates the transfer charger 32 to initiate the image transfer . in this state the trailing end of the transfer sheet p1 has passed the registration rollers 25 , 26 , and a step 109 stops the registration rollers 25 , 26 . immediately thereafter , a step 110 starts the feeding of a transfer sheet p2 from the cassette 21 , for use in a second image recording . a succeeding step 111 identifies , by the sheet feed sensor 37 , whether the second sheet p2 has been properly fed . if the sensor 37 cannot detect the transfer sheet p2 within a determined time due to sheet jamming , the program proceeds to a flow shown in fig4 . on the other hand , if the sensor 37 detects the transfer sheet p2 within said determined time , the program proceeds to a step 112 for terminating the rotation of the sheet feed roller . in this state the preceding transfer sheet p1 on the transfer drum 29 is still receiving , in the trailing part , image transfer but the leading part is already released from the gripper 30 . said sheet is separated from the transfer drum 29 in a step 113 and is transferred onto the conveyor belt 34 . a succeeding step 114 completes the image transfer onto the preceding transfer sheet p1 to the trailing end thereof , and a step 115 completes the separation of said sheet p1 from the transfer drum 29 . in this state , the gripper 30 rotating with the transfer drum 29 is in a rotational position capable of gripping the succeeding transfer sheet p2 . a succeeding step 116 activates the registration rollers 25 , 26 at a determined timing , corresponding to such rotational angle of the transfer drum 29 that the succeeding transfer sheet p2 can reach said gripper 30 . then a step 117 completes the gripping of the transfer sheet p2 , and a step 118 initiates the image transfer in the same manner as in the preceding transfer sheet p1 . in this state the preceding transfer sheet p1 has been introduced into the fixing unit 40 by the conveyor belt 34 . a succeeding step 119 discriminates the jamming of said transfer sheet p1 in the fixing unit 40 according to whether the sheet discharge sensor 36 detects the preceding transfer sheet p1 within a determined time , and , in the absence of said detection , the program proceeds to a flow shown in fig5 . on the other hand , if the preceding transfer sheet p1 is properly detected by the sheet discharge sensor 36 , the program proceeds to a step 120 . the step 120 counts the number of image recording operations by adding &# 34 ; 1 &# 34 ; to the aforementioned control variable n . thereafter the preceding transfer sheet p1 is discharged onto the tray 35 . in this state the trailing end of the succeeding transfer sheet p2 has passed the registration rollers 25 , 26 , and a step 121 thus stops the registration rollers 25 , 26 . a succeeding step 122 identifies whether the number of image recording operations has reached a determined number n , and , if not , the program returns to the step 110 , whereby a transfer sheet p is supplied for a next image formation and the above - explained steps are repeated . on the other hand , the program proceeds to a step 123 when the number of image recordings reaches the determined number n . in this state , the trailing part of an n - th transfer sheet p n on the transfer drum 29 is still in the course of image transfer , but the leading part of said sheet has completed image transfer and is released from the gripper 30 , and the step 123 starts the separation from the transfer drum 29 . then a step completes the image transfer to the trailing end of the transfer sheet p n , and a step 125 completes the separation of said sheet from the transfer drum 29 . then the transfer sheet p n is transferred to the fixing unit 40 by the conveyor belt 34 for image fixation . then , if a step 126 detects the transfer sheet p n within a determined time by the sheet discharge sensor 36 , a step 127 executes a post - process for terminating the image recording apparatus , a step 128 stops all the driving systems and a step 129 terminates the continuous image recording operation . on the other hand , if the discharge of the transfer sheet p n is not confirmed in the step 126 , the program proceeds to a step 150 for stopping all the driving systems , and a succeeding step 151 displays an error message . when the operator removes the transfer sheet p n in the fixing unit 40 and resets the apparatus , the program proceeds from a step 152 to a step 153 to start the photosensitive drum 33 , transfer drum 29 , conveyor belt 34 , and fixing rollers 38 , 39 for final image recording . thereafter the program proceeds to a flow , shown in fig6 for image recording on a transfer sheet p only . the processes of steps 401 - 407 shown in fig6 are respectively same as those of steps 103 - 109 for image recording on plural transfer sheets shown in fig3 . also steps 420 - 423 branched from the step 402 are same as the steps 140 - 142 and 120 shown in fig3 . on the other hand , if the apparatus proceeds in normal manner to the step 407 , a step 408 starts the separation , from the transfer drum 29 , of the transfer sheet p from the leading part thereof that has completed the image transfer , and , when the image transfer is completed to the trailing end by a step 409 , the program returns to the step 125 shown in fig3 to repeat the final image recording . in the following there will be explained a case in which there occurs an abnormality in transportation , such as a sheet jamming , in the sheet feeding unit or in the sheet discharge unit within a loop from the step 110 to the step 122 shown in fig3 in the course of continuous image recording operation . at first , if the sheet feed sensor 37 does not detect a transfer sheet pi within a determined time in the step 111 , the program proceeds to a step 201 shown in fig4 . the step 201 immediately stops the rotation of the sheet feed roller 22 in order to avoid that the jammed transfer sheet pi is entangled or stuck in unexpected part . then a step 203 performs a delaying operation in order to continue and complete the image transfer of the transfer sheet pi currently in progress , and , upon completion thereof , a step 203 terminates the power supply to the transfer charger thereby terminating the image transfer . thereafter a step 204 stops the photosensitive drum 33 , transfer drum 29 etc . and a step 205 displays an error message indicating that a jamming is present in the sheet feed unit containing the sheet cassette 21 etc . when the operator removes the jammed sheet and resets the apparatus in response to said error message , the program proceeds from a step 206 to a step 207 for re - starting the photosensitive drum 33 , transfer drum 29 , conveyor belt 34 , and fixing rollers 38 , 39 in order to advance the transfer sheet pi which has completed the image transfer stage . then steps 208 and 209 separate the transfer sheet pi from the transfer drum 29 and sends said sheet to the fixing unit 40 by the conveyor belt 34 . then , if the sheet discharge sensor 36 detects said transfer sheet pi in a step 210 , a step 211 adds &# 34 ; 1 &# 34 ; to the aforementioned control variable n . on the other hand , if the sheet pi is not detected by the sensor 36 in the step 210 , the program proceeds to succeeding steps 210 - 213 , which are same as those 150 - 153 shown in fig3 and thereafter the program proceeds to a step 212 . consequently the addition of &# 34 ; 1 &# 34 ; to the control variable is not conducted in this case . then , if two or more image recordings still remain in the step 212 , the program returns to the step 103 shown in fig3 to repeat the image forming procedure explained before . on the other hand , if only one image recording remains , the program proceeds to the flow shown in fig6 then from the step 409 to the step 125 shown in fig3 and returns to the original flow . thus , in case an abnormality in the transportation occurs in the sheet feed unit in the course of image transfer onto a transfer sheet pi on the transfer drum 29 , said image transfer is continued until completion , and all the driving systems are thereafter stopped to request the operator to deal with the transfer sheet that has caused said abnormality . when the operator removes said sheet and resets the apparatus , the transfer sheet pi is separated from the transfer drum 29 , subjected to image fixing and discharged to the tray 35 . then the apparatus returns to a procedure for executing the remaining image recordings . in case , in the step 119 , the sheet discharge sensor 36 does not detect the transfer sheet pi within the determined time , the program proceeds to a step 301 shown in fig5 . the step 301 stops the fixing rollers 38 , 39 in order to avoid undesirable effect of the jammed transfer sheet pi to said rollers . then a step 302 effects a delay operation in order to continue and complete the image transfer onto the transfer sheet currently in progress . upon completion of said image transfer , a succeeding step 303 terminates the power supply to the transfer charger , thus terminating the image transfer operation . then a step 304 stops all the driving systems including the photosensitive drum 33 , transfer drum 29 etc . and a step 305 displays an error message , indicating a jamming in the sheet discharge unit . when the operator removes the jammed sheet and resets apparatus , the program proceeds from a step 306 to a step 307 to activate the photosensitive drum 33 , transfer drum 29 , conveyor belt 34 and fixing rollers 38 , 39 to advance the transfer sheet pi that has completed the image transfer . then steps 308 and 309 separate the transfer sheet pi from the transfer drum 29 , and send said sheet to the fixing unit 40 by the conveyor belt 34 . then , if the sheet discharge sensor 36 detects the transfer sheet pi in a step 310 , a step 311 adds &# 34 ; 1 &# 34 ; to the control variable n . on the other hand , if said sensor 36 does not detect the transfer sheet pi in the step 310 , the program proceeds to steps 320 - 323 which are same as those 150 - 153 shown in fig3 and then to a step 312 . consequently , the addition of &# 34 ; 1 &# 34 ; to the control variable does not take place in this case . if two or more image recordings still remain in the step 312 , the program returns to the step 103 shown in fig3 to repeat the above - explained image forming procedure . on the other hand , if only one image recording remains , the program proceeds to the flow shown in fig6 then from the step 409 to the step 125 shown in fig3 and returns to the original flow . consequently , in case there occurs an abnormality in the transportation of a preceding transfer sheet p i - 1 in the fixing unit 40 during the image transfer onto a succeeding transfer sheet p i on the transfer drum 29 , said image transfer is continued until the completion thereof , and all the driving systems are stopped to request the operator to deal with thus troubled sheet . when the operator removes said transfer sheet p i - 1 and resets the apparatus , the transfer sheet p i is separated from the transfer drum 29 , then subjected to image fixation and discharged to the tray 35 . then the apparatus returns to a procedure for effecting the remaining image recordings . the foregoing explanation has been limited to a continuous operation of forming mono - color images with an electrophotographic color image recording apparatus . in the formation of a color image , however , there are required plural transfers of toner images of different colors for obtaining an image . consequently , in case of a trouble in transportation in the sheet feed unit or sheet discharge unit in the course of image transfer , the above - explained control can be applied also to color image formation by continuing the image transfer operation , until the remaining images are all transferred . it is also possible to complete an image transfer which is in progress at the trouble in transportation and to effect the transfers of images of other colors after the sheet jamming is resolved . in such case steps for plural image transfers can be added between the steps 207 and 208 in fig4 or between the steps 307 and 308 in fig5 . in this manner it is rendered possible to reduce the time from the start of abnormality to the stoppage of the driving systems by a time required for plural transfers , while attaining the object of the present invention , thus minimizing the continuation of operation while the trouble remains unattended . in the foregoing embodiment , the image transfer is continued and the driving systems are stopped after the completion of said image transfer for any abnormality in the transportation in the sheet feed unit upstream of or in the fixing unit downstream of the transfer drum , but it is also possible to continue the operation until the transfer sheet currently in image transfer is discharged after image fixation only for an abnormality in the upstream side . the display of error message , which is given after the driving systems are stopped in the foregoing embodiment , may also be given immediately after the branching step for discriminating error . though the foregoing explanation has been limited to an embodiment utilizing an electrophotographic image recording apparatus having a transfer drum , the present invention is not limited to such embodiment but is applicable also to other image recording apparatus in which sheet materials are supported on a rotary support member , such as a thermal transfer image recording apparatus in which a transfer sheet supported on a rotary cylindrical platen is contacted with an ink sheet and the ink on said ink sheet is melted by a thermal head applied from the back of said ink sheet and transferred onto said transfer sheet to form an image , an ink jet image recording apparatus having a similar platen , or an image recording apparatus in which a photosensitive master sheet or an ink sheet supported on a rotary member is contacted with a recording sheet to transfer an image thereto . in such apparatus the objects of the present invention can be achieved by continuing the image recording operation until the completion of a serial procedure in case of an abnormality in the transportation of a sheet material other than that on the rotary support member currently subjected to image recording operation . as explained in the foregoing , it is rendered possible to effectively utilize sheet materials without waste , in case of an abnormality in the transportation of sheet materials other than that placed on the rotary support member , by continuing the image forming process for said sheet material on the rotary support member until the completion of said process , and advancing said sheet material to the ordinary transport path after the sheet material that has caused said abnormality is removed by the operator . ( 1 ) operation of sheet removal is easier because it is not necessary to remove the sheet on the rotary support member but the sheets that have caused trouble in transportation only : ( 2 ) the sheet material in the course of image formation can be effectively used without waste since the sheet on the rotary support member need not be removed in such trouble in transportation : ( 3 ) it is rendered possible to prevent waste of other image forming materials such as toner or ink since the sheet material in the course of image formation can be effectively utilized without waste : ( 4 ) in case of a trouble in transportation , unevenness in the obtained image can be prevented as in the case of immediately interrupting the image forming operation , as the image forming operation is continued until a serial procedure is completed : and ( 5 ) it is rendered possible to avoid contamination in the apparatus , caused by the removal of the transfer sheet bearing unfixed toner image which easily causes scattering of toner , as such transfer sheet no longer needs to be removed . it is also possible , in case of an abnormality in transportation of sheet materials other than that on the transfer drum , to continue the image transfer at the transfer drum until the completion thereof and to guide the sheet material from said transfer drum to fixing means when it reaches a determined fixing temperature after the sheet materials having caused said abnormality are removed , thereby enabling efficient discharge of the sheet material on the transfer drum without incomplete image fixation . fig7 is a block diagram showing a control circuit for realizing such control . in fig7 there are provided a central processing unit ( cpu ) 501 for controlling various component units in response to signals from sheet feed sensor 37 etc . ; a random access memory ( ram ) 503 for storing status of various component units ; and a read only memory ( rom ) 502 for storing microinstructions of control procedures as shown in fig3 to 5 to be executed by the cpu 501 for controlling the component units . comparators 505 - 507 are provided for binary digitizing output detection signals from a sheet feed sensor 37 , a sheet discharge sensor 36 and a temperature sensor 40 . driver circuits 508 - 512 are provided for respectively controlling a sheet feed roller clutch 515 ; a registration roller clutch 516 ; a fixing roller clutch 518 ; a conveyor belt clutch 519 ; and a drum motor 520 . there are further provided an image forming unit 521 for image formation ; clock pulse generating means 522 for generating signals synchronized with the rotation of a photosensitive drum 33 ; and a heater control unit 523 for controlling power supply , and temperature of fixing heaters 41 , 42 . the power supply to the fixing heaters 41 , 42 are so controlled as to maintain respectively corresponding fixing rollers 38 , 39 at a constant temperature , and is totally interrupted in case of an abnormality in transportation in the fixing unit 43 . the above - explained components are electrically connected through an i / o port , and the control sequence of the present embodiment proceeds , as will be explained later , by the control of various driver circuits in reference to the signals from the clock pulse generating means 522 . now reference is made to the flow charts shown in fig8 and 9 , for explaining the control procedure of the present embodiment . a main flow , indicating the image recording sequence of an electrophotographic color image recording apparatus in a continuous image forming operation , will be omitted as it is similar to that shown in fig3 . fig8 shows a flow chart of an interruption sequence in case of an abnormality in transportation in the final image forming cycle in a continuous image forming operation , and fig9 shows a flow chart of an interruption sequence in case of an abnormality in the fixing unit during an image transfer operation . when the operator removes a transfer sheet p n in the fixing unit 43 and resets the apparatus in a step 152 shown in fig3 the program proceeds to a step 153 for re - activating the photosensitive drum 33 , transfer drum 29 , conveyor belt 34 and fixing rollers 38 , 39 for the final image forming cycle . then the program enters an image forming flow , shown in fig8 for a transfer sheet p . in fig8 steps 201 - 207 are same as the steps 103 - 109 , shown in fig3 for image recording on plural transfer sheets p . also steps 211 - 214 , branching from a step 202 , are same as the steps 140 - 142 and 102 shown in fig3 . on the other hand , in case the apparatus operates in normal manner up to the step 207 , a step 208 initiates separation of the transfer sheet p from the transfer drum 209 , starting from the leading end portion of said sheet that has completed image transfer , and , when the image transfer is completed to the trailing end of the sheet in a step 209 , the program returns to a step 125 shown in fig3 for inspecting normal transport of the final sheet in the step 126 etc . on the other hand , if the step 119 does not detect a transfer sheet pi - 1 within a determined time by the sheet discharge sensor 36 , the program proceeds to a flow chart shown in fig9 . at first a step 301 stops the fixing rollers 38 , 39 and interrupts power supply to the fixing heaters 40 , 41 . then a step 302 effects a delaying operaion in order to continue the image transfer operation currently in progress on the transfer drum 29 , and a step 303 completes the image transfer , for example of a first color , in images to be superposed on the transfer sheet . then a step 304 stops all the driving systems , and a succeeding step 305 displays a jam message for the operator . a step 306 awaits a jam recovery in the fixing unit 43 and a resetting of the apparatus . upon completion of said jam recovery and resetting , a step 307 terminates the jam message display , and a step 308 reactivates the photosensitive drum 33 , transfer drum 29 , fixing rollers 38 , 39 and fixing heaters 40 , 41 for a succeeding image forming cycle . a step 309 effect formation and transfer of the remaining images of the images to be superposed on the transfer sheet pi on the transfer drum 29 , and , upon completion of multiple transfers on all the color images on said transfer sheet pi , a step 310 starts the conveyor belt 34 , and a step 311 initiates separation of the transfer sheet pi from the transfer drum 29 . subsequently a step 312 detects the temperature of the fixing unit 43 with the temerature sensor 42 and identifies whether thus detected temperature is within a suitable fixing temperature range , and the program proceeds either to a step 321 if the fixing unit 43 has not reached such temperature range or to a step 313 if the detected temperature is already within said range . a step 313 completes the separation of the transfer sheet pi from the transfer drum 29 to the rear end of said sheet , and a succeeding step 314 introduces said transfer sheet pi into the fixing unit 43 for image fixation . then a step 315 identifies whether the transfer sheet pi has passed the fixing unit 43 without sheet jamming , according to the output signal of the sheet discharge sensor 36 . upon identification of proper image fixation and detection of the sheet pi by the discharge sensor 36 , a step 316 renews the cumultive number of image formations . if a step 317 identifies that two or more image formations are still remaining , the program returns to the step 103 , shown in fig3 to repeat the above - explained image forming procedure . on the other hand , if only one image formation remains , the program proceeds to the flow shown in fig4 then from the step 209 to the step 125 and returns to the original flow . on the other hand , if the step 312 identifies that the fixing unit 43 has not reached the predetermined temperature range , the program proceeds to a step 321 for causing a display of that effect . then a step 322 effects a delaying operation to continue the separation of the transfer sheet pi , to the rear end thereof , from the transfer drum 29 , and , upon completion of said separation and complete transfer of said sheet onto the conveyor belt 34 in a step 323 , a step 324 stops the movement thereof . in case a step 325 identifies that the fixing unit 43 has not reached the predetermined temperature range , the program returns to the step 324 to maintain a state in which the transfer sheet pi is placed on the conveyor belt 34 , until the fixing unit 43 reaches said temperature range , and , when the fixing unit 43 reaches said range by continued heating , the program proceeds to a succeeding step 326 . after the step 326 terminates the aforementioned display , a step 327 activates the conveyor belt 34 to transport the transfer sheet pi to the fixing unit 43 , and a succeeding step 314 fixes the transferred image to the sheet pi . then , if a step 315 detects the transfer sheet pi by the discharge sensor 36 , a step 316 steps up the number of image recordings . on the other hand , in case the step 315 does not detect the transfer sheet pi , the program proceeds to steps 331 - 325 , similar to the steps 150 - 153 shown in fig3 and then to the step 317 . consequently , in this case , the operation of increment of the number of image formations in the step 316 is not executed . in case the step 317 identifies that two or more image forming cycles are still remaining , the program returns to the step 103 , shown in fig3 for repeating the above - explained image forming procedure . on the other hand , if only one image formation remains , the program proceeds to the flow shown in fig4 then from the step 209 to the step 125 shown in fig3 and returns to the original flow . in the above - explained control procedure , in case of an abnormality in the transportation , for example of the transfer sheet pi - 1 in the fixing unit 43 during the transfer of image of a first color onto the transfer sheet pi on the transfer drum 29 , the power supply to all the driving systems and to the heaters of the fixing unit 43 is interrupted after the completion of said image transfer of first color . then , when the operator removes said transfer sheet pi - 1 and resets the apparatus during said interruption , the apparatus effects transfer of remaining colors onto the transfer sheet pi and transports said sheet by the conveyor belt 34 to the fixing unit 43 . besides the apparatus detects the temperature of the fixing unit 43 in the course of this operation , and allows the entry of said sheet into the fixing unit 43 if it has reached an appropriate temperature but maintains said sheet on the conveyor belt 34 , if the fixing unit has not reached said appropriate temperature , until such temperature is reached . on the other hand , in case of a jamming of another sheet pi + 1 in the upstream sheet feed path to the transfer drum 29 during an image transfer operation onto the transfer sheet pi on said transfer drum 29 , the program proceeds , from the step 111 shown in fig3 to a step 111a , which will not be explained further as it is essentially same as the process shown in fig9 . more specifically the control procedure thereafter is same as that shown in fig9 except that the process in the step 301 thereof for stopping the sheet feeding operation is conducted simultaneously with the interruption of power supply to the fixing rollers and the stopping of the fixing rollers . in the present embodiment the transfer sheet pi is made to wait on the conveyor belt 34 , but it is also possible to retain the transfer sheet on the transfer drum . also the present invention is not limited to the electrophotographic color image recording apparatus as described in the foregoing embodiment but is applicable also to an electrophotographic image recording apparatus for forming images on both sides of a sheet material by means of a sheet inverting mechanism and a transfer drum . as explained in the foregoing , the embodiment does not immediately stop the image transfer operation on the transfer drum , in case of an abnormality in the transportation of sheets other than that on said transfer drum , but continues said image transfer operation until the completion thereof , and , after the sheet materials that have caused said abnormality are removed , guides the sheet material on the transfer drum to fixing means for image fixation when said fixing means reaches a determined fixing temperature , thereby discharging the sheet material efficientrly in time , without unsatisfactory image fixation . ( 1 ) in case a sheet is jammed during an image transfer operation of another sheet , and if the temperature of the fixing unit becomes lower during the removal of the former sheet due to an interruption in the power supply to the fixing heaters , the sheet that has completed image transfer can be maintained free from in - complete image fixation or low - temperature offsetting since it is introduced into the fixing unit for image fixation after said unit reaches an appropriate fixing temperature : ( 2 ) in case of multiple superposed transfers , the fixing heaters are at first activated for temperature control after the jammed sheet is removed , and the temperature of said fixing unit is detected to identify whether the sheet should be introduced into the fixing unit , after the remaining image transfer are completed . thus the heating time of the fixing unit can be reduced by the period required for said remaining image transfers . stated differently , the waiting time for heating is shorter in comparison with a case in which the image transfers are conducted after the fixing unit is heated : ( 3 ) if the temperature of the fixing unit is in - sufficient after the removal of the jammed sheet , the sheet has completed image transfers is made to wait immediately in front of the fixing unit , for example on a conveyor belt . in this manner it is rendered possible to minimize the time required from the arrival of the fixing unit at an appropriate temperature to the discharge of the sheet after image fixation . on the other hand , if the sheet is made to wait on the transfer drum , the sheet discharge requires a longer time since the sheet has to be separated from the drum and then transported for fixation after the fixing unit reaches an appropriate temperature . the foregoing embodiment allows to minimize the time required for such sheet transportation . | 6 |
a novel protective athletic pad adapted to protect an anatomical body portion of a wearer is illustrated in fig1 and 2 of the drawings and the showing designated by the reference numeral 10 . the protective athletic pad 10 is a football shoulder pad which includes a left hand shoulder pad portion 11 and a right hand shoulder pad portion 12 which rest upon the left and right shoulders , respectively , of a wearer ( not shown ) in a conventional manner . the left hand shoulder pad portion 11 includes a substantially rigid plastic structural member or body arch 13 , a less rigid padding or arch pad 14 , a shoulder flap 15 , a shoulder cap 16 and a shoulder cap pad 17 carried by the shoulder cap 16 . the shoulder cap 16 is secured by rivets 19 ( fig4 and 8 ) to a flexible but strong strap 18 which is in turn connected by rivets 20 to the body arch 13 . rivets 21 ( fig1 ) connect the shoulder flap 15 to the strap 18 . the right hand shoulder pad portion 12 includes a substantially rigid plastic structural member or body arch 23 , a less rigid padding or arch pad 24 , a shoulder flap 25 , a shoulder cap 26 , and a shoulder cap pad 27 carried by the shoulder cap 26 . rivets ( not shown ) corresponding to the rivets 19 of fig4 and 8 secure the shoulder cap 26 to a strong flexible strap 28 which is in turn connected by rivets 30 to the body arch 23 . rivets 31 secure the shoulder flap 25 to the strap 28 . each of the body arches 13 , 23 is identical , except one being a left hand body arch and the other being a right hand body arch , and each includes an arch front terminal end or terminal end portion 40 , an arch rear terminal end or terminal end portion 41 , and a bight or bight portion 42 therebetween . the bight portions 40 , 42 impart a generally downwardly opening u - shaped configuration to each of the body arches 13 , 23 . the arch front terminal end 40 includes first fastening means 43 in the form of a male snap fastener and second fastening means 44 which defines an aperture , slot or opening . each arch rear terminal end 41 includes third fastener means 45 in the form of a pair of male fasteners and fourth fastener means 46 in the form of a strap 47 formed in a loop whose legs ( unnumbered ) receive therebetween one of the arch rear terminal ends 41 and a rivet 48 for securing the strap 47 thereto in a conventional manner . the arch pads or arch pad members 14 , 24 are also identical except , of course , the arch pad 14 is a left hand pad and the arch pad 24 is a right hand pad . each of the arch pads 14 , 24 includes an arch pad front terminal end or terminal end portion 50 , an arch pad rear terminal end or end portion 51 , and an arch pad bight or bight portion 52 therebetween . though the arch pads 14 , 24 are shown in the drawings to be of a generally inverted u - shaped configuration , they are normally relatively flat , but since constructed from flexible material the same can be shaped into conforming relationship to the respective arch bodies 13 , 23 , as is readily apparent from fig1 and 2 . means generally designated by the reference numeral 60 is provided at each arch pad front terminal end 50 for releasably securing each arch front terminal end 40 relative to its arch pad front terminal end 50 . the means 60 is a pocket defined by the arch pad front terminal end 50 and a wall 62 of relatively tough and flexible material which is sewn along a periphery thereof to a periphery ( unnumbered ) of the arch pad front terminal end 50 . the wall 62 of the pocket means 60 includes fifth fastening means 53 in the form of a female fastener which can snap secure to and be similarly removed from the male fastener 43 in the manner apparent in fig1 and 5 of the drawings . a slot 54 is formed in the wall 62 of the pocket 60 and when the arch front terminal end 40 is received in the pocket 60 , the slot 54 is in alignment with the slot 44 of the arch front terminal end 40 , as is most readily apparent in fig5 . a web of reinforcing material 58 ( 55 ) is preferably sewn about the periphery ( unnumbered ) of the slot 54 for reinforcing purposes . similar pocket or pocket means 61 is defined by a wall 64 which is sewn along a periphery 65 to the arch pad rear terminal end 51 of each of the arch pads 14 , 24 . the wall 64 carries sixth fastening means 55 in the form of two female snap fasteners and means 56 ( fig3 ) for forming apertures or opening means in the form of a pair of generally parallel upright slots . when the arch rear terminal end 41 of the body arches 13 , 23 is inserted into the pockets 61 of the respective arch pad rear terminal ends 51 , the male snap fasteners 45 can be snap secured to the female snap fasteners 55 . when thus secured the loop 46 is in alignment with the slots 56 and is sandwiches between each wall 64 and the arch pad rear terminal end portion 51 of the arch pads 14 , 24 ( fig6 ). from the foregoing it is readily apparent that the body arches 13 , 23 and the respective arch pads 14 , 24 can be readily assembled by sliding the arch front terminal ends 40 of each of the body arches 13 , 23 into the pockets 60 of the respective arch pads 14 , 24 and similarly slipping the arch rear terminal ends 41 of the body arches 3 , 23 into the pockets 61 of the respective arch pads 14 , 24 . when this is done the male fasteners 43 are snapped into the female fasteners 53 ( fig5 ) and the male fasteners 45 are snapped into the female fasteners 55 ( fig6 ). obviously , disassembly takes place in the reverse fashion , namely , unsnapping the fasteners 43 , 53 and 45 , 55 relative to each other and withdrawing the arch front terminal ends 40 , 41 of the arches 13 , 14 from the respective pockets 60 , 61 . this is highly desirable because the arch pads 14 , 24 can be laundered when soiled and thereafter reassembled quickly and securely . the body arches 13 , 23 are secured to each other adjacent the arch rear terminal end portions 41 thereof by means of a flexible yet strong strip 70 through rivets 71 ( fig2 ). at the front ( fig1 ) of the shoulder pad 10 the body arches 13 , 23 can be spread apart from the position shown in fig1 by merely untying a lace or a lacing 72 which passes through lace openings 73 in the arch bodies 13 , 23 . additional restraint for the shoulder pad 10 is provided by fastening means 80 in the form of a flexible strap carrying conventional slidably adjustable fastening elements 81 each having a t - shaped connector or fastening clip 82 . the strap 80 is laced or threaded through the pairs of slots 56 ( fig2 ) and the loop 47 therebetween ( fig2 and 6 ), and after the latter has been accomplished , the clips 82 are slipped upon the strap 80 . a wearer need but then hook the t - shaped clips 82 into the aligned slots 44 , 54 , in the manner best illustrated in fig5 . obviously the t - shaped clips are inserted into the slots 44 , 54 by first aligning the cross bar ( unnumbered ) of the clips 82 longitudinally with the longitudinal axis ( unnumbered ) of the slots 44 , 54 , inserting the cross bars through the slots 44 , 54 and then rotating the clips 82 through 90 degrees , as shown in fig5 which is the locked position thereof . the reverse will result in the release of the clips 82 from the associated slots 44 , 54 . the strap or fastening means 80 serves to additionally retain the shoulder pad 10 snugly upon the body of the wearer . each of the shoulder cap pads 17 , 27 is also readily secured to and removed from the associated shoulder caps 16 , 26 , respectively , as is best illustrated in fig4 and 8 . each relatively rigid shoulder cap 16 , 17 is formed of plastic material , has a generally oval shape configuration and includes a pair of upstanding elongated reinforcing portions 90 , 91 located inboard of a peripheral edge portion 92 . fastening means in the form of a pair of male snap fasteners 93 ( fig4 ) are secured to each of the shoulder caps 16 , 26 . each of the shoulder cap pads 17 , 27 includes a relatively oval shaped pad member or padding 94 having a peripheral edge portion 95 sewn to a generally annular or arcuate web or sheet 96 formed of strong resilient material . the web 96 includes an inboard edge 97 and also carries fastening means in the form of female snap fasteners 99 . the pad member 94 and the web 96 define a generally annular pocket 100 into which a portion of the peripheral edge 92 of each of the shoulder caps 16 , 26 can be inserted from the position shown in fig4 to the position shown in fig7 and 8 . when positioned as shown in fig7 and 8 the female fasteners 99 are snap - secured to the male snap fasteners 93 ( fig7 and 8 ), and in this fashion the pad members 94 are releasably secured to the shoulder caps 16 , 26 , respectively . obviously the snap fasteners 93 , 99 can be unsnapped to remove the shoulder cap pads 17 27 from the pockets 100 to permit the latter to be laundered , dried and subsequently replaced in the manner just described . as can be appreciated from the foregoing description , the pads or padding 14 , 17 , 24 and 27 can be rapidly and easily secured to and removed relative from the respective structural members 13 , 16 , 23 and 26 . furthermore , the strap 80 can be relatively easily united with and removed from the arch pads 14 , 24 and the body arches 13 , 23 . although a preferred embodiment of the invention has been specifically illustrated and described herein , it is to be understood that minor variations may be made in the apparatus without departing from the spirit and scope of the invention , as defined in the appended claims . | 0 |
a roof module 1 according to fig1 is inserted into a roof aperture in a roof region of a passenger motor vehicle and fitted there . the roof module 1 has a dimensionally stable supporting frame 2 which is provided on opposite longitudinal sides with dimensionally stable guide rails 5 for the shifting of a first , dimensionally stable roof part 3 in the form of a glass roof . in addition , a further roof part 4 in the form of a flexible shading structure , which is provided on the end side with a dimensionally stable pull - out profile , is displaceable along the guide rails 5 . the two roof parts 3 , 4 are moved by a drive device 6 , 7 . the drive device 6 , 7 comprises drive transmission cables 7 which are designed as flexible shafts transmitting tension and compression . the flexible shafts are also referred to as threaded shafts , since the outer casing thereof is provided with a helical profiling . in a first embodiment according to fig2 to 8 , the drive device 6 comprises a mechanical distributor gearing which is accommodated in a housing . the distributor gearing is operatively connected to an electric drive motor 11 and transmits the driving forces of the drive motor 11 to two output pinions 8 and 9 which are in each case assigned to a pair of drive transmission cables 7 , as can be gathered from fig2 . the drive transmission cables 7 act laterally on the respective roof parts 3 , 4 in order to shift the roof parts 3 , 4 between the opening and closed positions thereof . the closed position in the case of the shading structure is the shading position . the drive device 6 is provided in order alternatively to drive the two output shafts 8 , 9 . for this purpose , a change - over device 10 which , in the embodiment according to fig2 to 8 , comprises the mechanical distributor gearing is provided . the driving force of the drive motor 11 is divided there into two output trains , each of which is assigned one of the two output pinions 8 , 9 . the change - over device 10 according to fig3 to 8 has a housing 12 , 13 , 21 in which the distributor gearing is accommodated . the drive motor 11 has a drive shaft on which a drive pinion 22 is fastened ( fig4 ). the drive pinion uses a gear wheel transmission to drive a worm wheel 20 which meshes with a drive gear wheel 14 , which is designed as a spur gear wheel , of the distributor gearing ( see fig4 and 6 a ). the drive gear wheel 14 is connected to a sun wheel 16 of a planetary gearing for rotation therewith . coaxially with respect to the sun wheel 16 , a planet carrier 19 is mounted rotatably relative to the sun wheel 16 and the drive gear wheel 14 . the end of the planet carrier that is opposite the drive gear wheel 14 bears the output pinion 8 in a rotationally locked manner by means of a square pin . the end 33 of the planet carrier 19 protrudes outward through a housing cover 12 of the housing 12 , 13 , 21 coaxially with respect to a central axis of rotation of the distributor gearing ( see fig8 ) such that the output pinion 8 is positioned outside the housing 12 , 13 , 21 . a part of the planet carrier 19 that is in the form of a circular disk has journals for a plurality of planet wheels 17 , as can be seen with reference to fig3 and 8 . the planet wheels are mounted rotatably on the journals of the planet carrier 19 . all of the planet wheels 17 mesh with a serration of the sun wheel 16 which is mounted rotatably coaxially with respect to the central axis of rotation of the distributor gearing on a bearing sleeve protruding in an opposed manner to the end 33 . that end of the bearing sleeve which is opposite the output pinion 8 has a cavity which is open toward the end and is provided on the inside with tool engagement surfaces 31 . the tool engagement surfaces 31 serve in an emergency to enable emergency actuation of the distributor gearing and therefore of the input pinions 8 , 9 , by means of a suitable tool , such as an allen key or the like . the planet carrier 19 is axially embedded in a crown wheel 18 which is provided with an axially protruding toothed ring 29 in the region of an end side . in addition , the crown wheel 18 is provided with a further , radially inwardly projecting toothed ring 30 level with the planet wheels 17 . the planet wheels 17 mesh with said internal toothing formed by the radially inwardly projecting toothed ring . in addition , a further crown wheel 15 which is connected in a rotationally locked manner via vertical journals 27 to the journals of the planet carrier 19 is embedded in the crown wheel 18 . a toothed ring 28 of the crown wheel 15 is arranged in the same radial plane — with respect to the central axis of rotation of the distributor gearing — as the toothed ring 29 of the crown wheel 18 . the crown wheel 15 is embedded axially in the crown wheel 18 , as can be gathered from fig6 a and 8 . the two toothed rings 28 and 29 of the two crown wheels 15 and 18 can be stopped alternately by an adjustment unit 12 which , via a threaded worm 25 , axially adjusts an adjustment element 23 in the form of a toothed cam element provided with a toothed cam 32 . the adjustment element 23 is guided in a linearly movable manner in the housing 12 , 13 , 21 in such a manner that a rotational movement of the threaded worm 25 results in a linear adjustment of the adjustment element 23 . the linear guide for the adjustment element 23 is oriented radially with respect to the central axis of rotation of the distributor gearing , as can be gathered from fig6 a and 8 . the orientation is undertaken in such a manner that the toothed cam 32 of the adjustment element 23 engages in each case in one of the two toothed rings 28 , 29 of the crown wheels 15 , 18 , depending on the adjustment position of the adjustment element 23 . the adjustment element 23 is not linearly adjusted directly by transmission of torque between the threaded worm 25 and adjustment element 23 . on the contrary , the threaded worm 25 is screwed to a threaded sleeve 26 , with the adjustment element 23 being pushed onto the outer side of said threaded sleeve and being displaceable relative to the threaded sleeve 26 . the displaceability of the adjustment element 23 on the threaded sleeve 26 is formed by two axial stops a which are fixed on the threaded sleeve 26 . in addition , the adjustment element 23 is held in a central position between the two stops a by two helical compression springs 24 . the adjustment element 23 is therefore mounted in a floating manner on the outer casing of the threaded sleeve 26 . owing to the linear guidance of the threaded sleeve 26 in corresponding guide profilings of the housing 21 , a rotational movement of the threaded worm 25 inevitably results in a linear movement of the threaded sleeve 26 , as a result of which the adjustment element 23 is inevitably also entrained . the helical compression springs 24 are pretensioned and , in conjunction with the stops a , limit the adjustment distance of the adjustment element 23 on the threaded sleeve 26 . the adjustment distance of the threaded sleeve 26 itself is limited by corresponding revolutions of the threaded worm 25 of the adjustment unit 12 . the adjustment unit 12 has an electric motor as the adjustment drive . if the radially outer toothed ring of the crown wheel 18 is then fixed by the toothed cam 32 of the adjustment element 23 , the output pinion 9 is inevitably blocked in respect of a rotational movement . said output pinion is likewise stopped . accordingly , a rotational movement of the drive gear wheel 14 that is caused by the drive motor 11 is transmitted via the sun wheel 16 to the planet wheels 17 , which roll along the stopped toothed ring 30 of the crown wheel 18 and thus cause the planet carrier 19 to rotate . as a result , the output pinion 8 , which is rotationally locked to the planet carrier 19 , inevitably also rotates . if , alternatively , the outer toothed ring 29 is then released and the inner toothed ring 28 of the crown wheel 15 is fixed by the adjustment element 23 , the following sequence of movement arises : owing to the stopping of the crown wheel 15 , the planet carrier 19 inevitably also stops , and therefore the output pinion 8 is blocked in respect of a rotational movement . a rotational movement of the drive gear wheel 14 results in a rotational movement of the sun wheel 16 which meshes with the planet wheels 17 . since the planet carrier 19 is stopped , i . e . is blocked in respect of a rotational movement , the rotations of the planet wheels 17 inevitably , via the meshing with the toothed ring 30 located radially on the inside , bring about a rotational movement of the crown wheel 18 , which is connected in a rotationally locked manner to the output pinion 9 . accordingly , the output pinion 9 is caused to rotate . the toothed cam element 32 of the adjustment element 23 can also stop the two toothed rings 28 and 29 simultaneously . the two output pinions 8 , 9 are then automatically blocked in respect of a rotational movement . finally , the toothed cam element 32 of the adjustment element 23 can also release the two toothed rings 28 and 29 in respect of a rotational movement . in this position , the drive gear wheel 14 drives the two output trains of the two output pinions 8 , 9 . in the embodiment according to fig9 to 11 , a drive device 6 is basically constructed in the same manner as the drive device 6 according to fig1 . in order avoid repetitions , reference is therefore made to the explanations with regard to fig1 . the substantial difference is that , in the case of the embodiment according to fig9 to 11 , the change - over device 10 a comprises an electromagnetically switchable coupling unit . this drive device is also again provided with two output pinions 8 a , 9 a which are arranged coaxially with respect to each other and are operatively connected to corresponding drive transmission cables 7 a in order to permit corresponding shifts of the roof parts 3 , 4 . the two output pinions 8 a , 9 a are spaced apart coaxially with respect to each other — with respect to a central axis of rotation of the change - over device 10 a . the change - over device 10 a has a coupling unit 34 to 38 . the coupling unit is connected in a rotationally locked manner to a drive gear wheel 14 a which surrounds the coupling unit coaxially with respect to an axis of rotation of the output pinions 8 a , 9 a . the drive gear wheel 14 a is mounted axially in the center between the output pinions 8 a and 9 a . for this purpose , housing bearing supports g which prevent displacement of the drive gear wheel 14 a coaxially with respect to the axis of rotation of the output pinions 8 a , 9 a are provided . guide members 34 of the coupling unit are connected in a rotationally locked manner to the drive gear wheel 14 a , said guide members guiding a guide slide 35 in an axially movable manner between each other . the coupling slide 35 is mounted in a rotationally locked , but axially movable manner in the guide channel formed by the guide members 34 . the coupling slide 35 protrudes towards both axial end sides beyond the guide members 34 . the coupling slide 35 is provided with one magnetizable coupling disk 36 , 37 on each of said axial end regions . each coupling disk 36 , 37 has an axially outwardly protruding coupling extension 38 which can enter in a form - fitting or frictional manner into a respective coupling receptacle 39 of the assigned output pinion 8 a , 9 a . in addition , the end side of each output pinion 8 a , 9 a opposite the coupling disk 36 , 37 is assigned an electromagnetic coil 41 which can generate a magnetic field which can draw the respective coupling disk 36 , 37 axially against the assigned output pinion 9 a , 8 a and can thus produce a rotationally locked connection between the coupling slide 35 and the output pinion 8 a , 9 a . in the illustration according to fig1 , the coupling slide 35 is held in an intermediate position in which said coupling slide is operatively connected to the two output pinions 8 a , 9 a . this intermediate position can be maintained by springs ( not illustrated ). as soon as one of the two electromagnetic coils 41 is then energized , the magnetic field which has been produced inevitably draws the coupling slide 35 in the direction of the output pinion 8 a , 9 a of the activated coil 41 . as a result , the coupling extension 38 is inevitably disengaged in the region of the opposite output pinion because of the axial displacement of the coupling slide 35 , and therefore only one of the two output pinions 8 a , 9 a is still driven . a control unit is provided both for the adjustment of the adjustment unit 12 , in the embodiment according to fig2 to 8 , and for the energizing of the electromagnetic coils 41 according to fig9 to 11 , but said control unit is not specifically illustrated for the two embodiments . | 1 |
directing attention now to the drawings , and with reference made first to fig1 a , 1 b and 1 c , these three figures illustrate the system and methodology of the present invention in three different applications . from a “ layout ” point of view , essentially the same block arrangement exists in each of these figures . accordingly , similarly positioned blocks in these figures are similarly numbered , though in some cases differently labeled in accordance with different specific system characteristics . each layout thus illustrates a specific system and methodology 12 which includes blocks 14 , 16 , 18 , 20 , 22 , 24 . the layout pictured in fig1 c additionally includes a dashed - outline block 26 . these blocks are operatively interconnected similarly by single - and double - headed arrows , and the meanings and functionalities of these interconnections in the different systems will be explained shortly . pictured within each of fragmented blocks 24 are four sub - blocks , 24 a , 24 b , 24 c , 24 d , with sub - blocks 24 b , 24 c in each block 24 being differently shaded . the reason for this shading , and for shading differentiation , will be discussed shortly . each block 24 represents a heterogeneous collection of printers , and the sub - blocks therein represent different , individual printers , or printing devices . focusing now on fig1 a , block 14 represents a pre - created print job that is compatible with some pre - known printing ( imaging ) device . block 16 represents structure , and a series of method steps ( likenable to reverse engineering ) performed by that structure , involving assessing the printing - capabilities requirements of job 14 . block 18 functions to note devices in block 24 , and to select an available device , or plural devices , for specific use to handle job 14 . devices 24 b , 24 c are differently darkened by shading to indicate two different representative illustrations of being selected for use . device 24 c , the darker one of the two shaded devices , is employed ( so darkened ) to illustrate selection of a single printer to handle job 14 . shaded device 24 b is employed ( so darkened differently ), along with device 24 c , to illustrate selection of plural ( namely two ) printers to handle the job . continuing this description in the setting of selection of but a single printing device to handle job 14 , block 18 also functions to determine the specific printing - capabilities characteristics of a selected printing device ( device 24 c ), and then “ hands off ” control to block 20 which , in accordance with practice of the present invention , functions to assure compatibility between the print - control data structure provided for job 14 , and the noted printing - capabilities characteristics of selected printer 24 c . if there is an incompatibility between the pre - created job &# 39 ; s print - control data structure and the printing characteristics of a selected , “ available ” printer , such as printer 24 c , block 20 draws dynamically upon data from a prepared table of printer - driver definition data which is made available , in accordance with a key feature of the invention , from block 22 . specifically , block 20 performs a dynamic conversion in the job header for job 14 to replace the pre - created print - control data structure therein with data structure which will properly utilize printer 24 c . further details regarding this brief structural and functional description relating to fig1 a will be presented later herein in a discussion focusing on fig2 . before that , however , fig1 b and 1c are here discussed . whereas fig1 a illustrates employment of the present invention in a printing system with respect to handling , and if necessary performing a “ conversion ” in relation to , a pre - created print job , fig1 b illustrates another kind of employment — here in a printing system wherein a print job is “ initiated and fully created ” in the context of utilizing a virtual , or generic , printer driver . in this arrangement , the virtual driver resides in the system as a template which is ready for device - specific configuring . no conversion of the kind described above in relation to fig1 a is involved . thus , here block 14 represents job initiation , followed by the setting of certain selected conventional job preferences in block 16 . block 18 again performs a noting and printing - device selecting function based upon the work performed by blocks 14 , 16 . an appropriate available printer , or printers , is / are identified and selected , and then , with the aid of driver - definitions data drawn from block 22 , an appropriate virtual driver is configured in block 20 , effectively “ creating ” the intended job with the appropriate print - control data structure ( s ) for the selected printer ( s ). again , the definitional data content resident in block 22 plays a key role in this “ on - the - fly ”, dynamic creation of a job which , as a consequence , will be well handled by the selected printer ( s ). fig1 c illustrates performance of the invention in another kind of job - creating system — namely , one which utilizes a pseudo driver for direct printing in a printing device . blocks 14 , 16 and 18 perform substantially as described above in relation to fig1 b , except that here , job information flowing to block 20 is typically structured in a native - language format , such as microsoft word ®. block 20 , acting ( a ) either as an “ external ”, independent instrumentality in collaboration with block 22 , or ( b ) as a “ cooperator ” in a responsibility - sharing arrangement with structure and software in selected printer 24 c ( see dashed block 26 ), or ( c ) even perhaps as an internal instrumentality within printer 24 c , dynamically configures a job in association with a pseudo driver for proper handling by printer 24 c . once again , block 22 plays a key role in the behavior of this version of the invention . with attention turned now to fig2 , eight blocks are employed herein to illustrate a specific operation of system 12 of the invention , and in particular , the operation earlier described in conjunction with fig1 a . these eight blocks are identified with the numbers 32 , 34 , 36 , 38 , 40 , 42 , 44 and 46 . in fig2 , a pre - created print job is represented by block 32 ( also referred to herein as job 32 ). block 32 in fig2 corresponds to block 14 in fig1 a . the preconfiguration of job 32 is represented by block 34 , and this preconfiguration includes a job header 34 a which is cross - hatched in fig2 to symbolize a particular data - structure content that associates it with one of the several printing devices that are available at different times for use in system 12 . block 46 represents a cluster of these potentially available printing devices , and within this block six printing devices , 46 a , 46 b , 46 c , 46 d , 46 e , 46 f , are represented by square - marked areas . here it will be noticed that printing device 46 a is outlined with dashed lines , and contains shading that is the same as the shading which is employed in job header 34 a . this shading similarity , thus employed , is provided to illustrate herein that job 34 has been created with header data structure that is aimed directly for printing compatibility with printing device 46 a . however , device 46 a is not currently available , and this is represented by the surrounding dashed outline provided in fig2 regarding this device . of the five other printing devices , devices 46 b , 46 c , 46 d , 46 f are either ( a ) not currently available , ( b ) not compatible with job header 34 a , or ( c ) both . printing device 46 e , however , is available , and possesses printing - device characteristics that are symbolized the particular , dark , cross - hatched shading employed for it in fig2 . block 36 , which corresponds to block 16 in fig1 a , and which is also referred to herein as first structure , performs an examination and an assessment of job 34 , and specifically looks at header 34 a to determine the nature of the underlying job requirements that are specified in that header data structure . as was briefly mentioned earlier , this operation within block 36 is somewhat like a reverse - engineering operation . the output from block 36 is represented in block 38 with a rectangle inside it which is shaded with a different character of shading than that employed in header 34 a . this differential shading is employed here to represent the fact that block 36 has appropriately identified the core imaging requirements that were specified in header 34 a . whereas header 34 a is written with an expression that makes it “ specific ” to currently unavailable printing device 46 a , what block 38 is presented with is a data expression which describes “ in a general sense ” the underlying requirements of job 34 . block 40 , which corresponds to block 20 in fig1 a , is also referred to herein as second structure . its operation in the context of fig2 , will be discussed shortly . turning next here to block 42 which corresponds to block 22 in fig1 a , this block , also referred to herein as third structure , represents a library of data ( definitions ) which takes the form preferably of a look - up table . in this table , fundamental job characteristics of an imaging job , such as print job 34 a , are expressed relationally with appropriate data sets , or components , that describe command and control information which is specific , individually to the potentially available printing devices that form part of system 12 . the left vertical column in block 42 represents non - device - specific , fundamental and commonly expressed and understood data structure regarding printing and other control commands . to the right of the two , closely spaced vertical lines in block 42 are plural , vertical columns which represent device - specific printing and other control commands that are in the form of job header data , such as is represented by shaded job - header 34 a . what occurs now is that blocks 38 and 40 , working in conjunction with block 42 , determine that printing device 46 e is available , and has certain printing capabilities which will be appropriate for handling the fundamental printing requirements that have just been detected ( by operation of block 36 ) for job 34 . with this determination made , block 42 operates dynamically , in any appropriate manner , and by drawing “ conversion ” data from block 40 , to re - write the job header for job 34 , thus creating a re - written , or converted , print job , represented by block 44 . block , or job , 44 now stands as a surrogate for job 34 , and is armed with a header 44 a that is configured to be appropriate and compatible with respect to available printing device 46 e . further describing this process , within the illustration of block 40 in fig2 , one will notice that there is a sub - region marked 38 a , and another sub - region pointed - to by two arrows marked , respectively , 46 e and 44 a . sub - region 38 a is shaded as is its counterpart “ rectangle ” within block 38 , and the other mentioned sub - region in block 40 is shaded as within the square which represents printer 46 e . it is this graphically depicted relationship between these two sub - regions inside block 40 that highlights the way in which , according to practice of the present invention , the “ conversion ” now being described takes place . following conversion , the job is sent to device 46 e for printing . fig3 a - 10 , inclusive , illustrate in greater detail various features and operations of the system and method of this invention . read now in conjunction with just - described fig1 a , 1 b , 1 c and 2 in the drawings , all of these figures collectively present enough information , and at an appropriate level , to convey graphically to those skilled in the relevant art , a complete and detailed description both of the system and of the method of this invention . accordingly , description of the invention now progresses serially through fig3 a - 10 , inclusive . with regard to these drawing figures , the more general references to imaging and imagers will be employed . with the practice of the present invention , imagers with compatible capabilities , but with incompatible pjl syntax and / or pjl interpretation , are able to share imaging data , and / or imaging data generation devices , amongst themselves through the use of a user definable imager driver / model definition and conversion file . 1 . definition and value ranges of supported imager options ( fig3 a and 3b ). 2 . definition and settings of supported imager drivers ( fig4 a and 4b ). description begins with fig3 a and 3b which illustrate definitions and value ranges of supported imager options . the form and syntax used in this description are merely illustrative . in this illustration , imaging job options are grouped into common categories . below are examples of categories of imaging options that are currently common in the imaging industry : 1 . collation 2 . sheet assembly 3 . paper selection 4 . output trays 5 . finishing 6 . rendering 7 . accounting 8 . security for each category , one or more imaging options is / are defined . because the imaging options are simply names and not predefines , this area of interest supports the addition of future imaging options that may become available for each imaging option defined , the definition consists of a name , a data type and an optional range . for integer data types , the definition may optionally include a range . for example , 0 . 32767 might be specified to denote a range of any signed short ( 16 - bit ) integer value , or 1 , 2 , 4 , 8 for a list of sequence integer values . for enumerated data types , a definition requires specifying a list of symbol names that fully enumerate the range . for example , portrait , landscape and rotated might be used to enumerate the range of values for orientation . below is an example of definitions of imaging options for each of the above data types : in the examples specified , # symbol is used to designate a comment line and backslash to designate line continuation . fig4 a and 4b illustrate and describe the definitions and settings of supported imager drivers . it is assumed that each imager model has a unique imager driver associated with it , and can be distinguished by the driver name associated with the installed imager . as an alternative , definitions and settings may be specified for imager models as well . the form and syntax used in this description are also merely illustrative . in this illustration , imager driver definitions and settings , or subsets of the same , are grouped into compatible imager drivers . for example , a line of imager models may consist of three imagers with exactly the same options , firmware interpreter and capabilities , and only differ by speed ( i . e ., ppm ). in this case , it would be assumed that the three imager drivers could be grouped into a single common definition / setting . in another example , if the same three imager models additionally differed in syntax and interpretation of finishing options , the finishing options could be separately specified on a per - imager - driver basis , and the remaining definitions / settings could be grouped as described above . below is an example : # industry standard definitions / settings common to imager drivers unless otherwise overridden one set of options that are common to most advance - featured imagers and mfp devices are finishing options for stapling . the setting and interpretation of stapling is not standardized in the industry , and is proprietary to each manufacturer . the pjl industry standard for stapling only specifies whether to staple or not , as shown below : the definition and settings for the pjl industry standard for stapling might be as illustrated hereinbelow : as noted , the pjl industry standard for stapling does not specify either where to staple , or the number of staples to use . many modem finishers support multiple staples or multiple staple locations . below are examples of imager models with finisher attachments that support multiple staples and / or multiple locations : in the above imager models , stapling consists of at least two pjl statements — one specifying the stapling output tray , and the other specifying the type of stapling . for example , the above sharp imagers all specify an output tray that corresponds to the stapler tray in their respective finisher attachment : thus , here one sees an example of an incompatibility amongst imagers from the same manufacturer , where the first two imager model lines use tray 3 as the stapling output tray , and the third imager model line uses tray 5 . if an imaging job is generated from an imager driver associated with the first two imager model lines , but sent to a imager in the third model line , the imaging job would incorrectly not staple , since tray 3 is not the stapling tray . there are also inconsistencies amongst manufacturers regarding the pjl statement to specify the output stapling bin . for example , the hp laserjet 8100 series imager uses a different pjl operand to refer to the output tray as the stapling output tray : in the above sharp imager model lines , the type of stapling is specified by the jobstaple command : in the above examples , the @ pjl set jobstaple command is used to specify the location and number of staples . the above sharp imager models are also incompatible with the number of staples that their corresponding finishers support : there are also inconsistencies amongst manufacturers on the pjl statement to specify the location and number of staples . while the above sharp imager models use one pjl command to specify both location and number of staples , the hp laserjet 8100 series uses two commands — one to designate stapling , and one to designate the number of staples to use : as a reflection on the picture presented by the above definitions / settings illustration and discussion , the specifications of imaging job options / values and of imager driver options / settings are presented in a human readable text file . because the text file is human readable , this file can be updated and maintained on the fly by appropriate people . corrections , or additions regarding new imaging job option / settings , or imager driver / model options / settings , can be added dynamically without going back to a manufacturer . definitions can be loaded into a cluster solution either as interpreted data , or as pre - compiled binary data . in the case of interpreted data , a cluster solution parses / interprets and converts the text file into binary data that is loaded into the cluster solution at run - time ( i . e ., imaging job initiation ). alternately , a cluster solution can pre - compiled the text file , and store the compiled data as a binary file . the cluster solution then reads in the binary data at run - time ( i . e ., imaging job initiation ). when an imaging job is generated by a imager driver , and then directed to a different , but otherwise compatible imager , a cluster solution would perform the following steps : 1 . parse the imaging job data for pjl statements . 2 . match pjl statements in the imaging job to imaging job options / settings in the definition file . 3 . match the imaging job options / settings of the parsed pjl statements to the imager driver options / settings of the source imager driver . 4 . match the imaging job options / settings of the source imager driver to the imaging driver options / settings of the targeted imager model . 5 . check for supported imaging job options / settings . 6 . convert any imager model specific option / settings that differ between the source imager driver and the targeted imager model . 7 . send the converted imaging job to the targeted imager model . below are some examples using the finisher stapling option to illustrate the above . in this example , the options / settings for both the source imager driver and for the targeted imager model are identical . no change would be made . in this second example , the option / settings for the targeted imager model do not support stapling with two staples . no conversion can occur and the imaging job would not be redirected to this imager model . in the above example , the options / settings for both the source imager driver and targeted imager model differ only by the output tray . the outbin = tray 3 statement in the imaging job would be converted to outbin = tray 5 when sent to the targeted imager model . in the above example , the options / settings for both the source imager driver and targeted imager model differ significantly . in this case , the imaging job would be converted as follows : 1 . outbin = tray 3 would be changed to outbin = optionaloutbin 3 2 . jobstaple = stapleleft would be changed to finish = staple 3 . stapleoption = one would be added . continuing now with more commentary regarding various definition situations and thoughts , from a general layout point of view , a user - definable imager definition file is normally composed of a sequence of one or more sections . each section describes a grouping of one or more imager drivers and associated imager models that have similar characteristics , such as being from the same model line . the characteristics need not be identical , but just similar enough to be described together in a section . generally , this is defined as having the same configurable capabilities ( e . g ., duplex ), but perhaps differing in attributes ( e . g ., ppm ). each section is denoted by left and right brackets and has a user definable name . a section is broken down into components . a component is a predefined subsection that has a specific meaning , which is preceded by a % symbol and followed by a predefined keyword . below is an example of the general layout , wherein one will note that the # symbol denotes a line comment : with respect to defining imager models and imager drivers , the imager definition file usually contains component subsections to declare the imager drivers and associated imager models within a common section . generally , an imager model may accept more than one pdl , but an imager driver generally only generates a single pdl . to accommodate this , each imager driver can optionally be declared with the pdl that it generates . generally , imager models in a common section , such as from an imager model line , have certain varying attributes or capabilities . to accommodate this , each imager model can optionally be declared with an enumeration identifier , which can then be later used to differentiate attributes / capabilities that are supported with which models . below is an example of declaring a set of imager drivers and imager models within a common section : further , the imager driver declarations can be segmented for multiple imager model groupings , where each grouping of imager drivers can be interchanged with any of the corresponding imager models . if no grouping is specified , then all imager drivers are assumed to be interchangeable with the imager models . the groupings are specified in a parenthesized list using the enumerated ids of the imager models . in relation to defining attributes in an imager definition file , such a file will contain a component subsection to define the attributes of the imager models declared in the corresponding section . attributes are characteristics of an imager model that are not modifiable or selectable by the imaging source . attributes generally include , but are not limited to : 1 . ppm — imager rate 2 . imagable area — region of paper that ink can be placed on 3 . color — imager has color capabilities 4 . maximum output capacity — maximum number of sheets in output tray the attribute section contains zero or more attribute definitions . generally , each attribute is declared , followed by its definition . in this example , the declaration consists of the name of the attribute followed by a colon . the definition consists of the text that follows the colon on the same line . the above definitions can be segmented for multiple imager model groupings , where each grouping shares the same attributes . if no grouping is specified , then all imager models share the same attributes . in this situation , groupings are separated by commas , and the associated imager models are specified in a parenthesized list using the enumerated ids of the imager models . below is an example of defining a set of imager attributes for a set of imager models within a common section : from discussion and illustrations presented so far , it is understood that imager definition file can contain a component subsection to define the imaging options of the imager models and associated drivers declared in the corresponding section . options are user selectable settings implemented either by the imager firmware or by the imager driver , and may be optionally installed . 1 . collation 2 . sheet assembly 3 . paper selection 4 . output trays 5 . finishing 6 . rendering 7 . accounting 8 . security the option section contains zero or more option definitions . generally , each option is declared , followed by its definition . in this example , the declaration consists of the name of the option followed by a colon . the definition consists of two parts , a part that consists of the text that follows the colon on the same line , and a second part that consists of a sequence of option selections and their corresponding pjl commands . the first part specifies where the option is implemented , and whether the option is an installable option ( i . e ., implemented in the imager , but is not standard ). the option can be specified as either implemented in the imager firmware ( or attachment ) or imager driver . for example , duplexing is generally implemented in the imager firmware , stapling in a finisher attachment , but copy collation and booklet imaging may be emulated in the imager driver , if the imager model does not have the storage capacity for these types of operations . below is an example of declaring a set of imager options and defining the implementation location for a set of imager models within a common section : the second portion of the option declaration consists of a sequence of zero or more user selectable option settings and their corresponding pjl commands . each option selection consists of a tag name followed by zero or more pjl commands . in this example , the tag name is enclosed between angle brackets , and the pjl commands consists of zero or more commands — one per line , preceded by an @ sign . below is an example of defining the imager option for duplex mode imaging : in the above illustration , there are three user settings for duplex : simplex , longedge ( duplex in book format ) and shortedge ( duplex in tablet format ). the @ pjl statements following each option selection indicate the pjl statements generated by the corresponding drivers and the associated imager models in this section . note , some option selections may require more than one statement . in the above case , duplex on requires setting the binding edge option to determine the page orientation and the output tray to indicate which path in the imager has duplex capabilities . from a “ protocols ” point of view , an imager definition file contains a component subsection to define the protocols supported by selected imager models . protocols include imager port protocols , such as lpr and tcp / ip , device - query protocols , such as bi - di , snmp and ipp , and imaging languages , such as pjl , pcl 5 e , postscript , etc . the protocol section contains zero or more protocol definitions . generally , each protocol is declared , followed by its definition . in this example , the declaration consists of the name of the type of protocol followed by a colon . the definition consists of a sequence of zero or more protocol names that follow ( s ) the colon on the same line . additionally , imager protocol declarations can be further annotated , using the = sign , to indicate the supported version level of the protocol . below is an example : % protocol port : lpr , tcp / ip , appletalk , ieee 1284 = ecp query : snmp = v 3 , slp pdl : postscript = v 2 , pcl 5 e , pcl xl as an alternative , an imager definition file could have the means to describe proprietary fields that are extensions to these protocols , such as extended mib on a per imager model basis for snmp . regarding the issue of notification , an imager definition file can contain a component subsection to define the methods for notifying the imaging source of job completion which may be supported by certain imager models . job completion includes imaging phases such as : 1 . de - spooling — imaging job was fully de - spooled to / from the imaging device . 2 . internal queuing — imaging job was successfully queued in the imaging device . 3 . rip — imaging job was fully rip processed . 4 . output — imaging job was fully physically outputted the notification section contains zero or more notification definitions . generally , each notification is declared , followed by its definition . in this example , a declaration consists of the name of the type of notification followed by a colon . the definition consists of the name of the notification that follows the colon on the same line . in the above example , the definition indicates that the imager model announces successfully completion of both the de - spooling and rip back to the spooler ( e . g ., enddocimager ( )), there is no indication of queuing ( e . g ., no queue capabilities ), and completion of physical output is notified by email . with reference to the matter of capabilities matching , in one approach , the imager definition file is used to facilitate capabilities matching in an imager group for imager pooling or job splitting . in this approach , all the imagers are assumed to : 1 . accept the same imaging job stream ( i . e ., compatible pjl and pdl ), such as in a common imager model line . 2 . but have different capabilities , standard and / or installed options . 3 . and may be in different states : error , ready , offline , etc . generally , the imaging job is directed to the lead imager ( e . g ., imager a ) in the imager group , and the imaging job stream is generated by the imaging source to be compatible with the lead imager . prior to transmitting the imaging job to the imaging device , the imaging job is sent to a control unit where that control unit may be part of the imaging subsystem . it could be in the spooler , in the imaging processor , in the port monitor , or in the imaging assist , and may reside on the client , at the server , or with a third - party component which is added between the client and the imaging device , or built into the imaging device . the control unit analyzes the imaging job to determine the imaging requirements , such as by parsing the pjl commands that generally precede the imaging data . the imaging requirements ( e . g ., list of pjl commands ) are passed to a capabilities matching unit . the capabilities matching unit is used to match the requirements of the imaging job to one or more imagers in the imager group using any conventional best - fit algorithm , such as , but not limited to : availability , imaging rate and capabilities . the capabilities matching unit uses the imager definition file described herein to improve the performance and reliability of determining the capabilities of each imager in the imager group . instead of querying each imager for either all the imager &# 39 ; s capabilities , or the subset required by the imaging job , the capabilities unit queries an imager database that was constructed from the imager definition file . for each imager , the capabilities matching unit queries the imager database using the imager model name of the corresponding imager . any method may be used to determine the model name of the corresponding imager , such as by an snmp query . the imager database , generated by the imager definition file , returns to the capabilities matching unit a list of the corresponding imager &# 39 ; s standard features , installable features and methods of communication . the imager database may also contain a cache to return information on installable features that were obtained previously . the capabilities matching unit then uses this information to determine the minimum , if any , amount of information to query from the imaging devices to complete the matching algorithm . if the feature is an installable option , the capabilities matching unit may additionally store the result in a cache that can be subsequently accessed by the imager database in future queries . when a capability is an installed feature , and there is no information , or is stale , from the cache , the capabilities matching unit uses the communication method ( s ) obtained from the imager database to query the imaging device . if the imaging device does not respond , the imaging device can be assumed to be non - communicating , vs . not supporting the protocol . once the capabilities of the imaging devices are determined , relative to the requirements of an imaging job , the capabilities matching unit passes to the control unit the best - fit imager ( s ). the control unit then de - spools the imaging job to one , or a subset of , the matched imager ( s ). in another approach , the imagers in the imager group may accept different imaging data streams for specifying imaging job requirements ( e . g ., pjl ). in this case , the control unit performs the additional action of sending the imaging job to an imaging job editor , along with the imager model name ( s ) of the selected imagers and the imaging job requirements . the imaging job editor then queries the imager database with the selected imager model and the imaging job requirements . the imager database thereafter returns to the imaging job editor the imaging job commands ( e . g ., pjl ) that correspond to the imaging job requirements which are compatible with the specified imager model . the imaging job editor then edits the imaging job , in any manner , such as by replacement or by appending in an overriding manner , that transforms the imaging job to be compatible with the selected imager . in still another approach , the imager definition file is used to facilitate generating a user interface and a corresponding set of imaging job commands for a virtual or pseudo device driver , such as in a direct imaging utility ( pseudo ), or via a configurable generic device driver ( virtual ). fig7 and 8 provide illustrations regarding this area of utility of the present invention . in one example of a direct imaging ( di ) utility , the di utility dynamically generates a user interface of imaging options that correspond to the capabilities of the selected imager by querying an imager database which is generated from an imager definition file . as suggested earlier , the di utility can query the imager for installed capabilities using protocols specified by the imager definition file , or it can obtain the installed options via a cache from an earlier query . a user would then select the desired options from the dynamically generated user interface . the di utility would thereafter query the imager database to obtain the imaging job commands ( e . g . pjl ) for the selected options that correspond to the imager model of the selected imager . the di utility would then construct an imaging job by any suitable conventional means that conforms to the imaging device . in another illustration , an imaging job request is submitted through a non - user interface , such as a background process ; whereby , the imaging job requirements are stated in some intermediate format , and then converted to imaging job commands specific to the selected imaging device . with respect to a generic imager driver , the generic imager driver typically contains a programmable unit that dynamically generates a user interface which furnishes imaging options that correspond to the capabilities of a selected imager . this “ furnishing ” is based upon querying of an imager database that is generated from an imager definition file . as in the cases discussed above , the generic imager driver can query the imager for installed capabilities using protocols specified by the imager definition file , or it can obtain the installed options via a cache from an earlier query . a user would then select the desired options from the dynamically generated user interface . the programmable unit of the generic imager driver would then query the imager database to obtain the imaging job commands ( e . g . pjl ) for the selected options that correspond to the imager model of the selected imager , then passing the respective pjl commands back to the generic imager driver . the generic imager driver would then proceed to construct an imaging job in any conventional manner that conforms to the imaging device ; whereby the subject imaging job will consist of the generated pdl data ( e . g ., pcl , postscript , pdf , etc .) and the appropriate job commands for rendering , assembling and finishing . in yet another form , an imaging job request may be submitted through a non - user interface , such as a background process ; whereby , the imaging job requirements are stated in some intermediate format , and then converted to imaging job commands specific to the imaging device , as in the manner described above . fig9 and 10 herein help to illustrate one final area for discussion regarding the present invention &# 39 ; s flexibility and utility . here what is shown is how the imager definition file can be used to facilitate recovering a failed imaging job . in one example of an imaging job recovery , an imaging job is spooled to the spooler . the imaging job may be generated by an imager driver , by a direct imaging utility , by a configurable generic driver , or by some other process . in this example , a component of the spooling subsystem has the capability to monitor the successful completion of an imaging job , and additionally , the ability to restart the imaging job on another device in a setting where the available devices are either homogeneous ( i . e ., compatible with the same imaging stream ), or heterogeneous ( i . e ., not compatible with the same imaging stream ). the useful component in the associated imaging subsystem could be , among other things , the spooler , an imaging processor , a port monitor or an imaging assist ; where , an imaging assist is any custom component added to the imaging subsystem between the imager driver ( or source ) and the port manager . once an imaging job is spooled , the component of the spooling subsystem possessing the requisite capability ( e . g ., an imaging processor ) invokes an imaging job recovery unit ( jru ). the jru queries an imager database generated from the imager definition file to obtain the methods by which the specified imager , via its imager model ( e . g ., obtained by a snmp ), communicates the completion of an imaging job ( e . g ., de - spool , rip , output ). the jru then instantiates a monitoring process according to the methods associated with the imaging device , and notifies the component of the spooling subsystem that the jru is ready to monitor the job . the spooling subsystem then de - spools the imaging job to the imaging device . if the imaging device is successful , a message is received by the jru which informs the spooling subsystem about final job completion . if unsuccessful , a failure message from the device is received by the jru . if the failure message reports a recoverable type of failure on the same device ( e . g ., paper jam ), the spooling subsystem and / or the user is informed in an appropriate manner ( e . g ., user dialog notification ). if the failure is not recoverable on the device ( e . g ., device malfunction ), the jru restarts the imaging job on another compatible device . a new monitoring process is then set up for the device with respect to the restarted job , and the spooling subsystem is notified of the restarted job in an appropriate manner . it should be noted that the monitoring process for the second device may be different from that for the first device . monitoring methods for the second device are obtained from the imager database as described earlier . in still another illustration , where the second device is not compatible with the imaging stream , the jru , in order to effect a restart , performs the additional actions of sending the imaging job to an imaging job editor , along with the imager model name ( s ), and the imaging job requirements . the imaging job editor then queries the imager database with the selected imager model and the imaging job requirements . the imager database returns to the imaging job editor the imaging job commands ( e . g ., pjl ) that correspond to the imaging job requirements which are compatible with the imager model associated with the newly selected imager ( s ). the imaging job editor then edits the imaging job in any suitable manner , such as by replacement or by appending , in an overriding manner , information that transforms the imaging job to be compatible with the imager ( s ). the jru then sends the new imaging job to the new imager ( s ). the job is monitored , and the spooling subsystem notified as in the manners described above . the system and methodology of the invention thus offer very versatile and easily implemented ways to control appropriate data association with all sorts of imaging jobs , with respect to how job - handling requirements can be effectively “ translated ” into the most appropriate command set ( s ) which is / are matchingly relevant to and compatible with different potentially available imaging devices . certain variations and modifications also have been suggested . accordingly , it is understood that many and other modifications and variations may be made and found to be useful , and all such other modifications and variations are deemed to be encompassed by the scope of the present invention . | 6 |
the illustrations presented herein are , in some instances , not actual views of any particular butterfly valve , valve seat , or seat retainer , but are merely idealized representations which are employed to describe the present invention . additionally , elements common between figures may retain the same numerical designation . fig1 shows a perspective view of a butterfly valve 100 according to one embodiment of the present invention and fig2 shows a cross - sectional top view through line 2 - 2 of fig1 . the butterfly valve 100 comprises a valve body 110 defining a flow channel 120 of substantially circular cross - section , a disc 130 mounted for rotation within the flow channel 120 , a shaft 140 coupled to the disc 130 as is generally known in the art for rotating the disc 130 , an annular valve seat 150 , and a valve seat retainer 160 . the valve body 110 comprises a substantially circular opening defining the flow channel 120 configured to allow a fluid to flow therethrough . the valve body 110 may further comprise a substantially flat surface 170 ( fig3 ) extending radially outward from the flow channel 120 . the disc 130 is rotatably mounted within the flow channel 120 of the valve body 110 and configured to rotate between a fully open position ( when the disc 130 is positioned substantially parallel to the flow channel axis ) and a fully closed position ( when the disc 130 is positioned substantially perpendicular to the flow channel axis so that no fluid passes therethrough ). disc 130 may comprise a circumferential sealing edge 180 , which is inclined with respect to the flow channel axis . the shaft 140 is coupled to the disc 130 and may extend outside of the valve body 110 so that rotation of the disc 130 may be controlled from outside the valve body 110 , as is generally known in the art . fig3 is a magnified partial section view of a valve seat 150 and a valve seat retainer 160 showing the cooperation between the valve body 110 , the valve seat 150 , the valve seat retainer 160 and the disc 130 . the valve seat 150 may be positioned adjacent the substantially flat surface 170 of the valve body 110 . the valve seat 150 may comprise an annular ring circumscribing the flow channel 120 . the valve seat 150 may comprise a substantially s - shaped cross - section comprising a first concave region 190 and second concave region 200 configured to open in opposing directions . the valve seat 150 may comprise a plastic material , such as , by way of example and not limitation , an ultra high molecular weight polyethylene material . the s - shaped configuration provides improved compliance in the radial direction , allowing the valve seat 150 to conform and seal more effectively against the disc 130 , as will be discussed in further detail below . furthermore , this “ s ” shape may be capable of providing a relatively shorter valve seat , taken in the axial direction . fig3 shows the valve seat 150 in its totally undeflected position , i . e ., in the position which it would occupy if the disc 130 was rotated into the open position , out of contact with the valve seat 150 . the first concave region 190 , comprising the radially outermost portion of the valve seat 150 , may include a first leg 210 , a first support segment 220 , and a center leg 230 . the first support segment 220 may extend radially inward from the first leg 210 and substantially perpendicular thereto . the center leg 230 may extend from the first support segment 220 in the same direction as the first leg 210 and substantially parallel thereto , the center leg 230 also being substantially perpendicular to the first support segment 220 . the second concave region 200 , comprising the radially innermost portion of the valve seat 150 , may comprise the center leg 230 , a second support segment 240 , and a second leg 250 . the second support segment 240 may extend radially inward from the center leg 230 and substantially perpendicular thereto , the second support segment 240 extending substantially parallel to the first support segment 220 . the second leg 250 may extend from the second support segment 240 in the same direction as the center leg 230 and substantially parallel thereto , the second leg 250 being substantially perpendicular to the second support segment 240 . the second leg 250 further comprises a sealing tab 260 extending radially inward and configured to contact the circumferential sealing edge 180 of the disc 130 when the disc 130 is in the closed position . the inside diameter of the valve seat 150 , when unstressed , may be slightly smaller than the diameter of the disc 130 . this dimensional relationship may ensure an interference fit , designated as the sealing point 270 , between the sealing tab 260 and the circumferential sealing edge 180 . the increased compliancy and spring effect in the radial direction provided by the s - shaped valve seat 150 coupled with the interference fit at the sealing point 270 enhance the sealing effectiveness of the valve seat 150 , even at low line pressures . furthermore , the sealing tab 260 may comprise an incline at the radially innermost edge . in some embodiments , the angle of the radially innermost edge below the sealing point 270 may be nearly parallel to circumferential sealing edge 180 of the disc 130 . with an incline on the sealing tab 260 , as the valve seat 150 wears , the surface area of the sealing point 270 in contact with the circumferential sealing edge 180 will increase , and the valve seat 150 will continue to seal . in addition , as discussed above , the “ s ” shape of the valve seat 150 may provide the seal with increased resiliency and compliance in the radial direction . such an increased flexibility in the radial direction may allow more radial movement to compensate for wear of the valve seat 150 , dimensional tolerances between the parts , and also for thermal expansion and contraction caused by different operating temperatures . furthermore , the increased flexibility may create less friction forces between the disc 130 and the valve seat 150 , and may , therefore , reduce wear of the valve seat 150 . the valve seat retainer 160 is positioned over the valve seat 150 and may include an annular ring configured to retain the valve seat 150 in position . the valve seat retainer 160 includes a flat surface configured to mate with the substantially flat surface 170 when the valve is assembled . the valve seat retainer 160 may include a first recess or channel 280 formed proximate a radially inward edge 290 , and a second recess or channel 300 formed between the first channel 280 and the radially inward edge 290 . the first channel 280 may be configured to substantially receive the first concave region 190 of the valve seat 150 . similarly , the second channel 300 may be configured to substantially receive at least a portion of the second leg 250 of the valve seat 150 . the depths of the first channel 280 and the second channel 300 are configured to sufficiently receive the valve seat 150 , such that portions of the valve seat 150 may lie adjacent the substantially flat surface 170 of the valve body 110 . in some embodiments , the first channel 280 and the second channel 300 may have substantially similar depths . this may allow for a valve body 110 that does not require any substantial groove to receive a portion of the valve seat 150 , which groove may generally require a thicker body . in addition , the lack of a groove in the valve body 110 may provide a body which is more structurally sound . located between the first channel 280 and the second channel 300 is a first retaining tooth or protrusion 310 . the first protrusion 310 may be positioned and configured to extend at least partially into a portion of the second concave region 200 of the valve seat 150 . the length or height of the first protrusion 310 may be less than the depths of the first channel 280 and the second channel 300 to allow adequate space for the second support segment 240 between the first protrusion 310 and the substantially flat surface 170 of the valve body 110 . a second retaining tooth or protrusion 320 may be positioned adjacent the radially inward edge 290 . the second protrusion 320 may form a radially inward boundary of the second channel 300 and may be configured to circumscribe an outer surface of the radially inward edge of the second leg 250 of the valve seat 150 . the valve seat retainer 160 may comprise any suitable metal material . the first and second protrusions 310 , 320 , respectively , may further provide retention features to help retain the valve seat 150 in the valve seat retainer 160 . these retention features may also limit the movement of the valve seat 150 and prevent excessive deflection which , in turn , may lead to plastic yielding . for example , the second protrusion 320 may retain the second leg 250 , extending into the second channel 300 , from excessively deflecting . without such features , pressure differentials across a partially closed valve may deflect the valve seat 150 downstream and radially inward , or the seat may catch onto the disc 130 when it is rotating and be pulled out of the valve seat retainer 160 . when the disc is distorted or pulled out of the valve seat retainer 160 , closing the disc 130 may bend the valve seat 150 backwards or even invert it , causing damage to the valve seat 150 and severe leakage . in some embodiments , the valve seat 150 may be press - fit into the valve seat retainer 160 . an interference fit may be provided between that radially outermost edge of the first leg 210 and the relative mating surface of the valve seat retainer 160 , depicted as surface 350 . such an interference fit may positively align the valve seat 150 to the valve seat retainer 160 . with the valve seat 150 positioned and fit into the valve seat retainer 160 , the valve seat retainer 160 may be positioned adjacent to the substantially flat surface 170 of the valve body 110 . before the valve seat 150 and valve seat retainer 160 are secured in position , the valve seat retainer 160 may be allowed to float or move to center itself as a unit around the disc 130 rotated to its closed position . after the valve seat 150 and valve seat retainer 160 are positively aligned with the disc 130 , the valve seat retainer 160 may be secured in place adjacent the substantially flat surface 170 . when the valve seat 150 and valve seat retainer 160 are secured in place , the first leg 210 of the valve seat 150 may be clamped or compressed between the substantially flat surface 170 and the first channel 280 of the valve seat retainer 160 to further secure the valve seat 150 in place . the compressed first leg 210 may also create a seal between the valve seat retainer 160 and valve body 110 to prevent fluid from leaking around the outside of the valve seat 150 . the first leg 210 , therefore , may comprise a length which is greater than the depth of the first channel 280 to create the interference fit . in addition to providing the valve seat 150 with increase resilience and compliance in the radial direction , the “ s ” shape of the valve seat 150 may also improve the bi - directional pressure assisted sealing characteristics . conventionally , when closed and pressurized , inline fluid pressure is applied to both the valve seat and the disc . in embodiments of the present invention , this inline pressure enhances the sealing effectiveness , regardless of whether the valve is pressurized from flow with the shaft 140 upstream or downstream . fig4 illustrates the pressures on the valve seat 150 according to one embodiment with a fluid flow in which the shaft 140 is downstream . in other words , the fluid flow is from top to bottom of the valve , as the valve is oriented in fig4 . with increased pressure applied from a flow with the shaft 140 downstream , the disc 130 axially deflects in the downstream direction . the “ s ” shape of the valve seat 150 is such that unbalanced areas exposed to the pressure result in a sealing stress which increases proportionally to the pressure differential . more specifically , when pressure is applied to the valve seat 150 with the shaft 140 downstream , pressure may be applied on the valve seat 150 in the directions of the arrows as a result of fluid flow in the spaces between the valve seat 150 and the valve seat retainer 160 . the surface area of the radially outward surface 330 of the second leg 250 may be larger than the combined surface area of the radially inward surface 340 of the second leg 250 and the exposed surface of the sealing tab 260 . the valve seat 150 may , therefore , be deflected both downstream and radially inward into the circumferential sealing edge 180 of the disc 130 to a degree greater than the above - mentioned deflection of the disc 130 . this deflection of the valve seat 150 may enhance the sealing effectiveness of the valve . fig5 illustrates the pressures on the valve seat 150 according to one embodiment with a fluid flow in which the shaft 140 is upstream from the fluid flow . in other words , the fluid flow is from bottom to top of the valve , as the valve is oriented in fig5 . with increased pressure applied to the shaft side of the valve , a two - fold stress - versus - deflection phenomenon may occur in the valve seat 150 . the disc 130 may displace axially in the downstream direction . the axial displacement of the disc 130 may increase the elastic internal stresses in the valve seat 150 by virtue of a compression on the valve seat 150 between the circumferential sealing edge 180 and the surface 350 at the radially outer most edge the valve seat retainer 160 . furthermore , when pressure is applied to the valve seat 150 with the shaft 140 upstream , pressure may be applied to the radially outer surface of the center leg 230 , the upstream surface of the second support segment 240 , and the exposed surface of the sealing tab 260 in the direction of the arrows as a result of fluid flow in the spaces between the valve seat 150 and the valve body 110 . the surface area of the radially outer surface of the second support segment 240 may be larger than the surface area of the exposed surface of the sealing tab 260 , resulting in a net force pushing the valve seat 150 both downstream and into the disc 130 . these forces tend to increase proportionally with the fluid pressure . additionally , the deflection of the valve seat 150 downstream , combined with the pressures on the second concave region 200 , may cause the second concave region 200 to bend around the first protrusion 310 of the valve seat retainer 160 , creating essentially compressive stresses on the downstream surface of the second support segment 240 and tensile stresses on the upstream surface of the second support segment 240 . these stresses tend to increase proportionately with disc deflection . these actions may enhance the sealing effectiveness of the valve . fig6 is a system diagram of a fluid control system according to one embodiment of the present invention comprising a butterfly valve 100 . the butterfly valve may include a butterfly valve 100 of the present invention as previously described . more particularly , the butterfly valve 100 may include a valve body and a disc rotatably secured within the valve body . a valve seat may be coupled to the valve body with a valve seat retainer . the valve seat 150 and the valve seat retainer 160 may be configured according to an embodiment , as described above . an actuator 360 may be controllably coupled to the shaft 140 and configured to control the rotation of the disc 130 . the actuator 360 may comprise any conventional actuator known in the art . by way of example and not limitation , the actuator 360 may comprise a valtek - brand actuator , available from flowserve company of irving , tex . a positioner 370 may be operably coupled to the actuator 360 . the positioner 370 may comprise any conventional positioner 370 as is known in the art . by way of example and not limitation , the positioner 370 may comprise a valtek - brand positioner , available from flowserve company of irving , tex . while certain embodiments have been described and shown in the accompanying drawings , such embodiments are merely illustrative and not restrictive of the scope of the invention , and this invention is not limited to the specific constructions and arrangements shown and described , since various other additions and modifications to , and deletions from , the described embodiments will be apparent to one of ordinary skill in the art . thus , the scope of the invention is only limited by the literal language , and equivalents , of the claims which follow . | 5 |
with reference to fig1 , an apparatus 1 for carrying out a method in accordance with the present invention is illustrated . a natural gas stream 10 is introduced into a catalytic partial oxidation reactor 12 along with an oxygen stream 14 and a steam stream 16 . catalytic partial oxidation reactor 12 contains a partial oxidation catalyst to promote partial oxidation of hydrocarbons contained within natural gas stream 10 to produce a synthesis gas stream 18 containing hydrogen , carbon monoxide , water and carbon dioxide . the synthesis gas stream 18 is introduced into a water gas shift unit 20 that includes a water gas shift reactor containing a shift catalyst as well as known heat exchangers for steam generation and preheating of feeds to catalytic partial oxidation reactor 12 . for exemplary purposes synthesis gas stream 18 is produced at a temperature of 1750 ° f . and a pressure of about 315 psia . the natural gas stream 10 , available at 77 ° f . and 330 psia , is introduced into the catalytic partial oxidation reactor 12 after being preheated within unit 20 to 475 ° f . water gas shift unit 20 , by water gas shift conversion , increases the hydrogen content of the synthesis gas stream 18 to produce a synthesis gas stream 22 having a hydrogen content that is greater than that of synthesis gas stream 18 . synthesis gas stream 22 can have a temperature of about 700 ° f ., a pressure of about 300 psia , and a flow rate of about 21 . 2 mmscfd . further , synthesis gas stream 22 can have a composition as follows : a hydrogen content of about 58 . 3 mol percent , a water content of about 17 . 3 mol percent , a carbon monoxide content of about 3 . 5 mol percent , a carbon dioxide content of about 18 mol percent and a methane content of about 2 . 9 percent . all of these percentiles are on a volume basis . the process heat contained within synthesis gas stream 22 is extracted by heat exchangers 24 and 26 . a gas turbine fuel stream 27 , which can be natural gas having a flow rate of about 43 . 6 mmscfd , is passed through heat exchange passes located within heat exchangers 24 and 26 and is then fed to a gas turbine 28 . gas turbine fuel stream 27 emerges from heat exchanger 26 at a temperature of about 245 ° f . and thereafter , from heat exchanger 24 at a temperature of about 370 ° f . before being introduced into gas turbine 28 . as can be appreciated , gas turbine 28 is located as close as possible to catalytic partial oxidation unit 12 and water gas shift unit 20 , heat exchangers 24 and 26 and etc . to minimize fuel pressure and heat losses . synthesis gas stream 22 is cooled in heat exchanger 24 to a temperature of about 375 ° f . and is then introduced into a heat exchanger 30 to preheat boiler feed water to near saturation for subsequent process steam generation within water gas shift unit 20 , for instance to produce steam stream 16 . the synthesis gas stream 22 exits heat exchanger 30 at about 260 ° f . and is further cooled to 110 ° f . in heat exchanger 26 . a trim cooler 32 is provided for back - up cooling . the placement and use of heat exchanger 30 and trim cooler 32 will , however , be dictated by the steam requirements and the exact synthesis gas plant being utilized . knock - out drums 34 and 36 are located down stream of heat exchanger 30 and heat exchanger 26 for condensate removal via streams 38 and 40 , respectively . knock - out drum 36 removes most of the condensate , typically over about 70 percent . the resultant cooled dry synthesis gas stream 42 is then separated in a pressure swing adsorption unit 44 (“ psa ”) that , as would be known in the art contains , for example beds of alumina , carbon and molecular sieve adsorbent . the beds operate out of phase in a known manner to produce a hydrogen product stream 46 , here with 80 percent recovery and a flow rate of 9 . 9 mmscfd and a psa tail gas stream 48 . since the catalytic partial oxidation reactor 12 does not require external firing , all of psa tail gas stream 48 is routed to a heat recovery steam generator 50 containing a duct burner 51 . also introduced into heat recovery steam generator 50 is a heated exhaust stream 54 produced by gas turbine 28 through the combustion of fuel stream 27 . such combustion within gas turbine 28 is supported by an air stream 52 that is compressed within gas turbine 28 . steam is generated within heat recovery steam generator 50 to produce a warm flue gas 56 . some steam through a steam stream 58 may be introduced into a steam turbine 60 for power generation . pre - heating fuel stream 27 to 370 ° f . reduces gas turbine fuel requirements for gas turbine 28 by approximately 0 . 87 percent . furthermore , routing the psa tail gas stream 48 to the heat recovery steam generator 50 boosts the power of steam turbine 60 by roughly 10 percent . this reduces the production costs of hydrogen product stream 46 through the generation of power by approximately 20 percent over production costs that would be required without such integration . in fact , hydrogen production costs of an integration such as illustrated in fig1 and operated as described above yield production costs that become competitive with much larger facilities based on steam methane reforming . as indicated above , some of the heat in synthesis gas stream 22 is recovered at a temperature below 500 ° f . or more precisely , as low as about 110 ° f . this heat would if not recovered in accordance with the present invention would be dissipated or lost to the environment without the efficiency of the present invention being realized . the flow rate ratio of the fuel stream 27 and its makeup of entirely natural gas to the flow rate of the synthesis gas stream of about 2 . 0 allows such heat transfer and heat recovery in accordance with the present invention to take place . in practice , as indicated below for the embodiment of fig2 , such ratio is even higher but should in any case be greater than about 1 . 5 . with reference to fig2 , an apparatus 1 ′ is illustrated for carrying out a method in accordance with the present invention that involves steam methane reforming . in apparatus 1 ′, a hydrocarbon containing feed stream 62 and a steam stream 64 are introduced into a steam methane reformer 66 to produce a synthesis gas stream 68 that contains hydrogen , carbon monoxide , water and carbon dioxide . synthesis gas stream 68 is in turn introduced into a water gas shift unit 70 that consists of heat exchangers for steam generation and preheating of feeds to reformer 66 and a water gas shift reactor , as discussed above , to produce a synthesis gas stream 72 having increased hydrogen content over that of synthesis gas stream 68 . synthesis gas stream 72 is cooled within heat exchanger 74 and trim cooler 76 before being introduced into a knock - out drum 78 for removal of water 80 . synthesis gas stream 72 after having passed through heat exchanger 74 is introduced into a heat exchanger 80 to heat fuel to a gas turbine 82 . in heat exchanger 80 , low value heat is recovered from the incoming synthesis gas stream 72 after having been cooled within heat exchanger 74 to a temperature that is between about 200 ° f . and about 700 ° f . upon exiting the heat exchanger 80 , the synthesis gas will be cooled typically to a temperature of about 150 ° f . or less for processing within psa unit 86 . a synthesis gas product stream 88 can be recovered along with a hydrogen product stream 90 and a psa tail gas stream 92 that can be used to fire burners within steam methane reformer 66 . a fuel stream 84 and a subsidiary fuel stream 94 as a combined stream 96 is in part introduced into heat exchanger 80 as a subsidiary stream 98 . a remaining part of the combined stream 96 , namely , subsidiary stream 100 , is recombined with subsidiary stream 98 after having been heated within heat exchanger 80 . the resultant heated combined stream 102 can be combined with a further subsidiary fuel stream 104 to produce fuel stream 106 to be introduced into gas turbine 82 along with air 108 to produce a heated exhaust stream 110 . subsidiary fuel stream 94 and fuel stream 84 could be partly composed of synthesis product gas stream 88 provided that at least about 60 percent of subsidiary fuel stream 98 is derived from a source independent of the synthesis gas stream 88 . subsidiary fuel stream 94 and subsidiary fuel stream 104 are optional and could be formed from the synthesis gas product stream 88 . it is to be further pointed out that the heat transfer arrangement illustrated herein could be employed with a catalytic partial oxidation unit , such as unit 12 or optionally , the heat transfer arrangement of fig1 could be employed with a steam methane reformer , such as designated by reference number 66 . the advantage of the heat exchange arrangement of fuel flows used in connection with heat exchanger 80 is that the temperature of the fuel fed to the gas turbine can be controlled by mixing the heated fuel stream from heat exchanger 80 with an incoming ambient part of the stream 100 . however , as indicated in examples below , all of the fuel could be routed through heat exchanger 80 . fuel stream 106 is at a temperature of no greater than 400 ° f . which is the maximum allowable temperature contained in many manufacture - recommendations for gas turbines . the heated gas turbine exhaust 110 is introduced into a burner 112 within a heat recovery steam generator 114 to generate steam and a cooled flue gas stream 116 . again , a steam stream 118 can be routed to a steam turbine 120 for power recovery . with reference to fig3 , although heat exchanger 80 is illustrated as a single unit in fig2 , multiple heat exchangers such as 80 a and 80 b could be provided with process heat exchanger 122 situated between heat exchangers 80 a and 80 b . the fuel gas 98 in such case can be divided into first and second subsidiary streams 124 and 126 . the first subsidiary fuel stream 124 after having been heated in heat exchanger 80 b is divided into third and fourth subsidiary fuel streams 128 and 130 . third subsidiary fuel stream 128 is combined with second subsidiary fuel stream 126 and introduced into heat exchanger 80 a to produce a heated combined fuel stream 132 that is further combined with second subsidiary fuel stream 130 to produce a fuel stream 134 that would be introduced into a gas turbine such as gas turbine 82 as illustrated with respect to fig2 . with reference to fig4 , heat exchanger 80 or heat exchangers 24 or 26 may be replaced by heat exchanger 80 c in which a third cooling stream 135 such as water would only provide trim cooling and for cooling during periods in which gas turbine 82 is brought off line . with reference to fig5 , heat exchanger 80 , or either of the heat exchangers 24 or 26 for that matter , might be replaced with heat exchangers 80 d and 80 e that employ a heat transfer fluid , for instance , water circulating through a heat transfer circuit . a water stream 136 is introduced into the heat transfer circuit and then pumped to high pressure by pump 138 . excessive temperatures are moderated by a circuit cooler 140 . the following are calculated examples illustrating a variety of possible operational schemes for the embodiment of applicant &# 39 ; invention as carried out in fig2 . unless otherwise specified , in all examples , gas turbine 82 is a model 7fa gas turbine manufactured by general electric energy ( 4200 wildwood parkway , atlanta , ga . 30339 ) being fed with a fuel stream 106 made up of natural gas fuel having the following composition : 92 . 1 mol % ch 4 , 3 . 4 % c 2 h 6 , 3 . 2 % n 2 , 0 . 7 % co 2 , 0 . 6 % c 3 h 8 , a pressure of about 325 psia , a temperature of about 60 ° f . and a nominal flow rate of about 4675 lb - mol / hr . the manufacturer &# 39 ; s recommended maximum allowable fuel temperature is set at about 400 ° f . the synthesis gas stream 72 is cooled to a target temperature in a range of between about 70 ° f . and about 120 ° f . prior to water removal in knock - out drum 78 and further processing within psa unit 86 . additionally , it is assumed that heat exchanger 80 is designed with 3 psi pressure drop on both the synthesis gas and fuel sides and with a 30 ° f . pinch . a further assumption is that the additional gas turbine fuel pressure drop can be managed by the pipeline or fuel compressor used in connection with the source of natural gas . for purposes of this example , synthesis gas stream 72 has a flow rate of about 860 lb - mol / hr and has the following composition : 48 mol percent hydrogen , 35 . 7 mol percent water , 1 . 9 mol percent carbon monoxide , 10 . 8 mol percent carbon dioxide , 0 . 6 mol percent nitrogen and 3 . 0 mol percent methane . after passage through heat exchanger 74 , synthesis gas stream 72 has a pressure of about 238 psia and a temperature of about 372 ° f . assuming a hydrogen recovery of about 83 percent , approximately 3 . 12 mmscfd hydrogen would be produced for hydrogen product stream 90 . in heat exchanger 80 , the synthesis gas stream 72 is further cooled to 100 ° f . against subsidiary stream 98 that constitutes about 62 percent of combined stream 96 . subsidiary stream 98 emerges from heat exchanger 80 at a temperature of about 322 ° f ., which upon mixing with subsidiary stream 100 , produces fuel stream 106 at a temperature of about 227 ° f . in this example no additional fuel is used and hence , subsidiary fuel streams 94 and 104 are not present . the 30 ° f . pinch point is assume to occur near the warm end of heat exchanger 80 . the resulting preheated fuel stream 106 is calculated to decrease fuel consumption of gas turbine 82 by about 0 . 49 percent . this example is a modification of example 1 in which synthesis gas stream 72 has a flow rate of about 1385 lb - mol / hr and the same composition and temperature and pressure after having been cooled in heat exchanger 74 . again , assuming a recovery of hydrogen of about 83 percent , about 5 . 02 mmscfd hydrogen would be produced for hydrogen product stream 90 . furthermore , in this example it is assumed that all of fuel stream 84 passes through heat exchanger 80 to cool synthesis gas stream 72 to about 100 ° f . the resultant fuel stream 106 has a temperature of about 322 ° f ., which decreases fuel consumption by about 0 . 76 percent . this example is similar to that of example 2 , but with synthesis gas stream 72 having a different composition than that previously considered due to additional process heat recovery within water gas shift unit 70 . in this regard , for purposes of this example , synthesis gas stream 72 is assumed to have the following composition : 63 . 9 mol percent hydrogen , 13 . 2 mol percent water , 2 . 8 mol percent carbon monoxide , 14 . 1 mol percent carbon dioxide , 0 . 7 mol percent nitrogen and 5 . 3 mol percent methane . as a result of the additional process heat recovery , synthesis gas stream 72 has a lower stream temperature after heat exchanger 74 , namely 277 ° f . as opposed to 372 ° f . in the previous examples and consequently a lower moisture content due to condensation removed in an upstream knock - out drum that as would be known in the art could be associated with water gas shift unit 70 . further , in this example , synthesis gas stream 72 must only be cooled from about 277 ° f . to about 110 ° f . as such , about 2300 lb - mol / hr of synthesis gas stream 72 is cooled against all of the fuel stream 84 to produce 11 . 12 mmscfd hydrogen for hydrogen product stream 90 . under such conditions , fuel stream 106 has a calculated temperature of about 247 ° f ., which decreases fuel consumption by 0 . 54 percent . while previous examples have all considered a 7fa - based power plant , any power plant based on one or more gas turbines is suitable . for instance , a 6fa - based plant would nominally use 2150 lb - mol / hr of the previously specified natural gas as fuel stream 106 , while a 207fa combined cycle plant would nominally use 9350 lb - mol / hr of natural gas . for such plants , proportionally less or more of the synthesis gas could be cooled . for instance , example 4 shows that , when all 7fa gas turbine fuel is routed through heat exchanger 20 , 2300 lb - mol / hr of synthesis gas stream 72 could be cooled from about 277 ° f . to about 110 ° f . for a 6fa plant , about 1058 lb - mol / hr of synthesis gas stream 72 could be cooled , while for a 207fa plant , about 4600 lb - mol / hr of synthesis gas stream 72 could be cooled . synthesis gas stream 72 for such purposes is assumed to have the composition set forth in example 4 . this translates to about 5 . 11 and about 22 . 24 mmscfd h 2 production , respectively . for all three foregoing cases , fuel stream 106 emerges preheated to 247 ° f ., which decreases fuel consumption by about 0 . 5 percent . obviously , annual fuel savings would be proportionally greater / smaller for larger / smaller gas turbines . although the present invention has been described in connection with steam methane reforming and catalytic partial oxidation , the present invention could be employed in connection with an autothermal reformer . while the present invention has been described with reference to a preferred embodiment , as will occur to those skilled in the art , numerous changes , additions and omissions can be made without departing from the spirit and the scope of the present invention . | 5 |
fig1 is a block diagram 100 that illustrates a power supply 110 coupled with a ballast 120 to provide power to a high intensity discharge ( hid ) lamp 130 . the ballast 120 interfaces to an auxiliary lighting system 140 which in turn allows power to be transmitted from a power supply 110 to an auxiliary lamp 160 . power supply 110 can provide a wide range of input voltages , such as 208v , 240v or 277v , for example . additionally , voltage and / or current provided by the power supply 110 can have any number of characteristics . for example , in one embodiment the power can have alternating current with a frequency of 60 hz . of course the present concepts may be implemented with lighting systems utilizing alternating current of other frequencies . the ballast 120 can receive power from the power supply 110 to provide an initial voltage to the hid lamp 130 . the ballast 120 can start the hid lamp 130 by causing an arc to form inside the lamp . once the lamp is lit , the current flowing through the lamp is regulated to keep the arc operating at peak efficiency . it is to be appreciated that the ballast 120 can be “ matched ” to provide appropriate power to the hid lamp 130 . the hid lamp 130 can be a mercury vapor , a metal halide , a high - pressure sodium or a low - pressure sodium lamp , for example . the efficiency of the hid lamp 130 can vary widely based on the type of lamp employed . for example , mercury vapor has a low efficiency whereas low - pressure sodium is among the most efficient light sources . in addition , color rendering can vary based on the type of lamp employed . for example , a mercury vapor lamp can provide a bluish light whereas low - pressure sodium can provide yellow light . the auxiliary lighting system 140 is employed to turn on the auxiliary lamp 160 when the hid lamp 130 goes into a hot re - strike condition or is too dim to provide adequate light during a warm - up condition which can occur if the power supply 110 has experienced an interruption . in this manner , the system 100 can provide auxiliary light throughout a particular lighting system that amounts to a fraction ( e . g ., one percent ) of the total lumens emitted . the auxiliary lamp 160 can remain on until the hid lamp 130 reaches a predetermined power level . during this time , the ballast 120 may be in hot re - strike mode such that the hid lamp 130 cannot be reignited because the starter voltage is not sufficient to restart the hid lamp 130 under high pressure . as the hid lamp 130 cools down and pressure drops , sufficient power can be applied and the hid lamp 130 can be restarted again . for example , the auxiliary lighting system 140 ( and auxiliary lamp 160 ) can stay on until the power applied to the hid lamp 130 reaches 200 watts . after reaching such predetermined power level , the auxiliary lighting system 140 and auxiliary lamp 160 turn off . in accordance with the illustrated embodiment , the auxiliary lighting system will continue to operate even if the ballast 120 fails . in this maimer , the ballast 120 and the auxiliary lighting system 140 interface to a common power supply 110 though disparate connections . thus , if a fuse in the ballast 120 fails , the hid lamp 130 will turn off while the auxiliary lighting system 140 will continue to operate . fig2 is a block diagram 200 of an embodiment wherein a power supply 210 is connected to a ballast 220 to provide power to an hid lamp 230 . an auxiliary lighting system 240 interfaces to the same power supply 210 to provide power to an auxiliary lamp 260 . the hid ballast 220 and the auxiliary lighting system 240 are coupled such that the hid ballast 220 can provide a signal to trigger the auxiliary lighting system to turn on or off as appropriate . for example , the hid lamp 230 is turned off thereby drawing less current from the auxiliary lighting system 240 . such drop in current draw is detected to activate the auxiliary lighting system 240 which provides power to the auxiliary lamp 260 . a ballast power sensing component 242 detects when power delivered to the ballast 220 is below a predetermined level . such a determination is made via a transformer winding coupled to the ballast 120 . the ballast power sensing component can trigger a lamp driver component 244 that regulates the power delivered from the power supply 250 to the auxiliary lamp 260 . for example , the lamp driver component 244 reduces the voltage from the power supply 250 from approximately 240v to 120v to deliver to the auxiliary lamp 260 . it is to be appreciated that the lamp driver component accepts substantially any power level for conversion to a disparate power level . a voltage regulation component 246 maintains voltage delivered to the auxiliary lamp 260 independent of variation in the line voltage provided by power supply 250 . for example , the power output to the auxiliary lamp 260 can be regulated at approximately 120v even though the input line voltage varies from 208v - 277v . the auxiliary lamp 260 can be substantially any lamp that illuminates after receiving power . in one embodiment , the auxiliary lamp 260 is a 250 watt lamp that illuminates after receiving 120v . fig3 is a circuit level diagram of an auxiliary lighting system 300 that includes a ballast power sensing circuit 310 , a lamp driver circuit 320 and a feed forward voltage regulation circuit 330 . as noted above , the auxiliary lighting system 300 determines when an appropriate , regulated amount of power is to be delivered to an auxiliary lamp . the ballast power sensing circuit 310 includes current transformers t 1 and tvs 1 ; schottky diodes d 1 , d 2 , d 3 and d 4 ; resistors r 8 , r 9 , r 10 , r 11 , r 12 and r 13 ; comparator u 1 ; clamping diode d 9 ; resistors r 5 and r 6 ; and capacitor c 1 . voltage v bc , developed at the output of the ballast power sensing circuit 310 is approximately a linear representation of hid ballast power . the current drawn by the hid ballast is transformed by transformer t 1 , rectified by the schottky diode bridge d 1 - d 4 , and converted to a voltage in burden resistor r 12 . the resulting voltage is converted to a scaled current through resistor r 8 . the average current in the resistor pair r 9 & amp ; r 10 is proportional to the prevailing line voltage applied to the hid ballast input . when the current through r 8 and the current through r 9 & amp ; r 10 are summed , a pseudo - power signal is developed , and the average value is provided by the filter r 11 and c 1 . when the voltage , v bc , rises above a predefined threshold ( determined by resistors r 5 and r 6 ), then the trigger signal applied to the triac in lamp driver circuit 320 is suppressed ( through comparator u 1 ) thereby pulling the discharge capacitor c 4 low . this disables the auxiliary light circuit from operating whenever the ballast is drawing a certain prescribed amount of power . this occurs , essentially , when the hid ballast power is greater than the desired preset value . the auxiliary incandescent lamp will then be off . the relationship between the hid ballast power and the two current signals is illustrated in fig4 below . during those times when voltage v bc falls below the preset voltage value set by r 5 and r 6 , the lamp trigger signal will not be suppressed . the triac will be fired according to the timing determined by the feed forward voltage regulation circuit 330 and the incandescent lamp will be on . since the voltage drop across the triac is relatively small , the input / output relationship is relatively independent of the power rating of the incandescent lamp . the comparator u 1 compares the feed - forward reference voltage to the instantaneous line voltage ( scaled down by r 1 and r 2 ) and drives the switching of the triac through the pulse transformer t 2 . this circuit remains active anytime the hid lamp power falls below a desired value . in this way , the auxiliary light circuit 300 can provide an alternate light source during hot re - strike conditions and also during warm - up conditions when the hid lamp is lit but is still at a low power level . the lamp driver circuit 320 is comprised of a triac q 1 and a transformer t 2 . a diode d 10 is employed to protect the gate of the triac q 1 . in this configuration , when a pulse is received by the transformer t 2 , the gate of the triac q 1 is activated and it turns on for a certain amount of phase ( α ) of the line voltage . the triac reduces voltage received from the line voltage and delivered to the incandescent ( auxiliary ) lamp . in this manner , the incandescent lamp can operate regardless of the line voltage . the theory of operation of the triac phasing is based on the relationship of the phase angle α of the triac q 1 , and the rms line voltage ( v line ) to rms load voltage ( v load ) experienced by the incandescent lamp . this expression is given below : by adjusting α for the varying line voltages , the load ( e . g ., incandescent lamp ) voltage is held relatively constant ( e . g ., 120v ), independent of large line variations . this is accomplished in this circuit with the feed - forward element comprised by r 3 , r 4 , r 7 , and the voltage reference vr 1 . this circuit produces a threshold voltage at which the triac is switched . this threshold is designed to change linearly with the line voltage . the feed forward voltage regulator circuit 330 circuit determines the driven , rms , incandescent lamp voltage and includes rectifying diodes d 5 , d 6 , d 7 and d 8 ; bias resistors r 0 a and r 0 b ; voltage reference vr 1 ; filter capacitors c 2 , c 3 , and c 5 ; reference network resistors r 3 a , r 3 b , r 4 , and r 7 ; line detecting resistors r 1 a and r 1 b , and r 2 ; comparator u 2 ; mosfet transistor q 2 ; pulse transformer t 2 ; and pulse capacitor c 4 . the resistor network r 3 a , r 3 b , r 4 , and r 7 produces a scaled voltage into the input of the triggering comparator u 2 that provides a dc offset and a variable component that is linear with the line voltage thereby providing a linear function of the line voltage at the negative input to the comparator u 2 . the voltage divider ( including resistors r 1 and r 2 ) follows the rectified line voltage . when the rectified line voltage rises above a desired critical level , the comparator u 2 goes to a low state , turning off the mosfet transistor q 2 and allows the capacitor c 4 to charge up . when the scaled line voltage drops below the threshold of this reference , it turns the mosfet transistor q 2 on to provide a current impulse from the discharging capacitor c 4 through the pulse transformer t 2 . this pulses the gate of the triac q 1 and the transformer t 2 , thereby turning on the incandescent lamp . the incandescent lamp remains on for the remainder of the line cycle until the line voltage crosses through 0v at which time the triac q 1 turns off again . during this time , the output of the triac stays high keeping capacitor c 4 shorted , until such output crosses the upper threshold again . for example , if line voltage varies from 208 volts to 277 volts , the reference voltage and hence the trigger point changes thereby changing the level at which the triac q 1 is triggered . in this manner , the line voltage is regulated to approximately 120v . other desired voltage levels can be regulated , as desired . capacitor c 5 prevents undesired high frequency disturbances to the line voltage common in industrial environments . the capacitor c 5 acts as a low pass filter with a cutoff frequency of about 1 khz . employing this low pass filter prevents the auxiliary lamp from triggering at inappropriate times causing fluctuation in incandescent line voltage which can be perceived as lamp flicker or flash . for example , line voltage variation of approximately 20v can be reduced to a 3v variation before delivery to the incandescent lamp utilizing this technique . the auxiliary lighting circuit 300 demonstrated the following values when reduced to practice : fig4 is a graph of related data curves that illustrate signal voltage as related to ballast line power . the curve that represents voltage across resistor r 12 represents the contribution from the current sensing circuit . for example , if the ballast power is constant at 215 w and the load ( e . g ., auxiliary lamp ) is subjected to different line voltages , the amount of current drawn will change accordingly . the curve that represents voltage that is proportional to line voltage illustrates how power delivered to a lighting circuit can fluctuate . conventionally , such line voltage variation causes deleterious effects to the circuit such as improperly activating an auxiliary light and / or providing improper power to such auxiliary lights . the sum of the voltage across resistor r 12 curve and voltage that is proportional to the line voltage is represented by the sensing curve line at the very top of the graph . in this manner , the circuit compensates for changes in the power line voltage by adding a power line voltage component to the sensing voltage . for example , the power line current will decrease as the power line voltage increases . thus , the sensing curve is kept relatively constant such that it is proportional to the power that the hid ballast is drawing . the nominal set point represents the threshold value for activating the auxiliary lamp . this set point value is determined by changing resistor values in a voltage divider , for example . if the sensing curve is greater than the nominal set point , the auxiliary lamp will not be activated . in contrast , if the sensing curve is less than the nominal set point , the auxiliary lamp will be activated . in this embodiment , the sensing curve is greater than the nominal set point thereby keeping the auxiliary light in an off state fig5 is a graphical illustration of the predicted input / output relationship of the auxiliary lighting circuit that charts the load ( e . g ., auxiliary incandescent lamp ) voltage versus the line voltage of the circuit . in this embodiment , the auxiliary lamp is rated for 120v and can operate within a predetermined voltage range without noticeable fluctuation in light output . for example , if the voltage is between 115v and 125v , there may be no appreciable difference in lumens output by the incandescent lamp . the lamp driver circuit above is employed to provide a relatively constant load voltage regardless of line voltage variation . in this manner , the incandescent lamp can operate independently of the line voltage input into the auxiliary lighting system . the circuit disclosed in fig3 was built using the nominal component values shown in the illustration . it was tested on a 100 w , a 150 w , and a 250 w auxiliary incandescent lamp load . the output voltages observed across the 250 w lamp were : 124 . 0 . vac for a 277vac line , 118 . 4vac for a 240vac line , and 116 . 0vac for a 208vac line . using a 250 w prototype hid ballast to light , warm - up , and re - light a 250 w hid lamp , the auxiliary light source illuminated the 250 w quartz halogen lamp when the hid lamp was in hot re - strike or in warm - up . the auxiliary light source then extinguished and stayed off when the hid lamp was in its normal , steady state operating state . it is to be appreciated by one skilled in the art that the foregoing disclosure does not reference every component in the circuit level drawings contained herein . further , it is understood that the exemplary embodiments disclosed are but one approach to practice the novel concepts set forth in this disclosure . in addition , it is to be appreciated that the figures in conjunction with the specification provide an enabling disclosure to one skilled in the art . the chart below provides values for circuit components mentioned above and / or contained in the circuit level figures : | 7 |
when football fans watch a football game , either live or on television , they have no involvement in how the game is played . they know little about the plays the coach of their team is picking to execute on the field , and have no ability to influence the coach &# 39 ; s play choices . various embodiments disclosed herein are directed to computer - implemented methods and systems for increasing fan involvement in games by enabling fans to actively participate in calling plays at football games . as will be discussed in greater detail below , in accordance with various embodiments , a computer - implemented live - game system or engine is provided that enables fans of a team to collectively decide in real - time which plays should be executed by their team during a game . for each play , the coaches of the teams pick a set of possible plays , which the fans vote on . the system tabulates the fan votes , and the winning play can be executed on the field in real - time . the system provides users with access to a wide variety of information needed to participate in the system including information on plays , player rosters , teams , stats etc . the system also tracks each fan &# 39 ; s coaching performance ( e . g ., the % of times the fan &# 39 ; s play choice was the winning play , the % of times the fan &# 39 ; s play succeeded ( scored , achieved first down , gained certain yardage ), or the % of times the fan &# 39 ; s play selection likely would have been a better choice given the poor performance of the actual play run on the field , etc .). the system also enables fans to compete against one another , individually or in leagues , in their coaching skills . while the exemplary embodiments illustrated herein relate to the game of american football , this is by way of example only . it should be understood that the methods and systems for increasing fan participation are not limited to football , and may also be applied to other live events such as , e . g ., soccer , baseball , golf , hockey , basketball , movie screenings , game shows , award shows , sales meetings , political events , and business conferences . fig1 illustrates an exemplary network , in which a live - game system 100 may be implemented , according to some embodiments of the present disclosure . the live - game system 100 can be implemented in a computer server system , which communicates with a plurality of client devices operated by the users of the system 100 , including fans 102 , the coaches / coordinators 104 , 106 of the teams playing the game , referees 108 , and system administrators 110 . other users of the system can include production staff 112 and product marketing / customer service staff 114 . the client devices communicate with the system 100 over a communications network 116 . the communications network 116 can include any network or combination of networks including , without limitation , the internet , a local area network , a wide area network , a wireless network , and a cellular network . the client devices operated by users to access the live - game system 100 can include any computing device that can communicate with the computer server system including , without limitation , personal computers ( including desktop , notebook , and tablet computers ), smart phones ( e . g ., apple - based smart phones and android - based smart phones ), wearable computer devices ( e . g ., smart watches and smart glasses ), cell phones , personal digital assistants , and other mobile devices . the client devices include operating systems ( e . g ., android , apple ios , and windows phone os , among others ) on which applications run . the operating systems allow programmers to create applications ( often called “ apps ”) to provide particular functionality to the devices . a representative client device can include at least one computer processor and a storage medium readable by the processor for storing applications and data . the client device also can include input / output devices , one or more speakers for acoustic output , a microphone for acoustic input , and a display for visual output , e . g ., an lcd or led display , which may have touch screen input capabilities . fig2 is a block diagram illustrating system architecture , according to some embodiments of the present disclosure . fig2 shows a message listener 202 , record manager 204 , score manager 206 , poll manager 208 , advanced message queuing protocol ( amqp ) 210 , game manager 212 , engagement service 214 , coach manager 216 , vote manager 218 , information service 220 , referee application 222 , moderator devices 224 , coach devices 226 , fan devices 228 , database 230 , and fan connections . message listener 202 is active software built into the system . it provides asynchronous event handling that defines the initial action to be taken as each message arrives . different actions may be defined for different message types . record manager 204 includes a database for storing user voting records ( e . g ., votes during a game ). the database can include any physical database or cloud - based data storage ( e . g ., mongo database instance ). score manager 206 includes a database for storing game statistics ( e . g ., wins , losses , play executed during a game ). the database can include any physical database or cloud - based data storage ( e . g ., mongo database instance ). poll manager 208 controls state logic for polling . as described in more detail , polling can include a series of discrete states . amqp 210 comprises an advanced message queuing protocol ( e . g ., rabbitmq ). amqp can support a variety of protocols and includes message orientation , queuing , and routing . game manager 212 includes a database for storing real - time events and statistics during a game . the database can include any physical database or cloud - based data storage ( e . g ., mongo database instance ). game manger 212 can communicate with ref app 222 . as described in more detail below , game manager 212 can send ref app 222 real - time data corresponding to a game . ref app 222 can send instructions to game manager 212 , based on the real - time data , to update state information ( e . g ., state information for polling ) and information for display on one or more coach device 226 or fan device 228 . engagement service 214 represents multiple discreet services that coordinate elements of the game experience . these services include a user interface , logic , and storage . one of the services , fanscore moderator 224 , stores the data behind multiple question - and - answer games ( e . g ., the name of each game , one to one - thousand questions , timing logic associated with answers for each of the questions , and tips for each of the questions ). a person operating the fanscore moderator can define a game , initiate a game , and trigger the delivery of each question ( e . g ., the first question is sent 10 minutes before kickoff , the second question during the first timeout ), and identify the recipients of each question ( e . g ., all registered fans or fans voting with only one of the two teams ). another service , coachscore moderator 224 , allows an operator to evaluate the results of plays run on the field in real time ( e . g ., declaring an error on a play and assessing the success of the play run on the field ). these evaluations are then used to create each fan &# 39 ; s coachscore . coach manager 216 includes a database for storing coaching records ( e . g ., information about plays , players , scheduling ) and other data that is used in multiple devices across the system . the database can include any physical database or cloud - based data storage ( e . g ., mongo database instance ). coach manager 216 is in communication with a coach application 226 . coach manager 216 can display information in the database to the coach device and receive edits and changes from the coach device to information in the database . vote manager 218 coordinates voter polling . vote manager 218 maintains the logic for communication and controls that communication with fan devices 228 via fan connections 240 . fan connections 240 declares and manages the communication channel used with fan devices . vote manager 218 , through a fan connection module , can push a poll to fan device 228 and receive results from the poll . fan device 228 represents the mobile devices used by fans to participate in calling plays . the info service 220 includes web services that execute key processes ( e . g ., retrieving fan profile information , updating playbook information in fan apps , etc .). the information service refers to a fast , in - memory data store 230 ( e . g ., redis ). fig3 and 4 are flow diagrams illustrating an exemplary play voting cycle , according to some embodiments of the present disclosure . referring to fig4 , prior to a game , each of the entities in the system logs in once to backend service 420 . backend service is described in more detail above in fig2 . the entities include admin 410 , a voter 412 , offensive coordinator 413 , and defensive coordinator 414 . admin , at the start of the game , can send an instruction to the backend service 420 to start the game 411 . for each play , the process starts with the administrator starting a play clock 301 . in some embodiments , an administrator starts each game , starts each play clock , and identifies each possession switch ( e . g ., when possession of the ball transfers from one team to the other ). the coaches of each team are given a predetermined amount of time ( e . g ., 1 - 60 seconds , preferably 7 seconds ) to pick a set of possible plays to be voted on by the fans . the offensive coordinator can select a set of plays 302 , and a defensive coordinator can select a set of plays 303 . in some embodiments , the offensive coordinator and defensive coordinator each select 3 plays . the plays are pushed out via push technology ( preferably no manual refresh on the fans app is needed ) to fans who have registered with the system . fans are then able to view the poll 304 . fans are then given a preset time period ( e . g ., 1 to 60 seconds , preferably 10 seconds ) to vote on the play they want their team to execute 305 . the fan votes are sent to a system database and tabulated . the winning results are sent to the coaches 306 . the results can also be sent to the fans at the same time , again preferably via push technology 308 . coaches then radio or otherwise communicate the winning play to the personnel on the field , and the fans and coaches get to see the winning play executed on the field in real - time . the process described above can then start again for a subsequent play . the system provides users with access to a wide variety of information needed to participate in the system including information on plays , player rosters , teams , stats etc . in one or more embodiments , fans can download a fan app on their client devices to access the system . fig5 shows an exemplary screenshot from the fan app enabling users to register and login 503 to the system , according to some embodiments of the present disclosure . a user can access a unique url 501 and sign in using his / her username and password by clicking a “ sign in ” button 502 . during the registration process , a user will enter his or her name and choose a user name and password that will identify the user whenever using the system . users can also enter in secure information , including a credit card and billing address information if they are going to sign up for a premium or paid product . users can click on a “ get in the action ” button 504 to be directed to a team page where they will also be asked to choose which team they are a fan of 505 , or they can go in and look at team information before they decide . they can click a button 506 to decide on a team once they review team information . fans who are registered and logged in can enter a fan app dashboard as illustrated in the exemplary screenshot of fig6 . the dashboard provides fans with access to a variety of content items ( illustrated in fig7 - 14 ) they can use to participate in the live - game system . for example , fan app dashboard can include a header 601 , which displays details about a coming game before the start of a game . as described in more detail below , fan app dashboard can also include rattlers den 602 , team banter 603 , playbook 604 , injury report 605 , weekly recap 606 , player roster 607 , my stats 608 , and my achievements 609 . fans can access team information 700 , including coach and player videos and talk sessions as illustrated in the exemplary screenshot of fig7 . also known as rattlers den , a repository of player videos and talk sessions can be branded for each team . fans can be asked to choose and confirm a team selection 800 , as illustrated in the exemplary screenshot of fig8 . in some embodiments , a fan has up until game time to change which team they vote for in any given game . fans can also access a team page , as illustrated in the exemplary screenshot of fig9 . the team page can display various details about a team , including coach videos , player videos and talk sessions 900 . fans can also access a team match - up page , as illustrated in the exemplary screenshot of fig1 . to help fans determine which team to vote with , the team matchup page can include a comparison of game statistics for both teams , such as running and passing 1000 . the team match - up page can also display voting statistics and averages . fans can also access a team list , as illustrated in the exemplary screenshot of fig1 . in some embodiments , the team page lists all teams , their conference , rank , record , coach and next game 1101 . fans can access chat discussions 1202 and twitter ( or proprietary chat - based service ) feeds 1203 as illustrated in the exemplary screenshot of fig1 . also known as team banter , discussion and twitter feeds can be displayed alongside an icon of a fan displayed with their achievement level 1201 . fig1 is an exemplary screenshot illustrating fan access to injury reports 1301 . fig1 is an exemplary screenshot illustrating fan access to information 1401 on each player on the team roster . along with this content , the system also offers fans functionalities to track their performance — my stats 1501 shown in the exemplary screenshot of fig1 and my achievements 1601 shown in the exemplary screenshot of fig1 . my stats 1501 details the fan coach scores . the coaching game logic engine of the live - game system scores the fan &# 39 ; s coaching or play calling performance . participation 1502 indicates the % of plays that have been voted on by the fan . winning plays 1503 indicates the % of times the fan &# 39 ; s play choice was the winning play and run by the team . scoring plays 1504 indicates the % of times a fan &# 39 ; s play scored . my achievements 1601 can indicate achievement levels earned by each fan . achievements can include grid - iron ruler 1602 ( e . g ., voting on a certain number of plays ), primetime picker 1603 ( e . g ., picking a certain number of plays that have been executed ), captain endzone 1604 ( e . g ., picking a certain number of plays that score ), and move the chains 1605 ( e . g ., having a certain percentage of 3 rd down conversion ). in some embodiments , coach score can be displayed on a user device , as shown in the exemplary screenshot of fig1 . the main page can include a fan coach score season average 1701 , a voting section 1702 , results for each week 1704 , and results for each game 1705 . in some embodiments , voting section 1702 includes a breakdown of how a fan earns a coach score . the breakdown can include details of coaching game logic engine , described in more detail below . the coach score page can also include a challenges section , as shown in the exemplary screenshot of fig1 . challenges can allow fans to see their performance within head to head challenges 1800 , as described in more detail below . the coach score page can also include an education section , as shown in the exemplary screenshot of fig1 . the education section can include articles and activities to allow fans to learn more about play calling 1900 . in some embodiments , articles and activities that are displayed in the education section are selected based on a fan &# 39 ; s coach score . fig2 shows screenshot of a fan score page , according to some embodiments of the present disclosure . a fan score page can show points fans earn by participating in events hosted by the system 2000 . a fan score page can include an achievements section , showing fans how they have earned points 2002 . a fanscore page can also include an events section , as shown in the exemplary screenshot of fig2 . an events section can include links to activities where fans can earn additional points 2100 . activities can include fan contests , finding a fan voting party , subscribing to fan alerts , and tuning into coach picks . activities can also include answering trivia or other questions , as shown in the exemplary screenshot of fig2 . trivia allows fans to participate in real - time trivia and related contests 2200 . in some embodiments , each question has a time limit 2202 , and a fan can choose one of three answers 2203 . a fan can gather points that contribute to fanscore points 2204 . a fan is delivered a trivia answer page after answering a trivia question , as shown in the exemplary screenshot of fig2 . a fan can be shown a correct answer , their answer , and an explanation of the correct answer 2300 . fig2 shows a screenshot of a rewards page , in accordance with certain embodiments . fan points can be accumulated and redeemed for real merchandise and digital goods 2400 . fans may participate in challenges , as shown in the exemplary screenshot of fig2 . fans can initiate challenges 2501 and define a type of challenge 2502 . challenges may be decided by coachscore , a measure of effective play - calling . challenges may also be decided by fanscore earned by answering trivia or other questions 2200 . challenges can involve individual players or player - defined leagues . the duration of a challenge can last any amount of time ( e . g ., single game , weekend , or season ). a challenges page , as shown in the exemplary screenshot of fig2 , can also include real time requests for challenges 2600 . fans can choose either to accept or reject a real time challenge 2601 . fans can also access real - time results on the system , as shown in the exemplary screenshot of fig2 . real time results include allowing fans to see in real - time how they are performing in their coachscore and fanscore challenges as well as any pending invites 2700 . real time results can also include rankings , as shown in the exemplary screenshot of fig2 . fans can see in real - time where they are ranked for both coachscore and fanscore 2800 . fig2 is a screenshot illustrating a coach score engine , according to some embodiments of the present disclosure . coaching game logic engine ( also referred to in the present disclosure as “ coachscore engine ”) can determine each player &# 39 ; s coachscore . in some embodiments , coach score ranges from 50 - 100 . unlike traditional “ fantasy ” points , coach score is not merely additive . each player &# 39 ; s coach score can be calculated after each drive and can naturally vary through the course of each game . coachscore engine first receives a coach bundle , which can include 3 plays . coachscore engine assigns a historical “ adjusted yardage ” 2900 based on data from prior games . the historical adjusted yardage 2900 can be calculated automatically from the data from prior games , as described in more detail below . the play run on the field is then scored on the yards gained on the field , augmented by positive modifiers for good results ( e . g ., earning a first down or scoring ) or negative modifiers ( e . g ., resulting in a sack of the quarterback or lost yards ) 2901 . the three plays &# 39 ; adjusted yardage scores ( two historical , one actual ) are then ranked , highest to lowest , 1 st , 2 nd , and 3 rd . each play is then assigned points 2902 based on its ranking . the points are continuously summed and adjusted for tempo 2903 . tempo adjustments 2903 allow scoring to be consistent , whether the game is partially complete or complete and whether a team runs a fewer number or a greater number of plays ( e . g ., 65 plays or 85 ). fig3 is a screenshot illustrating a coach score engine moderator , according to some embodiments of the present disclosure . the moderator application can rate the play actually run on the field versus the historical expectations of the other two non - winning plays . the coach score moderator application can rank ( e . g ., good , neutral , bad or 1 st , 2 nd , 3 rd ) the play result seen on the field relative to the historical expectations of the two plays not selected , and submit any additional factors , especially errors ( dropped pass , fumble , etc . ), that impact the assessment of the play 3002 . the application can display which plays are suggested by a coach and which play was run on a field 3000 3001 . the ranking can come from a human operator or can be determined by a computing device . fig3 is a screenshot illustrating the calculation of historical adjusted yardage within a coach score engine , according to some embodiments of the present disclosure . each play can have a stored adjusted yardage value calculated from historical data and the adjusted yardage algorithm . in both pre - time and real - time , the system can calculate historical adjusted yardage from historical results 3100 . this calculation starts by identifying all plays previously run , noting their results ( e . g . yardage gained , 1 st downs gained , scoring , game , play #, etc . ), annotating each play with additional scenario identifiers ( e . g ., team , defense faced , game #, field position , time , down , distance , play type , in - game play #, etc . ), grouping these play - scenario combinations , calculating typical yardage gained for each play - scenario combination 3100 , and , finally , enhancing typical yardage with 1 st - down and scoring trending 3101 to produce a historical adjusted yardage number for each play in each scenario . the adjusted yardage calculation weighs results from the current game , current teams , and more recent games more heavily than results from less current and less pertinent teams . the playbook section of the fan app is indicated by way of example in the screenshot of fig3 . the playbook details the plays for the fan &# 39 ; s team 3200 . the fan can sort by play type formation 3201 . each play includes a detailed diagram , simple name , coach name , etc . 3202 . the playbook section can also include playbook detail , as shown in the exemplary screenshot of fig3 . every play in a team &# 39 ; s playbook can be clicked on to offer more detail , past performance , and video to illustrate the play and its performance history 3300 . the content items discussed above are live and active content during an actual game . when a game starts , the fan app automatically changes to a gamecasting / push app determined by a league official as shown in the exemplary screenshots of fig3 and 35 . during the game , the fan app automatically displays game information 3400 3500 such as the teams playing , which quarter , the time / game clock , the score , which team has possession , and down and distance . once a game is in progress and a fan is logged in correctly , the system automatically pushes a vote to the app as shown in the exemplary screenshots of fig3 and 37 . fans can see a push of the vote of coaches play choices visually through the voting screen , manually through a buzz , and / or aurally through a tone 3600 3700 . the screen displays down , distance , field position , and game time in real time 3601 . the screen can also display play choices as graphical renditions of the plays as well as text 3701 . visually through graphical renditions of plays , fans can see the three coach choices 3602 . fans can also choose to skip vote 3603 by clicking an “ x ” button 3702 or clicking a “ close ” button 3703 , if desired . once fans receive a poll from the system as illustrated in the exemplary screenshots of fig3 and 39 , they can vote with a single touch of the play of their choice 3800 3900 . in one embodiment , their chosen play is marked 3801 and automatically sent to be tabulated to the back - end service of the system . in another embodiment , fans can choose to change their vote by clicking a “ change vote ” button 3901 . fans then watch the winning play executed on the field . as shown in the exemplary screenshots of fig4 and 41 , the fan app shows fans when their play has been selected to be run on the field 4100 and what % of fans voted for each play 4000 4101 . as shown in the exemplary screenshot of fig4 , the fan app can also show fans when their play has not been selected to be run on the field 4200 . when a fan &# 39 ; s play is not selected , they are also shown the winning play 4201 . in addition to the live football game , fans can compete against other fans and other groups of fans on their coaching expertise . fans can choose and structure the ways in which they want to compete 4300 as shown in the exemplary screenshot of fig4 . game dimensions can include , e . g ., single game vs . season , player vs . player , intra and extra - team leagues , player - defined leagues , and league vs . league . fans can compete using their coaching score in additional to their achievements as shown in the exemplary screenshot of fig4 . a coach score is derived from the actual and typical results of the plays voted on by fans 4400 . scores are normalized to adjust for differences in team styles and results . the system allows coaches / coordinators to enter plays or formations to facilitate player coaching , game planning , and play selection . as shown in the exemplary screenshot of fig4 , coaches / coordinators can enter multiple name types 4501 and a description 4502 for new plays and formations . coaches / coordinators can apply standard tags to each play 4503 including , e . g ., “ opening script ”, “ short yardage ”, “ medium yardage ”, “ long yardage ”, “ pass ”, “ run ”, “ game 1 ”, “ game 2 ”. coaches / coordinators can define new tags 4504 and can attach images to each play 4505 . as shown in the exemplary screenshot of fig4 , coaches / coordinators can manage playbooks . they can search for plays by multiple categories 4601 and edit play names , tags , formations , etc . 4602 . coaches / coordinators can build scripts of plays that can be used for game planning , coaching , and easy selection as shown in the exemplary screenshot of fig4 . coaches / coordinators can select and / or create script names / tags 4701 . they can create poll names 4702 and assign plays to poll names 4703 . as shown in the exemplary screenshot of fig4 , coaches / coordinators can organize and present plays in various fashions 4801 , view plays on screen 4802 , and print plays for game day 4803 . as shown in the exemplary screenshot of fig4 , production team members can manage plays for presentation to fans . they can enter multiple name types for plays 4901 and a fan playbook description 4902 , and attach a simple play diagram 4903 . coaches / coordinators can pick plays to be voted on by fans as shown in the exemplary screenshot of fig5 . coaches / coordinators can access the screen from a unique url of the coach application 5000 . coaches / coordinators log in , click on 3 plays 5001 , and click on a commit plays button 5002 to confirm the choice . if no plays are committed , the system automatically assigns 3 plays after a given period of time ( e . g ., 7 seconds ). the coach receives the play that won the highest percentage of votes 5100 as shown in the exemplary screenshot of fig5 . fig5 shows a screenshot of a coach application , according to some embodiments of the present disclosure . coach application can communicate game status 5200 . game status can include a game quarter , a score , location of the ball , team with possession , and down information . coach application also allows a coach to choose plays sent to fans 5202 . plays sent to fans can include either pre - defined bundles of plays ( e . g ., in bundles of three ) or individually - selected plays 5204 . coach application can include a visual depiction of selected plays to the coach 5205 . coach application can also allow the coach to override and select a singular play for a number of times a game 5206 . as shown in fig5 , in accordance with one or more embodiments , a coach can also elect to override the vote and select the play himself or herself . coaches can be allowed a certain number of overrides per half ( e . g ., 4 ), and users can be notified immediately with a push notification on their device . according to some embodiments , a coach management system allows coaches to select their plays during games and coordinate other aspects of planning and executing plays during a game . an interface allows coaches to pick a set of plays offered to fans during each play , to see the winning play selected by fans , and to call “ overrides ” when they have to get their play run . in some embodiments , the coach management system allows football coaches to manage everything about a football team , as described in more detail below . briefly , a roster module can store the names , profiles , and video of all players . scouting can keep the profiles and assessments of all potential draftees and opposing players . medical manager can track all injuries , readying them for the injury report . playbook can give coaches a place to create any play they want , to organize each play by any attribute , and to create installs , scripts , and game plans for any situation . calendar can allow assistant coaches to structure daily coaching plans that roll up into weekly and seasonal plans managed by head coaches . analytics can allow coaches to understand the performance of all plays by situation , package and player . fig5 is a screenshot illustrating a coaching management system overview , according to some embodiments of the present disclosure . the coaching management system can enable efficient , data - and system - driven management of most aspects of a football team , including : personnel management , playbook management , game plan management , player education , scouting and injuries 5400 . for personnel management , the system will capture past and current of player ( s ), plays the player partakes in and the performance of that player in given situations — home , away , etc . for playbook management , the system will capture all aspects of the playbook from individual plays , video links of the play , players associated with the play etc . for game plan management , the system will allow the coaching staff to detail out all aspects of the upcoming opponent and plan out the game by quarter , by player personnel , by situations like down and distance etc . for scouting and injuries , the system would like with scouting reports , interface with video footage of scouting sessions and offer real - time insights on injuries directly from the training and strength and conditioning staff . fig5 is a screenshot illustrating a play section within a coaching management system playbook , according to some embodiments of the present disclosure . from the play section , a coach can store plays 5500 , filter plays by situation ( e . g ., down , distance , zone , game time , etc .) 5501 , filter plays by package 5502 ( an indicator of the number of running backs , tight ends , and receivers on the field ), filter plays by type ( e . g ., run , pass , play action , special teams , etc .) 5503 , and add plays 5504 . adding a new play involves entering a play name , illustrating the action of the play , and attaching the appropriate filters to the play . fig5 is a screenshot illustrating a bundles section within a coaching management system playbook , according to some embodiments of the present disclosure . in the bundles section , plays can be organized into bundles of multiple plays ( e . g ., three plays ) that can be selected by a coach 5601 . each bundle represents a reasonable set of plays for a given game scenario — a set that makes sense for the coach and the fan . organizing plays into bundles makes it easier to present multiple plays to voting fans . the bundles are entered into the system 5602 at the direction of the coach orchestrating the game plan and typically calling the plays . a coach may assign a bundle number such as “ r12 ” 5603 so that it is easier to call plays during a live game . fig5 is a screenshot illustrating an installs section within a coaching management system playbook , according to some embodiments of the present disclosure . in the installs section , plays can be organized into groups of installs . in some embodiments , installs include plays that teams will learn in an upcoming period of time 5701 . installs can be sorted by date 5702 and new installs can be added 5703 . fig5 is a screenshot illustrating a player roster section in a coaching management system , according to some embodiments of the present disclosure . in the roster section , players on the roster can be stored 5800 , sorted and searched by various attributes 5801 . for example , a member of the coaching staff could sort / filter the players by offense , defense or special teams . players can be assigned to groups 5802 , which indicate the position they play . they can also be assigned to packages 5803 , which indicate the number of running backs , tight ends , receivers and other personnel on the field , sometimes called the personnel grouping . players can be viewed by groups 5900 , as shown in the exemplary screenshot of fig5 , and by packages 6000 , as shown in exemplary screenshot of fig6 . fig6 is a screenshot illustrating a personnel view in a coaching management system , according to some embodiments of the present disclosure . personnel view includes access to detailed personnel information , such as participation in formations and play statistics 6100 . fig6 is a screenshot illustrating a game plan section in a coaching management system , according to some embodiments of the present disclosure . in the game plan section , game plans for an upcoming weekend can be created 6200 . plays can also be selected for a game sheet 6201 , pages can be added to a game board 6202 , plays can be dragged in or out of a game plan 6203 , columns of plays can be cleared 6204 , and game plans can be saved 6205 . a game plan 6200 is embodied within a game board . a game board is made up of one or more game sheets . a game sheet is made up of multiple scripts 6300 , described below , and plays organized by situation . fig6 is a screenshot illustrating script creation in a coaching management system , according to some embodiments of the present disclosure . in some embodiments , a script includes a series of plays run in sequence during specific scenarios : start of game , start of second half , goal line within the five yard line , etc . plays can be added to a script from other scripts and playlists 6302 . scripts can be created 6300 and assigned to a practice day 6300 . scripts can also be assigned to be practiced for specific game and opponents 6400 , as shown in the exemplary screenshot of fig6 . fig6 is a screenshot illustrating a game plan play sheet section in a coaching management system , according to some embodiments of the present disclosure . a play sheet 6500 can be generated that allows quick selection of bundles and plays during a game . for example , a member of the coaching staff can see all of the bundles ( sets of plays ) for the situation 3 rd and long . this allows the coaching staff to quickly choose the plays to push out to fans based on the situation on the field . fig6 is a screenshot illustrating a calendar section in a coaching management system , according to some embodiments of the present disclosure . a schedule can be created to install a game plan for a specific game 6600 . game plans can be organized by category 6601 , assigned to time slots in a calendar 6602 , and organized for viewing by day or week 6603 . a schedule can also include a scroll feature to view earlier and later events 6604 . events for the day can also appear in list format to identify points of emphasis for the day 6605 . points of emphasis could mean players on the injury report who won &# 39 ; t be reporting to practice , for example . events can also be viewed by week , as shown in the exemplary screenshot of fig6 . a team schedule can be viewed by week 6701 and events can be organized by time slot and emphasis 6702 . a team schedule can also be viewed by day 6800 , as shown in the exemplary screenshot of fig6 . fig6 is a screenshot illustrating scouting reports in a coaching management system , according to some embodiments of the present disclosure . scouting reports can be viewed and sorted by date 6900 . scouting reports can also be created 6901 . fig7 is a screenshot illustrating analytics in a coaching management system , according to some embodiments of the present disclosure . a variety of analytics reports can be delivered by team , game , opponent , offense , and defense 7000 . as shown in the exemplary screenshot of fig7 , the administrator ( admin ) can manage a game by accessing the system through a unique url and login 7101 . the admin can enter down , distance , score , quarter , time ( and save changes ) during a game 7102 . the admin can start the next set of plays once the referee ( on the field ) has placed the ball 7103 . at this point , the coaches will receive a notification on their app that they have a set amount of time ( e . g ., 7 seconds ) to input the next set of plays . the admin can also indicate a change in possession as needed , at which time a push notification will be sent out to all users that offense and defense has switched . fig7 shows a screenshot of a referee application , according to some embodiments of the present disclosure . a referee application indicates a status of the system . a status of the system is described in more detail below . briefly , a status of the system can include ready for next play , coaches selecting plays , etc . 7200 . a referee application can include a link to initiate a play 7201 , to release a winning play ( e . g ., results of a play ) to the fans 7202 , and to switch possession of the ball to indicate which team is on offense and defense 7203 . there can also include an input to select coach selection time and fan voting time . coach selection time and fan voting time can define the length of states during a poll , as described in more detail below . production personnel can access the system as shown in the exemplary screenshot of fig7 . production personnel can view participation statistics in real time of concurrent users on the system 7300 , send notifications if they are not participating 7301 , troubleshoot for technical issues 7302 , and alert marketing / customer service to flag for retention and participating strategies like rewards , etc . 7303 . as shown in the exemplary screenshot of fig7 , the system allows product marketing / customers service to view participation statistics in real time as well as analyzing data during non - games 7401 . they can use data to custom tailor “ mystat ” 7402 and myachievements ” to various fans . they can also tap the fan analytic database to reach out to inactive fans and try to re - engage them and other marketing / service details 7403 . fig7 illustrates an exemplary finite state machine , according to some embodiments of the present disclosure . the game engine is a system for organizing and running an official football game . this includes orchestrating exchanges between the fans , coaches , and referees via a central software solution . the system is modeled as a finite state machine . this means the system is in exactly one state at any given time . as different actions occur ( referee pushing a button , timer completed , etc .) the system moves onto other states . these states define what is possible and occurring at any given moment . the finite machine can be executed by a computing device . when a new game is created and scheduled , its first state is the “ pregame ” state . the system has been configured with two teams , but the game hasn &# 39 ; t actually started yet . in this state users will be able to interact with the game in different ways from when the game is running . this might include interactions / planning with their team coach . the only action from here that will change the state of the game is having the appropriate official input the command to start the game ( via the admin application ). this will transition the game to the state “ coach creating polls ”. all states except “ pregame ” and “ game over ” are considered to mean the game is currently “ active ”. this state means the coaches are currently selecting plays for inclusion in polls that will be sent out to and voted on by fans . coaches may also submit a “ coach override ” during this time . in this state , the system accepts play choice options for a poll from the coach application . a timer is started which can automatically transition to the “ notifying fans of polls ” state . the timer can range between 1 second and 60 seconds . in some embodiments , the timer is set for seven seconds . this state means the system is currently working to send both polls ( one for each team ) to their fans . in this state , coaches are no longer able to submit play choice options for a poll . a timer is started that will automatically transition to the “ fan voting ” state . the timer can range between 1 second and 60 seconds . in some embodiments , the timer is set for two seconds . the system verifies that each coach was able to create a poll . if a coach didn &# 39 ; t create their poll , the system can create a poll for them and populate it with three random play options . once both polls are ready they are transmitted to all fans . this state means the system is accepting votes from all fans . in this state , the poll sent to the fan in the previous state is made visible now . vote submissions are now accepted by the system . a timer is started which automatically transitions the game to the “ notify everyone of results ” state . the timer can range between 1 second and 60 seconds . in some embodiments , the timer is set for ten seconds . this state means the system is sending out vote results to all fans and coaches . in this state , votes are no longer accepted by the system . poll voting results are tabulated and a winning play or a tie is determined for each poll . a summary of each poll results are broadcast to all fans and coaches . a record of the vote summaries is stored for future use . a timer is started which automatically transitions the game to the “ play in action ” state . the timer can range between 1 second and 60 seconds . in some embodiments , the timer is set for two seconds . this state means that the winning plays are now being executed on the field by the actual football players . the system is waiting for input via the admin application about the final result of the play . depending on the results , the game can transition into two different states : 1 . if the system determines the game is over then the game transitions into the state “ game over ”. 2 . if the game is not technically over , then the system waits for a command from an official to start the next entire polling process . this is done by transitioning the game into the “ coach creating polls ” state again . in this state the game is now over and is no longer capable of going back to any of the other states . in some embodiments , the total execution time for the first four states is under 100 seconds . in some embodiments , the total execution time is in between 30 and 60 seconds . the processes of the live - game system described above may be implemented in software , hardware , firmware , or any combination thereof . the processes are preferably implemented in one or more computer programs executing on a programmable computer ( which can be part of the computer server system ) including a processor , a storage medium readable by the processor ( including , e . g ., volatile and non - volatile memory and / or storage elements ), and input and output devices . each computer program can be a set of instructions ( program code ) in a code module resident in the random access memory of the computer . until required by the computer , the set of instructions may be stored in another computer memory ( e . g ., in a hard disk drive , or in a removable memory such as an optical disk , external hard drive , memory card , or flash drive ) or stored on another computer system and downloaded via the internet or other network . having thus described several illustrative embodiments , it is to be appreciated that various alterations , modifications , and improvements will readily occur to those skilled in the art . such alterations , modifications , and improvements are intended to form a part of this disclosure , and are intended to be within the spirit and scope of this disclosure . while some examples presented herein involve specific combinations of functions or structural elements , it should be understood that those functions and elements may be combined in other ways according to the present disclosure to accomplish the same or different objectives . in particular , acts , elements , and features discussed in connection with one embodiment are not intended to be excluded from similar or other roles in other embodiments . additionally , elements and components described herein may be further divided into additional components or joined together to form fewer components for performing the same functions . for example , the computer server system may comprise one or more physical machines , or virtual machines running on one or more physical machines . in addition , the computer server system may comprise a cluster of computers or numerous distributed computers that are connected by the internet or another network . accordingly , the foregoing description and attached drawings are by way of example only , and are not intended to be limiting . those of skill in the art would appreciate that the various illustrations in the specification and drawings described herein can be implemented as electronic hardware , computer software , or combinations of both . to illustrate this interchangeability of hardware and software , various illustrative blocks , modules , elements , components , methods , and algorithms have been described above generally in terms of their functionality . whether such functionality is implemented as hardware , software , or a combination depends upon the particular application and design constraints imposed on the overall system . skilled artisans can implement the described functionality in varying ways for each particular application . various components and blocks can be arranged differently ( for example , arranged in a different order , or partitioned in a different way ) all without departing from the scope of the subject technology . furthermore , an implementation of the communication protocol can be realized in a centralized fashion in one computer system , or in a distributed fashion where different elements are spread across several interconnected computer systems . any kind of computer system , or other apparatus adapted for carrying out the methods described herein , is suited to perform the functions described herein . a typical combination of hardware and software could be a general purpose computer system with a computer program that , when being loaded and executed , controls the computer system such that it carries out the methods described herein . the methods for the communications protocol can also be embedded in a computer program product , which comprises all the features enabling the implementation of the methods described herein , and which , when loaded in a computer system is able to carry out these methods . computer program or application in the present context means any expression , in any language , code or notation , of a set of instructions intended to cause a system having an information processing capability to perform a particular function either directly or after either or both of the following : a ) conversion to another language , code or notation ; b ) reproduction in a different material form . significantly , this communication protocol can be embodied in other specific forms without departing from the spirit or essential attributes thereof , and accordingly , reference should be had to the following claims , rather than to the foregoing specification , as indicating the scope of the invention . the communications protocol has been described in detail with specific reference to these illustrated embodiments . it will be apparent , however , that various modifications and changes can be made within the spirit and scope of the disclosure as described in the foregoing specification , and such modifications and changes are to be considered equivalents and part of this disclosure . | 0 |
referring to the accompanying drawings in which like reference numbers indicate like elements , fig1 illustrates one disclosed system 10 for identifying a landmark . the system 10 includes a processor 12 , a magnetic field generator 16 , a landmark identifier 18 , and an orthopaedic implant assembly 28 . the system 10 also includes a monitor 14 electrically connected to the processor 12 and an insertion handle 40 removably attached to an orthopaedic implant 30 of the orthopaedic implant assembly 28 , and in a particular example , to a driving end 30 a opposite a non - driving end 30 b of the orthopaedic implant 30 . the processor 12 is depicted as a desktop computer in fig1 but other types of computing devices may be used . as examples , the processor 12 may be a desktop computer , a laptop computer , a personal data assistant ( pda ), a mobile handheld device , or a dedicated device . the magnetic field generator 16 is a device available from ascension technology corporation of 107 catamount drive , milton vt ., u . s . a . ; northern digital inc . of 103 randall drive , waterloo , ontario , canada ; or polhemus of 40 hercules drive , colchester vt ., u . s . a . of course , other generators may be used . as examples , the field generator 16 may provide a pulsed direct current electromagnetic field or an alternating current electromagnetic field . the system 10 may also include a control unit ( not shown ) connected to the magnetic field generator 16 . the control unit controls the field generator 16 , receives signals from small mobile inductive sensors , and communicates with the processor 12 , either by wire or wirelessly . the control unit may be incorporated into the processor 12 either through hardware or software . the system 10 may be referred to as a magnetic position tracking system . for illustrative purposes , the system 10 may include a magnetic field generator 16 comprised of suitably arranged electromagnetic inductive coils that serve as the spatial magnetic reference frame ( i . e ., x , y , z ). the system 10 may also include small mobile inductive sensors , which are attached to the object being tracked . it should be understood that other variants could be easily accommodated . the position and angular orientation of the small mobile inductive sensors are determined from its magnetic coupling to the source field produced by magnetic field generator 16 . it is noted that the magnetic field generator 16 generates a sequence , or set , of six , different spatial magnetic field shapes , or distributions , each of which is sensed by the small mobile inductive sensors . each sequence enables a sequence of signals to be produced by the small mobile inductive sensors . processing of the sequence of signals enables determination of position and / or orientation of the small mobile inductive sensors , and hence the position of the object to which the small mobile inductive sensor is mounted relative the magnetic coordinate reference frame which is in fixed relationship to the magnetic field generator 16 . the processor 12 or the control unit may use the reference coordinate system and the sensed data to create a transformation matrix comprising position and orientation information . the landmark identifier 18 is used to target a landmark , such as a landmark on the orthopaedic implant assembly 28 . the landmark identifier 18 may include one or more small mobile inductive sensors or may include the field generator . the landmark identifier 18 has a second sensor 20 . the landmark identifier 18 may be any number of devices . as examples , the landmark identifier may be a device that includes a structure that provides a user with an understanding of the location and orientation of a hidden landmark . for example , the landmark identifier can include a drill guide , a drill sleeve , a drill , a drill nose , a drill barrel , a drill chuck , or a fixation element . in some implementations , the structure can be a housing having an opening , or other structure that indicates the location and orientation of a landmark . in fig1 , the landmark identifier 18 is a drill sleeve and includes a sensor 20 . the landmark identifier 18 may include one or more of a serrated tip 22 , a tube 24 , and a handle 26 . the tube 24 also may be referred to as a bushing , cylinder , guide , or drilling / screw placement guide . the second sensor 20 is oriented relative to an axis of the tube 24 . the tube 24 may receive a drill . this offset of the sensor 20 from the tube 24 allows the position and orientation of the tube to be located in space in six dimensions ( three translational and three angular ) relative to the magnetic field generator 16 and / or another sensor in the system . the processor 12 may need to be calibrated to adjust for the offset distance of the second sensor 20 . the landmark identifier 18 and the field generator 16 may be combined into a single component . for example , the field generator 16 may be incorporated within the handle 26 . fig1 a illustrates an alternative implementation that combines the functionalities of the landmark identifier 18 and the field generator 16 with a removable component , such as a drill sleeve 2022 , into a handheld landmark identifier 2016 that may be used in the system 10 . the handheld landmark identifier 2016 houses an electromagnetic field generator ( not shown ) that may include one or more induction coils or other elements to create a suitable electromagnetic field or fields . the electromagnetic field generator is mounted in or on an autoclavable material and encapsulated in an autoclavable housing body 2018 that may be easily sterilized . the housing body 2018 includes a coupling member 2018 c that passes through the internal body and the housing 2018 and removably engages one or more attachable components , such as drill sleeve 2022 having a serrated tip 2024 , or other suitable tools , such as a screw driver sleeve or other drill sleeves as selected by a surgeon . the housing body 2018 includes a first covering 2018 a formed from an autoclavable material , such as an overmolding of silicone material , and may include a second covering 2018 b that provides an additional layer of protection or insulation , or aesthetics at an outer edge of the housing 2018 . the second covering 2018 b may be formed from an autoclavable material similar or different than the first covering 2018 a . unlike the landmark identifier 18 illustrated in fig1 , the handheld landmark identifier 2016 does not require the sensor 20 because the origin of the global space ( the area in which the electromagnetic field is generated ) can be defined within the landmark identifier 2016 . for example , one axis of the global space coordinate system can be the longitudinal axis of the drill sleeve or other component 2022 . in that situation , the other two axes of the global space coordinate system can be defined by planes orthogonal to that longitudinal axis and to each other . an advantage of incorporating the field generator into the landmark identifier 2016 includes a smaller size field generator because it can be brought into the local working space ( area which may include the landmarks such as implant holes that are to be targeted for screw placement ), therefore requiring a smaller electromagnetic field . in addition , use of the landmark identifier 2016 eliminates the necessity of x - ray devices for targeting of transfixion elements , such as radiation - emitting , fluoroscopic “ c - arms ,” which have been used during tibial and femoral nail cases to achieve proper distal screw placement . the orthopaedic implant assembly 28 may include the implant 30 and one or more small mobile inductive sensors . in the implementation shown in fig1 and 2 , the orthopaedic implant assembly 28 includes a probe 50 disposed within a longitudinal groove 60 formed in the implant 30 . the probe 50 includes a tape body 51 and a first sensor 32 disposed within or on the tape body 51 . the probe 50 is disposed within the groove 60 . the tape body 51 of the probe 50 may have a rectangular , circular , oval , or square geometry to assist in orienting the tape body 51 as it is placed into the implant 30 , and the geometry may be constant or varying along a length of the probe 50 . in some implementations , the tape body 51 may be a hollow metal tube . the probe 50 may include a lead or wire ( not shown ) coupled to the first sensor 32 to transmit , for example , a signal from the first sensor 32 to the processor 12 . the lead may be made from biocompatible wire . as an example , the lead may be made of dft wire available from fort wayne metals research products corp ., 9609 indianapolis road , fort wayne , ind . 46809 . dft is a registered trademark of fort wayne metals research products corp . alternatively , the first sensor 32 may be coupled to the processor 12 via a wireless connection . in fig1 and 2 , the implant 30 is in the form of im nail but other types of implants may be used . as examples , the implant may be an im nail , a bone plate , a shoulder prosthetic , a hip prosthetic , or a knee prosthetic . the implant 30 may be made from any suitable biocompatible material , such as , titanium , cobalt chrome , stainless steel , biodegradable polymer , or other biocompatible material . the implant 30 may include a cannulation 33 . the first sensor 32 is oriented and in a predetermined position relative to one or more landmarks on the implant 30 . as examples , the landmark may be a structure , a void , a boss , a channel , a detent , a flange , a groove , a member , a partition , a step , an aperture , a bore , a cavity , a dimple , a duct , a gap , a notch , an orifice , a passage , a slit , a hole , or a slot . in addition , the landmark may be a hole filler , a polymer screw hole window such as peek , or other identifier formed in or on the implant 30 that identifies or indicates the location on the implant 30 through which a surgeon may form a through hole or other aperture during implantation for receiving a fixation member , such as a screw . in fig1 and 2 , the landmarks are transfixion holes 31 . the offset of the first sensor 32 from the landmark allows the position of the landmark to be located in space in six dimensions ( three translational and three angular ) relative to the magnetic field generator 16 or another sensor in the system , such as the second sensor 20 . the processor may need to be calibrated to adjust for the offset distance of the first sensor 32 . the first sensor 32 and the second sensor 20 are coupled to the processor 12 . again , this may be accomplished by wire or wirelessly . the first sensor 32 and the second sensor 20 may be a six degree of freedom sensor configured to describe the location of each sensor in three translational axes , generally called x , y and z and three angular orientations , generally called pitch , yaw and roll . by locating the sensor in these reference frames , and knowing the location and orientation of each sensor , the landmark identifier 18 may be located relative to the landmark on the implant 30 . in one particular implementation , the information from the sensors allows for a surgeon to plan the surgical path for fixation and properly align a drill with a blind fixation hole 31 . exemplary sensors 32 , 20 are six degrees of freedom sensor from ascension technology corporation of 107 catamount drive , milton vt ., u . s . a . ; northern digital inc . of 103 randall drive , waterloo , ontario , canada ; or polhemus of 40 hercules drive , colchester vt ., u . s . a . of course , other sensors may be used . as shown in fig1 and 2 , the probe 50 , which includes the tape body 51 and the first sensor 32 disposed within or on the tape body 51 , are disposed within the longitudinal groove 60 formed in an outer surface of the implant 30 . the groove 60 extends from a driving end 30 a of the implant 30 to a non - driving end 30 b of the implant 30 so that the first sensor 32 may be placed in a desired proximity to the landmarks 31 to be targeted . of course , the groove 60 may be located anywhere along the length of the implant 30 in order to position the first sensor 32 within the desired proximity to the landmarks 31 . further , although the first sensor 32 is shown positioned near the landmarks 31 formed in the non - driving end 30 b of the implant 30 , the first sensor 32 may be positioned near the landmarks 31 formed in the driving end 30 a of the implant 30 . in this manner , having the probe 50 within groove 60 , instead of within the central cannula 33 , permits locking of the implant 30 using the landmarks 31 at the driving end 30 a of the implant 30 prior to affixing the implant 30 at the non - driving end 30 b . the groove 60 may include one or more portions 62 formed at intermittent locations along the length of the groove 60 to receive the probe 50 , and more particularly , the tape body 51 , in order to rigidly and mechanically capture the probe 50 and the first sensor 32 in a fixed position relative to the implant 30 . for example , as shown in fig3 and 5 , the portions 62 include two side walls 62 a and a floor 62 b intersecting the two side walls 62 a . the walls 62 a form an acute angle θ with the floor 62 b such that a cross section of the portion 62 forms a dovetail when viewed from an end of the groove 60 ( fig3 ). these dovetail - shaped side walls 62 a and floors 62 b provide an interference , press , friction , or snap fit between the probe 50 and the groove 60 by pressing the sections of the probe 50 received in the portions 62 against the floor 62 b . the force to capture the probe 50 in a position and orientation relative to the implant 30 , and the force required to remove the probe 50 from the groove 60 , for example , upon completion of targeting the landmarks 31 , depends on a number of factors . these factors include the length ( l ) of each dovetail portion 62 , the opening width ( t ), height ( h ), and floor width ( b ) of each dovetail side wall portion 62 ( fig5 ), and the location and number of dovetail portions 62 along the length of the groove 60 . as an example , the optimization of the length ( l ) of each dovetail portion 62 provides a balance between the force required to snap or press the probe 50 into each of the portions 62 and the force to remove the probe 50 following targeting . in an exemplary implementation , the length ( l ) is about 0 . 025 inch to about 0 . 5 inch , or alternatively , about 0 . 075 inch to about 0 . 15 inch , the height ( h ) of each portion 62 is about 0 . 055 inch , the opening width ( t ) is about 0 . 078 inch , and the floor width ( b ) is about 0 . 083 inch . the ratios of the height ( h ), the opening width ( t ), and the floor width ( b ) to , for example , the diameter of the probe 50 , in some implementations , are in the range of about 65 % to about 73 %, about 92 % to about 96 %, and at least 100 % respectively . the groove 60 may have as many as five to six dovetail portions 62 along its length , and in some implementations , a portion 62 is positioned to correspond to the location on the probe 50 where there is a change in a radial angle along the probe axis to insure that the probe 50 remains secured within the groove 60 within the transition portion of the implant 30 . for example , as shown in fig2 , implant 30 includes at least one transition section 30 c that forms an angle between the driving end 30 a and the non - driving end 30 b of the implant 30 . at least one dovetail portion 62 is positioned within transition section 30 c to ensure that the probe 50 is secured within the transition section 30 c . in other implementations , a minimum of one to two dovetail portions 62 may be sufficient to fix the probe 50 and the first sensor 32 in place relative to the implant 30 . in implementations where only one dovetail portion 62 is provided in the groove 60 , the dovetail portion 62 may be positioned near the driving end 30 a of the implant 30 to secure the probe 50 within the groove 60 . referring to fig2 and 4 , in addition to the one or more dovetail portions 62 , the groove 60 may include one or more portions 64 formed adjacent to the dovetail portions 62 and at intermittent locations along a length of the groove 60 . like the portions 62 , the portions 64 may include two side walls 64 a and a floor 64 b intersecting the two side walls 64 a . the side walls 64 a may form right angles with the floor 64 b such that a cross section of the portion 62 is substantially square or rectangular when viewed from an end of the groove 60 ( fig4 ). other implementations where the side walls form angles greater than 90 degrees with the floor are also within the scope of the invention . as shown in fig4 , unlike portions 62 , the probe 50 does not interact with the side walls 64 a of the portions 64 . however , in other implementations , the dimensions of the side walls 64 a and the floor 64 b may be sized such that the side walls 64 a and the floor 64 b interact with the probe 50 to provide , for example , an additional interference fit between the side walls 64 a and / or the floor 64 b . an alternative implementation of groove 60 , and specifically , portions 62 , is shown in fig3 a . in the implementation of fig3 a , portions 162 are formed with a substantially circular cross - sectional shape ( when viewed from an end of the groove 60 ) that receives the probe 50 . the portions 162 include an opening 163 formed between two walls 163 a , 163 b for receiving the probe 50 within the circular cross - sectional area of the portions 162 . the opening 163 has a width which is less than a diameter of the probe 50 . end portions of the walls 163 a , 163 b provide an interference , press , friction , or snap fit between the probe 50 and the groove 60 to maintain the probe 50 in position within the portions 162 and to limit movement of the probe 50 caused , for example , by tissue grabbing or dislodging the probe during , for example , insertion of the implant 30 in a bone . referring to fig3 a and 4a , in addition to the one or more circular portions 162 , the groove 60 may include one or more circular portions 164 formed adjacent to the portions 162 and at intermittent locations along a length of the groove 60 . like the portions 162 , the portions 164 are formed with a substantially circular cross - sectional shape ( when viewed from an end of the groove 60 ) that receives the probe 50 . as shown in fig4 a , unlike portions 162 , the probe 50 is free to move within the portions 164 . however , in other implementations , the dimensions of the circular portion 164 may be sized such that the probe 50 interacts with portions of the opening 164 a formed by end portions 164 b , 164 c of the implant 30 to provide , for example , an additional interference fit between the probe 50 and the portions 164 . as illustrated in fig3 a and 4a , when received within the portions 162 , 164 , the outer surface of the probe 50 is positioned at or below the outer surface of the body of the implant 30 , which assists in preventing or limiting tissue from dislodging or causing the probe 50 to translate or rotate during , for example , insertion of the implant 30 in a bone . in certain implementations , however , it may also be positioned above the outer surface of the implant 30 , if necessary . in use , the probe 50 , including the first sensor 32 , is secured within the groove 60 of the implant 30 , by pressing or snapping the probe 50 into the one or more dovetail portions 62 formed in the longitudinal groove 60 . the implant 30 may then be calibrated . calibration is analogous to registration in computer assisted surgery . calibration may be needed for different reasons . for example , sensor calibration may be needed to correct for manufacturing tolerances . the system may be designed based upon a computer - aided - design model , and calibration is used to accurately place the sensors relative to one another or to the one or more landmarks 31 . for example , calibration may be necessary to determine the spatial relationship between the first sensor 32 and one or more of the landmarks 31 . the processor or the control unit may include software to generate x , y , z , pitch , yaw , and roll offset values to locate the sensors in a global coordinate system or simply placement relative to one another . the system may be manufactured and calibrated during manufacturing and assigned a unique identifier , such as a serial number , color code , bar code , or rfid tag . if the system needs to be re - calibrated , the unique identifier may be used to retrieve the offset values , either locally or over a network . further , the unique identifier may be used to retrieve other data , such as the size of the im nail or the length of the im nail and / or the probe . following calibration , the implant 30 may be packaged and shipped to an end user , such as a physician , who then performs an implantation procedure . during shipping and implantation of the implant 30 , the probe 50 and the first sensor 32 are secured within the groove 60 via an interference or snap fit between the dovetail portions 62 and the probe 50 , as described above . once targeting of one or more of the landmarks 31 is complete , the probe 50 and the first sensor 32 may be removed from the implant 30 and sterilized for reuse with another implant 30 . fig6 illustrates an alternative implementation of the orthopaedic implant assembly 28 including the orthopaedic implant 30 . as shown in fig6 , the probe 50 and associated sensor , such as sensor 32 , are received in the longitudinal groove 60 formed in the implant 30 . similar to the other implementations discussed above , the groove 60 may extend from the driving end 30 a of the implant 30 to the non - driving end 30 b of the implant . the groove 60 may include an additional cut - out portion 60 a located near the outer portion of the implant 30 as shown in fig6 . a lid or cover 100 may be attached to the implant 30 within the groove 60 , and particularly within the cut - out portion 60 a of the groove 60 . the lid or cover 100 may be attached within the cut - out portion 60 a of the groove 60 by laser - weld , gluing , or other acceptable attachment means . in another implementation , the lid or cover 100 may be attached to the implant 30 , for example , to an outer surface of the implant 30 . the lid or cover 100 prevents bone in - growth in the groove 60 and thus , allows the implant to be removed easily later during , for example , revision surgeries or when a new implant is required . the lid or cover 100 also prevent tissue from touching the probe 50 during installation of the implant 30 into the body and therefore , may also assist in preventing rotation or translation of the probe 50 . fig7 shows an alternative to the cover or lid 100 of fig6 for preventing bone in - growth in the groove . as shown in fig7 , an outer sleeve 150 may be placed around the periphery or a portion of the periphery of the orthopaedic implant 30 . the outer sleeve 150 may be coupled to the implant 30 via press fit or other means known to one skilled in the art . the outer sleeve 150 covers over the groove 60 , and acts as the lid 100 of fig6 to prevent bone in - growth in the groove 60 , following , for example removal of the probe 50 from the groove 60 following implantation of the implant 30 into bone tissue . the outer sleeve 150 can include one or more longitudinal slits so long as it can grab on the implant 30 and cover the groove 60 . although the outer sleeve 150 is shown as encircling the periphery of the implant 30 , the outer sleeve 150 may encircle only a portion of the periphery of the implant 30 as long as the outer sleeve 150 can attach to the implant 30 or groove 60 and cover the groove opening . alternatively , a similar sleeve 155 ( fig7 a ) can be used in place of the outer sleeve 150 and adapted to be placed around the periphery or a portion of the periphery of the probe 50 . the sleeve 155 can include one or more longitudinal slits , and can cover only a portion of the periphery of the probe 50 so long as the sleeve 155 can cover the groove opening . in the implementation of fig7 a , the probe 50 and the sleeve 155 are , for example , press - fitted in the groove 60 . the sleeve 155 acts in a similar manner to the lid 100 of fig6 to prevent bone in - growth in the groove 6 following , for example , removal of the probe 50 from the groove 60 . fig8 illustrates a coupling mechanism for coupling the probe 50 to the implant 30 for limiting or preventing translation and rotation of the probe 50 and associated sensor 32 within the groove 60 relative to the implant 30 . as shown in fig8 , a retention mechanism 200 includes a body portion 202 with an anti - rotation cross section such as a rectangular cross section as shown and two leg portions 204 , 206 extending from the body portion 202 . in one implementation , the leg portions 204 , 206 include generally v - shaped , deflectable portions 204 a , 206 a configured and shaped to mate with mating portions ( such as corresponding grooves , voids or receptacles ( not shown )) formed within the groove 60 . as shown in fig8 , the retention mechanism 200 defines a through hole 210 through which the probe and included sensor may pass and be retained via glue , crimping , friction fitting or any attachment means known to one skilled in the art . in use , the retention mechanism 200 may be inserted , for example , into the longitudinal groove 60 at the driving end 30 a of the implant 30 by compressing the leg portions 204 , 206 towards each other . as the retention mechanism 200 is inserted into the longitudinal groove 60 , the leg portions 204 , 206 ride along the inside surface of the longitudinal groove 60 until the v - shaped portions 204 a , 206 a are positioned proximate the corresponding mating portions ( not shown ) formed within the groove 60 . once the leg portions 204 , 206 are proximate the mating portions , the leg portions 204 , 206 rebound towards their uncompressed state and interact with their respective corresponding mating portions such that the retention mechanism 200 , and the attached probe and sensor are prevented or limited from translating or rotating relative to the implant 30 . once targeting of one or more of the landmarks 31 is complete , the retention mechanism 200 , and the attached probe 50 and sensor , may be removed from the implant 30 by compressing the leg portions 204 , 206 such that they no longer interact with the corresponding mating portions formed in the groove 60 , and the retention mechanism 200 , probe 50 and sensor may be removed from the implant 30 and sterilized for reuse with another implant 30 . fig9 - 12 illustrate an alternative implementation of the orthopaedic implant assembly 28 including an orthopaedic implant 30 . as shown in fig1 and 12 , the implant 30 includes at least one landmark in the form of a transfixion hole 31 . the implant 30 includes a longitudinal groove 60 formed in a portion of the implant 30 . the groove 60 may be formed along an outer surface of the implant 30 . fig9 and 10 illustrate an element in the form of a bushing 70 that can be made from a biocompatible and / or biodegradable material , such as a biocompatible and biodegradable polyethylene or other suitable material . the bushing 70 includes an outwardly extending spherical nipple 72 that is received in a corresponding recess 66 defined in the groove 60 in a snap - fit arrangement . the assembly 28 includes a probe 50 in the form of an elongated polymer tape or printed circuit board 52 and a first sensor 32 disposed within or on the tape or printed circuit board 52 . the tape or board 52 may also include wires ( not shown ) coupled to the first sensor 32 to transmit , for example , a signal from the first sensor 32 to the processor 12 . the tape or board 52 is coupled to , and in contact with , the bushing 70 via a bond 80 . bond 80 may be formed by welding , gluing , or otherwise coupling and contacting the tape or board 52 , including the first sensor 32 , to the bushing 70 . the bushing 70 further includes a perforation 74 that permits separation of the tape or board 52 and the first sensor 32 from the bushing 70 following , for example , targeting of the landmark 31 . the perforation may be adapted to require a smaller force of breakage than that of the probe / tape . in use , following calibration , and during shipping and implantation of the implant 30 , the tape or board 52 and the first sensor 32 are secured within the groove 60 via the bushing 70 . once targeting of the one or more of the landmarks 31 is complete , the tape or board 52 and the first sensor 32 may be separated and removed from the implant 30 by separating the tape or board 52 from a portion of the bushing 70 via the perforations 74 . the tape or board 52 and the first sensor 32 may then be sterilized for reuse with another implant 30 and bushing 70 , or simply discarded . fig1 illustrates another implementation of the orthpaedic implant assembly 28 including the orthopaedic implant 30 . the implant 30 includes landmarks in the form of transfixion holes 31 . the implant 30 includes a longitudinal groove 60 formed on an outer surface of the implant 30 , however , the longitudinal groove is optional . the assembly 28 includes a probe 50 , which includes a tape body 51 and a first sensor 32 disposed within or on the tape body 51 . a portion of the tape body 51 and the sensor 32 may be positioned within the groove 60 . the groove 60 extends from a driving end 30 a of the implant 30 to a non - driving end 30 b of the implant 30 so that the first sensor 32 may be placed in a desired proximity to any of the landmarks 31 to be targeted . the implant assembly 28 further includes a biodegradable and / or biocompatible polymer film 90 . the film 90 may be made from any suitable biocompatible and / or biodegradable polymer material , such as , but not limited to , polylactic acid ( pla ) or polyglycolide or polyglycolic acid ( pga ). once the probe 50 ( tape body 51 and the first sensor 32 ) are placed on the surface of the implant 30 , such as within the groove 60 , the implant 30 and the probe 50 are shrink - wrapped with the film 90 to limit and / or prevent movement of the probe 50 and sensor 32 relative to the implant 30 . in order to remove the probe 50 from the implant 30 following , for example , targeting of the one or more landmarks 31 , the film 90 may be manufactured to include a one - way tear ( not shown ) or a set of perforations 92 to allow for separation of the probe 50 from the implant 30 through the shrink - wrapped film 90 . alternatively , the probe 50 may be provided with an outwardly extending formation ( not shown ), such as a sharp edge or protrusion that pierces and / or cuts the shrink - wrapped film 90 as the probe 50 is pulled and separated from the implant 30 . as a further alternative , the film 90 may be made from a molecularly - oriented polymer having a minimal tear strength along one direction or axis within the film . in such an implementation , the film 90 may be oriented on the implant 30 such that when the film is wrapped around the implant 30 , the minimal tear axis is lined up with , or parallel to , the longitudinal axis of the probe 50 , such that , upon removal of the probe 50 from the implant 30 , the film 90 tears along the longitudinal axis of the probe 50 allowing for ease of removal from the implant 30 . while only certain implementations have been set forth , alternatives and modifications will be apparent from the above description to those skilled in the art . for example , although the portions 62 of the groove 60 have been described as having a dovetail - like cross - sectional shape , other shapes are within the scope of this disclosure . for example , alternative cross - sectional shapes include polygonal , oval , keyhole , or circular . in addition , the cross - sectional shape of portions 62 may be similar to the cross - sectional shape of portions 64 yet smaller in size such that the probe 50 is received in the portions 62 in an interference fit . in addition , the portions 62 may include protrusions added to , or formed as an integral part of the groove 60 , that provide a balanced force between rigidly and mechanically capturing the probe 50 and allowing for the release of the probe 50 upon completion of use . these and other alternatives are considered equivalents and within the spirit and scope of this disclosure and the appended claims . | 0 |
the following examples illustrate preferred embodiments of the instant invention , example 1 constituting the best mode presently known to the inventors . in the examples , as elsewhere herein , the terms &# 34 ; percent &# 34 ; and &# 34 ; parts &# 34 ; refer to percent and parts by weight , unless otherwise indicated . a phenol - urea - formaldehyde condensate was produced from 1 , 240 parts phenol , 2 , 600 parts 52 percent formaldehyde , 2 , 500 parts portland cement , 1 , 290 parts urea , 2 , 500 parts gypsum cement , 2 , 500 parts alumina , 400 parts zine stearate and 800 parts ice . the phenol , formaldehyde , urea and 100 parts of the portland cement were charged to a stainless steel vessel equipped with a propeller type agitator and an indirect heat exchanger . this charge was agitated for 18 hours , during which time cooling water was circulated through the indirect heat exchanger to maintain the temperature of the charge at about 68 ° c . after the preliminary 18 hour reaction period , the rest of the portland cement , the gypsum , the alumina , the zinc stearate and the ice were added to the reactant products in the vessel . the resulting composition , which was a phenol - formaldehyde condensate was co - deposited with chopped glass fiber strand * on a moving polyester film approximately 24 inches in width and of indefinite length . a second polyester film , also 24 inches in width and of indefinite length was brought into contact with the upper surface of the sheet - like mass of deposited glass fibers and phenol - formaldehyde condensate , and was moved with the mass and the first sheet . sheets called &# 34 ; sheet molding compound ,&# 34 ; of the mass of condensate and glass fibers approximately 24 inches by 20 inches by one - eighth inch were cut from the mass , leaving the polyester films on each of the two major sides thereof . moldings were produced from these sheets between matched flat dies : five minutes at 300 ° f . and 283 pounds per square inch . sheets produced as described above were tested for flexural modulus **, for flexural strength , for tensile strength *** and for notched izod impact strength ****: ( 1 ) as molded ; ( 2 ) after they had been autoclaved for 16 hours at 227 ° f ., and ( 3 ) after they had been immersed in boiling water for two hours . results of this testing are summarized in the following table for several ratios of glass fibers to phenol - formadehyde condensate . ______________________________________ glass fibersample resin density * densitydesignation on film on film * ______________________________________1 341 752 341 603 341 454 341 305 341 27______________________________________ * units g / ft .. sup . 2 ft . lbs / in . psi × 10 . sup . 3 psi × 10 . sup . 6 psi × 10 . sup . 3 notched izodsample flexural strength flexural modulus tensile strength impact strengthdesignation a * b ** c *** a b c a b c a b c__________________________________________________________________________1 7 . 15 8 . 21 5 . 87 1 . 057 0 . 871 0 . 913 3 . 16 3 . 36 2 . 71 9 . 036 9 . 541 9 . 4732 7 . 28 6 . 51 5 . 36 0 . 983 0 . 703 0 . 777 3 . 02 3 . 14 2 . 31 6 . 963 6 . 933 7 . 8883 5 . 21 5 . 52 4 . 68 0 . 727 0 . 545 0 . 606 2 . 29 2 . 16 1 . 61 4 . 563 5 . 925 6 . 8994 4 . 04 4 . 62 3 . 76 0 . 557 0 . 559 0 . 495 1 . 35 1 . 50 1 . 26 4 . 903 4 . 589 5 . 5825 4 . 12 3 . 75 2 . 71 0 . 571 0 . 356 0 . 426 1 . 29 1 . 24 0 . 99 3 . 062 3 . 667 4 . 617__________________________________________________________________________ * as molded ** after 16 hours of autoclaving at 227 ° f . *** after two hours in boiling water it has been found that the phenolic condensate produced as described above has a shelf life sufficiently long , under ordinary ambient conditions , that sheet molding compound produced therefrom within four hours is satisfactory , and the sheet molding compound , itself , has a shelf life greater than three weeks . it will be appreciated that this is adequately long to make ordinary use of the material for producing sheets or other moldings entirely feasible . the data in the foregoing table show an unexpected result : a comparatively slight decrease in the strength of the moldings , as indicated by the data , after two hours of autoclaving at 227 ° f . and after two hours in boiling water , indicates that the glass fibers were not appreciably affected by the cement . this is unexpected because glass fibers of the indicated composition , distributed in reinforcing relationship with a hydrated mixture of equal parts of portland and gypsum cements , would be at least virtually destroyed by sixteen hours of autoclaving at 227 ° f . the data in the foregoing table , on the other hand , indicate not more than slight deterioration of the fibers during either autoclaving or boiling . it has been found that the relative proportions in which the hydraulic cement or cements , phenol and formaldehyde can be used in practicing the method of the instant invention can be varied within comparatively wide limits . for example , in one series of experiments , where the formaldehyde to phenol ratio was held constant at 3 : 1 , it was found that a curable , workable phenol - formaldehyde condensate could be produced when the amount of portland cement charged varied from one to nine times the weight of the sum of the weight of the water charged to the condensation reaction and three - fifths of the weight of the formaldehyde so charged . preferably the weight of hydraulic cement is from about one and a half to about five times this sum and , most desirably , from about two to four times this sum . it has also been found that the mole ratio of formaldehyde to phenol can be varied within wide limits in producing a molding according to the method of the invention . indeed , in one sense , there is no upper limit on this ratio because portland cement has been found to cure formaldehyde to an infusible condition . as a practical matter , it is usually preferred that the mole ratio of formaldehyde to phenol be from about 1 . 5 : 1 to about 4 . 5 : 1 , most desirably from about 2 : 1 to about 4 : 1 . it has been found that resorcinol can be used in producing a phenol - formaldehyde condensate and a phenolic molding according to the invention . in general , the use of resorcinol accelerates the reactions , both of those involved in producing the original condensate and those involved in producing the final molding . accordingly , resorcinol , when employed , is preferably used in amounts ranging from about 1 percent to about 70 percent of the phenol originally charged , most desirably from about 3 percent to about 10 percent thereof . several experiments were conducted to determine the relative proportions in which portland cement and gypsum cement can be used in producing molding compounds and moldings according to the invention . it had previously been determined that 100 percent of portland cement was operable . accordingly , in this series of experiments , the ratio g /( g + g &# 39 ;), where g represents the number of grams of portland cement used and g &# 39 ; represents the number of grams of gypsum used , was varied between 0 . 5 and 0 . in these experiments , the mole ratio of phenol to formaldehyde was held constant at 3 : 1 and , apart from the proportions of portland cement to gypsum , substantially the procedure described in example 1 , above , was followed . the systems explored were those where the indicated ratio was 0 . 5 , 0 . 4 , 0 . 3 , 0 . 2 , 0 . 1 and 0 . 0 . only the experiment where the ratio was 0 . 0 failed to cure , although the final moldings produced from the system where the ratio was 0 . 1 were somewhat pliable after final cure . accordingly , the minimum value for the indicated ratio should be 0 . 1 . preferably , the ratio is from about 0 . 2 to 1 and , most desirably , from about 0 . 4 to about 0 . 6 . it will be noted that urea was used in producing moldings according to the invention as described above in example 1 . it has been found that such use of urea is advantageous because of ( a ) the moderating effect the urea has on reaction rates , both during the initial condensation and during final cure to produce a molding and ( b ) because the urea acts as a fire retardant . to demonstrate the excellent fire resistance of moldings produced according to the method of the instant invention , panels were produced and were tested for flame spread , fuel contributed and smoke developed in comparison with panels which presently are being produced commercially . the panels according to the invention were produced from a phenol - urea - formaldehyde condensate produced as described in example 1 , above , from the charge there set forth plus 20 parts 1 , 2 - bis - trimethoxysilylethane . sheets were produced as described in example 1 from the resulting condensate and glass fibers * codeposited with the condensate in such proportions that the glass fibers constituted substantially 22 percent of the condensate and fibers . panels 21 inches by 24 inches by 1 / 8 inch were then molded from the resulting sheets : 290 ° f . for 5 minutes at 60 tons pressure . these panels were tested , astm e - 84 tunnel test against panels which are presently being marketed , with the following results . ______________________________________ panels produced present according to commercial the invention panels______________________________________flame spread 20 90 to 110fuel contributed 0 25 to 50smoke developed 2 400 to 500______________________________________ in each case , a low number for the e - 84 tunnel test indicates better performance than does a higher number . it will be appreciated that urea is preferably used in producing a molding according to the invention . when used , urea should constitute at least 10 percent , based upon the weight of the phenol employed , preferably at least 50 percent and , most desirably , at least 75 percent . ordinarily , there is no reason to employ more than 150 percent of urea , on the stated basis , although even greater amounts are not particularly detrimental . it has been found that a molding can be produced according to the method of the invention containing about 50 percent of urea , on the stated basis , and using formaldehyde and phenol in a 1 : 1 mole ratio . however , when urea is increased above about 50 percent , on the stated basis , the mole ratio of formaldehyde to phenol should be increased above 1 : 1 by about 1 per 100 percent of added urea , above 50 percent . | 2 |
the following definitions are provided for some of the terms used throughout this specification . as used herein , “ normal lp ( a ) concentration ” refers to an average plasma lp ( a ) concentration below 25 mg / dl . as used herein , “ elevated lp ( a ) concentration ” refers to an average plasma lp ( a ) concentration above 25 mg / dl . as used herein , “ acute elevation of lp ( a ) concentration ” refers to an average plasma lp ( a ) concentration above 25 mg / dl less than the course of a week . as used herein , “ chronic elevated lp ( a ) concentration ” refers to an average plasma lp ( a ) concentration above 25 mg / dl more than the course of a week . as used herein , “ total - cholesterol ” refers to a summation of cholesterol in plasma that are contained in the major plasma lipoproteins such as chylomicrons , vldl , ldl and hdl . as used herein , “ ldl - cholesterol ” refers to cholesterol contained in plasma ldl lipoprotein . as used herein , “ cardiovascular diseases ”, in the context of the present invention , refers to those disease states associated with high levels of lp ( a ) in plasma as well as other lipoproteins such as ldl ; and includes , inter alia , arteriosclerosis , atherosclerosis , coronary artery disease , peripheral artery disease , myocardial infarction , stroke , restenosis and bypass graft stenosis . as used herein , the term “ an effective amount ” used herein refers to that an amount of the biochemical composition disclosed in this application , when administered to a human subject in need thereof , is sufficient to lower plasma lp ( a ) concentration or inhibit the generation of apo ( a ), or reduce plasma concentrations of other lipoproteins . as used herein , the term “ therapeutically effective amount ” used herein refers to an amount of biochemical composition disclosed in this application , which when administered to a human subject in need thereof , is sufficient to effect treatment for disease states alleviated by the reduction of lp ( a ) or other lipoproteins . the therapeutically effective amounts can be determined routinely by one of ordinary skill in the art having regard to his / her knowledge and tho this disclosure . as used herein , the term “ treatment ” refers to treating a disease state in human , which disease state is alleviated by the reduction of plasma levels of lp ( a ) or other lipoproteins ; and include inhibition the disease or relieving the disease . “ treatment ” used herein also includes preventing , inhibiting or relieving the disease state from occurring in a human . as used herein , the term “ pharmaceutically acceptable salt ” refers to those salts which retain the biological effectiveness and properties of the active ingredient of the biochemical composition , which are not otherwise undesirable . pharmaceutically acceptable salts include , but not limited to , the sodium , potassium , calcium , magnesium , aluminum and the like . as used herein , the term “ ascorbate ” include any pharmaceutically acceptable salt of ascorbate , including sodium ascorbate , as well as ascorbic acid itself . the term “ lysine ” refers to lysine in its electrically neutral form or a pharmaceutically acceptable salt of lysine which includes lysine hydrochloride , lysine dihydrochloride , lysine succinate , lysine glutamate , and lysine orotate . the term “ proline ” refers to proline and proline in a pharmaceutical acceptable salt of proline which includes proline hydrochloride , proline glutamate and the like . an increased concentration of plasma lp ( a ) represents a risk factor for stroke and cardiac infarction . since lp ( a ) in plasma is exclusively produced in the liver , we concluded that the primary cause of an overproduction of lp ( a ) should be an impaired metabolism in liver cells ( hepatocytes ). the cause of this metabolic impairment would be a deficiency of certain biochemical compounds needed as coenzymes in the krebs - cycle , the respiration chain and for other metabolic functions in hepatocytes . the krebs cycle is also called the tricarboxylic acid ( tca ) cycle and the citric acid cycle . it is the final common catabolic pathway for the oxidation of fuel molecules . two carbons enter the citric acid cycle as acetyl coa and two carbons leave as co 2 . in the course of the cycle , four oxidation - reduction reactions take place to yield reduction potential in the form of three molecules of nadh and one molecule of fadh 2 . a high energy phosphate bond ( gtp ) is also formed . additional embodiments and advantages of the invention will be set forth in the description that follows , and in part will be obvious from the description , or may be learned by practice of the invention . this invention may be realized and obtained by means of the composition and method of treatment particularly pointed out from the description and drawings , and from the claims . a composition of biochemical substances can contain at least one ascorbate compound selected from the group consisting of ascorbic acid , pharmaceutically acceptable ascorbate salts and / or mixtures thereof in combination with at least one niacin compound selected from the group of nicotinic acid , niacin amide or another niacin salt , lysine hydrochloride , or pharmaceutically acceptable lysine salts , proline hydrochloride or pharmaceutically acceptable salts thereof and / or mixtures of these compounds . the composition can be effective to lower plasma levels of lipoprotein ( a ), low - density lipoprotein ( ldl ), cholesterol , triglycerides , homocysteine and / or other metabolic risk factors for cardiovascular disease . examples of pharmaceutical compositions useful for the prevention or treatment of cardiovascular disease are described , for example , in u . s . pat . nos . 5 , 278 , 189 , 5 , 650 , 418 , 5 , 230 , 996 , each of which is incorporated herein in its entirety . administration of the compounds of the invention , in pure form or in an appropriate pharmaceutical composition , can be carried out via any of the acceptable modes of administration or pharmaceutically acceptable means of delivery that may serve similar utilities . the modes of administration and pharmaceutically acceptable means of delivery include , but not limited to , oral , nasal , parenteral , topical or transdermal administration or delivery in the form of solid , semi - solid , lyophilized powder , or liquid dosage forms . the dosage forms include tablets , suppositories , pills , soft elastic and hard gelatin capsules , powders , solutions , suspensions , or aerosols , or the like , preferably in unit dosage forms suitable for simple administration of precise dosages . the compositions may include a conventional pharmaceutical carrier or excipient and a compound of the invention as the active agent , and in addition , may include other medicinal agents , pharmaceutical agents , carriers , adjuvants , etc . the preferred route of administration is oral , using a convenient daily dosage regimen which can be adjusted according to the degree of severity of the disease state to be treated . for such oral administration , a pharmaceutically acceptable composition containing the compounds of the invention , or a pharmaceutically acceptable salt thereof , is formed by the incorporation of any of the normally employed , pharmaceutically acceptable excipients , such as , pharmaceutical grades of mannitol , lactose , starch , pregelatinized starch , magnesium stearate , sodium saccharine , talcum , cellulose ether derivatives , glucose gelatin , sucrose , citrate , propyl gallate , and the like . such compositions take the form of solutions , suspensions , tablets , pills , capsules , powders , sustained release formulations and the like . preferably such compositions will take the form of capsule , caplet , or tablet and therefore will also contain a diluent such as lactose , sucrose dicalcium phosphate , and the like ; a disintegrant such as croscarmellose sodium or derivatives thereof ; a lubricant such as magnesium stearate and the like ; and a binder such as a starch , gum acacia , polyvinylpyrrolidone , gelatin , cellulose ether derivatives , and the like . the compounds of the invention in pharmaceutically acceptable form are administrated in a therapeutically effective amount which will vary depending upon a variety of factors including the activity of the specific compounds employed ; the metabolic stability and length of action of the compounds ; the age , body weight , general health , sex and diet of the patient ; the mode and time of administration ; the rate of excretion ; the drug combination ; the severity of the particular disease states ; and the patient undergoing treatment . generally , a therapeutically effective daily dose is not less than about 10 % and not more than about 200 % of the amounts of individual ingredients listed in table 1 . most preferably , a therapeutically effective daily dose is about 50 % identical with the list of components in table 1 . the following specific examples are provided as a guide to assist in the practice of the invention , and are not intended as a limitation on the scope of the invention . this example illustrates the preparation of a representative pharmaceutical composition containing the biochemical compounds listed in the following table ( table 1 ). to demonstrate the utility of the composition of the invention as therapeutic agents for treating disease states which are alleviated by the reduction of plasma lp ( a ) levels , we evaluated the composition of these biochemical compounds for its ability to lowering plasma lp ( a ) and other lipoproteins in humans . we administered the biochemical composition containing the compounds listed in table 1 in a prospective clinical study with 14 patients . various clinical parameters were recorded before the administration of the composition . blood samples were collected via venipuncture at the beginning of the study and plasma levels of various lipoproteins were monitored with elisa assays . the ages of this group of 14 patients ranged from 34 to 68 years old . this group of human subjects were clinically classified as polygenic hyperlipidemia . the average plasma level of lp ( a ) was 71 mg / dl . the average plasma total cholesterol level was 293 mg / dl . the average plasma ldl - cholesterol level was 195 mg / dl . the average plasma triglyceride level was 193 mg / dl . these patients received the biochemical compounds listed in table 1 as a daily dosage . the patients received the compounds of the invention for a period of three months . at the end of the three months after the therapeutic intervention , blood samples were again collected via venipuncture at the end of the study . plasma concentrations of various lipoproteins were monitored with elisa assays . results of the study , as illustrated in fig1 and fig2 demonstrates that the patents , after therapeutic administration of compositions , had led to the following average decrease in plasma levels of . 1 . lp ( a ) from 71 mg / dl to 64 mg / dl , a decrease of 13 %; 2 . total - cholesterol from 293 mg / dl to 252 mg / dl , a decrease of 14 %; 3 . ldl - cholesterol from 195 mg / dl to 176 mg / dl , a decrease of 10 %; and 4 . triglycerides from 193 mg / dl to 151 mg / dl , a decrease of 22 %. the results are further depicted graphically in fig1 and fig2 . [ 0060 ] fig1 is a graph for a pilot study conducted with 14 patients with various forms of lipid disorders ( hyperlipoproteinemia ). their average lipoprotein ( a ) levels at study entry were 71 mg / dl ( milligrams per deciliter ). after therapeutic use of the formula of table 1 the lipoprotein ( a ) levels were lowered within 12 weeks to an average of 62 mg / dl . this equals a reduction in the plasma concentration of this risk factor by 13 %. [ 0061 ] fig2 is a graph showing the lowering effect of the composition of table 1 on additional risk factors for cardiovascular diseases . within 12 weeks of therapy the total cholesterol levels decreased on average from 293 mg / dl to 252 mg / dl (− 14 %), the ldl - cholesterol from 195 mg / dl to 16 mg / dl (− 10 %) and triglycerides from 193 mg / dl to 151 mg / dl (− 22 %). when the chemical compounds of the present invention are combined , the concentration of plasma lipoproteins is significantly reduced . this combined effect is surprising in its effectiveness in lowering the plasma concentration of these lipoproteins as well as the risk of cardiovascular diseases . the lowering of the plasma concentration over the duration of 12 weeks indicates the therapeutic potential of the biochemical composition in controlling chronic elevation of lipoproteins in humans . while the present invention has been described with reference to the specific embodiments thereof , it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention . one of the ordinary skill in the art would appreciate that the effective amounts of the biochemical compounds may vary depending on the variations in patients , durations of treatment etc . modifications may be made to adapt a particular situation , and composition of matter . a number of embodiments of the invention have been described in the present application ; nevertheless , it will be understood all such modifications are intended to be within the scope of the following claims . | 0 |
it has been recognized for several years that if methanogenesis could be partially or totally inhibited with a corresponding increase in propionate production in the rumen , the result would be that approximately 8 percent of the feed energy which is normally lost ( ultimately through eructation ) would be made available to the growing animal , see , for example , hungate , the rumen and its microbes , academic press , n . y . ( 1966 ), pp . 246 and 247 . diversion of this energy loss from methanogenesis would in turn make this energy available for more productive metabolic processes such as the biosynthesis of propionate which is a major source of metabolic energy . the overall result for the animal might be expressed as improvement of feed efficiency and increased rate of weight gain . thus , discovering the means for the metabolic regulation of methanogenesis would be a productive approach to ultimately improving the efficiency of feed utilization for ruminant animals . it was found through extensive in vitro and in vivo studies that specific 5 - substituted tetrazoles of formula i below and a precursor compound of formula ii below , demonstrated the ability to inhibit methanogenesis and increase propionate production relative to acetate in the rumen of the animals . ## str4 ## where x is -- cl ,-- br , ## str5 ## -- nhso 2 ch 3 , ## str6 ## or -- sch 3 , and n is 1 or 2 ; and the 5 - substituted tetrazoles of the present invention are prepared by direct , efficient and high yield synthetic techniques , this being one of the advantages of the compounds of the present invention over other compounds disclosed in the prior art . the 5 - substituted tetrazoles of this invention are generally prepared according to the following scheme : ## str7 ## where x and n are the same as previously defined herein . the different azide reagents which can be used are ( 1 ) nan 3 + nh 4 cl in dmf as disclosed in u . s . pat . no . 2 , 977 , 372 ; ( 2 ) alcl 3 + nan 3 in thf as disclosed in j . o . c ., 34 ( 4 ), ( 1969 ) 1141 - 1142 ; and ( 3 ) ( n - bu ) 3 snn 3 in toluene as disclosed in j . organomet . chem ., 33 ( 1971 ) 337 - 346 . the selection of the particular azide reagent will be dependent upon the reaction conditions required to prepare the specific 5 - substituted tetrazole , cost , availability of materials as well as other such considerations . it has been found , however , that while all of these reagents generally lead to the desired products , reagent ( 1 ) suffers from the difficulty of complete removal of dmf ; reagent ( 2 ) was found to be useful in the preparation of water insoluble tetrazoles ; while reagent ( 3 ) was found to be useful in preparing tetrazoles which required mild reaction conditions such as the chloroacetamido species . the alkylene nitrile reactants or precursors for the preparation of the 5 - substituted tetrazoles of the present invention can be purchased through most bulk chemical suppliers . the particular procedure followed for preparing the 5 - substituted tetrazoles of the present invention comprised heating the mixture of reactants and the selected azide reagent in the selected solvent for a period of time at reflux . while the actual reaction time is not critical , it was found the best results were achieved if the reaction took place for a minimum of 12 hours . specific preparative procedures for compounds within the scope of this invention will be further illustrated in the examples that follow this discussion . the in vitro as well as the in vivo studies conducted show the compounds of the present invention to be effective for inhibiting methane production by ruminant animals as well as increasing the relative propionate concentration in the rumen . it was also discovered that while the compounds of this invention were quite effective for the disclosed utility , their effectiveness can be enhanced by mixing the compounds of this invention with other known rumen metabolic regulators , e . g ., polyether antibiotics ( monensin , etc .). the relative amounts of these compounds administered were not found to be critical except as is evident , the amounts must be kept below toxic levels . various features and aspects of the present invention will be further illustrated in the examples that follow . while these examples will show one skilled in the art how to operate within the scope of this invention , they are not to serve as a limitation on the scope of the invention where such scope is only defined in the claims . the following examples will serve to illustrate the synthesis of the compounds within the scope of this invention . a mixture of 39 . 9 g ( 0 . 3 mol ) of alcl 3 , 600 ml of thf , and 86 . 78 g ( 1 . 33 mol ) of nan 3 and 26 . 86 g ( 0 . 3 mol ) of clch 2 ch 2 cn were stirred and heated to reflux under argon for 24 hours then cooled and acidified with 450 ml of 15 percent hcl solution . the resulting mixture was warmed on a steam bath to remove hn 3 . the phases were then separated and the aqueous phase was extracted twice with 150 ml portions of ethyl acetate . the organic phases were combined , washed with saturated nacl solution followed by drying over anhydrous na 2 so 4 . removal of the solvent under reduced pressure gave 33 . 87 g of a brown solid , m . p . 88 °- 102 . 5 ° c . three recrystallizations from clch 2 ch 2 cl gave 23 . 55 g ( 59 percent ) of desired compound as fine beige needles , m . p . 104 °- 105 ° c . to a mixture of 26 . 6 g ( 0 . 2 mol ) of alcl 3 and 450 ml dry thf was added with stirring and in one portion , 57 . 2 g ( 0 . 88 mol ) of nan 3 . the resulting mixture was stirred under argon at room temperature for 15 minutes followed by the addition of 15 . 1 g ( 0 . 2 mol ) of clch 2 cn . the resulting mixture was heated and stirred at reflux for 24 hours then quenched with 300 ml of 15 percent hcl solution . the resulting 2 - phase mixture was heated on a steam bath for 15 minutes to remove hn 3 after which the phases were separated . the aqueous phase was washed 3 times with 100 ml portions of ethyl acetate and then dried over anhydrous na 2 so 4 . removal of the solvent under reduced pressure gave 26 . 07 g of black wax which was dissolved in 25 ml of h 2 o . the resulting solution was adjusted to a ph 10 with naoh . the aqueous alkaline solution was extracted 3 times with 100 ml portions of ether . the aqueous phase was then adjusted to ph 2 with 15 percent hcl solution . the aqueous phase was saturated with nacl then extracted 3 times with 100 ml of ethyl acetate . the ethyl acetate phases were combined , washed with brine and then dried over anhydrous na 2 so 4 . removal of solvent under reduced pressure gave 17 g of brown solid which was recrystallized from clch 2 ch 2 cl to give 9 . 74 g of a brown solid , m . p . 72 °- 79 ° c . this brown solid was in turn recrystallized from chcl 3 to give 5 . 33 g of the desired compound , m . p . 88 . 5 - 90 . 5 . the mother liquor afforded an additional 0 . 98 g of the desired compound , m . p . 87 °- 88 ° c . a solution of 9 . 3 g ( 65 mmols ) of ## str8 ## and 32 . 37 g ( 97 . 5 m mols ) of ( n - bu ) 3 snn 3 in 150 ml of toluene was stirred and heated at reflux for 19 hours then cooled to room temperature . the supernatant liquid was decanted from the brown oil which formed . removal of the solvent under reduced pressure gave a cloudy oil - solid mixture . the material was vigorously stirred with 300 ml of ether while anhydrous hcl gas was passed through the mixture resulting in a wax . the ether was decanted after which the wax was dissolved in 300 ml of hot ethyl acetate and anhydrous hcl gas was passed through the resulting solution . the solution became cloudy and an oil formed . the supernatant was separated from the oil and the solvent was removed from the supernatant under reduced pressure to give 2 . 61 g of an oily solid . this material was washed by stirring with ether then filtered to give 1 . 86 g of beige solid , m . p . 105 °- 120 ° c . three recrystallizations of this material from absolute ethanol afforded 0 . 658 g of the desired compound as colorless to white nodules , m . p . 132 °- 133 . 5 ° c . a solution of 11 . 26 g ( 50 mmols ) of ## str9 ## 19 . 92 g ( 60 mmols ) of ( n - bu ) 3 snn 3 , and 150 ml of dry thf was stirred and heated at reflux for 24 hours then cooled to room temperature . removal of the solvent under reduced pressure gave a clear pale yellow oil which was stirred at room temperature for 30 minutes with 350 ml of ethereal hcl solution . the resulting mixture was filtered followed by washing the solid by stirring for 2 hours with 200 ml of ether to give 4 . 03 g of white powder , m . p . 150 . 5 °- 152 . 5 ° c . recrystallization from 135 ml of boiling ethyl acetate afforded 2 . 98 g of the desired compound as colorless needles , m . p . 158 °- 159 ° c . all the 5 - substituted tetrazoles within the scope of this invention are prepared by the procedures illustrated in the previous examples . as indicated previously , the preparation of these compounds is direct and efficient , giving good yields of the desired compound . below is set forth the procedure followed for testing the compounds of the present invention in vitro . for these studies , rumen fistulated sheep were fed a concentrate diet which constituted 3 parts chopped corn and cob and 1 part alfalfa pellets . 1 . rumen fluid was removed from a fistulated sheep and strained through 4 layers of cheese cloth to remove large feed particles . 2 . one part rumen fluid was added to 3 parts of modified mcdougal &# 39 ; s artificial saliva , the ph was adjusted to 7 . 0 and the saliva solution was prewarmed to 39 ° c . in a water bath and gassed with co 2 . ______________________________________salt mmoles______________________________________nahco . sub . 3 58 . 5khco . sub . 3 58 . 5nah . sub . 2 po . sub . 4 13 . 0kh . sub . 2 po . sub . 4 13 . 0nacl 8 . 0kcl 8 . 0mgcl . sub . 2 0 . 3cacl . sub . 2 0 . 2______________________________________100x salt solutionsalt g / l h . sub . 2 o______________________________________nacl 47mgcl . sub . 2 6kcl 57cacl . sub . 2 4______________________________________ to prepare ( a ), ( i ) 9 . 8 g nahco 3 , 11 . 7 g khco 3 , 5 . 1 g nah 2 po 4 and 4 . 08 g kh 2 po 4 were diluted with two ( 2 ) liters of distilled h 2 o ; ( ii ) 20 ml of 100x salt solution was diluted to 1 . 33 l with tap h 2 o ; and ( iii ) mix ( i ) with ( ii ) to prepare the modified mcdougal artificial saliva . 3 . add 0 . 01 g concentrate feed / 1 ml of buffered rumen fluid ( the buffered rumen fluid with concentrate should be stirred at all times to prevent the concentrate from settling ). 4 . dispense 20 ml of buffered rumen fluid into 30 ml serum bottles that are being gassed with co 2 . ( a manifold that gases 12 bottles at a time was used .) the bottles should be in a 39 ° c . h 2 o bath . 5 . the test compounds , i . e ., the compounds of the present invention , were first added to the bottles . after the addition of the buffered rumen fluid to all 12 bottles , the gassing cannulae were quickly removed and a butyl rubber stopper was inserted in each bottle . an aluminum seal was then placed on each bottle and crimped tight . note : do not remove the bottle from the water bath until it has been crimped . 6 . the sealed bottles were removed from the water bath , shaken and placed in a 39 ° c . incubator for 18 hours . 7 . after the 18 - hour incubation , the bottles were removed from the incubator and the head space gas was analyzed using a gas partitioner . 8 . four ml of rumen fluid was removed from each bottle for volatile fatty acid ( vfa ) analysis . ( a ) the 4 ml sample was added to a centrifuge tube to which had previously been added 0 . 04 ml of 50 percent h 2 so 4 and 1 ml 2 - ethylbutyric acid ( concentration 2 ml of 2 - ethylbutyric acid / 500 ml h 2 o v / v ). ( b ) the mixture from ( a ) was centrifuged at 10000 xg for 20 minutes . ( c ) the supernatant was removed and analyzed by gas - liquid chromatography . the above procedures were followed in all trials for testing the compounds of the present invention . the results of the in vitro tests are set out in table i . it is pointed out that these results are reported in terms of relative concentration of the volatile fatty acids ( vfa ) acetate , propionate , and butyrate and percent methane inhibition to a negative control . table i__________________________________________________________________________ ratio treated to control levels total methanecompound ppm c2 . sup . 2 c3 . sup . 2 c4 . sup . 2 vfa inhibition (%) __________________________________________________________________________ . sup . 1 tch . sub . 2 cl 50 . 0 0 . 74 1 . 49 0 . 95 0 . 96 96 . 8tch . sub . 2 ch . sub . 2 cl 50 . 0 0 . 76 1 . 48 0 . 92 1 . 03 74 . 6tch . sub . 2 ch . sub . 2 br 50 . 0 0 . 73 1 . 44 1 . 25 0 . 91 91 . 3 ## str10 ## 50 . 00 0 . 91 1 . 16 1 . 05 1 . 02 4 . 9 tch . sub . 2 ch . sub . 2 nhso . sub . 2 ch . sub . 3 50 . 0 0 . 99 1 . 04 0 . 99 1 . 02 0 . 7 ## str11 ## 50 . 0 0 . 92 1 . 23 0 . 95 1 . 07 8 . 0 cnch . sub . 2 ch . sub . 2 nhso . sub . 2 ch . sub . 3 50 . 0 0 . 7 1 . 58 1 . 13 0 . 97 73 . 4__________________________________________________________________________ ## str12 ## . sup . 2 c2 represents acetate , c3 represents propionate and c4 represents butyrate . the results of the in vitro testing confirm that the compounds of the present invention are effective for increasing propionate production relative to acetate in rumen fluid as well as inhibiting the production of methane . the in vitro studies showed the compounds of the present invention had the desired effect on the biochemistry of the rumen bacteria , however , it had yet to be determined whether or not this effect would be sustained in the animal where numerous other biochemical processes are simultaneously occuring . eight rumen fistulated sheep were used as test animals . two sheep were alotted to each of three treatments and a control for each test . group i was always the control group in each of the different trials . groups ii through iv had varying concentrations of compounds of the present invention added to the animals &# 39 ; feed . the feed ration in each trial constituted 3 parts chopped corn and cob and 1 part alfalfa pellets . each sheep was offered 800 g daily of the feed in two equal portions . the particular compound and vitamin premix were mixed with chopped corn and cob . any feed refusals were weighed back before each feeding and discarded . to prevent any mold growth , the feed was stored under refrigeration . all animals in the various treatment groups were sampled for vfa &# 39 ; s twice a week . equal volumes of rumen fluid from each animal within a treatment were pooled for treatment vfa analysis . fluid from individual animals was also analyzed for vfa . individual animal vfa &# 39 ; s within a treatment were averaged . this value was then averaged with pooled treatment vfa yielding the final treatment vfa value . all ratios and statistics were calculated using this final value . vfa &# 39 ; s were calculated as the ratio treated to its respective pretreatment value . each of the trials lasted for 90 days . using the procedures set out in a , the data reported in tables ii and iii were collected from trials using two of the compounds of the present invention . table ii______________________________________compound : 5 - chloromethyltetrazole ratio of treatment vfa to pretreatment vfa level . sup . 1 totalgroups % c2 . sup . 2 c3 . sup . 2 c4 . sup . 2 vfa______________________________________i control 1 . 02 . sup . 3 0 . 99 0 . 90 0 . 87ii 0 . 01 1 . 01 0 . 98 1 . 02 0 . 96iii 0 . 05 0 . 97 1 . 05 1 . 04 0 . 88iv 0 . 025 0 . 96 1 . 10 1 . 05 0 . 93______________________________________ . sup . 1 level is reported as percent of compound added to total amount of feed administered to the animal . a dose level of 0 . 05 corresponds to approximately 60 ppm of the compound in the rumen . . sup . 2 c2 represents acetate , c3 represents propionate and c4 represents butyrate . . sup . 3 average of all values for biweekly samples taken over the 90day trial period . table iii______________________________________compound : 5 -( 2 - chloroethyl ) tetrazole ratio of treatment vfa to pretreatment vfa level . sup . 1 totalgroups % c2 . sup . 2 c3 . sup . 2 c4 . sup . 2 vfa______________________________________i control 1 . 00 . sup . 3 1 . 05 1 . 07 1 . 00ii 0 . 05 0 . 97 1 . 06 1 . 11 0 . 88iii 0 . 075 0 . 92 1 . 24 1 . 05 0 . 89iv 0 . 025 0 . 97 1 . 00 1 . 20 1 . 05______________________________________ . sup . 1 level is reported as percent of compound added to the total feed administered to the animal . a dose level of 0 . 05 percent corresponds approximately to 60 ppm of compound in the rumen . . sup . 2 c2 represents acetate , c3 represents propionate and c4 represents butyrate . . sup . 3 average of all values for biweekly samples taken over the 90day trial period . as illustrated by the results of these trials , the compounds of the present invention were found to be effective in decreasing the acetate concentration and correspondingly increasing the propionate production in the rumen of the animals for a sustained time period . testing of other compounds within the scope of this invention gives results that correspond to those set out in tables ii and iii . it was also discovered that combining the compounds of the present invention with known rumen metabolic regulators , e . g ., polyether antibiotics ( monensin , etc .) resulted in a still further increase in propionate production with a concomitant decrease by both acetate and butyrate . therefore , mixtures of two or more compounds of the present invention as feed additives , as well as mixtures of compounds of the present invention with known rumen metabolic regulators are within the scope of this invention . it has been found that the compounds of the present invention improve the efficiency of feed utilization in ruminant animals when they are administered orally to the animals . the simplest and easiest manner to orally administer the compounds of this invention to the animals is by admixture to their feed . any appropriate feed material for ruminant animals may be used including the concentrate feed previously described as well as roughage feeds such as silage or various commercial grain mixtures commonly used for ruminant animals . the compounds of the present invention can be added to any conventional premix formulation , animal feed carriers or adjuvants in an amount sufficient to increase the efficiency of feed utilization by ruminant animals . in addition to the compounds of the present invention , the animal feed compositions may contain such additives as vitamins ; minerals ; natural oils ; e . g ., vegetable oil , animal fat , fish oils , etc . ; antioxidants ; antibiotics ; anthelmintics ; and other appropriate medicaments . the compounds of the present invention may also be administered to the animals in other ways . for example , their may be incorporated into tablets , drenches , boluses , or capsules , and dosed to the animals in formulations and by means well known in the veterinary pharmaceutical art . they can also be administered in the field by means of salt or molasses blocks . use of the compounds of the present invention for improving the efficiency of feed utilization of monogastric animals which digest at least a portion of their food by cereal and / or colon fermentation , since it follows a chemical pathway similar to rumen fermentation , is also contemplated by this invention . in general , the scope of the present invention is not to be limited by any specific method of administration or any particular formulation of the compounds of this invention . any manner or form for increasing the efficiency of feed utilization by ruminant animals by use of the compounds of the present invention is within the scope of this invention . other features and aspects of this invention will be appreciated by those skilled in the art upon reading and comprehending this disclosure . such features , aspects and expected variations and modifications of the reported results are clearly within the scope of this invention where the invention is limited solely by the scope of the following claims . | 0 |
the present invention will be best understood by reference to fig1 and 2 . a modified bituminous membrane 10 as known in the prior art is a sheet material comprising a polymer - asphalt blend 12 saturating or forming a continuous matrix that embeds a fleece or mat like reinforcing inner core 14 . the primary modifiers of the bitumen are sbs and app . an upper surface or weathering surface of the membrane 10 is typically coated with a ceramic granular material 16 . one such material 16 is sold commercially as no . 11 roofing granule . a bottom surface of the membrane typically is coated with a means 18 to prevent sticking or adhesion , especially self - adhesion . one commonly - used means is a fine silica sand . because of the agitation involved in normal processing of the asphalt polymer blend , air is inherently entrained or entrapped during the mixing process or the dispersion of the polymer in the bitumen matrix . this entrained air results in the creation of air voids 20 in the polymer - asphalt matrix 12 . these voids 20 adversely affect the performance properties of the membrane 10 . in a typical membrane 10 of the prior art , voids 20 comprise a small but measurable amount of the volume of the membrane . this amount of voidage may be estimated through a directly measurable decrease in membrane density . the present invention produces a modified bituminous membrane 110 which is previously unknown in the prior art . like the prior art membrane 10 , it comprises a polymer - asphalt blend 112 saturating or forming a continuous matrix that embeds the fleece or mat like reinforcing inner core 14 . the polymer - asphalt blend 112 is substantially the same composition as the blend 12 of the prior art , but is distinctly different in physical properties due to the difference in the voidage . the upper or weathering surface of the membrane 10 is typically coated with the ceramic granular material 16 . the bottom surface of the membrane typically is coated with the means 18 for preventing sticking or adhesion , especially self - adhesion . the difference between the prior art membrane 10 and the membrane 110 of the present invention is the amount and dispersion of the voids 120 . by dispersing the polymer in the asphalt at a pressure lower than atmospheric , entrained air is reduced or eliminated . by measuring membrane density , the polymer - asphalt blend is observed to have a density which is in the range of 5 to 8 % higher when the blend is processed at pressures less than atmospheric . in particular , this level of increase is observed when the processing is conducted at a pressure at least 15 in . hg lower than atmospheric . as a result , the volumetric portion of the membrane comprising voids is reduced , by reducing either the average size of voids , the average number of voids per unit volume of membrane or both . as a result , the membrane 110 behaves more like a truly continuous matrix of the polymer - asphalt blend than the membrane 10 of the prior art . typical sbs asphalt recipes consist of thermoplastic block copolymers at 5 to 20 percent by weight similar to and including the kraton types or of the phillips solprene types sold under europrene , finaprene , calprene labels . typical app recipes include amorphous polypropylenes or attactic polypropylene at loadings of 15 to 30 percent by weight with optional amount of crystalline or isotactic polypropylenes at loadings of 0 to 5 percent . examples of app are eastman chemical &# 39 ; s elastoflex m - 5h or huls vestoplast 891 while examples of ipp are iscom &# 39 ; s ic - 20 . in these recipes the sbs and the app are primary asphalt modifiers , the modifiers that are used to give the polymer asphalt blend it &# 39 ; s improved low temperature properties — flexibility , plastic / elastic properties , strength , durability ; and , it &# 39 ; s improved high temperature properties — high softening point , reduced flow and improved sag / deformation resistance . what has been found and is an object of this invention is the use of secondary polymers to enhance the aging of these polymer asphalt blends . specifically claimed is styreneisoprene - styrene ( sis ), styrene - ethylene - butlyene - styrene ( sebs ), and styrene - ethylene ( se ) thermoplastic block co - polymers . these polymers , either used by themselves or in conjunction with one another enhance the typical aging characteristics of polymer asphalt blends . these secondary modifiers enhance the properties of the primary polymer asphalt blends by two different distinct mechanisms depending upon the polymer type . sis &# 39 ; s primary mode of degradation with age that occurs is chain scission , that is as it ages the polymer molecule becomes smaller in size and act as a plasticizer / softener for the sbs or app polymer asphalt blends that becomes brittles with time as it ages losing flexibility and elasticity . sebs and se polymers have a hydrogenated polymer backbone that resists degradation , either chain scission or crosslinking ( recombination ). withstanding any form of degradation these hydrogenated polymers retain their original properties that contribute to the physical properties of the overall polymer asphalt blend , i . e . flexibility , elasticity , and rubber like properties . in processing of polymer modified asphalt coatings , the temperature is usually between 300 and 400 degrees f . to ensure that the components are in a fluid state . the polymer is added in solid form for the case of sbs and in either liquid or solid form for app to the molten liquid asphalt . the materials are then mixed under heat and agitation until a homogenous blend is achieved . as the polymer disperses within the asphalt under mixing or agitation — the blend increases in viscosity . as the blend mixes with this increase in viscosity , the blend incorporates and entrains air as part of the mixing operation . often because these blends are so high in viscosity , the air entrained in mixing does not release by itself and transfers to the coating operation of the fleece or mat like material . air voids or pockets , on the order of around 100 to 1000 microns are formed in the modified bituminous membrane sheet material . these voids or air pockets sacrifice performance of the modified bituminous membranes . these voids or air pockets can cause blisters in the sheet material in field performance . as the air heats or warms up from the heat of sun — it expands putting the pocket under positive pressure forming a blister . under constant cycling of expansion and contraction from heating that occurs from the sun during the day and cooling that occurs during the night — these pockets or voids undergo excessive physical wear and stress and as a result , fail prematurely causing a break in the water - proofing integrity of the membrane . these breaks in the waterproofing integrity cause the further deterioration of the roof assembly by allowing water to penetrate the individual components of the roof assembly causing even further damage . also , larger air voids or pockets can cause incomplete coating and sealing of the reinforcement creating a direct channel allowing water to penetrate and wick into the fleece / mat reinforcement . once water penetrates into the fleece / mat material it eventually spreads causing delamination of the polymer asphalt coating and widespread material failure . laboratory test methods can assess the amount of air voidage , as well as how it correlates to blistering of the modified bituminous membrane . one method of assessment is to form a specimen , typically a square specimen with 6 - inch sides , cut from a piece of the formed membrane . the cut edges of the sides are sealed with asphalt to minimize edge effects , particularly lateral migration .. the specimen is immersed in water for 72 hours at a temperature of about 120 degrees f . porosity in the specimen , especially porosity due to air voidage , allows water to displace air during this immersion . the specimens are transferred immediately to a vacuum oven and maintained at a temperature in the range of about 160 degrees f . with a vacuum in the range of from about 15 to about 25 inches hg for up to about 48 hours . blistering from the evaporative release of the water in the pores is directly observable if present . this laboratory blistering may be directly related to a propensity for the same specimen to blister under actual field conditions . the laboratory blistering , if it is to occur , will generally be observed within 48 hours , although many of the cases will exhibit blistering much more quickly , if it is to occur at all . while the above describes a specific “ pass / fail ” test for determining the removal of air voidage from a modified bituminous membrane , it should also be observed that there are also other manners of conducting the determination . for example , in some cases , merely cutting the membrane to form the specimen and observing the matrix of the membrane for visible voidage will be a good predictor of field blistering . the present invention teaches that , by applying vacuum or negative pressure in the mixing process , air void formation can be minimized or eliminated . by eliminating and reducing the potential for air void or pocket formation the long term performance of the modified bituminous sheet material can be greatly improved . a preferred mixing unit is the versimix manufactured by charles ross & amp ; sons or equivalent . this unit allows for rapid dissolution of polymer into asphalt to which vacuum or negative pressure can be applied . the mixing unit has three type of mix heads : a mixer / emulsifier head providing high shear and particle size reduction ; a high speed disperser head similar to a cowles type mixer for dispersing solid powder particulate ; and , a low speed sweep to keep material moving and flowing over itself . this type of mixing is unique to polymer - asphalt technology , even more so when combined application of vacuum . polymer asphalt blends are mixed to complete dispersion with filler addition in 30 to 45 minutes , typical vacuum stages are applied for 5 to 15 minutes after dispersion is complete at 15 to 25 inches hg negative pressure . typical mixing times for polymer asphalt blends on conventional equipment is two to twenty four hours . while a process for applying the deaerating vacuum during the modification of the bitumen with polymer has described in detail , the invention is not limited to only that particular process . specifically , the polymer modification of the bitumen greatly increases viscosity , which also increases the entrainment of air during mixing . the critical aspect of the invention , as viewed by the inventors , is that the bitumen , once modified to increase the viscosity , should be allowed to release any entrained air through a vacuum treatment before being formed into the membrane and certainly after any vigorous mixing procedure . the deaeration procedure may be at the end of the blending step in the same vessel , it may be in a separate vessel after the blending step and it may even be achieved using in - line deaeration techniques while pumping the modified bitumen at the point of forming the membrane . | 8 |
as used herein the term “ lip care moisturizing product ” refers to lipsticks , lip balms , and other products used to treat the lips whether in solid or pasty form . the lip care products of the invention are based on the use of liposomes , which are defined generally as spherical , closed bilayer structures formed by hydrating lipids or lipid - like amphiphilic materials under appropriate conditions . liposomes may be differentiated based on lamellarity , size , and function . small unilamellar vesicles ( suv &# 39 ; s ) have a size between 25 and 75 nm , while large unilamellar vesicles ( luv &# 39 ; s ) have a size greater than 100 nm . unilamellar liposomes that are stearically stabilized by incorporating proteins are known as “ stealth liposomes ” while liposomes containing cationic lipids carry a net positive charge and are known as cationic liposomes . liposomes may also contain lipids designed to bind to specific cells or proteins , and these are known as targeted liposomes . in a first method , a solution of lipid is dried in a high vacuum to remove all organic solvent , then hydrated in an appropriate buffer to produce a raw liposome dispersion , which is generally a mixture of univesicular and unilamellar liposomes . the dispersion can be forced through a membrane to obtain large unilamellar vesicles , with size depending on the pore size of the membrane . alternatively , the raw dispersion can be treated by sonication to obtain small unilamellar vesicles , which are harvested by ultracentrifugation . a mixture of large and small unilamellar liposomes can be prepared by dissolving dry lipids in aqueous media in the presence of a detergent , then removing the detergent by dialysis . industrially , liposomes can be obtained by forming a slurry of lipid in water and microfluidizing at 12 , 000 - 14 , 000 psi . this process can be performed continuously to produce unilamellar liposomes and no organic solvent is necessary . a particularly preferred liposome for the products of the invention is sold as liposomes fg ™ by the collaborative group , ltd . of east setauket , n . y . these liposomes are formed of lecithin as the lipid and contain a mixture of water and glycerin . the compositions of the invention comprise a stable emulsion base containing about 1 . 0 to 35 . 0 % by weight purified water , and about 0 . 2 % to 30 % by weight liposome dispersion containing a purified water - glycerin mixture . in one embodiment , the liposome dispersion contains 82 % by weight liposomes and 18 % by weight of a water - glycerin mixture . the liposomes are preferably in the size range of about 25 to 75 nm . the emulsion base also preferably contains 0 . 05 to 20 % by weight , and preferably less than 5 % by weight , of a gelling agent , i . e . cholestryl / behenyl / octyldodecyl lauroyl glutamate , which will absorb and retain water in an amount of 4 % to 300 % of its own weight . the compositions of the invention typically contain a mixture of esters and waxes as the base material , although the particular esters and waxes used are not critical . typical esters used in such products include jojoba esters , dioctyl adipate , octyl stearate , octyl palmitate and caprylic / capric triglycerides . esters are typically present in a total amount of about 0 . 5 to 35 % by weight , preferably about 5 to 35 % by weight . typical waxes used are ozokerite ( ceresin ), microcrystalline waxes and petrolatum , in a total amount of about 0 . 5 to 29 % by weight , preferably about 3 to 29 % by weight . the total amount of esters and waxes will affect the physical form of the product . thus , pasty products will generally have between about 1 and 25 % by weight total esters and waxes , whereas solid products like lipsticks and lip balms will generally have between about 5 and 35 % by weight total esters and waxes . sunscreens which may be used include octylmethoxycinnamate and benzophenone - 3 , in amounts necessary to achieve sun protection factor ( spf ) 15 . the total amount of sunscreen in the composition is generally in the range of 5 . 0 to 30 % by weight , preferably 7 . 0 to 15 % by weight . the compositions preferably contain one or more penetrating moisturizers , particularly squalane and panthenol in a total amount of about 0 . 5 to 5 % by weight . the water in oil emulsions of the invention are typically produced using stearate emulsifiers , for example glyceryl stearate , peg stearate and behenoyl stearate . behenoyl stearate emulsifier is very effective in emulsifying 33 - 55 % by weight water into 45 - 67 % by weight of non - polar oils . the best results are obtained by dissolving about 2 - 7 . 5 % by weight emulsifier in the oil phase , and buffering the system by dissolving up to 4 % by weight borax in the water phase . a typical composition according to the invention thus contains , by weight : esters up to 35 % waxes up to 29 % sunscreens 7 . 0 - 15 % emulsifier up to 7 . 5 % liposomes and to 100 %. other ingredients a preferred composition also contains a skin protectant , and has the following composition , by weight : sunscreen and skin protectants 12 % esters 31 % emulsifier 2 . 5 % gelling agent 0 . 5 % waxes 29 % moisturizer 2 % purified water and liposomes 18 % preservatives and flavors 5 % the composition is prepared by mixing the waxes and esters and melting together to form an oil phase . the purified water is blended with cholestryl / behenyl / octyldodecyl lauroyl glutamate and passed through a high shear inline micronizer to form a water phase . the oil phase and the water phase are mixed together and passed through a high shear micronizer to obtain a water in oil emulsion . pre - blending of the water phase is important to stabilize the emulsion without loss of moisture during further processing . after obtaining the emulsion , liposomes are purged into the system at a rate of 1 liter per hour at a temperature below 45 ° c . while mixing at less than 400 rpm . because liposomes are delicate , excessive heat and shearing are to be avoided in the mixing step . a lip balm is prepared with the following composition ( by weight ): active ingredients : octyl methoxycinnamate 7 . 500 % benzophenone 2 . 500 % dimethicone 2 . 000 % other ingredients : dioctyl adipate / octyl 15 . 244 % stearate / octyl palmitate caprylic / capric triglycerides 13 . 596 % microcrystalline wax 11 . 712 % liposome composition 10 . 560 % petrolatum 9 . 024 % ozokerite 7 . 680 % purified water 6 . 680 % flavor 4 . 000 % jojoba esters 2 . 400 % behenoyl stearate 2 . 400 % sodium borate 1 . 360 % panthenol 1 . 000 % squalane 1 . 000 % cholesteryl / behenyl / 0 . 480 % octadecyl lauroyl glutamate methyl paraben 0 . 288 % propyl paraben 0 . 288 % ethyl paraben 0 . 096 % butyl paraben 0 . 096 % sodium saccharin 0 . 096 % total : 100 . 000 % | 8 |
in the figures , identical components and components having the same function are identified by the same reference signs . fig1 shows an mems 1 ( microelectromechanical system ). the mems 1 comprises a semiconductor substrate 2 with a sensitive , mechanical component structure 3 formed thereon , said component structure being formed from semiconductor material . the component structure 3 is protected against mechanical and other environmental influences , such as temperature and moisture and also gas , by an encapsulation 4 . the encapsulation 4 comprises a film 5 embodied as a multilayer film . in the exemplary embodiment shown , the film 5 is shaped two - dimensionally and forms a cavity 7 together with a spacer 6 , which is provided on the semiconductor substrate 2 and is embodied as a bonding frame , said cavity providing the component structure 3 with sufficient free space for movement . the film 5 comprises a polymer layer 8 , composed of lcp in the exemplary embodiment shown . the polymer layer 8 is coated with a first metal layer 9 on both flat sides . said metal layer is formed from a copper film laminated onto the polymer layer and serves for optimizing the hermetic sealing of the cavity 7 closed by the film 5 . a respective , namely second , metal layer which is formed from electrolytically reinforced copper in the exemplary embodiment shown , is in turn situated on the first metal layers 9 . with the aid of said second metal layer 10 , the film 5 , on the side facing the semiconductor substrate 2 , is connected to the semiconductor substrate 2 directly by means of a bonding layer 11 . on that side of the film 5 which faces away from the semiconductor substrate 2 , solder balls 12 for a flip - chip application are situated on the second metal layer 10 in regions electrically insulated from one another . it can be discerned that a soldering resist 13 is situated on that side of the film 5 which faces away from the semiconductor substrate 2 , said soldering resist being applied partly on the second metal layer 10 and partly directly on the polymer layer 8 . the direct contacting of the polymer layer 8 with soldering resist 13 results from a structuring of the first and the second metal layer 9 , for the production of regions electrically insulated from one another . within the cavity 7 , spacers 14 are provided on the first metal layer 9 , said spacers limiting a deflection movement of the mechanical component structure 3 . as is further evident from fig1 , through contacts extending perpendicularly to the semiconductor substrate 2 penetrate through the polymer layer 8 of the film 5 , said through contacts being formed in each case from electrolytically reinforced copper . the through contacts 15 directly connect the metal layers 9 , 10 on both sides of the polymer layer 8 to one another , to be precise in regions electrically insulated from one another . by means of the bonding layer 11 and the through contacts 15 , the semiconductor substrate 2 or electrical and / or electronically active regions or elements ( not shown ) of the semiconductor substrate 2 is or are electrically connected to a respective solder ball 12 . fig2 shows an alternatively constructed mems . the semiconductor substrate 2 with its sensitive , mechanical component structure 3 can be discerned . at a distance from the component structure 3 , with formation of a cavity 7 , a film 5 realized as a multilayer film is fixedly connected to the semiconductor substrate 2 . the film 5 is shaped three - dimensionally for example by thermoforming or injection molding . as in the exemplary embodiment in accordance with fig1 , the film 5 comprises a polymer layer 8 provided with a first metal layer 9 on both flat sides . the first metal layer 9 is directly fixed to the semiconductor substrate 2 by means of a bonding layer 11 . in the exemplary embodiment in accordance with fig2 as well , two through contacts 15 running perpendicularly to the semiconductor substrate 2 penetrate through the polymer layer 8 , said through contacts in each case electrically conductively connecting a solder ball 12 electrically to the first metal layer 9 facing the semiconductor substrate 2 , the semiconductor substrate 2 or electrical and / or electronic regions or elements ( not shown ) of the semiconductor substrate 2 being electrically conductively connected to the first metal layer 9 , with which the through contacts 15 make contact , by means of the electrically conductive bonding layer 11 . in the exemplary embodiment in accordance with fig2 as well , those regions of the first metal layer 9 with which the through contacts 15 make contact , both on the side facing the semiconductor substrate 2 and on the side facing away , are electrically insulated from one another by a corresponding structuring of the first metal layer 9 . | 7 |
the drawing shows a delivery pipe 1 with an inlet 1a to an overfall plant 2 with a distribution and control unit 2a and an overflow pipe 3 . in the control unit 2a a chamber 4 is arranged , said chamber being connected with the delivery pipe 1 and having an overfall edge 4a and a partition wall 5 , which forms an overflow chamber 6 and an underflow chamber 7 . the overflow chamber 6 is also referred to herein as a subchamber of the main chamber 4 , more particularly as the uppermost subchamber ; while the underflow chamber 7 is likewise alternatively designated as a lowermost subchamber here , and in the following claims . from the underflow chamber 7 an outlet in form of a cutoff pipe 8 is leading , which at its inlet may be provided with a hydraulic brake or controlling device 9 . on the upper side of the partition wall 5 a bigger ascension pipe 10 is arranged according to the embodiment shown in fig1 said pipe enclosing a smaller under / overflow pipe 11 connected with the cutoff pipe 8 . on the upper side of the partition wall 5 a grate 13 is mounted , and the back wall of the chamber 4 is prolonged downwardly to form a foam screen 14 at the inlet 1a . what is termed &# 34 ; overfall &# 34 ; in the present invention as seen in fig1 leaves from the uppermost subchamber ; while that termed overflow leaves from the lowermost chamber . in the embodiment according to fig3 and 4 the under - overflow pipe 11 is provided with outlets to an adjacent reservoir 16 , from which collected impure water may return completely or partially through a non - return valve 15 to the underflow . in the embodiment shown in fig5 the ascension pipe 10 has been replaced by an under - overflow pipe 23 , which discharges into the adjacent reservoir 16 . the reservoir is shown in fig6 and comprises a prechamber 18 with a height - wise adjustable overflow edge 19 and a non - return valve 15 , through which the collected impure water may return completely or partially to the underflow . in the embodiment according to fig5 a siphon system 17 is also provided . in fig7 and 8 an embodiment of the invention is shown , in which the underflow chamber is divided by means of an additional partition wall 20 , in such a way that the underflow chamber is divided into a proper underflow chamber 7 and an under - overflow chamber 21 , from which the under - overflow pipe 23 extends . in this embodiment the siphon system 17 is further provided with outlets to a particular chamber at the control unit 2a , from where an outlet 22 extends . in this case a possibility could be to prolong the delivery side of the siphon system 17 down to the lower edge of the foam screen 14 in order to replace it . thereby , liquids like oil and grease may be caught by leading the flow through the siphon discharge pipe 22 to an oil or grease separator . in fig8 the partition wall 5 is shown with a concave front edge 25 . hereby is achieved that the liquid flowing in is divided with a concave profile corresponding to the concentration profile as explained by way of introduction . the individual details may be combined in different ways according to actual needs . in dry weather , which is approx . 94 % of the time seen over a year , the dry weather flow , which comprises sewage , infiltration , and possible drain water , flows through the system and directly to the purifying plant . in case of rain the flow increases and if the flow becomes bigger than the discharge , a damming is created in the distribution and control unit 2a and up through the delivery pipe 1 , which is by and by filled up until the over - fall edge 4a , the siphon system 17 or the under - overflow 11 ; 19 are reached . rain , which does not occasion overflow , is uninteresting in this connection , because the whole amount of water still passes through the purifying plant . in view of rain occasioning overflow , the under - overflow can be adjusted as to capacity and time of start so that it starts when the capacity of the outlet and the overflow in combination surpasses the capacity of the delivery pipe as concentrator in such a way that the reduced concentrator effect is compensated for by an increased underflow . if the control unit 2a is provided with a siphon system 17 , where the capacity of the outlet and the siphon system in combination corresponds to the capacity of the delivery pipe as concentrator , the under - overflow can be adjusted as to height in such a way that it starts simultaneously with the overflow , the reduced concentrator effect being thus compensated for . if the delivery pipe is comparatively small and with a comparatively heavy fall , so that the volume is limited within an acceptable damming height , the under - overflow can be set for start , before the overflow and the siphon system starts functioning . fig9 - 12 show an embodiment , in which the chamber 4 is rectangular instead of circular . an under - overflow is provided here as something in between the under - overflows in the embodiments according to fig1 - 2 and fig5 - 6 , respectively : a vertical pipe 26 next to the chamber 4 is divided into two ducts for forming an ascension pipe 10 &# 39 ; and an under - overflow pipe 11 &# 39 ;, respectively , the ascension pipe 10 &# 39 ; being connected with the chamber 4 through a short pipe 23 &# 39 ; and the under - overflow pipe 11 &# 39 ; discharging into the cutoff pipe 8 . fig1 shows the embodiment according to fig9 - 12 , in which a movable foam screen is provided at the inlet 1a in form of a containment boom 27 in order at all events to keep back light impurities . the inlet 1a has in this case a rectangular cross section to make the construction of the containment boom 27 as simple as possible . as will be seen from fig1 - 12 the containment boom comprises a substantially box - shaped body 28 , the top and the sides of which are provided with coherent fins 29 , 30 for sealing purposes . the fins 30 of the sides are guided in guideways 31 and are sealed against them by means of lip sealings 32 of oilresistent rubber or the like . at the upper side of the inlet a hold is provided in form of a downwards opening duct 33 for reception of the upper fin 29 . when the water level at the inlet 1a is low , the containment boom 27 floats on the water , as it is guided by the guideways 31 and it will retain the upper layers of water and consequently light impurities floating on the water . the lip sealings 32 will prevent the upper layers of water from flowing around the containment boom 27 . when the cross section of the inlet 1a is full of water , the containment boom will be lifted to the position shown in fig1 - 16 . the upper fin 29 is received in the duct 33 and an air pocket 34 is formed , said pocket acting as a plug and preventing the upper layers of water in the delivery pipe 1 from flowing over the containment boom 27 , when water is rising in the chamber 4 against the over - fall edge 4a . the air pocket 34 just need to have a sufficient height h to prevent air from being let out due to pressure drop in the flow on account of the containment boom 27 . | 4 |
referring to fig2 a switching fabric architecture 200 is shown having switching fabrics 201 - 208 operative in accordance with a preferred embodiment of the invention . fabric architecture 200 interconnects a substantial number of input - output interfaces 211 - 243 , such as input - output processors , across switching fabrics 201 - 208 . input - output interfaces 211 - 243 each drive an input port of each switching fabric 201 - 208 but receive cell traffic from an output port of only one of switching fabrics 201 - 208 . for example , input - output interface 211 drives input port ip -- 0 -- in on each switching fabric 201 - 208 but only receives traffic output on output port op -- 0 associated with switching fabric 201 . each of switching fabrics 201 - 208 preferably has a common traffic shaping , routing , storing and forwarding capability described in greater detail herein . although fig2 illustrates a switching fabric architecture 200 having eight switching fabrics 201 - 208 , the number of switching fabrics implemented in a switching fabric architecture may vary . it should also be appreciated that a switching fabric architecture may support inputs from an interface for which there is no corresponding output to the interface , or may support outputs to an interface for which there is no corresponding input from the interface . referring now to fig3 switching fabric 201 is shown in greater detail in a preferred embodiment of the invention . switching fabric 201 includes multiple input ports ip -- 0 -- in through ip -- 32 -- in . fixed - length cells are preferably received on input ports ip -- 0 -- in through ip -- 32 -- in from associated input - output interfaces 211 - 243 at a rate of five bits per clock and delivered at the same rate to each intended destination input - output interface , if any , associated with one of output ports op -- 0 through op -- 3 . each successive five - bit segment of a cell , beginning with bits zero through four , is referred to herein as a &# 34 ; quint &# 34 ;. in a preferred embodiment , atm cells are contemplated , with control fields appended to the cells causing cell length to exceed the conventional 53 - byte length . more particularly , each cell preferably has twenty - six appended control bits giving each cell a total length of four hundred fifty bits . as shown in fig3 input ports ip -- 0 -- in through ip -- 32 -- in are each associated with one of input controllers 300 - 332 . controllers 300 - 332 are operative to filter cells that are not intended for any output port associated with switching fabric 201 and operative to effectuate , in conjunction with other control logic described herein , a time slot cell release operation . input controllers 300 - 332 are each associated with one of a smaller number of serial - to - parallel converters 333 - 336 operative to efficiently convert same - cell quints received from input controllers 300 - 332 into larger , parallelized words for writing into output queue 360 . in a preferred embodiment , four serial - to - parallel converters 333 - 336 are shared among thirty - three input controllers 300 - 332 . thus , for example , serial - to - parallel converter 333 may receive on a single clock a quint from nine input ports ip -- 0 through ip -- 8 via input controllers 300 - 308 . output queue 360 is configured to receive on a single clock cycle a parallelized word from each of serial - to - parallel converters 333 - 336 and to write a plurality of such parallelized words into memory on a single clock cycle in a manner that will enable cells to be dequeued from output queue 360 in a series of successive same - cell parallelized words . switching fabric 201 further includes output multiplexors 371 - 374 for retrieving the successive same - cell words from output queue 360 and serializing the words for forwarding at a rate of one quint per clock on output ports op -- 0 through op -- 3 , respectively . switching fabric 201 also includes queue controller 340 , which directs the orderly writing of cells from converters 333 - 336 to output queue 360 with the assistance of instruction queue 350 , and also directs the orderly dequeueing of cells from output queue 360 , in a manner hereinafter described in greater detail . turning now to fig4 input controllers 300 - 332 are shown in greater detail . input controllers 300 - 332 will be described by reference to input controller 300 , which is representative of controllers 300 - 332 . input controller 300 preferably has dedicated components , including cell destination address filter 400 , input queue 410 and read address counter 420 , and preferably shares other components , including write address counter 430 and release cell logic 440 , with other input controllers 301 - 332 . destination address filter 400 preferably includes four destination address registers , each of which is programmed with an address associated with a different one of output ports op -- 0 through op -- 3 . destination address filter 400 is operative to compare for a match the destination addresses encoded in incoming cells with the registered addresses . destination address filter 400 filters cells for which no match is found . destination address filter 400 captures cells for which a match is found and claims a line within match line set 401 for each one of output ports op -- 0 through op -- 3 which is an intended destination of the cell . although illustrated as a single line in fig4 match line set 401 may be advantageously configured as four separate lines associated with different ones of output ports op -- 0 through op -- 3 . cells captured by destination address filter 400 are written into input queue 410 in a series of quints . in a preferred embodiment , a time slot cell release operation is implemented in which each of the thirty - three input controllers 300 - 332 are assigned a distinct &# 34 ; start cell release &# 34 ; time slot within a repetitive 45 - clock cycle timing cycle . the timing cycle dictates a minimum size for input queue 410 in order to effectuate the time slot cell release operation without risking input queue overflow , since queue 410 must have sufficient capacity to store all quints received until the time slot assigned to its associated input controller 300 arrives . thus , in a preferred embodiment , input queue 410 is a physical memory element having a forty - five quint capacity . the queue address into which quints are written is determined by write address counter 430 , which has a free - running 45 - cycle clock shared by input controllers 300 - 332 . cells are read out of input queue 410 by read address counter 420 in accordance with the time slot cell release operation . read address counter 420 has a 45 - cycle clock which causes quints to be read first - in , first - out ( fifo ) from input queue 410 . more particularly , when the &# 34 ; start cell release &# 34 ; time slot assigned to input controller 300 arrives , release cell logic 440 validates time alignment strobe 441 instructing read address counter 420 to begin a fifo read of the contents of input queue 410 at a rate of one quint per clock . read address counter 420 continues reading for a total of 90 - clock cycles to read the entire 450 - bit cell from input queue 410 . the dequeued cell is transmitted in a series of quints to serial - to - parallel converter 333 on dedicated output pin ip -- 0 -- out . input controller 300 also has gate element 450 . contemporaneous with the instruction to begin the fifo read of input queue 410 time alignment strobe 441 instructs gate 450 to release , on cell start line set 451 , any valid signals gated - off on lines of match line set 401 . accordingly , one or more lines in cell start line set 451 will become valid on the same clock cycle that the first quint of a cell is transmitted from controller 300 to serial - to - parallel converter 333 . gate element 450 may be configured advantageously as four separate &# 34 ; and &# 34 ; gates each interconnecting one of four lines in match line set 401 with one of four lines in cell start line set 451 , with each match line and cell start line pair being associated with a particular one of output ports op -- 0 through op -- 3 . the time slot cell release operation just described , offset to account for different time slot assignments , occurs contemporaneously on each of input controllers 300 - 332 so that a continuous stream of time - aligned quints are transmitted from input controllers 300 - 332 to serial - to - parallel converters 333 - 336 . thus , as the thirty - third quint of a cell is being released by input controller 300 ( assigned clk -- 0 ) on ip -- 0 -- out , the first quint of a cell may be released by input controller 332 ( assigned clk -- 32 ) on ip -- 32 -- out with one or more cell start lines in set 483 also becoming valid . it will be appreciated , however , that due to non - constant traffic patterns and the destination address filtering operation performed by input controllers 300 - 332 , the assigned time slot for any particular controller may pass without the release of a new cell and , correspondingly , without any line within a cell start line set becoming valid . referring now to fig5 serial - to - parallel converter 333 , which is considered representative of converters 333 - 336 , is shown in greater detail . converter 333 includes a rotator 500 followed by nine linearly - incrementing shift registers 510 - 518 ( i . e ., nine shift registers having length one through nine , respectively ). provided that all associated output pins ip -- 0 -- out through ip -- 8 -- out are transmitting quints on the particular clock cycle , converter 333 receives one quint from each one of output pins ip -- 0 -- out through ip -- 8 -- out and applies the quints to different ones of registers 510 - 518 . rotator 500 rotates on each clock such that the quints arriving from a particular one of pins ip -- 0 -- out through ip -- 8 -- out are applied successively to incrementally shorter ones of registers 510 - 518 . where the previous quint from a particular one of pins ip -- 0 -- out through ip -- 8 -- out was applied to register 510 ( having length one ), the next quint is applied to ( the longest ) register 518 . the contents of each of shift registers 510 - 518 shift forward one length at each clock cycle . thus , quints received from a particular one of pins ip -- 0 -- out through ip -- 8 -- out remain linearly - aligned as the quints traverse shift registers 510 - 518 , and are accumulated until nine associated quints arrive concurrently at the front of shift registers 510 - 518 . on the subsequent clock cycle , converter 333 outputs a 45 - bit parallel word assembled from the nine associated quints . from the foregoing description of converter 333 it should be apparent that , in a maximum throughput situation , converter 333 produces on each clock cycle a 45 - bit parallel word from one of input controllers 300 - 308 , and produces a 45 - bit parallel word once every nine clocks from the same one of input controllers 300 - 308 . thus , for instance , on clock cycles n and n + 9 , converter 333 may produce a 45 - bit parallel word from input controller 300 ; on clock cycles n + 1 and n + 10 , converter 333 may produce a 45 - bit parallel word from input controller 301 ; and so on . it should also be apparent that , in a maximum throughput situation , converters 333 - 336 produce on each clock cycle a total of four 45 - bit parallelized words comprising inputs from four different ones of input controllers 300 - 332 , and produce a 45 - bit parallel word once every nine clocks from the same set of four input controllers 300 - 332 . thus , for instance , on clock cycle n , converters 333 - 336 may produce 45 - bit parallel words from input controllers 300 , 309 , 318 , 327 , respectively ; on clock cycle n + 1 , converters 333 - 336 may produce 45 - bit parallel words from input controllers 301 , 310 , 319 , 328 , respectively ; on clock cycle n + 9 , converters 333 - 336 may again produce 45 - bit parallel words from input controllers 300 , 309 , 318 , 327 , respectively ; and so on . of course , in a preferred embodiment , twelve time slots within the 45 - clock cycle are not assigned to any of input controllers 300 - 332 and , in any given timing cycle , assigned slots may not be utilized . therefore , 45 - bit parallel words will not be produced by each of converters 333 - 336 on each clock cycle . the time - aligned serial - to - parallel conversion just described has two important effects . first , it ensures that each 45 - bit parallel word produced by serial - to - parallel converters 333 - 336 contains only same - cell quints . second , it ensures that the up to four 45 - bit parallel words produced on any particular clock cycle are from different locations along the length of different cells . for instance , on the same clock cycle that the first 45 - bit word of a cell ( bits 0 through 44 ) received from input controller 309 ( assigned clk -- 9 ) is produced by converter 334 , a second or seventh 45 - bit word of a cell ( bits 45 through 89 ) received from input controller 300 ( assigned clk -- 0 ), if any , will be produced by converter 333 . as a consequence , the four words produced by converters 333 - 336 on any given clock will not have to compete for resources when being written into output queue 360 , as will become more evident from the description below . referring now to fig6 output queue 360 is shown in greater detail . output queue 360 includes an array of four - to - one multiplexors 601 - 610 each followed by one of physical memories 611 - 620 . physical memories 611 - 620 each have the capacity to store numerous 45 - bit words delivered from their associated one of multiplexors 601 - 610 . in a preferred embodiment , physical memories 611 - 620 are each able to store two - hundred fifty - six 45 - bit words . physical memories 611 - 620 are &# 34 ; stacked &# 34 ; such that they combine to form four distinct logical cell queues 621 - 624 , with each logical cell queue having the capacity to store numerous 450 - bit cells composed of ten 45 - bit words each . in a preferred embodiment , each of the four logical cell queues 621 - 624 can store sixty - four ( i . e ., 256 divided by four ) cells . logical cell queues 621 - 624 are each associated generally with a particular one of output ports op -- 0 through op -- 3 . thus , 45 - bit words associated with cells destined for output port op -- 0 are generally written to logical cell queue 621 ; 45 - bit words associated with cells destined for output port op -- 1 are generally written to cell queue 622 ; and so on . this general rule of one - to - one correspondence between logical cell queues 621 - 624 and output ports op -- 0 through op -- 3 is modified in the case of queueing of multicast cells ( i . e ., cells intended for more than one of output ports op -- 0 through op -- 3 ), as is described in more detail herein . physical memories 611 - 620 are preferably dual - ported so that queuing and dequeuing of different cells can proceed simultaneously , in a manner hereinafter described . the queueing of unicast cells ( i . e ., cells intended for only one of output ports op -- 0 through op -- 3 ) into output queue 360 is controlled by queue controller 340 in conjunction with instruction queue 350 . referring to fig7 queue controller 340 is shown in greater detail . the queueing function of queue controller 340 is implemented using variable selector 700 , instruction assembly 710 and address pointers 721 - 724 . variable selector 700 generates commands used to direct cells to the correct one of logical cell queues 621 - 624 . variable selector 700 has as inputs cell start match line sets 451 - 483 and generates commands associating each valid line in cell start line sets 451 - 483 with a particular one of logical cell queues 621 - 624 and a particular one of serial - to - parallel converters 333 - 336 . this is possible because of the known association of each line with a particular input port and output port . in a preferred embodiment , a mux steering command and a cell queue command is generated for each cell . each mux steering command is preferably a two - bit command indicating which one of convertors 333 - 336 mulxiplexors 601 - 610 must select 45 - bit words from to effectuate the writing of the cell into output queue 360 . each cell queue command is preferably a two - bit command indicating into which one of the logical cell queues 621 - 624 the selected 45 - bit words should be written . address pointers 721 - 724 hold values which are used to direct cells to the correct address within the correct one of logical cell queues 621 - 624 . each of address pointers 721 - 724 is associated with one of logical cell queues 621 - 624 and holds a value corresponding with the next one of the addresses to be written in its associated queue . thus , in a preferred embodiment , pointers 721 - 724 each hold six bits which together represent one of sixty - four possible addresses . address pointers 721 - 724 also have associated therewith queue level logic ( not shown ) which tracks dynamically the number of yet to be dequeued cells in each of logical cell queues 621 - 624 . address pointer values are revised upward or downward incrementally by queue level logic as cells are queued and dequeued . queue level logic stores in registers or other suitable memory elements known to the art information regarding the current number of cells in each of logical cell queues 621 - 624 . instruction assembly 710 assembles information provided by variable selector 700 and address pointers 721 - 724 into a useful write instruction . instruction assembly 710 has lines on variable selector and address pointers 721 - 724 . in a preferred embodiment , each instruction is an 11 - bit instruction including a one - bit write enable command , a two - bit mux steering command and a two - bit cell queue command from variable selector 700 , and a six - bit address from the one of address pointers 721 - 724 associated with the indicated logical cell queue . the assembled instructions are transmitted to instruction queue 350 on instruction line 711 . the variable selector 700 , instruction assembly 710 and address pointers 721 - 724 may be implemented in custom circuitry using elements and techniques well known to the art . it will be appreciated that because of the time slot cell release operation described previously , lines from only one of cell start match line sets 451 - 483 will be valid on any given clock cycle , advantageously avoiding problems associated with competition for the queue control resources just described . referring to fig8 instruction queue 350 is shown in more detail . instructions received on instruction line 711 are &# 34 ; tapped - off &# 34 ; registers within instruction queue 350 at regular intervals to cause successive multiplexors 601 - 610 to write into successive physical memories 611 - 620 successive 45 - bit words which together comprise a complete cell . instruction queue 350 may be configured as a series of multi - stage shift registers equal in number to the total number of parallelized words which are produced by switching fabric 201 for each cell . except for the first one of registers , the number of stages for each of registers will generally be equal in length to the number of clock cycles required by switching fabric 201 to produce each parallelized word . in a preferred embodiment , switching fabric 201 produces a total of ten 45 - bit words for each cell , and produces one word every nine clock cycles . thus , instruction queue 350 is operatively configured as a series of ten shift registers 801 - 810 , with registers 802 - 810 having nine - stages each and first register 801 having a lesser number of stages to account for the clock cycles spent after a cell is released generating an instruction from the asserted cell start line and transmitting the instruction to instruction queue 350 . instructions arriving on instruction line 711 are placed at the tail of the first register 801 and progress through register 801 as the first 45 - bit parallel word is being prepared by one of converters 333 - 336 from the first nine quints of the cell . on the same clock cycle that the first 45 - bit parallel word is released , instruction 811 is &# 34 ; tapped - off &# 34 ; the front of first register 701 to control first multiplexor 601 . more particularly , the instruction instructs multiplexor 601 to select a particular one 45 - bit word from among the up to four 45 - bit words released by serial - to - parallel converters 333 - 336 on the particular clock cycle , and to write the selected word to a particular location in physical memory 611 . the instruction is queued to the tail of second shift register 702 and nine clocks later controls multiplexor 602 in similar fashion . this process is repeated until instruction 720 has controlled each one of multiplexors 601 - 610 in sequence and caused each of the ten 45 - bit words comprising a complete cell to be written to the desired locations in physical memories 611 - 620 . while the operation of instruction queue 350 has been described in relation to a single cell , multiple instructions will generally traverse instruction queue 350 simultaneously to control successive multiplexors 601 - 610 . thus , instructions may be &# 34 ; tapped - off &# 34 ; from different ones of registers 801 - 810 on the same clock cycle and result in all of the up to four words produced by converters 333 - 336 being written into desired locations within logical cell queues 621 - 624 . returning to fig7 dequeueing of unicast cells is accomplished primarily by pointer assembly 730 and pointer queues 741 - 744 using information supplied by variable selector 700 and address pointers 721 - 724 . pointer queues 741 - 744 are each associated with a particular one of logical cell queues 621 - 624 and each have the capacity to store a number of read pointers equal in number to the number of addresses in its associated logical cell queue . pointer assembly 730 receives cell queue commands from variable selector 700 and also has lines on address pointers 721 - 724 . assembly 730 assembles read pointers from the cell queue commands and the addresses supplied by variable selector 700 and address pointers 721 - 724 , respectively . in a preferred embodiment , each assembled read pointer is an eight - bit pointer including a two - bit cell queue command and a six - bit address from the one of address pointers 721 - 724 associated with the indicated logical cell queue . the assembled read pointers are generally loaded at the tail of the one of pointer queues 741 - 744 associated with the indicated logical cell queue . dequeueing is accomplished reading cells fifo from logical cell queues 621 - 624 using pointers from pointer queues 741 - 744 . output multiplexors 371 - 374 are associated with pointer queues 741 - 744 , respectively . queue controller 340 instructs output multiplexors 371 - 374 whenever there is a cell to be dequeued from output queue 360 and where to locate the cell . cells are read from output queue 360 in successive 45 - bit words ( i . e ., reading same - cell 45 - bit words from each of the ten physical memories 611 - 620 until the complete cell is read - out ). memory reads are staggered so that two or more multiplexors 371 - 374 do not attempt to read from the same one of physical memories 611 - 620 on the same clock cycle . output multiplexors 371 - 374 serialize each 45 - bit word into a series of nine quints to be output successively on the associated one of output ports op -- 0 through op -- 3 . for example , a dequeued cell destined for output port op - 0 would be received in a series of successive 45 - bit words on output multiplexor 371 , which would perform a serializing operation to convert each of the ten 45 - bit parallel words into a series of nine quints output on op -- 0 . multiplexors 371 - 374 inform queue controller 340 when cell reads have been completed so that the queue level can be decremented . pointer assembly 730 and pointer queues 741 - 744 may be implemented in custom circuitry using elements and techniques well known to the art . in a preferred embodiment , queueing and dequeueing of multicast cells is conducted with the additional assistance of computational logic implemented in variable selector 700 . where more than one cell start line within a set is valid , computation logic is invoked to identify which of the logical cell queues 621 - 624 associated with a valid line is the fullest . variable selector 700 transmits to instruction assembly 710 a cell queue command indicating as the queue to be written only the logical cell queue identified by the computational logic . queueing to the identified logical cell queue proceeds otherwise as described previously . however , variable selector 700 also transmits to pointer assembly 730 information sufficient to enable pointer assembly 730 to identify all destination output ports for the multicast cell . pointer assembly 730 assembles a number of read pointers equal to the total number of identified destination output ports and loads the assembled pointers at the tail of each of the pointer queues 741 - 744 associated with an identified destination output port . dequeueing proceeds otherwise as described previously . it will be appreciated that by queuing multicast cells to the fullest queue only and replicating pointer commands , multicast cells can be advantageously read from output queue 360 to each intended destination output port without the need to replicate the entire 450 - bit cell , and without risking overwriting the once - written cell before it is dequeued to all destination output ports . in a preferred embodiment , the computational logic block which determines the fullest queue has access to information regarding the current number of cells in each of logical cell queues 621 - 624 via queue level signal 731 , which may be advantageously configured as four separate lines on queue level registers associated with address pointers 721 - 724 . the computational logic block utilizes that information in a &# 34 ; king of the hill &# 34 ; algorithm that performs one or more comparative operations that each involve two logical cell queues associated with destination output ports , until it is conclusively determined which queue associated with a destination output port is the fullest . the fuller of the queues as determined by each comparative operation is considered the &# 34 ; victor &# 34 ; and is compared with other &# 34 ; victors &# 34 ; until a &# 34 ; king &# 34 ; is determined . by way of example , where a cell is destined to each of output ports op -- 0 through op -- 3 , logical cell queues 621 and 622 may be compared to determine which is fuller , and logical cell queues 623 and 624 may be compared to determine which is fuller . the two fuller queues as determined from these comparisons are &# 34 ; victors &# 34 ; and are compared with one another to determine which of the &# 34 ; victors &# 34 ; is &# 34 ; king &# 34 ; ( i . e ., the fullest queue ). turning now to fig9 a timing diagram is presented to illustrate the manner in which two cells arriving concurrently on input ports ip -- 0 -- in and ip -- 4 -- in are queued in switching fabric 201 . clock signal clk -- 80 is a master clock that controls all timing within switching fabric 201 . release cell counter signal release -- cell -- counter is a free - running 45 - cycle clock indicating when release cell logic 440 should initiate a cell start . a further nine - clock counter signal rotate -- index provides an index relied upon by rotator 500 to apply quints to the appropriate ones of linearly - incrementing shift registers 510 - 518 . signals ip -- 0 -- in and ip -- 4 -- in represent which quint of a cell , from zero to eighty - nine , is applied to input ports ip -- 0 -- in and ip -- 4 -- in , respectively . signals ip -- 0 -- out and ip -- 4 -- out represent which quint of a cell , from zero to eighty - nine , is applied to output pins ip -- 0 -- out and ip -- 4 -- out , respectively . signal shift 13 reg -- out identifies the input port ( ip -- 0 -- in through ip -- 0 -- 32 ) for which a 45 - bit word has been produced by converter 333 . signal queue -- write -- enable -- 0 is a pulse signal which , when pulsed high , indicates that the first 45 - bit word of a cell are being written to output queue 360 ( i . e ., into physical memory 611 ). signals queue -- write -- enable -- 6 and queue -- write -- enable -- 7 are similar pulse signals indicating when the seventh and eighth 45 - bit words , respectively , of a cell are being written to output queue 360 . in the example illustrated in fig9 when cells arrive concurrently at input ports ip -- 0 -- in and ip -- 4 -- in , release cell counter signal release -- cell -- counter displays a reading of forty . the cell on input port ip -- 0 -- in is therefore delayed within input controller 300 until the release cell counter has counted through forty - four and reverted back to zero , which is the time slot assigned to input port ip -- 0 -- in . on clock zero , the cell begins to be read from input controller 300 onto pin ip -- 0 -- out , as indicated by the signal ip -- 0 -- out . the cell at input port ip -- 4 , meanwhile , is delayed for four additional clocks until the release cell counter signal displays a reading of four , which is the time slot assigned to input port ip -- 4 -- in . nine clocks are required to accumulate nine quints in a serial - to - parallel converter . therefore , nine clocks after the first quint from the cell on input port ip -- 0 -- in is applied to converter 333 , signal shift -- reg -- out indicates the production of a first 45 - bit parallelized word from the cell on input port ip -- 0 -- in . on the next clock , the first 45 - bit word is written to physical memory 611 , as indicated by queue -- write -- enable -- 0 being pulsed high . four clocks thereafter , a similar write operation is performed on a first 45 - bit word from the cell on input port ip -- 4 -- in , as indicated by queue -- write -- enable -- 0 again being pulsed high . the operation of the present switching fabric proceeds in this manner , as shown at the bottom of fig9 until the ten 45 - bit words comprising a complete cell have been written to each of physical memories 611 - 620 for each of the cells on each of input ports ip -- 0 -- in and ip -- 4 -- in . it will be appreciated by those of ordinary skill in the art that the invention can be embodied in other specific forms without departing from the spirit or essential character hereof . the present description is therefore considered in all respects to be illustrative and not restrictive . the scope of the invention is indicated by the appended claims , and all changes that come within the meaning and range of equivalents thereof are intended to be embraced therein . | 7 |
fig5 shows a block diagram of an automatic focusing system enploying a focus condition detecting device of the present invention . though this block diagram does not include an optical system for focus condition detection , the optical system as shown in fig1 is employed . however , a single line image sensor as shown in fig6 is employed in this automatic focusing system in place of the first and second image sensors 12 and 14 of fig1 . in other words the first and second image sensors 12 and 14 are formed with a first and second portions l and r of the single line image sensor 15 . the first portion l being comprised of forty picture elements from l 1 to l 40 is defined as a standard portion . the second portion r being comprised of forty eight picture elements from r 1 to r 48 is defined as a reference portion . a center position x is a position at which the optical axis of the objective lens crosses . in the standard portion l , there are defined first to third blocks i to iii being overlapped with each other . these first to third blocks i to iii comprise picture elements from l 1 to l 20 , from l 11 to l 30 and from l 21 to l 40 , respectively . there is arranged a monitoring photoelectric element ( not shown ) just above the standard portion l . as shown in fig6 a distance between the left most picture element l 1 of the standard portion l and the picture element r 1 of the reference portion r being nearest to the crossing position x of the optical axis is defined as &# 34 ; l 1 &# 34 ;. further , this optical system employed is designed so that an image having a light intensity distribution equal to that of an image formed on the second block ii of the standard portion l might be formed in a range defined between r 5 and r 44 of the reference portion r when the objective lens of the camera is in - focus with respect to an object , namely an object image is focused on the predetermined focal plane thereby . accordingly , the range defined from the picture element r 5 to the picture element r 44 is defined as &# 34 ; in - focus block &# 34 ; f . and , a distance from the center picture element l 21 of the standard portion l to the center picture element r 24 of the in - focus block f is defined as &# 34 ; image distance l 2 of in - focus state &# 34 ;. returning to fig5 a control circuit ( 31 ) constituted by a micro - computer starts a focus condition detecting operation when a shutter release button ( not shown ) is pushed down by a half stroke thereof while a switch for the focus condition detecting mode is turned on . at first , an integration clear pulse signal icgs is outputted from the control circuit 31 to a ccd image sensor provided in a photo - electric transducer circuit ( 20 ) and having the arrangement as shown in fig6 . due to this signal , all of picture elements of the ccd image sensor are reset to initial states and an output agcos of a brightness monitoring circuit ( not shown ) housed in the ccd image sensor to receive an output of the monitoring photo - electric element referred to above is set up to the level of the voltage of the power source . at the same time , the control circuit ( 31 ) outputs a permission signal shen of &# 34 ; high &# 34 ; level for permitting a shift pulse generator 34 to generate a shift pulse . as soon as the integration clear signal icgs disappears , integration of photocurrent is started in every element of the ccd image sensor . at the same time , while the output agcos of the brightness monitoring circuit in the photo - electric transducer circuit begins to drop with a velocity corresponding to the intensity of light incident on the monitoring photo - electric element , a reference signal dos generated by a reference signal generating circuit ( not shown ) provided in the photo - electric transducer circuit ( 20 ) is kept at a constant reference level . a gain control circuit ( 32 ) compares the output agcos with the reference signal dos and controls a gain of a differential amplifier ( 26 ) of a gain variable type according to an amount of drop of the output agcos relative to the reference level dos within a predetermined time interval ( for instance , it is set to 100 m sec upon the focus condition detecting operation ). the gain control circuit ( 32 ) output signal tint of &# 34 ; high &# 34 ; level as soon as it detects the agcos signal has dropped to a level equal to or lower than a predetermined level against the reference level dos within the predetermined time interval starting from the disappearance of the integration clear signal icgs . the signal tint is input to a shift pulse generating circuit ( 34 ) via an and gate ( an ) and an or gate ( or ) and the shift pulse generating circuit ( 34 ) outputs a shift pulse sh in response thereto . when the shift pulse sh is input to the photo - electric transducer ( 20 ), the integration operation of photo - current by each light sensing element of the ccd image sensor is stopped and , then , charges accumulated in each light sensing element and corresponding to integrated values of the photo - current are transmitted parallel to cells in a shift register provided in the ccd image sensor so as to correspond one to one to the light sensing elements of the ccd image sensor . further , a transmission pulse generating circuit ( 36 ) outputs two sensor driving pulses φ1 and φ2 having phases different from each other by 180 ° in a manner synchronized with clock pulses cl from the control circuit ( 31 ). the ccd image sensor in the photo - electric transducer circuit ( 20 ) outputs signals os forming image signals respectively by discharging a charge of each cell of the ccd shift register serially in the order of alignment of elements . this os signal has a higher voltage as an intensity of incident light to a corresponding element is weaker . a subtraction circuit ( 22 ) subtracts os signal from dos signal and outputs the difference ( dos - os ) as a picture element signal . on the contrary to the above , if the predetermined time interval has elapsed without receipt of a tint signal after the disappearance of icgs signal , the control circuit ( 31 ) outputs an instruction signal shm for generating a shift pulse of &# 34 ; high &# 34 ; level . therefore , in this case , the shift pulse generating circuit ( 34 ) generates a shift pulse sh in response to this instruction signal shm . further , the control circuit ( 31 ) outputs a sample - hold signal s / h when element signals from seventh to tenth element are outputted . this area of the ccd image sensor corresponding to these elements is covered with an aluminum mask , so that these elements integrate only dark currents inherent to the ccd image sensor . namely , these picture elements are shutted from the incident light . a peak hold circuit ( 24 ), when the sample hold signal s / h is applied thereto , holds a difference between the reference signal dos and one of output signals from the seventh to tenth elements covered with the aluminum mask . thereafter , the difference vp and element signal dos &# 39 ; are input to the gain variable amplifier ( 26 ). that gain variable amplifier ( 26 ) amplifies a difference ( vp - dos &# 39 ;) between vp and dos &# 39 ; with a gain controlled by the gain control circuit ( 32 ). the amplified signal dos &# 34 ; is converted from analogue data to digital data by an a / d converter ( 28 ) and digital data are applied to the control circuit ( 31 ) as picture element signal data . though the a / d conversion by the a / d converter is done in a unit of 8 bits , data are transmitted to the control circuit in each lump of top four bits and bottom four bits . the control circuit ( 31 ) stores these picture element signal data in an internal memory thereof and , when all of element signal data have been stored therein , processes those data according to programs set therein to calculate a defocus amount and a direction of defocus , to display these data on a display ( 38 ) and to drive a lens driving device ( 40 ) according to the defocus amount and the direction thereof in order for auto - focusing adjustment of the objective lens . data with respect to the focus condition of the objective lens obtained by the calculation operation of the control circuit 31 are a defocus amount and defocus direction . based on these data , a driving amount and direction of the objective lens driven by the lens driving device 40 are determined . while the lens driving device 40 drives the objective lens according to the driving amount and direction , it outputs signals corresponding to driving amounts of the objective lens . the control circuit 31 detects an actual driving amount from the signals and , when it becomes equal to the determined driving amount , outputs a signal for stopping the lens driving to the lens driving device . a switch afsw is provided to input a start signal for starting the detection of defocus amount and the automatic focus adjustment due to the defocus detection . fig7 shows a flow - chart of a main routine program to be executed by the control circuit . the program is started when electric power is supplied from the battery loaded in the camera to the control circuit by switching the power switch ( not shown ) on . the control circuit waits until the af switch ( afsw ) is switched on at step # 1 and , when the af switch has been switched on , indicates to start an integration operation by the ccd image sensor at step # 2 . when the integration operation has been completed in response to the shift pulse sh , output signals from picture elements of the image sensor are successively outputted as image signals ( os ) at data dump step # 3 . each image signal is converted to a picture element signal by the substracting circuit 22 and , then , converted to digital data by the a / d converter 28 after having been amplified with a gain corresponding to the brightness of the object . at step # 4 , differential data are calculated from picture element signals in order to remove low - frequency signal components contained in picture element signals . then , the correlation calculation between the standard l and reference portion r are made with use of the differential data at step # 5 and , at step # 6 , a range of the reference portion r showing the highest correlation is found out . further , an interpolation calculation is carried out in order to obtain a shift amount of image distance having a higher precision at step # 7 and , then , the shift amount p of image distance is calculated at step # 8 . at step # 9 , it is decided whether the shift amount p obtained at step # 9 has a reasonable credibility or not , i . e ., whether or not a reasonable focus condition detection is possible or not . if it is decided that a reasonable focus condition detection is impossible at step # 9 , it is decided whether a low - contrast scanning has been completed or not . this low - contrast scanning is provided as a countermeasure against such a case that the defocus amount is too large to perform the focus condition detection . in this operation , the objective lens is driven in one axial direction while repeating focus condition detections and , when the defocus amount detected falls within a range wherein the focus condition detection can be done exactly , the objective lens is driven to its in - focus position based on the shift amount of image distance having been detected at that time . if the low - contrast scanning has completed already at step # 10 , the display device is operated to display &# 34 ; low - contrast &# 34 ; at step # 12 and the program returns to step # 2 . if the low - contrast scanning has not completed yet , the low - contrast scanning is started at step # 11 , and , then , the program returns to step # 2 . if it is decided that the focus condition detection is possible at step # 9 , the shift amount of image distance is transformed into the defocus amount df at step # 13 and , further , the defocus amount is transformed to the lens driving amount df at step # 14 . at step # 15 , it is decided whether the defocus amount or driving amount having been sought falls within a predetermined in - focus range or not . if it falls within the in - focus range , the display device is operated to display &# 34 ; in - focus &# 34 ; at step # 17 . if it is not in - focus , the objective lens is driven according to the driving amount sought at step # 14 and , then , the program returns to step # 2 . since these steps mentioned above are disclosed more precisely in a copending u . s . patent application ser . no . 570 , 012 filed on jan . 10 , 1984 and assigned to the same assignee as the present application , only portions related to the present invention will be explained in detail hereinafter . fig8 ( a ) and 8 ( b ) show a flow - chart of the focus condition detection program according to the preferred embodiment of the present invention . according to the preferred embodiment , the standard portion is devided to have three blocks , a shift amount of image distance is calculated with respect to every block , a shift amount of image distance corresponding to the rearmost focus condition is chosen as a correct value among three shift amounts obtained and the objective lens is driven according to the shift amount chosen . as mentioned already with respect to fig6 three blocks i , ii and iii are defined in the standard portion l of the ccd image sensor . detection ranges wherein shift amounts can be detected with use of these three blocks are set so as to overlap with each other as is clearly shown in fig9 and a following table . table__________________________________________________________________________ area of pic left most elem . dect . area for element diff . data for corr . calc . image dist . error ( max ) __________________________________________________________________________stand . first . sup . l . sub . 1 ˜ l . sub . 20 . sup . ls . sub . 1 ˜ ls . sub . 16 γ . sub . 5 ( γs . sub . 5 ) - 4 ˜ 14 pitchport . ( l ) block ( i ) second l . sub . 11 ˜ l . sub . 30 ls . sub . 11 ˜ ls . sub . 26 γ . sub . 15 ( γs . sub . 15 ) - 8 ˜ 8 pitchblock ( ii ) third l . sub . 21 ˜ l . sub . 40 ls . sub . 21 ˜ ls . sub . 36 γ . sub . 25 ( γs . sub . 25 ) - 14 ˜ 4 pitchblock ( iii ) ref . all γ . sub . 1 ˜ γ . sub . 48 γs . sub . 1 ˜ γs . sub . 44port . ( r ) __________________________________________________________________________ now returning back to fig8 ( a ), when the af switch is turned on , the program proceeds to step # 18 after passing steps # 1 to # 3 . at step # 18 , differential data l sk are calculated with use of every four picture element signals ( l sk - l k - l k + 4 ) obtained by picture elements of the standard portion . also , differential data r sk (= r k - r k + 4 ) are calculated with respect to the reference portion r at step # 19 . these pre - processing of picture element signals are done in order to remove low - frequency error factors accompanied by spatial frequency components of the light intensity distributions on the standard and reference portions ( l and r ) which are caused by errors from the specification of the optical system for detecting the focus condition . since this pre - processing is disclosed in detail in the above mentioned copending u . s . patent application ser . no . 570 , 012 , further explanation thereabout is omitted . next , at step # 20 , the correlation calculation is made with use of the differential data belonging to the second block ii of the standard portion ( l ) and the differential data belonging to the range of the reference portion ( r ) defined from (- 8 ) th to (+ 8 ) th pitch when seen from the center in - focus position , respectively ( fig9 ). in the equation for the correlation calculation , 1 represents a shift amount by which the differential data belonging to the second block ii of the standard portion ( l ) are shifted relative to the differential data belonging to the above range of the reference portion ( r ). at step # 21 , there is sought with use of correlation functions obtained at step # 20 position (, i . e ., a shift amount ) lm 2 on the reference portion ( r ), which gives the highest correlation . it is decided whether results obtained at steps # 20 and # 21 have a high credibility or not , namely whether the focus condition detection is possible or not . if decided possible , an interpolation calculation is made to seek for a position mx 2 more accurate than the position lm 2 at step # 23 and , then the deviation amount p 2 of image distance is calculated from the position xm 2 . at step # 25 , before executing a correlation calculation with use of the first block i , it is decided whether the position lm 2 which gives the highest correlation with respect to the second block ii locates within the range which permits the correlation calculation with use of the first block i . the position of l = 11 is the front most focus side end position which permits the correlation calculation with use of the first block i . if lm 2 & lt ; 11 , the program proceeds to step # 28 in order to execute correlation calculation with use of the full detection range set for the first block i and defined from (- 4 ) th to (+ 14 ) th pitch since this fact suggests that the position lm 2 obtained by the correlation calculation of step # 20 locates on the front focus side with respect to the detection range set for the first block i . and , at step # 29 , a position lm 1 which gives the highest correlation with respect to the first block i is found . if it is decided at step # 22 that the focus condition detection is impossible , the program also proceeds to steps # 28 and # 29 . if it is decided at step # 25 that lm 2 is equal to or larger than eleven ( lm 2 ≧ 11 ), the program proceeds to steps # 26 and # 27 . in this case , the correlation calculation is made with use of a portion of the detection range set for the first block i and defined from ( lm 2 - 10 ) th pitch to 18th pitch in order to shorten a calculation time needed for the correlation calculation with use of the first block i by omitting correlation calculation which might give a position locating on the front focus side with respect to the position indicated by the lm 2 having been obtained at step # 21 . and , at step # 27 , a position lm 1 which gives the highest correlation is calculated therefrom . at step # 30 , it is decided whether the focus condition detection is possible with respect to the first block i or not . if decided possible , the program proceeds to steps # 31 and # 32 in order to calculate a deiation amount p 1 of image distance with a high precision by executing an interpolation calculation . then , the program proceeds to step # 38 of fig8 ( b ) in order to execute the correlation calculation with use of the third block iii . since the position lm 1 obtained by the correlation calculation with use of the first block i locates within the detection range set for the third block iii or rear focus side thereof , a range which is on the front focus side than the position lm 1 having been found out by the correlation calculation with use of the first block i is omitted from the correlation calculation with use of the third block iii in order to shorten a calculation time needed therefor . although not shown in fig8 ( a ) and 8 ( b ), if lm 1 ≧ 8 , the program jumps to step # 44 by skipping steps # 38 and # 39 since in this case there is no range which permits the correlation calculation with use of the third block iii . if it is decided at step # 30 of fig8 ( a ) that the correlation calculation with use of the first block i is impossible , the program proceeds to step # 33 of fig8 ( b ) to decide whether the correlation calculation with use of the second block ii was possible or not . if decided possible , the program proceeds to steps # 34 and # 35 in order to execute the correlation calculation with use of the third block iii . also , in this case , a range of the third block iii in which is on the front focus side of the position lm 2 having been obtained by the correlation calculation with use of the second block ii is omitted from the correlation calculation with use of the third block iii . although not shown in fig8 ( a ) and 8 ( b ), if lm 2 & gt ; 18 , namely there is no available range for the correlation calculation with use of the third block iii , the program jumps to step # 44 without executing steps # 34 and # 35 . if it is decided at step # 33 that the focus detection is impossible with use of the second block ii , the program proceeds to step # 36 in order to execute the correlation calculation over the full range of the reference portion r set for the third block iii and , at step # 37 , a position lm 3 which gives the highest correlation with respect to the third block iii is calculated . next , it is decided at step # 40 whether the correlation calculation with use of the third block ( iii ) has a reasonable credibility or not . if it has a reasonable credibility , the program proceeds to step # 41 to execute an interpolation calculation in order to obtain a deviation amount p 3 of image distance with a high precision due to the interpolation calculation . at next step # 43 , the maximum value of three deviation amounts p 1 , p 2 , p 3 of image distance which gives the rear most focus position is chosen as the most probable deviation amount p of image distance . if either of these values is impossible to calculate , the maximum value is chosen from the rest values . after that , the program returns to step # 13 of fig7 in order to calculate a defocus amount df based on the most probable deviation amount p of image distance . if it is decided that the correlation calculation has not a reasonable credibility , the program proceeds to step # 44 in order to decide whether the correlation calculation with use of the first block i has a reasonable credibility or not . then , at step # 45 , it is also decided whether the correlation calculation with use of the second block ii has a reasonable credibility or not . if it is decided at either one of steps # 44 and # 45 that the correlation calculation has a reasonable credibility , the program proceeds to step # 43 to calculate the most probable deviation amount p of image distance . if all correlation calculations with use of the first , second and third blocks have not reasonable credibilities , the program proceeds to step # 10 of fig7 to execute the low - contrast scanning . it is desirable to calculate correlation functions hn ( lmin - 1 )) and hn ( lmin + 1 ) adjacent to the minimum correlation function hn ( lmin ) before executing the interpolation calculation at step # 23 , # 31 or # 41 , wherein ( lmin - 1 ) represents ( lm 1 - 1 ), ( lm 2 - 1 ) and ( lm 3 - 1 ) while ( lmin - 1 ) represents ( lm 1 + 1 ), ( lm 2 + 1 ) and ( l m 3 + 1 ). this enables to calculate a focus position in a range defined from ( lmin - 0 . 5 ) pitch to ( lmin + 0 . 5 ) pitch . fig1 shows a flow - chart of the second preferred embodiment of the present invention . in this embodiment , the detection range of the first block i is changed according to the possibility of focus condition detection with use of the second block ii . if the focus condition detection with use of the second block ii is impossible , the detection range of the first block i is set at a wide range in order to improve the probability of detection as shown at step # 28 since a focus position might be shifted from the normal infocus position considerably in such a case as mentioned above . on the contrary to the above , if it is possible to detect a focus position with use of the second block ii , the detection range of the first block i is narrowed at step # 46 or # 48 in order to reduce the calculation time . although in consideration of the objects located at far and near distances the detection range in this case is set so as to include a range which is on the rear focus side with respect to a shift amount lm 2 having been sought with use of the second block ii , too , it is not necessary to set such a wide detection range as set in the case that the focus condition detection with use of the second block ii is impossible . actually , the correlation calculation is terminated at l = 12 . fig1 shows a flow - chart of the third preferred embodiment of the present invention in which the method for determining the most probable value p of the deviation amount of image distance is changed from that of the first preferred embodiment shown at step # 43 of fig8 ( b ). as explained already , the deviation amount of image distance indicating the rear most focus position is chosen among those obtained in the first preferred embodiment . however , there is a possibility that the detection precision is lowered since an error contained in the deviation amount of image distance obtained is enlarged when the contrast of an object becomes low in such a case of an object having a flat surface . this preferred embodiment is considered as a countermeasure against the problem just mentioned above . according to this embodiment , the maximum value chosen among deviation amounts ( p 1 , p 2 , p 3 ) of image distance is compared with the deviation amount p 4 of image distance which is obtained with use of the block with which the highest contrast is detected among blocks i to iii and if the difference between max ( p 1 , p 2 , p 3 ) and p 4 is smaller than or equal to a predetermined value , p 4 is employed as the most probable value of the shift amount of image distance . as shown in fig1 , the maximum value p 0 is chosen among deviation amounts p 1 , p 2 and p 3 of image distance obtained with use of the first , second and third blocks at step # 50 . next , at steps # 51 , # 52 and # 53 , contrast values c 1 , c 2 and c 3 of contrast on the first to third blocks i to iii are calculated with use of differential data ( lsk ), respectively . then , these contrast values are compared with each other to find the maximum value at steps # 54 and # 55 and the deviation amount of image distance obtained from the block having the maximum contrast is chosen as p 4 at step # 56 , # 57 or # 58 . then , a difference between p 0 and p 4 is compared with the predetermined value a at step # 59 and if the difference ( p 4 - p 0 ) is smaller than or equal to a , p 4 is set as the most probable deviation amount p of image distance at step # 60 . if it is larger than a , p 0 {= max ( p 1 , p 2 , p 3 )} is set as the most probable shift amount p . fig1 shows a flow - chart of the fourth preferred embodiment of the present invention . this embodiment is intended to shorten a calculation time necessary for the focus condition detection calculation . in order for that to occur the correlation calculation is done with the use of two blocks among three blocks , the two blocks having higher contrasts than the remaining one block . further , if the contrast value of every block is smaller than a predetermined value , the correlation calculation is prohibited since the credibility thereof is considered too low to do it . as shown in fig1 , steps from # 1 to # 19 are the same to those of fig8 ( a ) accordingly , explanations about these steps are omitted . next , as shown in fig1 at steps # 51 , # 52 , # 53 , contrast values c 1 , c 2 and c 3 of the contrasts on the first to third blocks are calculated , respectively . at step # 64 , it is decided whether the contrast value c 2 is minimum among contrast values ( c 1 , c 2 , c 3 ) or not . if it is minimum , the correlation calculation with use of the second block is omitted and the program proceeds to step # 68 in order to execute the correlation calculation with use of the first block i . if c 2 is not minimum , it is decided at step # 65 whether c 2 is equal to or larger than a predetermined limit value b of contrast or not . if c 2 is smaller than b , the program proceeds to step # 68 to execute the correlation calculation with use of the first block i . if c 2 is equal to or larger than b , the correlation calculation with use of the second block ii is done at step # 66 and a position ( shift amount l ) which gives the maximum correlation is found out at step # 67 . at next step # 22 , it is decided whether the credibility of the correlation calculation is high enough for determining a focus condition or not , namely the focus condition detection is possible or not . if it is decided that the focus condition detection is possible , an interpolation calculation for obtaining a more accurate correlation position xm 2 is done at step # 23 and , at step # 24 , a deviation amount p 2 of image distance is calculated with respect to the second block . then , the program proceeds to step # 68 and # 69 to decide whether c 1 is minimum among c 1 , c 2 and c 3 or not and to decide whether c 1 is equal to or larger than b if c 1 is not minimum . if either one condition is not satisfied , the correlation calculation with the use of the first block i is omitted and the program jumps to step # 72 to execute the correlation calculation with use of the third block iii . if both conditions are satisfied , the correlation calculation with use of the first block i is executed at steps # 70 and # 71 and it is decided at step # 30 whether the focus condition detection is possible or not . if possible , an interpolation calculation for calculating a more accurate correlation position xm 1 is done at step # 31 and then a deviation amount p 1 of image distance is calculated at step # 32 with respect to the first block i . next , the program proceeds to step # 72 to execute the correlation calculation with use of the third block iii . if it is decided to be impossible at step # 30 , the program also proceeds to step # 72 . then , the program proceeds to step # 68 in order to execute the correlation calculation with use of the first block i . at step # 68 , it is decided whether the contrast c 1 is minimum or not . if it is not , the contrast c 1 is compared with the predetermined value b at step # 69 . if either one condition is not satisfied at step # 68 or step # 69 , the program jumps to step # 72 in order to execute the correlation calculation with the third block iii without executing the correlation calculation with use of the first block i . if both conditions of steps # 68 and # 69 are satisfied , the program proceeds to step # 70 in order to execute the correlation calculation with use of the full range of the first block i . and at step # 71 the maximum correlation position lm 1 is determined therefrom . then , at step # 30 , it is decided whether the correlation calculation with use of the first block i has a reasonable credibility or not . if it has a reasonable credibility , a shift amount p 1 of image distance is calculated at step # 32 after executing an interpolation calculation at step # 31 . next , the program proceeds to step # 72 in order to execute the correlation calculation with use of the third block iii . if it is decided that the correlation calculation at steps # 70 and # 71 has not any reasonable creadibility , the program jumps to the step # 72 . similarly to the case of the first and second blocks , the contrast c 3 is checked whether minimum or not at step # 72 and whether equal to or larger than b at step # 73 . then , the correlation calculation with use of the third block is executed at step # 36 and at step # 37 , the maximum correlation position lm 3 is sought . after an interpolation calculation at step # 41 , a shift amount p 3 of image distance is calculated at step # 42 . then , at step # 43 , the maximum value among p 1 , p 2 and p 3 is determined to be the most probable deviation amount p 0 . if any one of the deviation amounts p 1 , p 2 and p 3 of image distance is impossible to calculate , it is excepted from the calculation . then , the program returns to step # 13 of fig7 . on the contrary to the above , if the correlation calculation at steps # 36 and # 37 has not a reasonable credibility , the program proceeds from step # 40 to steps # 44 and # 45 in order to check whether each of the correlation calculations with use of first and second blocks i , ii had a reasonable credibility at either step # 44 or # 45 , the program proceeds to step # 43 to calculate the most probable deviation amount p of image distance . if all of the correlation calculations are decided to have had no reasonable credibility , the program proceeds to step # 10 to execute the low - contrast scanning as mentioned regarding to fig7 . according to the present embodiment , the focus condition detection calculations are carried out with use of only two blocks having contrasts higher than that of the remaining ones . therefore , the total calculation time of the focus condition is reduced considerably . however , it is also possible to limit the focus condition detection to the block having the highest contast among contrasts of three blocks . it is to be noted that the number of detection blocks of the standard portion is not restricted to three and can be two or four . also , it is to be noted that each detection block is not necessarily set so as to overlap with another block . further , in place of the single line image sensor , there may be provided a plurality of image sensors , each of which is divided into two or more detection blocks . while the preferred embodiments have been described in detail , modifications and variations being obvious to those skilled in the art are possible without departing from the spirit of the invention . the scope is herefore to be determined solely by the appended claims . | 6 |
the following is a detailed description of the new variety with color terminology in accordance with the royal horticultural society colour chart 2001 edition . the specimens described were grown on a research orchard , lawn road , clive , new zealand . the observations were made in the 2007 season on trees which were four years old at the time , grown on ‘ golden queen ’ peach rootstock . size .— small - medium . height 2 . 6 m and 1 . 7 m diameter under the prevailing cultural practices for central leader trees in hawkes bay . form .— pruned to central leader , with a spreading growth habit . hardiness .— hardy under the prevailing hawke &# 39 ; s bay conditions . productivity .— generally smaller fruit yield because of smaller than average fruit size and sparse flowering under hawke &# 39 ; s bay conditions ; typically about 12 tonnes per hectare . fertility .— self - fertile . bearing .— regular , alternate bearing not observed . size .— small - medium . 5 . 6 cm diameter at 20 cm above gound level . texture .— smooth . color .— grey - brown 199b . branch diameter .— bottom tier at 53 cm above ground level 10 cm from main trunk typically 3 . 0 cm diameter . second tier at 109 cm above ground level 10 cm from main trunk is 2 . 6 cm diameter . size .— typically length of annual growth of one year old shoots ranges from 29 . 0 cm to 59 . 0 cm . branch color .— grey - brown 199a . one year old dormant shoot color .— greyed - purple 183b . one year old dormant brindille .— anthocyanin present — greyed - purple 183b . one year old dormant brindille .— anthocyanin absent — yellow - green 144b . texture .— smooth . lenticels .— typically with length of 2 . 0 mm and 9 / cm2 . lenticel color .— greyed - white 156c . size .— medium . average width .— 35 mm . average length .— 116 mm . shape .— lanceolate . shape of tip .— acuminate . angle of tip .— narrow acute . shape of base .— obtuse . margin .— serrate . leaf color — upper surface .— green 139b . leaf color — lower surface .— green 138a . venation .— pinnate . vein color .— yellow - green 146c . surface .— smooth . petiole .— medium . average length .— 11 . 5 mm . average width .— 1 . 8 mm . petiole color .— yellow - green 146b . glands .— type — reniform . size .— medium . average length .— 1 . 1 mm . average width .— 0 . 8 mm . gland color — yellow - green 147b . number .— typically 4 opposite each other in pairs , sometimes 3 . location .— typically on base of leaf blade and the upper end of petiole . hardiness .— hardy , under the growing conditions of hawke &# 39 ; s bay , new zealand . diameter .— 1 . 3 mm during early dormancy ( mid - june ). length .— 2 . 9 mm during early dormancy ( mid - june ). form .— appressed . surface .— pubescent . color .— greyed - green 197b . flowers : perfect , complete and containing typically a single pistil with 30 – 40 stamens and 5 petals and 5 sepals alternately placed . flowers sparse . type .— showy , large . flower diameter .— 35 mm . number of petals .— typically 5 , no double blossoms observed . petal shape .— circular . petal margin .— slightly wavy and slightly turning inwards towards pistil . petal apex .— rounded . petal color .— upper surface — red - purple 69d . petal color .— lower surface — red - purple 70d . position of stamens compared to petals .— below . anther color .— red 53a . position of stigma compared to anthers .— below . fragrance .— slight . pollen .— present . pubescence of ovary .— absent . bloom period .— mid season . date of 5 % flower bloom .— aug . 21 , 2008 . date of full bloom ( 95 %).— sep . 5 , 2008 . length of bloom period .— typically 2 – 3 weeks under hawke &# 39 ; s bay conditions . flower number per node .— typically 1 . maturity for consumption .— firm ripe . first picking .— late - season . size .— small to medium . average weight .— 110 g . average diameter across suture line .— 58 mm . average length .— 60 mm . shape ( ventral view ).— circular , symmetrical . shape of pistil end .— strongly pointed . suture .— medium prominence , extends from base to apex . ripens .— evenly . texture .— firm , non - melting canning clingstone . fibers .— non - fibrous . aroma .— strong . average soluble solids .— 20 brix . juice .— low to moderate . color .— yellow 9a . anthocyanin coloration of flesh absent . thickness .— medium . adherence to flesh .— medium to strong . pubescence .— nil . tendency to crack .— none . overcolor .— orange n25a blending to red n30b , with marbled to flush pattern of overcolor . ground color .— yellow - orange 22d ground type .— clingstone . size .— medium to large . average stone length .— 39 mm . average stone width .— 25 mm . average stone thickness .— 16 mm . average stone weight .— 6 . 9 g . shape ( lateral view ).— elliptic . surface .— pits and grooves . tendency to split .— very low . color .— yellow - brown n167b . use .— local and export markets . storage .— good ; trials indicate 2 – 3 weeks storage without internal breakdown of flesh . form .— oval . seedcoat color .— greyed - orange n167a . viability .— viable . seed length .— 17 . 1 mm . seed width .— 12 . 6 mm at widest point . seed depth .— 4 . 7 mm at deepest point . use : dessert . market : local and long distance . keeping quality : excellent when held in cold storage at 0 – 2 ° c . keeping for 3 weeks without internal breakdown or significant loss of flavor . shipping quality : very firm fruit which is readily handled without discernible fruit damage during picking , packing and transportation . plant / fruit disease resistance / susceptibility : the variety has not been tested for specific resistance or susceptibility . observations during planting , growing , and harvesting of fruit , under normal cultural and growing conditions of hawke &# 39 ; s bay new zealand , have not revealed any particular plant / fruit disease resistance or susceptibility . seedlings that may be particularly susceptible to the brown rot fungus ( monilinia fructicola ) ( a common problem in stonefruit plantings in hawke &# 39 ; s bay ) are eliminated during the seedling stage of the breeding program . the present new variety of nectarine tree , its flowers , foliage and fruit herein described may vary slightly in detail due to climate , soil conditions and cultural practices under which the variety may be grown . the present description is that of the variety grown under the environmental conditions prevailing near clive , hawke &# 39 ; s bay , new zealand . | 0 |
first aspect of the present invention provides a novel intermediate of formula ( ii ), wherein r 1 , r 2 and r 3 each may be different or same and selected from the group comprising of hydrogen , alkyl of c 1 - c 4 carbon atoms , alkoxy of c 1 - c 4 carbon atoms . second aspect of the present invention provides a novel intermediate of formula ( ii ′), wherein each r 1 and r 2 is hydrogen and r 3 is methoxy . compound of formula ( ii &# 39 ;) may be characterized by following nmr data : 13 c nmr ( 100 mhz , cdcl3 ) δ 17 . 74 & amp ; 19 . 20 ( ch 3 ), 41 . 99 & amp ; 42 . 40 ( c ), 57 . 53 & amp ; 57 . 88 ( och 3 ), 101 . 66 & amp ; 101 . 77 ( ch ), 113 . 51 & amp ; 113 . 68 ( arch ), 127 . 39 & amp ; 127 . 60 ( arch ), 173 . 56 & amp ; 177 . 47 ( c ═ o ; ester ) compound of formula ( ii ′) may be further characterized by ir ( kbr , cm − 1 ) spectrum having band at 1725 cm − 1 . third aspect of the present invention provides a novel intermediate of formula ( ii ″), wherein r 1 is hydrogen , r 2 is methyl and r 3 is methoxy . compound of formula ( ii ″) may be characterized by following nmr data : 1 hnmr ( 400 mhz , cdcl3 ) δ 3 . 31 ( s , 3h ), 3 . 35 ( s , 3h ), 3 . 78 ( s , 3h ), 2 . 07 ( s , 3h ), 1 . 24 ( s , 3h ), 4 . 16 ( d , 1h ), 6 . 74 ( d , 8 hz , 1h ), 7 . 18 ( 5 , 1h ), 7 . 21 ( d , 8 hz , 2h ), 7 . 24 ( s , 1h ), 5 . 94 ( d , 10 . 4 hz , 1h ) fourth aspect of the present invention provides a novel intermediate of formula ( iv ), wherein r 1 , r 2 and r 3 each may be different or same and selected from the group comprising of hydrogen , alkyl of c 1 - c 4 carbon atoms , alkoxy of c 1 - c 4 carbon atoms . fifth aspect of the present invention provides a novel intermediate of formula ( iv ′), wherein each r 1 and r 2 is hydrogen and r 3 is methoxy . compound of formula ( iv ′) may be characterized by following nmr data : 1 h nmr ( 400 mhz , cdcl3 ) δ δ 1 . 01 ( s , 3h ), 3 . 65 ( d , j = 11 . 2 hz , 2h ), 3 . 76 ( s , 3h ), 4 . 62 ( d , j = 11 . 2 hz , 2h ), 5 . 41 ( s , 1h ), 6 . 82 ( d , j = 8 . 8 hz , 2h ), 7 . 35 ( d , j = 8 . 8 hz , 2h ) compound of formula ( ii ′) may be further characterized by ir ( kbr , cm − 1 ) spectrum having band at 1253 , 1813 cm − 1 sixth aspect of the present invention provides a novel intermediate of formula ( iv ″), wherein r 1 is hydrogen , r 2 is methyl and r 3 is methoxy . compound of formula ( iv ″) may be characterized by following nmr data : 1 h nmr ( 400 mhz , cdcl3 ) δ 1 . 12 ( s , 3h ), δ 2 . 17 ( s , 3h ), 3 . 65 ( d , 11 . 5 hz , 2h ), 3 . 79 ( s , 3h ), 4 . 63 ( d , 11 . 48 hz , 2h ), 5 . 39 ( s , 1 h ), 6 . 74 ( d , 8 . 2 hz , 2h ) seventh aspect of the present invention provides a process for the preparation of compound of formula ii comprising treating rapamycin of formula ( iii ) with a compound of formula ( iv ). the reaction of rapamycin with compound of formula ( iv ) may be carried out in the presence of suitable solvents . suitable solvents may be selected from the group comprising of halogenated hydrocarbons such as ethylene chloride , methylene chloride , carbon tetra chloride and mixtures thereof . the reaction of rapamycin with compound of formula ( iv ) may be carried out in the presence of catalytic amount of dimethyl amino pyridine ( dmap ) or 4 - pyrrolidinopyridine ( ppy ). the reaction of rapamycin with compound of formula ( iv ) may be carried out at a temperature range of about − 20 ° c . to about room temperature . preferably the reaction may be carried out at the temperature range of 0 ° c . to about 5 ° c . the reaction of rapamycin with compound of formula ( iv ) may be carried out for about 6 - 24 hours . preferably the reaction may be carried out for about 18 hours . eighth aspect of the present invention provides a process for the preparation of temsirolimus comprising converting compound of formula ( ii ) to temsirolimus of formula ( i ). the conversion of compound of formula ( ii ) to temsirolimus may be carried out in the presence of an acid . an acid may be selected from the group comprising of sulfuric acid , hydrochloric acid and mixtures thereof . the conversion of compound of formula ( ii ) to temsirolimus may be carried out in the presence of suitable solvents . suitable solvent may be selected from the group comprising of alcohols such as methanol , ethanol , propanol , butanol and mixtures thereof ; ethers such as tetrahydrofuran , dioxane or mixtures thereof . the conversion of compound of formula ( ii ) to temsirolimus may be carried out at a temperature range of about − 20 ° c . to about room temperature . preferably the reaction may be carried out at the temperature range of 0 ° c . to about 5 ° c . the conversion of compound of formula ( ii ) to temsirolimus may be carried out for about 6 - 24 hours . preferably the reaction may be carried out for about 18 hours . temsirolimus may be further purified by known techniques like column chromatography and crystallization . ninth aspect of the present invention provides a process for the preparation of compound of formula ( iv ) comprising the steps of : b ) treating compound of formula ( vi ) with 2 , 2 - bis ( hydroxymethyl ) propionic acid to obtain the compound of formula ( vii ) c ) treating compound of formula ( vii ) with a coupling agent to obtain the compound of formula ( iv ) the reaction of compound of formula ( v ) with trimethyl orthoformate may be carried out in the presence of suitable solvents . suitable solvents may be selected from the group comprising of alcohols such as methanol , ethanol , propanol , butanol and mixtures thereof . the reaction of compound of formula ( v ) with trimethyl orthoformate may be carried out in the presence of catalytic amount of an acid such as hydrochloric acid . the reaction of compound of formula ( v ) with trimethyl orthoformate may be carried out at a temperature range of about 0 ° c . to about reflux temperature . preferably the reaction may be carried out at room temperature . the reaction of compound of formula ( v ) with trimethyl orthoformate may be carried out for about 6 - 24 hours . preferably the reaction may be carried out for about 18 hours . the reaction of compound of formula ( vi ) with 2 , 2 - bis ( hydroxymethyl ) propionic acid may be carried out in the presence of suitable solvents . suitable solvents may be selected from the group comprising of ketones such as acetone , methyl etly ketone , methyl isobutyl ketone and mixtures thereof ; the reaction of compound of formula ( vi ) with 2 , 2 - bis ( hydroxymethyl ) propionic acid may be carried out in the presence of catalytic amount of an acid such as p - toluenesulfonic acid . the reaction of compound of formula ( vi ) with 2 , 2 - bis ( hydroxymethyl ) propionic acid may be carried out at a temperature range of about 0 ° c . to about reflux temperature . preferably the reaction may be carried out at room temperature . the reaction of compound of formula ( vi ) with 2 , 2 - bis ( hydroxymethyl ) propionic acid may be carried out for about 2 - 10 hours . preferably the reaction may be carried out for about 5 - 6 hours . the reaction of compound of formula ( vii ) with coupling agent may be carried out in the presence of suitable solvent . suitable solvent may be selected from the group comprising of ketones such as acetone , methyl ethyl ketone , methyl isobutyl ketone and mixtures thereof ; halogenated hydrocarbons such as dichloromethane , dichloroethane and mixtures thereof . coupling agent may be selected from the group comprising of dicyclohexylcarbodiimide ( dcc ) and 1 -( 3 - dimethylaminopropyl )- 3 -( ethylcarbodiimide ) hydrochloride ( edac . hcl ). the reaction of compound of formula ( vii ) with coupling agent may be carried out at a temperature range of about 0 ° c . to about reflux temperature . preferably the reaction may be carried out at room temperature . the reaction of compound of formula ( vii ) with coupling agent may be carried out for about 6 - 24 hours . preferably the reaction may be carried out for about 18 hours . anisaldehyde ( 40 g ) and trimethylorthoformate ( 48 . 25 ml ) were added to meoh ( 60 ml ) at 20 - 25 ° c . and the mixture was cooled to 10 - 15 ° c . conc . hcl ( 0 . 26 ml ) was then added to the mixture at 10 - 15 ° c . and was warmed to 20 - 25 ° c . followed by stirring at the same temperature for 16 - 18 hours . 5 % aqueous koh ( 40 ml ) was added to the reaction mixture at 20 - 25 ° c . in 10 min and further stirred for 10 minutes . the reaction mixture was extracted with hexane ( 2 × 200 ml ) and the combined organic layer was washed with dm water ( 200 ml ). the organic layer was concentrated below 40 ° c . to obtain title compound ( 51 . 0 g , 95 . 2 %). a solution of 4 - methoxy - 3 - methyl benzaldehyde ( 10 g ) and trimethylorthoformate ( 43 . 77 ml ) in methanol ( 15 ml ) was cooled to 5 - 10 ° c . concentrated hcl ( 0 . 75 ml ) was added and the reaction mixture was warmed to ambient temperature . the reaction mixture was stirred for 6 hours and quenched with 5 % aqueous koh ( 10 ml ). the reaction mixture was extracted with hexane ( 100 ml ) and the hexane layer was washed with water ( 100 ml ). hexane layer was dried over sodium sulfate and concentrated below 30 ° c . to obtain title compound ( 15 . 8 g ). - 2 , 2 - bis ( hydroxymethyl ) propionic acid ( 10 g ) and anisaldehyde dimethyl acetal ( 20 . 4 g ) were added to acetone ( 50 ml ) at 20 - 25 ° c . p - toluenesulfonic acid ( 0 . 51 g ) was added to the reaction mixture and stirred at 20 - 25 ° c . for 5 hours . the mixture was then cooled to 0 - 5 ° c . and stirred for 1 hour . the slurry was filtered and the solid was washed with chilled ( 0 - 5 ° c .) acetone ( 10 ml ). the solid was dried under vacuum at 45 - 50 ° c . for 4 hour . the solid was added to toluene ( 150 ml ) and the resulting mixture was heated at 65 - 70 ° c . for 2 hours . the mixture was then cooled to 5 - 10 ° c . and stirred for 30 minutes . the slurry was filtered and the solid was washed with toluene ( 10 ml ) followed by drying under vacuum at 30 - 35 ° c . for 4 hours to obtain title compound ( 14 . 0 g , 74 . 4 %). a mixture of 2 , 2 - bis ( hydroxymethyl ) propionic acid ( 7 . 16 g ), 4 - methoxy - 3 - methyl benzaldehyde dimethyl acetal ( 15 . 0 g ) and acetone ( 43 ml ) was treated with p - toluenesulfonic acid ( 0 . 456 g ) at ambient temperature and stirred for 7 h . the reaction mixture was cooled to 0 - 5 ° c . the slurry obtained was filtered and the solid was washed successively with acetone ( 43 ml ) and dichloromethane ( 43 ml ). a mixture of the wet solid and dichloromethane ( 43 ml ) was treated with edac . hcl ( 4 . 4 g ; 0 . 43 equivalents ) at ambient temperature and stirred for 24 h . the reaction mixture was concentrated and the residue stirred with water ( 100 ml ) for 30 min . the slurry was filtered and the solid dried under vacuum to obtain title compound ( 5 . 5 g ). 1 h nmr ( 400 mhz , cdcl3 ) δ 1 . 12 ( s , 3h ), δ 2 . 17 ( s , 3h ), 3 . 65 ( d , 11 . 5 hz , 2h ), 3 . 79 ( s , 3h ), 4 . 63 ( d , 11 . 48 hz , 2h ), 5 . 39 ( s , 1 h ), 6 . 74 ( d , 8 . 2 hz , 2h ) ms ( es + ) ( m / z ) 515 [ m + h ] + , 532 [ m + nh 4 ] + , 537 [ m + na ] + 2 , 2 - bis ( hydroxymethyl ) propionic acid anisylidene acetal ( 10 g ) and dcc ( 4 . 1 g ) were added to ch 2 cl 2 ( 200 ml ) at 20 - 25 ° c . and stirred for 18 hours . the mixture was heated to 30 - 35 ° c . and stirred for 1 hour . the slurry was filtered and the solid was washed with ch 2 cl 2 ( 20 ml ). the filtrate was concentrated dryness and toluene ( 150 ml ) was added to residue at 20 - 25 ° c . the mixture was stirred at 20 - 25 ° c . for 1 hour and the slurry was filtered . the solid was washed with toluene ( 10 ml ) and dried under vacuum at 30 - 35 ° c . for 4 hours to obtain title compound ( 7 . 5 g , 77 . 8 %). 1 h nmr ( 400 mhz , cdcl3 ) δ δ 1 . 01 ( s , 3h ), 3 . 65 ( d , j = 11 . 2 hz , 2h ), 3 . 76 ( s , 3h ), 4 . 62 ( d , j = 11 . 2 hz , 2h ), 5 . 41 ( s , 1h ), 6 . 82 ( d , j = 8 . 8 hz , 2h ), 7 . 35 ( d , j = 8 . 8 hz , 2h ) m / z ( es + ) 487 [ m + h ] + , 504 [ m + nh 4 ] + rapamycin ( 1 . 0 g ) and anhydride ( 5 . 3 g ) obtained in example - 5 were added to ch 2 cl 2 ( 10 ml ) at 20 - 25 ° c . the mixture was then cooled to 0 - 5 ° c . and a solution of dmap ( 1 . 5 g ) in ch 2 cl 2 ( 5 ml ) was added in 15 minutes . the reaction mixture was stirred at 0 - 5 ° c . for 18 hours . the reaction mixture was washed with dm water ( 10 ml ). the organic layer was washed with 0 . 5n h 2 so 4 ( 15 ml ), 5 % aqueous nahco3 ( 20 ml ) and dm water ( 10 ml ). the organic layer was concentrated to dryness and the residue was purified by flash chromatography on silica gel using acetone - dichloromethane ( 2 : 23 ) as eluent to obtain title compound ( 0 . 6 g , 47 . 8 %). 13 c nmr ( 100 mhz , cdcl3 ) δ 17 . 74 & amp ; 19 . 20 ( ch 3 ), 41 . 99 & amp ; 42 . 40 ( c ), 57 . 53 & amp ; 57 . 88 ( och 3 ), 101 . 66 & amp ; 101 . 77 ( ch ), 113 . 51 & amp ; 113 . 68 ( arch ), 127 . 39 & amp ; 127 . 60 ( arch ), 173 . 56 & amp ; 177 . 47 ( c ═ o ; ester ) a solution of rapamycin ( 0 . 5 g ) and 2 -( 4 - methoxy - 3 - methyl phenyl )- 5 - methyl - 1 , 3 - dioxane - 5 - carboxylic anhydride ( 0 . 702 g ) obtained in example - 4 in dichloromethane ( 7 . 5 ml ) was cooled to 0 - 5 ° c . and treated with a solution of 4 - pyrrolidinopyridine ( 0 . 162 g ) in dichloromethane ( 2 . 5 ml ). the reaction mixture was stirred at 0 - 5 ° c . for 10 hours and quenched with water ( 10 ml ). organic layer was concentrated and the residue subjected to column chromatography over silica gel using acetone - dichloromethane ( 1 : 10 ) to obtain title compound ( 0 . 11g ). 1 hnmr ( 400 mhz , cdcl3 ) δ 3 . 31 ( s , 3h ), 3 . 35 ( s , 3h ), 3 . 78 ( s , 3h ), 2 . 07 ( s , 3h ), 1 . 24 ( s , 3h ), 4 . 16 ( d , 1h ), 6 . 74 ( d , 8 hz , 1h ), 7 . 18 ( 5 , 1h ), 7 . 21 ( d , 8 hz , 2h ), 7 . 24 ( s , 1h ), 5 . 94 ( d , 10 . 4 hz , 1h ) ms ( es + ) ( m / z ) 1180 [ m + nh 4 ] + , 1185 [ m + na ] + temsirolimus acetal ( 0 . 2 g ) obtained in example - 6 was added to thf ( 3 ml ) and meoh ( 2 ml ) at 20 - 25 ° c . the mixture was cooled to 0 - 5 ° c . and 2n aqueous h 2 so 4 ( 1 ml ) was added to the mixture . the reaction mixture was stirred at 0 - 5 ° c . for 18 hours and extracted with etoac ( 10 ml ). the organic layer was washed with 5 % aqueous nahco 3 ( 10 ml ) and dm water ( 10 ml ). the organic layer was concentrated to dryness and the residue was purified by flash chromatography on silica gel using acetone - dichloromethane ( 1 : 4 ) as eluent to obtain title compound ( 0 . 1 g , 55 . 7 %). a mixture of temsirolimus methyl acetal ( 50 mg ) obtained in example - 7 , methanol ( 0 . 2 ml ) and thf ( 0 . 3 ml ) was cooled to 0 - 5 ° c . a solution of conc . hcl ( 0 . 01 ml ) in water ( 0 . 15 ml ) was added and stirred for 24 hours . water ( 1 ml ) was added and the mixture was extracted with ethyl acetate ( 3 × 2 ml ). combined organic layer was washed with 5 % nahco3 ( 1 ml ) and concentrated to dryness . the residue was purified by column chromatography over silica gel using acetone - hexane ( 1 : 3 ) to obtain title compound ( 30 mg ). | 2 |
for purposes of description herein , the terms “ upper ,” “ lower ,” “ right ,” “ left ,” “ rear ,” “ front ,” “ vertical ,” “ horizontal ,” and derivatives thereof shall relate to the invention as oriented in fig1 . however , it is to be understood that the invention may assume various alternative orientations and step sequences , except where expressly specified to the contrary . it is also to be understood that the specific devices and processes illustrated in the attached drawings , and described in the following specification , are simply exemplary embodiments of the inventive concepts defined in the appended claims . hence , specific dimensions and other physical characteristics relating to the embodiments disclosed herein are not to be considered as limiting , unless the claims expressly state otherwise . fig1 to 6 show different further exemplary embodiments of a conveyor according to the invention . equal or essentially equal elements or respectively elements with equal or respectively essentially equal functions are described in the different figures with equal reference signs , partially with a following “′”. in fig1 , a partial view of a first further exemplary embodiment of a conveyor 100 according to the invention is shown . a drive frame 11 can be seen , with three bearings 14 a , 14 b , 14 c arranged on top of each other in vertical direction , for the bearing of three equally vertically on top of each other arranged belt drives , which serve the purpose of driving three equally vertically on top of each other arranged conveyor belts . on bearings 15 a , 15 b , 15 c , pressure rolls are located , which press the conveyor belt of the respective level to the respective drive roll , in order to transfer the drive power to the conveyor belt . in fig1 , only the top one of these three conveyor belts of the three - level design conveyor 100 is shown . the conveyor belt 300 is designed with an upper run 300 a and a lower run 300 b . the upper run 300 a is loaded with animal products , here feces 200 , while the conveyor belt 300 is driven by the belt drive in the way that the feces can be moved in one conveying direction fr . the conveyor belt 300 is pressed to the drive roll by pressure rolls that are supported at the bearing 15 a , in order to be driven by the friction , which is thus created in the conveying direction fr . the bearing 14 a is connected to a sprocket 16 a , which can be driven by a motor via a chain and thus torque m b is transferred to the belt drive , which then drives the conveyor belt 300 in the conveying direction fr . as the load rate of the conveyor belt 300 with animal production , here feces 200 , a motor current monitoring is used in the embodiment according to fig1 . that is , the recorded current of the drive motors 110 is determined in the conductor 120 with a current measuring device 130 . from this recorded motor current , the torque m b can be determined , which is needed in order to move the conveyor belt 300 . with the increasing load of the conveyor belt 300 , the torque m b necessary for the drive of the conveyor belt 300 increases together with the recorded motor current . if the characteristic of the drive motor 110 is known , then the difference to a maximum torque can be calculated from the necessary torque currently recorded from the motor current , and from this difference , a maximum possible additional load can be calculated , if applicable with a safety margin , with which the conveyor belt 300 can be additionally loaded , and simultaneously a reliable drive of the conveyor belt through the belt drive can be secured . if the maximum torque is exceeded , a standstill of the conveyor belt 300 with the corresponding disadvantages can occur . preferably , a warning message is issued if the currently necessary torque , which can be calculated from the currently recorded motor current , falls below a predetermined distance from the maximum torque , so that the animal products 200 located on the conveyor belt 300 can be removed before an overload of the conveyor belt 300 occurs . in particular , it is preferred to combine the measurement of the current consumption in a current measuring device 130 with a conveyor belt progress detector , for example , a speed monitor on a return pulley or a separate measuring wheel on the conveyor belt 300 , in order to ensure that slack is detected . beginning slack indicates that the calculated current consumption is no longer a direct measurement for the drive power impacting on the conveyor belt , but a , possibly low , overload has already occurred . a further possibility to determine the traction force of the conveyor belt consists for example in that one or multiple strain gauges are arranged between the bearing of a drive roll or the belt drive and the supporting lateral or drive frame 11 in order to directly determine the traction forces there . another possible embodiment of a conveyor according to the invention 100 is shown in fig2 . fig2 shows an embodiment of a conveyor 100 similar to the one shown in applicant &# 39 ; s utility model application de 20 2012 010 170 . 6 . the conveyor 100 described therein has an automatic conveyor belt control , which controls the fault - free straight running of the conveyor belts . here , both the pressure rolls as well as the drive roll are arranged across an adjustment plate 30 so that they can move horizontally in and opposite to the conveying direction fr via the bearings 15 a ′ and 14 a ′. the adjustment plate 30 is preferably connected to a servo motor or respectively a correcting device , in order to be able to shift the adjustment plate 30 horizontally with the bearings 14 a ′, 15 a ′. according to the embodiment of fig2 , a bearing reaction of the bearing 14 a ′ of the belt drive can be used as the load rate of the conveyor belt , wherein the corresponding measuring unit 131 is preferably designed as a force sensor arranged at a bearing 14 a ′ of a drive roll of the belt drive , specifically indirectly above the adjustment plate 30 in fig2 . since there is a side or a drive frame 11 on both sides of the conveyor with each one adjustment plate 30 and respective bearings 14 a ′, 15 a ′ for the drive roll and the pressure rolls , each one force can be determined in the respective force sensors 131 , which corresponds to half of the traction force f z of the conveyor belt 300 . the resulting traction force of the conveyor belt 300 therefore occurs , divided by the factor of 2 , at the bearings 14 a ′ of the drive roll of the belt drive and can be recorded via the force sensors 131 . in a control unit ( not shown ), the values determined by the force sensors 131 can be evaluated in order to facilitate a conclusion regarding the load of the conveyor belt 300 with animal products . alternatively , the traction forces to be determined can also be recorded via a strain gauge at the servo motor of the adjustment plate 30 . here , the connection with a conveyor belt progress detector is also preferred . in this way , the currently working traction forces can be determined in a reliable way and processed in a control unit , in order to determine a load rate of the conveyor belt and thus realize the advantages described above . in fig3 , another possible embodiment of a conveyor 100 according to the invention is shown . in the partial view of fig3 , the drive roll 12 a supported at the bearing 14 a as well as a drive roll 13 a supported at the bearing 15 a can be seen . in the variation shown in fig3 , a torque is used as a load rate of the conveyor belt , wherein the measuring unit is designed as a strain gauge 132 , which is arranged at an axle journal of the drive roll 12 a of the belt drive . in this variation , the evaluation possibilities mentioned above can also be connected to the equally previously mentioned advantages . in fig4 and 5 , variations are shown in which a weight of the animal products located on a section of the conveyor belt is used for the load rate of the conveyor belt . here , the measuring unit is designed to be a load cell 133 . in fig4 , two conveyor belt side supports 420 are mounted to vertical stands 410 via fixed bearings 510 and respectively via movable bearings 520 . at the conveyor belt side supports 420 in turn , conveyor belt bottom joists 430 are mounted , on which the conveyor belt ( not shown in fig4 ) runs . the weight force of the animal products f g to be transported on the upper run of the conveyor belt impacts on the conveyor belt bottom joists 430 . via the mounting of the conveyor belt bottom joist 430 on the conveyor belt side supports 420 , this weight force f g is transferred to the movable bearings 520 , at which each one load cell 133 is arranged , which can record the respective weight forces . in the variation shown in fig5 , one or preferably two load cells 133 are arranged under at least one of the bottom joists 430 , which can directly record the weight force f g there . here , after recording the weight as the load rate of the conveyor belt , another evaluation and processing follows as well , preferably in a not - shown control unit in the way described above with the also described advantages . in fig6 , another variation is shown , in which a deviation in vertical direction from a position of a section of the conveyor belt 300 , in particular of the upper run 300 a , between two conveyor belt carriers , here conveyor belt bottom joists 430 , from an initial position is used for the load rate of the conveyor belt . the measuring unit is embodied in the variation shown in fig6 as a distance sensor 134 , which is arranged in the vertical direction beneath the lower run 300 a of the conveyor belt between two conveyor belt carriers , here conveyor belt bottom joists 430 . the initial position of the lower run 300 a of the conveyor belt can be seen in fig6 on the right and left side of the conveyor belt bottom joists 430 . the distance sensor 134 , however , measures between the two conveyor belt bottom joists 430 only a distance x to the lower run 300 a of the conveyor belt in the middle between the two conveyor belt bottom joists 430 . compared to the initial position of the upper run 300 a of the conveyor belt , to be seen on the right and left side of the conveyor belt bottom joists 430 , there is therefore a deviation between the bottom joists 430 in vertical direction of the position of the section of the conveyor belt from this initial position . this deviation can also be described as sagging . with increasing load of the conveyor belt with animal products 200 , this sagging increases , which means that the distance x measured by the distance sensor 134 to the upper run 300 a of the conveyor belt decreases . after the determination of the load rate of the conveyor belt , the position deviation , the described evaluation and further processing steps can follow , such as issuing warning messages and / or calculations of further possible maximum loads , load rates and / or load times , in this variation as well . by way of these evaluations and further processing steps , measures can be facilitated for a farmer or operators of agricultural businesses and the employees that work there that can counteract and prevent an overload of a conveyor belt at an early point in time . in this way , disadvantageous situations with loaded , but no longer conveying - capable conveyor belts can be avoided and / or reduced . it is to be understood that variations and modifications can be made on the aforementioned structure without departing from the concepts of the present invention , and further it is to be understood that such concepts are intended to be covered by the following claims unless these claims by their language expressly state otherwise . | 1 |
the present invention maintains the fast adaptation from sub - band echo cancellers and the zero delay from the full band canceller . it adds a little to the processing power requirements , but is still much closer to the low processing power requirements of a conventional sub - band echo canceller compared to a conventional full band echo canceller , especially when complex and sophisticated adaptation algorithms are involved . in order to describe the present invention , the prior art system of fig3 will now be described in more detail referring to fig4 , which illustrates a more detailed version of the system . as in fig3 , the signal from the far end 4101 is passed to the loudspeaker as signal 4102 . it is also divided into sub - bands using the analyze filter 4301 . the uncancelled microphone signal 4106 is divided into sub - bands using another ( but equal ) analyze filter 4302 . for each sub - band , the loudspeaker analyze filter outputs a sub - band reference signal 4203 , which is filtered through a sub - band fir filter , consisting of a reference delay line 4211 , a set of fir filter taps 4212 and a convolution unit 4213 . the convolution unit outputs an inverted sub - band echo estimate 4205 . the microphone analyze filter outputs a sub - band uncancelled signal 4206 , which is added to the inverted echo estimate , outputting a sub - band echo cancelled microphone signal 4207 . the echo cancelled microphone signal is used for the adapting of the fir filter , shown as the sub - band fir filter update loop 4208 . the echo cancelled microphone signals from all sub - bands are also merged together to a microphone cancelled full band signal 4107 by the synthesize filter 4303 . fig5 illustrates a first embodiment of the present invention . as in the prior art system of fig4 , the signal from the far end 5101 is passed to the loudspeaker as signal 5102 . it is also divided into sub - bands using the analyze filter 5301 . the uncancelled microphone signal 5106 is divided into sub - bands using another ( but equal ) analyze filter 5302 . for each sub - band , the loudspeaker analyze filter outputs a sub - band reference signal 5203 , which is filtered through a sub - band fir filter , consisting of a reference delay line 5211 , a set of fir filter taps 5212 and a convolution unit 5213 . the convolution unit outputs an inverted sub - band echo estimate 5205 . the microphone analyze filter outputs a sub - band uncancelled signal 5206 , which is added to the inverted echo estimate , outputting a sub - band echo cancelled microphone signal 5207 . as with the prior art system of in fig4 , the echo cancelled microphone signal is used for the adapting of the fir filter , shown as the sub - band fir filter update loop 5208 . however , different from prior art , the sub - band echo cancelled microphone signal is not passed through a synthesize filter . instead , the filter tap values of the fir filter are sequentially passed through a fir model synthesize filter 5304 to calculate a full band fir filter replica 5104 . a filter tap multiplexer 5214 controls the sequencing . first the synthesize filter are reset to an all zero state , thereafter the filter tap values of the sub band fir filters are fed to the synthesize filter , starting with the h 0 taps from all sub bands , thereafter the h 1 taps from and so on , finishing with the h n − 1 taps of all sub bands . here , n is the number of taps in the sub band fir filters . in sub band echo cancellers , it is common to use different number of taps for different sub bands , and in such a case , the filter tap multiplexer will output zero for all sub bands where no more taps are present . consequently , some passes with all zeros are passed through the synthesize filter , due to the delay and length of response in the synthesize filter , calculate the tail of the response . the required number of passes will depend on the synthesize filter design . finally , the output of the synthesize filter is copied to the fir filter replica 5104 . the result is that the full band fir filter is made up of fir taps generated from the fir taps of the respective sub - bands . several approaches on how and when to pass the sub - band fir filter taps through the synthesize filter is possible . all sequencing could be performed atomically ( at one point of time ), but this will add unnecessary much processing power . a more preferred solution is to pass one set of taps through the synthesize filter each sample interval . this implies that the full band filter is only updated at an interval a little higher than the tail length chosen , but this is rather insignificant , as the sub band filters are fairly constant . even when the acoustic response changes , the re - adaption time will be high compared to the tail length / update interval . further , the signal from the far end 5101 , identical to the signal to the loudspeaker 5102 , is passed through the full band fir filter replica 5104 , making an inverted full band echo estimate 5105 . this is added to the uncancelled microphone signal 5106 , making the echo cancelled full band microphone signal 5107 . using this approach , zero algorithmic delay is achieved , as the microphone signal is not exposed to signal processing . all adaptations are performed in sub - band , and benefits from the sub - band echo canceller are maintained . however , the full band echo filtering has to be made twice , once in the sub - band domain ( computationally inexpensive ) and once in the full band domain ( computationally expensive ). thus , even though the processing power requirements are considerably lower than the full band case , they are high compared to the pure sub - band approach , and further reductions are desired . in a second embodiment of the present invention , the processing power requirements are lowered . this embodiment is illustrated in fig6 . again , the signal from the far end 6101 is passed to the loudspeaker as signal 6102 . it is also divided into sub - bands using the analyze filter 6301 . the uncancelled microphone signal 6106 is divided into sub - bands using another ( but similar ) analyze filter 6302 . for each sub - band , the loudspeaker analyze filter outputs a sub - band reference signal 6203 , which is filtered through a dual sub - band fir filter , consisting of a reference delay line 6211 , a set of fir filter taps 6212 and a dual convolution unit 6213 . the convolution unit outputs an inverted sub - band early echo estimate 6205 and an inverted late echo estimate 6209 . the sub - band early echo estimate is the first part of the sub - band echo estimate in time , determined by the filter taps h 0 − h m − 1 , while the sub - band late echo estimate is the last part of the sub - band echo estimate in time , determined by the filter taps h m − h n . the microphone analyze filter outputs a sub - band uncancelled signal 6206 , which is added to both the inverted echo estimates , outputting a sub - band echo cancelled microphone signal 6207 . as in fig5 , the echo cancelled microphone signal is used for the adapting of the fir filter , shown as the sub - band fir filter update loop 6208 . the adaptation of the fir filter is identical as in fig5 . as in fig5 , a filter tap multiplexer 6214 and a fir model synthesize filter 6304 calculates a full band response filter replica 6104 . however , this replica is only calculated using early part of the estimated sub - band fir filter responses , and the full band replica only represent the early part of the acoustic response . thus , the full band fir filter replica 6104 is considerably shorter than the replica in fig5 . the full band reference signal 6101 is passed through this filter , outputting an inverted full band early echo estimate 6108 . in addition , the inverted sub - band late echo estimate is passed through a late echo synthesize filter 6303 , forming an inverted full band late echo estimate 6109 . note that it is a late echo estimate and not an echo reduced signal ( as in fig4 ) which is passed through the synthesize filter . for balancing the delay through the analyze and synthesize filter , a delay adjustment 6110 might be required just after the synthesize filter 6303 . the full band early echo estimate 6104 and the full band late echo estimate 6109 are added , forming the full band echo estimate 6105 . the full band echo estimate is added to the uncancelled microphone signal 6106 , outputting an echo cancelled microphone signal . basically , the approach of the second embodiment only estimates the first part of the echo using a full band fir filter , while the late part of the echo , which is delayed anyway , allows for calculation with the inherent delays introduced by the sub band structure , without introducing any algorithmic delay in the microphone signal path . since the full band early response filter replica is considerably shorter than the replica in fig5 , a complexity reduction is achieved . the number of filter taps which can be used for the early echo and for the late echo , depends on the design of the analyze and synthesize filter . depending on this design , there may also be some overlap between the echo estimate contribution from the full band fir filter and from the sub band late echo model . as an example , assume that the analyze and synthesize filter introduces 40 ms of algorithmic delay , while the system needs to cancel 250 ms tail length . typically , the early echo full band fir filter then needs to be somewhat longer than the 40 ms delay . the first 40 ms are cancelled solely by the full band filter , the next , e . g . 10 ms are jointly cancelled by the full band fir filter and the late echo estimate , while the last 200 ms are cancelled solely by the late echo estimate . in this example , the processing power requirement for the full band filter is reduced by 80 % compared to the embodiment illustrated in fig5 . the net improvement is not that big , as another synthesize filter is necessary . however , compared to the first embodiment , for the same update interval of the full band fir filter , the computationally complexity of the fir model synthesize filter can be reduced , due to fewer sets of taps which must be passed . the present invention combines the benefits from full band echo cancellers and subband echo cancellers , without introducing the disadvantages . by the present invention , there will be zero algorithmic delay in the microphone path , which is the case in full band cancellers , opposed to the inherent delay of sub - band cancellers . further , the adaptation / convergence speed equal to sub - band echo canceller , as adaptation is performed in sub - band , as opposed to the slow convergence speed of full - band echo cancellers , especially for speech and natural signals . finally , the present invention requires low computational complexity , close to the sub - band echo canceller , as opposed to the high computationally complexity of full band cancellers . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims . | 7 |
in the following the construction and operation of a monitoring means shall be explained by referring to fig1 and 2 . in fig1 a radio base station 200 according to the invention is shown . it comprises an antenna device 210 and a transmitter , receiver or transceiver device 220 for transmitting and / or receiving signals over the antenna device 210 . for monitoring the performance of the antenna device 210 the signals and / or parameters to be supervised and related to the performance of said antenna device 210 are extracted by the device 220 and input into a monitoring means 100 . said monitoring means 100 comprises a measuring means 110 for measuring from time to time the performance of the received antenna signals by taking performance samples p i with 1 ≦ i ≦ n with i representing discrete times . each performance sample pi is obtained by averaging the supervised signal ( s ) and / or parameter ( s ) within the observation time of performance sample pi . according to fig2 the claimed method proposes in a first measurement step s 1 to carry out an initializing method step for achieving a first performance sample p 1 . it is assumed that at the beginning the antenna device is checked and that thus the measured performance sample p 1 can be taken as an initializing performance sample representing a properly operating antenna device . alternatively , a proper initializing performance sample p 1 may be generated by carrying out an external measurement of the antenna system performance . in a second method step s 2 said initial performance sample p 1 which is not a general value but which has been individually generated with respect to the antenna device the performance of which shall be determined is stored in a storage means 120 . for transmitting antenna devices the initial performance sample might be generated , e . g . by using the voltage standing wave ratio vswr parameter , whereas for receiving antenna devices said samples might be generated by using e . g . the received signal strength indication rssi - parameter . in a third step s 3 another performance sample p i is achieved by carrying out a further measurement at a time i by the measuring unit 110 . according to method step s 4 in fig2 said newly generated performance sample p i is also stored within said storage means 120 . method steps s 3 and s 4 may be repeated for an arbitrary number of times before actually starting a monitoring of the performance of the antenna device 210 by going to method step 5 . according to method step 5 a newly or last measured performance sample p n is compared with a previous performance sample p n - 1 and the difference between said two performance samples is calculated . the amount of said difference represents the variation of the performance samples over the time . according to a first embodiment of the invention as shown in fig1 said calculation is done by a calculating means 130 preferably accompanied within said monitoring means 100 . the combination of said storage means 120 and of said calculating means 130 may also be referred to as watching means 125 because it serves for watching the variation of said performance samples p i over the time . within step s 5 the amount of the difference between the previous performance sample p n - 1 and the last or new performance sample p n is compared to a first threshold value t r1 for detecting an eventual deterioration in the performance of the antenna device 210 . more specifically , such a deterioration is detected by the detecting means 140 in the case that the difference / variance between the two compared performance samples p n - 1 , p n exceeds said first threshold value t r1 . theoretically , said first threshold value t r1 might be set to 0 but in practice certain tolerances must be accepted so that the first threshold value t r1 is not set to 0 but to another acceptable value . in the case that the variation is greater than said first threshold value preferably a first type of alarm a 1 is generated . due to the specific compared performance samples p n - 1 and p n said first alarm type provides the information that a deterioration of the performance of the antenna has just recently occurred within the time interval t n - 1 to t n . of course , the described comparison must not necessarily be carried out between two adjacent performance samples like p n - 1 and p n - 1 but may also be carried out between two performance samples having another arbitrary time interval therebetween . an example for such a measurement is given and carried out in method step 6 according to fig2 . in that step preferably a last performance sample p n is compared with the first or initial performance sample p 1 . there is the time interval t n - t 1 therebetween . consequently , if the difference between said performance samples p n and p 1 exceeds a second threshold value t r2 also a deterioration in the performance of the antenna device 210 is detected . consequently , in difference to the detection done in method step s 5 the detection in method step s 6 only leads to the result that the detected deterioration of the antenna device 210 must have been occurred within the longer time interval t n - t 1 . thus , a second type of alarm a 2 representing a gradual change in the deterioration may be generated . according to fig2 method step s 6 is carried out if method step s 5 does not lead to a detection of a deterioration . in the case that also method step 6 does also not lead to a detection of a deterioration it is proposed to go back to the beginning of method step 3 for generating new performance samples p n + 1 . . . . the amount of the difference that means the amount the variation between the two compared performance samples represents the amount of the deterioration . thus , small variations only represent little deteriorations and in these cases only a warning may be sufficient for indicating that the antenna device shall be checked and repaired at the next opportunity ; but there is no urgency . to the contrary , large amounts of differences represent a dramatic deterioration . thus , in these cases , not a warning but preferably an alarm is output to technicians in charge indicating that a quick repair of the antenna device 210 is required . in the case of transmitting or transceiver antennas the performance of the antenna device is typically measured in the form of the voltage standard wave ratio vswr parameter ; consequently , the performance samples typically represent such a ratio averaged within the observation time of sample pi . however , in the case of receive - only - antennas other parameters , in particular received signal quality parameters like the “ received signal strength indication ” are more appropriate ; in these cases the performance samples represent such indications . [ 0029 ] fig3 shows another embodiment of the present invention . more specifically it illustrates the application of the present invention to a mobile radio system . such a mobile radio system 300 comprises a plurality of radio base stations 200 ′- 1 . . . 200 ′- n . these radio base stations 200 ′ are substantially built up the same as the radio base stations 200 described above by referring to fig1 . however , the base stations 200 ′ differ from said previously described base stations 200 in that the detection of the deterioration , i . e . the comparison of the difference of the performance samples to the threshold values t r is not carried out within said base stations 200 ′ but is carried out within an evaluation means 320 of said mobile radio system 300 . preferably , said evaluation unit 320 is part of a control station 310 typically comprised within said mobile radio system 300 for controlling the operation of said base stations 200 ′. for carrying out the detecting operation the performance samples p i measured within said radio base stations 200 ′ are preferably wirelessly transmitted from said base stations 200 ′- i with 1 ≦ i ≦ n to said evaluation unit 320 within the mobile radio system 300 ; for achieving this the deterioration means 323 within the radio base stations described above by referring to fig1 are replaced by transmitting means 230 ′- i with 1 ≦ i ≦ n for transmitting said performance samples p i . further , within said evaluation unit 320 a receiving unit 321 must be provided for receiving said performance samples from said radio base stations . additionally , the evaluation unit 320 comprises a detecting means 323 for detecting an eventual deterioration in the performance of the antenna devices 210 ′- i with 1 ≦ i ≦ n depending on the amount of the difference / variation of two compared performance samples p i as described above . said deterioration means 323 may be identical to the deterioration means 130 in fig1 . the performance of receive - only - antennas may alternatively be checked by another monitoring method . this method is based on the fact that many receivers , especially base station receivers , use a technique called diversity reception . that means two receivers fed from two antenna systems are used in parallel to enhance the reception . the proposed alternative monitoring method takes advantage of this fact by comparing the measured quality parameters from the two antennas . because it is very unlikely that both antennas will fail simultaneously , the difference between both parameters is used to generate warnings or alarms . if necessary , also a so - called training phase could be used to compensate an initial difference between the two antennas , e . g . if one antenna is shaded by some obstacles . in this case only the changing difference after the training phase is used for generating warnings or alarms . the method according to the invention may be established in the form of a hardware or a software solution . in the case of a software solution a computer program comprising a sequence of instructions must be provided wherein said instructions are selected such that they are able to carry out the method steps according to the claimed and described method . the hardware solution or the software solution or a combination of both might be provided within the monitoring means , the radio base stations or the mobile radio system according to the invention . in the case of a software solution the computer program may together with other computer programs for controlling the monitoring means , the radio base stations or the mobile radio system stored on a storage medium . said storage medium may be a disc , a compact disc or a flash memory , etc . the computer program stored on said storage medium represents a product which might be sold to a customer . further , in the case of a software solution it is possible that the computer program realizing the method according to the invention might — together with other programs — be transferred via a communications network without using said storage medium . this is another way to transfer the product “ computer program ” to a customer and to sell it to him . the communication network may be the internet . according to another embodiment , a network monitoring device separated from the base stations or from the monitoring means is provided and measures the transmitting field strength t x of said base stations and generates alarm signals depending on the amount of the difference between the performance measured during different measurements . however , an error detected by such a measurement might be caused by the antenna system of the monitoring means ( 100 ) or by a temporarily occurring obstacle . | 7 |
fig1 illustrates the nucleic acid sequence of a human vldl receptor ( seq id no : 1 ). fig2 illustrates the nucleic acid sequence of a mouse vldl receptor ( seq id no : 2 ). fig3 illustrates the amino acid sequence of a human vldl receptor encoded by sequence id no . 1 , utilizing the one letter code as is well known in the art ( seq id no : 3 ). fig4 illustrates the amino acid sequence of a mouse vldl receptor encoded by sequence id no . 2 , utilizing the one letter code as is well known in the art ( seq id no : 4 ). the amino acid sequences of the human and mouse vldl receptors have been deduced from their respective cloned cdnas which were isolated and sequenced . see , sequence id nos . 1 and 2 . each protein is predicted to contain 873 amino acid residues , including 27 residues in the signal peptide . thus , the two proteins are identical in size . the cdna nucleotide sequences and predicted amino acid sequences also show high homology between the two species . ( the cdna for the rabbit vldl receptor has been cloned . takahashi et al ., proc . natl . acad . sci . u . s . a ., 89 : 9252 - 9256 , ( 1992 )). the n - terminal 27 amino acid sequence ( residues - 27 to - 1 ) is hydrophobic in nature and constitutes the putative signal peptide . the mature human and mouse vldl receptor protein contains three potential n - linked glycosylation sites ( asn - 124 , 737 and 754 ). like the ldl receptor ( yamamoto et al ., cell 39 : 27 - 38 , 1984 ; yamamoto et al ., science 232 : 1230 - 1237 , 1986 ), the human and mouse vldl receptor can be divided into five domains . at the n - terminal region are 8 - fold ˜ 40 residue cysteine - rich repeats that are homologous to the ligand binding region of the ldl receptor which contains 7 - fold repeat units ( esser et al ., j . biol . chem . 263 : 13282 - 13290 , 1988 ; russell et al ., j . biol . chem . 264 : 21682 - 21688 , 1989 ). the next domain , which has homology to the epidermal growth factor precursor , spans 396 amino acids including three cysteine - rich repeats , designated a , b and c . this domain in the ldl receptor is thought to be important for the acid - dependent dissociation of the ligand from the receptor ( davis et al ., nature 326 : 760 - 765 , 1987 ). the next domain , the clustered o - linked sugar region , is well conserved among the known mammalian vldl receptor sequences . the last two domains , the transmembrane domain and the cytoplasmic domain , are completely conserved with no amino acid change between human and mouse vldl receptors . in the ldl receptor , there is a conserved tetrapeptide npxy ( asn - pro - x - tyr ) ( wherein x is any amino acid ) in the cytoplasmic domain which is required for clustering of the ldl receptor in coated pits ( chen et al ., j . biol . chem . 265 : 3116 - 3123 , 1990 ). in the human , mouse and rabbit vldl receptor , the tetrapeptide has the sequence npvy ( asn - pro - val - tyr ). overall , the vldl receptor has evolved at a much slower rate than the ldl receptor . the cloned human vldl receptor cdna probe was used to localize the vldl receptor gene on chromosomal spreads by fluorescence in situ hybridization . a hybridization signal was consistently observed on chromosome band 9p24 . thus , the vldl receptor is on a chromosome different from the ldl receptor which is located on chromosome 19pl3 ( lindgren et al ., proc . natl . acad . sci . u . s . a . 82 : 8567 - 8571 , 1985 ). the vldl receptor binds to apolipoprotein ( apo ) e - containing lipoproteins , including vldl , intermediate density lipoprotein ( idl ), and β - vldl . it may also bind to chylomicrons and chylomicron remnants which also contain apoe . unlike an ldl receptor , a vldl receptor will not competeably bind to and internalize ldl . as described above , a vldl receptor encompasses any fragment of a vldl receptor which exhibits functional properties of a vldl receptor as defined above . vldl are the precursors of idl and ldl . both idl and ldl have been identified as important risk factors for atherosclerosis . therefore , any therapeutic intervention that lowers idl and ldl will reduce their atherogenic potential . there is recent evidence that lowering serum cholesterol and ldl may actually cause regression of atheromatous lesions . elevated triglycerides are positively correlated with risk for coronary heart disease . much of this association may be related to the fact that high triglycerides often occur in the presence of reduced high density lipoproteins ( hdl ). hdl is thought to be anti - atherogenic and low hdl predisposes one to atherosclerosis . furthermore , high triglycerides are often associated with atherogenic forms of ldl ( e . g ., in familial combined hyperlipidemia and diabetic dyslipidemia ). therapeutic agents that lower plasma vldl will accomplish two important objectives : first , they will lower idl and ldl , the metabolic products of vldl , and total plasma cholesterol , and second , they will also lower triglyceride levels . the lowering of idl and ldl and total plasma cholesterol is highly desirable because of the known strong association between these lipid parameters and coronary heart disease . the lowering of triglyceride is also of benefit especially when it occurs in the presence of atherogenic dyslipidemias , a common situation . in fact , therapeutic intervention in this situation is recommended by the national cholesterol education program ( ncep ) expert panel ( adult treatment panel ii ) ( jama 269 : 3015 - 3023 , 1993 ). it would be useful to control blood levels of β - vldl vldl and idl through the use of exogenously administered vldl receptor binding to these ligands , thereby decreasing the risk of cardiovascular disease and the resulting need for invasive surgical procedures directed at the heart . currently , there is a clinical protocol approved for the treatment of ldl receptor deficient homozygous fh patients by somatic gene therapy using the human ldl receptor gene ( wilson , hum . gene ther . 3 : 179 - 222 , 1992 ). use of the vldl receptor should also effectively lower ldl in homozygous fh patients because vldl is the precursor of ldl . furthermore , the vldl receptor offers one important advantage over the ldl receptor . fh patients have either no ldl receptor or abnormal ldl receptor . with the expression of the normal ldl receptor , they will develop antibodies to the protein which will eventually interfere with the continued expression of the ldl receptor and the effectiveness of treatment . the vldl receptor , on the other hand , is normally present in multiple tissues in these patients . therefore , the induced over - expression of the vldl receptor in tissues that normally produce it , or the induced expression of the receptor in an ectopic site such as the liver will not cause any untoward immunological response . this is a major advantage of the use of the vldl receptor . the nucleic acid sequence encoding vldl receptor can be administered prophylactically , or to patients having a disease or condition characterized by an elevated plasma lipoprotein level , e . g ., by exogenous delivery of the nucleic acid sequence encoding vldl receptor as naked dna , dna associated with specific carriers , or in a nucleic acid expression vector to a desired tissue by means of an appropriate delivery vehicle , e . g ., a liposome , by use of iontophoresis , electroporation and other pharmacologically approved methods of delivery . routes of administration may include intramuscular , intravenous , aerosol , oral ( tablet or pill form ), topical , systemic , ocular , as a suppository , intraperitoneal and / or intrathecal . the specific delivery route of a vldl receptor will depend on the use of the vldl receptor . c . localization to nuclear compartment utilizing nuclear targeting site found on most nuclear proteins , d . transfection of cells ex vivo with subsequent reimplantation or administration of the transfected cells , at least three types of delivery strategies are useful in the present invention , including : injection of naked vldl receptor dna or charge modified naked vldl receptor dna , particle carrier drug delivery vehicles which are also suitable for delivery of vldl receptor proteins , and retroviral expression vectors . unmodified nucleic acid sequence encoding vldl receptors , like most small molecules , are taken up by cells , albeit slowly . to enhance cellular uptake , the nucleic acid sequence encoding vldl receptor may be modified in ways which reduce its charge but will maintain the expression of specific functional groups in the final translation product . this results in a molecule which is able to diffuse across the cell membrane , thus removing the permeability barrier . chemical modifications of the phosphate backbone will reduce the negative charge allowing free diffusion across the membrane . this principle has been successfully demonstrated for antisense dna technology which shows that this is a feasible approach . in the body , maintenance of an external concentration will be necessary to drive the diffusion of the modified nucleic acid sequence encoding the vldl receptor into the cells of the tissue . administration routes which allow the tissue to be exposed to a transient high concentration of the nucleic acid sequence encoding the vldl receptor , which is slowly dissipated by systemic adsorption are preferred . intravenous administration with a drug carrier designed to increase the circulation half - life of the nucleic acid sequence encoding the vldl receptor or vldl receptor proteins can be used . the size and composition of the drug carrier restricts rapid clearance from the blood stream . the carrier , made to accumulate at the desired site of transfer , can protect the nucleic acid sequence encoding the vldl receptor from degradative processes . drug delivery vehicles are effective for both systemic and topical administration . they can be designed to serve as a slow release reservoir , or to deliver their contents directly to the target cell . an advantage of using direct delivery drug vehicles is that multiple molecules are delivered per uptake . such vehicles have been shown to increase the circulation half - life of drugs which would otherwise be rapidly cleared from the blood stream . some examples of such specialized drug delivery vehicles which fall into this category are liposomes , hydrogels , cyclodextrins , biodegradable nanocapsules , and bioadhesive microspheres . from this category of delivery systems , liposomes are preferred . liposomes increase intracellular stability , increase uptake efficiency and improve biological activity . liposomes are hollow spherical vesicles composed of lipids arranged in a similar fashion as those lipids which make up the cell membrane . they have an internal aqueous space for entrapping water soluble compounds and range in size from 0 . 05 to several microns in diameter . several studies have shown that liposomes can deliver nucleic acids to cells and that the nucleic acid remains biologically active . for example , a liposome delivery vehicle originally designed as a research tool , lipofectin , has been shown to deliver intact mrna molecules to cells yielding production of the corresponding protein . liposomes offer several advantages : they are non - toxic and biodegradable in composition ; they display long circulation half - lives ; and recognition molecules can be readily attached to their surface for targeting to tissues . finally , cost effective manufacture of liposome - based pharmaceuticals , either in a liquid suspension or lyophilized product , has demonstrated the viability of this technology as an acceptable drug delivery system . other controlled release drug delivery systems , such as nanoparticles and hydrogels may be potential delivery vehicles for a nucleic acid sequence encoding a vldl receptor . these carriers have been developed for chemotherapeutic agents and protein - based pharmaceuticals ( such as vldl receptor proteins ), and consequently , can be adapted for nucleic acid delivery . chemical modification of the nucleic acid sequence encoding a vldl receptor to neutralize negative charge may be all that is required for penetration . however , in the event that charge neutralization is insufficient , the nucleic acid sequence encoding a vldl receptor can be co - formulated with permeability enhancers , such as azone or oleic acid , in a liposome . the liposomes can either represent a slow release presentation vehicle in which the modified nucleic acid sequence encoding a vldl receptor and permeability enhancer transfer from the liposome into the targeted cell , or the liposome phospholipids can participate directly with the modified nucleic acid sequence encoding a vldl receptor and permeability enhancer can participate directly with the modified nucleic acid encoding a vldl receptor and permeability enhancer facilitating cellular delivery . in some cases , both the nucleic acid encoding a vldl receptor and permeability enhancer can be formulated into a suppository formulation for slow release . the nucleic acid sequence encoding a vldl receptor or a vldl receptor protein may also be systemically administered . systemic absorption refers to the accumulation of drugs in the blood stream followed by distribution throughout the entire body . administration routes which lead to systemic absorption include : intravenous , intramuscular , subcutaneous , intraperitoneal , intranasal , intrathecal and ophthalmic . a gene gun may also be utilized . administration of dna - coated microprojectiles by a gene gun requires instrumentation but is as simple as direct injection of dna . a construct bearing the gene of interest is precipitated onto the surface of microscopic metal beads . the microprojectiles are accelerated with a shock wave or expanding helium gas , and penetrate tissues to a depth of several cell layers . this approach permits the delivery of foreign genes to the skin of anesthetized animals . this method of administration achieves expression of transgenes at high levels for several days and at detectable levels for several weeks . each of these administration routes exposes the nucleic acid sequence encoding a vldl receptor to an accessible targeted tissue . subcutaneous administration drains into a localized lymph node which proceeds through the lymphatic network into the circulation . the rate of entry into the circulation has been shown to be a function of molecular weight or size . the use of a liposome or other drug carrier localizes the nucleic acid sequence encoding vldl receptor at the lymph node . the nucleic acid sequence encoding vldl receptor can be modified to diffuse into the cell , or the liposome can directly participate in the delivery of either the unmodified or modified nucleic acid sequence encoding vldl receptor to the cell . liposomes injected intravenously show accumulation in the liver , lung and spleen . the composition and size can be adjusted so that this accumulation represents 30 % to 40 % of the injected dose . the remaining dose circulates in the blood stream for up to 24 hours . the chosen method of delivery should result in cytoplasmic accumulation and molecules should have some nuclease - resistance for optimal dosing . nuclear delivery may also be used . most preferred delivery methods include liposomes ( 10 - 400 nm ), hydrogels , controlled - release polymers , microinjection or electroporation ( for ex vivo treatments ) and other pharmaceutically applicable vehicles . the dosage will depend upon the disease indication and the route of administration but should be between 1 - 1000 μg / kg of body weight / day . the duration of treatment will extend through the course of the disease symptoms , possibly continuously . the number of doses will depend upon disease delivery vehicle and efficacy data from clinical trials . another method of administration involves the use of a dna transporter system for inserting specific dna into a cell . the dna transporter system comprises a plurality of a first dna binding complex , said complex including a first binding molecule capable of non - covality binding to dna , said first binding molecule covalently linked to a surface ligand , said surface ligand capable of binding to a cell surface receptor ; a plurality of a second dna binding complex , said complex including a second binding molecule capable of non - covalently binding to dna , said second binding molecule covalently linked to a nuclear ligand , said nuclear ligand capable of recognizing and transporting a transporter system through a nuclear membrane ; wherein said plurality of first and second dna binding complexes are capable of simultaneously , non - covalently binding to a specific dna . additionally , a plurality of a third dna binding complex may be used , said complex includes a third binding molecule capable of non - covalently binding to dna , said third binding molecule covalently linked to a virus ; wherein said plurality of third dna binding complexes are capable of simultaneously , non - covalently binding to a specific dna . the first binding molecule , the second binding molecule and third binding molecule can each be selected from the group consisting of spermine , spermine derivative , histones , cationic peptides and polylysine . spermine derivative refers to analogues and derivatives of spermine and include compounds as set forth in international publication no . wo 93 / 18759 , filed mar . 19 , 1993 and published sep . 30 , 1993 hereby incorporated by reference . establishment of therapeutic levels of nucleic acid sequence encoding vldl receptor within the cell is dependent upon the rates of uptake and degradation . decreasing the degree of degradation will prolong the intracellular half - life of the vldl receptor gene . descriptions of useful systems are provided in the art cited above , all of which is hereby incorporated by reference . a vldl receptor nucleic acid sequence may be administered utilizing an ex vivo approach whereby cells are removed from an animal , transduced with the vldl receptor nucleic acid sequence and reimplanted into the animal . the liver can be accessed by an ex vivo approach by removing hepatocytes from an animal , transducing the hepatocytes in vitro with the vldl receptor nucleic acid sequence and reimplanting them into the animal ( e . g ., as described for rabbits by chowdhury et al , science 254 : 1802 - 1805 , 1991 , or in humans by wilson , hum . gene ther . 3 : 179 - 222 , 1992 ) incorporated herein by reference . the vldl receptor nucleic acid sequence may be administered utilizing an in vivo approach whereby the gene will be administered directly to an animal by intravenous injection , intramuscular injection , or by catheterization and direct delivery of the gene via the blood vessels supplying the target organ . since the vldl receptor is normally expressed in multiple tissues and organs including heart , skeletal muscle , adipose tissues , spleen , lung , brain , kidney , testis , adrenal , small intestine , and other tissues , any of these tissues can be target organs . among these tissues , skeletal muscle is one tissue that is readily accessible by intramuscular injection or intravenous injection . expression will be achieved using a skeletal muscle - specific promoter for the nucleic acid sequence encoding vldl receptor . normally there is little expression of the vldl receptor in the liver . this organ is , however , also a good target organ for expression because the liver clears large volumes of blood and is able to metabolize the apoe - containing lipoproteins that bind to the vldl receptor and become internalized in this organ . the liver can also be accessed by an in vivo approach by administration of the nucleic acid sequence encoding vldl receptor intravenously , intraportally ( via the portal vein ) or intra - arterially into the hepatic artery . many nonviral techniques for the delivery of a vldl receptor nucleic acid sequence into a cell can be used , including direct naked dna uptake ( e . g ., wolff et al ., science 247 : 1465 - 1468 , 1990 ), receptor - mediated dna uptake , e . g ., using dna coupled to asialoorosomucoid which is taken up by the asialoglycoprotein receptor in the liver ( wu and wu , j . biol . chem . 262 : 4429 - 4432 , 1987 ; wu et al ., j . biol . chem . 266 : 14338 - 14342 , 1991 ), and liposome - mediated delivery ( e . g ., kaneda et al ., expt . cell res . 173 : 56 - 69 , 1987 ; kaneda et al ., science 243 : 375 - 378 , 1989 ; zhu et al ., science 261 : 209 - 211 , 1993 ). many of these physical methods can be combined with one another and with viral techniques ; enhancement of receptor - mediated dna uptake can be effected , for example , by combining its use with adenovirus ( curiel et al ., proc . natl . acad . sci . u . s . a . 88 : 8850 - 8854 , 1991 ; cristiano et al ., proc . natl . acad . sci . u . s . a . 90 : 2122 - 2126 , 1993 ). the construction of expression vectors encoding a vldl nucleic acid sequence encoding a vldl receptor in whole or in part or in modified form will be performed utilizing standard techniques known to those of ordinary skill in the art as set forth in , for example , maniatis , fritsch and sambrook , molecular cloning : a laboratory manual . cold spring harbor laboratory , cold spring harbor , n . y . 1982 . the nucleic acid sequence encoding a vldl receptor or a functional part thereof will be inserted at one end of a promoter , typically but not necessarily the 3 &# 39 ; end , the promoter capable of directing appropriate transcription of the vldl nucleic acid sequence . the promoter used can be any that gives good expression of a vldl receptor , these include the retroviral long terminal repeat ( ltr ) promoter , rsv - ltr , muv - ltr , promoters from cytomegalovirus , apolipoprotein a - i , albumin ( together with its enhancer ), transthyretin , transferrin , skeletal muscle actin , metallothionein , or a myogenic specific promoter selected from a group consisting of skeletal alpha actin gene promoter , first myosin light chain 1 promoter , myosin heavy chain promoter , tropinin t promoter , muscle creatinine kinase promoter / enhancer , cytomegalovirus promoter , rsv promoter and rous sarcoma virus ltr . in the preferred embodiment the skeletal alpha actin promoter is used . other promoters as are known in the art may also be used . also , specific embodiments may include the addition of regulatory promoter elements to regulate the expression of any specific nucleic acid sequence in myogenic tissue . in the preferred embodiment , vitamin d is used to regulate expression . one skilled in the art will recognize that the selection of the promoter will depend on the vector , the vldl receptor nucleic acid sequence utilized and the desired biological effect . one skilled in the art will also recognize that in the selection of a promoter the parameters can include : achieving sufficiently high levels of gene expression to achieve a physiological effect ; maintaining a critical steady state of gene expression ; achieving temporal regulation of gene expression ; achieving tissue - specific expression ; achieving pharmacological , endocrine , paracrine or autocrine regulation of gene expression ; and preventing inappropriate or undesirable levels of expression . any given set of selection requirements will depend on the conditions , but can be readily determined once the specific requirements are determined . genomic sequences comprising an intron or introns and in certain embodiments including regulatory sequences for transcription or rna stability may be included . these may include 3 &# 39 ; untranslated sequences possibly including regulatory sequences for rna stability . a polyadenylation signal from genes such as growth hormone or sv40 or others as are known in the art will be ligated to one end of the nucleic acid sequence , typically the 3 &# 39 ; end of the nucleic acid sequence . in the case of a retroviral vector the elements include two long terminal repeat sequences , the y ( packaging ) sequence which may extend into the gag region of the retrovirus and may be modified to eliminate splice signals or translation initiation sites , a promotor capable of producing appropriately regulated transcription of vldl receptor nucleic acid sequences , in alternate embodiments the retroviral vector can include a selectable marker for chemical , pharmacological , or fluorescent elimination of non - transduced cells and / or other retroviral sequences required for integrity and function of the retroviral vector . a number of viral vectors can be used to deliver a vldl receptor nucleic acid sequence , including papovaviruses , adenovirus , vaccinia virus , adeno - associated virus , herpesviruses , retroviruses of avian , murine , and human origin and other viruses as are known in the art ( reviewed by morgan and anderson , ann . rev . biochem . 62 : 191 - 217 , 1993 incorporated herein by reference .) retroviral vectors can be used for transducing the vldl receptor vector into liver cells or muscle . the advantage of retrovirus as a delivery system is the ability of the virus to integrate into the host cell chromosomes ( reviewed by a . d . miller , hum . gene ther . 1 : 5 - 14 , 1990 ). the vldl receptor vector can be delivered by retroviral - mediated gene transfer , a two - component system consisting of the packaging cell and the viral vector . the vldl receptor nucleic acid sequence can be inserted into the retroviral vector by molecular cloning ( e . g ., as described by wilson , hum . gene ther . 3 : 179 - 222 , 1992 ). the virus particle assembled by the producer cell line ( i . e ., a packaging cell line containing the vldl receptor - containing retroviral vector ) will be used to transfer the vldl receptor nucleic acid sequence to a target organ or tissue such as liver cells in vivo ( following partial hepatectomy because only dividing cells take up retroviral vectors ), isolated hepatocytes in vitro or skeletal muscle in vivo . the virus particle will bind to the cell and deliver the vldl receptor nucleic acid sequence which is integrated into the host genome and result in stable long - term expression of the vldl receptor . two major limitations to the use of retroviral vectors are the restricted host - cell range and the inability to obtain high - titer virus . these limitations have been overcome by burns et al ., proc . natl . acad . sci . u . s . a . 90 : 8033 - 8037 , 1993 . they replaced the retroviral envelope glycoprotein with the g glycoprotein of vesicular stomatitis virus . such vectors can be produced in high titer (& gt ; 10 9 colony - forming units / ml ) and can infect diverse cell types . partial hepatectomy may not be necessary for liver expression using such vectors . the nucleic acid sequence encoding vldl receptor can be delivered by using this or a similarly designed vector in vivo by intravenous administration . the other viral vector delivery system that will be used is the adenovirus system . the vldl receptor nucleic acid sequence can be used to replace the e1 region of the adenovirus using the method described by graham and prevec ( methods molec . biol ., vol . 7 , e . j . murray , ed ., humana press , new jersey , pp . 109 - 128 , 1991 ) using recombination in 293 cells incorporated herein by reference . the replication - defective vldl receptor nucleic acid sequence / adenovirus can be injected intravenously , intramuscularly , intraportally or intra - arterially ( hepatic artery ). to date , adenovirus - mediated expression vectors generally direct the transient expression of the therapeutic gene . improvements and refinements in vector structure and design may lead to diminished immunogenicity and allow the vector to be administered repeatedly . other modifications may result in the ability of the vldl receptor nucleic acid sequence to be integrated in the host chromosomes allowing for stable expression . other viral vector delivery systems as are known in the art will also be used for the targeted transfer of the vldl receptor nucleic acid sequence . the following examples are offered by way of illustration and are not intended to limit the invention in any manner . methods of augmenting levels of expression of human or mouse vldl receptor vector normally , the vldl receptor is expressed at a high level in skeletal muscle , although the exact level of expression has not been defined . for a therapeutic effect using muscle expression , it will be necessary to increase vldl expression by about 5 % or more . the persistent over - expression of the vldl receptor in muscle by this amount should lead to a substantial lowering of plasma vldl , idl and ldl . liver normally does not express detectable amounts of vldl receptor . therefore , the induced expression of low level of vldl receptor should have a substantial effect on plasma lipoproteins . the minimal level aimed at is an average expression of one molecule per cell ( i . e ., 1000 receptors per cell if 0 . 1 % of hepatocytes show expression , 100 receptors per cell if 1 % express it and so on ). for patients with more severe elevation of ldl cholesterol , e . g ., levels of about 200 mg / dl to 250 mg / dl or higher , a higher level of expression will be targeted , e . g ., aiming at 10 - 1000 molecules per cell . the relatively high level of expression will be a function of the nucleic acid sequence encoding vldl receptor construct ( e . g ., different promoters will have different activities ) and the delivery method ( e . g ., naked dna delivery , liposome delivery , receptor - mediated delivery , retrovirus - mediated delivery and adenovirus - mediated delivery will have different efficiencies , and in vivo versus ex vivo delivery will also produce different results ) which can be experimented on and optimized . the level of expression will be determined at the rna level by rna blotting or s1 protection assay , and at the protein level by immunoblot analysis and by receptor - binding assay by the method of goldstein et al ., methods enzymol . 98 : 241 - 260 , 1983 . methods of enhancing vldl receptor activity by expression of lipoorotein lipase ( lpl ) vldl receptor and lpl are expressed in similar tissues , e . g ., heart , skeletal muscle and adipose tissue . lpl has been found to play an important role in the receptor - mediated uptake of various lipoproteins ( eisenberg et al ., j . clin . invest . 90 : 2013 - 2021 ) via ldl receptor related protein (&# 34 ; lrp &# 34 ;) ( chappell et al ., j . biol . chem . 267 : 25764 - 25767 , 1992 ; beisiegel et al ., proc . natl . acad . sci . u . s . a . 88 : 8342 - 8346 , 1991 ), and ldl receptor ( mulder et al ., j . biol . chem . 268 : 9369 - 9375 , 1993 ). it also may be involved in the non - receptor mediated uptake of lipoproteins ( mulder et al ., j . biol . chem . 268 : 9369 - 9375 , 1993 ; rumsey et al ., j . clin . invest . 90 : 1504 - 1512 , 1992 ; williams et al ., j . biol . chem . 267 : 13284 - 13292 , 1992 ). the co - expression of lpl in the same tissues that express the vldl receptor will enhance the activity of the latter . to accomplish this , an lpl gene vector will be delivered using a similar design as the vldl gene vector . the two vectors can be delivered simultaneously , or they can be delivered consecutively with a varying period in between . it is expected that the activity of the vldl receptor will be markedly enhanced by this method of co - expression . the human or mouse vldl receptor may be used without modification for gene therapy . however , variants of the human or mouse nucleic acid sequence encoding vldl receptor generated by site - specific mutagenesis and having the following properties , such as ; increased affinity for the ligand , recognition of apob - containing lipoproteins in addition to apoe - containing lipoproteins , or usefulness for screening for pharmaceutical agents that bind to the vldl receptor and modulate its activity ( see , example 5 below ) will also be useful . selection from a wide variety of methods for site - directed mutagenesis for modifying the vldl receptor , including the methods of taylor et al ., nucleic acids res . 13 : 8765 - 8785 , 1985 , and of deng and nickoloff , anal . biochem . 200 : 81 - 88 , 1992 , incorporated herein by reference , may be used . determination of serum chemistry values for patients undergoing vldl gene therapy a large number of serum chemistry values will be obtained as for all patients with hyperlipidemia who are at risk for accelerated atherosclerosis . the following values are specifically measured with respect to vldl receptor gene therapy : total serum cholesterol , triglyceride , ldl - cholesterol , hdl , apoa - i , apoe ( level and isoform ), apob , and lipoprotein ( a ). the aim of vldl gene therapy is to reduce total serum cholesterol ( and triglyceride if it is elevated ), ldl - cholesterol and both apoe and apob . the effect of treatment on hdl and its major apolipoprotein , apoa - i , will be monitored . lipoprotein ( a ) level is relatively resistant to various forms of medication . since vldl receptor gene therapy will lower the apob - containing lipoproteins ( vldl , idl and ldl ), it is likely that the level of lipoprotein ( a ), which contains apob - 100 as an essential component , will also be lowered . screening for compounds having a pharmacological effect on human or mouse vldl receptor the highest level of expression of the vldl receptor is found in the heart . the heart also synthesizes lipoprotein lipase ( lpl ) at a high level . vldl receptor and lpl , acting - separately or in concert , mediate the uptake of lipids ( vldl and fatty acids ) from the circulation . these lipids constitute a major source of energy for the heart . disruption of vldl receptor function will likely lead to cardiac dysfunction , such as congestive heart failure , cardiomyopathy or arrhythmia . by using wild - type human or mouse or variant human or mouse vldl receptors expressed in vitro , we can screen for various natural and synthetic compounds that bind to the vldl receptor ( by a modification of the method of goldstein et al ., methods enzymol . 98 : 241 - 260 , 1983 , using apoe - containing lipoproteins instead of ldl as a competing ligand ). compounds identified by in vitro binding experiments can be tested for metabolic effects in vitro , e . g ., do they block or modulate vldl uptake , or lpl action ? do they modulate hmgcoa reductase activity ( by the method of goldstein et al ., methods enzymol . 98 : 241 - 260 , 1983 )? the bioactive compounds can be tested in experimental animals in vivo . the compounds found to have beneficial therapeutic effects in congestive heart failure , cardiomyopathy or cardiac arrhythmia may ultimately be used as therapeutic agents in humans or animals . the high concentration of vldl receptor in heart may provide a useful handle for developing in vivo diagnostic imaging equipment . natural or synthetic ligands for this receptor can be labeled ( e . g ., with 125 i or other radionuclides ) and injected intravenously . the imaging and quantitation of the radionuclide uptake by the heart will allow the structure and function of the heart to be studied in vivo . the ligands in such studies include vldl , apoe - containing vesicles , labeled monoclonal antibodies against the vldl receptor , or other natural or synthetic compounds identified by in vitro binding assays . labels which are detectable by magnetic resonance imaging , positron emission tomography or computerized axial tomography are also suitable . the mouse is a useful animal for both genetic and conventional therapy . it is especially useful for drug screening . the vldl receptor nucleic acid sequence will be useful in this type of screening . since the mouse vldl receptor sequence is highly homologous to the human vldl receptor , sharing over 95 % sequence identity with the latter , many of the methods applicable to the mouse will be applicable to humans . all the uses of the human vldl receptor discussed in the previous sections can be applied to the mouse vldl receptor as well . in addition , natural or synthetic compounds that bind to the vldl receptor , or that modulate vldl receptor expression can be studied in mouse in vivo before they are used for clinical trials in humans . the human or mouse vldl nucleic acid sequences or vectors containing such sequences can be used as probes , as is known in the art , in order to screen cdna or genomic libraries and isolate additional vldl receptors and / or other as yet unidentified lipoprotein receptors . the human or mouse vldl nucleic acid sequences or vectors containing such sequences can also be utilized to perform in situ hybridizations , as is known in the art , in order to further characterize the tissue distribution of the vldl receptor or homologous lipoprotein receptors in various species . stably transformed or transfected cell lines which express vldl receptors are useful for the screening of compounds which will specifically bind to these vldl receptors . nucleic acid sequences encoding vldl receptor genes may be isolated and cloned as is known in the art , as set forth in , for example , maniatis , fritsch and sambrook , molecular cloning : a laboratory manual . cold spring harbor laboratory , cold spring harbor , n . y . 1982 . probes generated from ldl receptor nucleic acid sequences or vldl receptor nucleic acid sequences as are known including rabbit , mouse and human may be used . for example , the human and mouse vldl receptor genes were isolated utilizing probes based on the rabbit vldl receptor sequence . it will be readily apparent to one skilled in the art that various substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention . __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 4 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 3330 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 1 : tttcccctccccgcccccaccttcttcctcctttcggaagggctggtaacttgtcgtgcg60gagcgaacggcggcggcggcggcggcggcggcggcaccatccaggcgggcaccatgggca120cgtccgcgctctgggcgctctggctgctcgtcgcgctgtgctgggcgccccgggagagcg180gcgccaccggaaccgggagaaaagccaaatgtgaaccctcccaattccagtgcacaaatg240gtcgctgtattacgctgttgtggaaatgtgatggggatgaagactgtgttgacggcagtg300atgaaaagaactgtgtaaagaagacgtgtgctgaatctgacttcgtgtgcaacaatggcc360agtgtgttcccagccgatggaagtgtgatggagatcctgactgcgaagatggttcagatg420aaagcccagaacagtgccatatgagaacatgccgcatacatgaaatcagctgtggcgccc480attctactcagtgtatcccagtgtcctggagatgtgatggtgaaaatgattgtgacagtg540gagaagatgaagaaaactgtggcaatataacatgtagtcccgacgagttcacctgctcca600gtggccgctgcatctccaggaactttgtatgcaatggccaggatgactgcagcgatggca660gtgatgagctggactgtgccccgccaacctgtggcgcccatgagttccagtgcagcacct720cctcctgcatccccatcagctgggtatgcgacgatgatgcagactgctccgaccaatctg780atgagtccctggagcagtgtggccgtcagccagtcatacacaccaagtgtccagccagcg840aaatccagtgcggctctggcgagtgcatccataagaagtggcgatgtgatggggaccctg900actgcaaggatggcagtgatgaggtcaactgtccctctcgaacttgccgacctgaccaat960ttgaatgtgaggatggcagctgcatccatggcagcaggcagtgtaatggtatccgagact1020gtgtcgatggttccgatgaagtcaactgcaaaaatgtcaatcagtgcttgggccctggaa1080aattcaagtgcagaagtggagaatgcatagatatcagcaaagtatgtaaccaggagcagg1140actgcagggactggagtgatgagcccctgaaagagtgtcatataaacgaatgcttggtaa1200ataatggtggatgttctcatatctgcaaagacctagttataggctacgagtgtgactgtg1260cagctgggtttgaactgatagataggaaaacctgtggagatattgatgaatgccaaaatc1320caggaatctgcagtcaaatttgtatcaacttaaaaggcggttacaagtgtgaatgtagtc1380gtggctatcaaatggatcttgctactggcgtgtgcaaggcagtaggcaaagagccaagtc1440tgatcttcactaatcgaagagacatcaggaagattggcttagagaggaaagaatatatcc1500aactagttgaacagctaagaaacactgtggctctcgatgctgacattgctgcccagaaac1560tattctgggccgatctaagccaaaaggctatcttcagtgcctcaattgatgacaaggttg1620gtagacatgttaaaatgatcgacaatgtctataatcctgcagccattgctgttgattggg1680tgtacaagaccatctactggactgatgcggcttctaagactatttcagtagctaccctag1740atggaaccaagaggaagttcctgtttaactctgacttgcgagagcctgcctccatagctg1800tggacccactgtctggctttgtttactggtcagactggggtgaaccagctaaaatagaaa1860aagcaggaatgaatggattcgatagacgtccactggtgacagcggatatccagtggccta1920acggaattacacttgaccttataaaaagtcgcctctattggcttgattctaagttgcaca1980tgttatccagcgtggacttgaatggccaagatcgtaggatagtactaaagtctctggagt2040tcctagctcatcctcttgcactaacaatatttgaggatcgtgtctactggatagatgggg2100aaaatgaagcagtctatggtgccaataaattcactggatcagagctagccactctagtca2160acaacctgaatgatgcccaagacatcattgtctatcatgaacttgtacagccatcaggta2220aaaattggtgtgaagaagacatggagaatggaggatgtgaatacctatgcctgccagcac2280cacagattaatgatcactctccaaaatatacctgttcctgtcccagtgggtacaatgtag2340aggaaaatggccgagactgtcaaagtactgcaactactgtgacttacagtgagacaaaag2400atacgaactcaacagaaatttcagcaactagtggactagttcctggagggatcaatgtga2460ccacagcagtatcagaggtcagtgttcccccaaaagggacttctgccgcatgggccattc2520ttcctctcttgctcttagtgatggcagcagtaggtggctacttgatgtggcggaattggc2580aacacaagaacatgaaaagcatgaactttgacaatcctgtgtacttgaaaaccactgaag2640aggacctctccatagacattggtagacacagtgcttctgttggacacacgtacccagcaa2700tatcagttgtaagcacagatgatgatctagcttgacttctgtgacaaatgttgacctttg2760aggtctaaacaaataatacccccgtcggaatggtaaccgagccagcagctgaagtctctt2820tttcttcctctcggctggaagaacatcaagatacctttgcgtggatcaagcttgtgtact2880tgaccgtttttatattacttttgtaaatattcttgtccacattctacttcagctttggat2940gtggttaccgagtatctgtaacccttgaatttctagacagtattgccacctctggccaaa3000tatgcactttccctagaaagccatattccagcagtgaaacttgtgctatagtgtatacca3060cctgtacatacattgtataggccatctgtaaatatcccagagaacaatcactattcttaa3120gcactttgaaaatatttctatgtaaattattgtaaactttttcaatggttgggacaatgg3180caataggacaaaacgggttactaagatgaaattgccaaaaaaatttataaactaattttg3240tacgtatgaatgatatctttgacctcaatggaggtttgcaaagactgagtgttcaaacta3300ctgtacattttttttcaagtgctaaaaaat3330 ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 3116 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 2 : caccatccgggcgggcagcatgggcacgtccgcgcgctgggccctgtggctgctgctcgc60gctgtgctgggcgccccgggacagcggcgccactgcaagcgggaagaaagccaaatgtga120tagctcccagtttcagtgcacaaatggccgctgcattaccctgctgtggaaatgtgatgg180agatgaagactgtgcggatggcagcgacgagaagaactgtgtaaagaagacgtgtgctga240gtctgacttcgtgtgcaaaaacggccagtgtgttcctaacagatggcagtgtgacgggga300tcctgattgcgaaaacggttctgatgaaagccctgaacagtgccatatgagaacatgccg360cataaatgaaatcagctgtggcgcccgttctactcagtgtatccccgtctcctggagatg420cgatggtgaaaatgattgtgacaatggagaagatgaagaaaactgtggcaacataacatg480tagtgcagatgagttcacttgctccagtggccgctgcgtctccagaaactttgtgtgcaa540tggccaggatgactgtgacgatggcagtgatgagctggactgtgctccaccaacctgcgg600agcccacgagttccagtgcagcacctcttcctgcattcccctcagctgggtgtgtgatga660tgacgcagactgttcagaccaatcagacgagtctcttgagcagtgtggccgtcagcctgt720gatacataccaaatgtcctaccagtgagatccagtgtggctctggcgagtgcattcacaa780aaaatggcggtgtgacggagaccctgactgcaaggacggcagcgatgaggtcaactgccc840ttctcgaacctgccgacctgaccagtttgaatgtgaagatggtagctgtatccacggcag900caggcaatgcaatggcatccgagactgtgttgatggctctgatgaagtcaactgcaaaaa960cgtcaatcagtgcctgggccctggaaagttcaagtgcagaagcggggaatgcatagacat1020gagcaaagtatgtgaccaggaacaagactgcagagactggagtgacgagcccctgaagga1080atgccatatcaacgaatgcctggtcaataatggtggctgttcccatatctgcaaagacct1140agttataggttatgagtgtgattgtgcagctgggtttgaactgatagataggaaaacctg1200tggagatattgatgaatgccaaaacccggggatctgcagtcaaatttgtatcaacttaaa1260aggcggttacaagtgtgaatgtagtcgtggctatcaaatggatcttgccactggcgtgtg1320caaggcagtaggcaaagagccgagtctgatcttcactaatcgaagagacatcaggaagat1380tggcctagagagaaaggaatacatccaacttgtagagcaactaaggaacacggtggctct1440cgatgcggacattgcagctcagaagctgttttgggctgatctcagccagaaggccatctt1500cagtgcctcaattgatgacaaggttggtagacattttaaaatgatcgacaatgtctataa1560tcctgcagccattgctgttgattgggtgtacaagaccatctactggactgatgcggcttc1620taagactatttcagtagctaccctagacggagccaagaggaagttcctgtttaattctga1680cttgcgagagcctgcctccatagctgtggatccgttgtcgggctttgtttactggtcaga1740ctggggcgagccagctaaaatagaaaaagcaggaatgaatggatttgatagacgtcctct1800ggtgacggaggacatccaatggcctaatggaattacactcgaccttgtcaaaagccgcct1860ctactggctggattccaagttgcacatgctctctagtgtggacctgaatggtcaagatcg1920taggatagtgctcaagtctctggagttcctagctcatcctcttgcactcaccatatttga1980ggatcgcgtctactggatagatggagaaaatgaagcagtgtacggtgccaataaattcac2040tgggtcagagctggccactctagtgaattccctcaatgatgcccaagacatcattgtcta2100ccatgaactcgtccagccgtcaggtaaaaactggtgtgaagacgatatggagaatggagg2160atgtgaatatctctgcctgccagcaccacagatcaatgaccactctccaaaatatacctg2220ttcctgtcccaatgggtacaatctcgaagaaaatggacgagagtgtcaaagtacttcaac2280tcctgtgacttacagtgagacaaaagatatcaacacaacagacattctacgaactagtgg2340actggttcctggagggatcaatgtgaccacagcagtatcagaagtcagtgttcccccaaa2400agggacttcagctgcctgggccatccttcctctcttgctcttagtgatggcagcagtagg2460tggctacttgatgtggaggaattggcaacataaaaacatgaaaagcatgaactttgacaa2520tcctgtgtacttgaagaccactgaagaggacctgtcgatagacattggtagacacagcgc2580ttctgtaggacacacatacccagcaatatcagttgtaagcacagatgatgatctggcttg2640agttctgaacaaatcttggtctatgaggtctacaccaataacaccctactctggaatggt2700aacagagccagcgctgaagtctcctttcttcctcccatctggaagaacatcaagatatct2760ttttgtggatcaagtttgagtacttgatcatttttatattacttttgtaaatattcttgg2820ccacattctacttcagctctggatgtggttaccaagtatctgtaacccttgagcccctag2880acagtattgccatctctggccaaatatgcactttccctagaaagccatattccagcaatg2940aacgttgtgctatagtgactcccacctgtacatacattgtataggccacctgtacatatc3000ccagagaacaatcactattcttaagcactttgaagatatttctatgtaaattattgtaaa3060ctttttcaatggttgggacaatggcaataggataaaacgggttactaagatgaaat3116 ( 2 ) information for seq id no : 3 :( i ) sequence characteristics :( a ) length : 846 amino acids ( b ) type : amino acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 3 : glyarglysalalyscysgluproserglnpheglncysthrasngly151015argcysilethrleuleutrplyscysaspglyaspgluaspcysval202530aspglyseraspglulysasncysvallyslysthrcysalagluser354045aspphevalcysasnasnglyglncysvalproserargtrplyscys505560aspglyaspproaspcysgluaspglyseraspgluserproglugln65707580cyshismetargthrcysargilehisgluilesercysglyalahis859095serthrglncysileprovalsertrpargcysaspglygluasnasp100105110cysaspserglygluaspglugluasncysglyasnilethrcysser115120125proaspgluphethrcysserserglyargcysileserargasnphe130135140valcysasnglyglnaspaspcysseraspglyseraspgluleuasp145150155160cysalaproprothrcysglyalahisglupheglncysserthrser165170175sercysileproilesertrpvalcysaspaspaspalaaspcysser180185190aspglnseraspgluserleugluglncysglyargglnprovalile195200205histhrlyscysproalasergluileglncysglyserglyglucys210215220ilehislyslystrpargcysaspglyaspproaspcyslysaspgly225230235240seraspgluvalasncysproserargthrcysargproaspglnphe245250255glucysgluaspglysercysilehisglyserargglncysasngly260265270ileargaspcysvalaspglyseraspgluvalasncyslysasnval275280285asnglncysleuglyproglylysphelyscysargserglyglucys290295300ileaspileserlysvalcysasnglngluglnaspcysargasptrp305310315320seraspgluproleulysglucyshisileasnglucysleuvalasn325330335asnglyglycysserhisilecyslysaspleuvalileglytyrglu340345350cysaspcysalaalaglyphegluleuileasparglysthrcysgly355360365aspileaspglucysglnasnproglyilecysserglnilecysile370375380asnleulysglyglytyrlyscysglucysserargglytyrglnmet385390395400aspleualathrglyvalcyslysalavalglylysgluproserleu405410415ilephethrasnargargaspilearglysileglyleugluarglys420425430glutyrileglnleuvalgluglnleuargasnthrvalalaleuasp435440445alaaspilealaalaglnlysleuphetrpalaaspleuserglnlys450455460alailepheseralaserileaspasplysvalglyarghisvallys465470475480metileaspasnvaltyrasnproalaalailealavalasptrpval485490495tyrlysthriletyrtrpthraspalaalaserlysthrileserval500505510alathrleuaspglythrlysarglyspheleupheasnseraspleu515520525arggluproalaserilealavalaspproleuserglyphevaltyr530535540trpserasptrpglygluproalalysileglulysalaglymetasn545550555560glypheaspargargproleuvalthralaaspileglntrpproasn565570575glyilethrleuaspleuilelysserargleutyrtrpleuaspser580585590lysleuhismetleuserservalaspleuasnglyglnaspargarg595600605ilevalleulysserleuglupheleualahisproleualaleuthr610615620ilephegluaspargvaltyrtrpileaspglygluasnglualaval625630635640tyrglyalaasnlysphethrglysergluleualathrleuvalasn645650655asnleuasnaspalaglnaspileilevaltyrhisgluleuvalgln660665670proserglylysasntrpcysglugluaspmetgluasnglyglycys675680685glutyrleucysleuproalaproglnileasnasphisserprolys690695700tyrthrcyssercysproserglytyrasnvalglugluasnglyarg705710715720aspcysglnserthralathrthrvalthrtyrsergluthrlysasp725730735thrasnserthrgluileseralathrserglyleuvalproglygly740745750ileasnvalthrthralavalsergluvalservalproprolysgly755760765thrseralaalatrpalaileleuproleuleuleuleuvalmetala770775780alavalglyglytyrleumettrpargasntrpglnhislysasnmet785790795800lyssermetasnpheaspasnprovaltyrleulysthrthrgluglu805810815aspleuserileaspileglyarghisseralaservalglyhisthr820825830tyrproalaileservalvalserthraspaspaspleuala835840845 ( 2 ) information for seq id no : 4 :( i ) sequence characteristics :( a ) length : 846 amino acids ( b ) type : amino acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 4 : glylyslysalalyscysaspserserglnpheglncysthrasngly151015argcysilethrleuleutrplyscysaspglyaspgluaspcysala202530aspglyseraspglulysasncysvallyslysthrcysalagluser354045aspphevalcyslysasnglyglncysvalproasnargtrpglncys505560aspglyaspproaspcysgluasnglyseraspgluserproglugln65707580cyshismetargthrcysargileasngluilesercysglyalaarg859095serthrglncysileprovalsertrpargcysaspglygluasnasp100105110cysaspasnglygluaspglugluasncysglyasnilethrcysser115120125alaaspgluphethrcysserserglyargcysvalserargasnphe130135140valcysasnglyglnaspaspcysaspaspglyseraspgluleuasp145150155160cysalaproprothrcysglyalahisglupheglncysserthrser165170175sercysileproleusertrpvalcysaspaspaspalaaspcysser180185190aspglnseraspgluserleugluglncysglyargglnprovalile195200205histhrlyscysprothrsergluileglncysglyserglyglucys210215220ilehislyslystrpargcysaspglyaspproaspcyslysaspgly225230235240seraspgluvalasncysproserargthrcysargproaspglnphe245250255glucysgluaspglysercysilehisglyserargglncysasngly260265270ileargaspcysvalaspglyseraspgluvalasncyslysasnval275280285asnglncysleuglyproglylysphelyscysargserglyglucys290295300ileaspmetserlysvalcysaspglngluglnaspcysargasptrp305310315320seraspgluproleulysglucyshisileasnglucysleuvalasn325330335asnglyglycysserhisilecyslysaspleuvalileglytyrglu340345350cysaspcysalaalaglyphegluleuileasparglysthrcysgly355360365aspileaspglucysglnasnproglyilecysserglnilecysile370375380asnleulysglyglytyrlyscysglucysserargglytyrglnmet385390395400aspleualathrglyvalcyslysalavalglylysgluproserleu405410415ilephethrasnargargaspilearglysileglyleugluarglys420425430glutyrileglnleuvalgluglnleuargasnthrvalalaleuasp435440445alaaspilealaalaglnlysleuphetrpalaaspleuserglnlys450455460alailepheseralaserileaspasplysvalglyarghisphelys465470475480metileaspasnvaltyrasnproalaalailealavalasptrpval485490495tyrlysthriletyrtrpthraspalaalaserlysthrileserval500505510alathrleuaspglyalalysarglyspheleupheasnseraspleu515520525arggluproalaserilealavalaspproleuserglyphevaltyr530535540trpserasptrpglygluproalalysileglulysalaglymetasn545550555560glypheaspargargproleuvalthrgluaspileglntrpproasn565570575glyilethrleuaspleuvallysserargleutyrtrpleuaspser580585590lysleuhismetleuserservalaspleuasnglyglnaspargarg595600605ilevalleulysserleuglupheleualahisproleualaleuthr610615620ilephegluaspargvaltyrtrpileaspglygluasnglualaval625630635640tyrglyalaasnlysphethrglysergluleualathrleuvalasn645650655serleuasnaspalaglnaspileilevaltyrhisgluleuvalgln660665670proserglylysasntrpcysgluaspaspmetgluasnglyglycys675680685glutyrleucysleuproalaproglnileasnasphisserprolys690695700tyrthrcyssercysproasnglytyrasnleuglugluasnglyarg705710715720glucysglnserthrserthrprovalthrtyrsergluthrlysasp725730735ileasnthrthraspileleuargthrserglyleuvalproglygly740745750ileasnvalthrthralavalsergluvalservalproprolysgly755760765thrseralaalatrpalaileleuproleuleuleuleuvalmetala770775780alavalglyglytyrleumettrpargasntrpglnhislysasnmet785790795800lyssermetasnpheaspasnprovaltyrleulysthrthrgluglu805810815aspleuserileaspileglyarghisseralaservalglyhisthr820825830tyrproalaileservalvalserthraspaspaspleuala835840845__________________________________________________________________________ | 2 |
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . for better understanding of the present invention , it may be necessary to understand the term “ degree of distortion ” with regard to a mask having predetermined sized holes . the degree of distortion refers to a magnitude that a photoresist hole pattern is distorted from a mask hole pattern due to a proximity effect . as discussed above , the narrower the distance between holes of a mask , the larger a degree of distortion . such a distortion is a value which can be measured with regard to a mask having holes having a predetermined size . in this measurement , distance between holes on the mask varies from a large value to a small value . when the distance is large , the proximity effect does not occur during the process . conversely , when the distance is small , the proximity effect is so serious that the patterned holes are connected to each other . a hole size of the photoresist pattern formed on the semiconductor substrate is then measured after exposing to the light . at this time , the distance between the holes of the mask may be classified with different intervals . it is assumed that a degree of distortion is the same as each interval . the number of intervals is determined by a permitted error limit . the exact location of a hole deviates during a photolithographic process . the deviation is called a “ margin .” when the margin is large , the number of intervals may be less than that of a smaller margin . for example , in forming a photoresist hole pattern consisting of square contact hole having a side length 0 . 25 μm and a distance between holes of 0 . 23 μm , a degree of distortion varies with the distance between holes . when a distance between holes is 0 . 23 ˜ 0 . 3 μm , a large distortion occurs . when the distance is 0 . 3 ˜ 0 . 5 μm , a small distortion occurs . when the distance becomes 0 . 5 μm , no distortion occurs . then , a photoresist hole pattern is determined with regard to the respective distances . next , mask data is generated to decrease a degree of distortion . fig2 a to 2 e are top views sequentially illustrating the steps of generating mask data . initially referring to fig2 a , an original data a plotted by a chip designer in accordance with a desired hole pattern on a semiconductor substrate is shown . the original data a consists of square holes having a side length 1 . the top row has a single hole and it is assumed that a distance between holes in that row is infinite . a hole pattern having a distance between holes is 2p ( 1 ) in a subsequent row . at the bottom row , a hole pattern having a distance between holes is 2p ( 2 ). for convenience , it is assumed that the distances between the top row and the middle row and the bottom row are infinite . thus , a proximity effect therebetween may be ignored . as shown in fig2 a , generally , distances between holes formed in a mask have several different values . the values are determined in correspondence to the respective distances to obtain a degree of distortion as discussed above . for example , a mask having three different values will be explained with reference to fig2 a - 2e . the three values are as follows : a value having no proximity effect between holes ; a value 2p ( 1 ) with a small proximity effect ; and a value 2p ( 2 ) with a large proximity effect . the original mask data is generated by an image process program using a computer . the data is generated by executing an operation , such as magnification , reduction , addition and substraction . for example , operators for executing the operation are defined as follows : the magnification is defined as an operator of *, the reduction is defined as an operator of *−, the addition is defined as an operator of +, and the subtraction is defined as operator of −. using such operators , generation of the original data a according to the present invention will now explained in detail . when a hole pattern having a large value 2p ( 1 ) among the distances between holes is considered , a data generation is implemented to decrease a degree of distortion which corresponds to 2p ( 1 ). the original data a is magnified as much as p ( 1 ), and then reduced by p ( 1 ). the value a is further subtracted therefrom . the obtained value l ( 1 ) is represented by equation ( 1 ): in fig2 b , l ( 1 ) is shown as a solid line . for convenience , the original data a is shown as a dotted line in fig2 b . in the next step , a degree of distortion of holes having a distance between holes 2p ( 1 ) is obtained from the above - mentioned equation ( 1 ). a degree of distortion is taken as s ( 1 ). then , the l ( 1 ) is magnified by s ( 1 ). l ( 1 ) magnified by s ( 1 ) is then subtracted from the original data a . the obtained value a ( 1 ) is represented by equation ( 2 ): in fig2 c , a ( 1 ) is illustrated as a solid line and a dotted line represents l ( 1 ). a ( 1 ) is obtained by decreasing a size of the holes by s ( 1 ) toward the neighboring directions with respect to the holes having a distance between the holes less than 2p ( 1 ) in the original data a . therefore , in the holes at the bottom having a distance between holes of 2p ( 2 ), a size of the hole is decreased by s ( 1 ) toward the neighboring directions thereof however , since a degree of distortion of the holes having a distance between the holes 2p ( 2 ) is larger than s ( 1 ), an additional reduction is required . as the same method of processing a to a ( 1 ) data , a ( 1 ) is magnified by p ( 2 )+ s ( 1 ), and then decreased by p ( 2 )+ s ( 1 ). further , the value a ( 1 ) is subtracted therefrom . the result l ( 2 ) is represented by equation ( 3 ): in fig2 d , l ( 2 ) is shown as a solid line and a ( 1 ) is shown as a dotted line . here , a magnification or reduction ratio of a ( 1 ) is p ( 2 )+ s ( 1 ) because a ( 1 ) becomes the original data a by magnifying s ( 1 ) and adjacent holes having a distance between holes 2p ( 2 ) will be connected with each other by magnifying p ( 2 ). that is , the magnification or reduction ratio , p ( 2 )+ s ( 1 ), is a critical value which serves to connect holes having the distance between holes 2p ( 2 ) in the original data a . from the above - described equation ( 3 ), a degree of distortion t ( 2 ) of holes having a distance between holes 2p ( 2 ) is obtained . due to a reduction as much as s ( 1 ) in the step of obtaining a ( 1 ) data , t ( 2 )− s ( 1 ) is additionally decreased therefrom . assuming that t ( 2 )− s ( 1 ) is s ( 2 ), l ( 2 ) is magnified by s ( 2 ). then , the l ( 2 ) magnified by s ( 2 ) is subtracted from a ( 1 ). the obtained value a ( 2 ) is represented by equation ( 4 ): in fig2 e , a ( 2 ) is shown as a solid line and l ( 2 ) is shown as a dotted line . a ( 2 ) denotes the decrease in the hole size as much as s ( 2 ) toward the neighboring directions with regard to the holes having a distance between holes less than 2p ( 2 )+ 2 s ( 1 ) in a ( 1 ) data . therefore , a ( 2 ) is obtained by decreasing the hole size as much as s ( 1 )+ s ( 2 ) toward the neighboring directions with regard to the holes having the distance between holes less than 2p ( 2 ) in the original data a . using above described method , the data generation with regard to mask having three different hole patterns for three intervals of the distance between holes is completed . therefore , a ( 2 ) is determined as final mask data and used to fabricate a desired mask . fig3 is a top view of a photoresist patterned by exposing the photoresist formed on a semiconductor substrate to the light using a mask fabricated in accordance with the a ( 2 ) data , as shown in fig2 e . as shown therein , with regard to all three different hole patterns having different distances between holes , a desired square hole pattern with a side length 1 is obtained . with reference to the above example of a mask having three different values , as shown in fig2 a - 2e , a method of generating mask data will now be explained . in a mask consisting of hole patterns having predetermined size of holes , the distance between holes is represented by 2p ( i ), wherein i is sequentially numbered from 0 to n . the hole patterns are sorted according to 2p ( i ) while the number of sorted hole patterns is n + 1 . a hole having a distance between holes 2p ( 0 ) ( i = 0 ) denotes an independent hole which is sufficiently distanced not to have a proximity effect . although there is no independent hole among the holes formed in the mask , it may be assumed that there is an independent hole for simplicity . the hole pattern of the mask is inputted as the original data a . the original data is generated by considering the hole pattern in an order where i varies from 1 to n . a degree of distortion t ( i ) with regard to respective hole patterns divided in the number n + 1 is represented by equation ( 5 ): therefore , using equations ( 1 ) through ( 4 ) with regard to the distance between holes 2p ( i ), l ( i ), a ( i ) are represented by equations ( 6 ) and ( 7 ), respectively . here , t ( i − 1 ) in equation ( 6 ) corresponds to s ( 1 )+ s ( 2 )+ . . . + s ( i − 1 ) from equation ( 5 ). using the equations ( 6 ) and ( 7 ), with regard to a mask wherein the hole patterns divided in the number n + 1 coexist in accordance with the distance between holes , a ( i ) is obtained in an order of i = 1 to i = n . as a result , a mask data generation is completed by obtaining equation ( 8 ) for a ( n ) as follows : an example of exposure to a light source having the same size as that of the hole in the mask ( i . e . a ratio of exposing to light is 1 ) has been described . this invention is also applicable to exposing to the light with different exposing conditions including a magnification or reduction of mask hole patterns . as described above , in the method of generating mask data according to the present invention , a degree of distortion from a mask hole pattern is considered prior to mask fabrication , and is decreased . thus , a high cost mask , such as a conventional phase shift mask , is not required in the present invention . further , since the data generation is implemented prior to the mask fabrication , the mask is fabricated according to the generated data for preventing a proximity effect . thus , without employing additional processes , a process in the present invention is much simplified comparing to the process of using a conventional anti - reflective coating film . it will be apparent to those skilled in the art that various modifications and variations can be made in the method of generating mask data in fabricating semiconductor devices of the present invention without departing from the spirit or scope of the inventions . thus , it is intended that the present invention covers the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents . | 6 |
although the preferred embodiment of the present invention is disclosed in the context of a stacked capacitor dram fabrication process , it will be appreciated that the principles and techniques herein disclosed may be applied to other semiconductor devices and fabrication processes where a depletion layer capacitance may be encountered such as with polysilicon contacts and interconnects . referring now to fig1 a silicon wafer has been fabricated up to a point having capacitor storage cell ( s ) 11 , for example in a dram memory array . a conventional fabrication process to develop a capacitor cell may develop field oxide regions 14 separating digit lines 16 from the silicon substrate 10 . digit lines are isolated by surrounding dielectric layers 15 . a contact / container opening 17 has been created , thus providing access to active areas 12 . after contact / container opening 17 has been formed , a doped polysilicon layer is deposited to fill container / contact opening 17 , thus forming the polysilicon storage node 18 . the polysilicon layer is often conductively doped using phosphorous ( n - doped ) to densities typically greater than about 10 19 cm - 3 , producing a high conductivity desirable for capacitor electrodes . further , the surface 20 of the polysilicon storage node 18 may be textured by known methods to provide greater surface area , thereby increasing the stored charge . the basic capacitor structure is completed by forming a capacitor dielectric layer 21 , such as silicon nitride ( si 3 n 4 ), over the storage node surface 20 , and a cell plate 22 forming the capacitor counter electrode over the dielectric layer 21 . a common problem encountered in the formation of such capacitors is a parasitic depletion layer capacitance formed in a region 24 of the polysilicon storage node 18 , adjacent to the capacitor dielectric 21 . specifically , in conventional processing , when for example process steps are performed to grow a nitride dielectric layer , elevated process temperatures often ranging between 700 ° c .- 1000 ° c . may cause a dopant out - diffusion from the polysilicon storage node 18 into the dielectric layer 21 . as a result of this out - diffusion , a depletion region 24 in the polysilicon is created adjacent to the cell dielectric . the depletion region may also result from insufficient out - diffusion from a polysilicon electrode substrate into a subsequently formed hsg layer . regardless of its source , the effect of the depletion region 24 is to introduce an additional capacitance , c d ( 26 ) in series with the dielectric capacitance c d ( 28 ) as shown schematically in fig2 . thus , the total capacitance is reduced by the series combination as c = c d c d / c d + c d . as shown in fig3 the capacitance - voltage characteristic 30 of an exemplary storage cell having a depleted layer 24 as shown in fig1 typically displays a reduced capacitance over a range of bias potentials . in the present embodiment , the c - v curve 30 is relatively constant for positive bias voltages , where the capacitance is substantially that of the dielectric . however , for negative bias voltages the capacitance of the storage cell decreases , which is attributed to the polysilicon depletion layer capacitance 26 in series with dielectric capacitance 28 . in accordance with the principles of the present invention the introduction of fixed or immobile charge into the capacitor electrode / dielectric interface region during dielectric deposition contributes substantially to reduce deleterious effects of the polysilicon depletion layer capacitance , thereby increasing charge storage capability of the capacitor . the term fixed charge used herein refers to stationary or otherwise immobile electric charge carriers such as ionized atomic species or bound electronic charge , in contrast to mobile charge carriers which provide charge conduction . a preferred embodiment of a process for introducing fixed charge into the capacitor structure first comprises completing the storage node electrode structure 18 as shown in fig4 . as mentioned earlier , the storage node electrode 18 is basically comprised of conductively doped polysilicon , and preferably has a textured surface morphology 20 providing enhanced capacitance . typically , during processing a native silicon dioxide layer ( not shown ) can easily form at the surface of the polysilicon layer as a result of exposure to the atmosphere . the presence of this native silicon dioxide is considered unsuitable for high performance dram cells and therefore is preferably removed prior to fixed charge formation . one embodiment of the native oxide removal process comprises an ex - situ wet etch followed by an in - situ soft plasma sputter performed using ar + - ion bombardment . an ex - situ wet etch , may for example comprise exposing the oxidized polysilicon surface to an hf / deionized water solution well known in the art . an hf solution selectively etches the silicon dioxide layer , with an etch rate depending upon on solution concentration . typically a 10 : 1 ratio of deionized water to hf at room temperature will yield an oxide etch rate of approximately 10 - 20 nm / min . the etching process may be followed by an alcohol vapor drying step . following the wet - etch cleaning step , a second in - situ soft plasma sputter step is performed , preferably using a vacuum cluster tool apparatus , which enables subsequent in - situ processes in the same vacuum system . the plasma sputtering process is typically performed with a low pressure ar ambient exposed to ionizing rf excitation . the energetic ions bombard the electrode surface , thereby removing a topmost surface layer . while the present preferred embodiment uses soft ar + - ion sputtering , it will be appreciated that other techniques may be used to complete the cleaning of the storage node surface . as illustrated in fig5 a , after providing a clean polysilicon electrode surface , a fixed charge is introduced into the polysilicon surface through a plasma enhanced chemical vapor deposition ( pecvd ) process . this process converts the top 1 - 3 nm of polysilicon to a silicon - rich nitride layer having an embedded fixed charge density . the pecvd process comprises exposing the polysilicon surface 20 to a plasma of a suitable nitrogen - containing process gas at predetermined conditions such as ambient pressure , process gas flow rate , temperature and time . a process gas may for example comprise ammonia ( nh 3 ) or more preferably a mixture of ammonia and nitrogen ( n 2 ). a preferred process may have an nh 3 flow rate of about 50 - 200 sscm and a n 2 flow rate of about 500 - 2000 sscm with a plasma power of about 300 - 500 watts . the storage node surface 20 is exposed to the resulting plasma at temperatures of approximately 400 ° c . for approximately 30 to 200 seconds . the plasma nitridation results in approximately 1 - 3 nm of the polysilicon being converted into a si rich nitride layer having a fixed positive charge distributed in the layer as a result of ionized atomic species . the plasma power and exposure time may be adjusted to change the amount of fixed charge density introduced into the nitride layer . using the present inventive process , an average charge density ranging from 10 12 cm - 2 to 10 13 cm - 2 has been obtained . the layer 32 resulting from the foregoing plasma nitridation process is si x n y which is generally found to be silicon rich and having a net positive fixed charge density q f ( 34 ). as illustrated in fig5 b , subsequent to introducing a layer of fixed charge density 34 into a region of the storage node electrode 18 , the capacitor structure may be completed by conventional process steps . specifically , a capacitor dielectric 33 , such as silicon nitride , may be deposited over and directly contacting the fixed charge layer 32 , followed by formation of a capacitor upper electrode 35 , as described above in the background section . preferably , an oxidation step precedes the formation of the upper electrode 35 , thereby filling any pinholes through the dielectric 33 with silicon oxide . as shown in fig6 presence of a fixed charge ( q f ) results in a change of the capacitance - voltage characteristics such that the undesirable effect of depletion is shifted by approximately δv = q f / c d . preferably such a shift is comparable or greater than the resulting capacitor operational voltage ranges . for example , as a result of the fixed charge density q f the c - v characteristic 30 is shifted to yield the c - v characteristic 36 , which displays a relatively constant capacitance over the operating voltage range . in other words , the undesirable effect is shifted outside the operating range of biasing voltages . the effects of the above disclosed plasma nitridation process on overall cell capacitance is illustrated in fig7 which compares the c - v characteristics of test capacitors having plasma nitridation to that of a corresponding control capacitor having conventional processing ( ie . no plasma nitridation ). c - v curves of similar capacitors having 30 seconds plasma nitridation ( 40 ) and 200 seconds plasma nitridation ( 42 ) clearly display large shifts of the c - v characteristics compared to that of a control capacitor having no fixed charge ( 38 ). there is however , an observable decrease in cell capacitance for the capacitors having plasma nitridation as shown by the curves 40 and 42 . this decrease is believed to be caused by surface smoothing from the plasma nitridation process and a possible lower dielectric constant from the non - stoichiometric nitride interlayer . thus , an optimum plasma nitridation process would represent a balance between the magnitude of the fixed charge density introduced by the plasma nitridation process and any consequent capacitance attenuation . for example , a series of c - v test curves such as shown in fig7 will readily determine a maximal average capacitance over a predetermined voltage range , thus determining an optimal time for plasma nitridation . while preferred embodiments of this invention have been disclosed herein , those skilled in the art will appreciate that changes and modifications may be made therein without departing from the spirit and scope of the invention as defined in the appended claims . | 7 |
in the above general formula i illustrative examples of straight or branched alkoxy groups having from 1 to 4 carbon atoms are methoxy , ethoxy , n - propoxy , isopropoxy , and n butoxy . illustrative examples of straight or branched alkyl groups having from 1 to 4 carbon atoms are methyl , ethyl , n - propyl , isopropyl , and n - butyl . by virtue of the basic nitrogen atom in the tetrahydropyridine ring , the compounds of the present invention form pharmaceutically acceptable acid addition salts with organic and inorganic acids . examples of suitable acids for the formation of pharmaceutically acceptable salts are hydrochloric , sulfuric , phosphoric , acetic , benzoic , citric , malonic , salicylic , malic , fumaric , oxalic , succinic , tartaric , lactic , gluconic , ascorbic , maleic , aspartic , benzenesulfonic , methane - and ethanesulfonic , hydroxymethane -, and hydroxyethanesulfonic , and the like ( see , for example , &# 34 ; pharmaceutical salts &# 34 ;, j . pharm . sci . 1977 ; 66 ( 1 ): 1 - 19 ). the compounds of the present invention as represented by general formula i are prepared as outlined in the general reaction scheme set forth below wherein the various substituents ar , r 1 , and r 2 have the meanings defined in formula i and x is halogen , for example , chlorine or bromine . ## str4 ## the pyridine carboxaldehyde ( 1 ) and aryl ketone ( 2 ) are reacted in water in the presence of sodium hydroxide at room temperature to give the 1 - aryl - 3 -( 3 - pyridinyl )- 2 - propene - 1 - one ( 3 ) which is hydrogenated in a parr hydrogenation apparatus using , for example , 10 % palladium on barium sulfate to give the pyridinylpropanone ( 4 ). the pyridinylpropanone ( 4 ) is reacted with an appropriate hydroxylamine of the formula nh 2 or 2 · hx wherein r 2 and x have the meanings defined above to give the oxime ( 5 ), which is alkylated in , e . g ., acetonitrile with a reagent of the formula r 1 x wherein r 1 and x have the meanings given above to give the quaternary salt ( 6 ). the iodate is reduced with a metal hydride such as sodium borotetrahydride to give the products ( 7 ) and ( 8 ). the following specific examples further illustrate the synthesis of compounds of the present invention . to a suspension of 3 pyridinecarboxaldehyde ( 18 . 9 ml , 0 . 20 mol ) and acetophenone ( 23 . 4 ml , 0 . 20 mol ) in 200 ml water at room temperature with vigorous stirring was added dropwise 5 % aqueous sodium hydroxide ( 200 ml ) over a 45 - minute period . the reaction mixture was stirred for 12 hours . white solid was formed during the reaction . dichloromethane ( 500 ml ) was added to dissolve the solid . the organic layer was separated , washed with water ( 300 ml × 3 ), and dried over anhydrous sodium sulfate . after the drying agent and solvent were removed , the crude product was recrystallized to give the title compound as yellow solid ( 35 . 62 g , 85 %), mp 113 °- 114 ° c . to a solution of 3 ( 3 - pyridinyl )- 1 phenyl - 2 - propen - 1 - one ( 24 . 8 g , 0 . 12 mol ) in 400 ml tetrahydrofuran was added 10 % pd / baso 4 ( 2 g ). the slurry was hydrogenated at room temperature on a parr hydrogenation apparatus . the reaction was monitored by pressure drop . the hydrogenation was complete after 40 minutes . after the catalyst was filtered off on celite , the solvent was removed under vacuum to give a dark brown oil . the crude product was purified on flash silica gel column using a gradient eluent system ( ch 2 cl 2 → meoh -- ch 2 cl 2 , 3 : 97 ) to furnish the title compound as a pale yellow solid ( 22 . 54 g , 91 %), mp 86 °- 87 ° c . 3 -( 3 - pyridinyl )- 1 phenylpropan 1 - one ( 6 . 34 g , 0 . 03 mol ) and hydroxylamine hydrochloride ( 4 . 17 g , 0 . 06 mol ) was dissolved in methanol ( 100 ml ). the mixture was refluxed for 12 hours . the solvent was removed under vacuum . the residue was stirred in a mixture of dichloromethane ( 150 ml ) and 10 % aqueous sodium carbonate ( 150 ml ). the aqueous layer was separated and extracted with dichloromethane ( 200 ml × 3 ). the combined organic layer was dried over anhydrous sodium sulfate . after the drying agent and solvent were removed , the crude product was purified on a silica gel column using a gradient eluent system ( ch 2 cl 2 → meoh -- ch 2 cl 2 , 5 : 95 ) to afford the title compound as a white solid ( 5 . 97 g , 87 . 9 %), mp 107 °- 108 ° c . to a solution of 3 -( 3 - pyridinyl )- 1 - phenylpropan - 1 - one oxime ( 4 . 79 g , 0 . 021 mol ) in acetonitrile ( 50 ml ) was added 1 - iodopropane ( 3 . 10 ml , 0 . 032 mol ). the mixture was then refluxed for 12 hours . solvent was removed to dryness under vacuum to give a dark brown oil ( 8 . 46 g , 100 %). the crude product was used in the next step without further purification . to a 100 - ml round - bottom flask containing mixed solvent of methanol and water ( 1 : 1 , 150 ml ) at 0 ° c . was added powdered sodium borohydride ( 1 . 59 g , 0 . 042 mol ) followed immediately by addition of a solution of 3 -[ 3 -( hydroxyimino )- 3 - phenylpropyl ]- 1 - propylpyridinium iodide ( 8 . 46 g , 0 . 021 mol ) in methanol ( 200 ml ). the mixture was stirred for an additional 3 hours and allowed to warm to room temperature . solvent was removed to dryness under vacuum . the residue was dissolved in dichloromethane ( 200 ml ) and water ( 200 ml ). the aqueous layer was separated and extracted with dichloromethane ( 150 ml × 3 ). the combined organic layer was dried ( sodium sulfate ) and the solvent removed to give a mixture of the title compounds as brown oil . the compounds were separated ( silica gel column ) and converted to their respective oxalic salts . the salts were recrystallized from isopropanol to give ( a ) 1 phenyl - 3 -( 1 , 2 , 3 , 6 - tetrahydro - 1 - propyl - 3 - pyridinyl )- 1 - propanone oxime oxalate ; white solid , 3 . 27 g , mp 212 °- 213 ° c ., and ( b ) 1 - phenyl - 3 -( 1 , 2 , 5 , 6 - tetrahydro - 1 - propyl - 3 - pyridinyl )- 1 - propanone oxime oxalate ; white solid , 1 . 42 g , mp 201 °- 205 ° c . when in the procedure of example 1 ( a ) an appropriate amount of p - methoxyacetophenone was substituted for acetophenone , the above 2 ( a ) compound was obtained . yield : 65 . 7 %, mp 113 °- 114 ° c . when in the procedure of example 1 ( b ) an appropriate amount of compound 2 ( a ) was substituted for 3 -( 3 - pyridinyl )- 1 - phenyl - 2 - propen - 1 - one , the above 2 ( b ) compound was obtained . yield : 92 %, mp 76 °- 78 ° c . when in the procedure of example 1 ( c ) an appropriate amount of the 2 ( b ) compound was substituted for 3 -( 3 - pyridinyl )- 1 - phenylpropan - 1 - one , the above compound 2 ( c ) was obtained . yield : 96 . 1 %, white crystal , mp 101 °- 102 ° c . when in the procedure of example 1 ( d ) an appropriate amount of compound 2 ( c ) was substituted for 3 -( 3 - pyridinyl )- 1 - phenylpropan - 1 - one oxime , the above 2 ( d ) compound was obtained as an oil and was used in the next step without further purification . when in the procedure of example 1 ( e ) an appropriate amount of compound 2 ( d ) was substituted for 3 -[ 3 -( 1 - propylpyridiniumyl )]- 1 - phenylpropan - 1 - one oxime iodate , the title compound was obtained . ( a ) 1 -( 4 - methoxyphenyl ) 3 -( 1 , 2 , 3 , 6 - tetrahydro - 1 - propyl - 3 - pyridinyl )- 1 - propanone oxime oxalate ; white solid ( 1 . 48 g ), mp 175 °- 177 ° c . ( b ) 1 -( 4 - methoxyphenyl - 3 -( 1 , 2 , 5 , 6 - tetrahydro - 1 - propyl - 3 - pyridinyl )- 1 - propanone oxime oxalate ; white solid ( 2 . 57 g ), mp 173 °- 176 ° c . the utility of the compounds of the present invention is demonstrated by various in vitro studies . sigma binding affinities are measured using [ 3 h ]-(+)- 3 -( 3 &# 39 ;- hydroxyphenyl ) n ( 1 &# 39 ;- propyl ) piperidine , referred to in the following table i as 3ppp . this test is carried out according to the procedures of b . l . largent , et al , proc . natl . acad . sci ., usa , 1984 ; 81 : 5618 . the affinity of the compounds of the present invention for dopamine receptors was determined in vitro with the dopamine antagonist [ 3 h ] spiperone according to the procedure of s . urwyler , et al , j . neurochem . 1986 ; 46 : 1058 . the ability of the compounds to bind muscarinic antagonist sites was determined in vitro using [ 3 h ]- quinuclidinyl benzylate ( rqnb ) according to the procedure of m . watson , et al , j . pharmacol . exp . ther . 1986 ; 237 : 411 . the test results are set forth below : table i______________________________________example [. sup . 3 h ] 3ppp rqnb rbspnumber ic . sub . 50 nm % inhib at 10 . sup .- 6 m ic . sub . 50 nm______________________________________1 ( e )( a ) 2 . 07 27 % & gt ; 10001 ( e )( b ) 1 . 99 10 % & gt ; 10002 ( e )( a ) 6 . 49 6 % & gt ; 10002 ( e )( b ) 2 . 39 9 % & gt ; 1000______________________________________ in therapeutic use as agents for treating depression , psychoses , or inflammation , the compounds utilized in the pharmaceutical method of this invention are administered to the patient at dosage levels of from 0 . 7 to 7000 mg per day . for a normal human adult of approximately 70 kg of body weight , this translates into a dosage of from 0 . 01 to 100 mg / kg of body weight per day . the specific dosages employed , however , may be varied depending upon the requirements of the patient , the severity of the condition being treated , and the activity of the compound being employed . the determination of optimum dosages for a particular situation is within the skill of the art . for preparing pharmaceutical compositions from the compounds of this invention , inert , pharmaceutically acceptable carriers can be either solid or liquid . solid form preparations include powders , tablets , dispersible granules , capsules , cachets , and suppositories . a solid carrier can be one or more substances which may also act as diluents , flavoring agents , solubilizers , lubricants , suspending agents , binders , or tablet disintegrating agents ; it can also be an encapsulating material . in powders , the carrier is a finely divided solid which is in a mixture with the finely divided active component . in tablets , the active compound is mixed with the carrier having the necessary binding properties in suitable proportions and compacted in the shape and size desired . for preparing suppositories , a low - melting wax such as a mixture of fatty acid glycerides and cocoa butter is first melted , and the active ingredient is dispersed therein by , for example , stirring . the molten homogeneous mixture is then poured into convenient sized molds and allowed to cool and solidify . powders and tablets preferably contain between about 5 % to about 70 % by weight of the active ingredient . suitable carriers are magnesium carbonate , magnesium stearate , talc , lactose , sugar , pectin , dextrin , starch , tragacanth , methyl cellulose , sodium carboxymethyl cellulose , a low - melting wax , cocoa butter , and the like . the term &# 34 ; preparation &# 34 ; is intended to include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component ( with or without other carriers ) is surrounded by a carrier , which is thus in association with it . in a similar manner , cachets are also included . tablets , powders , cachets , and capsules can be used as solid dosage forms suitable for oral administration . liquid form preparations include solutions suitable for oral or parenteral administration , or suspensions , and emulsions suitable for oral administration . sterile water solutions of the active component or sterile solutions of the active component in solvents comprising water , ethanol , or propylene glycol may be mentioned as examples of liquid preparations suitable for parenteral administration . sterile solutions may be prepared by dissolving the active component in the desired solvent system , and then passing the resulting solution through a membrane filter to sterilize it or , alternatively , by dissolving the sterile compound in a previously sterilized solvent under sterile conditions . aqueous solutions for oral administration can be prepared by dissolving the active compound in water and adding suitable flavorants , coloring agents , stabilizers , and thickening agents as desired . aqueous suspensions for oral use can be made by dispersing the finely divided active component in water together with a viscous material such as natural or synthetic gums , resins , methyl cellulose , sodium carboxymethyl cellulose , and other suspending agents known to the pharmaceutical formulation art . preferably , the pharmaceutical preparation is in unit dosage form . in such form , the preparation is divided into unit doses containing appropriate quantities of the active component . the unit dosage form can be a packaged preparation , the package containing discrete quantities of the preparation , for example , packeted tablets , capsules , and powders in vials or ampoules . the unit dosage form can also be a capsule , cachet , or tablet itself , or it can be the appropriate number of any of these packaged forms . | 2 |
microscope configuration . in a microscope configuration , the light emitting array can be configured in a trans - or epi - illumination manners . referring to fig1 , in one embodiment arranged for trans - illumination , a light source array 2 which includes electronic control circuitry is mounted on an adjustable stage 1 which is arranged to allow fine tuning of the position of the light source array . a lens system 3 comprises an array of lenses each associated with one of the light sources , and a further lens located below the light source array 2 through which light from all of the sources passes downwards . focusing optics 7 in the form of a further lens 7 are arranged to focus the light from the lens system 3 downwards onto a holder 8 which is arranged to hold sample cells . a microscope objective lens 9 is located below the holder 8 and microscope internal mirrors 12 are arranged to direct light from the objective lens 9 to a microscope eyepiece and camera 11 . a fluorescent light source 10 for the microscope is also provided and a fluorescent light filtering unit 13 is located between the objective lens 9 and the internal mirrors 12 to direct fluorescent light from the fluorescent light source 10 up through the objective lens 9 to the underside of the holder 8 . an illumination light source 4 is also provided and a half mirror 5 between the light source lens system 3 and the adjustable optics 7 is arranged to direct light from this illuminating light source 4 down on to the sample cells on the holder 8 . a patch clamp electrophysiology unit 6 is arranged to detect the response of the sample cells to the optical stimulation of the stimulating light source 2 . a control system comprises a data acquisition unit 14 arranged to receive image data from the camera 11 , cell response data from the patch clamp unit 6 , data regarding the position of the holder 8 , data from the adjustable stage 1 indicative of the position of the light source array 2 . the control system is also arranged to control the lights sources in the array 2 , being able to switch each of the light sources on and off independently . in this arrangement , the array of light sources 2 can be imaged using the light source and focusing lenses 3 , 7 in a relay arrangement . the light is coupled to the optic path of the microscope with optics such as beam splitter , dichromic mirror or semi - transparent mirror . the position of the array 2 can be fine tuned with the 3d positioning stage 1 either manually with a screwing mechanism or electronically with a piezo or motorized stage under control of the control system 15 . in this trans - illumination embodiment the array of light spots is coupled to the optic path of the microscope light source using a beam splitter or semitransparent mirror 5 for example . the second lens 7 is placed after the beam splitter 5 and can be used also as a condenser for the light from microscope lamp 4 . in case of a phase - contrast microscopy , a condenser annulus mask is placed near this lens . referring to fig1 b , in which components corresponding to those in fig1 a are indicated by the same reference numerals , in epi - illumination the array 2 is coupled to one of the microscope ports . the array 2 can also share a port with other devices such as camera 11 or epi - fluorescent light source 10 . in the case of an array - camera configuration , a beam splitter , dichromic mirror or a semi - transparent mirror 12 is used to couple the array light to the optic path . the emission filter is then placed in front of the camera 11 ( instead of in the filter box 13 next to the objective lens ) so the light from the array 2 is not filtered out . when the array 2 is sharing a port with epi - fluorescent source 10 , the beam splitter 12 is used to couple the array light to the optic path of the epi - fluorescent light . in this case , the excitation and nd filters are placed near the epi - fluorescent light source 10 before the beam splitter so they will not filter out the light from the array 2 . a long pass filter removes the blue light from the illuminator in order to image the cells without invoking stimulation . enhancement components . micro - lens on each micro emitter , forming part of the lens system 3 , can be used to increase the effective fill factor of the array 2 and hence may be useful in allowing the smaller fill factor . photonic crystal structures can be used to improve the extraction coefficient of the light from each emitter . since the radiation efficiency typically decreases with temperature , a cooling system based for example on fan or thermoelectric effect can be introduced to maintain high efficient functioning . multi - cell and sub - cellular resolution . the diameter of a single illumination spot generated in the systems of fig1 a and 1b is typically 20 to 50 micrometers . using a 1 : 1 magnification , each light spot covers approximately a single cell . this arrangement enables simultaneous patterned stimulation of thousands of cells . alternatively , each spot of light can be de - magnified by further lenses included in the system so that hundreds of light spots cover a single cell . in this case , stimulation with sub - cellular resolution can be achieved . this can be very useful for fundamental study of neuron functions and single cell computing . multiple wavelengths configuration . in some cases it is beneficial to illuminate multiple arrays that have different wavelengths . this can be used for example to trigger both channelrhodopsin ( chr2 ) and halorhodopsin ( nghr ) independently . a multiple array configuration can be realized for example by stacking multiple beam splitters or dichromic mirrors in the optic path and coupling light array per splitter . the splitters or dichromic mirrors can be designed to reflect just one specific wavelength of one of the light source arrays , and not the wavelength or wavelengths from the other array or arrays . in this way , the optics from a single array is not affecting the light from other arrays with different wavelength . referring to fig2 , in one such embodiment which is an epi illumination system , a microscope comprises a housing 15 having a fluorescent light input 17 in one side , an output 18 to an eyepiece and a port 11 , which can be a side , rear , back or bottom port . a sample holder 16 is provided in this embodiment on top of the housing 15 and an objective lens 14 is located beneath the holder 16 . a fluorescent light filter 13 is arranged to direct light from the fluorescent light source 17 into the light path of the microscope and to filter fluorescent light from the output . a half mirror 7 between the filtering unit 13 and the output 18 splits the light path between the output 18 and the port 11 . microscope port optics 12 are provided adjacent to the port 11 . an led stimulation unit comprises a housing 10 with two stimulating light source arrays 2 each with associated optics 3 , 4 and mounted on adjustable stages 1 . the two arrays are arranged to generate light of different respective wavelengths . a lens 9 is provided adjacent the port connector 11 at one end of the unit and a camera unit 5 at the other end . half mirrors 6 , 7 , one of which 6 forms part of a light filtering unit , are arranged to introduce images of the light source arrays 2 into the light path of the system between the camera 5 and the port 11 . the half mirrors 6 , 7 are mounted on an adjustable stage 8 which enables the optical focus of the system to be optimized . referring to fig3 , a top illumination multi - wavelength system is similar to that of fig2 . the microscope 15 is set up in the same way , and corresponding components are indicated by the same reference numerals , except that the led stimulation unit is arranged above the sample holder 9 . the stimulation unit is essentially the same as that of fig2 , with corresponding components indicated by the same reference numerals except that the fluorescent light input , still through the side port of the microscope , is indicated as 11 . stand - along configuration . in another configuration the cells or tissue is placed directly above the light emitter array . this approach can be useful for long stimulation experiments whereby the cells are grown for long periods of time , for example in an incubator . in this configuration , all the electronics and the emitter array are packaged in a manner that keeps them safe from humidity or water drops . the light from the emitters is coupled out through a transparent window in the package . in that case , the cells are cultured on a cover slip , or a special stimulating chip that have a mini ring to contain cell medium with components to perfuse medium and maintain temperature . there may also be a cover to provide additional protection against evaporation of cell medium . in this case the packaging box of the stimulation platform fits exactly above the light emitters . in - vivo configuration . the same platform can be used for in - vivo photo - stimulation . the advantage of this technique is that it enables multi - site in - vivo stimulation with micrometer spatial resolution . such a configuration can be used for imaging live animals in a modified microscope setup . the emitter array is imaged on the body or organ using micro lenses or lenses relay . alternatively long working distance lenses can be used to focus the light from a distance onto the target area , e . g . the brain . in this case a clamping system is required to keep the leds stationary relative to the target area . the control and driving circuitry can be kept separate from the light emitter for better compatibility . referring to fig4 , the light source 2 in each of the embodiments described may be an array of micrometer high - power light emitters in the visual and uv region . one example is a micro - led array based on nitride semiconductors such as aluminium - nitride ( aln ), gallium - nitride ( gan ), indium - nitride ( inn ) and their alloys . using these semiconductors leds in the entire visible range and deep uv wavelengths can be potentially realized . since the band structure of these semiconductors has a direct band gap across the entire alloy range , it allows the nitride - based leds to exhibit high quantum efficiencies that together with their narrow spectral emission enables high brightness which is essential for the current application . the leds 1 are arranged in an array on a chip , supported on a substrate 4 , with a micro - optical component such as a micro - lens 2 over each of them . control electronics 3 for controlling the leds 1 is provided , for example on the back of the substrate 4 in a flip chip arrangement . for example , a 64 by 64 matrix - addressable and a 120 × 1 stripe addressable micro - pixelated nitride based light emitting diodes that have been developed under the rcuk basic technology project , and their applications have been previously demonstrated ( v . poher , n . grossman et al . 2008 ). it can have a matrix addressed or flip - chip configuration . another example is an array of micro lasers such as vertical - cavity - surface - emitting - lasers ( vcsels ), or array of organic light emitting diodes ( oleds ). the light source for some embodiments of this invention comprises an array or bright light emissive diodes , but can alternatively come from vcsel laser or other light emitting products . however , the circuitry generally follows the same principles . the light emission can be controlled independently for each of the array of light sources by applying a specific voltage and allowing the device to determine the current . alternatively , it is possible to drive the device at a specific current and allowing the device to determine the voltage . the difference is subtle but important . as the generated photons result from the current injection , generally a much more linear and stable light emission characteristic is achieved by operating in current source mode rather than voltage source . the total number of photons hitting the target is related to the integral of the intensity with time . thus the effective intensity can be varied by varying either the intensity or the illumination pulse time , or both . in most cases the most convenient implementation is to pulse the light at the maximum intensity and simply vary the duration of the pulse . the light emitters in one embodiment are passively driven via raster scan control , as can be seen in fig5 ( b ) . in this case , the emitters are arranged on a gan led chip 7 each having a respective control wire 3 enabling it to be controlled , with minimum requirement for control electronics built in . instead a simple raster of the rows is required while turning on specific desired columns . the raster control can be performed via digital or analog logic components making up control electronics 8 , but generally programmable digital logic such as an fpga is the most cost - effective . a circuit board can house individual power components and provide discrete current sources if required . the passive array is simple to implement but has limitations in that only one row can be illuminated at a time which reduces the overall potential integral illumination intensity when scanning the whole array . for this reason , active control , whereby each light source has its own continuous control is optimum . however , most led and vcsel configuration are limited in terms of the electronic components which can be integrated on the chip . thus , external controller chips need to be used . however , the number of input lines which can be addressed from external chips is limited . thus the optimum configuration is for a cmos chip to be sandwiched with the light emitting chip , whereby individual control lines for each light emitter can be addressed through a matrix of connection points . such an active array , as shown in fig5 ( a ) which comprises an active driver chip 6 which is flip - chip bonded to the gan led chip . the arrangement has space to allow for individual control electronics per pixel , as well as an information stream decoder and line and column control electronics 1 . the simplest arrangement is for a memory unit such as a flip flop 4 at each pixel to be connected to a gate which allows current through the light emitter . in this case a raster or asynchronous address event system can be used to turn individual pixels on and off . decoder circuitry in the side of the chip can be used to decode desired oscillation frequencies into required address events or rastered updates of status . other configurations include oscillator circuitry with or instead of the memory unit 4 which can change the current or voltage control level , either with digital or analog circuitry . further to the specific circuitry , as multiple pixels will be illuminated at any one time , each of the individual pixels is also provided with its own current source 2 so as not to divide the current between pixels and thus vary the illumination intensity according to the number of pixels which are on . in both the passive and active cases an electronic communication protocol will be required for the circuit to communicate with the computer . this may be a wired serial interface such as usb , parallel such as gpib - 488 , or wireless such as 802 . 11g . cooling structures such as heat sinks and peltier cooling can be applied to the led / control chip combination in order to reduce the temperature of gan led &# 39 ; s and vcsel &# 39 ; s . the reduced temperature increases efficiency and thus brightness . this may not be necessary where oled light emissive structures are incorporated . in some configurations , the led illumination unit and control components may be enclosed in a humidity proof case to allow operation in humid environments such as that required for long term recording . requirements . the optic system must provide the required spatial profile and sufficient irradiance for very light intensity demanding photo - stimulation processes . in addition , other factors such as appropriate working distance to accommodate for example the recording patch clamp probes , microelectrodes recording module and perfusion chambers must be taken into account . moreover , the compatibility with the normal functions of the microscope such as fluorescent illumination and imaging must be considered . design consideration . led sources have in general lambertian emission profile ( the light is emitted into a solid angle of 2π steradians and the radiant intensity is proportional to the cosine of the angle relative to the surface normal ). in order to collect as much light as possible from the led the imaging system should then have as large input na as possible . for a small lambertian source the collection efficiency η of a lens having a na is given by η ≈ na 2 . for example , a lens with a na of 0 . 5 will collect 25 % of the total emission from the led . progressing through the optical projection system , the lagrange invariant states that the brightness ( power per unit area per unit solid angle ) can never be increased beyond that of the object or rather that collected from the object by the input na of the system . however , if the image is de - magnified then the output na will be larger than the input na ( the magnification , m , is the ratio of the input na to the output na ) and thus because the solid angle of illumination is increased the absolute irradiance ( power per unit area ) is then increased by 1 / m 2 . it is this irradiance ( power per unit area ) that is important for photo - stimulation . the trade - off in this case is that a smaller field of view is covered by the projected image and inevitably the working distance is reduced because of the use of higher na optics . when the system is first put in place and later after adjustments , the total illumination of the photons hitting the sample can be measured with a calibrated photodiode . then the variance of the intensity for each of the light spots can be measured using a professional camera with calibrated pixel responses . a computer algorithm then simply calculates the total intensity and divides by the spatial integral of the relative pixel intensities from the digital imager to find the base pixel intensity . this can be then multiplied by each individual pixel intensity to determine the exact amount of light flux passing through that point , i . e . for each light spot and hence each light source in the array . a feedback algorithm ideally controlling intensity can then be used to achieve a flat distribution of light flux over the light source array . a similar approach can be used when the control system is arranged to intersect or combine the image of the light spots with the image of the neuron thereby to determine how much light is shining on each point on the cellular surface . this information can be used in a feedback loop with the cells such that when a desired response or action potential frequency is required at one of the cells or one point on a cell , the feedback loop will automatically adjust signalling to the light emissive electronics until the requirement is met . the stimulus patterns and the corresponding responses of the cells recorded by the electrodes or calcium imaging are in some embodiments fed to a data processing unit that compares the performance in real time and uses it to modify in real time the stimulus . for example if a series of 10 spikes in 10 hz is wanted from cell x , the driving circuit generates a corresponding pulse train of current , each pulse with a peak that is enough to trigger signal in the cell . both the timing of the stimulus and the corresponding response are fed to a data - processing unit that compares the results . if in this case it found that , for example , the second and third pulse did not generate signals it will immediately send a command to increase the stimulus of the next pulse till the desired response is achieved . the closed - loop feature can be useful for memory and plasticity studies in neurons as well as for real neuron - computer communication . using this bilateral communication channel a neuronic chip a neuron computer or an in - vitro ‘ brain ’ can be developed . in order to use micro - led array devices for photo - stimulation and simultaneous electrical recording of nerve cells the system shown schematically in fig1 can be used . the system is constructed around an inverted microscope for sample imaging and alignment . the mea system is mounted on the stage of this microscope and the photo - stimulation is provided by mounting the led array and projection optics in a trans - illumination position above the stage . ancillary electronics including led driver and mea instrumentation are controlled by a computer , which can adjust the stimulation and record the nerve cell response as required . commercially available mea recording systems typically consist of a matrix of indium tin oxide electrodes on a glass substrate , coated with titanium nitride at the stimulation / recording points . non - stimulating areas are passivated with silicon nitride . the array is thus fairly transparent to both trans - illuminated and epi - illuminated light . the inter - electrode spacing is typically between 100 μm and 500 μm . typical electrode tip size of the microelectrodes is between 10 μm and 20 μm , and the electrodes are arranged in an 8 × 8 array . a blue 120 × 1 stripe micro - led gan based light emitting diodes that was developed under the rcuk basic technology project ( v . poher , n . grossman et al . 2008 ) was used to stimulate action potentials in hippocampal neurons that were photosensitized with chr2 . the neurons were obtained from rats on embryonic day 18 and grown for 12 days in vitro . the photosensitization was achieved by transfecting the cells with chr2 . responses from single cells were recorded with a standard patch clamping setup ( heka epc10 double patch clamp amplifier , operating with heka pulse software ). a long working distance 1 : 1 4f relay is based on two 50 mm triplet lenses ( sill optics gmbh s5lpj2851 ). this system although not diffraction limited , has peak to valley aberrations of less than 1 . 5 waves across the entire field and more than 90 % of the light collected from a 17 μm diameter emitter is contained within a 32 μm diameter circle at the image plane . the working distance of this arrangement is 40 mm allowing good access to an mea or patch - clamping . the results show a unique spatio - temporal resolution can be seen in fig6 and demonstrate single cells with sub - cellular resolution . a neuron expressing gfp and chr2 was fluorescently imaged and 3 light spots from the led source shone on sub - cellular components . the system automatically calculated the light distribution on each part of the neuron . fig6 [ 1 ] shows a fluorescent image of a neuron , fig6 [ 2 ] shows and image of light spots from the led , and fig6 [ 3 ] shows the intersection of the light spots over the neurons , which gives an exact distribution of the light intensity hitting each part of the neuron . banghart , m ., k . borges , et al . ( 2004 ). “ light - activated ion channels for remote control of neuronal firing .” nature neuroscience 7 ( 12 ): 1381 - 1386 bernardinelli , y ., c . haeberli , et al . ( 2005 ). “ flash photolysis using a light emitting diode : an efficient , compact , and affordable solution .” cell calcium 37 ( 6 ): 565 - 572 . nikolic , k ., p . degenaar , et al . ( 2006 ). modeling and engineering aspects of channelrhodopsin 2 system for neural photostimulation . engineering in medicine and biology society , 2006 . embs &# 39 ; 06 . 28th annual international conference of the ieee . v . poher , n . grossman , et al . ( 2008 ). “ micro - led arrays : a tool for two - dimensional neuron stimulation .” journal of physics d : applied physics 41 . zhang , f ., l .- p . wang , et al . ( 2007 ). “ multimodal fast optical interrogation of neural circuitry .” nature 446 ( 7136 ): 633 - 639 . | 6 |
the competitive saprophytic ability ( csa ) of strains of trichoderma spp . was determined by the modified cambridge method ( sensu garrett , s . d . pathogenic root infection fungi . cambridge university press , london ( 1970 )). two rhizosphere - competent mutants of tharzianum ( t - 95 and t - 12b ) had higher csa indices than four rhizosphere - incompetent trichoderma spp . and strains . csa was directly correlated with rhizosphere competence . when the strains were grown for 6 days on czapek dox broth with cellobiose , carboxy methyl cellulose , or cotton linters as sole sources of carbon , mutants produced more cellulase than the wild types . the amount of cellulase produced by these strains was directly correlated with csa and rhizosphere competence . rhizosphere competence of the mutants , therefore , can be at least partially explained by their capacity to utilize cellulose substrates associated with the root . it should also be noted that the above noted trichoderma are benomyl - tolerant . tests for rhizosphere competence . various methods have been employed to test rhizosphere competence . these were primarily based on a comparison of the numbers of cfu of microorganisms in the soil associated with roots to population densities in non - rhizosphere soil . the rhizosphere competence assay used in this research effort was developed to improve measurement in time and space of the activity of potential rhizosphere inhabitants . certain criteria were demanded by the experimental questions to be examined . quantitative analysis of population densities at each depth of root was necessary . no water was added during incubation obviating the possibility of propagules being washed into the rhizosphere . to test whether the agent introduced from a seed into the rhizosphere could compete under typical ecological condition , raw soil was used . therefore , the system allowed rhizosphere competence to be measured on the basis of cfu / mg or g of rhizosphere soil as a function of root depth . the nature and quantity of root exudates have been analyzed in the past in axenic systems by use of perfusion and filter paper absorption techniques . since such analyses often are obtained under gnotobiotic conditions , it is difficult to extrapolate such findings into the ecological conditions present in the rhizospheres of plants growing in raw soil . to overcome this objection , bioassays relating relative magnitudes of microbial population densities in the rhizosphere compared with non - rhizosphere soil were developed , the r / s ratio . such analyses are subjected to many variables and , at best , provide only a relative gross assay of the activity of the total biomass about the root . the rhizosphere competence assay provided a quantitative measurement of a specific rhizosphere - competent microorganism at the root tip where exudates are in relatively high concentration . in more mature portions of the root , however , interpretations based on population densities are confounded by maturation of the agent resulting in propagule production , various interaction leading to auto - or heterolysis , or changes in characteristics of substrates provided by senile tissues of the root . nevertheless , the rhizosphere competence assay provides the best bioassay yet developed for the rhizosphere nutrient at root tips . it has potential for use in a wide variety of experimental problems related to ecological and nutritional interactions in the rhizosphere . several species of trichoderma were tested for rhizosphere competence by coating the seed with each isolate and following population densities of the fungus to a root depth of 8 cm . no species grew to greater depth than 2 cm . this confirms the conclusions of other workers that trichoderma spp . are not rhizosphere - competent . additional evidence for rhizosphere competence of strain t - 95 was obtained by microscopic observations comparing the length of hyphae on root originating from seeds coated with or without conidia of the fungus . of course , it was not possible to identify with certainty the hyphae of t - 95 ; however , the total length of hyphae observed was relatively similar to the cfu obtained by use of the rhizosphere competence assay . roots were essential for colonization below the site ( seed ) where the strains of trichoderma were applied . the wild type was recovered at low densities to a 4 - cm depth ; mutants were recovered at all depths of rhizosphere sand when applied to seed . neither the wild type nor a mutant was recovered below the glass beads . our particular rhizosphere - competence assays were conducted as follows . polypropylene centrifuge tubes ( 28 . 6 by 103 . 6 mm ) were sliced longitudinally into two halves . each half was filled with moistened soil (- 0 . 03 bars ) and pre - incubated for 48 hours in plastic bags . one treated seed was placed on the half - tube 1 cm below the rim . the unseeded half - tube was placed on the first half and secured with rubber bands . tubes were completely randomized and lots in portions of six each were placed vertically in 10 cm diameter plastic pots . soil , previously moistened to - 0 . 03 bars and of the same ph as in the tubes , was added to the pots so that the length of the tube was surrounded by the soil , with the top 1 cm of each tube uncovered . no water was added to the tubes or the pots after seed were sown . pots were covered with plastic bags to maintain constant matric potential leaving enough space above the tubes for the plants to grow . pot were placed under constant illumination supplied by 10 white , 40 - watt , 120 cm long fluorescent lamps ( approximately 5000 lux ), at desired temperatures . after 8 days , or as desired by the experiment , tubes were removed from the pots . after the unseeded half of a tube was carefully lifted , the roots in he seeded half , starting from the crown , were excised in 1 cm segments with a sterile scalpel . the scalpel was flamed between cuts . after loosely adhering soil was shaken off root segments with their adhering rhizosphere soil were air dried under a 100 - watt lamp for 30 minutes . each unit was weighed and transferred to a 20 ml glass vial containing 1 ml sterile distilled water . the contents of the vial were stirred vigorously with a sterile spatula . the colony forming units ( cfu ) of trichoderma contained in the rhizosphere soil at each cm of root were determined by plating a series of 10 - fold dilutions from the vial of trichoderma - selective medium . root segments were removed from the dilution flask , blotted on paper towel and weighed to determine the dry weight of rhizosphere soil removed through washing . in experiments where sand was substituted for soil and glass beads were coated with conidia , what would have been rhizosphere sand was sampled after 8 days and treated as explained above . plates were incubated at 25 ° c . for 5 days . counts of trichoderma cfu per mg rhizosphere soil for each root segment were made with six replicates per treatment . all experiments were repeated twice . microscopic observation of roots . root segments with rhizosphere soil were placed in multi - well tissue culture plates . one - half ml of an aqueous 0 . 3 % calcofluor solution ( calcofluor white m2r , polysciences , inc ., warrington , pa .) was added to each well . the plate was covered with aluminum foil and incubated at 25 ° c . for 20 hours . root segments were transferred to a microscope slide . after addition of a drop of water and a cover slip , the slide was viewed with an olympus bh microscope ( olympus optical co ., tokyo , japan ), with a blue exciter filter ( 8g - 12 ) providing 400 nm light supplied by an epifluorescent illuminator . a barrier filter ( 530 nm ) also was used when viewing the slides . each root segment was viewed and the total length of hyphae per root cm was measured with the aid of an ocular micrometer . the experiment was repeated twice . statistical analysis . the date for weight of mycelium and cellulase units produced was subjected to one way analysis of variance and the means were separated with an flsd ( p - 32 0 . 05 ). the date of csa were subjected to multiple regression analysis and the slopes values were separated with an flsd ( p = 0 . 05 ). soil . nunn sandy loam was used in these investigations . water content of 43 . 2 kg portions was adjusted to - 0 . 03 bars and the soil was stored for 48 hours before use . the soils had the following characteristics : ph 7 . 0 , conductivity 0 . 4 mmhos , lime low , organic matter 1 . 4 %, no 3 - n 1 hg / g . p 9 hg / g , k198 hg / g , zn 0 . 5 hg / g , fe 3 . 2 hg / g . its ph was measured by the cacl 2 method . to adjust soil ph , 10 % ( v / w ) 0 . 1n h 2so4 was added to a 1 kg portion of soil . the soil was mixed thoroughly , allowed to dry , and ground with a mortar and pestel . by this method , soil ph was reduced from 7 . 0 to 2 . 5 . portions of this soil were added to field soil to adjust ph values from 7 . 0 to 5 . 0 and 6 . 0 . no change in ph was observed during the course of experiments . trichoderma spp . and strains . various strains of trichoderma harzianum ( e . g ., t - 95 [ atcc 60850 ] t - 12b , wt , and t - 12 ) and one strain each of trichoderma koningii ( t - 8 ) and trichoderma viride ( t - s - 1 ) were used in these investigations . they were obtained from various sources . for example , the t . harzianum designated as wt originally was isolated from a soil in columbia , sa . t . harzianum ( t - 95 ) a benomyl tolerant mutant , was derived from t . harzianum wt . t . harzianum ( t - 12 ) t . koningii ( t - 8 ) were isolated from a soil in new york , were provided by g . e . harman ( new york state agricultural experiment station , geneva , n . y .). t . viride ( t - s - 1 ) was provided by m . t . dunn ( mycogen corporation , san diego , calif .). t . harzianum ( t - 12b ) was a benomyl tolerant mutant derived from t . harzianum ( t - 12 ). conidia of the strain being tested were exposed to 100 μg / ml of n - methyl - n - nitro - n - nitrosoguanidine ( tredom chemical , inc ., 255 oser ave ., hauppauge , n . y .) for 30 minutes . the conidia were centrifuged at 2500 g for 15 minutes and resuspended in sterile water three times . seeds of cucumber ( cucumis sativus l . &# 34 ; straight eight &# 34 ;), radish ( raphanus sativus l . &# 34 ; early scarlet globe &# 34 ;), tomato ( lycopersicum esculentum l . burpee &# 39 ; s big boy ), beans , ( phaseolus vulgaris l . &# 34 ; olathe &# 34 ;), and maize ( zea mays l . t . e . 6998 ) were surface disinfested for 10 minutes in 1 . 1 % sodium hypochlorite solution and 5 % ethanol , washed in distilled water , and air dried . seeds were treated with conidial suspensions of trichoderma spp . in water containing 2 % ( v / w ) pelgel ( the nitragen co ., milwaukee , wis .) as a spreader or sticker . conidial density was adjusted to 106 per seed . controls were treated with pelgel alone . competitive saprophytic ability assay . to test csa of trichoderma spp ., the cambridge method was modified . strains of trichoderma spp . were grown on potato - dextrose agar ( pda ). mutants tolerant to benomyl were grown on pda containing 10 ug a . i . benomyl per ml . plates were incubated for 8 days at 25 ° c ., flooded with sterile distilled water and conidia were gently freed from the culture with a brush . the suspension was sieved through four layers of cheese cloth , centrifuged at 2500 grams for 15 minutes and resuspended in sterile distilled water three times . conidia were counted with a hemacytometer and then adjusted to the desired concentrations . freshly harvested conidia were added to 7 . 2 kg of previously moistened and incubated field soil at the rate of 101 , 102 , 103 and 104 conidia per grams soil . no conidia were added in controls . the soil was mixed thoroughly by hand and distributed in nine 11 - cm - diameter plastic pots . clean , mature , polished winter wheat straw was cut in 1 - cm segments ; each segment included a node . twenty pieces were buried randomly in each pot . the pots were arranged in a completely randomized design , covered with plastic to conserve moisture at - 0 . 03 bars and incubated in the dark . no water was added to the pots . all twenty pieces , from each treatment including a non - infested control were removed from the pots after 2 , 4 , or 6 days ; washed in tap water to remove all adhering soil and debris and surface - disinfested in a mixture of 1 . 1 % sodium hypochlorite solution and 5 % ethanol for 5 minutes . segments were plated on medium selective for trichoderma and incubated at 25 ° c . for 5 days . percent colonization of wheat pieces by trichoderma for each treatment at a given time was determined . there were three replicates per treatment and all experiments were repeated twice . in experiments where cellophane disks were substituted for straw pieces , the disks were obtained by punching holes ( 6 - mm diameter ) in an untreated cellophane sheet . disks were removed from the pots after incubation for 2 , 4 , or 6 days , washed in sterile distilled water and plated on trichoderma selective medium . growth of trichoderma spp . in liquid culture . strains of trichoderma spp . were grown in 250 ml erlenmeyer flasks containing 50 ml czapek dox broth on a rotary shaker at 100 rpm at 26 ° c . for 6 days . finely ground cotton linters , carboxy methyl cellulose or cellobiose ( sigma chemical co ., st . louis , mo .) were used as sole sources of carbon . each flask was seeded with a 4 - mm diameter disk of pda on which the strains had been grown for 2 days . after 6 days the hyphal mat was removed aseptically and dried for 2 days at 60 ° c . to obtain the weight of mycelium . there were six replicates per strain . enzyme assay . cellulase ( e . c . 3 . 2 . 1 . 4 ) was assayed spectrophotometrically ( a 340 ) by following the release of free glucose from the substrates listed above according to the manufacturer &# 39 ; s directions ( sigma chemical co ., st . louis , mo .). cellulase activity was expressed as units of cellulase produced per ml culture filtrate of each strain when grown in the substrate for 6 days . there were six replicates per strain . competitive saprophytic ability ( csa ) index . a csa index for each strain was developed as follows : ## equ1 ## where c is the frequency of isolation of a specific strain of trichoderma from the segments , t is time of incubation , p is the population density of conidia added to the soil and n is the number of treatments . rhizosphere competence ( rc ) index . rhizosphere competence index ( rc index ) for each strain was developed from the data reported in reference 2 by use of the equation : ## equ2 ## where p is the population density per mg rhizosphere soil , d is the root depth and n is the total root length . colonization of straw by trichoderma spp . when polished wheat straw pieces were buried in soil infested with conidia of trichoderma spp . and removed after 2 , 4 , and 6 days , t . koningii ( t - 8 ) and t . viride ( t - s - 1 ) were not isolated at any population density . t . harzianum t - 12 and wt were recovered from straw less frequently than the other strains and were slow to colonize the straw segments at higher population densities ( fig1 ). however , the mutants of these wild types , t - 12b and t - 95 , respectively , were isolated from the straw segments at any population density ( fig1 ). strains t - 95 and t - 12b showed significantly higher percent colonization than wt and t - 12 at any population density on all days . strain t - 95 showed significantly higher percent colonization than t - 12b at 101 , 102 , and 103 cfu / grams soil on all days but there were no significant differences between the two strains at 104 cfu / g . strain wt showed significantly higher percent colonization than t - 12 and wt were added at 101 cfu / grams soil , and 10 4 cfu / g . when strains t - 12 and wt were added at 10 1 cfu / grams soil , neither were isolated from what straw pieces after 2 , 4 , and 6 days incubation . trichoderma spp . were not isolated from controls . when washed cellophane disks were buried in soil infested with conidia of t - 95 or wt and removed after 2 , 4 , and 6 days , both strains could be isolated from the disks at any population density ( fig2 ). strain t - 95 showed significantly higher percent colonization than wt at 101 , 102 , and 103 cfu / grams soil on all days but there were no significant differences between the two strains at 104 cfu / g . growth of trichoderma spp . in liquid culture . when strains of trichoderma spp . were grown in czapek dox broth with cellobiose as the sole source of carbon , the mutant ( t - 95 ) mycelium attained significantly higher dry weight than all other wild type strains ( fig3 a ). strains t - 12b , t - 12 , and wt had significantly higher dry weight than t - 8 and t - s - 1 . when carboxyl methyl cellulose or cotton linters were the sole source of carbon , the mutants t - 95 and t - 12b had significantly higher dry weights than the wild types ( fig3 b and c ). in both cases strain t - 95 had significantly higher dry weight than t - 12b . with cotton linters strains wt and t - 12 had significantly higher dry weights than t - 8 and t - s - 1 . production of cellulase . all strains produced cellulase when grown in czapek dox broth with cellobiose as the sole source of carbon ( fig4 a ). mutants t - 95 and t - 12b produced significantly higher amounts of cellulase than the wild type or other strains . when carboxy methyl cellulose was the sole source of carbon , strain t - 12 failed to produce any cellulase , strain t - 95 produced significantly higher amounts of cellulase than all other strains and mutant t - 12b produced significantly more than t - 12 ( fig4 b ). when cotton linters were the sole source of carbon , the mutants of t . harzianum produced significantly higher amounts of cellulase than the wild types or other strains and strain t - 95 produced significantly higher amount than all other strains ( fig4 c ). isolation of fungi from baits of dead plant material buried in field soil provides direct evidence that recovered fungi can colonize these substrates as competitive saprophytes . therefore , many investigators have used wheat straw pieces rich in cellulose in the cambridge method to determine the competitive saprophytic ability of root infecting fungi . the csa index measured the capacity of different strains and species of trichoderma to compete effectively in the colonization of wheat straw . benomyl - tolerant mutants had higher csa indices than the wild types . garret has included the ability to produce enzymes for utilization of specific substrates among the attributes of fungal species that contribute to their csa . strains of trichoderma spp . produce cellulase and other cell wall degrading enzymes . in our study the csa indices were correlated directly with production of cellulase ( fig6 a ). also , mutants of t . harzianum produced significantly greater amounts of cellulase when ( cotton linters ) was the sole source of carbon . by use of the rc index , rhizosphere competence was directly correlated with amount of cellulase units produced by the mutants and the csa of the mutants . these correlations indicate that mutants with higher cellulase activity than wild types can utilize cellulose substrates on or near the root more efficiently and thus , are rhizosphere - competent . utilization of cellulose substrates is not associated with parasitism since microscopic examination revealed no evidence of such a relationship . a more likely source of cellulose substrates is the remains of the primary cell walls in the mucigel . the pattern of hydrolytic enzymes used by strains of trichoderma spp . for the hydrolysis of cellulose has been well studied . exo and endo b - 1 , 4 - glucanases act on cellulose that is broken down to cellobiose and glucose . cellobiose is further hydrolized by , b - 1 , 4 - glucosidases to glucose . in an attempt to distinguish the amount of these enzymes produced , different carbon sources were used as substrates . when cellobiose was used as the sole carbon source , the mutants produced significantly greater amount of b - 1 , 4 - glucosidases than the wild types . the mutants not only produced greater amounts of b - 1 , 4 - glucanases but , evidently , also produced significantly greater amounts of b - 1 , 4 - glucosidases and utilized the substrates more efficiently . this is also evident from the dry weight of mycelium produced . these results indicate that certain strains of t . harzianum are rhizosphere - competent because of increased enzyme activity which results in higher csa for possession of cellulose substrates on or near the root surface . this attribute of rhizosphere - competence has not been previously recognized . if the extension rate of fungal thalli are sufficient to keep pace with root growth , the attribute of higher efficiency of cellulose degradation could be a key factor for inducing these microorganisms to become rhizosphere - competent . these results also indicate that mutation and selection of other strains of other fungi and bacteria based upon an ability to produce rhizosphere competence in a wide variety of biocontrol agents . | 8 |
a preferred embodiment of the present invention will be described by referring to fig2 . in fig2 the reference numerals ( 10a ), ( 10b ) respectively designate ac amplification circuits ; ( 11a ) to ( 11c ) respectively designates rectifying circuits ; ( 12 ) designates dc amplification circuit ; ( 13 ) designates an output relay ; ( 15 ) designates a differential amplification circuit ; ( 16 ) designates a cumulative amplification circuit ; ( 17 ) designates a pulse counter ; ( 18 ) designates an or circuit ; ( 19a ) designates a first detecting circuit ; and ( 19b ) designates a second detecting circuit . an ac voltage given by shunting the voltage of the ac power source ( 8 ) by the electrostatic capacity ( 6 ) and the earth electrostatic capacity ( 3 ) of the antenna ( 1 ), is applied to the antenna ( 1 ). the ac voltage is rectified by the rectifying circuit ( 11a ) to obtain the dc voltage ( 11aa ). on the other hand , the ac voltage given by shunting the voltage of the ac power source ( 8 ) by the electrostatic capacity ( 7 ) and the earth electrostatic capacity ( 4 ) of the antenna ( 2 ), is applied to the antenna ( 2 ). the ac voltage is rectified by the rectifying circuit ( 11b ) to obtain the dc voltage ( 11ba ). the dc voltages ( 11aa ) ( 11ba ) given by the rectifying circuits ( 11a ), ( 11b ) are subtracted and amplified by the differential amplification circuit ( 15 ) of the first detecting circuit ( 19a ). the antenna ( 1 ) and the antenna ( 2 ) form a bridge from the viewpoint of the output of the differential amplification circuit ( 15 ). the output of the differential amplification circuit ( 15 ) is zero in the case of the equation : when the output of the differential amplifier circuit ( 15 ) has been changed in the positive direction by an increase in the earth electrostatic capacity ( 3 ) of the antenna ( 1 ) caused by proximity of a substrate to the antenna ( 1 ), the output of the differential amplification circuit ( 15 ) can be changed in the negative direction by proximity of a substrate to the antenna ( 2 ). it is difficult to always maintain the balance of the electrostatic capacities ( 3 ), ( 4 ), ( 6 ), ( 7 ) because of variations of ambient temperature and humidity and adhesion of dust on the antenna cover ( 14 ), whereby the output of the differential amplification circuit ( 15 ) is not kept zero and it is not always constant . in general , the change of the output of the differential amplification circuit ( 15 ) caused by the ambient temperature has a longer period in comparison with the change of the output of the differential amplification circuit ( 15 ) caused by proximity of a substrate to the antennas ( 1 ), ( 2 ). accordingly , only the change of the output of the differential amplification circuit ( 15 ) caused by proximity of a substrate to the antennas ( 1 ), ( 2 ) is selectively amplified by the next ac amplification circuit ( 10a ), whereby the effect of the ambient temperature is eliminated . the polarity of the output of the ac amplification circuit ( 10a ) caused by proximity of a substrate to the antenna ( 1 ) is different from that of proximity of a substrate to the antenna ( 2 ). accordingly , it is rectified as the full - wave rectification by the next rectifying circuit ( 11c ) and amplified by the dc amplification circuit ( 12 ) and passed through the or circuit ( 18 ) to drive the relay ( 13 ). the first detecting circuit ( 19a ) attains non - contact detection of high sensitivity higher than that of the conventional proximity detector , by the combination of the differential amplification circuit ( 15 ), the ac amplification circuit ( 10a ),, the rectifying circuit ( 11c ) and the dc amplification circuit ( 12 ). on the other hand , in the cumulative ( summing ) amplification circuit ( 16 ) of the second detecting circuit ( 19b ), the dc voltages ( 11aa ), ( 11ba ) obtained by the rectifying circuits ( 11a ), ( 11b ) are summed and amplified . the output of the cumulative amplification circuit ( 16 ) is decreased depending upon the increase of the earth electrostatic capacities ( 3 ), ( 4 ) of the antenna ( 1 ) and the antenna ( 2 ), and it is increased depending upon the decrease of the earth electrostatic capacities ( 3 ), ( 4 ) of the antenna ( 1 ) and the antenna ( 2 ). accordingly , the antennae ( 1 ), ( 2 ) are considered to form one antenna from the viewpoint of the output of the cumulative amplification circuit ( 16 ). in the case of a single antenna structure , the output of the cumulative amplification circuit ( 16 ) is changed because it is easily affected by the swinging of a door during the operation of shutting the door and the change of the earth electrostatic capacities ( 3 ), ( 4 ) of the antennas ( 1 ), ( 2 ) caused by the variation of ambient temperature and humidity . accordingly , it is difficult to detect , with high sensitivity , the variations of the earth electrostatic capacities ( 3 ), ( 4 ) of the antennae ( 1 ), ( 2 ) from the output of the cumulative amplification circuit ( 16 ). in the second detecting circuit ( 19b ), only large changes in the earth electrostatic capacities of the antennas ( 1 ), ( 2 ) that is , the operation of touching or disengaging a hand from the antenna cover ( 14 ) is detected . when a large change of the output of the cumulative amplification circuit ( 16 ) is given , for example , a hand is caused to touch the antenna cover ( 14 ), a touch pulse signal ( 10ba ) is generated as the output of the ac amplification circuit ( 10b ). when a hand is caused to disengage from the antenna cover ( 14 ), the disengage pulse signal ( 10bb ) is generated as the output of the ac amplification circuit ( 10b ). the pulse counter ( 17 ) is usually set to zero for the datum . the pulse counter ( 17 ) is counted up by the touch pulse signal ( 10ba ) of the ac amplification circuit ( 10b ) to record the touching of the antenna cover ( 14 ). the output of the pulse counter ( 17 ) is passed through the or circuit ( 18 ) to drive the relay ( 13 ). when the pulse counter ( 17 ) is counted down to zero by the disengage pulse signal ( 10bb ) of the ac amplification circuit ( 10b ), the driving of the relay ( 13 ) by the output of the pulse counter ( 17 ) is stopped as there is no touching of the antenna cover ( 14 ). when a plurality of hands touch on the antenna cover ( 14 ), the driving of the relay ( 13 ) is continued until disengaging of the same number of hands occurs . the relay ( 13 ) is driven by the logical sum of the highly sensitive detection by the first detecting circuit ( 19a ) and the touch detection on the antenna cover ( 14 ) by the second detecting circuit ( 19b ), whereby the door shutting operation is stopped or reversed so as to prevent the catching of a body or a substance in a door . in the above - mentioned embodiment , there has been described the combination of only the electrostatic capacities as to convert the change of the earth electrostatic capacities ( 3 ), ( 4 ) of the antennas ( 1 ), ( 2 ) to a voltage variation . thus , it is clear that the present invention can be applied to the case of converting the change of the earth electrostatic capacities ( 3 ), ( 4 ) of the antennas ( 1 ), ( 2 ) to the voltage variation by a other circuit systems . in the above - mentioned embodiment , there has been described conversion of the the voltages given to the antennas ( 1 ), ( 2 ) to dc voltages by rectification . thus , it is clear that the present invention can be applied to the case of applying the voltages given to the antennas ( 1 ), ( 2 ) directly to the differential amplification circuit ( 15 ) and the cumulative amplification circuit ( 16 ). as described above , in accordance with the present invention , the earth electrostatic capacities of the divided antennas are respectively converted to corresponding voltages and the proximity of a substrate is detected by both a summing signal and the a subtracting signal . high sensitivity detection higher than that of the conventional bridge system can be attained and the non - sensitive zone to touching of the antenna cover can be eliminated and the erroneous operation caused by a plurality of touches on the antenna cover can be prevented . when the present invention is applied to an electric automatic door , the safety factor can be further improved . | 8 |
the extrusion blow molding machine 1 shown in fig1 comprises two extrusion heads 2 with respectively associated extruders which are not illustrated . the extrusion heads 2 are arranged above a three - part tool 3 which is movable both into the plane of the drawing and also out of same . the tool 3 includes two outer molds 3 a , 3 b and a central mold 3 c , wherein the outer molds 3 a , 3 b each have a respective cavity 4 a , 4 b which define the later external contour of the finished product 5 . ( see fig1 ). a preform 6 in web form of thermoplastic material is extruded in a hanging condition from each extrusion head 2 . in the described embodiment of the invention the preforms are extruded between the respectively open outer molds 3 a , 3 b and the central mold 3 c which are shown in the opened position in fig1 . as is diagrammatically illustrated hereinafter ( see fig3 ), the outer molds 3 a , 3 b are displaceable relative to each other and with respect to the central mold 3 c by hydraulic drives within closing frame structures ( not shown ). those details are known and are not shown here for that reason . the entire assembly comprising the outer molds 3 a , 3 b and the central mold 3 c can be displaced into and out of the plane of the drawing relative to the extrusion heads 2 . in addition the central mold 3 c can be displaced with respect to the outer molds 3 a , 3 b into and out of the plane of the drawing . for the sake of simplicity that direction of movement into and out of the plane of the drawing is referred to hereinafter as the z - direction . the direction of the closing and opening movement of the outer molds 3 a , 3 b is referred to hereinafter as the x - direction and the extrusion direction as the y - direction . the production cycle begins in the position shown in fig1 of the tool 3 beneath the extrusion head 2 . as has already been mentioned hereinbefore , each preform 6 is extruded between a respective outer mold 3 a , 3 b and the central mold 3 c . when the preform 6 has reached its full length , as is also shown in fig1 , the outer molds 3 a , 3 b are moved towards each other in the x - direction so that they clamp the preform against the central mold 3 c ( see fig3 ). as the preforms are extruded continuously , the entire closed tool 3 is then moved away in the z - direction from under the extrusion heads 2 , principally in order not to impede the discharge of the following extrudate . at the same time or thereafter an increased internal pressure is produced in the mold cavity 7 , for example by introducing compressed air or another suitable gas . ( see fig4 ). as support or alternatively the preforms 6 can be caused to bear against the internal contour of the cavities 4 a , 4 b by means of reduced pressure . the respective cavity 4 a , 4 b corresponds to the external contour of the product 5 in that region . provided in the central mold 3 c are component holders which can be extended for the purposes of positioning built - in fitment components into the product 5 , which holders will not be described in greater detail hereinafter . built - in fitment components can be fixed to the inside wall of the product 5 with those component holders . when the product 5 is in the form of a fuel tank they can be for example valve mounting means or the like ( see fig3 - 6 ). after the preforms 6 have been caused to bear against the inside wall of the respective cavity 4 a , 4 b and have been shaped out thereagainst , the outer molds 3 a , 3 b are moved away from each other in the x - direction ( see fig7 ) and the central mold 3 c is moved out in the z - direction between the outer molds 3 a , 3 b so that the condition illustrated in fig8 is attained . the outer molds 3 a , 3 b are then closed against each other in the x - direction so that the edges 8 , of a flange - like configuration , of the respective intermediate product 9 are welded together ( see fig9 ). the outer molds 3 a , 3 b are then opened and the product 5 can be removed ( see fig1 ). the process according to the invention now provides that the wall thickness of each preform 6 is varied in accordance with a predetermined program , that is to say a thickness profile is imparted to the respective preform 6 both in the y - direction and also in the z - direction . extrusion of the preforms 6 from the respective extrusion head 2 is effected synchronously , wherein a wall thickness profile is imparted either to one preform or also in relation to the preforms in dependence on time ( in relation to the cycle time or extrusion time ). in that situation the wall thickness profiles of the preforms 6 are controllable independently of each other so that for example it is possible to obtain an article which for example is thicker at one side than at the other side , without in that respect extrusion of the one side being influenced by the wall thickness variation at the other side . possible configurations of the nozzle 10 of the extrusion heads 2 are shown in each of fig1 a and 12 a respectively . they show a section through the nozzle region of the nozzle which is respectively in the form of a wide - slot nozzle . the nozzle 10 has a nozzle body 11 with , in the case of the embodiment shown in fig1 a through 11 c , two tool lips 13 delimiting a nozzle gap 12 . adjustment of one of the tool lips 13 in the extrusion direction , that is to say in the y - direction , causes the nozzle gap 12 to be narrowed or enlarged and thus causes a change in the wall thickness of the preform 6 in question . fig1 a and 12 a each show a section at a location of the nozzle body 11 . the man skilled in the art will appreciate that the nozzle body 11 is adjustable in portion - wise manner in the z - direction so that portion - wise adjustment of the nozzle gap 12 is possible , thereby providing for a variation in the wall thickness of the preform 6 in the y - direction and the z - direction respectively . ( see fig1 b and 11 c ). that portion - wise adjustment of the nozzle gap 12 can be implemented for example by the tool lips 13 being of a suitably pliable nature , with control elements which are not shown in fig1 a through 11 c acting on the tool lips . an alternative configuration of the nozzle body is shown in fig1 a through 12 c , in which a first tool lip 13 ′ is displaceable uniformly over the entire depth of the nozzle gap 12 , that is to say over the entire width of the preform , in the z - direction , whereas a second tool lip 13 ″ is in the form of a counterpart lip which is oppositely deformable in portion - wise manner in the z - direction and is thus superimposed on the adjustment of the nozzle gap 12 by the tool lip 13 ′. various variations in that adjusting mechanism are possible in accordance with the invention . | 1 |
reel - to - reel type processing is effective to use in manufacturing . the laminate is guided through the different process steps as a continuous strip . this eliminates many manual handling and alignment problems . semi - finished products can also be stored and shipped between the various process steps in / on the reels . in fig1 a projection of copper - kapton - copper laminate 1 ( commonly called flex - laminate ) is shown with copper 2 , 4 and kapton 3 thicknesses of 75 μm and 25 μm , respectively . in fig2 a cross section of such a laminate is also shown . laminate like this is available on reels and its further processing is easy to automate . the intention is to process the laminate into the segments 5 which finally form the layers of the multilayer structure . processing begins as shown in fig3 by forming the intended conductor pattern into to conductor layers 2 and 4 so that the conductor is alternately removed from the bottom and top sides of the insulator 3 from each segment . generally speaking , this occurs at least from the places where connections between conductor layers will later be formed . the intention of the figures here is only to illustrate the manufacturing method , and the details of the conductor patterns are not considered . the removal of the conductor in places 2 and 4 reveals the insulating layer 3 where apertures 6 can be made into the insulator 3 according to fig4 . apertures 6 can be formed for example by mechanical drilling , with laser or by etching with plasma or suitable chemical etching bath . it is also possible to pattern conductor layers 2 and 4 in multiple steps and for example to use conductor layers 2 and 4 as etching masks when apertures 6 are formed into insulator 3 . the insulator 3 can also be etched in multiple steps . other electronics manufacturing methods , such as additive conductor build up , photo - definable insulation ; mechanical forming and lamination methods can also be used . various different insulator , conductor and solder materials can also be used in manufacturing . the processed laminate is next folded stage by stage according to fig5 and 7 resulting in a multilayer structure ( fig8 ) where the insulator 14 and the conductor 13 layers alternate . the laminate bends easily at the right place as the discontinuous conductor layers form a place for bending and also align the layers to some degree . as seen in fig5 - 8 , the alternation of conductor segments on different sides of the laminate results in inherent insulation between the conductor layers . also , at no stage did an insulation layer need to be placed on the conductors . this reduces the thickness of the multilayer structure , when compared with the known structures obtained with other methods requiring an additional insulator layers . as additional insulator layers are not needed , the copper fill factor and the power density are increased . the winding layers following each other are also insulated from each other at the segment edges at folding lines due to the folded but continuous insulator . folding does not have to be done in one direction only but can be accomplished at any other angle or angles to the main direction of laminate as well . the winding layers on top of each other are seen individually through the apertures 15 , and the winding layers 13 can be contacted together for example with a rivet which punches the conductors at the apertures according to fig9 . the rivet is formed to provide soldering possibility to a printed circuit board as well . the above - mentioned multilayer structure can also be manufactured in a manner where , at the segments following each other , there is first conductor on both sides of the laminate and then there is a segment without conductor on any side . however , in this case the access to the insulation layer for processing may be more difficult than as mentioned above . also , in some cases prepatterned copper strips may be laminated on a sheet of kapton , in order to directly obtain the printed flex laminate without the above etching process . the apertures 6 may also be formed on the kapton before the lamination of the conductive layers . a multilayer circuit according to the invention comprises therefore a flexible sheet of insulating material 3 having two sides , wherein sections of electrical circuit 7 , 8 , 9 are attached to both of said two sides , wherein said flexible sheet 3 is folded along folding lines 5 , which divide said flexible sheet 3 into consecutive segments , in order to form a multilayer structure comprising conductor layers 13 and insulator layers 14 stacked above each other . in a variant of the invention at least two consecutive sections of electric circuit that must be insulated from each other are disposed on different sides of said flexible sheet 3 . in another variant of the invention the greater part of the consecutive sections of electric circuit that must be insulated from each other are disposed on different sides of said flexible sheet 3 . in another variant of the invention special arrangements will be required for the top and bottom layers , and all consecutive sections of electric circuit not lying on said top and bottom layers and that must be insulated from each other are disposed on different sides of said flexible sheet 3 . finally , in another variant of the invention , all consecutive sections of electric circuit not lying on said top and bottom layers and that must be insulated from each other are disposed on different sides of said flexible sheet 3 . in fig1 a and 10b , it is shown how the conductor thickness of a multilayer structure can be doubled , for example to reduce winding resistance , but by still using a laminate with the original copper thickness . the conductor has been removed especially on the top of the right side segment . on the left side , the conductor has been removed only to give access to the insulator for processing ; if compared with the laminate in fig3 it should be noted that the conductor 17 is now located below the left side segment . after folding , this conductor will contact with the conductor in the next segment and , in this case , they will be placed on top of each other resulting in the copper thickness doubling . in other words , the conductor patterns on the same side of the segments following each other can be connected together . if the layers connected to each other are further contacted permanently together , for example by using a soldered connection , the mechanical stability of the folded structure will be improved . apart from the rivet contact presented above , a more flexible and efficient method is to contact consequent winding layers together already as the folding proceeds . this makes it possible to manufacture so called “ buries vias ” where only some of the winding layers come in contact together at each connection point . in fig1 a , the contact points 19 of the conductor patterns 18 have been plated with solder 20 . in fig1 b , the conductor layers are pressed together for contact 22 using a tool 21 . the tool can for example be a soldering iron or an ultrasound tool . the finished connection according to fig1 c is reliable since the flexibility of the multilayer structure reduces stresses that may for example be due to thermal expansion . the method also does not require the realization of plated through holes . low contact resistance between layers can be obtained . as an additional benefit , connections between layers stabilize the structure . folding edges outside the structure , or some of them , can be cut away after folding . conductor layers can also be mechanically formed , for example to have extensions or dimples which can then connect together and form a connection . apertures 6 can also be filled with solder paste or solder to form interconnections by simply heating the folded structure . in order to connect the finished multilayer structure 24 to the circuit board as a surface mounted component , it can be provided with a solder extension 23 which is then folded under the component to position 25 according to fig1 a , 12b and 12 c . some layers of the structure can also be provided with mechanical dimples 28 or connection terminals 26 or interconnection balls 29 to provide electrical and mechanical contact to the substrate . a conductor pattern on the outermost surface may also be used as sufficient interconnection surface . connection extensions 23 can be used to provide both internal and external connections to the multilayer structure . [ 0048 ] fig1 a and 17 b illustrate two further embodiment of the present invention , in which the flexible etched laminate is shown in its unfolded state , before the folding operation . [ 0049 ] fig1 a shows a circuit in which each of the segment of circuit 7 , 8 , 9 constitutes one turn each , and all the turns are connected in series in order to form a high - inductance coil . while the structure is folded , electrical connections between segments of circuit are realized at the etched apertures 6 by the creation of “ buried vias ”, for example by the method explained in the precedent embodiment . the center holes are found in aligned positions once the folding is complete and allow the insertion , for example , of a magnetic core . [ 0050 ] fig1 b shows another circuit in which each segment of circuit 7 , 8 , 9 constitutes one turn each , and all the turns are connected in parallel , in order to form a coil of high current capability . in this case all the etched apertures 6 corresponding to one pole of the coil are aligned ; and the connection can be obtained with the insertion of rivets , like in the method illustrated in fig9 by adding magnetic components such as ferrites to the multilayer structure , an inductive component is obtained . ferrite components can be attached to the structure before or after the folding . the method makes it possible to manufacture other components such as capacitors and resistors and combinations thereof such as integrated lc - components , as well as for example to make filters of small size . in other words , the conductors of the multilayer structure can also be used both as windings of an inductive component and as capacitor plates of a capacitor . it may also be efficient to use the same laminate to manufacture multiple separate components at the same time . in another embodiment of the invention , the multilayer structure includes besides the conductor and insulator layers other electrical components assembled therein . fig1 illustrates a processed laminate with various layers separated from each other . the top side conductor layer 30 has a component 33 mounted on it and , similarly , the bottom side conductor 32 has a component 34 on it . the conductor layers 30 and 32 and the insulator layer have large material removal apertures in them . the side projection along a - b is shown in fig1 . fig1 illustrates a multilayer structure where a first component 33 is outside the structure and a second component 34 is inside a cavity formed by the apertures in the conductor and insulator layers . burying components inside multilayer structures reduces the size of the assemblage . it is also possible to shield noise components inside the structure to reduce electromagnetic interference . the components can be traditional through - hole or surface - mounted components or more advanced flip - chip components and passive thin and thick film components . it is especially beneficial to include components of switched mode power supplies into the inductive components . the insulator can also be used for guiding light , for example for communication between different parts of the structure . the cavities which can be formed inside the structure can be used for cooling . especially the increase of the structure surface area by cavities or apertures promotes cooling . | 7 |
an inherent problem associated with using a programmable logic structure as a reprogrammable function block is how to ascertain that only valid design information is placed into the pls . this problem may be viewed in terms of the actual programming of the pls , the secure transmission of the programming data across a system level bus , and secure storage of the programming data . referring initially to fig1 , there is shown a block diagram of an existing system on a chip ( soc ) 100 , having one or more programmable logic blocks ( plb ) 102 associated therewith . the system 100 also includes a function library 104 for storing therein each of the different types of functions available for selective programming into the one or more programmable logic blocks 102 . the programmable logic blocks 102 are accessible by the function library 104 through a system level bus 106 . other devices , such as microprocessor 108 , memory 110 and core 112 may also have access to the system level bus 106 . during a “ functional ” mode , the microprocessor 108 instructs the function library 104 to transmit a new configuration to a particular programmable logic block 102 . as illustrated more particularly in fig2 , the configuration information is passed from the function library 104 across the system bus 106 , and is received by bus logic 114 that converts the data on the system bus 106 to useable data for configuration logic 116 . the configuration logic 116 , also included within the programmable logic block 102 , is used to reconfigure the individual programmable gates 118 of the plb 102 to achieve a particular function . however , a significant problem associated with system 100 ( in terms of the above described method of downloading the configuration data ) is that it is possible that corruption of the processor code itself will allow a deliberate “ bad ” write of a programmable logic block 102 ( i . e ., a virus may corrupt the programming of one or more plbs ). this is schematically represented in fig3 . moreover , if the system bus 106 is accessible to the external ( i . e ., “ off - chip ”) network / world , it is possible that such a “ bad ” configuration could be provided by outside agents . accordingly , finding a way to protect the plb configuration data ( so that only “ valid ” sources of configuration information are used ) becomes problematic . one possible solution could be to create a second set of system buses , in addition to arbitrators for allowing a direct connection between the library and the programmable logic block . while such an approach might be acceptable for simple systems , the use of a separate bus structure for complex system becomes prohibitive , as a result of the additional wiring resources needed to achieve such a function . therefore , in accordance with an embodiment of the invention , there is disclosed a method for system level protection of field programmable logic devices . briefly stated , the method incorporates encoded transmissions across a system level bus and decodes the encrypted transmissions at the programmable logic structures ( pls ) through the use of encryption keys . the encryption keys are generated at system power - up and are transmitted across the system to the library and the pls before any outside interference is possible . furthermore , the encryption keys are written into write - once registers that cannot be viewed from the system level bus or any other structure except the encoding logic . referring now to fig4 , there is shown a block diagram illustrating an exemplary system 400 incorporating the present encryption scheme . as is shown , a signature / lock generator 402 in communication with the system level bus is configured to generate an encoding signature and to then pass that signature to the function library 104 , as well as each of the programmable logic blocks 102 . in order to ensure that the encoding signature is not observable from any non - secure observer , a lock 404 is put on all outside resources 406 ( e . g ., external connections and microprocessor 108 ) and programmable bus members to prevent them from either interfering with or reading the signature . this allows the signature to be passed from the generator 402 to the individual programmable logic blocks 102 and library 104 securely . in one embodiment , the lock 404 is generated from the generator 402 upon a power - on reset , thereby locking all of the i / o and external connections . furthermore , the generated lock would also place any processors , bridges and other possible snooping resources in a lock or reset condition . during this lock / reset condition , each of these resources would be required to maintain a non - bus intrusive status on their connection to the system bus 106 . after the lock / reset is obtained , the signature / lock generator 402 will then generate a random number signature . the random number may be generated through any number of techniques known in the art , such as through a linear shift feedback register ( lfsr ), for example . it will be appreciated , however , that alternative signature generation embodiments may include the use of multiple signatures , or combinations of signatures with other authenticating information , such as specific time window data . more complex signatures in this regard may be used to increase system robustness , thus making observation or random hacking more difficult . in any case , the secure random number signature is sent across the system bus 106 to various programmable logic blocks 102 and the library 104 , and is specifically stored within an associated write - once register 408 . the write - once register 408 is a device that may only be written to once from reset , and the signature data therein is not readable , observable or otherwise obtainable through other methods directed toward making the signature accessible , except to the decoding logic . the value of the signature data stored in the write - once registers is tied directly to encoding or decoding logic included within the programmable logic block or library . as is illustrated in fig5 , the system bus 106 is connected to the bus logic 104 . again , the bus logic 114 converts the data on the system bus 106 to useable data . if the data is the initial signature , it is sent to the write - once register 404 . on the other hand , if the data on the system bus 106 is configuration data , then the information is sent directly to the decoding logic 410 included within the programmable logic block 102 . if the programmable logic block 102 is in a functional mode , then data is either passed from the system bus 106 into the programmable gates 118 or is read from the programmable gates 118 onto the system bus 106 . the library 104 is configured to encode the configuration information and to then pass this encoded information to the particular programmable logic block ( s ) 102 . the configuration information contained within the library 104 is also protected , such as by storing the configuration data in rom . in this manner , all of the actual configuration information is never seen , except as encoded on the system bus 106 . the encoding scheme used in the present embodiments may be implemented by any number of known systems . for example , a 128 - bit key provides a large solution space and may be sufficient , depending of the specific application of the soc . further , the actual encoding scheme is preferably hardware amenable ( i . e ., is easily constructed from hardware ). with the decoding in hardware , the security of the design is even more protected . during plb configuration , the data from the system bus 106 is decoded using the signature from the write - once register 404 . the decoded configuration data is thereafter used to configure the programmable gates 118 . because the write - once register 404 is only viewable from the decoding logic 410 , an outside ( bus ) observer is therefore unable to view the data in the write - once register 404 . accordingly , once the data is decoded , it is used to program an sram ( not shown ) that controls the programmable logic gates 118 . once configuration is accomplished , the configuration logic is turned off , and information to / from the system bus 106 is passed directly to the programmable gates 118 . it should be noted that although the decoding logic 410 in fig5 is depicted as being external with respect to the programmable gates 118 , this need not be the case . in other words , the decoding logic may also be integrated in the programmable gates ( i . e ., the decoding logic is itself programmable ). as indicated previously , another function provided by the signature and locking generator 402 is the locking of external i / o ( resource ) access points to the system level bus and other components . this locking scheme may be implemented , for example , simply by utilizing an and gate between the i / o ( or other resource ) 406 and the system bus 106 . this function thus prevents an external system from reading the bus transactions that occur during the signature passing , and is particularly desirable for systems providing a direct connection of the system bus to an off chip or off system . finally , in addition to isolating off chip / off system access during signature generation and passing , it may also be desirable for multiple soc implementations on a single chip to be isolated from one other during the signature passing . this is illustrated by the block diagram shown in fig6 , in which a chip 600 includes a first system ( system 1 ) and a second system ( system 2 ) therein . both systems share a common system level bus 602 having a bus connection 604 therebetween . in addition , the bus connection element 604 is provided with a lock 404 ( as described earlier ) so as to isolate the two systems from one another during the signature passing . while the invention has been described with reference to a preferred embodiment or embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments falling within the scope of the appended claims . | 6 |
an oxygen - selective ceramic membrane structure of the present invention can be used to form ceramic membrane elements in the form of stacks of plates or bundles of tubes that are set within known reactors . the oxygen containing feed is heated by combusting the fuel in the presence of part of the oxygen of the feed and then introducing the feed into the reactor or membrane elements . alternatively , the reactor itself may be heated or the oxygen containing feed may be heated by indirect heat exchange with various heated process streams . oxygen ions are transported through the membrane elements and are collected or further reacted and discharged . in case the oxygen is fed into the membrane elements , fuel and steam can be fed into the reactor . a catalyst can be supplied for resultant steam methane reforming reactions . alternatively , the oxygen containing feed can be introduced into the reactor for oxygen ion transport through the membrane elements . other possible applications include oxygen separation itself for nitrogen production as well as other possible chemical oxidative processes . a positive oxygen partial pressure is applied across the membrane structure by either compressing the feed or by removing the feed at the anode side of the membrane by a sweep gas or a reactant or a combination of all of the foregoing mechanisms . in a membrane structure in accordance with the present invention , an active porous supporting layer and possibly also the dense layer uses a multi - phase heterogeneous material that incorporates both an oxygen ion conducting phase and mixed electronic ionic conducting phase that can be used to separate oxygen from a gas stream containing oxygen by oxygen ion conduction at temperatures in excess of 600 ° c . the mixed electronic ionic conducting phase is preferably an oxygen deficient perovskite or a brownmillerite . the ionic conducting phase is preferably a non - perovskite such as a fluorite , a bismuth oxide , an apatite oxide , and mixtures thereof . an oxygen - selective ceramic membrane structure of the present invention may have more than one active supporting layers and optionally inert porous supporting layers . such membranes are fabricated from a variety of known techniques such as slurry coating and co - firing and typically have a dense layer of anywhere from between about 1 and about 200 micrometers in thickness either sandwiched or supported on one side by an active porous supporting layer ( s ) of about 200 to about 20000 micrometers in thickness . the porous supporting layers can have pores ranging from between about 1 and about 50 micrometers and a porosity ranging from about 30 % to about 50 %. the dense layer can be formed of a variety of materials including but not limited to strontium doped lanthanum ferrite , for instance , la 0 . 8 sr 0 . 2 co 0 . 2 fe 0 . 8 o x and the active porous supporting layer can be formed of between about 5 % and about 95 % by volume of ce 0 . 8 gd 0 . 2 o 1 . 9 and between about 5 % and about 95 % by volume of la 0 . 8 sr 0 . 2 co 0 . 2 fe 0 . 8 o 3 - d . other possible formulations are possible including those containing ion conducting phases formed from yttria stabilized zirconia , urania , partially stabilized zirconia , la 2 mo 2 o 9 , perovskites that are ion conductors , and ion conducting pyrochlores and mixed conducting phases formed from the series of perovskites that include lanthanide , alkaline earth and transition metals , materials of the ruddelson - popper phase , mixed conducting fluorites . it is to be noted that the composition of the ionic conducting and mixed conducting phases need not be constant throughout a layer of material . for instance , layers may be fabricated having a varying composition , for instance , in a radial direction of a tubular layer , for thermal or chemical compatibility . additionally , composition may also be made to vary along the length of an element to obtain desirable thermal expansion characteristics and improved sealing options . for example , in a tubular element , the end or ends of the tube to be sealed might entirely be an ionic conducting phase because such materials generally have very linear expansion characteristics and hence , are easier to match with those of a metal to which such a tubular element were to be sealed . the following examples are set forth with specific materials and process conditions to specifically exemplify materials of the invention and should not limit the invention in any way . ce 0 . 8 gd 0 . 2 o 1 . 9 + la 0 . 6 sr 0 . 4 co 0 . 2 fe 0 . 8 o 3 - d two phase material mixed at a 30 %/ 70 % volume ratio ( cgo / lscf ( 30 / 70 )) ce 0 . 8 gd 0 . 2 o 1 . 9 (“ cgo ”) was intimately mixed with la 0 . 6 sr 0 . 4 co 0 . 2 fe 0 . 8 o 3 - d (“ lscf ”) in the desired ratio to produce a mixture of about 30 volume % cgo and about 70 volume % lscf . this cgo / lscf material was then pressed into disc , bar and tube forms and sintered in the temperature range of 1200 - 1400 ° c . to produce a heterogeneous two - phase material . with reference to fig1 the thermal expansion of the two - phase material was measured using a dilatometer from 25 - 950 ° c . it is to be noted that dilatometry is used to measure the expansion of materials as a result of temperature increase . in case of oxide ceramics , the expansion is a result of the increase in amplitude of oscillation of the ions as the temperature increases and also , the loss of oxygen in the lattice . the thermal expansion coefficient (“ tec ”) of a material is a measure of the rate of expansion as a function of temperature . it is calculated by dividing the absolute linear expansion over a given temperature range by the temperature range . oxygen loss from the lattice results in a considerable deviation from linearity in the tec . it is desirable to have a membrane material with a low and constant tec over the temperature range to which it is exposed . as shown in fig1 the total expansion of the two - phase material was about 1 . 16 % and the two - phase material had a mean tec of about 12 . 5 ppm / k as shown in fig2 . this proved to be significantly less than a sample of the single phase la 0 . 2 sr 0 . 8 fe 0 . 8 cr 0 . 2 o 3 - d which had a total expansion of about 1 . 56 % and a mean tec of about 16 . 9 ppm / k . with reference to fig3 the expansion due to changes in the partial pressure of oxygen was measured at 950 ° c . from po 2 = 0 . 2 to po 2 = 10 − 16 using mixtures of co , co 2 , n 2 and air . as represented in fig3 it can be seen that the contraction that occurs in the single phase la 0 . 2 sr 0 . 8 fe 0 . 8 cr 0 . 2 o 3 - d sample did not occur in two - phase mixture of cgo and lscf . with reference to fig4 oxygen permeation was measured on discs of the two - phase mixture using a 90 % co / 10 % co 2 ( by volume ) gas stream on one side and air on the other side , with flow rates of one liter per minute on both sides . the discs were maintained at a temperature of about 1000 ° c . it is to be noted that commercially significant fluxes can be obtained in membrane elements formed of materials outlined herein at temperatures at and above 600 ° c . a maximum flux of about 7 sccm / cm 2 for a 1 mm thickness was obtained for the two - phase material under consideration in this example . this flux is significantly higher than obtained using cgo / ag + pd two - phase discs where oxygen fluxes of about 1 and about 4 sccm / cm 2 for a 1 mm thickness were obtained . it is to be noted that oxygen flux measurements on single phase lscf are not possible under 90 % co / 10 % co 2 gas conditions because the material is chemically unstable . oxygen permeation was measured on tubes of the material using a 40 % ch 4 / 60 % n 2 gas stream on one side and air on the other side . the flow of the air was decreased until all the oxygen was removed from the gas stream , creating deoxo conditions . a flux of about 2 . 4 sccm / cm 2 for a 1 mm thickness was obtained for the two - phase material of this example at deoxo conditions . this is comparable to oxygen flux measurements made on the la 0 . 2 sr 0 . 8 fe 0 . 8 cr 0 . 2 o 3 - d single phase sample . ce 0 . 8 gd 0 . 2 o 1 . 9 + la 0 . 8 sr 0 . 2 co 0 . 2 fe 0 . 8 o 3 - d two phase material mixed at a 50 %/ 50 % volume ratio ( cgo / lscf ( 50 / 50 )) cgo was intimately mixed with lscf in the desired ratio to produce a mixture of 50 volume % cgo and 50 volume % lscf . this two phase material was then pressed into disc , bar and tube forms and sintered in the temperature range of 1200 - 1400 ° c . to produce a heterogeneous two - phase material . the thermal expansion of the material was measured using a dilatometer from 25 - 950 ° c . the total expansion as shown in fig1 was about 1 . 1 % and the mean tec , as shown in fig2 was about 11 . 9 ppm / k . fig3 shows that the contraction that occurs in the single phase lscf sample at low oxygen partial pressures did not occur in the two - phase mixture of cgo / lscf ( 50 / 50 ). with continued reference to fig4 a maximum flux of about 6 . 1 sccm / cm 2 for a 1 mm thickness was obtained for the two phase mixture which again was significantly higher than obtained for the cgo / ag + pd two - phase discs . further , a flux of 2 . 6 sccm / cm 2 for a 1 mm thickness of the mixture was obtained at deoxo conditions . this again is comparable to oxygen flux measurements made on single phase la 0 . 2 sr 0 . 8 fe 0 . 8 cr 0 . 2 o 3 - d . ce 0 . 8 gd 0 . 2 o 1 . 9 + la 0 . 8 sr 0 . 2 co 0 . 2 fe 0 . 8 o 3 - d two phase material mixed at a 70 %/ 30 % volume ratio ( cgo / lscf ( 70 / 30 )) cgo was intimately mixed with lscf in the desired ratio to produce a mixture of about 70 volume % cgo and about 30 volume % lscf . this two phase material was then pressed into disc , bar and tube forms and sintered in the temperature range of 1200 - 1400 ° c . to produce a heterogeneous two - phase material . with reference again to fig1 the thermal expansion of the material was about 1 . 2 % and as shown in fig2 the mean tec was about 12 . 9 ppm / k . with further reference to fig3 the contraction that occurs in single phase la 0 . 2 sr 0 . 8 fe 0 . 8 cr 0 . 2 o 3 - d at low oxygen partial pressures did not occur in the two phase sample of cgo / lscf ( 70 / 30 ). as shown in fig4 a maximum flux of about 6 sccm / cm 2 for a 1 mm thickness was obtained for the sample . the flux measured under deoxo conditions was about 2 . 6 sccm / cm 2 for a 1 mm thickness . the examples use a fluorite as the ionic conductor and a perovskite as the electronic conductor . however , the invention is not intended to be limited to these crystal structures . the invention preferably includes the use of any ionic conductor for the oxygen ion conducting phase having an oxygen ion conductivity at 1000 ° c . of greater than about 0 . 01 s / cm ( siemans / centimeter ). this includes cgo , bismuth oxides , and apetite oxides such as la 10 - x sr x sio 27 and la 10 - x sr x geo 27 . the invention preferably also includes the use of any mixed conductor for the mixed conducting phase having an ionic conductivity in air of greater than about 0 . 01 s / cm at 1000 ° c . and an electronic conductivity of greater than about 0 . 02 s / cm at 1000 ° c . under dynamic operating conditions . this includes , but is not limited to perovskites such as la x sr 1 - x fe 1 - y - z co y cr z o 3 - d . the following table exemplifies useful mixed conductors . ( la 1 − x sr x )( co 1 − y fe y ) o 3 − δ ( 0 ≦ x ≦ 1 . 1 , 0 ≦ y ≦ 1 . 1 , δ from srmn 1 − x co x o 3 − δ ( 0 ≦ x ≦ 1 , δ from stoichiometry ) yba 2 cu 3 o 7 − δ ( 0 ≦ δ ≦ 1 , δ from stoichiometry ) a x a ′ x ′ a ″ x ″ b y b ′ y ′ b ″ y ″ o 3 − z ( x , x ′, x ″, y , y ′, y ″ and z all in 0 - 1 range ) where : a , a ′, a ″ = from groups 1 , 2 , 3 and f - block lanthanides bi 2 − x − y m ′ x m y o 3 − δ ( 0 ≦ x ≦ 1 , 0 ≦ y ≦ 1 , δ from stoichiometry ) where : m ′ = er , y , tm , yb , tb , lu , nd , sm , dy , sr , hf , th , ta , nb , one of the materials of a s a ′ t b u b ′ v b ″ w o x b ″ represents mn , co , v , ni or cu , or a mixture thereof and s , t , u , v , w , and x are numbers such that : x equals a number that satisfies the valences of the a , a ′, b , b ′, b ″ in the formula ; and 0 . 9 & lt ; ( s + t )/( u + v + w ) & lt ; 1 . 1 one of the materials of ce 1 − x a x o 2 − δ family , where : δ equals a number that satisfies the valences of ce and a in the one of the materials of sr 1 − x bi x feo 3 − δ family , where : δ equals a number that satisfies the valences of ce and a in the one of the materials of sr x fe y co z o w family , where : w equals a number that satisfies the valences of sr , fe and co in the any of the materials described in 1 - 13 , to which a high temperature metallic phase ( e . g ., pd , pt , ag , au , ti , ta , w ) is added . one of the materials of a 2 − x a ′ x b 2 − y b ′ y o 5 + z family whose b represents a metal ion or mixtures of 3d transition metal ions and b ′ represents a metal ion or mixtures of 3d transition metal ions and 0 & lt ; x & lt ; 2 ; 0 & lt ; y & lt ; 2 ; z renders the compound charge neutral one of the materials of ln x a ′ x co y fe y ′ cu y ″ o 3 − z family whose composition is disclosed in ep 0 732 305 a1 ( dyer et al .) as follows : x & gt ; 0 , y & gt ; 0 , x + x ′ = 1 , y + y ′ + y ″ = 1 , 0 & lt ; y ≦ 0 . 4 one of the materials of ln x a ′ x ′ a ″ x ″ b y b ′ y ′ b ″ y ″ o 3 − z o 3 − z family whose composition is disclosed in ep 0 931 763 al ( dyer et al .) as follows : 0 ≦ x & lt ; 1 , 0 & lt ; x ′ ≦ 1 , 0 & lt ; y & lt ; 1 . 1 , 0 ≦ y ′ & lt ; 1 . 1 , x + x ′ + x ″ = 1 . 0 , 1 . 1 & gt ; y + y ′ & gt ; 1 . 0 , z renders the compound charge neutral in all three examples , the thermal expansion of the material is considerably less than the single phase la 0 . 2 sr 0 . 8 fe 0 . 8 cr 0 . 2 o 3 - d sample . moreover , the non - linearity seen in the expansion of the two phase materials is less than observed in la 0 . 2 sr 0 . 8 fe 0 . 8 cr 0 . 2 o 3 - d . a comparison of the thermal expansion coefficients of the three cgo / lscf materials together with single phase la 0 . 2 sr 0 . 8 fe 0 . 8 cr 0 . 2 o 3 - d shows a lower and more linear tec which is very important to enable sealing materials to be employed , and to match the thermal expansions of the dense and active porous layers . the chemically induced strain of the two - phase cgo / lscf materials is also less than the single phase la 0 . 2 sr 0 . 8 fe 0 . 8 cr 0 . 2 o 3 - d . the comparison shown in fig3 shows that in all cases , under a reduction in oxygen partial pressure , the initial expansion followed by the contraction of the single phase la 0 . 2 sr 0 . 8 fe 0 . 8 cr 0 . 2 o 3 - d material is not present in the two phase cgo / lscf materials . it is to be noted that prolonged exposure of the single phase la 0 . 2 sr 0 . 8 fe 0 . 8 cr 0 . 2 o 3 - d to low oxygen partial pressures can produce an irreversible transition . the comparison of the oxygen flux shown in fig4 for the three cgo / lscf materials with cgo / ag + pd and cgo / lsm shows that less flux is obtained with a pure electronic conductor such as ag / pd alloy , or lanthanum strontium manganite ( lsm ). the results taken together show that a composite membrane structure having a dense layer and one or more active porous layers in accordance with the present invention can be constructed with more closely matched thermal expansion coefficients to reduce the stress of differential thermal expansion coefficients that would otherwise exist in the membrane architecture of a prior art structure . additionally stresses produced in the active porous layer are also reduced due to the lack of chemically induced contraction under low oxygen partial pressures . at the same time , the use of the ionic conductor together with the mixed phase conductor in the porous support , or possibly also in the dense layer , produces a membrane that for a given volume of material has a higher oxygen flux capacity while at the same time providing a more robust structure than the single phase and dual phase structures of the prior art . while the present invention has been discussed in reference to a preferred embodiment , as will occur to those skilled in the art , numerous changes and additions can be made without departing from the spirit and scope of the present invention . | 8 |
as shown in fig4 a and 4b , the corrugated tube 10 according to the present invention has a plurality of circular peak sections 12 and trough sections 13 on its outer surface , alternatingly provided on tube 10 at a predetermined pitch along the axial ( longitudinal ) direction . tube 10 has a longitudinal slit 11 along the longitudinal direction of the tube . the longitudinal slit 11 forms separated first and second longitudinal zones along the slit . the first longitudinal zone defines a plurality of first peak sections 12a , while the second longitudinal zone defines a plurality of second peak sections 12b . the first and second peak sections 12a and 12b are provided with a concave and convex shapes respectively . as discussed below , these shapes are closed in single motion to lock slit 11 . the first peak section 12a makes up a female locking portion 14 . female locking portion 14 includes , sequentially from the slit 11 counterclockwise in fig4 an inserting convex shape 15 having an l - shaped cross - section and an open edge , a stopper concave shape 16 , a stopper convex shape 17 , and a positioning concave shape 18 for defining the position during cutting ( discussed below ). the second peak section 12b is a male locking portion 19 . portion 19 includes , clockwise in fig4 a receiving convex shape 20 preferably having a v - shaped cross - section , a stopper concave shape 21 , a stopper convex shape 22 , and a positioning concave shape 23 for defining the position during cutting . as shown in fig6 the insertion convex shape 15 , stopper concave shape 16 and stopper convex shape 17 of the female locking portion 14 have a width w1 along the longitudinal direction , which is wider than the width w2 of the corresponding shapes 20 , 21 , and 22 of the male locking portion 19 ( i . e ., w1 & gt ; w2 ). thus , the male locking portion 19 easily fits under the female locking portion 14 ( viewed from the tube axis ). also , the corrugated tube 10 is provided with a longitudinal notch 24 having a roughly inverted v - shaped cross - section . notch 24 extends longitudinally along tube 11 at a position distal to slit 11 . further , the stopper concave shape 16 of the female locking portion 14 has a length l1 around the circumference of tube 10 , which is shorter than the length l2 of the corresponding stopper concave shape 21 of the male locking portion 19 ( i . e ., l1 & lt ; l2 ). as shown in fig7 a and 7b , the corrugated tube 10 is initially fabricated in a circular form in which the edge of the inserting convex shape 15 of the female locking portion 14 and the receiving convex shape 20 of the male locking portion 19 are integrally connected by a radially rising wall 25 . the wall 25 is cut by a cutter 27 to form slit 11 , i . e ., female locking portion 14 and male locking portion 19 separate to defme slit 11 therebetween . when cutting with the cutter 27 , the tube 10 is installed in a container 28 having a pair of holding ribs 29 which engage concave shapes 18 and 23 respectively , so that the tube 10 is held in the appropriate position . a connector housing ( not shown in the figures ) is mounted at the end of a plurality of electrical wires . in this state , as shown in fig8 a , the slit 11 of the corrugated tube 10 is open and the connector housing is laterally inserted thereinto through the slit . subsequently , the female and male locking portions 14 and 19 on the opposing sides of the slit 11 are pressed together . the male locking portion 19 fits into the radially inner side of the female locking portion 14 , as shown in fig5 and 8b . notch 24 provides sufficient flexibility to permit these opposing sides of slit 11 to be brought together and locked . in this locking process , the receiving convex shape 20 ( inverted v shape in the figures ) is inserted under the convex shape 15 ( l form ), and then moves over the stopper concave shape 16 and finally fits into the stopper convex shape 17 . at the same time , the stopper concave shape 21 and convex shape 22 of the male locking portion 19 are tightly superposed on the inner side of the stopper concave shape 16 and the inserting convex shape 15 of the female locking portion 14 , respectively . as discussed above , the three sequential concave and convex formations of the male locking portion 19 engage their counterparts at the underside of the female locking portion 14 . especially , the fitted stopper concave shapes 16 and 21 are flanked by the respectively fitted stopper convex shapes . all the peak sections 12 at the sides of the slit 11 thus securely lock the female locking portion 14 and the male locking portion 19 . accordingly , it is not necessary to wrap the tube 11 in tape as required in the prior art . however , the present invention is not limited to the aforementioned embodiments . the locking mechanism may be provided using only some of the peak sections near the slit edges , or at a predetermined pitch along the slit 11 , instead of on all of the peak sections along the slit line as mentioned above . further , the locking mechanism is preferably provided on the peak sections of the tube , but not on the trough sections thereof . thanks to this configuration , the flexibility of the tube is not impaired . after being loaded with a wiring harness , the tube can still be curved or bent as desired . moreover , only part of a circular corrugated tube is cut to define a slit between female and male locking mechanisms . carrying into practice of the present invention is therefore very easy . the present invention also relates to a method for loading a plurality of electrical wires w into the above - mentioned corrugated tube 10 and locking the tube . it further concerns a device specifically designed for this purpose . fig9 shows a corrugated tube 10 and a wire - loading device 30 by which a plurality of electrical wires are installed in the corrugated tube , where the slit of the tube is closed and locked . the shape of wire - loading device 30 is shown in fig9 - 13 . a tubular guiding unit 32 for guiding the electrical wires includes at least left and right wing parts ( slant tube part ) 32a and 32b integrally linked at the underside of each wing . guiding unit 32 connects with a tubular locking unit 33 at a predetermined angle of inclination . the two units can be formed integrally from a resin . tubular locking unit 33 has a left and a right wing 33a and 33b integrally linked at the underside of each wing . the wings of both units 32 and 33 extend upwardly to form a projection having opposed portions 34a and 34b . thus , the projection extends continuously from the tubular guiding unit 32 to the tubular locking unit 33 . the units 32 and 33 are opened by separating the opposed portions 34a , 34b , so that the electrical wires w can be installed in units 32 and 33 . wings 32a and 32b of the tubular guiding unit 32 have an external diameter r1 smaller than the internal diameter of the corrugated tube 10 . the tubular guiding unit 32 may also be provided with a slit - fitting part 35 for opening the slit 11 of the corrugated tube 10 . the slit - fitting part 35 is provided under wings 32a and 32b and extends vertically forward of device 30 . this slit - fitting part 35 is formed by linking a semicircular shaped cross section to each of the wings 32a and 32b through a neck part 35a . when both wings 32a and 32b are pressed against each other , the slit - fitting part 35 has a round cross - section . the shape of the slit - fitting part 35 gradually merges into wings 32a and 32b moving from the front of guiding unit 32 to the rear , ending in a substantially circular rear opening 32d . wings 32a and 32b of the tubular guiding unit 32 are integrally formed with the left and right wings 33a and 33b of the tubular locking unit 33 at the top ends thereof , respectively , so that rear opening 32d of the tubular guiding unit 32 faces the front opening 33c of the tubular locking unit 33 . a space s formed between the bottom - side outer surface of the tubular guiding unit 32 and the bottom - side inner surface of the tubular locking unit 33 corresponds to the thickness of the corrugated tube 10 . the tubular locking unit 33 has a gradually narrowing diameter along its axis , from the forward end towards the rear thereof . the narrow end 33d has an inner diameter equal to the outer diameter of the corrugated tube 10 when it is locked . the inner circular surface of the tubular locking unit 33 is provided with a pair of ribs 33f and 33g at both sides of the upper opening 33e thereof . the pair of ribs 33f and 33g mate with the concave shapes 18 and 23 of the female and male locking portions 14 and 19 of the tube 10 . ribs 33f and 33g extend along the axial direction of unit 33 . the distance d between ribs 33f and 33g gradually narrows towards an end 33d of the tubular locking unit 33 . at the rear end 33d of tubular locking until 33 , distance d is small enough such that female locking portion 14 mates with male locking portion 19 . further , as shown in fig1 , the inner surface of the tubular locking unit 33 is provided with a rib 33h at its bottom , which slidably mates with notch 24 in the corrugated tube 10 . by using the above device , the electrical wires w are loaded into the corrugated tube 10 , and the slit locked , as follows . the opposed portions 34a and 34b of the projection of the device 30 are opened . the wires are loaded through the tubular guiding unit 32 to the tubular locking unit 33 , as shown by the dotted lines in fig1 - 13 . in this state , the wires pass from the opening 32d of the slant tube part 32 through the guide - side opening 33c of the tubular locking unit 33 . the corrugated tube 10 is then held with the slit 11 facing upwards . the neck 35a linking the tubular guiding unit 32 and the slit - fitting part 35 is then inserted into slit 11 . thus , the slit - fitting part 35 is fitted into the corrugated tube 10 . thereafter , as device 30 moves along corrugated tube 10 , the shape of outer circular surface of the slit - fitting part 35 forces slit 11 gradually open wider and wider . when the edge of the corrugated tube 10 is advanced into the guiding - side opening 33c of the tubular locking unit 33 , the bottom part of the corrugated tube 10 is inserted into the space s formed between the tubular guiding unit 32 and the inner surface of the tubular locking unit 33 . the corrugated tube 10 is thus guided into the tubular locking unit 33 . when notch 24 ofthe tube 10 engages with the rib 33h ofthe tubular locking unit 33 , the pair of ribs 33f and 33g on the tubular locking unit 33 engage concave shapes 18 and 23 provided at the upper part of the tube 10 , as shown in fig1 a . when the corrugated tube 10 is inserted along the inner circular surface of the tubular locking unit 33 , the electrical wires contained in the tubular guiding and locking units 32 and 33 are inserted into the corrugated tube 10 , as shown in fig1 a . namely , the electrical wires contained in the tubular locking unit 33 automatically transfer into the corrugated tube 10 as locking unit 33 moves along tube 10 . as the corrugated tube 10 advances relative to the tubular locking unit 33 towards its end 33d , the distance between the ribs 33f and 33g narrows . the concave shapes 18 and 23 engaged with these ribs are brought closer together . as shown in fig1 b , when the tube 10 arrives at the edge 33d of the tubular locking unit 33 , the female and male locking portions 14 and 19 of the tube 10 completely superpose , closing slit 11 . accordingly , when the corrugated tube 10 exits from the edge 33d of the device 30 , the wires are loaded in the tube 10 and the slit 11 is locked . although , in the above - description , the corrugated tube 10 is moved vis - a - vis the device 30 , it can be done inversely to obtain the same result and / or both items can be moved simultaneously . fig1 shows a variant type of the device 30 , wherein the slit - fitting part 35 &# 39 ; provided at the bottom part of the tubular guiding unit 32 has a flat shape . this part 35 &# 39 ; is formed by flatly bending the left and right wings of the tubular guiding unit 32 , at the position located under ( in fig1 ) the wings 32a and 32b . in this configuration , the slit - fitting part 35 &# 39 ; is inserted into the slit 11 of the tube 10 . the tube 10 or the device 30 &# 39 ; ( or both ) is then moved in the longitudinal direction . the slit 11 reaches the outer circular surface 32c of the wings 32a and 32b , automatically widening slit 11 . the other functions are the same as in the aforementioned embodiment . the bottom part of the tubular guiding unit 32 may be formed so as not to include a slit - fitting part . in such a case , the slit 11 of the corrugated tube 10 is directly opened along the bottom outer surface of the guiding unit 32 . when the slit 11 is opened , the corrugated tube 10 is inserted into the tubular locking unit 33 and fitted therewith . then , the electrical wires w are loaded in the tube 10 and the slit 11 is locked . by using the device 30 according to the invention , it is unnecessary to wrap the tube in tape . further , the wire is installed and the slit closed in a single step , substantially reducing manufacturing time and associated costs . a worker &# 39 ; s workload is therefore greatly reduced and the work efficiency is enhanced . further , device 30 can be easily manufactured by molding a resin and does not raise manufacturing costs . although the invention has been described with reference to particular means , materials and embodiments it is to be understood that the invention is not limited to the particulars disclosed and extends to all equivalents within the scope of the claims . the present application is related to japanese patent application no . 8 - 232783 , filed sep . 3 , 1996 , and japanese patent application no . 8 - 273442 , filed oct . 16 , 1996 , the disclosure of which is incorporated by reference in their entireties herein . | 8 |
various embodiments are now described with reference to the drawings , wherein like reference numerals are used to refer to like elements throughout . in the following description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of one or more embodiments . it may be evident , however , that such embodiments ) may be practiced without these specific details . in other instances , well - known structures and devices are shown in block diagram form in order to facilitate describing one or more embodiments . in the following paragraphs , the present invention will be described in detail by way of example with reference to the attached drawings . throughout this description , the preferred embodiment and examples shown should be considered as exemplars , rather than as limitations on the present invention . as used herein , the “ present invention ” refers to any one of the embodiments of the invention described herein , and any equivalents . furthermore , reference to various feature ( s ) of the “ present invention ” throughout this document does not mean that all claimed embodiments or methods must include the referenced feature ( s ). referring to fig1 , a tool holding glove 100 , according to one embodiment is illustrated . fig1 shows the palm side of the tool holding glove 100 . the glove portion 102 is similar to workman &# 39 ; s gloves , typically worn by craft workers while performing tasks . the glove portion 102 may be made from leather or other sturdy and protective material . the glove portion extends beyond the wearer &# 39 ; s wrist and partially up the wearer &# 39 ; s forearm . a flap 104 is attached in the wrist area , according to an embodiment of the invention . this flap 104 has attached adhesive fabric piece 106 . adhesive fabric piece 106 may be one part of a hook and loop adhesive fabric , that when mated lock together . alternatively , fabric piece 106 may be any other adhesive fabric capable of repeated joining and separating without requiring replacement . a thumb pad piece 108 a is made of the same adhesive fabric as fabric piece 106 . fig2 illustrates the reverse side , or back of the wearer &# 39 ; s hand side of the tool holding glove . the glove portion 102 is shown looking down on the back of the wearer &# 39 ; s hand with four fingers visible . the portions of the glove on the back of the wearer &# 39 ; s fingers , above the wearer &# 39 ; s fingernails , are covered with adhesive fabric pieces 108 b - e . these fabric pieces 108 b - e are also made of a hook and loop adhesive fabric , and are of a type opposite that of the fabric piece 106 attached to flap 104 , in order to provide adhesion when mated together . fig3 illustrates use of the tool holding glove . the user puts on the glove as he or she would a typical glove . the wearer then picks up the tool 302 to be retained by the tool holding glove . the thumb and index finger encircle the tool and thumb pad piece 108 a is pressed against adhesive fabric piece 108 e , which covers the wearer &# 39 ; s index finger . pressing the thumb pad piece 108 a against adhesive fabric piece 108 e forms a secure grip around the tool , 302 . in a similar manner , the adhesive fabric piece 106 , attached to flap 104 is pressed against fabric pieces 108 b - d to complete the grip on the tool 302 . once the grip on the tool 302 has been formed the wearer has a secure hold on the tool 302 . the wearer may even relax the grip of his or her muscles and the tool holding glove will retain the tool 302 within the tool holding glove 100 . the wearer may break the grip established by the tool holding glove by grasping the flap 104 and separating adhesive fabric piece 106 from adhesive fabric pieces 108 b - d . in a similar fashion , the thumb piece 108 a is separated from adhesive fabric piece 108 e , over the wearer &# 39 ; s index finger . a further embodiment of the tool holding glove varies the location of flap 104 . specifically , flap 104 may be located further away from the wearer &# 39 ; s wrist , up the forearm . this embodiment prevents flap 104 from being tangled in the grip of the wearer &# 39 ; s hand . in a further embodiment , fabric piece 108 e may also be located closer to the base of the wearer &# 39 ; s thumb . this embodiment facilitates a tighter grasp of tools with a small gripping diameter . yet another embodiment facilitates opening the flap 104 to release the grip . flap 104 may be shaped with an “ ear ” on the top of flap 104 , parallel with the wearer &# 39 ; s wrist . this “ ear ” provides easier opening with which to initiate separation of the adhesive fabric pieces 106 and 108 b - d . a still further embodiment facilitates opening the grip with the wearer &# 39 ; s other hand . flap 104 may have “ ears ” or rounded portions on the sides . these “ ears ” allow a wearer to grasp flap 104 with the fingers of the other hand and then separate adhesive fabric piece 106 and adhesive fabric pieces 108 b - d . yet a further embodiment provides for holding the flap 104 when the tool holding feature is not in use . fig4 provides a tool holding glove , 400 , incorporating flap 104 , positioned as described above . adhesive fabric pieces 402 a and 402 b are affixed to flap 104 as shown . specifically , the wrist of the glove 400 has adhesive fabric piece 402 a affixed above the attachment point for flap 104 . flap 104 has adhesive fabric piece 402 b affixed to the outer side of flap 104 , facing away from the palm of the user . when the flap 104 is not in use , adhesive fabric pieces 402 a and 402 b are used to hold flap 104 against the wrist of the user and prevent flap 104 from tangling in the user &# 39 ; s hand . while various embodiments of the present invention have been described above , it should be understood that they have been presented by way of example only , and not of limitation . likewise , the various diagrams may depict an example architectural or other configuration for the invention , which is done to aid in understanding the features and functionality that may be included in the invention . the invention is not restricted to the illustrated example architectures or configurations , but the desired features may be implemented using a variety of alternative architectures and configurations . indeed , it will be apparent to one of skill in the art how alternative functional , logical or physical partitioning and configurations may be implemented to implement the desired features of the present invention . also , a multitude of different constituent module names other than those depicted herein may be applied to the various partitions . additionally , with regard to flow diagrams , operational descriptions and method claims , the order in which the steps are presented herein shall not mandate that various embodiments be implemented to perform the recited functionality in the same order unless the context dictates otherwise . although the invention is described above in terms of various exemplary embodiments and implementations , it should be understood that the various features , aspects and functionality described in one or more of the individual embodiments are not limited in their applicability to the particular embodiment with which they are described , but instead may be applied , alone or in various combinations , to one or more of the other embodiments of the invention , whether or not such embodiments are described and whether or not such features are presented as being a part of a described embodiment . thus the breadth and scope of the present invention should not be limited by any of the above - described exemplary embodiments . terms and phrases used in this document , and variations thereof , unless otherwise expressly stated , should be construed as open ended as opposed to limiting . as examples of the foregoing : the term “ including ” should be read as meaning “ including , without limitation ” or the like ; the term “ example ” is used to provide exemplary instances of the item in discussion , not an exhaustive or limiting list thereof ; the terms “ a ” or “ an ” should be read as meaning “ at least one ,” “ one or more ” or the like ; and adjectives such as “ conventional ,” “ traditional ,” “ normal ,” “ standard ,” “ known ” and terms of similar meaning should not be construed as limiting the item described to a given time period or to an item available as of a given time , but instead should be read to encompass conventional , traditional , normal , or standard technologies that may be available or known now or at any time in the future . likewise , where this document refers to technologies that would be apparent or known to one of ordinary skill in the art , such technologies encompass those apparent or known to the skilled artisan now or at any time in the future . a group of items linked with the conjunction “ and ” should not be read as requiring that each and every one of those items be present in the grouping , but rather should be read as “ and / or ” unless expressly stated otherwise . similarly , a group of items linked with the conjunction “ or ” should not be read as requiring mutual exclusivity among that group , but rather should also be read as “ and / or ” unless expressly stated otherwise . furthermore , although items , elements or components of the invention may be described or claimed in the singular , the plural is contemplated to be within the scope thereof unless limitation to the singular is explicitly stated . the presence of broadening words and phrases such as “ one or more ,” “ at least ,” “ but not limited to ” or other like phrases in some instances shall not be read to mean that the narrower case is intended or required in instances where such broadening phrases may be absent . the use of the term “ module ” does not imply that the components or functionality described or claimed as part of the module are all configured in a common package . indeed , any or all of the various components of a module , whether control logic or other components , may be combined in a single package or separately maintained and may further be distributed across multiple locations . additionally , the various embodiments set forth herein are described in terms of exemplary block diagrams , flow charts and other illustrations . as will become apparent to one of ordinary skill in the art after reading this document , the illustrated embodiments and their various alternatives may be implemented without confinement to the illustrated examples . for example , block diagrams and their accompanying description should not be construed as mandating a particular architecture or configuration . the previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention . various modifications to these embodiments will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention . thus , the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein . | 0 |
refer now to the drawings wherein depicted elements are , for the sake of clarity , not necessarily shown to scale and wherein like or similar elements are designated by the same reference numeral through the several views . when looking to migrate from an air gap package ( e . g ., packaged ic 100 ), conventional thought is generally insufficient . some lower cost packages would be an epoxy mold compound ( emc ) package and a green mold compound package , where , in each case , a mold compound is deposited directly onto the ic ( e . g ., ic 102 ), but conventional thought , though , would dismiss these types of packages as a replacement for air gap packages because empirical evidence shows significant performance degradation . one reason for this is that most of literature related to emc packages centers on the reliability , thermal , and mechanical performance . almost no data can be found regarding the effects of mold compounds on the electrical performance of microelectronic devices . in other words , conventional thought ignored the impact of a mold compound on the electrical or electromagnetic performance . while this may appear to be intuitive , it is not , because most ics do not include active components or an active region ( e . g ., active region 306 ) at the surface of an ic . this type of assembly is relatively uncommon , and techniques that are suitable for other conventional applications ( e . g ., microprocessors ) may not be applicable for ics that include active components or an active region ( e . g ., active region 306 ) at the surface . for ics that include active components or an active region ( e . g ., active region 306 ) at the surface , it can be said that when an active or passive device is encapsulated with a mold compound , the electromagnetic fields in the volume around the die and interconnects that carry the signals in and out the package are affected by the change of the dielectric constant ( ε ) and dissipation factor ( tan δ ) of the mold compound , namely for high frequency applications . typical values of dielectric constant for mold compounds are around 4 , and the dissipation factor is typically between about 0 . 001 and about 0 . 01 . this means that , compared to air cavity packages ( e . g ., packaged ic 100 ), the electrical performance can be affected , mainly , in two aspects . the first aspect is related to the high dielectric constant of the mold compound that can increase the capacitive coupling between the structures in the surface of the die and also between the interconnects . the second aspect is related to an increment of losses due to the increase in the dissipation factor caused by the mold compound . this effect can cause degradation in the efficiency of the devices and generation of heat that should be dissipated in order to keep the temperature under specifications . turning to fig1 , an example of a packaged ic 200 with a lower cost package can be seen . in this example , ic 402 is similar to ic 102 in construction in that it includes an active region or active components at its surface and will typically include an epi layer formed over a substrate . for example , ic 402 can be an ldmos high power high frequency transistor that can be used in the power amplifiers for the wireless infrastructure . this type of example device is able to deliver 90w of continuous rf power at frequencies of 2 ghz , and conventional packages are air cavity type ( i . e ., as shown in the example of fig1 ). in this example and similar to packaged ic 100 , there can be two dies ( e . g ., ic 402 ) coupled in parallel with wire bonds ( e . g ., 108 ) to the flanges ( e . g ., 110 and 116 ). the dies ( e . g ., ic 402 ) can have an area of about 5 mm 2 with a thickness of about 50 μm , and the package can be made of a copper - tungsten ( cuw ) alloy that can be designed to match the coefficient of thermal expansion of a alumina cover ( e . g ., lid ). the metal base ( e . g ., 104 ) can be plated with au to be able to use an gold silicide ( ausi ) eutectic die attach process . the difference between packaged ics 100 and 400 lies in the “ cover .” with the example packaged ic 400 , the lid 104 has been replaced with a fill 406 formed over the ic 402 and a mold compound 404 formed over the fill 406 . alternatively , the mold compound 404 can be omitted and a thicker fill 406 can be applied to the region illustrated as the mold compound 404 . typically , the fill 406 should encapsulate the upper or top surface of the ic 402 and be of sufficient thickness ( e . g ., greater than about 10 μm ) to confine electromagnetic fields at the surface of the ic 402 . a reason for using fill 406 to confine electromagnetic fields at the surface of ic 402 relates to the change in the output resonant frequency of the parts imparted by the fill 406 itself because ic 402 includes an active region at the surface , the parasitic capacitances and resistances and the inductance of the wires can form a resistor - inductor - capacitor ( rlc ) circuit . in order to maximize the transference of rf power to the load , the resonance frequency of the equivalent rlc circuit of the ic 402 ( e . g ., ldmos transistor ) should be matched to the specified frequency of operation of the amplifier . by filling the air cavity of the package with a mold compound 404 , for example , the dielectric constant of the cavity increases from 1 ( e . g ., dry air ) to approximately 4 . the increase of the dielectric constant of the cavity affects the previously described rlc equivalent circuit in two ways . the first is due to an increase of the parasitic capacitances because the active devices ( e . g ., in the active region of ic 402 ) at the surface coupled through a media of a higher dielectric constant . for the second way , the fill 406 affects the resonant frequency due to the increased capacitive coupling between wire bonds . in order to account for the effect of the fill 406 on the radio frequency ( rf ), samples were prepared ( labeled groups a and b in fig5 ), with both groups having substantially the same output resonant frequency . group a functioned as the control group , which employed an air cavity similar to that shown in fig1 . group b included the wire bond length adjustments to obtain substantially the same resonant frequency as group a ( air cavity packages ). the reduction in length of the wires reduces the inductance value of the rlc circuit and compensates for the increase of the parasitic capacitance explained above . the parasitic resistance , as shown in this example , is minimally affected and the final output resonant frequency of group b , after application of fill 406 , matches the output resonant frequency of group a . once the output resonance of both groups a and b have been substantially matched , a relatively accurate comparison of the performance can be accomplished by employing continuous wave rf measurements . in fig6 , the results of the measurement of the p1db versus frequency for the center and edges of the wideband code division multiple access ( wcdma ) band . the one decibel compression point p1db is generally defined as the power where the curve output rf power versus input rf power falls one decibel below the asymptotic linear characteristic . this parameter can be important in that it can define the maximum power a rf transistor can deliver at the linear regime . the effect of the fill 406 on p1db is evident from the data that shows a clear deterioration of 6 . 5 % in the maximum linear power the ldmos transistor can deliver for the example shown in fig6 . in fig7 , an example of a continuous wave measurement of maximum gain versus frequency for groups a and b measured at the center and edges of wcdma band can be seen . this parameter can be important as it measures the maximum gain the transistor can deliver in the linear regime . the curves show a worsening of 0 . 35 db in maximum gain for the group that has a fill 406 . fig8 shows an example of two typical curves of gain versus power out . this comparison shows that the fill 406 degrades the gain performance , not only at the peak of the curve ( as shown in the example of fig7 ), but in the entire range of output power . from the curves , it can be seen that there is a generally constant gain reduction of approximately 0 . 35 db for the linear range . it can also be observed that the gain curve of the device with fill 406 falls in the nonlinear region at lower output power confirming that p1db can be seriously affected . in fig9 , an example diagram of the drain efficiency versus rf output power can be seen . for output power up to 48 dbm in this example , it can be observed that there is no difference between the devices with fill 206 and the air cavity control parts . however , for output power above 48 dbm , there is a clear degradation of the drain efficiency . this degradation is likely due to loss tangent of material used for fill 406 . in order to understand the effects of fill 406 on the performance of the rf transistor while operating in a real application , a measurement employing both groups of transistors exciting them with a wcdma modulation standard was made . fig1 shows an example of the third order modulation distortion ( imd 3 ) for control group a and group b as a function of frequency . imd 3 is generally defined as the ratio of the power in one of the third - order tones to that in one of the main tones . as one can observe , the fill 406 can increase the adjacent channel power degrading the linearity of the transistor . additionally , fig1 shows an example of two typical curves of imd 3 versus power out . in this plot , a degradation in the linearity of the devices due to the fill 406 can also be seen . in the load pull measurements , the impedance seen can be varied by the output of the transistor to other than 50ω in order to measure performance parameters . in the case of power transistors , a load pull power bench is used to evaluate large signal parameters such as compression characteristics , saturated power , efficiency and linearity as the output load is varied across the smith chart . fig1 shows an example of the load pull results obtained for p1db as a function of frequency . it can be seen that there is a degradation of p1db in the order of 5 to 6 % when the fill 406 is employed . fig1 shows an example of the results of the maximum gain as a function of frequency for groups a and b measured using a load pull setup at the center and edges of the wcdma band frequencies . as it was explained above , when fill 406 is used , the change of the dielectric constant above the surface of ic 402 can change the capacitive coupling between different structures of the device ( e . g ., gate , drain , and source of an ldmos transistor ). fig1 - 16 show examples of the measurements of the parasitic capacitances . it can be seen that , on average , ics having fill 406 can have a 4 % higher values of gate - drain capacitance , a 10 % higher drain - source capacitance , and a 20 % higher gate - drain capacitance . therefore , in order to reduce the impact of the encapsulating material on the performance of the devices , it is necessary to use a low dielectric constant , low loss material to cover the die , probably using a glob - top technique . preferably , the dielectric constant of the fill 406 should be approximately equal to that of dry air to achieve desirable results . having thus described the present invention by reference to certain of its preferred embodiments , it is noted that the embodiments disclosed are illustrative rather than limiting in nature and that a wide range of variations , modifications , changes , and substitutions are contemplated in the foregoing disclosure and , in some instances , some features of the present invention may be employed without a corresponding use of the other features . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention . | 7 |
referring now in greater detail to the drawings , fig1 illustrates an apparatus 4 being designed and arranged to measure the strain or deformation of a tire element of a tire 10 of a motor vehicle 8 during its contact with a road 15 while the vehicle 8 is moving . the tire 10 is mounted to a wheel 9 of the motor vehicle 8 , and it rotates together with the wheel 9 in the direction of a turning arrow 14 about an axis of rotation 18 . thus , the motor vehicle 8 moves forward in a direction of an arrow 13 ( x - axis ). the apparatus 4 includes a transmitting and receiving unit 7 which is fixed to the vehicle behind the wheel 9 , of a frequency analyzing unit 20 being associated with the unit 7 , and of a transponder unit 19 being arranged within the tire which is read out by radio signals . the transmitting and receiving unit 7 includes a transmitter antenna 5 for emitting an electromagnetic exciting wave or read - out signal , and a receiver antenna 6 for receiving an electromagnetic sensor wave or sensor signal . the transmitter antenna 5 and the receiver antenna 6 can also be realized as one common antenna . the frequency analyzing unit 20 controls the transmitter antenna 7 for emitting the read - out signal and analyses the signal received by the receiver antenna 6 for its frequency or frequency composition . the sensor signal is back - scattered by the transponder antenna 17 of the transponder unit 19 as a response to the read - out signal and results in an output signal of the receiver antenna 7 . the sensor signal is modulated as compared to the read - out signal by the time dependence of an sensor 16 which has an electrical impedance sensitive to the measurement value , and which is connected to the transponder antenna 17 , and which thus changes the radar cross section ( or radar reflectivity ) of the transponder antenna 17 with the time dependence of the process to be measured . the sensor 16 can also be an integrated part of the transponder antenna 17 . the measurement value of interest here is the strain of a tire element 12 of the tire 10 . correspondingly , in this case the sensor is arranged within the tire 10 . it may be assumed that the motor vehicle 8 shows a uniform linear movement in the direction of the arrow 13 . because the antennas 5 and 6 are placed behind the wheel 9 , the tire element 12 including the sensor element 16 is moving towards the antennas and generates a doppler shift during passing through the contact area of the tire 10 with the road 15 . if an arrangement of the antennas 5 , 6 in front of the wheel 9 was chosen , the profile element 12 would move away from the antennas 5 , 6 , thus changing the sing of the doppler shift . using an arrangement of the antennas 5 , 6 vertical above the contact area , the doppler shift would become zero . nevertheless , the measurement method described here would work anyhow . in the following calculations only those movements in the direction of arrow 13 are considered ; thus , the antennas may be regarded as being placed at the level of the roadway 15 . if the altitude above the roadway 15 would be taken into account , this would not change anything concerning the basic considerations but the formulas would become more complicated . this results in an angular velocity ω wheel of the tire 10 according to the equation : case 1 : circular movement of the wheel without consideration of the flatness of the tyre in the contact area . the x - axis may be parallel to the direction of movement , and the taxis may be that direction from the axis of rotation 18 to the contact area . if the motor vehicle is moving straight on in forward direction , the considered profile element 12 is moving in the x - y - plane . the antennas 5 , 6 , which are fixed to the motor vehicle 8 are assumed to be on the same level as the surface of the roadway 15 . s , s x , s y are the location and the components of the location , and v , v x , v y are the velocity and the components of the velocity of the sensor element 16 in the x - y - plane or x -, y - direction with regard to the fixed antennas 5 , 6 . t is chosen in such a way that the profile element is in the center of the contact area at t = 0 . s 0 is the distance in x - direction between the antennas 5 , 6 and the center of the contact area , i . e . s 0 is the distance in x - direction between the antennas 5 , 6 and the axis of rotation 18 of the tyre 9 . this results in : the doppler - shifted frequency f d of the reflected sensor signal can be calculated using the frequency of the read - out signal f 0 and the velocity of light c : the maximum of the doppler shift occurs in those two positions in which a straight line connecting the antennas 5 , 6 , which are fixed to the motor vehicle , and the transponder antenna 17 form a tangent to the wheel , i . e . : f 0 = 1 ghz , v car = 100 km / h . this results into a maximum doppler shift of f d − f 0 = 92 . 5 hz , which can be measured easily by a cw - radar as can be seen from police speed measurements . in the following , only the movement of the transponder unit along the x - axis will be considered to simplify the calculations . the above equations are thus simplified to : case 2 : circular movement of the wheel with consideration of the flatness of the tire 10 in the contact area . while passing through the contact area , the profile element 12 is no more moving circularly but linearly . because the secant is shorter than the circular arc , a strain of the tire 10 results with a bulge both in the running in area and in the running out area . if a circular movement is subtracted from the corresponding movement of the profile element , the movement shown in fig2 and denoted with x remains . the curve denoted with x is now approximated with a sinus curve for further simplifying the calculations . the maximum strain ( approximately 0 . 45 mm in fig2 ) is denoted with a contact . the length of the contact area ( 2 a and 2 b in fig2 ) is denoted with l contact . the total length of the sinus curve , which is an approximation of the actual strain of the profile element , is approximately given by 2 * l contact . the corresponding frequency f contact and the angular frequency ω contact of the movement through the contact areas can be derived from the fact that the motor vehicle 8 goes through the length 2 * l contact with its velocity v car : v car = f contact · 2 · l contact → f contact = v car 2 · l contact → ω contact = 2 · π · f contact = π · v car l contact the movement s x of the sensor 16 with regard to the fixed antennas 5 , 6 in x - direction is given by : any time when the profile element 12 moves through the area ± l contact around the centre of the contact area , the specific movement due to the strain of the profile element 12 , which is shown in fig2 and denoted with x there , is added to the circular movement of the profile element 12 . the sign is given by the fact , that the strain points away from the antennas 5 , 6 in the first part of the contact area , which is the accelerating area , and then points towards the antennas 5 , 6 , in the second part of the contact area , which is the decelerating part . this means , that the ordinary movement of the tire element is delayed in the running in area due to the bulge . at the time t = 0 the tire element 12 is again located at the distance s 0 in the middle of the contact area . as a result , there are two portions of the doppler shift , the amplitude of the strain of a tyre element being by the factor π * a contact / l contact smaller than the contribution of the turning of the wheel . l contact = 8 cm ( see fig2 ) and a contact = 0 . 45 mm thus the doppler shift is increased by approximately 1 . 8 %, which is very hard to detect . by processing of the doppler shift alone no significant measurement signal describing the conditions of during passing the contact area can be extracted . although the frequency ω latsch is clearly higher than the turning frequency of the wheel ω wheel , the amplitude a contact is also significant smaller as compared to the radius of the wheel r . case 3 circular movement of the wheel with consideration of the modulated back scattering process . according to the invention , the strain a contact · sin ( ω contact · t ) is now transformed into a modulation of the frequency of the back - scattered sensor signal . to this end , the electrical parameters of a frequency determining element of the sensor , e . g . a part of the transponder antenna 17 , or any load of the transponder antenna 17 , is altered at the angular frequency ω contact . this can be achieved by deforming the shape of the antenna due to the strain of a tire element , thus tuning ( or modulating ) their resonant frequency , or , by using a strain gauge , like a tuneable capacitance , inductance , or resistance , to implement the sensor 16 as a load of the transponder antenna 17 . thus , the circuitry , which is provided by the transponder antenna 17 and the sensor 16 includes at least one element z ( t ) the electrical impedance z of which is changing due to the strain of the tire element . the back - scattered sensor signal thus contains at least one component with the same time dependence as z ( t ). the spectrum of this component corresponds to the spectral composition of z ( t ) and thus to those of the strain of the tire element . if the electrical impedance of the load z ( t ) is altered between open and short while the profile element passes the contact area , or if the resonance frequency of the antenna is altered by the fraction f 0 / q , q giving the quality factor of the transponder antenna 17 , the phase of the back scattered sensor signal is changed by ± 180 °, which corresponds to a shift of a “ reflector mirror ” by a distance of ± λ / 2 . here , λ is the electromagnetic wave length of the sensor signal : λ = c / f 0 . the sensor signal which is modulated in this way can be regarded as a signal which is doppler - shifted by the frequency f latsch , the amplitude a contact of which , however , is λ / 2π : hence , the shift of the sensor signal generated by the modulation of at least one electrical parameter of the back - scatter with the aid of the strain of the tire profile element with regard to the doppler shifted signal will be in the order of the ratio of 1 / l contact to 1 / λ . therefore , the coefficient /( 2 · l contact ) gives the relation between the sensor signal representing the strain of a tire profile element and the doppler - shifted back - scattered signal . a typical example : l contact = 8 cm ( see fig2 ). using the international ism bands ( ism = industrial , scientific , and medicine ), the following results are achieved : frequency f 0 wave length λ relative distant of the modulated signal and the doppler shifted one ( = λ 2 · l latsch ) 433 mhz 70 cm 4 . 3 869 mhz 35 cm 2 . 2 2 . 45 ghz 12 cm 0 . 76 5 . 6 ghz 5 . 3 cm 0 . 33 19 ghz 1 . 5 cm 0 . 1 73 ghz 0 . 4 cm 0 . 02 the absolute distance between the sensor signal characterizing the strain of a tire profile element and the doppler - shifted back - scattered signal remains the same , but their ratio decreases with increasing frequency . if the electrical impedance z ( t ) is changed by only a small amount due to the strain of a tire profile element , the corresponding “ reflector mirror ” will be shifted by a smaller amount than λ / 2 . in this case the back - scattered signal can be decomposed into a first part with no change due to the strain at all , and a second part the phase of which changes by ± 180 °. the second component again has the same spectral composition like z ( t ). consequently , in this case not the spectral composition of the modulated back - scattered signal is changed but only the amplitude of the signal generated by a modulation of at least one electrical parameter of the back - scatter with the aid of the strain of a tire profile element . if , for example , the back - scattered signal will be changed due to the variation of the electrical parameter z ( t ) in amplitude or phase by only 1 %, then the modulated part of the whole signal will be 1 / 100 , or − 20 db of the full amount of the back - scattered signal . the modulation shift , however , is still f latsch = ω latsch / 2π . the total spectral composition of the back - scattered signal will again be f d , with : with the novel method and apparatus , not only the fundamental of the signal generated by a modulation of at least one electrical parameter of the back - scatter is monitored with the help of the strain of a tire profile element , which is denoted with x in fig2 , but also higher harmonics of this signal may be monitored . the ratios of the higher harmonics to the fundamental signal contain the desired information about the actual shape of the strain of a tire profile element 12 , which gives the information about the tire on the road friction coefficient , and also information about local slipping processes of single profile elements 12 during the roadway contact . the frequency shift of this higher harmonics is yet higher than the frequency shift of the fundamental . the above calculations show that frequencies in the uhf and vhf region up to some 6 ghz are well suited for the described measurement method to monitor the strain of a tire profile element . many variations and modifications may be made to the preferred embodiments of the invention without departing substantially from the spirit and principles of the invention . all such modifications and variations are intended to be included herein within the scope of the present invention , as defined by the following claims . | 1 |
referring now to the drawings in greater detail , and to fig1 for now , there is shown a system architecture in which the present invention is employed . the system architecture consists of a number of ip telephones 10 , or the equivalents thereof , that are typically coupled to a personal computer or workstation 10 ′. the pc &# 39 ; s and ip telephones , or end - users , form part of an ip , packet - based data network system . while each end - user 10 is typically an ip telephone , it may be a pots - type telephone whose audio data stream has been converted to ip data format , in the well - known manner . the system architecture includes one or more media servers 12 depending upon system requirements and scale . each server has the software applications , described in detail hereinbelow , embedded therein for achieving call - recording in accordance with the present invention , and includes all call - managing and logging . these media servers bridge end - users , whereby all audio data is streamed or routed through a respective server , so that the call - control manager of the invention may record the call and perform other functions described in detail hereinbelow . the media servers 12 , in turn , are coupled to a central file server 14 where all of the recorded files that have been recorded and stored at the 1 through n media servers are downloaded for storage , for access thereto by a dedicated personal computer 18 . the specific media server 12 of the 1 through n media servers 12 that is used for recording calls of a specific end user or workstation is determined using the following algorithm to optimize networking resources : 1 . media server of the call manager that is hosting the triggering end - user ; 2 . the lowest loaded media server on the same lan of the triggering end - user ; or 3 . the lowest loaded media server on another lan when call - admission control is disabled . this approach provides considerable benefits for systems that span multiple geographic locations . by utilizing the optimal call manager to manage the media stream , additional optimization is capable by utilizing the call manager &# 39 ; s knowledge of the call - state . when an end - point being recorded is put on hold , the call manger does not route the moh ( message - on - hold ) stream through the recording media server , thus not wasting resources recording that moh call . another instance involves transfers . since the call manager of the optimal media server knows every call - state , when an ongoing call of an end - point 10 being recorded is transferred , the recording is automatically split into two recording files , since the call manager is made aware of the call - transfer state . an example where this is especially useful is as follows : a pstn call arrives to a customer - service agent end - user 10 ; after being unable to solve the problem , the service agent transfers the call to a supervisor at another end - point 10 . afterwards , the supervisor would like to review the call with the agent . the supervisor may easily access the leg of the call between the customer and the agent without exposing his discussion with the customer that occurred after the transfer . each media server 12 creates a recording of the session in a common format for easy playback . this format may be , for example , an 8 khz , 8 - bit sampled , u - law wav file . recordings are initially cached on the local or optimal processing media server 12 , where they remain , or may optionally transferred to an alternative storage share or file server 14 of the data network , thus providing flexible recording storage . in the case of workstation or pc to which an ip phone or end - point 10 is connected , a desktop cti ( computer - telephony interface ) application playback can be used to obtain credentials and access his or her recording log . the selected recording can be streamed back via rtsp ( real - time streaming protocol ) or downloaded and played back locally . since the storage of recordings are stored on a file - share in the data network using secure identity , prevention of any unauthorized access to the recording store is achieved , thus providing secure playback of recordings , where access to the recordings require some form of authentication . playback may also be achieved by phone playback using a pin code to identify the user where a recording log is displayed for selection of a recording for playback . alternatively , web - service playback is also possible via a secure web - service using username / password credentials to obtain the recording log . the selected recording can be streamed back via rtsp ( real - time streaming protocol ) or downloaded and played back locally . referring now to fig2 and 3 , there is shown the main software architecture of the invention at each media server 12 . audio data stream from ip phones 10 , or their equivalents , are conventionally connected to the network via a network interface card ( nic ) 20 , one phone being the source providing an audio stream 0 and the second being the destination providing an audio stream 1 . the network interface card ( nic ) acts as a gateway through which audio data frames are transmitted and received at the media server . the nic is controlled by a conventional network driver interface or miniport adapter or driver 22 by which one or more nic drivers send and receive data packets and communicate with the one or more overlying protocol drivers and the operating system . the miniport adapter 22 delivers the audio data stream to the intermediate - level rtp ( real - time transport protocol ) intermediate bridge driver software kernel 24 of the invention . the rtp level provides end - to - end network transport functions for applications transmitting real - time data , such as the telephone audio data stream , over multicast or unicast network services . the data transport is , conventionally , augmented by a control protocol ( rtcp ) to allow monitoring of the data delivery in a manner scalable to large multicast networks , and to provide minimal control and identification functionality . rtp and rtcp are designed to be independent of the underlying transport and network layers . the rtp protocol supports the use of rtp - level translators and mixers . this rtp intermediate protocol driver interface lies between legacy protocol adapter or driver 22 and the upper level transport protocol adapter or driver 26 which driver implements a tdi interface or another application - specific interface to provide services to its users . such a driver allocates packets , copies data into the packets and sends the packets to the lower level driver by calling the ndis . it also provides a protocol interface at its lower level to receive packets from the next lower level driver or adapter 24 . the intermediate , high - performance network rtp bridge device driver 24 is located immediately above the network interface driver 22 in the network stack and processes every network packet that is received . this processing consists of passing each received audio data packet up to the next higher ip protocol adapter driver 26 in the network stack , and inspecting each packet to determine if it is an rtp packet whose destination port is listed in a redirection table 30 at the rtp level , which redirection table is set up by the call manager program in order to redirect the call to call destination , as discussed hereinbelow in detail . a call coming in has the media server as its destination , so that the call manager must redirect the call to its actual , intended destination . those packets which meet this latter criterion are duplicated , and then overwritten with respect to source and destination ip addresses and ports — these values being read from the same redirection table entry that contained the destination port . the duplicated packet is then passed back to the network driver 22 to be transmitted . the delay introduced from reception to retransmission is less than 1 ms . the source audio stream 0 ( block 32 of fig2 ) and the destination audio stream 1 ( block 34 of fig2 ) sent from the rtp bridge driver are then input into the recording application 34 ′, and thereafter encoded by an encoder 36 and stored in local storage medium 38 of the respective media server 12 , for subsequent storage in network storage device or file server 14 , if desired or required . it is noted that the above - described packet reflection procedure is codec ( coder - decoder ) independent . at the application level , the packets to be recorded are independently decoded , whereby the bi - directional media streams 32 , 34 utilizing asymmetric codes are supported . the two streams 32 , 34 are summed to create a single recording of both sources in the call . the summed stream is converted to a common format for storage and playback , such as 8 khz , 8 - bit sampled , u - law wav file . since the real time reflection of the stream is handled below the ip stack , the application layer utilizes the ip stack buffering while performing the decoding , summing , recoding and transfer to recording - storage operations . information regarding the call recording is stored as an extension to the cdr ( call detail record ). therefore , recordings are searchable by all cdr attributes such as caller id ( clid ) or automatic number identification ( ani ); dialed number identification service ( dnis ). cdr reports can provide an indication that there is a recording available for a call . referring now to fig4 , the recording resources selection logic is shown . once a call is initiated ( block 40 ), the recording applications software 34 determines if the call is one that requires recording ( block 42 ) as set either by the local end - user or workstation , or an administrator . if it is not a call to be recorded , then the audio data stream is set up as usual and the call completed in a normal manner ( block 44 ). if the answer to decision block 42 is “ yes ”, then the software determines if there are recording resources available on the respective managing host media server 12 associated with the source , ( decision block 46 ). if “ yes ”, then the subsequent audio streams 32 , 34 ( fig2 ) are re - routed via this media server ( block 48 ), with call setup accomplished ( block 50 ), and with the audio data streams 32 , 34 being recorded via the recording application at the host media server . if the answer to decision block 46 is “ no ”, then the software of the invention looks for other media servers 12 on the same lan as that of the triggering end - user to see if they have recording resources available ( decision block 50 ′). if yes “, then the audio streams 32 , 34 are re - routed to the one thereof having the most availability ( block 52 ). if the answer to decision block 50 ′ is “ no ”, then the system software looks to recording resources availability at media servers of another lan not associated with the triggering end - point ( decision block 52 ′). if “ yes ”, then the audio streams 32 , 34 are re - routed to the one thereof having the most availability ( block 54 ), with the call setup completed ( block 50 ). if the answer to decision block 52 ′ is “ no ”, then the application software determines in decision block 56 if the call should allowed to be completed without the recording thereof . if “ yes ”, the call setup is completed ( block 44 ). if “ no ”, then a “ failed ” call signal is sent back to the triggering or source end - user ( block 58 ). referring to fig5 , there is shown the flow chart for the intermediate rtp bridge driver 24 of fig2 and 3 . the rtp bridge driver waits for audio packets from the protocol adapter 22 of fig2 and 3 ( block 60 ), whereupon receipt thereof , it sends the packets to the upper - level ip protocol adapter 26 of fig2 and 3 ( block 62 ), where it is decided in decision block 64 if the packets contain rtp data . if the answer to decision block 64 is “ no ”, then nothing is done . if the packets are rtp data , then decision block 66 determines if the destination port is listed in re - direction table 30 of fig2 . if not , then nothing is done , since the call would not be able to be recorded . if “ yes ”, then the source ip address and destination and port ip address are re - written , with a new ip and ethernet checksums computed ( block 68 ), whereupon the modified packet is sent to the miniport adapter 22 of fig2 and 3 ( block 70 ). referring now to fig6 , there is shown the flow chart for the recording applications software . in order to create a recording of a conversation between two end - points , the voice from both sources ( stream 0 and stream 1 ) must be captured and mixed together . a packet queue of depth 8 is created to sum , or mix , together the packets of the streams . every 20 ms , which is the nominal audio packetization period , the software application of the invention attempts to read a rtp packet and sum it into that stream &# 39 ; s next available element of the queue for the stream . this done once for each of stream 0 and 1 per interrupt of 20 ms . the rtp packet from an audio stream 32 , 34 ( block 71 ) is read ( block 72 ). decision block 74 decides if there is any audio data to read ; owing to network jitter and possible packet loss , there may be no data or more than one packet of data available to be processed . if “ yes ”, then the software decodes the data ( block 76 ) and then determines if there is room for the data in queue ( decision block 78 ). many codecs can be used to transport rtp . the rtp is decoded into a linear format before it is mixed , if the answer to decision block 78 is “ yes ”, then the operation of summing is performed placing the data into the next available queue element for the associated respective streams 0 and 1 . the use of a pointer for each stream 0 and 1 is used that allows the summation process to reconcile the effects of network jitter ( block 88 ). if the answer to decision block 78 is “ no ”, then the software flushes all summed samples from the queue to disk ( bock 82 ). a summed sample refers to a queue that has had data from both streams 0 and 1 summed into it . these elements are complete and can be moved from the queue and sent to the disk to free up space to sum more packets . the software then determines in decision block 84 if there is now room for the data in queue . if “ yes ”, then the program proceeds to block 88 to sum the data into the next available queue element for the available stream , as described above . if the answer to decision block 84 is “ no , then the software flushes enough unsummed samples from the queue until there is room for data ( block 86 ). due to severe jitter or packet loss in the network , it is possible to exhaust the queue with only data from one of the streams 0 and 1 ; in this case , an element containing only one stream &# 39 ; s data will be moved from the queue and sent to the disk for storage . then , the program proceeds to block 88 , as described above . the steps from blocks 78 through 88 are used to sum both audio streams 32 , 34 ( streams 0 and 1 ) in buffer in order that the complete conversation is recorded , with both ends of the call recorded in sequence as it actually occurred , as described above . if the answer to decision block 74 is “ no ”, or after completing the sum - data step of block 88 , the program then increments in block 90 from data stream 0 to data stream 1 , if data stream 0 had been processed . if data stream 1 had been processed , then the software determines that the audio data stream is greater than one (“ yes ” to decision block 90 ), meaning the software will return and await data for stream 0 again . if the answer is “ no ” to decision block 92 , then the program awaits receipt of audio data for stream 1 from the rtp bridge level . the queue consists of a buffer with 2 pointers , one pointer for each stream ( stream 0 pointer and stream 1 pointer ). the queue is initialized to silence and each sample flushed to disk is replaced with silence . as packets arrive for each system , they are summed into the next available location in the queue , resulting in either packets containing the sum of stream 0 and stream 1 or the data from a single system stream if the other stream is unavailable for a period of time ( some stream data may not available due to packet loss or excessive jitter ). referring to fig7 , there is shown the recording setup call flow managed by the call manager program 34 of the invention stored at a media server 12 . the call flow describes the signaling between the call manager , media server and the phones in order to manage and record a call . the call manager controls the call setup and the redirection table 30 at the rtp bridge driver level 24 ( fig2 ), and provides the duplication of the packets overwritten with respect to source and destination ip address and ports — these values being read from the same redirection table entry that contained the destination port . the duplicated packet is then passed back to the network driver 22 to be transmitted . in fig7 , the initial state is an established connection between phones a and b . the call manager initializes recording of the call via the respective media server , and then creates media connections consisting of media descriptions a and b , containing the ip addresses and port that the end - point will be accepting the rtp stream . the media server responds to the call manager with the “ create connection result ”, which includes the media server descriptions of a and b , each of which includes the ip address and ports that the media server will be using to accept the rtp streams . the call manager , in turn , modifies the media connection &# 39 ; s descriptions of a and b and triggers the media server to start the process of forwarding copies of , or duplicating , the voice packets to a and b for the rtp bridge . the media server then signals the call manager with the modified connection result of the media descriptions a and b . the call manager then modifies the media connection result for sending packets to phone a , which sends modified connection packets back to the call manager , followed by the same for the connection with phone b . the redirection table redirection table 30 at the rtp bridge driver level 24 ( fig2 ) consists of 5 parameters per entry . each entry is responsible for one unidirectional stream . two entries are required to record both directions of a phone call : listenport — the udp ( user datagram protocol ) port the media server listens on for the incoming rtp stream to be processed ; sendport — the udp ( user datagram protocol ) port the media server will use to transmit copied rtp packet from ; redirectport — the port of the destination endpoint that the media server will send rtp to ; redirectipaddr — the ip address of the destination endpoint that the media server will send rtp to ; redirectmacaddr — mac ( media access control ) address to redirect to ( this may be the endpoint or the gateway if located on another subnet ) the redirection table parameters are obtained by the recording application of fig6 , and passed on to the rtb bridge driver as follows . redirectport and redirectipaddr are obtained by the recording application during call setup ( see recording call flow diagram of fig7 discussed hereinabove ). recording application performs an arp ( address resolution protocol ) to obtain the mac ( media access control ) address to be used . the recording application opens the listen and send ports to be used . the recording application passes these parameters to the rtp bridge driver to build the redirection table . the application of the rtpbridge is not limited to the recording of audio rtp . the present invention may be used to record video rtp . it may be utilized for applications beyond recording . for example , it may also be used to construct an n - party conference broadcast application as diagrammed below : the present invention is not restricted to rtp traffic . it may be used for any application requiring the need to efficiently relay real time udp traffic . while a specific embodiment of the invention has been shown and described , it is to be understood that numerous changes and modifications may be made therein without departing from the scope and spirit of the invention as set forth in the appended claims . | 7 |
fig1 a illustrates a computer of a type suitable for carrying out the invention . viewed externally in fig1 a , a computer system has a central processing unit 100 having disk drives 110 a and 110 b . disk drive indications 110 a and 110 b are merely symbolic of a number of disk drives which might be accommodated by the computer system . typically , these would include a floppy disk drive such as 110 a , a hard disk drive ( not shown externally ) and a cd rom drive indicated by slot 110 b . the number and type of drives varies , typically , with different computer configurations . the computer has a display 120 upon which information is displayed . a keyboard 130 and a mouse 140 are typically also available as input devices . preferably , the computer illustrated in fig1 a is a sparc workstation from sun microsystems , inc . fig1 b illustrates a block diagram of the internal hardware of the computer of fig1 a . a bus 150 serves as the main information highway interconnecting the other components of the computer . cpu 155 is the central processing unit of the system , performing calculations and logic operations required to execute programs . read only memory ( 160 ) and random access memory ( 165 ) constitute the main memory of the computer . disk controller 170 interfaces one or more disk drives to the system bus 150 . these disk drives may be floppy disk drives , such as 173 , internal or external hard drives , such as 172 , or cd rom or dvd ( digital video disks ) drives such as 171 . a display interface 175 interfaces a display 120 and permits information from the bus to be viewed on the display . communications with external devices such as a network can occur over communications port 185 . fig1 c illustrates an exemplary memory medium which can be used with drives such as 173 in fig1 b or 110 a in fig1 a . typically , memory media such as a floppy disk , cd rom , or digital video disk will contain the program information for controlling the computer to enable the computer to performs its functions in accordance with the invention . fig2 a is an illustration of one exemplary form of implementing the invention using a network such as an intranet . the network 200 is typically an internal organizational network that connects the client computing device 21 d and at least one www server 22 d . fig2 b is an illustration of another exemplary form of implementing the invention using a typical internet arrangement . the client computing device 250 connects via one network with the client &# 39 ; s internet service provider ( isp ) 240 . the isp 240 then connects via the internet 230 to a www server 260 requested by the user . fig3 is an illustration of bandwidth allocation from a network server to several clients . the network server 300 has a predetermined amount of bandwidth n 310 which it must divide 320 , 330 , 340 and 350 between multiple clients 360 , 370 , 380 , and 390 . note that the bandwidth allocation each client receives varies . this variance reflects the bandwidth allocation of the prioritized client connections as described in fig4 , hereinafter . fig4 is a database schema organized as an exemplary way for storing file - type priorities . the table has two columns : file type 400 and priority 410 . an html file 420 will have a priority of 4 ( 430 ). a style sheet 440 will have a priority of 3 ( 450 ). priority 2 470 is reserved for future use . gif 480 and jpg files 490 both have priorities of 1 ( 485 and 495 ). fig5 is a database schema organized as an exemplary way for storing connection information about clients actively involved in retrievals . the allocation utilization table ( aut ) 500 shown is a data structure used to track the status of each active current connection . for each such active current connection the file name 510 , priority 520 ( determined from fig4 ), allocated bandwidth 530 , utilized bandwidth 540 , and a recalculation boolean variable 550 are stored in the aut . the aut is used to provide the data for the bandwidth reallocation algorithm of fig7 . in rows 560 and 565 it should be noted that the allocated bandwidth exceeds the utilized bandwidth . when this difference exceeds a threshold , the recalculation variables are automatically set to false to prevent re - allocation of more bandwidth than the connection can utilize . fig6 is a flowchart of a monitoring procedure to initiate dynamic bandwidth allocation by the server . a continuous monitoring loop 600 responds to events affecting bandwidth allocation . one event is a new request ( 605 ) for bandwidth . normally , this will occur when an http get command is received by the server . following a new request 605 the requested file name and its associated priority based on its file - type are placed into the aut and the recalculation variable is set to true ( 610 ). then the recalculation of bandwidth allocation algorithm is invoked ( 650 ) which updates the aut , then the aut is used to provide parameters to the bandwidth allocator ( 655 ) and the monitoring loop resumes 600 . an event indicating the completion or cancellation of a transmission connection ( 615 ) will remove the connection from the aut ( 620 ). then the recalculation of bandwidth allocation algorithm is invoked ( 650 ) which updates the aut , the aut is then used to provide parameters to the bandwidth allocator ( 655 ) and the monitoring loop resumes ( 600 ). an event indicating that the client is not utilizing all of the allocated bandwidth occurs when the average throughput of data ( calculated , for example , using the number of acks received per unit of time ) falls below the allocated bandwidth maximum data rate ( 625 ). various protocols from in the prior art , including stop - and - wait link utilization and sliding - window flow control , can be used to calculate the actual data rate . for example , one might add the packet lengths of a number of packets sent over a period of time and divide the total by the length of the period of time to determine effective throughput , or actual data rate . that value is then stored in the aut and the recalculation variable is set to false so that for the remainder of that retrieval request the bandwidth re - allocation algorithm will not increase that connection &# 39 ; s bandwidth ( 630 ). then the recalculation of bandwidth allocation algorithm is invoked ( 650 ) which updates the aut , the aut is then used to provide parameters to the bandwidth allocator ( 655 ) and the monitoring loop resumes ( 600 ). an event indicating a change in the relative priority of a transmission ( 640 ) may occur . the priority for that transmission is then updated in the aut ( 660 ). then the recalculation of bandwidth allocation algorithm is invoked ( 650 ) which updates the aut , the aut is then used to provide parameters to the bandwidth allocator ( 655 ) and the monitoring loop resumes ( 600 ). a scheduled event may be set to occur periodically ( 645 ). this event is to handle any situation not handled by the other events . then the recalculation of bandwidth allocation algorithm is invoked ( 650 ) which updates the aut , the aut is used to provide parameters to the bandwidth allocator ( 655 ) and the monitoring loop resumes ( 600 ). fig7 a is a flowchart of a procedure for dynamic bandwidth allocation by the server . the procedure begins by initializing several variables : maxbw is set to the maximum bandwidth available to the server , count is set to the number of rows in the aut ( i . e ., the number of current connections ), sumofpriorities is set to zero , and index i ( a loop counter ) is set to one ( 700 ). if index i is not greater than count ( 705 ) then there are more rows to process in the aut . at 710 the maxbw is decreased by any difference between the allocated bandwidth and the utilized bandwidth . if the aut recalculation variable for the current row is true then the priority of the current row is added to the sumofpriorities ( 720 ). this action prevents those connections that are being under - utilized from receiving more bandwidth which they have already demonstrated they cannot use . then index i is incremented by one ( 725 ) and the loop continues at 705 until all the rows in the aut have been processed . index i is re - initialized at 730 to one and another loop commences at 735 . while index i does not exceed count ( 735 ), the recalculation variable of each row is checked 760 . if it is false then the current aut row has its allocated bandwidth set to equal its utilized bandwidth ( 755 ) thus reflecting the true state of the system . if it is true , then the current aut row allocated bandwidth variable is assigned the value of the ratio of the current row &# 39 ; s priority to the sumofpriorities and the utilized value is set to equal the allocated value ( 765 ). this assumes that the client connection can utilize the new bandwidth it has been allocated . if it cannot , then it will be detected and corrected via fig6 at 625 . in either case , index i is incremented ( 770 ) and processing the remaining rows in the aut continues at 735 . if all the rows have been processed ( 735 ) then the aut has been completely updated and is ready for use by the bandwidth allocator in fig6 at 655 and the process is terminated ( 750 ). fig7 b is a illustration depicting the result of one iteration of the dynamic bandwidth allocation procedure of fig7 a . assume a web server is transmitting an htlm document and a jpg file to one client and a gif file to another client . using the bandwidth allocation algorithm described in fig7 a and using the priority scheme of fig4 , the sum of the priorities is 6 so the htlm document will receive 4 / 6 ( 66 . 7 %) of the bandwidth , and both the jpg file and gif file will receive ⅙ ( 16 . 7 %) of the bandwidth . now assume that the second client can only utilize 10 % of the total bandwidth ( which was determined using the process in fig6 at 625 ). the initial state 780 is shown in rows 781 , 782 and 783 . note that 783 has unused bandwidth capacity of 6 . 7 % of the server &# 39 ; s total bandwidth . in order for this bandwidth to be used , the bandwidth re - allocation algorithm of fig7 a is run again . the results of the reallocation are shown in the final state 790 . since the recalculation variable of the aut row for the jpg file would have been set to false , the sum of the priorities is now 5 and the proportional distribution of the spare bandwidth would be ⅘ for the html document 791 and ⅕ for the gif document 792 . so , ⅘ of the 6 . 7 % available bandwidth is re - allocated to the html document , resulting in a final bandwidth utilization of 72 . 0 %. repeating the process for the gif documents lead to a final bandwidth utilization of 18 . 0 %. the jpg file retains the 10 . 0 % share it could use prior to the re - allocation . fig8 a is a database schema organized as an exemplary way for storing client browser - status priorities . each browser has an id 800 , a status 810 and a priority 815 . the row 820 has an id of a , a status of “ has focus ” ( i . e ., is the user &# 39 ; s active browser ) and a high priority of 4 . browser id b 821 does not have the focus but is visible on the screen and has a priority of 2 . browser id c 823 does not have the focus and is not visible ( perhaps minimized ) and has a low priority of 1 . fig8 b is a flowchart of a procedure for clientside control of bandwidth allocation . similar to the algorithm of fig7 a , this procedure utilizes the ratio of a process priority to that of the sum of the priorities of all active process . the maxbw constant is initialized at 830 with the maximum bandwidth the client has available to manage . the priorities of the browsers in use are summed ( 840 ) and that sum is then used as the divisor of the individual browser priorities to determine the bandwidth to be allocated to each browser ( 850 ). next , the bandwidth is allocated , e . g . by controlling the number of packets acknowledged to the server to obtain the desired throughput rate ( 860 ) ( as described in fig6 at 625 ) and the process terminates ( 870 ). fig9 is a flowchart of a procedure for changing the priority of a connection after a fixed amount of data has been transmitted . as an alternative or a supplement to the preferred embodiment , an html file could be assigned a high priority only during the transmission of the first n kb . this approach might be used when only the first screen or part of the first screen of text must be delivered as rapidly as possible . the process begins by initializing n to the number of kb to transmit at high priority ( 900 ). then the new request event ( 910 ) ( fig6 at 605 ) is triggered . the number of kb transmitted is monitored ( 920 ) and when the number transmitted equals n ( 930 ) the aut is updated to reflect a lower priority by triggering the change priority event ( 950 ) ( fig6 at 640 ). fig1 a is a database schema organized as an exemplary way for storing a value representing the variable amount of data a specific file needs have transmitted at high priority . as another alternative or supplement to the preferred embodiment , an html file could be examined ( e . g ., using a browser ) to determine the number of bytes necessary to render the first page . this number of bytes would then be stored ( 1005 ) in a database along with the html file name 1000 . the database rows 1006 , 1007 and 1008 are examples of the name and byte tuples required . fig1 b is a flowchart of a procedure for changing the priority of a connection after the variable amount of data indicated in fig1 a has been transmitted . the variable n is set , via a database lookup of the file name , to the number of bytes that need to be transmitted with high priority 1010 . the new request event is triggered ( 1020 ) ( fig6 at 605 ) and the number of bytes transmitted is monitored ( 1030 ). when the number of bytes transmitted equals n ( 1040 ) the change priority event is triggered ( 1060 ) ( fig6 at 640 ) which then updates the aut table and begins the bandwidth re - allocation process and this process is terminated ( 1070 ). fig1 a is a database schema organized as an arc 15 exemplary way for storing a list of customer passwords and a corresponding priority multiplier . as another supplement or alternative to the preferred embodiment , the priority given to web pages could be based on information about the person requesting them . for example , valued customers can be given higher priority . when implemented in a log - in type website , a list of passwords that have higher than normal priority could be kept in the form of the tuple customer password 1100 and priority multiplier 1105 . as rows 1106 , 1107 and 1108 show , the multiplier can be different based on how valued the customer is . in another approach , a list of network addresses of valued customers is maintained and checked against the address of client &# 39 ; s connections to the server to determine priorities . fig1 b is a flowchart of a procedure for increasing the priority of a connection using the information contained within fig1 a . a customer accesses a website and enters his password ( 1110 ). if the password is in the priority database of fig1 a ( 1120 ) then the priority for the document requested is set to the standard priority for that type of document multiplied by the priority multiplier 1130 . for example , if an htlm document has a priority of 4 and the multiplier is 2 the new priority would be 8 . then the new request event is triggered ( 1140 ) ( fig6 at 605 ) and this process is terminated ( 1140 ). fig1 a is a database schema organized as an exemplary way for storing a list of documents and their associated priority multipliers . as another supplement or alternative to the preferred embodiment , the priority given to web pages could be based on content of the pages themselves and their value to the web page owner . providing an order form on the user &# 39 ; s screen may be deemed to have a higher priority than delivering product information . the tuples of htlm page name 1200 and priority multiplier 1205 can be stored in the database . as rows 1206 , 1207 and 1208 show , the multiplier can be different based on how important a particular html document is . fig1 b is a flowchart of a procedure for increasing the priority of a connection using the information contained within fig1 a . the user requests an html page ( 1210 ). if the page name is found in the priority database ( 1220 ) then the transmission priority becomes the normal transmission priority multiplied by the priority multiplier ( 1230 ). then the new request event is triggered ( 1240 ) ( fig6 at 605 ) and this process is terminated ( 1250 ). there has thus been described a communication system in which communication resource allocated by either servers or clients can be adapted based on priority of various types . as a result , user satisfaction with the network is enhanced by obtaining desired information in a prompt fashion and server and client resources are prioritized to enhance throughput of the network . although the present invention has been described and illustrated in detail , it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation , the spirit and scope of the present invention being limited only by the terms of the appended claims . | 7 |
fig1 is a schematic view of a s - type wave - guide optical attenuator according to an embodiment of the invention . the optical attenuator includes a core layer 10 , a cladding layer 20 , a buffer layer 30 , and a temperature - control electrode layer 40 . the core layer 10 is embedded in a slot of the cladding layer 20 and exposes a surface over which the buffer layer 30 is placed . the electrode layer 40 is formed on the buffer layer 30 . the cladding layer 20 has a first refraction index n cladding , and the core layer 10 has a second refraction index n core . the core layer 10 is made of a polymer material , and constitutes the principal light guide area . the cladding layer 20 is made of a glass material , and is correspondingly associated with the core layer 10 to obtain an amount of light attenuation . the buffer layer 30 is formed to match with the electrode layer 40 , and is made of silicon dioxide sio 2 . when a temperature controller 50 applies a temperature change via the electrode layer 40 to the core layer 10 , the refraction index n core of the core layer 10 will vary accordingly . the width w in and the thickness t of the core layer 10 are specific parameters . as shown in fig2 , the s - type wave - guide element includes two curved wave - guide portions 21 , 22 , linear inlet and outlet wave - guide portions 23 , 24 . this s - type wave - guide can be simply and conveniently manufactured . light enters through the core layer 10 , travels through the two curved wave - guide portions 21 , 22 , and emerges out via the outlet wave - guide portion 24 . in a cartesian coordinate system ( x , y ), the profile of the s - type wave - guide structure can be expressed as follows : the s - type wave - guide structure is so - called ‘ due to the sine function in the above equation ’. wave - guide structures of similar profiles can also include cosine function , and the s - type wave - guide structure can be otherwise modified to include two continuously curved portions . the temperature controller 50 is used to adjust and change , via the electrode layer 40 and the buffer layer 30 , the temperature of the core layer 10 , and consequently its refraction index n core . the temperature controller can be a hot light heater or cooling machine . when the temperature controller applies the temperature change to the core layer 10 , the latter has the most significant variation in refraction index , the cladding layer 20 , due to its constituent material , is mostly not affected by the temperature change . therefore , the polymer - based core layer is , due to the variation in the refraction index , more sensitive to temperature changes than the glass - based cladding layer . the variation ratio in refraction index between the core layer and the cladding layer can be thereby easily controllable . when the refraction index of the core layer 10 becomes smaller or equal to the refraction index of the cladding layer 20 due to a temperature change , the light propagation direction changes to avoid the core layer 10 . as a result , the light power received at the outlet 24 changes according to the modification in the direction of light propagation , which thereby achieves a light attenuation effect . therefore , light power can be changed via temperature adjustment . for example , let &# 39 ; s assume a preset temperature adjustment range , for example 30 ° c . the temperature controller is operated to change the temperature range , so that the variation of refraction index of the core layer 10 is also set in a fixed range . on the basis of a weakly guiding property linked to the refraction index , the refraction index difference between the core layer 10 and the cladding layer 20 is reduced in association with a bending loss , so that the attenuation of the light path can be adjusted . in contrast to the prior art technique , where the temperature of the cladding layer is controlled to vary the refraction index of a part of the cladding layer or a part of the core layer , the invention implements a temperature variation of the core layer to change the refraction index of the whole core layer . further , in the prior art technique , either the material of both the cladding layer and core layer is similar , or the cladding layer is made of polymer . in contrast , the core layer in the invention is made of polymer , while the cladding layer is made of a glass material . in a manufacturing process conducted to fabricate the attenuator structure , a slot is etched in a glass substrate , used as cladding layer . a wave - guide polymer material then is filled in the slot to form the core layer . a buffer layer then is spin - coated on the core layer , and a metallic electrode layer is plated on the buffer layer . the implementation of optical wave - guide element techniques to fabricate a optical attenuator can provide the advantages of a smaller size and an easy adjustment of the optical attenuator . however , the attenuator structure is more complex , which renders the manufacturing process more difficult , especially when high precision is achieved . therefore , the optical wave - guide attenuator of the invention modifies the structure of the core layer and cladding layer . further , it uses wave - guide bending and refraction index variation to create a scattering effect due to bending loss occurring during wave guiding and weakly guiding . this is caused by the variation of the refraction index . a significant range of light attenuation can be thereby achieved , while the light wavelength still can keep a certain configuration during transmission . further , a principal aspect of the invention is that weakly guiding and wave - guide bending effects are implemented via the variation of the refraction index between the core layer and the cladding layer to produce a bending loss , and thereby constitute the attenuation mechanism . a simulation is conducted to verify the light wave range adequate to the structure of the invention . fig3 is a graph describing a relationship between the light wavelength and the level of attenuation for a temperature adjustment of δt = 20 . 3 ° c .˜ 50 . 3 ° c . for a communication wavelength between 1 . 28 μm ˜ 1 . 33 μm , the attenuation level varies between 0 db ˜ 22 db according to the temperature adjustment . the graph of fig4 shows that , for a communication wavelength between 1 . 51 μm ˜ 1 . 56 ∥ m , a temperature variation δt = 27 ° c .˜ 60 ° c . results in a range of light attenuation between 0 db ˜ 30 db . fig3 and fig4 therefore show the characteristics of the temperature - controlled optical attenuator , and show that light attenuation can be observed from about 30 ° c . the structure of the invention can be also applicable for variations in higher or lower temperature ranges . because the location of the core layer subjected to refraction index variation is close to the temperature controller , the response time is therefore faster than when the temperature controller is placed on a cladding layer . light attenuation thereby can be accurately adjusted by modifying the temperature . further , the optical attenuator structure of the invention exhibits good response in respect of polarization effects . as shown in the graphs of fig5 and fig6 , for a same wavelength , the wave - guide structure is very little affected by the application of te , tm fields . for the wavelengths of 1 . 28 μm and 1 . 33 μm , the maximal polarization difference ( te and tm ) is 0 . 5 db ( see fig5 ). for the wavelengths of 1 . 51 μm and 1 . 56 μm , the maximal polarization difference is 0 . 8 db ( see fig6 ). the foregoing observations show that the optical attenuator structure of the invention , when undergoing temperature - controlled wave - guide adjustment , exhibits good reliability and stability in respect of light attenuation and polarization variations . it will be apparent to the person skilled in the art that the invention as described above may be varied in many ways , and notwithstanding remaining within the spirit and scope of the invention as defined in the following claims . | 6 |
the present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto . the drawings described are only schematic and are non - limiting . in the drawings , the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes . it will be understood that the terms “ vertical ” and “ horizontal ” are used herein refer to particular orientations of the figures and these terms are not limitations to the specific embodiments described herein . furthermore , the terms “ first ”, “ second ”, “ third ” and the like in the description , are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order . the terms are interchangeable under appropriate circumstances and the embodiments of the invention can operate in other sequences than described or illustrated herein . moreover , the terms “ top ”, “ bottom ”, “ over ”, “ under ” and the like in the description and the claims are used for descriptive purposes and not necessarily for describing relative positions . the terms so used are interchangeable under appropriate circumstances and the embodiments of the invention described herein can operate in other orientations than described or illustrated herein . fig1 illustrates ecg signals with noise and / or motion artifacts . in particular , fig1 illustrates a plurality of acquired ecg signals with motion artifacts having high amplitude . six measured ecg signals 11 , 12 , 13 , 14 , 15 , 16 are shown . in ecg signals 11 , 12 , 13 , the level of noise is low , making interpretation of the signals easier . however , due to the presence of noise and / or motion artifacts , it is more difficult to extract actual ecg signals from the measurement ecg signals 14 , 15 , 16 . one of the most relevant applications in the automatic analysis of ecg signals is the automatic detection of beats . the importance of accurate beat detection is high , as this is usually a first step in the development of algorithms for the analysis of ecg signals . the accurate detection of the beat can be used in many clinical applications . it can form the basis for the analysis of rhythm , the analysis of heart rate variability ( hrv ), detection of pathologies , and / or other advanced analyses . under optimal recording conditions , these methods give detection rates over 99 %. however , beat detection accuracy is significantly reduced when the signal quality is decreased due to the presence of motion artifacts . fig2 illustrates a graph of beat detection accuracy versus signal - to - noise ratio ( snr ). in particular , fig2 shows how positive predictivity , indicated by solid line 22 , of a beat detection algorithm decreases rapidly when the value of snr drops . the sensitivity is also shown as indicated by dotted line 24 . there is thus a desire for methods and systems that can reduce noise and motion artifacts in ambulatory ecg signals . in one aspect , a method for performing heart beat detection in noisy ecg signals with increased accuracy is disclosed . the method comprises acquiring a plurality of ecg signals . these signals may be multi - channel or multi - lead ecg signals or signals obtained from multiple sources . these acquired channels are transformed into signals in a component space by means of pca or ica . as described above , pca and ica are techniques commonly used in multivariate statistical analysis . the goal of these techniques is the reduction of the number of dimensions from a numerical measurement of several variables for further processing . with this dimensional reduction , pca and / or ica can simplify a statistical problem with minimal loss of information . these methods are also used in signal processing for separating a linear combination of signals generated from sources that are statistically independent . this is achieved by representing the data in a new coordinate system . these transformations are bidirectional , and an inverse transformation may be carried out to provide the data in the original coordinate system . this is described by jolliffe i t , in “ principal component analysis ”, springer series in statistics 2002 , new york : springer . applying pca or ica to n - channel ecg signals that are statistically independent gives n new signals or components . the components corresponding to noise to be cancelled are set to zero and the transformation is inverted to obtain the “ filtered ” signals in the original coordinate space . it is to be noted that the first new signal or component does not necessarily correspond to the first measured ecg signal . identifying which components correspond to noise and which correspond to ecg signals is not trivial . variance and kurtosis can be used for automatic selection of the components . variance is a descriptor of a probability distribution in that it provides information about how far variables in a set are spread out from a mean or expected value . kurtosis is a measure of “ peakedness ” of a probabilistic distribution of a real - valued random variable . high distributions have sharper peaks and flatter tails , while low distributions have more rounded peaks and shorter thinner tails . fig3 illustrates a flowchart of a beat detection method , in accordance with an embodiment . the method 30 begins at block 32 where multi - channel ecg signals are measured or otherwise acquired . in some embodiments , additional non - ecg signals , such as , for example , accelerometer signals , electrode - skin impedance measurements , optical measurements , signals obtained from microphones , light sensors , temperature sensors , gas sensors , humidity sensors or cameras , or other measurements are also measured or acquired at block 32 . at block 34 , the acquired ecg signals are transformed into a set of either principal or independent components , depending on whether pca or ica is to be performed on the measured ecg signals . the principal or independent components are representations of the ecg signals in the component space . from this set of components , a subset is automatically selected at step 36 . in embodiments where non - ecg signals are also measured , the subset may be selected in accordance with parameters determined from the non - ecg signals . the non - ecg signals may be used to determine a quality of the ecg signals . then , the subset may be selected based on the determination of the quality of the ecg signals . at block 38 , a beat detection algorithm is applied to this subset of components . in this manner , an improvement in performance may be obtained . in the case of pca , for high snr values , retaining the principal components of highest variances give the best performance . when snr is decreased , the principal components corresponding to highest variance are related to high amplitude noise . accordingly , a method for identifying the optimal subset of principal components as a function of input snr and number of channels is described below . it will be appreciated that a similar process is carried out when using ica instead of pca . in addition to component selection , the time window used to apply pca or ica can also be chosen according to noise characteristics of the signals being analysed . the length of the time window for this selection can be adjusted according to the duration of noise in the ecg signals , that is , the shorter the duration of noise , the shorter the time window and the longer the duration of noise , the longer the time window . in the disclosed method , parameters used in ecg signal analysis in ambulatory recordings , such as the set of components and the time window , may be adapted in real - time either independently or in combination . experimentation has shown that this adaptation can be carried out based on characteristics of noise in the signal , for example , the length , the level , and frequency bands properties of noise . more generally , this adaptive pca or ica method can be based on other parameters that characterise the context of the monitoring environment ( called context - aware adaptive pca or ica ). these parameters may be obtained from the original input multi - channel ecg signals as well as signals from other sources , for example , motion measurements using accelerometers , electrode - tissue or contact impedance measurements , heart rate ( when known ), and / or optical sensors . the performance of the pca and ica is described below . clean ecg signals were obtained by recording 8 - channel ecg signals , and 8 - channel noise only recordings were also obtained . each 8 - channel noise signal was multiplied for a gain factor and added to each 8 - channel clean ecg in order to obtain a specific snr . snr values ranging from 10 to − 10 db were considered . fig4 illustrates the effect of noise on an ecg signal . in fig4 , an example of a clean ecg signal is shown by trace 42 , a pure noise signal is shown by trace 44 , and a combination of both signals is shown by trace 46 . pca was applied to the combined signal 46 to provide principal components , and a subset of principal components was selected in accordance with descending order of variance . the subset of principal components was then inverted , that is , the pca transform was reversed , to filter out noise . similarly , ica was also applied to the combined signal 46 to provide independent components , and a subset of independent components was selected by kurtosis over a fixed threshold . the subset of independent components was then inverted to effect filtering out of noise . fig5 illustrates the principle of using pca on ecg signals , in accordance with an embodiment . an eight - channel ecg signal together with noise at − 5 db is shown at 52 . initially , pca was applied to all 8 - channel ecg lead signals at 54 . only one of the 8 resulting principal components was retained and the pca transform was inverted to obtain the filtered original 8 ecg leads as shown at 56 . it can readily be seen that the filtered ecg signals 56 have less noise than the measured ecg signals 52 . selecting the principal component with highest variance gave in general highest correlation coefficients for high snr values , that is , over 0 db . however , for snr values between 0 and − 7 db , the principal component which had highest ecg content was the second one with highest variance . between − 8 and − 10 db , the principal component which gave the best the highest correlation coefficient was the fourth one . the optimal number of principal components in function of the snr was then investigated . pca was applied to the 8 - channel ecg signals . then , the principal components were sorted by their ranking obtained in descending order . finally , n components were selected , where n = 1 , 2 , . . . , 8 , and the pca transform was inverted . overall , the best values were obtained with n = 3 giving a small correlation coefficient improvement with median of 0 . 02 ( median absolute deviation ( mad )= 0 . 05 ) and the snr improvement was in median of 1 . 49 db ( mad = 4 . 62 ). for low snr values , pca performed better when retaining more principal components , for example , 4 principal components for an snr value of − 8 db and 6 principal components for an snr value between − 9 db and − 10 db . combining the results , the best subset of principal components was selected for each snr value , for example , principal component 1 corresponds to the value with highest variance , principal component 2 corresponds to the value with the next highest variance , and principal component 8 corresponds to the value with lowest variance . fig6 illustrates a graph of a subset of principal components as a function of the signal - to - noise ratio . that is , fig6 illustrates the subset of principal components that gave best results when considering correlation . it can be seen that for an snr value between 10 db and − 2 db , components 1 to 3 are chosen as the subset . as the snr increases , different components are chosen . as shown in fig6 , components 1 to 4 are chosen when the snr is − 3 db , components 2 to 4 are chosen when the snr is between − 4 db and − 7 db , components 2 to 5 are chosen when the snr is between − 5 db , and finally components 2 to 7 are chosen when the snr is between − 9 db and − 10 db . it will be appreciated that these values are given by way of example only and that any other combination of adjacent components can be chosen in accordance with the snr values . the use of this method of component selection was evaluated by comparing its performance with the direct comparison of the noisy ecg signals and the clean ecg signals , that is , with no de - noising , and the use of pca when the optimal set of principal components was retained for each signal within the dataset and snr value independently . the optimal set was defined as the one ( from all possible combinations ) that gave the highest correlation coefficient between the clean ecg signal and the output of the inverted pca . for evaluating the signal improvement for pca and ica , the correlation coefficient between the noise - free signal and the output after pca and ica filtering was determined . in addition , snr before and after pca and ica filtering was estimated . in evaluating the combined signal 46 using pca and ica , the optimal subset of principal and independent components respectively was identified for each signal within the dataset and for the snr independently . the optimal component subset was retained and the pca or ica transformation was inverted to provide a filtered 8 - channel signal . the optimal component subset was defined as the one that gave the highest correlation coefficient between the clean ecg signal and the output of the inverted pca or ica signal . the output of the filtered signal was compared with the clean ecg signal before adding the noise by calculating the correlation coefficient . median and mad values of the eight output signals were considered to be representative values for each signal , and median ± mad values of the whole data set was considered as being representative for each snr value . tables 1 and 2 illustrate respectively the correlation coefficients and snr improvement respectively for pca and ica . pca output and clean ecg signals were plotted against snr value when the selected pc were retained ( pca alg ), the optimal subset of principal components were retained ( optpca ), and the median correlation coefficient of noisy ecg with clean ecg signals ( nopca ). fig7 illustrates a graph of correlation coefficients as a function of the signal - to - noise ratio . in particular , a comparison of the median correlation coefficient for each snr value is shown in fig7 for the case were there is no pca , line 72 , conventional pca ( where the principal components are arbitrarily selected ), line 74 , and optimised pca , line 76 , in accordance with the invention . fig8 illustrates a graph of signal - to - noise ratio improvement as a function of the signal - to - noise ratio for pca output . in particular , fig8 illustrates the median snr improvement for optimised pca , line 84 , compared to conventional pca , line 82 , for each snr value . as shown , applying optimised pca can give a significant improvement , especially with low snr values , for example , improvement in the correlation coefficient of 0 . 16 and snr 6 . 39 db with snr =− 10 db when the optimal principal components can be indentified for each noisy signal . however , the subset of principal components , as a function of snr as above , gave a smaller improvement , for example , improvement in the correlation coefficient of 0 . 03 and snr 1 . 92 db with snr =− 10 db . the effect of the number of input channels was also investigated for both pca and ica . in addition to the eight input channels , subsets of input channels of six , four and two channels were also considered . following the same procedures as described above , for each input subset , the optimal component subset was found for each signal and snr value . to obtain consistent results , only one lead , common for all subsets , was considered for comparing the input and output of the pca and ica . for pca , the highest correlation coefficients for high snr values was obtained for six and eight input channels , for example , at an snr of 10 db , the correlation coefficient was found to be 0 . 96 ± 0 . 02 . for snr values between 1 db and − 8 db using two input channels , the highest correlation coefficients were obtained , for example , at an snr value of 0 db , a correlation coefficient of 0 . 73 ± 0 . 10 was obtained . as the snr decreased , eight input channels gave the highest correlation coefficient of 0 . 39 ± 0 . 11 at − 10 db . when ica was used , higher correlation coefficients were obtained for six and eight input channels over all snr values . over 3 db , the correlation coefficient was similar , for example , for an snr value of 10 db , the correlation coefficient was found to be 0 . 95 ± 0 . 02 , and for below that value , the difference was small , for example , 0 . 82 ± 0 . 07 and 0 . 84 ± 0 . 07 respectively at 0 db , and at an snr value of − 10 db , correlation coefficients of 0 . 43 ± 0 . 15 and 0 . 46 ± 0 . 16 were obtained respectively . in contrast , two input channels provided lower correlation coefficients , for example , 0 . 94 ± 0 . 04 and 0 . 32 ± 0 . 13 at snr values of 10 db and − 10 db respectively . in addition , the snr before and applying pca or ica was estimated in order to calculate the snr improvement . for pca , using eight input channels , the highest snr improvement was obtained for snr values down to 4 db , and between 3 db and 0 db , the highest improvement was obtained using six input channels . between snr values of − 1 db and − 8 db , two input channels provided the best snr improvement and for lower snr values , eight input channels provided the best snr improvement . ica based filtering provided higher snr improvements when using six or eight input channels . using two input channels , the lowest snr improvement was obtained for all snr values . fig9 illustrates a graph of correlation coefficient of the pca as a function of the signal - to - noise ratio . as shown , fig9 illustrates the correlation coefficient results for different numbers of input channels against the different values of snr . respective lines 92 , 94 , 96 , 98 refer to two , four , six and eight input channels . decreasing the number of input channels did not yield a big drop in the correlation coefficient , namely , a median drop of 0 . 49 and 0 . 42 for eight and two input channels respectively at snr =− 10 db ). the snr improvement dropped in median value from 4 . 35 db down to 0 . 38 db ( eight and two input channels ) at snr =− 10 db . fig1 illustrates a graph of correlation coefficients as a function of the signal - to - noise ratio , for methods using adaptive pca or ica and methods using no filtering . in fig1 , the difference obtained for the correlation coefficient against snr when there is no filtering using either pca or ica ( trace 102 ), using an optimised pca ( trace 104 ), and using an optimised ica ( trace 106 ). fig1 illustrates a graph of signal - to - noise ratio improvement as a function of signal - to - noise ratio for optimised pca and ica . like in fig1 , in fig1 , the snr improvement against snr is shown for an optimised pca ( trace 112 ) and an optimised ica ( trace 114 ) respectively . in addition , the effect of a “ fixed ” subset of components for each snr value was investigated . for each value of the input snr , the components were sorted in descending order by variance in the case of pca and by kurtosis in the case of ica . the subset of components that gave the highest median value of the correlation coefficient between filtered and clean ecg signals was identified for each input sbr . these fixed component subsets were used to test an automatic pca or fixed - pca and automatic ica or fixed - ica . it was found that the difference in the correlation coefficient , when comparing clean ecg signals with filtered signals , using fixed - pca led to a significantly lower performance than not applying any filtering for snr values of 0 db and above . below 0 db , fixed - ica had a higher median correlation coefficient than no filtering . for the snr improvement determination , fixed - pca provided an improvement of 3 . 86 ± 1 . 59 db at 10 db . the performance was lower when the input snr decreased , for example , at an snr value of − 10 db , the snr improvement was determined to be 1 . 03 ± 2 . 56 db . fixed - ica provided low improvement in snr for high input snr values , for example , at an snr of 10 db , the improvement was 0 . 45 ± 2 . 40 db . however , lower input snr values provided higher performance , for example , at an snr value of − 5 db , the snr improvement was found to be 7 . 50 ± 4 . 13 db . fig1 illustrates adaptive pca or ica , in accordance with an embodiment . in the embodiment shown in fig1 , ecg signals are processed to remove the noise . a multi - channel ecg 120 , signals ecg_ 1 to ecg_n , is taken from which snr and heart rate can be derived to provide an ecg - related input 122 . non - ecg related signals are also taken , that form a non - ecg input 123 , which , in this embodiment , are indicative of motion of the subject , and hence motion artifacts . although only motion sensors are shown , it will be appreciated that other sensors can also be utilised as discussed above . pca or ica is applied to the multi - channel ecg 120 to produce components comp_ 1 to comp_n in component space 124 . using the ecg - related input signal 122 and the non - ecg related input reference signal 123 are used to adapt a time window for the transformation into component space 124 . the time window can be considered to be estimated from the time variant properties of the noise that can be estimated from the snr determined in the input ecg signals or from additional non - ecg signals . from the component space 124 , the number of components 126 selected is determined in accordance with the noise properties ( such as , snr and other time - frequency parameters ), or according to other parameters derived from the ecg or non - ecg input signals . an inverse transform is applied on the selected components to provide a multi - channel ecg signal 128 with less noise than the measured multi - channel ecg signal 120 . this system can be adapted in accordance with signals determined from the environment and can be dynamically modified , for example , in accordance with the time window and / or component selection , based on changes in the environment . this adaptive approach effectively de - noises the ecg signals to improve the performance of subsequent ecg processing compared to traditional pca or ica approaches . here , the set of components , when using either pca or ica , can be used for reconstruction based on the noise of the signal , or more generally , based on the context of the monitoring environment . fig1 illustrates de - noising of ecg signals , in accordance an embodiment . here , reference signals 132 are used in conjunction with the ecg signals 130 to define the components 134 using either pca or ica . component reduction 136 is determined and an inverse transform is applied to provide de - noised ecg signals 138 . as discussed above , the selection of the components is determined from the actual ecg signals and the environment , the selection being dynamically modified based on the change in the environment . this is in contrast to current pca / ica techniques where the component selection is pre - defined and static , and hence , the component selection is not adaptable to changes in the environment . fig1 illustrates a graph of snr improvement as a function of the signal - to - noise ratio for pca and ica . here , ica is indicated by trace 142 and pca by trace 144 . it is shown that ica can provide better performance for de - noising . fig1 illustrates adaptive pca or ica for beat detection , in accordance with an embodiment . in fig1 , beat detection can be carried out in component space without having to apply the inverse transform , as described with reference to fig1 and 13 . here , a multi - channel ecg signal 150 is converted to component space 154 using reference signals 152 . a single component 156 is selected and from this component , an instantaneous heart rate value 158 can be determined this is in contrast to the conventional beat detection where the instantaneous heart rate is determined only once the inverse transform has been applied to the selected component ( s ). the advantages of determining the instantaneous heart rate or beat detection in the component space include an increased robustness to noise , lower computing complexity , and the component selection is carried out dynamically using adaptive pca or ica . this additionally provides a positive detection of beats and does not detect false beats . a further option for using adaptive pca or ica as described above is in atrial activity detection . here , pca or ica is used to extract a specific wave containing information about atrial activity and an optimal component containing this information can be identified in real - time . fig1 illustrates adaptive pca or ica for atrial activity , in accordance with an embodiment . this is similar to that shown in fig1 , but with the component that carries almost exclusively the information on the atrial fibrillation wave being selected . in a similar way to fig1 , the multi - channel input signals 160 are transformed to component space 164 using reference signals 162 . a single component 166 is selected in component space and 164 and an atrial fibrillation algorithm applied to determine the presence of atrial fibrillation 168 . again , no inverse transform is required and the relevant atrial activity can be isolated in the component space . this has the advantages of increased sensitivity and automatic component selection due to only one component carrying the information of interest for the detection of atrial activity . the effect of using pca and ica for beat detection was evaluated in comparison to the situation where no filtering was applied for snr values between 10 db and − 10 db , in 1 db steps . here , the pca and ica transformations are inverted before the beat detection algorithm was applied . in each case , an optimal component subset was selected that gave the highest correlation coefficient between a clean ecg signal and the output of the inverted pca or ica . sensitivity and positive predictability were considered for optimal component selection . in each case , a beat detection algorithm was applied to the filtered signals produced by pca and ica and to the original signal before filtering . in terms of sensitivity , the beat detector had a good performance with a sensitivity of 100 % down to − 6 db . in terms of positive predictability , a value of 100 % was obtained down to 6 db and , below 6 db , the value dropped to 83 . 09 % at 0 db and 48 . 81 % at − 10 db . when both pca and ica were applied using the optimal component subset , a sensitivity of 100 % was obtained for all snr values in the range . for positive predictability , pca yielded an improvement for all snr values with values of 95 . 45 % at an snr value of 0 db and 56 . 87 % for an snr value of − 10 db . however , ica filtering gave a higher performance for positive predictability for all snr values , for example , 100 % for 0 db and 61 . 38 % for − 10 db . the selection of principal and independent components may be automatic , such that it does not require human intervention . here , automatic component selection was carried out using kurtosis to identify which components correspond to ecg information . components having a kurtosis over a fixed threshold were selected whilst components below this threshold were rejected . if none of the components had a kurtosis over the fixed threshold , then the component with the highest kurtosis was selected . again , positive predictability and sensitivity were considered . for positive predictability , a value of 100 % was obtained for snr values down to 3 db when no filtering was applied . however , below an snr value of 3 db , the positive predictability dropped considerably to 57 . 43 % when the snr was − 10 db . applying pca and selecting the components automatically gave a higher positive predictability than the case with no filtering for all snr values below 3 db with values of 100 % for all snr values down to 0 db and 58 . 82 % for an snr value at − 10 db . it was found that pca with optimal component selection outperformed pca with automatic selection for all snr values below 0 db . ica with automatic component selection was found to give a higher positive predictability values when compared to pca with automatic component selection , for example , down to − 4 db a value of 100 % was obtained and at − 10 db a value of 59 . 69 % was obtained . in addition , ica with the optimal component subset gave higher positive predictability values than those obtained for both versions of pca and for ica with automatic component selection for snr values below − 5 db . the results obtained are shown in fig1 . fig1 illustrates using adaptive pca or ica to identify different types of ecg activity . in fig1 , a graph of positive predictability against snr value is shown . line 170 relates to the results obtained with no filtering ; line 172 relates to the results obtained for pca with automatic component selection ; line 174 relates to the results obtained for ica with automatic component selection ; line 176 relates to the results obtained for pca with optimal component selection ; and line 178 relates to the results obtained for ica with optimal component selection . fig1 shows a multi - channel ecg that , after adaptive pca or ica , can provide information relating to noise 182 , atrial activity 184 and ventricular activity 186 , in accordance with an embodiment . although pca and ica have been described as being alternatives , there may be some applications where both pca and ica need to be applied in succession . in addition , a combination of pca - ica could also be applied . while the above detailed description has shown , described , and pointed out novel features of the invention as applied to various embodiments , it will be understood that various omissions , substitutions , and changes in the form and details of the device or process illustrated may be made by those skilled in the technology without departing from the invention . | 0 |
referring to fig1 , there is shown , a side elevation view of a firearm 10 capable of automatic or semiautomatic fire incorporating features in accordance with an exemplary embodiment of the present invention . although the present invention will be described with reference to the embodiments shown in the drawings , it should be understood that the present invention can be embodied in many alternate forms of embodiments . in addition , any suitable size , shape or type of elements or materials could be used . firearm 10 may be a rifle or carbine with a direct gas impingement operating system , like examples , such as the m - 4 ™ or m - 16 rifles available from colt defense , llc , similar commercial variants thereof and may have features as disclosed in u . s . patent application ser . no . 11 / 231 , 063 filed sep . 19 , 2005 , u . s . patent application ser . no . 11 / 352 , 036 filed feb . 9 , 2006 or u . s . patent application ser . no . 60 / 772 , 494 filed feb . 9 , 2006 all of which are hereby incorporated herein by reference in their entirety . firearm 10 is illustrated as generally having a black rifle configuration . the black rifle configuration being the family of rifles developed by eugene stoner , for example , such as an m4 ™ or m16 automatic firearm configuration . however , the features of the disclosed embodiments , as will be described below , are equally applicable to any desired type of automatic firearm . firearm 10 may have features such as disclosed in u . s . patent application ser . no . 11 / 672 , 189 filed feb . 7 , 2007 , and u . s . patent application ser . no . 11 / 869 , 676 filed oct . 9 , 2007 , all of which are hereby incorporated by reference herein in their entirety . firearm 10 may have operational features such as disclosed in u . s . pat . nos . 5 , 726 , 377 , 5 , 760 , 328 , 4 , 658 , 702 , 4 , 433 , 610 , u . s . non provisional patent application ser . no . 10 / 836 , 443 filed apr . 30 , 2004 , and u . s . provisional patent application 60 / 564 , 895 filed apr . 23 , 2004 , all of which are hereby incorporated by reference herein in their entirety . the firearm 10 and its sections described in greater detail below is merely exemplary . in alternate embodiments the firearm 10 may have other sections , portions or systems . firearm 10 may have an upper receiver section 13 a barrel 24 , and hand guard portion . the hand guard portion is shown as being separate from receiver 13 . in alternate embodiments , the hand guard portion may be integral with upper receiver 13 . the hand guard section may have features such as disclosed in u . s . pat . nos . 4 , 663 , 875 and 4 , 536 , 982 , both of which are hereby incorporated by reference herein in their entirety . hand guard section 40 of upper receiver section 34 may be configured to support such rails as a “ picatiny rail ” configuration as described in military standard 1913 , which is hereby incorporated by reference herein in its entirety . the rails may be made from any suitable material such as hard coat anodized aluminum as an example . a rear sight assembly is provided and mounted to upper receiver section 13 . firearm 10 may incorporate stock 22 , lower receiver section 12 , magazine well 16 , a clip or magazine , rear and front sights , fire control selector 26 , trigger 14 , bolt assembly 20 and ejection port 18 . upper receiver 13 having barrel 24 , lower receiver 12 and magazine well 14 may be modular and configurable such that firearm 10 comprises a modular rifle design . further , the hand guard , and accessory mounting rails thereon , may be integral with the upper receiver and the integral upper receiver , hand guard and mounting rails may be of unitary construction . in alternate embodiments , the upper receiver and hand guard may be separate . referring now to fig2 , there is shown a section view of an upper receiver section of the firearm shown in fig1 . firearm 10 has a direct gas impingement operating system facilitating automatic or semi - automatic operation as will be described below . the direct gas operating system may have a gas feed regulator that may be configured to provide a substantially constant feed flow , independent of variances in barrel exhaust aperture , or may be configured to be adjustable , allowing the operator to vary cyclic rate as desired . as will be described in greater detail below , the system has a gas block assembly mounted or otherwise fitted to the barrel ( see fig1 ) and in fluid communication with the bore of the barrel . the gas block assembly includes a gas block which has a passage formed through the gas block and a sleeve positioned in the passage in communication with the bore . gas line 96 is provided fitted to the sleeve and also in communication with the bore through the sleeve and the gas block . as can be seen in fig2 , gas line 96 is further in fluid communication , via passage in key 30 with impingement cylinder 32 in bolt carrier 28 of bolt assembly 20 . as will be described below , the sleeve and the gas line are removable from a front portion of the gas block without removal of the gas block and without removal of the barrel from the receiver assembly . bolt assembly 20 has bolt carrier 28 , within which are located bolt or bolt assembly 29 and firing pin 40 slidably mounted within the bolt 29 . the bolt 29 is slidably mounted within the bolt carrier 28 . pin 36 is pressed into the bolt 29 and interfaces with corresponding camming slot 38 of bolt carrier 28 . impingement key 30 has a cylinder portion 32 that slidably engages gas line 96 . port 46 is provided between cylinder portion 32 and the expansion volume 34 of the impingement cylinder between a rear portion of the bolt and the bolt carrier . as can be seen in fig2 , hammer 42 strikes firing pin 40 discharging cartridge 44 . as can be seen below , gas from discharged cartridge 44 is routed from the barrel , to the gas block and sleeve and to gas line 96 . as can be seen in fig3 , gas discharged from fired cartridge 44 displaces the impingement cylinder 34 of key 30 , displacing bolt carrier 28 as gas expands in the larger expansion volume 48 . camming slot 38 moves toward the rear of the firearm rotating the bolt until pin 36 bottoms out on slot 38 . as can be seen in fig4 , resulting momentum of bolt carrier 28 in combination with pressure in cylinder 34 also displaces the bolt thus displacing the bolt assembly 20 to eject cartridge 44 and displace hammer 42 . here , impingement cylinder 32 disengages the gas line during operation . a gas regulator may be provided that interfaces with the pressurizing gas in the cylinder to provide a desired gas feed flow independent of variances arising from use of the firearm . the regulator may be incorporated into the gas block assembly or otherwise as will be described in greater detail below . a suitable example of a gas regulator is described in u . s . patent application ser . no . 11 / 231 , 063 , filed sep . 19 , 2005 , and incorporated by reference herein in its entirety . in alternate embodiments , any suitable gas regulator may be provided . referring now to fig5 , there is shown an isometric view of a barrel and gas tube assembly . referring also to fig6 , there is shown an exploded isometric view of a barrel and gas tube assembly . referring also to fig7 , there is shown an exploded isometric view of a barrel and gas tube assembly . the direct gas impingement operating system interfaces with gas block 72 fitted to barrel assembly 24 where cylinder 32 of bolt carrier 28 is in fluid communication with gas block 72 via gas tube 96 and removable sleeve 70 ( see also fig6 - 7 ). in the exemplary embodiment , the removable sleeve 70 may include the gas regulator and may be removable from the front of gas block 72 ( in the direction indicated by arrow f ) and therefore removable from the front of the receiver or rail without further disassembly ( e . g . without disconnecting barrel from receiver or removable of gas block from barrel ). as can be seen in fig6 and 7 , this further enables removal of the gas tube 96 from the firearm as a unit with the gas sleeve without further disassembly . in the exemplary embodiment , removable sleeve 70 is maintained captive with takedown pin 73 ( see fig9 ) allowing for quick removal for reinitiation . a wave spring ( not shown ) may be provided under the head of sleeve 70 to bias sleeve 70 forward . the take down pin may be held captive . in alternate embodiments , the gas sleeve may be removable or installed in the gas block 72 in any other suitable manner . referring now to fig8 , there is shown a section view of a barrel and gas tube assembly . referring also to fig9 , there is shown a section view of a barrel and gas tube assembly . referring also to fig1 , there is shown a section view of a barrel and gas tube assembly . the cylinder 32 of the direct gas impingement operating system interfaces with gas block 72 fitted to barrel assembly 24 via gas line 96 and sleeve 70 . barrel 24 has bore 6 with the gas block being in fluid communication with the bore through a port 76 in barrel 24 . the gas block 72 , may include a passage that extends through the block ( as seen best in fig9 ) and is in fluid communication with the bore through a corresponding port disposed on a surface of the gas block facing the barrel . the sleeve may be located within the passage in the gas block , and may be installed and removed through a front opening of the passage as may be realized from fig6 . the sleeve is in fluid communication with the bore through a corresponding port 74 disposed on a surface of the sleeve facing the barrel . as seen in fig1 , in the exemplary embodiment the barrel port 76 , block port 90 and sleeve port 74 , may have different sized openings respectively , arranged so that the gas sleeve port 74 effects gas regulation of feed gases exhausting from the barrel bore 6 , via port 70 , into the gas line 96 feeding cylinder 32 . in the exemplary embodiment , sleeve port 74 is sized and arranged so that changes in either or both the barrel port 76 and gas block port 90 ( such as from erosion or fouling ) have little perceivable effect on cyclic rate of the firearm . in the exemplary embodiment , gas block 72 is in communication with bore 6 through the first gas port 90 in the gas block and sleeve 70 is in communication with bore 6 through the regulating or second gas port 74 of sleeve 70 inside the passage in the gas block where second gas port 74 is smaller than first gas port 90 and gas port 76 . the tube 96 is in fluid communication with the bore through a corresponding port 77 , for example disposed on a surface of the tube facing the barrel though such port for the gas tube may be located in any other suitable position in the barrel . hence , cylinder 32 of bolt carrier 28 is in fluid communication with bore 6 via gas block 72 , sleeve 70 and gas tube 96 . tube 96 may have a keyed feature ( not shown ) that prevents rotation of tube 96 relative to sleeve 70 during operation and alignment of the ports . in alternate embodiments , a recess may be made in the bore of sleeve 70 or housing 72 allowing rotation of tube 96 . holes 82 , 84 may be provided on the head of sleeve 70 whereby a tool may be used to rotate sleeve 70 for removal in the event of carbon buildup preventing removal . chamfer 86 is shown provided on the bore of sleeve 70 to allow for easy assembly and disassembly of rod 96 to sleeve 70 . a plug 88 having recesses is provided in tube 96 where the outer surface of tube 96 is formed over the recesses to retain the plug . a hole 90 through tube 96 and plug 88 is shown for proper orientation . in the exemplary embodiment removable sleeve 70 is maintained captive with takedown pin 73 above sleeve 70 engaging slot 102 . slot 102 in the upper portion of sleeve 70 in the upper portion of sleeve 70 provides a cam surface for pin 73 to cam sleeve 70 to seal gas sleeve 70 opening to the gas port in sight block 72 . in this manner , pin 73 engages takedown notch 102 such that pressure reacting on sleeve 70 causes pin 73 to cam sleeve 70 down to the exhaust hole and making a tighter seal . wave spring 104 is provided under the head of sleeve 70 to bias sleeve 70 forward , removing play and actuating the cam surface 102 by lock pin 73 . in this manner , the sleeve 70 is coupled to the gas block 72 with removable pin 73 , where pin 73 provides a camming surface to seal sleeve 70 to a gas port in gas block 72 . the take down pin may be held captive , for example , by a spring and detent ball , or by a pin or otherwise . in alternate embodiments , the sleeve may also have exhaust ports . relief 80 in the outside diameter of sleeve 70 may facilitate cutting gum or carbon and act as a scrapper and may also be relieved in the back to clear any carbon buildup . in the exemplary embodiment , external annular groove ( s ) 98 are provided on sleeve 70 for cutting carbon buildup in gas block bore housing cylinder sleeve 70 . the annular grooves 98 in the outside diameter of sleeve 70 facilitate cutting gum or carbon that may have impacted on the inside and act as a scraper and may also be relieved in the back to clear any carbon buildup . grooves 98 may form a labyrinth seal for trapping exhaust blow by and to minimize carbon build up . although grooves 98 are shown radially cut , in alternate embodiments , grooves 98 may have any suitable shape , for example , grooves 98 may be helically cut . here , slots or grooves 98 are adapted to remove carbon build up during operation . grooves 98 may be provided with rings 100 , with the rings adapted to enhance sealing of the sleeve to gas block interface ( minimizing exhaust blow by through the interface ) and may remove carbon build up during operation and removal of sleeve 70 from gas block 72 . in the exemplary embodiment , different interchangeable gas sleeves ( similar to gas sleeve 70 ) may be provided , each with different sized gas regulating ports ( similar to port 74 ). the bores of the regulating ports may be varied in size , for example in accordance with different barrel lengths or other predetermined characteristics of the barrel or firearm . the gas sleeves may be selected for installation from the different interchangeable gas sleeves in accordance for example , with barrel length . in alternate embodiments , a gas sleeve may be provided with more than one gas regulating port , each port having a different bore size and resulting in a different gas feed flow when positioned in communication via gas block port 90 with the barrel exhaust port 76 . it should be understood that the foregoing description is only illustrative of the invention . various alternatives and modifications can be devised by those skilled in the art without departing from the invention . accordingly , the present invention is intended to embrace all such alternatives , modifications and variances which fall within the scope of the exemplary embodiments . | 5 |
fig1 illustrates a receiver according to a preferred embodiment of the invention . an intermediate frequency ( if ) signal input 101 enters a baseband section of the receiver from an analog - to - digital converter ( adc ) output of a conventional rf front - end 100 . the if input is multiplied in if mixers 102 and 103 in - phase and in quadrature , respectively , with a local frequency signal generated by a direct digital frequency synthesizer ( ddfs ) 106 . this mixing involves multiplying the adc output 101 by the local ddfs frequency in - phase which generates the in - phase component i 107 . in a parallel path the same signal 101 is multiplied by the ddfs frequency in quadrature ( i . e ., with a phase shift of 90 degrees ) to produce quadrature component q 108 . the ddfs 106 is driven by a carrier numerically controlled oscillator ( nco ) 105 . in addition , carrier nco 105 receives phase and frequency corrections from a processor 113 . because of this correction , the ddfs frequency and phase is almost the same as that of the adc output 101 . thus the i and q signals produced by the if mixers 102 and 103 are at near zero carrier frequency after being low - pass filtered to remove the high frequency components which are at twice the if frequency band . the i and q components 107 and 108 are correlated in correlators 109 and 110 , respectively , with a locally - generated prn sequence generated by a prn generator 111 . the prn - sequence corresponds to the satellite whose signal is being processed by the baseband section at that time . the prn sequence generator is driven by code nco 112 . the local code frequency is made equal to the code rate of i and q paths by corrective feedback from processor 113 to the code nco 112 . in addition , processor 113 sends a signal to prn code generator 111 to set the starting phase of the locally generated code . the nco 112 provides the correct clock signals to correlators 109 and 110 . for example , nco 112 provides a clock signal to generate two samples per prn chip in the signal acquisition stage and three samples per chip during the tracking stage . sys clk 104 provides to nco 105 and nco 112 a common clock synchronization signal . the correlator outputs are then sent to processor 113 at every millisecond interval . the processor 113 is preferably a digital signal processor ( dsp ) core suitable for high speed arithmetic computations . subsequent processing of the signals take place in the processor 113 , as will be described in detail below . additional details of the receiver baseband section described above are contained in u . s . patent application ser . no . 11 / 123 , 861 filed on may 6 , 2005 , the specification of which is incorporated herein by reference . the improvement in the ttff or enhanced cold start due to the approximately known receiver location is described here . in the normal cold start mode the receiver searches for all the satellites in all possible frequency bins and then acquires the signal . once the signal is acquired the receiver proceeds to detect the navigation data bit edge at one of the twenty possible one millisecond intervals . the systems and methods of the present invention may detect the first satellite data bit edge in a similar manner . in present day receivers , this procedure is repeated with each of the other satellites . however , in the systems and methods of the present invention , the timing is obtained from the first satellite signal . using this timing , the approximate receiver location and the almanac , the receiver can determine the bit edges of all the other visible satellite signals with an accuracy of one millisecond . thus the twenty millisecond second uncertainty reduces to +/− 1 millisecond uncertainty with a corresponding reduction in the search time . in addition , the receiver can determine the visible satellites , thereby reducing the number of satellites that need to be searched . thus this results in a reduction of the ttff . the accuracy of the position can be +/− 150 kms as one millisecond corresponds to a distance of 300 kms . if the approximate time is known , it is not necessary to determine the same from the first satellite signal , thereby further reducing the ttff . this improvement increases with the accuracy of the predicted time . fig2 shows an exemplary form of database of cities with associated co - ordinates in latitude , longitude and optionally height . the database may also include locations or landmarks with associated co - ordinates in latitude , longitude and optionally height . the co - ordinates may be the co - ordinates of the geographical center of the cities and landmarks . the database may also include areas which are the states of a country with associated co - ordinates of the geographical center of the areas or states . fig3 shows a database of states with co - ordinates of their geographical center points . the areas considered need not be constrained to states alone . the area may be a county , a district or even a small country . further , it is possible to define custom made areas comprising several states or part of the states . the custom made areas may be defined by a rectangular or circular border on a map . in the normal cold start mode of a typical navigation receiver the receiver memory contains no information on present or prior position , ephemeris and time . in some cases memory may contain a location which is far away from the present position . under these conditions the receiver starts to search all the satellites with all search frequency bins . this takes a long time resulting in a long ttff . however , in such instances the user may have some information regarding the new location , which can be used to reduce the acquisition time . for example , the user may know the nearest city but not its co - ordinates . in such cases the user can provide the location information by selecting the city name from a drop down list on the receiver display . the receiver uses the city name to find the center co - ordinates of the city from the database and uses the center co - ordinates as the initial position of the receiver . in another embodiment the user may be aware of the area but not the nearby city . in such cases , the user can select the area which may be a state , a group of states , a county or a group of counties . in such cases , the list may include the names of states , counties or region , etc . the list may also even include the name of small countries . the user selects the appropriate area from the list . under such cases the receiver takes the co - ordinates of the center of the area as the approximate position of the receiver and proceeds to compute the visible satellite list and associated doppler values . the receiver then tries to acquire the signals . in another embodiment the location provided by the user need not be a city or state but may be some landmark or any pre - defined location that is recognizable by the user and whose co - ordinates are known . in this embodiment , the database in the receiver may include a list of landmarks or pre - defined locations with associated co - ordinates , and the user selects a landmark or pre - defined location from the list . the locations may include airports , train stations , and other location where the receiver may be powered on after traveling a long distance . in cases where the receiver has no timing information the time may be provided by the user . the user may estimate the time through his watch , by the position of the sun during the day or by the position of the stars during night time . the receiver performance can further be improved by providing both the approximate position and the time as above . under certain circumstances , selecting items from a dropdown list can be somewhat tedious , such as while driving . further , the accuracy of the location information may be limited . therefore , an embodiment involving user interface through a map is also provided . in this embodiment , a map of a country or any suitable area is displayed on the receiver display as shown in fig4 . the user pinpoints the approximate position on this display . the display may be a touch screen with the user pinpointing the approximate position on the map by touching the screen . the user may also pinpoint the approximate position using a track ball . any display selection tool may be used to pinpoint the location on the map . if the resulting accuracy is sufficient , the receiver computes the longitude and latitude of the location and sends it to the receiver computation engine for enhanced cold start . various levels of zooming as shown in fig5 may be employed to improve the positioning accuracy . fig5 shows a possible division of states for a second “ zoomed in ” level . the user may zoom in a certain area by touching the area on a touch screen and activating a zooming function by , e . g ., touching a “ zoom ” button on the screen . the screen may also have different “ zoom ” level buttons so that the user can immediately zoom to a desired “ zoom ” level . although the present invention has been described in terms of the presently preferred embodiments , it is to be understood that the disclosure is not to be interpreted as limiting . various alterations and modifications will no doubt become apparent to those skilled in the art after having read this disclosure . for example , although the above embodiments have been described using the gps system as an example , the techniques and methods may be used for other global satellite navigational systems including glonass , galileo , secondary systems such as wass , egnos , and msas , as well as hybrids of the above systems and also to any type direct sequence spread spectrum receivers . accordingly , it is intended that the appended claims be interpreted as covering all alterations and modifications as fall within the spirit and scope of the invention . | 6 |
in the following description , reference is made to the accompanying drawings where like numerals represent like elements . the embodiments are described in sufficient detail to enable those skilled in the art to practice the present disclosure . it is to be understood that other embodiments may be utilized and that process , electrical , and mechanical changes , etc ., may be made without departing from the scope of the present disclosure . examples merely typify possible variations . portions and features of some embodiments may be included in or substituted for those of others . the following description , therefore , is not to be taken in a limiting sense and the scope of the present disclosure is defined only by the appended claims and their equivalents . referring to the drawings and particularly to fig1 , there is shown a block diagram depiction of an imaging system 50 according to one example embodiment . imaging system 50 includes an image forming device 100 and a computer 60 . image forming device 100 communicates with computer 60 via a communications link 70 . as used herein , the term “ communications link ” generally refers to any structure that facilitates electronic communication between multiple components and may operate using wired or wireless technology and may include communications over the internet . in the example embodiment shown in fig1 , image forming device 100 is a multifunction device ( sometimes referred to as an all - in - one ( aio ) device ) that includes a controller 102 , a user interface 104 , a print engine 110 , a laser scan unit ( lsu ) 112 , one or more toner bottles or cartridges 200 , one or more imaging units 300 , a fuser 120 , a media feed system 130 and media input tray 140 , and a scanner system 150 . image forming device 100 may communicate with computer 60 via a standard communication protocol , such as , for example , universal serial bus ( usb ). ethernet or ieee 802 . xx . image forming device 100 may be , for example , an electrophotographic printer / copier including an integrated scanner system 150 or a standalone electrophotographic printer . controller 102 includes a processor unit and associated memory 103 and may be formed as one or more application specific integrated circuits ( asics ). memory 103 may be any volatile or non - volatile memory or combination thereof such as , for example , random access memory ( ram ), read only memory ( rom ), flash memory and / or non - volatile ram ( na / ram ). alternatively , memory 103 may be in the form of a separate electronic memory ( e . g ., ram , rom , and / or nvram ), a hard drive , a cd or dvd drive , or any memory device convenient for use with controller 102 . controller 102 may be , for example , a combined printer and scanner controller . in the example embodiment illustrated , controller 102 communicates with print engine 110 via a communications link 160 . controller 102 communicates with imaging unit ( s ) 300 and processing circuitry 301 on each imaging unit 300 via communications link ( s ) 161 . controller 102 communicates with toner cartridge ( s ) 200 and non - volatile memory 201 on each toner cartridge 200 via communications link ( s ) 162 . controller 102 communicates with fuser 120 and processing circuitry 11 thereon via a communications link 163 . controller 102 communicates with media feed system 130 via a communications link 164 . controller 102 communicates with scanner system 150 via a communications link 165 . user interface 104 is communicatively coupled to controller 102 via a communications link 166 . processing circuitry 121 and 301 may include a processor and associated memory such as ram , rom , and / or non - volatile memory and may provide authentication functions , safety and operational interlocks , operating parameters and usage information related to fuser 120 , toner cartridge ( s ) 200 and imaging unit ( s ) 300 , respectively . controller 102 processes print and scan data and operates print engine 110 during printing and scanner system 150 during scanning . computer 60 , which is optional , may be , for example , a personal computer , including memory 62 , such as ram , rom , and / or nvram , an input device 64 , such as a keyboard and / or a mouse , and a display monitor 66 . computer 60 also includes a processor , input / output ( i / o ) interfaces , and may include at least one mass data storage device , such as a hard drive , a cd - rom and / or a dvd unit ( not shown ). computer 60 may also be a device capable of communicating with image forming device 100 other than a personal computer such as , for example , a tablet computer , a smartphone , or other electronic device . in the example embodiment illustrated , computer 60 includes in its memory a software program including program instructions that function as an imaging driver 68 , e . g ., printer / scanner driver software , for image forming device 100 . imaging driver 68 is in communication with controller 102 of image forming device 100 via communications link 70 . imaging driver 68 facilitates communication between image forming device 100 and computer 60 . one aspect of imaging driver 68 may be , for example , to provide formatted print data to image forming device 100 , and more particularly to print engine 110 , to print an image . another aspect of imaging driver 68 may be , for example , to facilitate the collection of scanned data from scanner system 150 . in some circumstances , it may be desirable to operate image forming device 100 in a standalone mode . in the standalone mode , image forming device 100 is capable of functioning without computer 60 . accordingly , all or a portion of imaging driver 68 , or a similar driver , may be located in controller 102 of image forming device 100 so as to accommodate printing and / or scanning functionality when operating in the standalone mode . several components of the image forming device 100 are user replaceable e . g . toner cartridge 200 , fuser 120 , and imaging unit 300 . it is advantageous to prevent counterfeiting these user replaceable components . a puf 202 may be attached to the toner cartridge 200 to prevent counterfeiting as described below . a puf reader 203 may be integrated into the image forming device 100 to verify the authenticity of the puf 202 . data related to the puf 202 may reside in non - volatile memory 201 and is preferably encrypted . this data may be generated at the time of manufacture by measuring the puf 202 at the factory . the non - volatile memory 201 is preferably located on the supply item along with the puf 202 . to verify the authenticity of the puf 202 , the image forming device 100 measures the magnetic field generated by the puf 202 in one or more directions along a measurement path and compares these measurements to data in the non - volatile memory 201 . fig2 shows a puf 210 next to a magnet 212 . the puf 210 is elongate and has a longitudinal axis 214 . the puf 210 contains a plurality of magnetized particles 216 each having a volume less than one cubic millimeter . the magnetized particles 216 may be , for example , flakes of an alloy of neodymium , iron and boron ( ndfeb ). the magnet 212 is located on the longitudinal axis 214 and is separated from the puf 210 by a distance d . preferably , the magnet 212 has a volume of at least five cubic millimeters so that the magnet &# 39 ; s magnetic field is much greater than the magnetic field of a particle 216 . the puf 210 may be read by moving a magnetic sensor along the longitudinal axis 214 . the magnetic sensor will have a much higher reading when positioned over the magnet 212 and thus the magnet 212 designates a home position from which readings of the puf may be referenced spatially . preferably , the distance d is five millimeters or less to minimize the overall travel of the positioning mechanism of the magnetic sensor to reduce cost . preferably , the puf 210 and magnet 212 are mounted to a planar surface , the magnetic sensor measures orthogonal to the surface , the magnet has a magnetic pole orientation that is orthogonal to the surface , and the majority of the particles 216 have a magnetic pole orientation that is not orthogonal to the body surface . this is to maximize the difference between measurements of the magnet 212 and the particles 216 to give a clear home position signal . the magnetic sensor may measure along multiple orthogonal directions . preferably , the magnet 212 has multiple north poles 218 , 220 and south poles 222 , 224 that alternate in polarity along the longitudinal axis of the puf . the magnet 212 may be fabricated by joining discrete magnets having alternating poles into one magnet . the alternating poles limits the magnetic field seen by the particles 216 and thus limits the effect of the magnet 212 on the particles 216 . this allows the magnet 212 to be placed near the puf 210 without disturbing the signature of the puf 210 . fig3 shows an imaging device supply item 300 , for example a toner bottle , with the puf 210 and magnet 212 located on a surface 310 of a body 312 located on the back side 314 of the body 312 . the puf 210 and magnet 212 may be used by an imaging device to verify the authenticity of the supply item 300 . fig4 shows the front side 410 of the body 312 including a handle 412 located on the front side 410 . the handle 412 is configured to pivot about a pivot axis 414 that is parallel to the puf longitudinal axis 214 . the pivot axis 414 is parallel to the longitudinal dimension of the body 312 , which allows a larger , and thus easier to use handle 412 than if the handle was rotated ninety degrees . similarly , the puf longitudinal axis 214 is parallel to the longitudinal dimension of the body 312 , which allows a longer and thus more difficult to clone puf . it is preferential to locate the puf 210 on the back side 314 so the magnetic sensor may be protected by being as far from the user as possible . also , the magnetic sensor may be spring biased toward the puf 210 to insure proper gap spacing for accurate measurements without being in the insertion path of the imaging device supply item 300 . fig5 shows an imaging device supply item 500 having a puf 510 slidably attached to a body 512 by a pair of snaps 514 , 516 . at least one face 518 of the puf 510 contains magnetic particles as described previously . fig6 shows a top view of the puf 510 , snaps 514 , 516 , and a spring 520 . the puf 510 has a toothed rack 522 having a longitudinal axis 524 . the puf 510 has slots 526 , 528 that , together with the snaps 514 , 516 , constrain the puf 510 to move linearly relative to the body 512 parallel to the longitudinal axis 524 . an imaging device reads the puf 510 using a stationary magnetic sensor . the puf 510 is moved linearly by mating a gear with the teeth of the toothed rack 522 and turning the gear . preferably , the puf moves at least ten millimeters to read a sufficient length of the puf 510 to make it difficult to counterfeit the puf 510 . it is preferable to use a stationary magnetic sensor to reduce cost . the puf 510 is returned to a home position , e . g . against the snaps 514 , 516 , by the spring 520 . fig7 shows another view of the supply item 500 . a handle is located on the front side 712 of the body opposite the puf 510 located on the back side 714 of the body . the insertion path of the supply item 500 is defined by rails 716 that run front - to - back . thus , it is preferable to locate the puf 510 on the back side 714 to simplify mating with the gear used to move the puf 510 . fig8 shows a flowchart of a method of manufacturing a puf . the method 800 uses an injection molding machine to make an injection - molded puf . as is known in the art , injection molding machines heat feed material until it is molten and then forces the feed material through a nozzle into a mold cavity . once the material is cooled enough to harden , the injection molded part is ejected from the injection molding machine . at block 810 , feed material is obtained containing plastic and magnetizable flakes that are not magnetized . the plastic may be , for example , a thermoplastic , a thermosetting polymer , etc . the magnetizable flakes may be , for example , an alloy of neodymium , iron and boron . other magnetizable particles may be used , for example , spheres , rods , etc . preferably , the feed material contains between ten and twenty percent , inclusive , by weight magnetizable flakes to maximize the variability in the magnetic signature of the puf while maintaining good flow within the mold . at block 812 , the flakes are magnetized . alternatively , feed material may be used that contains pre - magnetized flakes . it is preferable to magnetize the flakes after they are enveloped by the plastic to prevent the flakes from clumping together . at block 814 , the feed material is fed into an injection molding machine . the feed material may be fed as solid pellets containing plastic and magnetic material , pellets containing plastic as well as pellets containing both plastic and magnetic material , etc . at block 816 , the magnetized alloy is heated to below its curie temperature . it is necessary to heat the feed material so that it will flow into the mold . however , it is preferable to avoid heating the magnetized alloy to above its curie temperature to avoid degrading the magnetic fields generated by the magnetic particles . at block 818 , the feed material is formed into an injection - molded puf . for example , the feed material may be forced through one or more nozzles into a mold cavity . the turbulent flow of the feed material through the nozzle and through the mold cavity creates a random distribution and orientation of the magnetic particles , which creates a highly random magnetic signature for each puf . the random magnetic signature makes it very difficult to reproduce a puf . this process may economically produce the toothed - rack puf 510 described above . the foregoing description illustrates various aspects and examples of the present disclosure . it is not intended to be exhaustive . rather , it is chosen to illustrate the principles of the present disclosure and its practical application to enable one of ordinary skill in the art to utilize the present disclosure , including its various modifications that naturally follow . all modifications and variations are contemplated within the scope of the present disclosure as determined by the appended claims . relatively apparent modifications include combining one or more features of various embodiments with features of other embodiments . | 6 |
fig1 is an example diagram of a substantially transparent display , in accordance with embodiments . viewer 10 is able to see an arbitrary object ( e . g . cube 12 ) through substrate 14 . substrate 14 may be transparent or substantially transparent . while viewer 10 sees arbitrary object 12 through substrate 14 , the viewer can also see images ( e . g . circle 15 and triangle 16 ) that are created at substrate 14 . substrate 14 may be part of a vehicle windshield , a building window , a glass substrate , a plastic substrate , a polymer substrate , or other transparent ( or substantially transparent ) medium that would be appreciated by one of ordinary skill in the art . other substrates may complement substrate 14 to provide for tinting , substrate protection , light filtering ( e . g . filtering external ultraviolet light ), and other functions . fig2 and 3 are example diagrams of transparent displays illuminated with excitation light ( e . g . ultraviolet light or infrared light ) from light sources ( e . g . projector 18 or laser 20 ), in accordance with embodiments . substrate 14 may receive excitation light from a light source ( e . g . projector 18 or laser 20 ). the received excitation light may be absorbed by light emitting material at substrate 14 . when the light emitting material receives the excitation light , the light emitting material may emit visible light . accordingly , images ( e . g . circle 15 and triangle 16 ) may be created at substrate 14 by selectively illuminating substrate 14 with excitation light . the excitation light may be ultraviolet light , in accordance with embodiments of the present invention . if the excitation light is ultraviolet light , then when the light emitting material emits visible light in response to the ultraviolet light , a down - conversion physical phenomenon occurs . specifically , ultraviolet light has a shorter wavelength and higher energy than visible light . accordingly , when the light emitting material absorbs the ultraviolet light and emits lower energy visible light , the ultraviolet light is down - converted to visible light because the ultraviolet light &# 39 ; s energy level goes down when it is converted into visible light . in embodiments , the light emitting material is fluorescent material . the excitation light may be infrared light , in accordance with embodiments of the present invention . if the excitation light is infrared light , then when the light emitting material emits visible light in response to the infrared light , an up - conversion physical phenomenon occurs . specifically , infrared light has a longer wavelength and lower energy than visible light . accordingly , when the light emitting material absorbs the infrared light and emits higher energy visible light , the infrared light is up - converted to visible light because the infrared light &# 39 ; s energy level goes up when it is converted into visible light . in embodiments , the light emitting material is fluorescent material . in the up - conversion physical phenomenon , absorption of more than one infrared light photon may be necessary for the emission of every visible light photon . in embodiments illustrated in fig2 , the excitation light is output by projector 18 . projector 18 may be a digital projector . in embodiments , projector 18 is a micro - mirror array ( mma ) projector ( e . g . a digital light processing ( dlp ) projector ). a mma projector that outputs ultraviolet light may be similar to a mma projector that outputs visible light , except that the color wheel has light filters that are tailored to the ultraviolet light spectrum . in other embodiments , the projector 18 is a liquid crystal display ( lcd ) projector . in embodiments , the projector may be a liquid crystal on silicon ( lcos ) projector . in embodiments , the projector may be an analog projector ( e . g . a slide film projector or a movie film projector ). one of ordinary skill in the art would appreciate other types of projectors which may be used to project ultraviolet light on substrate 14 . in embodiments illustrated in fig3 , excitation light is output from laser 20 . the intensity and / or movement of a laser beam output from laser 20 may be modulated to create an image in substrate 14 . in down - conversion embodiments , the output from laser 20 may be ultraviolet light . in up - conversion embodiments , the output from laser 20 may be infrared light . fig4 is an example diagram of light emitting material ( e . g . light emitting particles 22 ) dispersed in a substantially transparent substrate , according to embodiments . when excitation light is absorbed by the light emitting particles 22 , the light emitting particles emit visible light . accordingly , in down - conversion embodiments , when ultraviolet light is absorbed by light emitting particles 22 , visible light is emitted from the light emitting particles . likewise , in up - conversion embodiments , when infrared light is absorbed by light emitting particles 22 , visible light is emitted from the light emitting particles . fig5 is an example diagram of light emitting particles 24 disposed on a surface of substrate 14 . light emitting particles 24 may be integrated into substrate 14 by being coated on substrate 14 . light emitting material ( e . g . light emitting particles 22 and light emitting particles 24 ) may be fluorescent material , which emits visible light in response to absorption of electromagnetic radiation ( e . g . visible light , ultraviolet light , or infrared light ) that is a different wavelength than the emitted visible light . the size of the particles may be smaller than the wavelength of visible light , which may reduce or eliminate visible light scattering by the particles . examples of particles that are smaller than the wavelength of visible light are nanoparticles or molecules . according to embodiments , each of the light emitting particles has a diameter that is less than about 400 nanometers . according to embodiments , each of the light emitting particles has a diameter that is less than about 300 nanometer . according to embodiments , each of the light emitting particles has a diameter that is less than about 200 nanometers . according to embodiments , each of the light emitting particles has a diameter that is less than about 100 nanometers . the light emitting particles may be individual molecules . different types of light emitting particles ( e . g . light emitting particles 22 and light emitting particles 24 ) may be used together that have different physical characteristics . for example , in order to create color images in substrate 14 , different types of light emitting particles may be utilized that are associated with different colors . for example , a first type of light emitting particles may be associated with the color red , a second type of light emitting particles may be associated with the color green , and a third type of light emitting particles may be associated with the color blue . although the example first type , second type , and third type of light emitting particles are primary colors , one of ordinary skill in the art would appreciate other combinations of colors ( e . g . types of colors and number of colors ) in order to facilitate a color display . in down - conversion embodiments , light emitting particles which emit red light may include europium , light emitting particles which emit green light may include terbium , and light emitting particles which emit blue or yellow light may include cerium ( and / or thulium ). in up - conversion embodiments , light emitting particles which emit red light may include praseodymium , light emitting particles which emit green light may include erbium , and light emitting particles which emit blue light may include thulium . in embodiments , light emitting particles are fluorescent molecules that emit different colors ( e . g . red , green , and blue ). in embodiments , light emitting particles are included in pure organic or organo - metallic dyes . different types of light emitting particles may absorb different ranges of excitation light to emit the different colors . accordingly , the wavelength range of the excitation light may be modulated in order to control the visible color emitted from the light emitting particles in substrate 14 . in embodiments , different types of light emitting particles may be mixed together and integrated into substrate 14 . by modulating the wavelength of the excitation light , along with spatial modulation and intensity modulation of the excitation light , visible light with specific color characteristics can be created in substrate 14 . for example , by selectively exciting specific combinations of different types of light emitting particles associated with primary colors , virtually any visible color can be emitted from substrate 14 . in dlp projector embodiments , the wavelength of ultraviolet light emitted from a dlp projector can be modulated using a color wheel with specific ultraviolet pass filters . similar modulation techniques may be utilized in other projector embodiments and laser embodiments . in embodiments , multiple projectors and multiple lasers may be utilized , each being associated with a specific ultraviolet wavelength range to excite a specific type of light emitting particle , to output a specific color of light . fig6 is an example diagram of different types of light emitting particles , associated with different visible colors , dispersed in different pixel regions ( e . g . stripe region 26 , stripe region 28 , and stripe region 30 ) in a substantially transparent substrate . in embodiments , substrate 14 may include different regions in which different types of light emitting particle are dispersed . for example , a first type of light emitting particle ( e . g . a light emitting particle associated with red light ) may be dispersed in stripe region 26 , a second type of light emitting particle ( e . g . a light emitting particle associated with green light ) may be dispersed in stripe region 28 , and a third type of light emitting particle ( e . g . a light emitting particle associated with blue light ) may be dispersed in stripe region 30 . stripe region 26 , stripe region 28 , and stripe region 30 may be formed in stripes ( i . e . rows ). a projector or laser ( e . g . projector 18 or laser 20 ) may use an excitation light wavelength range that excites all of the different types of light emitting particles and selectively illuminates different colors by spatial modulation of the excitation light . for example , in example fig6 , to emit green visible light in a given region of substrate 14 , projector 18 or laser 20 may illuminate a portion of stripe region 28 ( e . g . which includes light emitting particles associated with green light ). in embodiments that spatially separate the different types of light emitting particles , it is not necessary for the excitation light source to modulate the wavelength of the excitation light to create different colors , because color may be selected by the spatial modulation of the excitation light . similarly , in embodiments illustrated in fig7 , different types of light emitting particles may be coated on regions of substrate 14 ( e . g . stripe region 32 , stripe region 34 , and stripe region 36 ) instead of being dispersed in substrate 14 . in embodiments illustrated in fig8 , different types of light emitting particles , associated with different visible colors , are separated into different regions of substrate 14 in the form of a matrix 38 . fig8 illustrates different matrix regions ( e . g . region 40 , region 42 , and region 44 ) that include different types of light excitation particles associated with different colors . one of ordinary skill in the art would appreciate that other pixel configurations are applicable , other than the pixel configurations illustrated in fig6 - 8 , without departing from embodiments . although example fig8 illustrates light emitting particles coated on substrate 14 , the light emitting particles may also be dispersed in substrate 14 , similar to embodiments illustrated in fig6 . embodiments relate to methods , materials , components , and designs to display optical images or computer information onto an optically transparent screen . an optical projector may be used to project ultraviolet ( uv ) or lower wavelength visible images or information onto a fluorescent screen , which is in the form of a film , coating , or plate . in embodiments , the screen will down - convert the uv or lower wavelength optical image to a higher wavelength visible fluorescent image , while remaining optically transparent or substantially transparent in an un - projected region . in embodiments , a uv lamp or lower wavelength visible lamp is used in the projector , which may be a liquid crystal display ( lcd ) or digital light processor ( dlp ). the projector may interface to a computer , pda , dvd , vcr , tv , or other information input devices . in embodiments , a fluorescent screen may be a transparent or translucent glass or plastic plate filled by fluorescent organic dyes or inorganic phosphors . in embodiments , a fluorescent screen may be a transparent or translucent glass or plastic plate coated by fluorescent organic dyes or inorganic phosphors . in embodiments , a fluorescent screen may be a transparent or translucent thin glass sheet or plastic film filled by fluorescent organic dyes or inorganic phosphors . in embodiments , a fluorescent screen may be a transparent or translucent thin glass sheet or plastic film coated by fluorescent organic dyes or inorganic phosphors . transparent or substantially transparent displays may have many applications . for example , transparent or substantially transparent displays may display an image on a transparent or translucent window of moving vehicles , such as automobiles , motorcycles , aircrafts , and boats ; the image may be information on the conditions of the vehicles . directions ( e . g . gps map ), that are currently displayed on the dashboard electronic display , may be projected onto the windows ( e . g . front glass , wind shields ) of the vehicle . drivers do not have to turn their eyes away from the road to view the vehicle conditions and / or directions . transparent or substantially transparent displays may display images or advertisements on transparent or translucent windows ; such transparent window projective display may be applied in any room or building to effectively communicate the information through the window of the structure , while not blocking the view of the window . in embodiments , to display a full color fluorescence projective display on the transparent screen , full color ( e . g . red , green , blue , or rgb ) dyes of molecules can be placed onto different pixelized regions of the screen , with each pixel containing rgb elements . in embodiments , three separated modulated uv beams from a projector can be applied to the three sets of rgb elements on the screen . by controlling and partitioning the projective uv lights onto corresponding rgb elements of each pixel on the multiple colored fluorescent screen , a full color image can be displayed on the transparent screen . in embodiments , a screen is again pixilated using rgb elements . each pixel comprises 3 portions for rgb respectively . a single projective uv beam can be illuminated onto the pixilated screen . to get various mixtures of rgb for different color , the same uv projective beam on a pixel may be shifted to cover a certain amount of areas of the rgb elements within a pixel . accordingly , only one projective beam is necessary to generate the full color projective image . the color balance of the rgb for a pixel can be calculated and converted into the right area of rgb elements on the screen , the beam can then be shifted to cover the right relative area percentage of each rgb elements to display the right color on the pixel . in embodiments , a fluorescent screen may be a transparent or translucent glass or plastic plate filled by fluorescent organic dyes or inorganic phosphors . in embodiments , a fluorescent screen may be a transparent or translucent glass or plastic plate coated by fluorescent organic dyes or inorganic phosphors . in embodiments , a fluorescent screen may be a transparent or translucent thin glass sheet or plastic film filled by fluorescent organic dyes or inorganic phosphors . in embodiments , a fluorescent screen may be a transparent or translucent thin glass sheet or plastic film coated by fluorescent organic dyes or inorganic phosphors . the glass for the fluorescent screen may include inorganic solids which are transparent or translucent to the visible light . examples of such inorganic solids are oxides and halides . the glass may include silicates , borosilicate , lead crystal , alumina , silica , fused silica , quartz , glass ceramics , metal fluorides , and other similar materials . these types of glass may be used as the window in rooms , buildings , and / or moving vehicles . plastics for fluorescent screens may include organic and polymeric solids , which are transparent or translucent to the visible light . thermoplastics for fluorescent screens may include special thermoset solids , such as transparent gels . some examples of the plastics include polyacrylic , polycarbonate , polyethylene , polypropylene , polystyrene , pvc , silicone , and other similar materials . glass and plastic may be turned into fluorescent projective displays , by combining them with fluorescent dyes . fluorescent dyes are organic molecules or materials that can absorb a higher energy photon and emit lower energy photon . to emit visible light , such molecules may absorb uv light or lower wavelength visible ( e . g . violet or blue ) light , in the typical wavelength range of 190 nm to 590 nm or in the wavelength range of 300 nm to 450 nm . some examples of the fluorescent dyes include ( but are not limited to ) commercial dye molecules from various dye vendors , including lambda physik and exciton . fluorescent dyes that may be used in a transparent display include pyrromethene , coumarin , rhodamine , fluorescein , and other aromatic hydrocarbons and their derivatives . in addition , there are many polymers containing unsaturated bonds , which can be fluorescent materials that may be used in a transparent display . for example , some of them ( meh - ppv , ppv , etc ) have been used in optoelectronic devices , such as polymer light emitting diodes ( pled ). glass or plastics may be turned into a fluorescent projective display , by combining them with phosphor materials . the down - conversion phosphors include inorganic or ceramic particles or nano - particles , including but not limited to metal oxides , metal halides , metal chalcoginides ( e . g . metal sulfides ), or their hybrids , such as metal oxo - halides and metal oxo - chalcoginides . these inorganic phosphors have found wide applications in fluorescent lamps and electronic monitors . they may be applied in converting shorter wavelength projective light ( e . g . uv and blue ) into higher wavelength visible light . they may be dispersed or coated to the transparent screen or window and excited by corresponding shorter wavelength projective light to display a visible image . fluorescent phosphors or dye molecules that can be excited into visible light by projective light ranging from ultraviolet light ( e . g . wavelength greater than 240 nanometer ) to blue ( e . g . less than 500 nanometer ). lamps for projectors may emit light in this range of wavelengths . such lamps are commercially available ( e . g . those used for skin - tanning purposes ). they can also be halogen lamps , special incandescent lamps , and arc vapor lamps ( e . g . mercury , xenon , deuteron , etc ). such lamps may contain phosphors to convert shorter wavelength uv to longer wavelength uv . phosphors containing metal oxide hosts ( e . g . metal silicates , metal borates , metal phosphates , metal aluminates ); metal oxohalides , oxosulfides , metal halides , metal sulfides , and chalcoginides may be applied to the projective fluorescence displays . one example of phosphors that may be used in fluorescent displays includes the garnet series of phosphors : ( y m a 1 - m ) 3 ( al n b 1 - n ) 5 o 12 , doped with ce ; where 0 ≦ m , n ≦ 1 ; a includes other rare earth elements , b include b and / or ga . in addition , phosphors containing common rare earth elements ( e . g . eu , tb , ce , dy , er , pr , and / or tm ) and transitional or main group elements ( e . g . mn , cr , ti , ag , cu , zn , bi , pb , sn , and / or tl ) as the fluorescent activators may be applied to projective fluorescence displays . some undoped materials ( e . g . metal , ca , zn , cd , tungstates , metal vanadates , and zno ) are also luminescent materials and may be applied in projective fluorescent displays . the organic dyes and inorganic phosphors may be filled in or coated on the hosts of glass or plastics to prepare a fluorescent transparent screen . the dye molecules , if dissolved in the hosts , will not scatter the visible light , although it may absorb some visible light and add some color tint to the hosts . in contrast , larger phosphor particles will scatter visible light , which will affect the optical transparency of the hosts . embodiments relate to different approaches to reduce the scattering of the phosphor particles to visible light . in embodiments , the size of the phosphor particles is reduced . in embodiments , the concentration of phosphor particles is reduced and evenly dispersed in the host . in embodiments , hosts are chosen with refractive indexes close to those of the phosphors to reduce the scattering or phosphors are chosen with refractive indexes close to those of the hosts . the foregoing embodiments ( e . g . light emitting material integrated into a substantially transparent substrate ) and advantages are merely examples and are not to be construed as limiting the appended claims . the above teachings can be applied to other apparatuses and methods , as would be appreciated by one of ordinary skill in the art . many alternatives , modifications , and variations will be apparent to those skilled in the art . | 6 |
various embodiments of the invention are discussed in detail below . while specific implementations are discussed , it should be understood that this is done for illustration purposes only . a person skilled in the relevant art will recognize that other components and configurations may be used without parting from the spirit and scope of the invention . limitations in the bandwidth of any user &# 39 ; s internet connection can greatly reduce the quality of the user &# 39 ; s internet experience . chief among the problems that are experienced is the delay in rendering web pages that are transmitted . as the content included within a typical web page becomes even more focused on multi - media , this problem is expected to increase as users are forced to download larger and larger files for rendering on a particular web page . it is a feature of the present invention that a user &# 39 ; s web experience can be improved through the reduction in the amount of content that needs to be transmitted . in general , this reduction is achieved through the leveraging of cache technology , especially at the client site in synchronization with changes in cache at the server site . at the client site , the client cache minimizes the portions of a web page that need to be rebuilt at the server , thereby resulting in the reduction of the server &# 39 ; s load . as will be described in greater detail below , the client cache and the server cache can be kept dynamically in - sync with content residing at the server . in accordance with the present invention , a client cache is used to cache portions ( or fragments ) of a web page . in general , these portions ( or fragments ) of the web page can represent any part of a web page that can be separately identified from the entire web page . for example , in one scenario , the portion of the web page can represent a fragment of a web page that is to be displayed through a frame of a skeleton page . in one embodiment , the skeleton page represents a web page implementing partial web page caching technology . in various examples , the fragment can be embodied as its own html document , a web user control , or any other web page component that can be separately defined . fig1 illustrates an embodiment of a skeleton page having a plurality of fragments that are displayed through a plurality of frames . as illustrated in fig1 , the skeleton page includes frames 101 - 104 . fragments 111 - 114 would then be displayed through frames 101 - 104 , respectively . as would be appreciated , a plurality of fragments could be displayed through one particular frame under the control of , for example , a timer or other user menu selection mechanism . in another example , the portion of the web page can represent an image file , identified by an image source tag , that can be displayed within a skeleton page or a fragment . in the more detailed description below , the principles of the present invention are described with reference to an example of fragments that are displayable through a plurality of frames within a defined skeleton page . in accordance with the present invention , the plurality of fragments within a skeleton page can be stored individually in a client &# 39 ; s cache . these fragments are dynamic because they are only downloaded from the server when their physical display properties or textual content changes . this partial caching process is in contrast to conventional methods that cache entire web pages at the client for a predefined expiration period or cache no part of the web page . in one embodiment , because web page fragments are stored in the client &# 39 ; s cache , subsequent visits to the web page initially retrieve only a skeleton page from the server . this skeleton page enables the synchronization of the client &# 39 ; s cached fragments with the server data . in general , the skeleton page can be designed to store a uniform resource locator ( url ) to each fragment that is to be displayed on the skeleton page . in one embodiment , this fragment url can be formatted to include a reference to a proxy page that is used to construct web page components that cannot independently render themselves separate of a web page . the proxy page can therefore be used to render controls that are dependant upon being constructed from within a web page . when the skeleton page attempts to load these urls into frames of the skeleton page , it first looks for the fragments in the client &# 39 ; s cache . if the fragments identified by the urls are found in the client cache , then the cached fragments are retrieved and immediately rendered in the skeleton page . if the fragments identified by the urls are not found in the client cache , then the fragments are requested from the server , rendered in the skeleton page , and then stored in the client &# 39 ; s cache for subsequent page requests . it is a feature of the present invention that the fragment urls that are downloaded in the skeleton page include version information . in one embodiment , the version information includes a reference number . in another embodiment , the version information includes a timestamp of the date and time that the fragment file was last modified . in this framework , the version information would change when the fragment &# 39 ; s content changes at the server . because the version information is embedded within the fragment &# 39 ; s url , a change in the version information effectively changes the fragment &# 39 ; s entire url . thus , if the fragment &# 39 ; s entire url is changed , the fragment will not be found in the client &# 39 ; s cache . this causes the client to request the newly modified fragment from the server . the previous fragment identified by the fragment url with the old version information would simply be abandoned . with this general caching framework , only a small skeleton page would be downloaded from the server on subsequent visits to that web site . any fragments that are unchanged would be immediately retrieved from the client &# 39 ; s cache and displayed . only changed fragments would need to be downloaded from the server . this savings in bandwidth would enable a modem operating at 28 . 8 kbps to download a 5 kb skeleton page in less than 2 seconds . fragments , no matter how large , would be retrieved from the client &# 39 ; s cache within milliseconds . if any of the fragment versions have changed then only that changed fragment is requested from the server . having described the general framework of a client caching mechanism , a more detailed description of the caching process is now provided . in this description , reference is made to the generic system components that are illustrated in fig2 . as illustrated in fig2 , the system generally includes a client 120 in communication with a server 110 via network 130 . as would be appreciated , network 130 generally encapsulates any network infrastructure that would support a general communication channel through which client - server communication would pass . in one embodiment , network 130 would include any system components that would support the handling of internet traffic . as further illustrated in fig2 , client 120 includes client cache 122 , while server 110 includes server cache 112 . the cooperation of both server cache 112 and client cache 122 in the overall process is now described with reference to the flowcharts of fig3 - 5 . fig3 illustrates a flowchart of a process for serving a skeleton page that includes frames through which fragments may be displayed . at design time , the designer would specify which fragments ( e . g ., html pages , web user controls , or the like ) are to be placed on a skeleton page . in various embodiments , this specification can be performed using a design - time property , xml , or a program interface . in one example , a new or existing control could be included with the following line of aspx code : the following example further shows how to use an xml file to enable display of a different fragment within a single frame every six seconds : after the various fragments have been specified for a particular skeleton page , the skeleton page can then be used in responding to a web page request . as illustrated in fig3 , this process begins at step 302 where server 110 receives a page request from client 120 . at step 304 , server 110 would then retrieve the skeleton page that is associated with the page request . as noted above , this skeleton page can be designed to include one or more frames , such as frames 101 - 104 in fig1 . next , at step 306 , server 110 would retrieve input ( e . g ., xml document , a code behind method call , or a property ) for each frame that can include a list of fragment uniform resource locators ( urls ) that is to be included . as will be described in greater detail below , the content corresponding to this list of fragment urls can be cached in client cache 122 . the retrieved fragment urls would then be formatted prior to being sent to the client as part of the skeleton page . in one embodiment , the fragment url is formatted to include a reference to the proxy page along with versioning information . it is a feature of the present invention that part of this format includes the fragment &# 39 ; s version information . in one embodiment , this version information is a version number . in another embodiment , this version information is the date / time that the fragment was last modified . for each url input , at step 308 , it is determined whether the input is dynamic . examples of dynamic url inputs can be represented by the following : while an example of a static url input can be represented by the following : if it is determined at step 308 , that the url input is dynamic , then at step 310 , the fragment &# 39 ; s last modified date is retrieved from the fragment file and used for the version information . this returned version information is then used as an input to the process at step 312 where the fragment url is formatted to include the version information . if it is determined at step 308 , that the url input is static ( i . e . the version is defined by the implementing web application ), then the version information is already available in the url input and the process can proceed directly to formatting step 312 . at step 312 , each fragment url is reformatted by inserting the proxy page and changing the fragment url by appending the version information . in one embodiment , the fragment urls can be placed in the following format where the version information is represented by the time stamp having a format of “ yyyymmddhhmmss .” once formatted , the fragment urls are put into an array on the skeleton page . this skeleton page can then be sent to the client at step 314 . fig4 illustrates a flowchart of a process for rendering a web page based on the skeleton page that is received from the server in cooperation with a client cache . as illustrated , the process begins at step 402 where the client receives the skeleton page that includes the fragment urls . at step 404 , each of the fragment urls that are to be displayed through a frame of the skeleton page is loaded . in general , there can be an unlimited number of frames in a skeleton page . the number of frames is limited only by how much content can logically fit on the skeleton page . moreover , frames can also be nested within other frames . for example , an aspx skeleton page can contain a frame that displays a user control that contains another frame . at step 406 , it is then determined for each of the fragment urls that are sought to be loaded , whether the fragment url exists in client cache 122 . if the fragment url exists in client cache 122 , then , at step 408 , the cached fragment identified by the fragment url is loaded into the frame , a process that can be completed in milliseconds . at this point , it should be noted again that the process of step 406 is based on the caching of individual fragments and not entire web pages . each individual fragment is identified by a url that has been augmented with version information that enables the client to determine whether a fragment identified by the skeleton page has been modified since the last time the client retrieved that skeleton page from the server . for example , if the skeleton page includes the fragment url “ usrctrl1 . htm ? version = 20040802090134 ” having version information reflecting a last modified date of 9 : 01 : 34 am on aug . 2 , 2004 , then the client would determine whether that entire fragment url including the version information was located in the client cache . if that particular fragment url string is located in the client cache , then the fragment would be immediately retrieved from the client cache . if , on the other hand , the same fragment used in the previous visit to that skeleton page had different version information ( e . g ., “ usrctrl1 . htm ? version = 20040730141212 having version information reflecting a last modified date of 2 : 12 : 12 pm on jul . 30 , 2004 ), then the search for the fragment url string “ usrctrl1 . htm ? version = 20040802090134 ” would turn up empty notwithstanding the existence of the previous fragment url string “ usrctrl1 . htm ? version = 20040730141212 ” in the client cache . in effect , this process dictates that outdated fragment urls in the client cache are not used and simply ignored . as far as the client is concerned , the non - existence of the current fragment url in the client cache indicates that a request to the server for the current fragment url is needed to fully render the web page at the client . referring again to fig4 , this process is illustrated , at step 406 , by the determination that the fragment url is not in the client cache . upon this determination , the process would then continue to step 410 where the fragment url is retrieved from the server . details of the process in the server in responding to this fragment url request is described below with reference to the flowchart of fig5 . once the fragment url is retrieved from the server it is displayed in its frame at step 412 , then stored in the client cache at step 414 . in one embodiment , the frame in which a fragment url is displayed is automatically resized to fit the size of the content . this resizing can occur whenever the content within a frame changes , such as , for example , when a plurality of fragments of different size are sequentially displayed within a particular frame . in another scenario , the resizing can occur when content within a nested frame changes . consider for example , a scenario where a particular frame of a skeleton page has a first frame nested within a second frame , which in turn is nested within a third frame . upon display , assume that only the first frame has changed . the client would then retrieve the highest two frame levels ( i . e ., second and third frame ) from the client cache and request the modified first frame from the server . this modified first frame may have a different content size as compared to the previous first frame that was retrieved . upon display of the newly - retrieved first frame , the second frame in which the first frame is nested could then be resized , followed in turn by the resizing of the third frame in which the second frame is nested . in general , the resizing of frames can be implemented to ensure that content can be displayed without cropping ( loss of ) content or the unnecessary or undesirable display of scroll bars . in general , frames often have to be resized because in most cases the length of the frame isn &# 39 ; t known until the frame &# 39 ; s content is rendered on the client computer . fig5 illustrates an embodiment of a resizing process . as illustrated , the resizing process begins when the frame within a parent page has its onload event fired ( triggered ). if the frame includes a plurality of nested frames , then the process would first apply to the inner most frame and would then proceed outward to the outer most frame . on loading of the inner most frame , the process would begin at step 502 where the parent page &# 39 ; s resize method is invoked . next , at step 504 , a search is performed to find a parent frame on the parent page . in one embodiment , the process looks for a frame on the parent page that has the same url as the current page . at step 506 , it is determined whether a parent frame exists . if no parent frame exists , then the frame is not nested within another frame and the resizing process ends . if , on the other hand , it is determined at step 506 that a parent frame exists , then a resize parent method is invoked at step 510 , whereupon a recursive call is made back to step 502 . in one embodiment , the frame is resized to the length of the scrollbar . an implementation of the resize and parentresize methods in javascript is illustrated below . function ppcresize ( frm ) { var theframe = eval ( frm ); var autoheight = eval (‘ aht ’ + frm ); if ( theframe . document . body != null & amp ;& amp ; theframe . document . body . scrollheight & gt ; 0 & amp ;& amp ; theframe . location . host . length & gt ; 0 & amp ;& amp ; autoheight == true ) { document . getelementbyid ( frm ). style . height = theframe . document . body . scrollheight ; ppcresizeparent ( frm ); } return false ; } function ppcresizeparent ( frm ) { var frms = parent . document . all . tags (‘ iframe ’); for ( i = 0 ; i & lt ; frms . length ; i ++) { var srchfor = frms [ i ]. src ; if ( srchfor . length & gt ; 0 & amp ;& amp ; frms [ i ]. name == ‘ avidcache ’ & amp ;& amp ; location . href . indexof ( srchfor ) & gt ; − 1 ) { window . parent . ppcresize ( frms [ i ]. id ); break ; } } } fig6 illustrates a flowchart of a process by which the server responds to a client request for a fragment url that includes version information . in one embodiment , the fragment url request generated by a client includes the proxy page with parameters including the fragment filename and relative path from the proxy page , any fragment parameters , and the version information . the receipt of the fragment url request at the server begins the process at step 602 . at step 604 , the server then retrieves fragment and version information from the server cache . in an embodiment , the server uses the fragment url without the version information as a key into the server cache . in this embodiment , the cache key would be used to retrieve cached data that includes the version information for that particular fragment . here , it should be noted that the use of a cache key without the version information would enable the server to find the fragment in cache regardless of its version . this is in contrast to the client cache search process , which seeks to find only a particular version of a fragment in the client cache . once the version information is retrieved from the server cache , the retrieved version information can then be compared to the version information included in the client &# 39 ; s fragment url request . if , at step 606 , it is determined that the version information matches , then the fragment cached in the server cache can be retrieved and sent to the client at step 608 . if , on the other hand , the version information does not match , then the process continues at step 610 where the fragment page is reconstructed by the server . at step 612 , the reconstructed fragment page then replaces the previously stored fragment in the server cache . finally , at step 614 , the reconstructed fragment page is sent to the client in combination , the processes of fig3 - 6 provide a fragment caching process that enables a client to minimize the amount of content requested from the server . this greatly reduces the bandwidth requirements in rendering a web page , thereby increasing the speed at which a web page can be displayed . further , any reduction in content requested of the server reduces the load required of the server to construct complete web pages and avoids the necessity of having to reconstruct total content for subsequent users . also , versioning keeps client and server cache synchronized with content residing at the server . as noted , one of the significant features of the present invention is the ability to accommodate the separate caching of portions of a web page at the client site . this is in contrast to the caching of entire web pages . as would be appreciated , the principles of the present invention can be applied at various levels of granularity . in particular , it should be noted that the principles of the present invention can be applied at any web page component level that can be individually identified and modified . for example , as noted above , web page images can be individually cached at the client site to thereby ensure that new requests for that figure are only made when a change to that image has been made at the server . in this example , a change to the image would also be reflected by a change in version information in the image &# 39 ; s file name . this filename would then be propagated back to the client by changing the html page to include the image &# 39 ; s changed filename . in - turn , the html version would also change . the client , not finding either the html page or image in it &# 39 ; s cache is then forced to make another request from the server . this is in contrast to conventional methods where if the entire page or fragment containing that image is cached as a whole , then any change in the entire page or fragment ( even those unrelated to the image ) would cause the client to request the entire page or fragment including a second request for the previously downloaded image file . in addition to savings in bandwidth , the principles of the present invention also enable a reduction in ambiguity as to the use of the most recently updated information . conventionally , time - limited cache items represent the only mechanism for controlling the use of outdated cached items . this conventional mechanism , however , provides no insight into whether a particular item to be displayed is outdated . in accordance with the present invention , the use of version information in the skeleton page and the client cache , enables the client to identify immediately whether items stored in the client cache are up to date . if the cached item is outdated , it can be ignored since the cache search for an entry that includes specific version information would turn up empty . as soon as the client detects that the server &# 39 ; s new version of the data is not available at the client , a request is then made to the server . not only does this ensure that only necessary requests are made , but it also ensures that outdated information is never used nor displayed . although the above description may contain specific details , they should not be construed as limiting the claims in any way . other configurations of the described embodiments of the invention are part of the scope of this invention . accordingly , only the appended claims and their legal equivalents should define the invention , rather than any specific examples given . | 6 |
referring to the drawings and , in particular , fig1 there is shown a preferred embodiment of the combination wall and scaffold jack of the present invention generally represented by reference numeral 1 . referring to fig1 jack 1 has a guide member 8 , a floor plate 3 , a ratchet - pawl mechanism 11 , a traveller 50 , and a wall plate 21 . guide member 8 is a square , hollow tube . however , other shapes may alternatively be used , preferably to provide strength to guide member 8 . guide member 8 has a first end 70 and a second end 72 . referring to fig1 and 2 , first end 70 has floor plate 3 pivotally secured thereto . in this preferred embodiment , floor plate 3 is pivotally secured to guide member 8 by pin 4 and cotter pin 5 . however , alternative pivotal mechanisms may also be used . floor plate 3 has a flat plate 43 that is rectangular having a plurality of holes 44 and floor brackets 45 . bolts or screws ( not shown ) may be driven through holes 44 and into the surface of a floor in order to secure flat plate 43 to that surface . floor brackets 45 are centrally located and perpendicular to flat plate 43 . floor brackets 45 are preferably welded to flat plate 43 , but alternative fastening means may also be used , as well as forming floor brackets 45 integrally with flat plate 43 . floor brackets 45 are spaced apart a distance slightly larger than the outer width of guide member 8 so that floor brackets 45 can slide over first end 70 . floor brackets 45 each have holes 7 essentially centrally located and aligned with each other . similarly , first end 70 has holes 9 on opposing sides and aligned with holes 7 . the diameter and alignment of holes 7 and 9 , allow pin 4 to slide through holes 7 and 9 , and lockingly engage cotter pin 5 . thus , floor plate 3 is free to pivot about an axis passing longitudinally through pin 4 . the distance of holes 7 from flat plate 43 is sufficient to allow floor plate 3 to freely pivot . first end 70 also has a stub 6 on outer surface 32 between the sides where holes 9 are located . preferably , stub 6 is welded to guide member 8 . stub 6 perpendicularly extends from guide member 8 and has a ratchet hole 10 centrally located therein . ratchet hole 10 has a diameter that allows ratchet hook 12 to engage with ratchet hole 10 which will be discussed later in further detail . ratchet - pawl mechanism 11 is a ratchet device that provides incremental pulling and is well known in the art . although the preferred embodiment uses ratchet - pawl mechanism 11 to drive combined wall and scaffold jack 1 , it is recognized by a skilled artisan that other driving devices , including pneumatic , hydraulic , or electric may alternatively be used in the present invention . ratchet - pawl mechanism 11 comprises a ratchet hook 12 , a traveller hook 52 , a pulley 15 and a cable 13 . as described above , ratchet hook 12 passes through ratchet hole 10 , securing ratchet - pawl mechanism 11 to first end 70 . cable 13 extends from ratchet - pawl mechanism 11 along outer surface 32 and engages with pulley 15 . pulley 15 is secured to second end 72 of guide member 8 by pulley brackets 16 . preferably , pulley brackets 16 are welded to second end 72 , but alternative securing means may also be used including nut and bolt assembly . at the end of cable 13 is secured traveller hook 52 . traveller hook 52 is removably secured to metal strap 51 which will be discussed later in further detail . referring to fig1 and 4 , traveller 50 comprises a slide tube 53 , a traveller tube 14 , traveller brackets 17 , a t - bolt 20 , and metal strap 51 . slide tube 53 is a square , hollow tube having an inner height and width slightly greater than the outer height and width of guide member 8 , allowing traveller 50 to freely slide along guide member 8 . although in the preferred embodiment slide tube 50 is square and hollow , alternative shapes may also be utilized that allow slide tube 50 to translate along guide member 8 . traveller tube 14 is a tube that perpendicularly extends from the outer surface of slide tube 53 . preferably , traveller tube 14 is square and hollow . traveller tube 14 is also preferably welded to slide tube 53 . traveller tube 14 has holes 18 centrally located on opposing sides . traveller brackets 17 are parallel flat plates that perpendicularly extend from slide tube 53 on the same outer surface as traveller tube 14 . preferably , traveller brackets 17 are welded to slide tube 53 . traveller brackets 17 each have holes 19 that are aligned with each other . holes 19 have a diameter that allows pin 23 to slide therein . slide tube 53 further comprises a threaded hole ( not shown ) centrally located on the opposite outer surface from traveller tube 14 and traveller brackets 17 , that engages with t - bolt 20 . a user can drive t - bolt 20 inward whereby the tip of t - bolt 20 engages outer surface 32 of guide member 8 , serving to lock traveller 50 and prevent its slideable movement along guide member 8 . preferably , t - bolt 20 has a tip with a flat surface to maximize friction and enhance the engagement and locking function of t - bolt 20 . slide tube 53 also comprises a metal strap 51 that engages with traveller hook 52 in order to drive traveller 50 along guide member 8 as a result of the pulling force of ratchet - pawl mechanism 11 . metal strap 51 is secured to slide tube 53 on opposing sides adjacent to outer surface 32 . preferably , metal strap 51 is welded to slide tube 53 . referring to fig1 and 3 , wall plate 21 comprises a flat plate 46 and a post 26 . flat plate 46 is rectangular having a plurality of holes 25 and a lip 48 formed along one side of flat plate 46 . preferably , lip 48 is integrally formed with flat plate 46 . bolts or screws ( not shown ) may be driven through holes 25 and into the surface of a wall in order to secure flat plate 46 to that surface . lip 48 provides a guide for alignment of wall plate 21 with a wall ( not shown ). post 26 is centrally located on flat plate 46 and perpendicularly extends therefrom , in the opposite direction from lip 48 . preferably , post 26 is welded to flat plate 46 , but alternative securing means may be used including post 26 being integrally formed with flat plat 46 . post 26 has a post hole 27 with a diameter that allows pin 23 to slide therethrough . holes 19 and 27 are aligned so that pin 23 can slide therethrough . wall plate 21 is pivotally secured to traveller 50 by positioning post 26 in between traveller brackets 17 ; passing pin 23 through holes 19 and 27 ; and removably locking pin 23 with cotter pin 24 . the distance of hole 27 from flat plate 46 is sufficient to allow wall plate 21 to freely pivot about an axis passing longitudinally through pin 23 to a significant angle without interference between the wall surfaces ( not shown ) and guide member 8 , as the wall is lifted and pivoted . when ratchet - pawl mechanism 11 is used to apply a pulling force upon cable 13 , traveller 50 is pulled along guide member 8 towards pulley 15 . this results in wall plate 21 and the horizontal wall ( not shown ) that has been secured to wall plate 21 , to also advance along guide member 8 . by securing floor plate 3 to a floor but allowing it to pivot , the motion of traveller 50 will elevate the wall to a vertical position while simultaneously elevating jack 1 at an increasing angle . once the wall raising function of jack 1 is performed , the construction project then requires the scaffolding function of jack 1 . referring to fig1 and 6 combined wall and scaffolding jack 1 further comprises a scaffold arm 22 , a wall brace 34 and a brake mechanism 28 . an advantage of the present invention is the interchangeable use of scaffold arm 22 , wall brace 34 and brake mechanism 28 with wall plate 21 , in order to convert jack 1 from functioning as a wall raising system to functioning as a scaffolding system . scaffold arm 22 is a tube having a first end 75 and a second end 77 . preferably , scaffold arm 22 is square and hollow . the inner height and width of scaffold arm 22 is slightly greater than the outer height and width of traveller tube 14 allowing first end 75 to slide over traveller tube 14 . first end 75 has scaffold holes 80 on opposing sides and aligned with each other . the diameter and alignment of holes 18 and 80 allow a pin 30 to pass through the holes and be removably locked by cotter pin 31 . second end 77 of scaffold arm 22 has a scaffold bracket 42 that can securely hold an end of a staging plank ( not shown ) to hoist heavy loads to an elevated position . wall brace 34 comprises a first leg 47 , a second leg 49 , a u - clamp 37 and brace brackets 35 and 36 . first leg 47 has a right - angle shape with a first end 84 , a second end 86 , and a center portion 88 . alternatively , first leg 47 may be of another shape including square , hollow tubing . first end 84 has holes 33 located along first leg 47 on the same side . holes 33 are spaced apart to allow u - clamp 37 to pass through holes 33 . u - clamp 37 has threaded ends 38 and 39 that correspond to bolts 40 and 41 to lock u - clamp 37 through holes 33 and onto leg 47 . u - clamp 37 has an inner width slightly larger than the outer width of guide member 8 so that guide member 8 can be passed within u - clamp 37 and locked to first leg 47 . second end 86 has a brace bracket 35 having holes 55 . preferably , brace bracket 35 is welded to first leg 47 . second leg 49 has a right - angle shape with a first end 90 , a second end 92 , and a brace bracket 36 . alternatively , second leg 49 may be of another shape including square , hollow tubing . first end 90 extends from center portion 88 at about a 45 ° angle to provide support to first leg 47 , but other angles may also be used , preferably to improve strength or provide for a more compact design . preferably , second leg 49 is welded to first leg 47 , but alternative securing means may also be used including integrally forming second leg 49 with first leg 47 . second end 92 has a brace bracket 36 having holes 85 . preferably , brace bracket 36 is welded to second leg 49 . bolts or screws ( not shown ) may be driven through holes 55 and 85 and into the surface of a wall in order to secure wall brace 34 to that surface . referring to fig1 and 6 , brake mechanism 28 can be interchanged for wall plate 21 to pivotally engage traveller 50 . brake mechanism 28 comprises a threaded cylinder 56 , a hex bolt 60 having a distal end 63 , a bearing bracket 57 and a bearing assembly 74 . threaded cylinder 56 has an outer surface 64 from which extends bearing bracket 57 . threaded cylinder 56 has an under surface 62 . threaded cylinder 56 engages with hex bolt 60 having a hex nut 61 such that tightening of hex nut 61 against under surface 62 prevents hex bolt 60 from further advancing through threaded cylinder 56 . bearing bracket 57 comprises a traveller hole 54 and a bearing hole 66 . bearing bracket 57 extends from outer surface 64 at an upward angle and has a length so that bearing assembly 74 extends past traveller 50 . preferably , bearing bracket 57 is welded to threaded cylinder 56 . traveller hole 54 is substantially centrally located in bearing bracket 57 with a diameter slightly larger than the diameter of pin 23 . brake mechanism 28 is pivotally secured to traveller 50 by positioning bearing bracket 57 in between traveller brackets 17 ; aligning holes 19 and 54 ; passing pin 23 through holes 19 and 54 ; and releasably locking pin 23 with cotter pin 24 . bearing hole 66 is located near the end of bearing bracket 57 and pivotally engages bearing assembly 74 . bearing assembly 74 comprises a threaded sleeve 59 , bearings 58 , washers 68 and a bearing bolt 65 . threaded sleeve 59 passes through concentric holes in bearings 58 and washers 68 which are located on opposing sides of bearing bracket 57 , through bearing hole 66 , and threadingly engages with bearing bolt 65 . washers 68 prevent bearings 58 from contacting bearing bracket 57 . thus , bearings 58 are prevented from lateral motion while allowed to rotate . brake mechanism 28 provides a controlled braking for traveller 50 and is an added safety device in the event of failure of cable 13 or ratchet - pawl mechanism 11 . a user can drive hex bolt 60 through threaded cylinder 56 and contact distal end 63 with the bottom surface of traveller 50 . this causes the end of bearing bracket 57 where hex bolt 60 is located , to move away from the bottom surface of traveller 50 . due to the pivotal engagement of brake mechanism 28 to traveller 50 at essentially a central location of bearing bracket 57 acting as a fulcrum , the end of bearing bracket 57 where bearings 58 are located , moves closer to the under side of guide member 8 . this creates a force from bearings 58 onto the under side of guide member 8 . at intermediate levels of force , brake mechanism 28 retards movement of traveller 50 along guide member 8 in the direction of pulley 15 and prevents movement of traveller 50 away from pulley 15 . while at high levels of force , movement of traveller 50 in either direction is prevented . hex nut 61 can be used to lock hex bolt 60 once the desired amount of force is obtained . spacing a plurality of jacks 1 apart along a wall , and supporting them by floor plates 3 secured to a floor and wall braces 34 secured to a wall , jacks 1 function as a scaffolding system . traveller 50 is driven along guide member 8 towards pulley 15 by the pulling force of ratchet - pawl mechanism 11 . thus , scaffold arm 22 is driven upwards and combined wall and scaffolding jack 1 has performed its second function as a scaffolding system . referring to fig7 a method of a construction operation that utilizes wall and scaffolding jack 1 , is shown . the initial step 700 is to attach floor plate 3 to a floor at a location in the proximity of either the pre - assembled wall to be raised or the elevated area that is to be worked on . screws or bolts can be driven through holes 44 into the surface of the floor to secure floor plate 3 . the user then determines whether a wall is required to be raised or whether a scaffolding system is to be used ( step 710 ). if a wall is to be raised then wall plate 21 is installed on traveller 50 , as in step 720 . this is done by positioning post 26 in between traveller brackets 17 ; passing pin 23 through holes 19 and 27 ; and locking pin 23 with cotter pin 24 . the user then attaches wall plate 21 to a pre - assembled wall that is in a substantially horizontal orientation ( step 730 ). this is done by driving screws or bolts through holes 25 into the surface of the wall . the user then cranks ratchet - pawl mechanism 11 so that traveller 50 moves along guide member 8 , as in step 740 . by securing floor plate 3 to the floor but allowing it to pivot about pin 4 , the motion of traveller 50 towards pulley 15 elevates the wall to a vertical position while simultaneously elevating jack 1 at an increasing angle . preferably , this angle is about 45 °. additionally , t - bolt 20 may be driven into outer surface 32 of guide member 8 to lock traveller 50 while the pre - assembled wall is braced by other means . wall plate 21 is then detached from the pre - assembled wall ( step 750 ). wall plate 21 is uninstalled from traveller 50 , as in step 760 . this is done by removing cotter pin 24 from pin 23 and removing pin 23 from holes 19 and 27 . the user next determines if a scaffolding system is required in order to continue working on the raised wall or whether another wall is to be raised , as in step 770 . if another wall is to be raised , floor plate 3 is detached from the floor for re - positioning of jack 1 ( step 780 ). this is done by removing the screws or bolts that were driven through holes 44 into the surface of the floor . if a scaffolding system is required , wall brace 34 , brake mechanism 28 and scaffold arm 22 are installed on to jack 1 ( step 800 ). wall brace 34 is installed by sliding guide member 8 through u - clamp 37 and tightening bolts 40 and 41 to threaded ends 38 and 39 . brake mechanism 28 is installed to traveller 50 by positioning bearing bracket 57 in between traveller brackets 17 ; aligning holes 19 and 54 ; passing pin 23 through holes 19 and 54 ; and locking pin 23 with cotter pin 24 . scaffold arm 22 is installed to traveller 50 by sliding first end 75 over traveller tube 14 ; passing pin 30 through holes 18 and 80 ; and locking pin 30 with cotter pin 31 . wall brace 34 is then attached to a wall ( step 810 ). this is done by driving screws or bolts through holes 55 and 85 . a staging plank ( not shown ) is secured to scaffold bracket 42 to hoist heavy loads to an elevated position , as in step 820 . the user can then adjust braking mechanism 28 in order to apply the appropriate force of bearings 58 to guide member 8 ( step 830 ). this is done by driving hex bolt 60 through threaded cylinder 56 and contacting distal end 63 with the surface of traveller 50 . due to the pivotal engagement of brake mechanism 28 to traveller 50 , this creates a force from bearings 58 onto the under side of guide member 8 . at intermediate levels of force , brake mechanism 28 retards movement of traveller 50 along guide member 8 in the direction of pulley 15 and prevents movement of traveller 50 away from pulley 15 . while at high levels of force , movement of traveller 50 in either direction is prevented . hex nut 61 is then tightened to lock hex bolt 60 once the desired amount of force is obtained . the user then cranks ratchet - pawl mechanism 11 to raise the staging plank ( not shown ) to the desired height , as in step 840 . once a desired height is reached , t - bolt 20 is driven into outer surface 32 of guide member 8 providing a locking mechanism for traveller 50 ( step 850 ). if work must be done at other elevations , the user can repeat the step of raising the staging plank to the next desired height , as in step 860 . if the work has been completed then the user cranks ratchet - pawl mechanism 11 to lower the staging plank , as in step 870 . the staging plank is removed from scaffold bracket 42 ( step 880 ). wall brace 34 is then detached from the wall by removing the screws or bolts through holes 55 and 85 , as in step 890 . the user can then uninstall wall brace 34 , brake mechanism 28 and scaffold arm 22 from jack 1 ( step 900 ). this is done by loosening bolts 40 and 41 and sliding guide member 8 out from under u - clamp 37 ; removing cotter pins 24 and 31 ; and sliding pins 23 and 30 out from their respective holes . the user then detaches floor plate 3 from the floor ( step 910 ). this is done by removing the screws or bolts that were driven through holes 44 into the surface of the floor . the user is then ready to re - position jack 1 and to repeat these steps , as necessary . the present invention having thus been described with particular reference to the preferred forms thereof , it will be obvious that various changes and modifications may be made therein without departing from the spirit and scope of the present invention as defined in the appended claims . | 4 |
the present invention is a passive preloading gripping device that does not rely on applying or maintaining external mechanical force to efficiently initiate or maintain its gripping action on an object . referring now to the drawings , and initially to fig1 and 2 , it is pointed out that like reference characters designate like or similar parts throughout the drawings . the figures , or drawings , are not intended to be to scale . for example , purely for the sake of greater clarity in the drawings , wall thickness and spacing are not dimensioned as they actually exist in the assembled embodiment . fig1 and 2 illustrate a gripping device 10 mounted in a tubular housing 12 . the exterior of tubular housing 12 has an increased diameter at its upper end ( the right side of the drawing ) to accommodate the actuating means for the device and to structurally support mirror image integral ears 13 with through hole lifting eyes 14 provided for handling purposes . first hydraulic actuation port 15 and second hydraulic actuation port 16 are connected to sealed chambers inside the body for selective operation of the mechanism of this device . the description of the internals of gripping device 10 is common to its operating states shown in fig4 , and 6 . referring now to fig3 ( with the bottom of the device 10 on the left ), female thread 18 with a large thread relief extends to downwardly facing lower transverse shoulder 19 . main through bore 20 extends approximately halfway through housing 12 from lower transverse shoulder 19 to upwardly facing small shoulder 21 . first polished counterbore 24 is located above small transverse shoulder 21 . second polished counterbore 25 is located above first counterbore 24 and connected by upwardly looking large transverse shoulder 27 . first hydraulic actuation port 15 intersects second counterbore 25 adjacent large transverse shoulder 27 . second hydraulic actuation port 16 also intersects second counterbore 25 near its upper end . female thread 30 is located at the upper end of housing 12 , where its thread relief is joined to second counterbore 25 by conically tapered transition 31 . annular bottom retainer ring 36 has transverse upper and lower faces and a smooth through bore to clear the outer diameter of any cylindrical objects which will be gripped by this device 10 . male thread 37 on the exterior of bottom retainer ring 36 engages female thread 18 of housing 12 to retain the internals of gripping device 10 on the lower end . spanner holes 38 are provided on the lower face of bottom retainer ring 36 to facilitate assembly . gripper assembly 40 , as seen in fig4 consists of gripper anchor 42 , elastomeric gripper element 44 , and movable gripper end 46 . gripper assembly 40 is positioned within main through bore 20 of device 10 . annular gripper anchor 42 has a smooth through bore the same diameter as that of bottom retainer ring 36 and a transverse lower face 32 provided with multiple spanner holes 39 . gripper anchor 42 has a stepped outer profile with a larger cylindrical surface 33 located below a smaller cylindrical face 35 , said faces being separated by an upwardly facing transverse shoulder 29 . as shown in fig3 the upwardly facing transverse shoulder 29 of gripper anchor 42 abuts lower transverse shoulder 19 of the housing 12 , and the smaller outer cylindrical face 35 of gripper anchor 42 closely fits within main through bore 20 of housing 12 . the upper transverse face 28 of gripper anchor 42 has an optional radiused undercut face groove 57 to provide enhanced bonding for attachment of the elastomer of elastomeric gripper element 44 . the elastomeric gripper element 44 may also have a substance having a high frictional coefficient , such as silica flour , embedded in its inner surface 66 that will comate with the object being gripped . in addition , the elastomeric gripping element may have one or more antiextrusion devices 63 embedded in and bonded to the elastomeric matrix of gripping element 44 to provide the gripping element 44 with increased strength and stability . a preferred embodiment will have more than one antiextrusion devices 63 embedded in the gripping element 44 , with at least one at each end . if only one antiextrusion device is embedded in the gripping element 44 , it would preferably be located at the lower end close to the gripper anchor 42 . the antiextrusion device is further described in copending application entitled antiextrusion device filed feb . 21 , 2001 which is incorporated herein by reference . the inner diameter of such antiextrusion devices would be only slightly more than that of the gripping surface 66 of the gripping element . annular movable gripper end 46 has a groove 22 on its lower transverse face 26 similar to that on the upper transverse face 28 of gripper anchor 42 . the outer cylindrical face of movable gripper end 46 is stepped , with the lower cylindrical face 43 closely fitting to the main through bore 20 of housing 12 and the upper cylindrical face having a reduced diameter male thread 47 with a thread relief a transverse face 23 of movable gripper end 46 connects the lower cylindrical face 43 with the thread relief adjacent male thread 47 , while an upper transverse face 17 connects male thread 47 with the through bore of the part . movable gripper end 46 has the same smooth through bore as that of bottom retainer ring 36 . elastomeric gripper element 44 is molded onto gripper anchor 42 and movable gripper end 46 . the outer diameter of gripper element 44 closely fits to main through bore 20 of housing 12 , while the inner cylindrical face of gripper element 44 is smaller than the minimum size cylinder which will be gripped by this device . transitional tapered lead - ins will connect the inner cylindrical face 66 of gripper element 44 with the bores of the gripper anchor 42 and movable gripper end 46 . at least a tapered lead - in from the gripper anchor 42 to the gripping element 44 should be used to effect a progressive interference fit against a gripped object by the elastomeric gripping element . turning now to fig3 piston 52 has an annular construction and is positioned upwardly from and connected to movable gripper end 46 . piston 52 has a head section 92 which has the largest outer diameter . head section 92 is positioned between first reduced outer diameter section 94 on the lower side of piston 52 and second reduced outer diameter section 96 on the upper end of piston 52 . the head section 92 of piston 52 is a cylindrical surface carrying a male o - ring groove 54 in which o - ring 55 is positioned so that it can seal between piston 52 and second polished counterbore 25 of housing 12 . first reduced outer diameter cylindrical section 94 is sized to slide freely within the first polished counterbore 24 of housing 12 ; male o - ring groove 56 carrying o - ring 57 is positioned intermediately in first reduced outer diameter cylindrical section 94 . second reduced outer diameter cylindrical section 96 of piston 52 has the same diameter as the first section 94 and has a first hydraulic chamber 72 between it and second reduced outer diameter cylindrical section 96 . spanner holes 59 in upper end transverse face 95 permit application of torque to the piston 52 for assembly of the piston to the gripping element 44 . still referring to fig3 piston 52 through bore has the same diameter as bottom retainer ring 36 . lower end transverse face of piston 52 is counterbored and provided with female thread 60 , a thread relief , and a transverse shoulder 91 between the thread relief and the through bore . piston 52 is threadedly connected to movable gripper end 46 by male thread 47 and female thread 60 . annular top retainer ring 62 has a through bore closely mating to the second reduced outer diameter cylindrical section 96 of piston 52 . female o - ring groove 64 carrying o - ring 65 is positioned near the lower end of the through bore of top retainer ring 62 . the upper transverse face 97 of top retainer ring 62 is provided with spanner holes 98 for assembly purposes . male thread 67 is located on the largest outer diameter cylindrical section of top retainer ring 62 adjacent the upper transverse face 97 . male thread 67 is engaged with female thread 30 of housing 12 to retain the internals of the gripper device 10 . below male thread 67 is located second reduced outer diameter cylindrical segment 93 of top retainer ring 62 , with male o - ring groove 68 near its lower end and o - ring 69 positioned therein . the second reduced outer diameter cylindrical segment 93 of top retainer ring 62 closely fits to the second polished bore 25 of housing 12 , so o - ring 69 seals against the second polished bore 25 of housing 12 . the second reduced outer diameter cylindrical segment 93 of top retainer ring 62 is joined to the through bore by a transverse lower face 99 . an annular first hydraulic chamber 72 , accessible through first hydraulic port 15 , is defined between o - rings 55 and 57 , with piston 52 as the chamber inner wall and housing 12 as its outer wall . second hydraulic port 16 intersects second polished counterbore 25 of housing 12 below o - ring 69 on the lower end of top retainer ring 62 . an annular second hydraulic chamber 74 , accessible through second hydraulic port 16 , is defined between o - rings 55 , 65 , and 69 with piston 52 as the chamber inner wall and housing 12 as its outer wall . referring to fig6 a length of pipe 75 is shown inserted within the bore of the gripping device 10 and engaged by gripping element 44 . the gripping device 10 is shown in fig3 in a relaxed , inactivated state . the gripping device in fig3 has no hydraulic pressure applied to piston 52 through either hydraulic port 15 or 16 , so the elastomeric gripping element 44 is untensioned and free to assume its as - molded shape . the as - molded shape of elastomeric gripping element 44 is such that it will , when relaxed , have a substantial interference fit with the smallest cylindrical object which it is designed to grip . the same gripping device 10 is shown in fig5 in its stretched configuration for receiving installation of a cylindrical object such as a pipe into its bore preparatory for gripping said object . normally , the object to be gripped is inserted through the lower end of the gripping device , and during lifting the object will be supported in a manner such that the axis of the gripping device is vertical . the gripping device is typically supported by suitable means , such as lifting cables attached to the lifting eyes 14 when it is being used for gripping . however , it should be noted that the preceding conditions are not requirements . the configuration of fig5 is attained by applying and maintaining hydraulic pressure to hydraulic port 15 and , hence , to chamber 72 in order to cause piston 52 to be forced upwardly ( to the right of the drawings ). when piston 52 is forced upwardly , the elastomer of elastomeric gripping element 44 is stretched , since the gripper anchor 42 is restrained by lower transverse shoulder 19 of housing 12 . the pressure applied to first hydraulic port 15 must be sufficient to cause sufficient stretch in elastomeric gripping element 44 so that its cross - sectional radial thickness will be sufficiently reduced ( i . e ., its inner diameter increased ) at its inner diameter section to eliminate the fit interference of its unstretched state shown in fig3 with the object , such as pipe 75 , to be gripped . fig6 shows gripping device 10 holding a pipe 75 . the pressure in first hydraulic chamber 72 has been released through first hydraulic port 15 , permitting the elastomer of elastomeric gripping element 44 to rebound inwardly and downwardly ( towards the left of the figure ) in an attempt to resume its unstressed as - molded state . because the diameter and ovality of the pipe 75 are controlled by factory tolerances to lie within a known range , the inner diameter of the elastomeric gripping element 44 is deliberately molded sufficiently smaller than the minimum pipe size to ensure an interference fit with the pipe 75 . thus , in the process of attempting to return to its molded shape from its stretched position , the elastomeric gripping element 44 will assume a position such that it conforms to the local contours of the pipe 75 and presses strongly against it in a radial direction to effect a highly preloaded interfacial contact . the elastomer cannot fully rebound with the pipe present , due to the essentially incompressible nature of the elastomer . thus , piston 52 does not fully return to its unloaded position shown in fig3 when the pipe 75 is present . the high interfacial contact stresses of the gripper element 44 on pipe 75 permit the development of proportionately high frictional forces on the same interface , particularly since the elastomer will be selected on the basis of having a high coefficient of friction . the high interfacial frictional forces permit using the clamp as a reliable device to grip the object . if pipe 75 moves downward following initial gripping , the attendant frictional drag on the elastomer forces the elastomer into even more intimate contact with higher interfacial stresses and , hence , better gripping . release of the gripped object is simply accomplished by reapplying pressure to the first hydraulic chamber 72 in order to restretch gripper element 44 and thereby eliminate its interference fit . for long gripper elements , it is possible that excessive friction drag may occur between gripper element 44 and either pipe 75 or the main through bore 20 of housing 12 , thereby interfering with developing adequate compressive forces on the elastomer / pipe interface . it is very simple in such a case to remedy the problem by applying temporary hydraulic pressure to second hydraulic chamber 74 through second hydraulic port 16 and thereby overcome the frictional drag which would otherwise prevent the elastomeric element from fully seating against the pipe . it is not necessary to maintain the hydraulic pressure on second hydraulic chamber 74 to ensure adequate gripping . an alternative or supplemental method of avoiding the frictional drag problem is to slightly taper the inner diameter of the contact surface of gripping element 44 , between the tapered lead - ins , so that the inner diameter of the gripping surface is slightly larger on its upper end . with this modification , the seating of elastomeric gripper element 44 against pipe 75 will proceed progressively upwardly from the bottom to the top , thereby aiding in obtaining proper seating . additionally , downward axial loads from pipe 75 on gripper element 44 during lifting aid in seating the elastomer against the pipe . longer gripper elements may also demonstrate a tendency to ‘ neck down ’ in the middle when subjected to high tensions . this tendency is easily controlled by using integrally bonded rigid intermediate rings 112 which either partially or fully segment the elastomer to radially stiffen the gripping element 44 . such rigid intermediate rings 112 , shown for clarity only in fig5 cannot have outer diameters larger than that of the main through bore 20 of housing 12 nor can their inner diameters be less than the clearance diameter for the gripped cylindrical object . gripping may be enhanced by integrally bonding high friction elements into the elastomeric matrix of the gripping element or laminating a high friction surface material to the internal surface of the elastomeric gripping element 44 . the advantages of this invention accrue primarily from : a ) the molded shape of the elastomeric gripping element allowing the gripping element to be designed to have a non - marring interference fit with a wide range of object sizes and shapes , b ) stretching of the elastomeric gripping element to avoid significant fit interference when the object to be gripped is being inserted into the device 10 , and c ) the ability of the gripping element to attempt to return to its as - molded shape and thereby passively assume a presqueezed condition against its comating object surface simply by releasing the installation tension on the elastomeric gripping element . conventional gripping devices rely upon active elements which are not molded or formed to have an interference fit and are installed with no interference fit but then must be actively compressed to cause interference with their comating surface . prestretching an elastomeric gripper element for its installation adjacent a comating object surface so that its cross - section thickness is reduced permits very high but controllable presqueezes for ensuring reliable gripping . having an elastomeric gripper element which is sized to always assume an interference fit against its comating object surface in attempting to return to its molded shape following stretching ensures that the gripper element will always be sufficiently biased against its comating surface due to the locked - in stresses in the elastomer . this interfacial bias against the gripped object is maintained passively by the tendency of the elastomer to return to its molded , minimal energy shape . thus , the interfacial biasing force of this invention is obtained by a passive means rather than the active means or gravity relied on by current devices . the gripper device described herein is always passively urged ( i . e ., without outside intervention ) to have adequate presqueeze on the object interface in spite of elastomer shrinkage or creep . this maintenance of proper presqueeze with shrinkage or creep is not feasible with conventional elastomeric grippers without actively recompressing the gripping element . recompression of the gripping element is often impractical and the need for recompression is typically unrecognized until it is too late and the gripper has failed during use . furthermore , in contrast to the conventional active elastomeric grippers , the level of presqueeze for the grippers of this invention is controllable by selection of the gripping element &# 39 ; s general geometry , the elastomeric compound from which it is constructed , and the minimum amount of interference fit designed into the gripping device 10 . in contrast , conventional active grippers frequently are overcompressed by installation personnel when presqueeze is applied , with the result that the pipe or other gripped object may be locally necked down in an excessive manner . this situation is particularly difficult to avoid with screws applying the active loading on conventional grippers , even when jack screw torsions are carefully controlled , since screw and elastomer friction are highly variable and unknown . the ability to overcome friction , which resists the gripping element assuming its as - molded condition after release of the installation tension , by means of temporarily hydraulically biasing the actuating piston downwardly to overcome the friction , is another strong advantage of this apparatus . this approach to gripping is applicable to both male and female gripping devices and is applicable to a variety of cross - sectional shapes of the gripped member . for picking up gravity loads , it is preferable for the tensioning of the elastomer to be applied upwardly so that the gravity load will contribute to grip performance . by using a smooth elastomer without aggressively abrasive additives , this type of gripping device will not mar sensitive surfaces . the active surface of the elastomeric gripper element may be mildly ridged or waffled so that water or other problematic materials can be excluded from the heavily preloaded elastomer / comating surface interface and good frictional properties thereby maintained . a particular advantage of this type of gripping device is that it can be designed to grip a wider range of object sizes than a collet type of gripper . additionally , this design is compact , robust , does not require intricate or precision machining , and is inexpensive . the passive gripping device is a much safer approach to handling dangerous objects than the traditional active gripping devices . release of the gripped object is also particularly simple compared to slip - type grippers , which are prone to jamming . it readily may be understood that the gripping device of this invention may be somewhat changed from what is shown for this embodiment without departing from this invention . for instance , the bonding surfaces of the gripper anchor upper end and the movable gripper end can varied from the types shown in the drawings for this invention without exceeding the limits of this invention . similarly , the gripper embodiment can be adapted readily to both planar or near planar or irregularly shaped objects . for instance , a one - sided planar gripper having the basic design characteristics of this device and operated by a conventional hydraulic piston and which entraps a planar object against a static planar surface on its obverse side is consistent with this invention . the gripping device of this invention is not limited to only tubular objects . the gripping device shown in the drawings of this patent can be everted so that the operative features are mounted on a mandrel , rather than in an outer housing , so that a male gripping device is also consistent with the principles of this invention . the stretching of the gripping element also can be performed by wedging , camming , or other suitable means without departing from this invention . multiple hydraulic cylinders or cylinders with arcuate or lunate or unusually shaped pistons can also be used for hydraulic tensioning of the gripping element for installation . these tensioning variations are desirable for semicircular or other irregularly shaped objects . thus , having described several embodiments of the gripping device and its use , it is believed that other modifications , variations , and changes will be suggested to those skilled in the art in view of the description set forth above . it is therefore to be understood that all such variations , modifications , and changes are believed to fall within the scope of the invention as defined in the appended claims . | 5 |
refer now to the drawings wherein depicted elements are , for the sake of clarity , not necessarily shown to scale and wherein like or similar elements are designated by the same reference numeral through the several views . turning to fig4 , an example of a circuit 400 in accordance with a preferred embodiment of the present invention . the circuit 400 is similar in construction to the comparator 100 of fig1 ; however , the unipolar ( nmos ) transistors q 1 and q 2 of fig1 have been replaced by the ambipolar transistors am 1 and am 2 . because of the characteristics ( namely , the i - v characteristics ) of ambipolar transistors am 1 and am 2 , circuit 400 does not function as a comparator . circuit 400 generally can , instead , operate as a frequency doubler or an inverter depending on the value of the reference voltage ref . alternatively , the current minor ( i . e ., pmos transistors q 3 and q 4 ) can be replaced by resistors or biased pmos transistors . in fig5 , an example of the response for operation of circuit 400 ( as a frequency doubler ) can be seen . for this example , the reference voltage ref is set to 0 . 75v , and the input signal in is a triangular wave . initially , as shown , the input signal in is at 0v , meaning that the output signal vout should be at logic high or “ 1 ” ( i . e ., about 1 . 5v ). as the input signal in increases ( increasing the gate - source voltage for transistor am 2 ), the drain current for transistor am 2 decreases , entering the “ valley ” of its i - v curve . when this drain current for transistor am 2 becomes sufficiently low ( at threshold voltage th 1 ), the output signal vout transitions to logic low or “ 0 ” ( i . e ., about 0v ). the output signal vout then remains at logic low until the input signal in becomes sufficiently large enough so that the drain current becomes large enough to allow output signal vout to transition back to logic high or “ 1 ” at threshold voltage th 2 . the output signal vout , then , becomes logic low or “ 0 ” between thresholds th 2 and th 1 as the input signal in decreases from its peak ( i . e ., at about 2 . 0v ) to 0v , producing a square wave as the output signal vout . as shown , reference voltage ref is between the thresholds th 1 and th 2 . additionally , a sine wave may be used to achieve in place of the triangular wave to achieve substantially the same result . moreover , if the input signal in is a square wave ( as shown in fig6 ), the output signal vout is a pulse train signal . if the reference voltage ref is set to logic high ( i . e ., about 1 . 5v ), then the circuit 400 begins to function as an inverter , as shown in fig7 . for this example , when the input signal is logic high or “ 1 ” ( i . e ., about 1 . 5v ), the output signal vout will be logic high or “ 1 ,” similar to fig5 . when the input signal in transitions to logic high or “ 1 ,” the output signal vout becomes logic low or “ 0 ” ( i . e ., about 0v ). thus , by adjusting the reference voltage ref , the frequency doubler can become an inverter . now turning to fig8 , a frequency quadrupler 800 can be seen . as shown , this frequency quadrupler 800 is generally comprised of circuits 400 - 1 and 400 - 2 coupled in series with one another . if the reference voltage ref is set so that each of the circuits 400 - 1 and 400 - 2 can operate as a frequency doubler ( like fig5 and 6 ), then a pulse train signal can be generated from a sine wave or square wave ( as the input signal in ), where the pulse train signal has a frequency that is approximately quadruple the input signal in . an example of this can be seen in fig9 ( where the reference voltage ref is set to about 0 . 75v ). alternatively , if the reference voltage ref is set so that circuits 400 - 1 and 400 - 2 operate as inverters , frequency quadrupler 800 would operate like two inverters coupled in series with one another ( i . e ., delay line ). having thus described the present invention by reference to certain of its preferred embodiments , it is noted that the embodiments disclosed are illustrative rather than limiting in nature and that a wide range of variations , modifications , changes , and substitutions are contemplated in the foregoing disclosure and , in some instances , some features of the present invention may be employed without a corresponding use of the other features . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention . | 7 |
the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . like numbers refer to like elements throughout . each embodiment described and illustrated herein includes its complementary conductivity type embodiment as well . fig1 a is a block diagram of an integrated circuit 101 including a function identification circuit 103 according to the present invention . according to fig1 a , the function identification circuit 103 is electrically connected between a first pad 111 and a second pad 121 . the first and second pads 111 , 121 provide input and / or output to / from the integrated circuit and the circuit 131 . the circuit 131 can perform a plurality of functions one of which may be selected . for example , the function of the circuit 131 may be selected by severing a fuse during a manufacturing process . the function identification circuit 103 operates in a plurality of modes which correspond to the plurality of functions performed by the circuit 131 . moreover , the operating modes of function identification circuit 103 are selected to correspond to the functions performed by the circuit 131 . in particular , a series of predetermined voltages may be chosen , each of which corresponds to a function performed by the circuit 131 . the predetermined voltages are applied between the first and second pads 111 , 121 and the resulting current observed for each voltage applied . the predetermined voltage that results in current flow identifies the function performed by the circuit 131 . fig1 b is a schematic diagram of a first embodiment of a function identification circuit 103 according to the present invention . in particular , the function identification circuit 103 comprises a load circuit 140 , including a plurality of current circuits 141 - 144 , and a plurality selection circuits 151 - 153 . the plurality of current circuits 141 - 144 are electrically connected in series between the first and second pads 111 , 121 . each of the current circuits 141 - 144 functions as a diode that is forward biased by applying a voltage difference across the anode and cathode of the diode . as shown in fig1 b , each current circuit can be a field effect transistor ( fet ) 161 - 164 that includes a source node , a gate node , and a drain node , such as pmos transistor , wherein the gate node and the drain node are electrically connected . accordingly , the transistor functions as a diode as described above , wherein the gate / drain node corresponds to the cathode and the source node corresponds to the anode . consequently , the transistor will conduct current if the voltage applied at the source node exceeds the voltage applied at the gate / drain node by a corresponding bias voltage . the current circuits 141 - 144 are electrically connected in series between the first and second pads 111 , 121 . in particular , the source node of the first current circuit 141 is electrically connected to the first pad 111 . the gate / drain node of the first current circuit 141 is electrically connected to the source node of the second current circuit 142 . the gate / drain node of the second current circuit 142 is electrically connected to the source node of the third current circuit 143 . the gate / drain node of the fourth current circuit is electrically connected to the second pad 121 . when a voltage difference is applied between the first and second pads 111 , 121 a current will flow if the voltage at the first pad 111 exceeds the voltage at the second pad 121 by at least the sum of the voltage drops required to forward bias each of the current circuits electrically connected between the first and second pads 111 , 121 . in addition , the voltage applied between the first and second pads 111 , 121 may be in excess of the power supply voltage for the integrated circuit 101 . for exemplary purposes , the forward bias voltage for the current circuits described herein is equal to about 0 . 7 volts ( v ) and the power supply voltage is equal to about 3 . 3v . the plurality of selection circuits 151 - 153 are electrically connected to the plurality of current circuits 141 - 144 and select which of the plurality of current circuits 141 - 144 is electrically connected between the first and second pads 111 , 121 . in particular , each selection circuit includes a primary node and a secondary node . when the selection circuit is activated , current may flow between the primary and secondary nodes . if the selection circuit is deactivated , no current will flow between the primary and secondary nodes . the selection circuit can be a fuse that is severed to deactivate the selection circuit or left intact to activate the selection circuit . a primary node of the first selection circuit 153 is electrically connected to gate / drain node of the first current circuit 141 . a secondary node of the first selection circuit 153 is electrically connected to the second pad 121 . a primary node of the second selection circuit 152 is electrically connected to gate / drain node of the second current circuit 142 and a secondary node of the second selection circuit 152 is electrically connected to the second pad 121 . a primary node of the third selection circuit 151 is electrically connected to the gate / drain node of the third current circuit 144 and a secondary node of the third current circuit 144 is electrically connected to the second pad 121 . according to fig1 b , the function identification circuit 103 operates in four modes . in a first mode of operation , the first selection circuit 153 is activated . consequently , if the voltage applied between the first and second pads 111 , 121 exceeds about 4 . 0v , current will flow from the first pad 111 through the first current circuit 141 , through the first selection circuit 153 to the second pad 121 . the function performed by the circuit 131 may thereby be identified . in a second mode of operation , the second selection circuit 152 is activated and the first selection circuit 153 is deactivated . consequently , if the voltage applied between the first and second pads 111 , 121 exceeds about 4 . 7v , current will flow from the first pad 111 through the first and second current circuits 141 , 142 , through the second selection circuit 152 to the second pad 121 . the function performed by the circuit 131 may thereby be identified . in a third mode of operation , the third selection circuit 151 is activated and the first and second selection circuits 153 , 152 are deactivated . consequently , if the voltage applied between the first and second pads 111 , 121 exceeds about 5 . 4v , current will flow from the first pad 111 through the first , second , and third current circuits 141 - 143 , through the third selection circuit 151 to the second pad 121 . the function performed by the circuit 131 may thereby be identified . in a fourth mode of operation , the first through fourth selection circuits 151 - 153 are deactivated . consequently , if the voltage applied between the first and second pads 111 , 121 exceeds about 6 . 1v , current will flow from the first pad 111 through the first through the fourth current circuits 141 - 144 , to the second pad 121 . the function performed by the circuit 131 may thereby be identified . alternately , the identification circuit 103 may provide the same operating modes described above if the third selection circuit 151 is electrically connected in parallel with the third current circuit 143 , and if the second selection circuit 152 is electrically connected in parallel with the second and third current circuits 142 , 143 , and the first selection circuit 153 is electrically connected in parallel with the first through the third current circuits 141 - 143 . the term parallel as used herein includes an electrical connection wherein the primary node of the selection circuit is electrically connected to the source node of the corresponding current circuit and the secondary node of the selection circuit is electrically connected to the gate / drain node of the current circuit . fig2 is a schematic diagram of a second embodiment of a function identification circuit 103 according to the present invention . according to fig2 the first through the fourth current circuits 141 - 144 are electrically connected in series between the first and second pads 111 , 121 as described above . a primary node of a first selection circuit 253 is electrically connected to a gate / drain node of the first current circuit 141 and a secondary node of the first selection circuit 253 is electrically connected to the gate / drain node of the second current circuit 142 . a primary node of a second selection circuit 252 is electrically connected to the gate / drain node of the second current circuit 142 and a secondary node of the second selection circuit 252 is electrically connected to the drain / gate node of the third current circuit 143 . a primary node of a third selection circuit 251 is electrically connected to the gate / drain node of the third current circuit 143 and a secondary node of the third selection circuit 251 is electrically connected to the second pad 121 . as shown in fig2 the function identification circuit 103 operates in four modes . in a first mode of operation , the first selection circuit 253 is activated and the second and third selection circuits are deactivated . consequently , if the voltage applied between the first and second pads 111 , 121 exceeds about 5 . 4v , current will flow from the first pad 111 through the first current circuit 141 , through the first selection circuit 253 , through the third and fourth current circuits 143 , 144 to the second pad 121 . the function performed by the circuit 131 may thereby be identified . in a second mode , the first and second selection circuits 253 , 252 are activated and the third selection circuit 251 is deactivated . consequently , if the voltage applied between the first and second pads 111 , 121 exceeds about 4 . 7v , current will flow from the first pad 111 through the first current circuit 141 , through the first and second selection circuits 253 , 252 , through fourth current circuit 144 to the second pad 121 . the function performed by the circuit 131 may thereby be identified . in a third mode , the first through the third selection circuits are activated . consequently , if the voltage applied between the first and second pads 111 , 121 exceeds about 4 . 0v , current will flow from the first pad 111 through the first current circuit 141 , through the first through the third selection circuits 253 - 251 to the second pad 121 . the function performed by the circuit 131 may thereby be identified . in a fourth mode , the first through the third selection circuits 253 - 251 are deactivated . consequently , if the voltage applied between the first and second pads 111 , 121 exceeds about 6 . 1v , current will flow from the first pad 111 through the first through the fourth current circuits 141 - 144 to the second pad 121 . the function performed by the circuit 131 may thereby be identified . fig3 is a schematic diagram of a third embodiment of a function identification circuit 103 according to the present invention . according to fig3 the first through the fourth current circuits 141 - 144 are electrically connected in series between the first and second pads 111 , 121 as described above . a primary node of a first selection circuit 353 is electrically connected to the gate / drain node of the first current circuit 144 and a secondary node of the first selection circuit 353 is electrically connected to the second pad 121 . a primary node of a second selection circuit 352 is electrically connected to gate / drain node of the second current circuit 142 and a secondary node of the second selection circuit 352 is electrically connected to the gate / drain node of the third current circuit 143 . a primary node of a third selection circuit 351 is electrically connected to gate / drain node of the third current circuit 143 and a secondary node of the third selection circuit 351 is electrically connected to the second pad 121 . as shown in fig3 the function identification circuit 103 operates in four modes . in a first mode of operation , the first selection circuit 353 is activated . consequently , if the voltage applied between the first and second pads 111 , 121 exceeds about 4 . 0v , current will flow from the first pad 111 through the first current circuit 141 , through the first selection circuit 353 to the second pad 121 . the function performed by the circuit 131 may thereby be identified . in a second mode of operation , the second selection circuit 352 is activated and the first and third selection circuits 353 , 351 are deactivated . consequently , if the voltage applied between the first and second pads 111 , 121 exceeds about 5 . 4v , current will flow from the first pad 111 through the first and second current circuits 141 , 142 , through the second selection circuit 352 , through the fourth current circuit 144 to the second pad 121 . alternately , the third selection circuit 351 may be activated and the second selection deactivated to provide the same mode of operation described above . the function performed by the circuit 131 may thereby be identified . in a third mode of operation , all of the selection circuits 353 - 351 are deactivated . consequently , if the voltage applied between the first and second pads 111 , 121 exceeds about 6 . 1v , current will flow from the first pad 111 through the first through the fourth current circuits 141 - 144 to the second pad 121 . the function performed by the circuit 131 may thereby be identified . in a fourth mode of operation , the second and third selection circuits 352 , 351 are activated and the first selection circuit 353 is deactivated . consequently , if the voltage applied between the first and second pads 111 , 121 exceeds about 4 . 7v , current will flow from the first pad 111 through the first and second current circuits 141 , 142 , through the second and third selection circuits 352 , 351 to the second pad 121 . the function performed by the circuit 131 may thereby be identified . the identification circuit 103 may provide the same operating modes described above if the first selection circuit 353 is electrically connected in parallel with the second through the fourth current circuits 142 - 144 , and the second selection circuit 352 is electrically connected in parallel with the second current circuit 142 , and the third selection circuit 351 is electrically connected in parallel with the third current circuit 143 . the identification circuit 103 may also provide the same operating modes described above if the first selection circuit 353 is electrically connected in parallel with the second through the fourth current circuits 142 - 144 , and the second selection circuit 352 is electrically connected in parallel with the first current circuit 141 , and the third selection circuit 351 is electrically connected in parallel with the second current circuit 142 . furthermore , the identification circuit 103 may provide the same operating modes described above if the first selection circuit 353 is electrically connected in parallel with the first through the third current circuits 141 - 143 , and the second selection circuit 352 is electrically connected in parallel with the first current circuit 141 , and the third selection circuit 351 is electrically connected in parallel with the second current circuit 142 . fig4 is a schematic diagram of a fourth embodiment of a function identification circuit 103 according to the present invention . according to fig4 the first through the fourth current circuits 141 - 144 are electrically connected in series between the first and second pads 111 , 121 as described above and may be nmos transistors 461 - 464 . according to fig4 a primary node of a first selection circuit 453 is electrically connected to the first pad 111 and a secondary node of the first selection circuit 453 is electrically connected to the gate / drain node of the first current circuit 144 . a primary node of a second selection circuit 452 is electrically connected to the gate / drain node of first current circuit 141 and a secondary node of the second selection circuit 452 is electrically connected to the gate / drain node of the second current circuit 142 . a primary node of a third selection circuit 451 is electrically connected to the gate / drain node of second current circuit 142 and a secondary node of the second selection circuit 451 is electrically connected to the gate / drain node of the third current circuit 143 . as shown in fig4 the function identification circuit 103 operates in four modes . in particular , the four operating modes associated with the embodiment in fig4 are analogous to the operating modes described above in conjunction with fig2 . fig5 is a flowchart illustrating operations of a function identification circuit according to the present invention . during a manufacturing process , a number of selection circuits , described herein , may be activated to identify the function performed by the circuit 131 ( block 501 ). the activated selection circuits may reduce the voltage difference required between the first and second pads to cause a current to flow into the integrated circuit . a series of predetermined voltages may be applied between the first and second pads of the integrated circuit . a current flow may be detected as a result of one of the applied predetermined voltages . the applied predetermined voltage which causes the current flow may be used to determine which selection circuits are activated , thereby determining the function performed by the circuit ( block 511 ). in the drawings and specification , there have been disclosed typical preferred embodiments of the invention and , although specific terms are employed , they are used in a generic and descriptive sense only and not for purposes of limitation , the scope of the invention being set forth in the following claims . | 7 |
referring to fig1 and fig2 the pertinent elements of the apparatus 10 are schematically shown supported on a base of 12 . the unmixed components of the alternate liquid fuel are transmitted in the direction of the arrows in fig1 from fuel storage tank 60 through a filter 14 . the filter may be composed of either single or duplex twin basket , metal strainers through which the components flow thereby removing unwanted particles from the fuel components . after the basket strainer is filled with unwanted residuum it is simply removed , cleaned and replaced . if the filter is a single basket strainer the flow of the components must be interrupted but if the filter is a twin basket strainer the strainer may be cleaned without interruption of the flow of the alternate liquid fuel components . a magnetic insert element may be placed in the suction line to remove metal particles small enough to escape through the strainer . pressure drop across the strainer is measured via gauge ( s ) 15 and 16 to assist in determining whether the strainer needs cleaning . after passing through strainer element 14 , the fuel components may be routed through a heat exchanger 20 by using control valves 18 . an operator can determine whether or not the fuel components should be passed through heat exchanger 20 by comparing the pressure and temperature of the components as indicated on pressure gauges 16 , 42 and 44 and temperature gauge 40 with predetermined optimum mixing parameters which depend on the components being mixed . the fuel components are transmitted through the entire apparatus by means of a positive displacement liquid pump 38 which has a power source 30 . in one embodiment of the invention the power source 30 is a variable speed electric motor and in another an internal combustion engine . the power source 30 has a control panel 32 and transmits power to the fuel pump 30 by means of clutch and reduction gear assembly 34 and a torque limiter 36 . the torque limiter 36 protects the power source from overload by slipping when the torque demand exceeds a preset value as a result of shock loads , overloads , etc . due to the varied consistencies and unrefined quantity of many of the alternate liquid fuel components , such changing load conditions which require some type of protective device may be encountered . the final stage of the apparatus is the synthesizing stage 52 comprised static mixers 48 ( and 50 if needed ) which are well known in the industry and have a series of baffles and orifices through which the fluids to be mixed are pumped . the fluids are mixed by the sheer forces and turbulence developed by passage of the fluid through the static mixer . pressure gagues 44 and 46 are provided for the operator to maintain vigilance over a constant flow of the components through the mixing stage 52 . check valve 54 is provided to prevent back flow of the mixed alternate liquid fuel as it reenters storage tank 60 . in a preferred embodiment of the invention the power source 30 for the pump 38 is an internal combustion engine having an optional weather closure and fuel tank 31 . there is also provided a means 25 for piping the hot exhaust gases from the internal combustion engine exhaust 28 to the heat exchanger 20 . the exhaust gases are then ultimately released to the atmosphere through heat exchanger exhaust outlet 22 . the means for piping the hot exhaust gases to the heat exchanger is equipped with a temperature gauge 24 by which the operator may monitor the exhaust temperature . when the heat exchanger 20 is not being utilized , the exhaust gases may be directed into the atmosphere before passing through the heat exchanger by means of a bypass control 26 . the arrow before the stainer 14 represents the introduction of the alternate liquid fuel components into the apparatus of the invention from the outlet port preferably arranged near the bottom of a storage tank . the continuation of the transmission line after the check valve 54 is where the processed alternate liquid fuel exits the apparatus and enters the storage tank preferably near the top of the tank . the arrangement of the elements of the invention in the figure is an example of how the invention may be used in connection with the storage tank which contains the alternate liquid fuel . the apparatus of the invention is operated after the fuel components are placed in a storage tank . the apparatus circulates , filters , heats , and mixes fuel components until a homogeneous mixture is achieved . the necessary time will vary according to the compatibility of the fuel components and the capacity of the pump and the volume of fuel components . mixture is terminated when uniform fuel samples are obtained from the top and bottom of the storage tank . while there has been described what is believed to be the preferred embodiment of the invention , those skilled in the art will realize that changes and modifications may be made thereto without departing from the spirit of the invention , and it is intended to claim all such changes and modifications as fall within the true scope of the invention . | 8 |
fig1 and 2 depict detecting apparatus 11 of the present invention , which apparatus comprises an elongated housing 12 of suitable material , such as copper or aluminum , having an air passage 13 therein . air passage 13 extends between an air inlet 14 , at one end of the housing 12 , and which may comprise a plurality of elongated slots , as shown , and an air outlet at the other end of the housing , which also may comprise a plurality of elongated slots . suitable means , symbolically depicted by a fan 17 , are provided for creating an air flow through passage 13 from inlet 14 to outlet 16 . the means 17 may be a fan or an air pump , or it may be means for heating the housing 12 to create a convective air flow between the inlet and the outlet with the housing oriented uprightly . a first mos sensor 18 is mounted to a member 19 of insulating material which in turn is mounted in housing 12 in the vicinity of air inlet 14 so that sensor 18 extends into passage 13 . electrical leads 21 and 22 extend from sensor 18 through member 19 and are connected to suitable signal evaluation circuitry and voltage sources , as will be discussed hereinafter . in like manner , a second mos sensor 23 is mounted in an insulating member 24 through which leads 26 and 27 extend . housing 12 is provided with a bore 28 located approximately midway between sensors 18 and 23 into which an absorber module or cartridge 29 is fitted . cartridge 29 comprises a hollow absorber containing member 31 having slots 32 in the walls thereof to allow for a continuous flow of air in passage 13 , and an integral cap 33 . cartridge or module 29 may be of any suitable material , such as plastic or metal . member 31 is filled with an absorbent material 34 for removing ammonia from the air flowing in passage 13 , which may comprise a non volatile acid , such as phosphoric acid , supported upon a bed of granular , porous material . in fig3 there is shown a schematic diagram of the sensors 18 and 23 coupled to signal evaluation circuit means for generating an output signal indicative of the amount of ammonia pollutant in the ambient air . a heating circuit for heating sensors 23 and 18 comprises heaters 36 and 37 connected in series between a voltage source vt and ground for maintaining sensors 23 and 18 at an elevated temperature . the elevated temperature is such that any changes in ambient temperature constitute only very small percentages of the total sensor temperature , and thus the effect on the sensors of such changes is minimal . what little effect there is affects both sensors equally , which , as will be understood from the following description , insures that a balance between the sensors is maintained . sensor 23 is connected between voltage source v t and the negative input terminal 38 of an operational amplifier 39 , the positive input terminal 41 of which is connected to ground . amplifier 39 , in this configuration , functions as a current to voltage converter . a calibrating potentiometer 42 is connected between output terminal 43 of amplifier 39 and input terminal 38 . in the same manner , the output of sensor 18 is applied to the negative input terminal 44 of operational amplifier 46 , the positive input terminal 47 of which is connected to ground . a resistor 48 , which may be adjustable , is connected between the output terminal 49 of amplifier 46 and input terminal 44 . amplifier 46 also functions as a current to voltage converter in the same manner as amplifier 39 . the output terminal 43 of amplifier 39 is connected to a first input terminal 51 of a differential amplifier 52 , and the output terminal 49 is connected to a second input terminal 53 . the output terminal 54 of amplifier 52 is connected to an input terminal 56 of a signal amplifier 57 , the other input terminal 58 of which is connected to ground . connected between the output terminal 59 of amplifier 57 and signal input terminal 56 is a gain adjusting potentiometer 61 . the detecting apparatus 11 of fig1 and 2 and the circuit of fig3 may be constructed as a single unitary structure , although the circuit of fig3 is simply an example of a signal processing circuit for the apparatus 11 . it is , of course , possible to use other circuit configurations which respond to the operation and output of the apparatus 11 . where the apparatus 11 is introduced into an environment where it is desired to monitor the amount of pollution such as ammonia gas in the air , its operation to be described hereinafter will be little effected by temperature and humidity changes , inasmuch as both sensors 18 and 23 will be affected equally . the circuitry of fig3 is preferably calibrated and adjusted to produce zero signal output where non - polluted air is directed through passage 13 . ambient air is directed into apparatus 11 through input 14 , and flows along passage 13 past sensor 18 , which , in the presence of a polluting gas , responds to generate an output by virtue of the pollutant induced reduction in its resistance . the air stream then passes through slotted member 31 of cartridge 29 , the absorbent material 34 therein acting to remove ammonia from the airstream . the air stream then flows past sensor 23 , which , because the ammonia is now largely absent from the flowing air , undergoes a lesser reduction in resistance than does sensor 18 , thereby generating a signal that differs from the signal generated by sensor 18 . the signals thus generated are compared in the circuit of fig3 and the difference between them , which is a measure of the amount of ammonia gas in the air entering apparatus 11 , is amplified and applied to a suitable control system , such as that shown in the aforementioned application ser . no . 202 , 557 of ball , to control as by reducing the level of ammonia in the air . as pointed out before , mos sensors react to a number of different gases , such as methane , ethane , propane , carbon monoxide , and other organic gases , as well as to ammonia . any of these other gases present in the air flowing through apparatus 11 will affect sensors 18 and 23 in the same way and to the same degree but will not be absorbed by the ammonia absorbent material 34 . hence , their presence will not result in an output signal being generated . on the other hand , if the conditions of the environment are such that , in addition to ammonia , one or more of these other pollutants may be present in toxic amounts , the absorbing material 34 can be had to include absorbent material for such other gases as well . in that event control signals are produced which are indicative of the amounts of both gases . as yet another alternative , the absorbent material may be only that which absorbs gases other than ammonia . from the foregoing it can be appreciated that the present invention retains the desirable features of both mos and electrochemical sensors , without their disadvantages , in the reliable detection of the amount of ammonia gas in the ambient air . only one preferred embodiment of the invention has been shown , but it should be understood that numerous modifications , additions , and deletions may occur to workers in the art without departure from the spirit and scope of the invention . | 8 |
referring to the figures , a light source device ( hereinafter device 10 ) of the present invention is shown . the device 10 may be attached to any fire hose / nozzle as will be described below . the device 10 may provide future generations of fire fighters with a means that attaches to fire nozzles and fire hose couplings that may allow fire fighters to advance hose lines into structure fires , wild land fires , vehicle fires , hazardous material environments , and other hazardous situations without the necessity of these fire fighters assuming the burden of carrying hand held flashlights on their person . the device 10 may further provide visual indicators about current operating conditions for the firefighters as will be discussed below . the device 10 may be configured to securely fit between a fire nozzle 60 and fire hose coupling 62 . alternatively , the device 10 may be positioned between two fire hose couplings 62 . the device 10 is designed to not impede the flow of extinguishing agent or to be obstructive when moved around the fire ground when the device 10 is positioned between the fire nozzle 60 and fire hose coupling 62 or between two fire hose couplings 62 . the device 10 may have a housing 12 . the housing 12 may be used to store and house a plurality of lighting fixtures 14 . the lighting fixtures 14 may be used to illuminate the fire ground and guide the fire fighter as he / she advances the hose lines . the housing 12 may further be used to store and house one or more visual indicators 16 . the visual indicators 16 may be used to provide warnings to the firefighters about current operating conditions . the housing 12 may be constructed of a material that is lightweight , durable , heat resistant , cold resistant , water resistant , and able to function flawlessly in the demanding environments occupied by fire fighters in the course of their work . the housing 12 may be formed of different geometric shapes . in the present embodiment , the housing 12 is circular in shape . a circular shape housing 12 may provide the least amount of resistance when moving the fire house with the device attached . however , the circular shape is shown as one embodiment , and should not be seen in a limiting manner . the housing 12 may be comprised of a front plate 18 . a side wall 20 may be formed around a perimeter of the front plate 18 . the side wall 20 may be formed to extend up from the front plate 18 there by forming a hollow interior section 22 of the housing 12 . the interior section 22 may be used to store and house the plurality of lighting fixtures 14 as well as electronics for one or more visual indicators 16 . one or more light openings 24 may be formed through the front plate 18 . the light openings 24 may be formed around the perimeter of the front plate 18 . the light openings 24 may be used to position the one or more lighting fixtures 14 within the housing 12 . one or more light slots 26 may also be formed within the side wall 20 . the one or more light slots 26 may be formed next to and adjacent a corresponding light opening 24 . the light slots 26 may be used to allow easy removal of a corresponding lighting fixture 14 . a lighting fixture plate 28 may be positioned within each light slot 26 to secure the lighting fixture 14 within the light slot 26 and corresponding light opening 24 . the lighting fixture plate 28 may be designed to be pressure fitted within the light slots 26 . thus , by applying pressure to the lighting fixture plate 28 , one may be able to release the lighting fixture plate 28 from within the light slots 26 , thereby allowing one to remove the corresponding lighting fixture 14 . as stated above , a plurality of lighting fixtures 14 are positioned within the housing 12 . as shown in the figures , each lighting fixture 14 may be comprised of a light source unit 32 . each light source unit 32 may be a high - intensity , led lighting fixture that may be able to illuminate the fire ground and guide the fire fighter as he / she advances hose lines . a lens 34 may be positioned in front of each light source unit 32 . the lens 34 may be used to focus and / or direct the light from the light source unit 32 . the lens 34 may also be used to protect the light source unit 32 . a lens housing 36 may be used to secure the lens 34 in front of each light source unit 32 . a plate member 38 may be used to secure the lighting fixture 14 within the interior section 22 of the housing 12 . the housing 12 may have a cover 40 . the cover 40 may be positioned over the interior section 22 of the housing 12 . thus , the cover 40 may be used to enclose the housing 12 . a locking plate 42 may be used to secure the cover 40 to the housing 12 . the locking plate 42 may have one or more securing members 44 . the securing members 44 may be used to secure the cover 40 to the housing 12 . in accordance with one embodiment , the securing members 44 may be a plurality of screws 44 a . as shown in the figures , one or more openings 46 may be formed around an outer perimeter of the locking plate 42 . each opening 46 may be aligned with a corresponding channel 48 formed on the housing 12 . each channel 48 may be formed on the side wall 20 . each channel 48 may be threaded so as to engage a corresponding screw 44 a . the front plate 18 , the plate member 38 , the cover 40 , and locking plate 42 may each have a central opening 30 a , 30 b , 30 c and 30 d respectively , formed there through . the central openings 30 a , 30 b , 30 c and 30 d may be used to allow the extinguishing agent to enter and flow through the housing 12 . a pipe 50 may be positioned through the housing 12 . the pipe 50 may be used to allow the extinguishing agent to pass through the housing 12 . in accordance with the embodiment depicted in the figures , the pipe 50 may be positioned through the central openings 30 a , 30 b , 30 c and 30 d formed through the front plate 18 , the plate member 38 , the cover 40 , and locking plate 42 respectively . the pipe 50 may be used to allow the extinguishing agent to enter and flow through the housing 12 . the pipe 50 is designed to not impede the flow of extinguishing agent or to be obstructive when moved around the fire ground when the device 10 is positioned between the fire nozzle 60 and fire hose coupling 62 or between two fire hose couplings 62 . the pipe 50 may have a coupling 52 located on each end . the coupling 52 may be used to connect the pipe 50 between the fire nozzle 60 and fire hose coupling 62 or between two fire hose couplings 62 . the coupling 52 may be a threaded end 52 a , a threaded hose coupling 52 b , or the like . the above is given as an example and should not be seen in a limiting manner . other couplings may be used without departing from the spirit and scope of the present invention . the pipe 50 may further have a pair of ring members 72 . a ring member 72 may be positioned on each end of the pipe 50 . the ring members 72 may be used to secure the pipe 50 within the housing 12 . the housing 12 may have one or more contacts 56 . the contacts 56 may be used to secure a power supply 54 to the housing 12 . the power supply 54 may be used to power electronic circuitry 70 stored within the housing 12 . the power supply 54 is interchangeable so that a current power supply 54 may be removed , and a fully charged power supply attached to the contacts 56 . the power supply 54 may also be a rechargeable power supply . the figures show one embodiment of the power supply 54 . as may be seen in the figures , the power supply 54 may have a battery unit 80 . the battery unit 80 may be used to supply a dc power source to the electronic circuitry 70 . the battery unit 80 may have a contact board 82 attached thereto . one or more securing devices 76 may be used to secure the contact board 82 to the battery unit 80 . the contact board 82 may be used to attach a battery contact 84 to the battery unit 80 . the battery contact 84 may be used to attach the power supply 54 to contacts 56 . this may allow the power supply 54 to attach to the electronic circuitry 70 . when in use , the battery contact 84 may contact the contacts 56 to secure the power supply 54 to the housing 12 and to the electronic circuitry 70 . the battery unit 80 may be stored within a battery housing 88 . a lid 90 may be attached to the battery housing 88 thereby enclosing the battery unit 80 within the battery housing 88 . in accordance with one embodiment , the battery unit 80 is a rechargeable battery unit . one or more charging pins 92 may be coupled to one of the battery contacts 84 . this may allow the charging pins to attach to a charging plug 94 of a recharging unit 92 . one or more alignment pins 90 may be formed on the battery housing 88 . the alignment pins 90 may be used to align the power supply 54 onto a recharging unit 92 having corresponding alignment pins 96 . the housing 12 may store electronic circuitry 70 . the electronic circuitry 70 may be positioned within the interior section 22 of the housing 12 . the electronic circuitry 70 may be capable of connecting and operating a myriad of simple systems that perform functions essential to fire fighter safety . a switch 58 may be coupled to the power supply 54 . the switch 58 may be used to activate and deactivate the electronic circuitry 70 . the switch 58 may be located on the exterior of the housing 12 . the switch 58 may be programmed to “ turn on ” with a 0 . 5 second engagement and “ turned off ” with a 3 . 0 second engagement to avoid any inadvertent termination of the electronic circuitry 70 during operation . the switch 58 may further double as a “ cap ” ( conditions , air , people ) elapsed time warning light . fire fighters are taught that 10 minutes of flame impingement on building structural components seriously effect construction integrity and pose serious collapse hazards to fire fighters inside structure . the switch 58 may be an illuminating switch . when activated , the switch 58 may automatically initiate a timer 100 . the switch 58 may appear “ green ” advising fire fighters that they have been inside the “ hot zone ” for less than 10 minutes . at 10 minutes the switch 54 will begin blinking “ red ”. this will remind fire fighters to address their tactical priorities : ( 2 ) air : check the available air in you and your crew &# 39 ; s scba bottles . ( 3 ) people : know the location and condition of all your assigned members . and begin to plan their egress from the structure . at 15 minutes the blinking “ red ” will become a solid “ red ”. this will provide a “ fire fighter off line / mayday ” safety feature that will keep the device illuminated to act as a beacon for fire fighters attempting to find the hand line in low visibility environments or locate lost / incapacitated fire fighters . the light function on the switch 56 can again be illuminated by engaging the switch 58 for 0 . 5 second . one of the functions of the electronic circuitry may be to provide a high - intensity , led lighting system able to illuminate the fire ground and guide the fire fighter as he / she advances hose lines . thus , the lighting fixtures 14 are generally coupled to the power supply 54 . the lighting fixtures 14 may be programmed to automatically turn off at 15 minutes to save on the life of the power supply 54 should the nozzle be unattended and acts as a timer for work cycles . whether inside a structure , outside on a wild land fire , or on the scene of an auto accident the lighting fixtures 14 may have a minimum of two settings , high / low . the choice of light intensity will not affect the light timing as it is independent of the fire fighter choice of light intensity . timing requirements can be altered or customized per individual fire department specifications and needs . one or more sensors / alarms 102 may also be coupled to the power supply 54 . one of the sensors / alarms 102 may be for example a hazmat monitor 102 a . the hazmat monitor 102 a may monitor for hazardous materials such as o 2 , co , so 2 , cn , radiation , lel ( explosion limit ), and the like . the listing of the above is given as an example and should not be seen in a limiting manner . the hazmat monitor 102 a may be coupled to a visual indicator 103 thus , when hazmat monitor 102 a detects a specified hazardous material , the corresponding visual indicator 103 may illuminate . the electronic circuitry 70 may further have a receiver / transmitter unit 106 . the receiver / transmitter unit 106 may be used to transmit data collected from the electronic circuitry 70 to a desired location ( i . e ., command post , etc .). the receiver / transmitter unit 106 may further be used to receive data transmitted by another party . for example , the receiver / transmitter unit 106 may receive a command to evacuate the building transmitted by the command post . in this situation , the receiver / transmitter unit 106 may cause the electronic circuitry 70 to start flashing all visual indicators 103 . the receiver / transmitter unit 66 may further be able to receive and then transmit current health data of the firefighter . for example , a firefighter may wear one or more sensors to monitor the firefighter &# 39 ; s health ( i . e , heart rate , blood pressure , o 2 levels , etc . the information monitored by these sensors may then be collected and transmitted by the receiver / transmitter unit 106 to a desired location ( i . e ., command post , etc .). the electronic circuitry 70 may further have a display screen 108 . the display screen 108 may be used to display graphical information . for example , the display screen 108 may display information captured by the sensors 102 and or sensors on the firefighters as discussed above . the display screen 108 may display information transmitted by the command post . the above is given as examples of information that may be displayed on the display screen 108 . other information may be displayed without departing from the spirit and scope of the present invention . it should also be noted that the display screen 108 may be used for other purposes than that described above without departing from the spirit and scope of the present invention . the electronic circuitry 70 may further have a distress button 110 . the distress button 110 when activated would alert others that a firefighter is in need of help . the distress button 110 may send a signal which causes all of the lighting fixtures 14 to start flashing . the distress button 110 may send a signal to the receiver / transmitter unit 106 which may transmit a signal to a command post that the firefighter is in trouble . the above are given as examples . the distress button 110 when activated may alert others that a firefighter is in need of help in other ways without departing from the spirit and scope of the present invention . while embodiments of the disclosure have been described in terms of various specific embodiments , those skilled in the art will recognize that the embodiments of the disclosure may be practiced with modifications within the spirit and scope of the claims . | 0 |
two different approaches to power meters or measuring devices incorporated into bicycle cranksets are described below . a first approach involves a system including gages integrated into the crankset “ spider ” ( the portion of the crankset that connects the crank arm to the chain rings ). a second approach involves a system that integrates gages into the crank arm . a bicycle crankset as used in this disclosure refers to an assembly of opposing crank arms rotatably mounted to a bicycle via bottom bracket . a first side of the crankset includes a crank arm adapted to mount a pedal at an outer end and adapted for connection to the bottom bracket at the opposite end . this is typically the left crank arm . a second side of the crankset includes a crank arm which also is adapted to mount a pedal at the outer end and adapted for connection to the bottom bracket at an opposite end . the second side of the crankset may also include a spider 100 , such as shown in fig1 , to which a chain ring may be mounted or which may have integral teeth for engaging a bicycle drive chain . a typical spider may have four or five spider arms , typically evenly spaced , with a chain ring mounted at an end of the spider arms and typically fixed in place by a bolt in each spider arm . the spider may be rigidly connected to the crank arm of the second side . the chain and other drive line components are conventionally mounted to the right side of a bicycle . the bottom bracket is typically configured to transmit rotation force exerted on the first side crank arm to the spider on the second side and to the drive chain . thus , all force generated by a cyclist using this crankset will be applied to at least one of the crank arms and also transmitted through the spider to exert force on and move the drive chain . according to the present disclosure , both approaches may calculate output power of a cyclist by measuring the torque load applied to the cranks and the crank angular velocity . crank angular velocity can be easily measured with numerous sensors designs , whereas the applied torque load is somewhat more challenging . both approaches described herein utilize a spring element integrated into the crankset that deforms a predictable amount under a given load , and a strain gage arrangement to measure the amount of deformation . while pedaling , a cyclist is exerting a torque load between the chainrings and the crank arm . in the “ spider ” approach , each arm of the chainring spider may be instrumented with strain gages to measure the amount of deformation that occurs in each spider arm under load . there is also loading between the chain and the chainring , which is applied to the chainring in a local area at the top contact point ( assuming a typical rear wheel driven bicycle arrangement , with the crankset mounted in front of the rear hub ). because the chain load is applied locally and the chainring may not be perfectly rigid , the bending load on each of the spider &# 39 ; s arms may not be evenly distributed at any given point in time when the cyclist is applying force to the crankset . therefore , each of the spider &# 39 ; s arms may desirably be instrumented . because the spider arms are the only parts connecting the chainrings to the crank arm , the sum of the loading on the spider arms will yield the total loading between the crank arm and the chainrings . note that there are several methods of summing the loads , including measuring each arm individually and summing in embedded software or summing electrically with a unique arrangement of the strain gages , as will be described later . alternatively , fewer than all of the spider arms may be instrumented and some form of algorithm may be used to calculate or interpolate the force or load exerted by the non - instrumented spider arms . the power generated by a cyclist may vary during pedaling and this variance may tend to be cyclical in nature about each rotation of the crankset . the nature of the peaks and valleys of force generated may be unique for each cyclist and these variations may make it difficult to estimate overall force or power generated with fewer than all of the spider arms instrumented . however , assumption as to a typical cyclist &# 39 ; s cycle of power exerted may be used or specific parameters for each cyclist may be determined and used in the algorithm . to avoid using such algorithms and the necessary assumptions or prior analysis to calculate a derived power output , it may be more desirable though not necessary to provide gages on each of the spider arms of the crank . in the spider approach described generally above , only the loads acting in the plane of the spider arms are preferably measured to calculate power . the chainline is almost never exactly in this plane , as the chain line varies depending on the gear selection and arrangement of components making up the drive line . this offsetting of the chainline may create a lateral load on the spider arm ( in the axial direction of the bottom bracket ). additionally , the spider may carry multiple chainrings . the center planes of the chainrings are offset from each other and will be offset from the center plane of the spider . this may create a torque about the long axis of the spider arm . this arrangement of forces or loads is illustrated in fig2 . in fig2 , spider 100 in incorporated into a crankset 22 with an inner or small chain ring 24 and an outer or large chain ring 26 . both chain rings are connected to spider 100 at an outer end of a spider arm 28 . in the illustrated force example , a chain is engaged with small chain ring 24 and an applied load is applied to the chain through spider 100 . because the chain may not pull perfectly in plane with chain ring 24 , the applied force may be comprised of a lateral load and a normal load . additionally , because chain ring 24 is offset laterally from spider arm 28 , the applied load also creates a torque load as shown . preferably , only the normal load is measured , as this is the mechanical force that generates forward of the bicycle . according to the present disclosure , strain gages should preferably not respond to either of the lateral load and torsion load . as a background to the following discussion of strain gage locations , the following review of strain gage wiring and measurement methods is provided . strain gages are basically resistors whose electrical resistance changes when mechanically distorted . the change in resistance is proportional to the change in length of the gage . in order to compensate for numerous other variables that can affect resistance , it is common to place strain gages in pairs such that under load , one gage is under compression ( meaning the gage will be shortened , leading to less electrical resistance ) and the other is under tension ( meaning the gage will be lengthened , leading to more electrical resistance ). the resistance of each gage in the pair may be measured and a ratio of the resistances of the paired gages can be determined with a suitable electrical circuitry . the first arrangement is a tension / compression arrangement where a strain gage 10 is placed on each side of a spider arm 12 of a spider 14 , as shown in fig3 . the strain gage may be located on a raised ridge 20 that concentrates strain under the gage . this arrangement is fairly straightforward ; chain tension in the plane of the spider will bend the arm , causing tension under one gage and compression under the other . the lateral load may be canceled out in each gage , because the neutral strain axis in this load case runs through the center of each gage , with compression on one half , and tension on the other . overall the net effect on the gage resistance is generally zero . also , the torsion load about the arm &# 39 ; s axis is effectively cancelled out because it generally affects both gages equally and the result is generally zero when measuring the ratio of resistance between the gages . therefore this opposed arrangement of strain gages achieves the desired measurement characteristics . symmetry may be desirable in the local area 16 between the placement of gage 10 in order to create this behavior . similarly , the shape of arm 12 beyond the immediate local area 16 will preferably encourage good stress “ flow ” into the symmetrical area 16 between the gages 10 in order to enhance the performance of the gages . the performance and viability of this design has been verified through the use of finite element analysis . although conceptually sound , there are drawbacks to this design . strain gages 10 are placed on an external surface that is vulnerable to damage and not readily protectable . similarly , the location is not conducive to routing lead wires nor does it immediately lend itself to easy gage placement or construction . a second strain gage arrangement is a shear web , as illustrated in fig4 . in this arrangement a shear gage 118 may be used . shear strain gage 118 may utilize two strain gage grids 110 arranged at opposing 45 degree angles on a single gage substrate . when gage 118 is placed under shear strain , one grid 110 is compressed and the other grid 110 is stretched . in the shear web arrangement , a pocket 120 may be created on each side of a spider arm 112 of a spider 110 , creating a thin web 122 of material between each gage . a pair of gages 118 may be placed on opposite sides of web 122 and a second pocket 120 may be formed in spider arm 112 opposite the first pocket 120 to contain a second gage 118 opposite the first gage 118 . under chain load in the plane of the spider 112 , this web 122 will see a shear strain . a shear strain gage 118 may be placed on both sides of the web 122 . the gages 118 may be wired so that the two grid areas 110 ( one of each gage 118 on opposite sides of web 122 ) under compression are in series with each other and the two grid areas 110 under tension are in series with each other . the resistance of strain gages in series will average the strain under each of the gages . lateral loads on the spider arm may stretch and compress both left and right strain grids equally , and the effect on the ratio is generally zero . also , torsion loads about the vertical axis of the arm may be essentially cancelled out , in this case , the right front and back left grids will see a tension , when the left front and right back are compressed , or vise versa . again , due to the wiring arrangement , the net effect of this load on the resistance ratios may be essentially zero . the function and performance of this gage arrangement of fig4 has been verified both through finite element analysis and construction and testing of a physical prototype . again , symmetry may be desirable about spider arm 112 to achieve the desired performance . note that a slot 124 may be located at the bottom of the shear web . this slot 124 allows for routing lead wires from one side of the spider 114 to the other . the placement of this slot 124 and the material geometry between it and the strain gages 118 may be designed specifically to minimize the effect of the slot on the strain gage measurement . the shear web arrangement of fig4 may have several advantages in terms of packaging and construction . the strain gages 118 may be placed in the bottom of pocket 120 , so that the pocket may enclose and protect the gage from five sides . only the top is exposed , which can be covered by epoxy , wax , urethane , plastic , silicone or similar encapsulation material or other suitable mechanical cover , filling in pocket 120 atop the gage . the pocket 120 may be used create reference geometry which may be used to facilitate the accurate and repeatable placement of the strain gages 118 on spider 114 . also the gages 118 may be placed on the front and back of the spider , which introduces possibilities of integrating all the grid areas for all five arms onto one large substrate that can be affixed at once . this common substrate may improve overall production or cost efficiency . as mentioned above , the total torque about the bottom bracket axis generated by the cyclist is equal to the sum of the torques that each arm carries . also , in the above strain gage arrangements , the resultant strain is proportional to the applied torque . therefore , the sum of the strains is proportional to the sum of the torques . depending on the construction of the electronics , each arm can be measured independently , and then the independent measurements can be added together by software to get the total torque . alternatively , the strain gages can be physically wired together such that one measurement can be taken that is proportional to the total torque . specifically , all the grid areas on the left side of the spider arms may be wired in series with each other , and all the grid areas on the right side of the spider arms may be wired in series with each other . then just one measurement may be taken and the ratio of all the lefts to all the rights is proportional to the total torque . numerous alternative wiring and measurement arrangements can also be conceived , including , but not limited to , pairing spider arms together , and measuring the front sides of the spider arms separately from back side of the spider arms . these variations on wiring and measurement arrangements may yield equivalent primary results , but each may posses distinct characteristics related to measurement resolution , repeatability , precision as well as fabrication and additional properties . the second approach described herein may include placement of a shear web strain gage arrangement in the crank arm of the crankset . an example of this approach is illustrated in fig5 and 6 . one of the challenges in executing input torque measurement in a crank arm is to isolate the input torque from the other forces acting on the arm . the input force from the cyclist &# 39 ; s leg is applied to the pedal , which is cantilevered off the side of the crank arm . this creates a torque around a longitudinal axis of the crank arm . unfortunately , the radius at which the load is applied is a function of the pedal design , cleat placement on the shoe and the biomechanics of the rider &# 39 ; s pedal stroke . likewise there are other forces acting laterally and longitudinally along the arm . the shear web strain gage arrangement addresses these issues . the shear web arrangement operates similarly to the spider based system above , however in this case the shear web arrangement measures the strain from a location within the crank arm instead of the spider . referring to fig5 and 6 , a crank arm 200 may include a first end 206 with an opening 208 for mounted a pedal to the crank arm and a second opposite end 210 with an opening 212 for mounting crank arm 200 to a bottom bracket . a pocket 216 may be is machined into both front and back sides of crank arm 200 to create a thinned web section 202 . a strain gage measurement grid such as gage 118 described above may be mounted within the pockets 216 and attached to the front and back faces of web 202 . each strain gage 118 may have two grids 110 , oriented at approximately forty - five degrees to the longitudinal axis of crank arm 200 , and generally ninety degrees from each other . the cross - sectional area between the gages ( web 202 ) and in the surrounding local area of the arm is preferably symmetrical in order to create well - behaved linear responses to applied loads . likewise the local area should be conducive to even stress flow into the strain gage section . the creation of pockets 216 for gage placement is conducive to location and protection of the gages , but is not required for function . the gages may be placed on the external surface of the arm and the section between the gages may be hollow or otherwise modified from a thin web section provided the symmetry requirements are met . like the spider approach described above , this crank arm arrangement may allow the torque about the axis of rotation to be measured . note that in this approach , the strain gage arrangement does not measure bending due to the applied load . gage 118 instead measures shear . this allows the strain gages to be placed anywhere along the length of the crank arm . the amount of shear measured by gages 118 will be proportional to the load applied to the crank arm , regardless of where along the length of the crank arm the gages are placed . in fig5 and 6 , one possible configuration of crank arm 200 utilizing a shear web strain gage arrangement is illustrated . the electronics for sensing and recording the reaction of the mounted gages may be placed within a channel 204 on the back of the crank arm 200 . an alternative embodiment of a crank arm 300 according to the crank arm approach is shown in fig7 and 8 . crank arm 300 includes the two strain gages on the internal surface of a hollow crank arm . although conceptually distinct from the shear web of crank arm 200 , the execution is very similar . two strain gages such as gages 118 are used , each having two strain grids oriented generally ninety degrees from each other and approximately forty - five degrees from a longitudinal axis of the crank arm . fig7 and 8 show a possible design of crank arm 300 utilizing a dual internal shear gage arrangement . the electronics may be placed inside a hollow section 302 of the crank arm to provide good protection from the elements . strain gages 118 may be placed adjacent to first end 306 where pedal mounting opening 208 is located . as described above , strain gages 118 could located at other locations along the length of crank arm 300 . the wiring and measurement of strain gages 118 mounted to any of the crank arms described above can be executed in much the same manner as the spider approach described above . however a few changes can be made that may greatly improve the accuracy of the measurement . in fig9 , a crank arm 400 includes a pair of opposing gages 118 , each with two grids 110 . the labeling the four strain gage grids are as follows : sg ( strain gage )— f or b ( front or back ) and t or b ( top or bottom ). in the case of crank arm 400 , the primary load along the arm is torsion due to the torque placed about the longitudinal axis l of the arm . this creates shear on the front and back of the arm in opposite directions . table 1 shows an example of average strain under each grid 110 as calculated by finite element analysis . the strain gage measurement electronics may measure the ratio of resistances of two strain gage grids . ultimately the average shear strain of the two gages must be calculated . there are two primary methods that can be used to achieve this . a first method is to measure the total strain of the front and rear grids independently with the measurement electronics then add them together to get the total . one advantage of this method is that the strain gage measurement electronics will measure higher strain levels , leading to greater accuracy and precision . however , two separate measurements must be made in this method . a second method is to wire the top grids of the front and rear gages in series and likewise the bottom grids of the front and rear gages in series . the strain gage electronics then makes one measurement of the total effective strain . one advantage of this method is that only one measurement must be made , however the effective strain measured on each composite grid will be lower , which may reduce the precision and accuracy of the measurement . measuring the front and back gages independently may be preferable because making separate measurements can be easily executed with the electronics and will likely yield more accuracy and precision in the output . in order to directly measure the total input torque , both the left and right crank arms may be instrumented as described above . the strain gages on each arm may be connected to a common set of measurement electronics via wires routed through the bottom bracket axle . alternatively , each arm may have its own complete set of measurement electronics and may transmit the data to , for example , a handlebar mounted cycle computer that would sum the torque of the two arms . such a cycle computer might be remotely mounted with a separate display mounted in the cyclist &# 39 ; s view , or may be a fully integrated display and computer unit with the display mounted in the cyclist &# 39 ; s field of view . the cycle computer would then be able to display the left vs . right power balance , and may also provide logging of the data for later review . an alternative embodiment of a power measuring system according to the present disclosure might be to instrument only a single crank arm and measure the input torque from one leg only . this embodiment would not measure the total input torque from the rider but would extrapolate a total torque . most riders apply output roughly equal torque with each leg , so under most conditions simply doubling the measured torque may give a good estimate of total torque . while the spider approach described above included electronics on only one side of the bike , the total torque input by the rider and transmitted to the chain was measured . although this single crank arm measurement embodiment might be less accurate than the spider based system described above , it may have several advantages . namely , using a single instrumented crank arm requires replacing fewer parts of the bicycle and has only one set of electronics at the crankset . in both the spider and crank arm based approaches , there are a number of electrical functions that may be executed . these functions and the design requirements for components to accomplish these functions may be similar between the two approaches . there are a number of electronic functions that may be executed at the crankset . the strain gages may be connected to electronics to measure the resistance of the strain gages . the strain gage measurement components may then be connected to a microcontroller that controls all functions and manipulates the data . the microcontroller may then pass the data to rf transmission components . the rf components transmit the data to a computer mounted elsewhere on the bicycle , for example but not limited to the handlebar . additional components may include hall - effect sensors or accelerometers for cadence measurement . alternatively , the microcontroller may be wired to the other components of the power measurement system . while wires may be vulnerable to damage , removing electrical components such as the rf components may reduce battery drain and improve reliability of the power measuring system . circuitry is also required to power the electronics embedded on the spider or crank arm . this will likely be achieved with a small battery . the power consumption of the embedded electronics may be aggressively minimized in order to minimize battery size and weight and maximize battery life . power reduction strategies may include changing the data transmission rate depending on the power level , i . e . at zero power no data is transmitted , at low power levels the data may be averaged over a several seconds , and at high power levels more data is transmitted . cadence is a component of the power calculation and can be measured with a variety a methods . one method is to use a hall - effect sensor ( s ) in the spider or crank arm and a magnet ( s ) affixed to the frame of the bike , such that the hall - effect sensor is tripped on each revolution . multiple hall - effect sensors or magnets may be used to receive multiple pulses per revolution . alternatively , an accelerometer can be used to measure the direction of gravity relative to the orientation of the crank . this can be achieved through the use of a single or dual axis accelerometer . a single axis accelerometer will give the magnitude of the gravitational pull , alternating from + 1 g to − 1 g . a dual axis accelerometer measures acceleration in two directions perpendicular to each other , each alternating from + 1 g to − 1 g . some basic calculations will yield the angle and angular velocity of the crank . two other methods of determining cadence look closely at the torque profile measured from the spider . one method is to analyze a time based total spider torque profile . due to the natural biomechanics of the pedaling action , there will be two distinct torque pulses as each leg passes through the 3 o &# 39 ; clock position and has maximum leverage . by identifying these torque peaks and measuring their frequency , pedaling cadence can be determined . as this method of determining cadence is based on cyclist biomechanics , a similar approach may be applied to the torque profile determined by a crank arm approach . the crank arm should show the greatest torque applied by the cyclist at the 3 o &# 39 ; clock position and this peak should be distinct from the amplitude of the torque applied at any other position . based on this , the spacing of the peak torque recorded by a crank arm gage may be used to derive cadence . the other method involves looking at the torque on each spider arm individually . the spider arms closest to the chain contact point at the 12 o &# 39 ; clock position will show the greatest torque . by looking for this strain maximum on each spider arm individually it is possible to determine when each spider arm passes the chain contact point . the frequency will yield the pedaling cadence . note that this method is not dependent on the rider &# 39 ; s biomechanics . the embodiments of the inventions disclosed herein have been discussed for the purpose of familiarizing the reader with novel aspects of the present invention . although preferred embodiments have been shown and described , many changes , modifications , and substitutions may be made by one having skill in the art without unnecessarily departing from the spirit and scope of the present invention . having described preferred aspects and embodiments of the present invention , modifications and equivalents of the disclosed concepts may readily occur to one skilled in the art . however , it is intended that such modifications and equivalents be included within the scope of the claims which are appended hereto . | 6 |
referring to fig1 and 2 , an organic combined insulated dry electronic transformer for outputting an optical signal according to the present invention comprises an electric conductor 1 and a capacitor voltage - divider insulator 2 consisting of organic insulation layers 8 ( such as polytetrafluoroethylene films ) and cylindrical capacitance plates 8 a alternatively wound around the electric conductor , wherein each cylindrical capacitance plate 8 a is formed of conductive or semi - conductive material ( such as aluminum foils ). as shown in fig1 , the longer the radial distances from the organic insulation layer 8 and the capacitance plate 8 a to the electric conductor 1 are , the shorter the axial lengths of the organic insulation layer 8 and the capacitance plate 8 a are . an organic insulated outer jacket 11 is tightly wrapped around the outer surface of the capacitor voltage - divider insulator 2 . the electric conductor 1 is provided with a wiring clip 6 ( only one wiring clip is shown in fig1 ) at each end thereof for conveniently connecting the mutual inductor to a line to be detected , such as a line of a transformer substation . a grounded housing 5 made of metal material is fitted over the outside of the organic insulated outer jacket 11 and located in a section defined by the tap of capacitance plate 8 a ′. the tap of capacitance plate 8 a ′ is in a grounded state during operation . a coreless coil 3 , fitted over the capacitor voltage - divider insulator 2 , is disposed inside the grounded housing 5 . the coreless coil 3 is formed by winding a metal wire around a non - magnetic material framework . a converter 4 is also disposed inside the grounded housing 5 for converting an electric signal , after processed , into an optical pulse signal . the converter 4 , mounted inside a case made of metal material ( not shown ), comprises an electric signal processor and a photoelectric converter . the electric signal processor performs collecting , processing , and a / d converting of electric signals . the photoelectric converter converts an electric signal into an optical signal . the electric signal processor and the photoelectric converter are well - known , thus further detailed illustration is omitted here . current signal input terminals 16 , 16 and corresponding optical pulse signal output terminals 17 , 17 of the converter 4 are disposed on the case . two leads 12 , 13 at ends of the coreless coil are connected respectively to the current signal input terminals 16 , 16 of the converter 4 . a silicon rubber umbrella 14 is adhered to or fitted over the outer jacket ( 11 ) of the capacitor voltage - divider insulator at the surface of its two ends beyond the grounded housing . thus an organic insulated dry current transformer for outputting an optical signal is formed . referring to fig1 and 2 , voltage signal input terminals 15 , 15 are also disposed on the case of the converter 4 . a measurement lead 9 is led out from the capacitance plate 8 a ″ adjacent to the tap of capacitance plate 8 a ′, at the same time , a tap lead 10 is led out from the tap of capacitance plate 8 a ′. the measurement lead 9 and the tap lead 10 are respectively connected to the voltage signal input terminals 15 , 15 . thus an organic combined insulated dry electronic transformer for outputting an optical signal is formed , with a current transformer and a voltage transformer integrated therein . a person skilled in the art may understand easily , if the electric conductor 1 is configured as the i - shape structure shown in fig1 , it is possible to form an organic combined insulated dry electronic transformer for outputting an optical signal integrating functions of three kinds of electric apparatus , i . e . a wall bushing , a current transformer , and a voltage transformer , or an organic combined insulated dry electronic transformer for outputting an optical signal integrating functions of two kinds of electric apparatus , i . e . a wall bushing and a current transformer ; and , if the electric conductor 1 is configured as the u - shape structure shown in fig2 , it is possible to form an organic combined insulated dry electronic transformer for outputting an optical signal integrating functions of two kinds of electric apparatus , i . e . a current transformer and a voltage transformer , or only the function of a current transformer , so as to reduce the occupied area , and reduce the manufacture cost of the equipment and the construction cost of the whole project . referring to fig1 , the electric conductor 1 may be formed by a metal conducting rod or a metal conducting pipe , with its outer surface attached by a semi - conductive transition layer 7 ( such as a carburized ethylene propylene rubber semi - conductive adhesive tape ), so as to further improve electric field and play function of stress relieving . referring to fig4 , as an alternative example , the electric conductor 1 may consists of a metal conducting rod or conducting wire 18 , a non - magnetic metal pipe 19 ( for example , a stainless steel pipe ) fitted over the metal conducting rod or wire 18 , and a semi - conductive transition layer 7 tightly attached to the outer surface of the non - magnetic metal pipe 19 . one end of the metal conducting rod or conducting wire 18 may be electrically connected to the non - magnetic metal pipe 19 via a metal conducting ring 20 , and the other end may be insulated supported within the magnetic metal pipe via a separating sheath 21 made of insulating material , as shown in fig4 . since the electric conductor 1 also plays the role of the framework of the manufacture , the whole rigidity of the manufacture can be improved by utilizing the structure of the electric conductor shown in fig4 . as shown in fig1 , the tap of capacitance plate 8 a ′ and the adjacent capacitance plate 8 a ″ of the capacitor voltage - divider insulator 2 are connected in parallel with another corresponding capacitance plate at inner side , respectively , so as to improve the capacitance of the low voltage capacitor c 2 and decrease the divided voltage . as an alternative example for the embodiment shown in fig1 , an dry voltage transformer for outputting an optical signal is formed without the coreless coil 3 disposed in the grounded housing 5 . such dry voltage transformer comprises an electric conductor 1 ; a capacitor voltage - divider insulator 2 consisting of organic insulation layers 8 and cylindrical capacitance plates 8 a alternatively wound around the electric conductor , wherein each cylindrical capacitance plate 8 a is made of conductive or semi - conductive material , and the longer the radial distances from the organic insulation layer 8 and the capacitance plate 8 a to the electric conductor 1 are , the shorter the axial lengths of the organic insulation layer 8 and the capacitance plate 8 a are ; an organic insulated outer jacket 11 tightly wrapped around the outer surface of the capacitor voltage - divider insulator 2 ; and wiring clips 6 each disposed respectively at each end of the electric conductor 1 ; a grounded housing 5 fitted over the outside of the organic insulated outer jacket 11 and located within a section defined by the tap of capacitance plate 8 a ′; a converter 4 ,, mounted inside a case made of metal material ( not shown ), disposed inside the grounded housing 5 for converting an electric signal into an optical signal ; voltage signal input terminals 15 , 15 and corresponding optical signal output terminals 17 , 17 disposed on the case ; a measurement lead 9 led out from the capacitance plate 8 a ″ adjacent to the tap of capacitance plate 8 a ′; a tap lead 10 led out from the tap of capacitance plate 8 a ′, and wherein the measurement lead 9 and the tap lead 10 are respectively connected to the voltage signal input terminals 15 , 15 of the converter 4 , and silicon rubber umbrellas 14 are disposed on the outer jacket 11 of the capacitor voltage - divider insulator at the surface of its two ends beyond the grounded housing . some specific manufacture examples of the organic combined insulated dry electronic transformer for outputting an optical signal according to the present invention are provided below : referring to fig1 , the organic combined insulated dry electronic transformer for outputting an optical signal , with a rated voltage of 110 kv , a rated current of 1200 a , and a structure of an i - shape conducting rod , can be utilized as a wall bushing , for current measurement , voltage measurement and relay protection simultaneously . the steps for manufacturing the transformer are as follows : a . selecting a copper bar having a diameter of 30 mm as the conducting rod 1 ; b . selecting the length of the grounded housing as about 1 m , and the length of the conducting rod 1 as 3 . 5 mm since the rated voltage of 110 kv requires an air gap of 1 m ; c . winding a layer of carburized ethylene - propylene rubber semi - conductive adhesive tape 7 around the conducting rod 1 ; d . winding initially the first layer of polytetrafluoroethylene insulation tape 8 coated with silicone oil around the outside of the semi - conductive adhesive tape 7 ; then disposing tightly the first layer of capacitance plate 8 a by using an aluminum foil having a length of 3 m ; winding the insulation tape on the outside of the capacitance plate 8 a again and repeating the above process until the 17th layer of capacitance plate and the 18th layer of capacitance plate are obtained , with aluminum foil conductive pieces for both the 17th layer of capacitance plate and the 18th of layer capacitance plate reserved ; while forming the 19th layer of capacitance plate , connecting the 17th layer of capacitance plate with the 19th layer of capacitance plate 8 a ″ in parallel via the reserved aluminum foil conductive piece , meanwhile , pressing a metal wire , which has a diameter of 2 . 5 mm 2 and comprises an insulation skin , tightly onto the 19th layer of capacitance plate 8 a ″ by using a spring hoop , wherein each layer of insulation tape 8 has a thickness of about 1 . 5 mm , the length of each layer of capacitance plate decreases by 50 mm one after another , and the metal wire is used as the measurement lead 9 ; e . keep on winding the 20th layer ( i . e . the last layer ) of capacitance plate , and connecting the 18th layer of capacitance plate with the 20th layer of capacitance plate 8 a ′ in parallel in the same way via the reserved aluminum foil conductive piece , meanwhile , pressing a metal wire having a diameter of 2 . 5 mm and comprising an insulation skin tightly onto the 20th layer of capacitance plate by using a spring hoop , wherein the metal wire is used as the tap lead 10 ; f . shrinking a heat shrinkable tube 11 on the whole capacitor voltage - divider insulator 2 , and exposing the measurement lead 9 and the tap lead 10 out of the heat shrinkable tube in the middle section of the capacitor voltage - divider insulator ; g . mounting the coreless coil 3 and the converter 4 inside a grounded housing 5 , with the leads 12 , 13 at two ends of the coreless coil connected to the current input terminals 16 , 16 of the converter 4 ; h . fitting the grounded housing 5 over the outside of the heat shrinkable tube 11 of the capacitor voltage - divider insulator 2 ( the portion defined by the tap of capacitance plate 8 a ′), and fixing the grounded housing 5 to the capacitor voltage - divider insulator 2 ; i . connecting the measurement lead 9 and the tap lead 10 with the voltage input terminals 15 , 15 of the converter 4 ; j . integral silicon rubber umbrellas are disposed on the surface of the two ends , beyond the grounded housing 5 , of the outer jacket 11 of the capacitor voltage - divider insulator . referring to fig2 , the organic combined insulated dry electronic transformer for outputting an optical signal , with a rated voltage of 110 kv , a rated current of 1200 a , and a structure of an u - shape conducting rod , can be utilized for current measurement , voltage measurement and relay protection simultaneously . the steps for manufacturing the transformer are as follows : a . selecting a copper bar having a diameter of 30 mm as the conducting rod 1 , and bending it into u - shape ; b . selecting the length of the u - shape conducting rod in the grounded housing as about 1 . 5 m , and the length of the conducting rod 1 as 4 m since the rated voltage of 110 kv requires an air gap of 1 m ; c . repeating the steps of c - g in the first example ; d . fitting the grounded housing 5 over the outside of the heat shrinkable tube 11 of the capacitor voltage - divider insulator 2 ( the portion defined by the tap of capacitance plate 8 a ′), and fixing the grounded housing 5 to the capacitor voltage - divider insulator 2 ; e . repeating the steps of i and j in the first example . referring to fig1 and 2 , the organic combined insulated dry voltage transformer for outputting an optical signal , with a rated voltage of 110 kv , a rated current of 1200 a , and a structure of an i - shape or u - shape conducting rod , can be utilized merely for voltage measurement and relay protection . the steps for manufacturing the transformer are as follows : a . selecting a copper bar having a diameter of 30 mm as the conducting rod 1 , and making it into i - shape or u - shape ; b . selecting the length of the conducting rod 1 as 4 m if u - shape conducting rod 1 is used , since the rated voltage of 110 kv requires an air gap of 1 m ; c . repeating the steps of c - f in the first example ; d . mounting the converter 4 inside the grounded housing 5 ; h . fitting the grounded housing 5 over ( in case of i - shape conducting rod ) or mounting the grounded housing 5 on ( in case of u - shape conducting rod ) the outside of the heat shrinkable tube 11 of the capacitor voltage - divider insulator 2 ( the portion defined by the tap of capacitance plate 8 a ′), and fixing the grounded housing 5 to the capacitor voltage - divider insulator 2 ; i . connecting the measurement lead 9 and the tap lead 10 with the voltage input terminals 15 , 15 of the converter 4 ; j . integral silicon rubber umbrellas are disposed on the surface of the two ends , beyond the grounded housing 5 , of the outer jacket 11 of the capacitor voltage - divider insulator . referring to fig1 and 2 , the organic combined insulated dry current transformer for outputting an optical signal , with a rated voltage of 110 kv , a rated current of 1200 a , and a structure of an i - shape or u - shape conducting rod , can be utilized merely for current measurement and relay protection . the steps for manufacturing the transformer are as follows : a . selecting a copper bar having a diameter of 30 mm as the conducting rod 1 , and making it into i - shape or u - shape ; b . selecting the length of the conducting rod 1 as 4 m if u - shape conducting rod 1 is used , since the rated voltage of 110 kv requires an air gap of 1 m ; c . repeating the step of c in the first example ; d . winding initially the first layer of insulation tape 8 around the outside of the semi - conductive adhesive tape 7 ; then disposing tightly the first layer of capacitance plate 8 a by using an aluminum foil having a length of 3 m ; winding a insulation tape on the outside of the capacitance plate 8 a again and repeating the above process until the 20th layer of capacitance plate is obtained ; pressing a metal wire , which has a diameter of 2 . 5 mm 2 and comprises an insulation skin , tightly onto the 20th layer of capacitance plate 8 a ′ by using a spring hoop , wherein each layer of insulation tape 8 has a thickness of about 1 . 5 mm , the length of each layer of capacitance plate decreases by 50 mm one after another , and the metal wire is used as the tap lead 10 ; e . shrinking a heat shrinkable tube 11 on the whole capacitor voltage - divider insulator 2 , and exposing the tap lead 10 out of the heat shrinkable tube in the middle section of the capacitor voltage - divider insulator ; f . repeating the step of g in the first example ; g . fitting the grounded housing 5 over ( in case of i - shape conducting rod ) or mounting the grounded housing 5 on ( in case of u - shape conducting rod ) the outside of the heat shrinkable tube 11 of the capacitor voltage - divider insulator 2 ( the portion defined by the tap of capacitance plate 8 a ′), and fixing the grounded housing 5 to the capacitor voltage - divider insulator 2 ; h . integral silicon rubber umbrellas are disposed on the surface of the two ends , beyond the grounded housing 5 , of the outer jacket 11 of the capacitor voltage - divider insulator . the above embodiments and the specific examples are given only for illustrating and understanding the invention , they are not intended to limit the present invention . the scope of the present invention should be defined by the claims . | 7 |
while this invention is susceptible of embodiment in many different forms , there are shown in the drawings and will be described in detail , several specific embodiments , with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not intended to limit the invention to the embodiments illustrated . when referring to the plan illustrations of the blanks , the usual drawing conventions are applied . that is , unless otherwise noted , broken lines indicate fold lines ; scalloped lines indicate lines of weakness forming a tear strip or similar structure ; and interior solid lines indicate through - cuts . in preferred embodiments of the invention , the blanks are fabricated from corrugated paperboard material , although other materials having similar suitable performance characteristics may be employed if desired . the basic premise underlying the quadcorner tray wrapper designs of the present invention , is that of providing a wrapper type blank construction , in which the blank comprises four panels , consecutively arranged on the blank : top panel ; rear ( side ) panel ; bottom panel ; and front ( side ) panel , contiguously connected along interpanel fold lines . major flaps ( end panels ) emanate from the end edges of the top and bottom panels , each of which major flaps ( end panels ) are sized to cover the ends of the articulated carton . minor flaps emanate from the leading and trailing edges of the major flaps . a closure tab emanates from a free edge of either the top or the front ( i . e ., the leading or trailing edges of the blank ). upon articulation , the minor flaps emanating from the major ( end ) flaps of the bottom panel are folded to the inside of the front and rear panels , and form vertical supports for the container . the described minor flaps may or may not be adhered to the stated front and rear panels . if adhered , improved stacking strength can result . the interior folded ( and adhered ) minor flaps form vertical supports for the container . the front and rear ( side ) panels are then folded up perpendicular to the bottom panel . within this phase of container articulation , adhesive can be dispensed to adhere the minor flaps juxtaposed to the front and rear panels . the top panel is then folded down parallel to the bottom panel and the extension from the top panel ( closure tab or glue lap ) is further folded down and adhered over the front panel and parallel to the front and rear panels . the major flaps ( external end panels ) emanating from the top panel are folded down over the major flaps ( internal end panels ) of the bottom panel and once juxtaposed are adhered to each other . the minor reinforcing flaps of the major flaps ( external end panels ) emanating from the top panel are folded and adhered to the outside of the front and rear panels . this creates a laminated and adhered triple thickness of container material along the end edge regions of the front and rear panels , as well as a laminated and adhered double thickness of material on the ends of the carton . in a first variation of the general design ( fig1 - 9 ), the width of the carton is considerably greater than the depth or height . the minor flaps are all each substantially less than one - half the width of the carton , so that there is a substantial gap between facing free edges of the minor flaps on the interior and exterior faces of the front and rear walls , thus creating “ corner post ” reinforcement structures , rather than complete end or side walls . the closure tab emanates from the free edge of the top panel , and is folded to be juxtaposed and adhesively affixed to the front panel . container 10 is formed from blank 11 ( fig2 ). blank 11 includes bottom panel 12 , front ( side ) panel 14 , rear ( side ) panel 16 , top panel 18 and closure flap 20 ; as well as fold lines 13 , 15 , 17 and 19 . blank 11 also includes inner end panels 22 , 24 ( emanating along fold lines 21 , 23 , respectively ) from which interior minor flaps 26 , 28 , 30 , 32 emanate along fold lines 25 , 27 , 29 and 31 , respectively . outer end panels 34 , 36 emanate from top panel 18 along fold lines 33 , 35 , respectively . reinforcing flanges 38 , 40 , 42 , 44 emanate from outer end panels 34 , 36 , along fold lines 37 , 39 , 41 and 43 , respectively . the end edges of panels 14 and 16 may be vertical . alternatively , the end edges of rear panel 16 preferably may be concavely bowed and the end edges of front panel 14 preferably may be inwardly inclined from bottom to top ( both as illustrated ), because this style of slot configuration may permit ease of removing and ease of stripping the waste material from the designated and created aperture in the blank sheet . as an alternative , rather than the described designated slot , a singular cut including offsets as required may be implemented thereby eliminating a need to remove waste material . in a typical articulation procedure , first , the product to be contained will be pushed onto blank 11 , which will be laid flat on a packaging apparatus . flaps 30 , 32 will be folded perpendicular to panel 24 , and flaps 26 , 28 will be folded perpendicular to panel 22 . panels 22 , 24 will be folded upwardly perpendicularly to bottom panel 12 . rear ( side ) panel 16 and front ( side ) panel 14 will then be folded upwardly perpendicular to bottom panel 12 , as shown sequentially in fig3 - 5 . top panel 18 is then folded down , toward and parallel to bottom panel 12 ; and outer end panels 34 , 36 are folded over inner end panels 22 , 24 , respectively and adhered to end panels 22 , 24 . finally , reinforcing flanges ( minor flaps ) 38 , 40 , 42 , 44 are folded perpendicular to outer end panels 34 , 36 , and adhesively adhered to the outer surfaces of front and rear ( side ) panels 14 , 16 . when top panel 18 is folded down , closure flap 20 is preferably folded to the outside of front panel 14 , and adhesively affixed to the outer surface thereof ( fig6 ). in an alternative sequence , which is described in detail with respect to the embodiment of fig1 , but which is understood to be applicable to all of the embodiments described and / or illustrated herein , the goods to be packaged are not placed on the bottom panel prior to any articulation . instead , the front inner minor flaps and the front panel may not be folded with respect to the inner end panels and the bottom panel , respectively , at the same time that the rear inner minor flaps and the rear panel are folded and adhered with respect to the inner end panels and the bottom panel , respectively . this would result in a partially erected container , having an open frontal area , into which the goods to be packaged would be thrust , relying upon the inner surfaces of the rear inner minor flaps to provide stacking or other alignment structures . upon insertion of the goods , the remaining panels and flaps are articulated and glued substantially as previously described . the first variation of the general design of fig1 - 9 may be addressed in an alternative manner . the width of the carton is still considerably greater than the depth or height . the minor flaps are all each substantially less than one - half the width of the carton , so that there is a substantial gap between facing free edges of the minor flaps on the interior and exterior faces of the front and rear walls , thus creating “ corner post ” reinforcement structures , rather than complete end or side walls . the closure tab emanates from the free edge of the top panel , and is folded to be juxtaposed and adhesively affixed to the front panel . container 10 will be formed from blank 11 ( fig2 ) blank 11 includes bottom panel 12 , front ( side ) panel 14 , rear ( side ) panel 16 , top panel 18 and closure flap 20 ; as well as fold lines 13 , 15 , 17 and 19 . blank 11 also includes inner end panels 22 , 24 ( emanating along fold lines 21 , 23 , respectively ) from which interior minor flaps 26 , 28 , 30 , 32 emanate along fold lines 25 , 27 , 29 and 31 , respectively . outer end panels 34 , 36 emanate from top panel 18 along fold lines 33 , 35 , respectively . reinforcing flanges 38 , 40 , 42 , 44 emanate from outer end panels 34 , 36 , along fold lines 37 , 39 , 41 and 43 , respectively . the end edges of panels 14 and 16 may be vertical . alternatively , the end edges of rear panel 16 preferably may be concavely bowed and the end edges of front panel 14 preferably may be inwardly inclined from bottom to top ( both as illustrated ), because this style of slot configuration may permit ease of removing and ease of stripping the waste material from the designated and created aperture in the blank sheet . as an alternative , rather than the described designated slot , a singular cut including offsets as required may be implemented thereby eliminating a need to remove waste material . in a typical alternative articulation procedure , first the blank 11 is formed into a tray - like container as per fig1 whereby inner minor panels 26 , 28 , 30 and 32 are folded along folds 25 , 27 , 29 and 31 , respectively , perpendicular to inner end panels 22 and 24 . end panels 22 and 24 are then folded along folds 21 and 23 , respectively , perpendicular to bottom panel 12 . inner minor panels 26 , 28 , 30 and 32 are adhesively adhered to front ( side ) panel 14 and rear ( side ) panel 16 . product to be contained will be drop packed into the formed cavity whose perimeter can consist of inner minor flaps 26 , 28 , 30 and 32 , front ( side ) panel 14 and rear ( side ) panel 16 , inner end panels 22 and 24 along with bottom panel 12 of blank 11 and as shown sequentially in fig3 - 5 . top panel 18 is then folded down , toward and parallel to bottom panel 12 ; and outer end panels 34 , 36 are folded over inner end panels 22 , 24 , respectively and adhered to end panels 22 , 24 . finally , reinforcing flanges ( minor flaps ) 38 , 40 , 42 and 44 are folded perpendicular to outer end panels 34 , 36 and adhesively adhered to the outer surfaces of front and rear ( side ) panels 14 , 16 . when top panel 18 is folded down , closure flap 20 is preferably folded to the outside of front panel 14 , and adhesively affixed to the outer surface thereof ( fig6 ). in an alternative sequence , which is described in detail with respect to the embodiment of fig1 , but which is understood to be applicable to all of the embodiments described and / or illustrated herein , the goods to be packaged are not placed on the bottom panel prior to any articulation . the product will be drop packed into the described walled cavity whose perimeter is formed from inner minor flaps 226 , 228 , 230 and 232 along with inner end panels 222 and 224 and bottom panel 212 . depending upon proportions , the rear perimeter will be formed by the addition of rear ( side ) panel 216 . the front ( side ) panel of the tray may only be a portion of the front perimeter panel and would be completed by the top panel 220 . the front inner minor flaps and the partial front panel may be folded with respect to the inner end panels and the bottom panel , respectively , at the same time that the rear inner minor flaps and the rear panel are folded and adhered with respect to the inner end panels and the bottom panel , respectively . this would result in an erected tray container , having a partially open frontal area , into which the goods to be packaged would be drop packed , relying upon the inner surfaces of the rear inner minor flaps , the inner end panels , the front minor flaps , and potentially , a partial front ( side ) panel as well as a rear ( side ) panel to provide stacking or other alignment structures . upon insertion of the goods , the remaining panels and flaps are articulated and glued substantially as previously described . a second variation of the design ( fig1 a - 10d and 11 ) is substantially the same as that of fig1 - 9 , except that the closure tab 20 ′ is trapezoidal . accordingly , the blank forming container 10 ′ is substantially identical to blank 11 forming container 10 of fig1 - 9 , and the method of articulation of the blank forming container 10 ′ is substantially identical to the method of articulation of blank 11 . therefore , the panels and fold lines forming blank 11 ′ which are similar or identical to corresponding panels and fold lines of blank 11 are provided with like reference numerals , augmented by a prime (′). the process of articulation of blank 11 ′ is illustrated in fig1 a - 10d . container 10 ′ is formed from blank 11 ′ ( fig1 ). blank 11 ′ includes bottom panel 12 ′, front ( side ) panel 14 ′, rear ( side ) panel 16 ′, top panel 18 ′ and closure flap 20 ′; as well as fold lines 13 ′, 15 ′, 17 ′ and 19 ′. blank 111 ′ also includes inner end panels 22 ′, 24 ′ ( emanating along fold lines 21 ′, 23 ′, respectively ) from which interior minor flaps 26 ′, 28 ′, 30 ′, 32 ′ emanate along fold lines 25 ′, 27 ′, 29 ′ and 31 ′, respectively . outer end panels 34 ′, 36 ′ emanate from top panel 18 ′ along fold lines 33 ′, 35 ′, respectively . reinforcing flanges 38 ′, 40 ′, 42 ′, 44 ′ emanate from outer end panels 34 ′, 36 ′, along fold lines 37 ′, 39 ′, 41 ′ and 43 ′, respectively . the end edges of panel 14 ′ and 16 ′ may be vertical . alternatively , the end edges of both rear panel 16 ′ and front panel 14 ′ preferably may be concavely bowed or notched ( as illustrated ), because this style of slot configuration may permit ease of removing and ease of stripping the waste material from the designated and created aperture in the blank sheet . as an alternative , rather than the designated and created slot , a singular cut including offsets as required may be implemented thereby eliminating a need to remove waste material . in a typical articulation procedure , first , the product to be contained will be pushed onto blank 11 ′, which will be laid flat on a packaging apparatus . flaps 30 ′, 32 ′ will be folded perpendicular to panel 24 ′, and flaps 26 ′, 28 ′ will be folded perpendicular to panel 22 ′. panels 22 ′, 24 ′ will be folded upwardly perpendicularly to bottom panel 12 ′. rear ( side ) panel 16 ′ and front ( side ) panel 14 ′ will then be folded upwardly perpendicular to bottom panel 12 ′, as shown sequentially in fig1 a - 10d . top panel 18 ′ is then folded down , toward and parallel to bottom panel 12 ′; and outer end panels 34 ′, 36 ′ are folded over and adhered to inner end panels 22 ′, 24 ′, respectively . finally , reinforcing flanges ( minor flaps ) 38 ′, 40 ′, 42 ′ and 44 ′ are folded perpendicular along folds 37 ′, 39 ′, 41 ′ and 42 ′, respectively to outer end panels 34 ′, 36 ′, and adhesively adhered to the outer surfaces of front and rear ( side ) panels 14 ′, 16 ′. when top panel 18 ′ is folded down , closure flap 20 ′ is preferably folded to the outside of front panel 14 ′, and adhesively affixed to the outer surface thereof ( fig1 c and 10d ). a third variation of the design ( fig1 and 13 ) is similar to the variations of fig1 - 9 and 10 - 11 , except that the closure tab emanates from the free edge of the front panel 114 , and is trapezoidal . container 110 is formed from blank 111 ( fig1 ). blank 111 includes bottom panel 112 , front ( side ) panel 114 , rear ( side ) panel 116 , top panel 118 and closure flap 120 ; as well as fold lines 113 , 115 , 117 and 119 . blank 111 also includes inner end panels 122 , 124 ( emanating along fold lines 121 , 123 , respectively ) from which interior minor flaps 126 , 128 , 130 , 132 emanate along fold lines 125 , 127 , 129 and 131 , respectively . outer end panels 134 , 136 emanate from top panel 118 along fold lines 133 , 135 , respectively . reinforcing flanges 138 , 140 , 142 , 144 emanate from outer end panels 134 , 136 , along fold lines 137 , 139 , 141 and 143 , respectively . the end edges of panels 114 and 116 may be vertical . alternatively , the end edges of both rear panel 116 and front panel 114 preferably may be concavely bowed or notched ( as illustrated ), because this style of slot configuration may permit ease of removing and ease of stripping the waste material from the designated and created aperture in the blank sheet . as an alternative , rather than the described designated slot , a singular cut including offsets as required may be implemented , thereby eliminating a need to remove waste material . in a typical articulation procedure , first , the product to be contained will be pushed onto blank 111 , which will be laid flat on a packaging apparatus . flaps 130 , 132 will be folded perpendicular to panel 124 , and flaps 126 , 128 will be folded perpendicular to panel 122 . panels 122 , 124 will be folded upwardly perpendicularly to bottom panel 112 . rear ( side ) panel 116 and front ( side ) panel 114 will then be folded upwardly perpendicular to bottom panel 112 , as shown in fig1 a - 13d . top panel 118 is then folded down , toward and parallel to bottom panel 112 ; and outer end panels 134 , 136 are folded over and adhesively affixed to inner end panels 122 , 124 , respectively . finally , reinforcing flanges ( minor flaps ) 138 , 140 , 142 and 144 are folded perpendicular to outer end panels 134 , 136 , and adhesively adhered to the outer surfaces of front and rear ( side ) panels 114 , 116 . when top panel 118 is folded down , closure flap 120 is preferably folded to the inside of top panel 118 , and adhesively affixed to the inside surface thereof . in a fourth variation of the design ( fig1 ), which is generally similar to the embodiment of fig1 - 9 , the ratio of the width of the carton to the depth of the carton is still greater than one , but substantially less than in the variations of fig1 - 9 ; 10 - 11 ; or 12 - 13 . as such , the widths of the “ minor ” flaps equals one - half the width of the carton , so that the minor - flap - facing free edges meet or nearly meet , along the side - to - side midpoint of the carton , along the inside and outside surfaces of the front and rear panels . container 210 is formed from blank 211 ( fig1 ). blank 211 includes bottom panel 212 , front ( side ) panel 214 , rear ( side ) panel 216 , top panel 218 and closure flap 220 ; as well as fold lines positioned similarly to fold lines 13 , 15 , 17 and 19 of fig2 . blank 211 also includes inner end panels 222 , 224 ( emanating along fold lines positioned similarly to fold lines 21 , 23 , of fig2 , respectively ) from which interior minor flaps 226 , 228 , 230 , 232 emanate along fold lines positioned similarly to fold lines 25 , 27 , 29 and 31 of fig2 , respectively . outer end panels 234 , 236 emanate from top panel 218 along fold lines positioned similarly to fold lines 33 , of fig2 . reinforcing flanges 238 , 240 , 242 , 244 emanate from outer end panels 234 , 236 , along fold lines positioned similarly to fold lines 37 , 39 , 41 and 43 of fig2 , respectively . the end edges of rear panel 216 and front panel 214 may be concavely bowed or notched , or inwardly inclined from bottom to top , or vertical , as disclosed in previously described embodiments , if so desired or deemed necessary in accordance with the requirements of any particular application . in a typical articulation procedure , first , the product to be contained will be pushed onto blank 211 , which will be laid flat on a packaging apparatus . flaps 230 , 232 will be folded perpendicular to panel 224 , and flaps 226 , 228 will be folded perpendicular to panel 222 . panels 222 , 224 will be folded upwardly perpendicularly to bottom panel 212 . rear ( side ) panel 216 and front ( side ) panel 214 will then be folded upwardly perpendicular to bottom panel 212 , as shown in path a of fig1 . top panel 218 is then folded down , toward and parallel to bottom panel 212 ; and outer end panels 234 , 236 are folded over and adhesively affixed to inner end panels 222 , 224 , respectively . finally , reinforcing flanges ( minor flaps ) 238 , 240 , 242 , 244 are folded along folds 237 , 239 , 241 and 243 , respectively , perpendicular to outer end panels 234 , 236 , and adhesively adhered to the outer surfaces of front and rear ( side ) panels 214 , 216 and 220 . when top panel 218 is folded down , closure flap 220 is preferably folded to the outside of front minor flaps 228 and 234 , and adhesively affixed to the outer surface thereof , but to the inside of reinforcing flanges 242 , 238 , due to the breadth of those flanges . in an alternative embodiment of the method for forming the package , shown in path b , front panel 214 is not raised at the same time as rear panel 216 , and minor flaps 232 and 228 are likewise not folded inwardly , at the same time as flaps 230 , 226 . this provides for a “ tray - like ” function , in that instead of placing the product on bottom panel 212 , prior to any articulation , positioning of the product may be delayed until the configuration that is the first step ( as reflected by the arrow ) in path b is attained . in this configuration , because there is a “ back wall ’ formed by minor flaps 230 , 226 , the container can serve as a straightening or alignment structure , for more or less loosely collected , stacked or otherwise aligned , products . regardless of the path taken , the structure and configuration of the container according to fig1 will be the same , as shown in the right - hand side of that figure . a fifth variation of the design ( fig1 ) is similar to the design of fig1 - 9 , except that , upon articulation , the sides of the carton are all inclined , so that the resultant container is frusto - pyramidal in configuration . the frusto - pyramidal container is formed from blank 311 ( fig1 ). blank 311 includes bottom panel 312 , front ( side ) panel 314 , rear ( side ) panel 316 , top panel 318 and closure flap 320 ; as well as fold lines 313 , 315 , 317 and 319 . blank 311 also includes inner end panels 322 , 324 ( emanating along fold lines 321 , 323 , respectively ) from which interior minor flaps 326 , 328 , 330 , 332 emanate along fold lines 325 , 327 , 329 and 331 , respectively . outer end panels 334 , 336 emanate from top panel 318 along fold lines 333 , 335 , respectively . reinforcing flanges 338 , 340 , 342 , 344 emanate from outer end panels 334 , 336 , along fold lines 337 , 339 , 341 and 343 , respectively . the end edges of rear panel 316 may be concavely bowed ( as illustrated ), notched , inclined or vertical , while the end edges of front panel 314 may be vertical ( as illustrated ), inwardly inclined from bottom to top , or concave , because this style of slot configuration may permit ease of removing and ease of stripping the waste material from the designated and created aperture in the blank sheet . as an alternative , rather than the described designated slot , a singular cut including offsets as required may be implemented thereby eliminating a need to remove waste material . in a typical articulation procedure , first , the product to be contained will be pushed onto blank 311 , which will be laid flat on a packaging apparatus . flaps 330 , 332 will be folded perpendicular to panel 324 , and flaps 326 , 328 will be folded perpendicular to panel 322 . panels 322 , 324 will be folded upwardly perpendicularly to bottom panel 312 . rear ( side ) panel 316 and front ( side ) panel 314 will then be folded upwardly perpendicular to bottom panel 312 . top panel 318 is then folded down , toward and parallel to bottom panel 312 ; and outer end panels 334 , 336 are folded over inner end panels 322 , 324 , respectively . finally , reinforcing flanges ( minor flaps ) 338 , 340 , 342 and 344 are folded along folds 337 , 339 , 341 and 343 perpendicular to outer end panels 334 , 336 , and adhesively adhered to front and rear ( side ) panels 314 , 316 . when top panel 318 is folded down , closure flap 320 is preferably folded to the outside of front panel 314 , and adhesively affixed to the outer surface thereof . fold lines 329 , 331 , 325 , and 327 are all at non - perpendicular angles with respect to fold lines 323 , 321 , respectively . similarly , fold lines 341 , 343 , 337 and 339 are all at non - perpendicular angles with respect to fold lines 335 and 333 , respectively . in addition , panels 342 , 344 , 330 , 332 , 338 , 340 , 326 , 328 are all non - rectangular . further , bottom panel 312 is deeper , from front to back , than top panel 318 . thus , upon articulation , the resultant container has inwardly inclined front , rear , and end regions , to create a frusto - pyramidal container . a sixth variation of the design ( fig1 ) is similar to the design of fig1 - 13 , except that , upon articulation , the sides of the carton are all inclined , so that the resultant carton is frusto - pyramidal in configuration . the container is formed from blank 411 ( fig1 ). blank 411 includes bottom panel 412 , front ( side ) panel 414 , rear ( side ) panel 416 , top panel 418 and closure flap 420 ; as well as fold lines 413 , 415 , 417 and 419 . blank 411 also includes inner end panels 422 , 424 ( emanating along fold lines 421 , 423 , respectively ) from which interior minor flaps 426 , 428 , 430 , 432 emanate along fold lines 425 , 427 , 429 and 431 , respectively . outer end panels 434 , 436 emanate from top panel 418 along fold lines 433 , 435 , respectively . reinforcing flanges 438 , 440 , 442 , 444 emanate from outer end panels 434 , 436 , along fold lines 437 , 439 , 441 and 443 , respectively . the end edges of panels 414 and 416 may be vertical . alternatively , the end edges of both rear panel 416 and front panel 414 preferably may be concavely bowed or notched ( as illustrated ), because this style of slot configuration may permit ease of removing and ease of stripping the waste material from the designated and created aperture in the blank sheet . as an alternative , rather than the described designated slot , a singular cut including offsets as required may be implemented thereby eliminating a need to remove waste material . in a typical articulation procedure , first , the product to be contained will be pushed onto blank 411 , which will be laid flat on a packaging apparatus . flaps 430 , 432 will be folded perpendicular to panel 424 , and flaps 426 , 428 will be folded perpendicular to panel 422 . panels 422 , 424 will be folded upwardly perpendicularly to bottom panel 412 . rear ( side ) panel 416 and front ( side ) panel 414 will then be folded upwardly perpendicular to bottom panel 412 . top panel 418 is then folded down , toward and parallel to bottom panel 412 ; and outer end panels 434 , 436 are folded over inner end panels 422 , 424 , respectively . finally , reinforcing flanges ( minor flaps ) 438 , 440 , 442 and 444 are folded perpendicular to outer end panels 434 , 436 , and adhesively adhered to the outer surfaces of front and rear ( side ) panels 414 , 416 . when top panel 418 is folded down , closure flap 420 is preferably folded to the inside of top panel 418 , and adhesively affixed to the inside surface thereof . fold lines 429 , 431 , 425 , and 427 are all at non - perpendicular angles with respect to fold lines 423 , 421 , respectively . similarly , fold lines 441 , 443 , 437 and 439 are all at non - perpendicular angles with respect to fold lines 435 and 433 , respectively . in addition , panels 442 , 444 , 430 , 432 , 438 , 440 , 426 , 428 are all non - rectangular . further , bottom panel 412 is deeper , from front to back , than top panel 418 . thus , upon articulation , the resultant container has inwardly inclined front , rear , and end regions , to create a frusto - pyramidal container . the seventh variation ( fig1 a - 19f ) of the design are similar to the basic design of fig1 - 9 ; except that the front panel is substantially shorter than the rear panel , to create an open display region , and lines of weakness are provided in the closure tab , along the middle portions of the front , rear , and side edges of the top panel and along diagonals at the corners of the top panel . this permits the bulk of the top panel to be removed , leaving triangular - shaped top panel sections remaining , for strength , stability and stacking ability . container 510 is formed from blank 511 . blank 511 includes bottom panel 512 , front ( side ) panel 514 , rear ( side ) panel 516 , top center panel 518 a with top corner panels 518 b - 518 d , and closure flap 520 ; as well as fold lines 513 , 515 , 517 a and 517 d and 519 a and 519 d . blank 511 also includes inner end panels 522 , 524 ( emanating along fold lines 521 , 523 , respectively ) from which interior minor flaps 526 , 528 , 530 , 532 emanate along fold lines 525 , 527 , 529 and 531 , respectively . outer end panels 534 , 536 emanate from top center panel 518 a and its respective corner panels , along fold lines 533 b - c , 535 b - c , and perforations 533 a , 535 a , respectively . reinforcing flanges 538 , 540 , 542 , 544 emanate from outer end panels 534 , 536 , along fold lines 537 , 539 , 541 and 543 , respectively . blank 511 also includes perforation lines 517 b , 517 c , 518 g - j , 519 b and 519 c , as well as apertures 518 f and 520 d . the end edges of panels 514 and 516 may be vertical . alternatively , the end edges of rear panel 516 preferably may be concavely bowed and the end edges of front panel 514 preferably may be inwardly inclined from bottom to top ( both as illustrated ), because this style of slot configuration may permit ease of removing and ease of stripping the waste material from the designated and created aperture in the blank sheet . as an alternative , rather than the described designated slot , a singular cut including offsets as required may be implemented thereby eliminating a need to remove waste material . in a typical articulation procedure , first , the product to be contained will be pushed onto blank 511 , which will be laid flat on a packaging apparatus . flaps 530 , 532 will be folded perpendicular to panel 524 , and flaps 526 , 528 will be folded perpendicular to panel 522 . panels 522 , 524 will be folded upwardly perpendicularly to bottom panel 512 . rear ( side ) panel 516 and front ( side ) panel 514 will then be folded upwardly perpendicular to bottom panel 512 , as shown sequentially in fig1 a and 19 a - 19 f . top panel 518 is then folded down , toward and parallel to bottom panel 512 ; and outer end panels 534 , 536 are folded over and adhesively adhered to the outer surfaces of inner end panels 522 , 524 , respectively . finally , reinforcing flanges ( minor flaps ) 538 , 540 , 542 and 544 are folded perpendicular to outer end panels 534 , 536 , and adhesively adhered to the outer surface of rear ( side ) panel 516 , outer surface of front ( side ) panel 514 and outer surfaces of closure flap 520 , specifically outer surfaces of top closure front panels 520 c and 520 b . when top panel 518 is folded down , closure flap 520 is preferably folded to the outside surfaces of interior minor flaps 532 and 528 and adhesively affixed to the outer surface thereof . instead of ripping or cutting the container apart , as in other wraparound container constructions , access to the interior of container 510 is achieved , via removal of top center panel 518 a , tearing along perforation lines 533 a , 518 h , 517 b , 517 c , 518 j , 535 a , 518 i , 519 c , 519 b and 518 g , leaving behind a display tray having four corner posts , with triangular top corner panels for still enabling stacking of the opened tray . fig1 a - 19f show different ways in which articulation of blank 511 may be accomplished , to arrive at the fully articulated configuration of fig1 f . in the eighth variation of the design ( fig2 - 24 ), there is no closure tab along either of the leading or trailing edges of the blank . instead , there are trapezoidal areas of both the top and front panels that are die cut out , to leave an open area along the top and front panels , for display and dispensing purposes , without removal of material from the carton . container 610 is formed from blank 611 ( fig2 ). blank 611 includes bottom panel 612 , front ( side ) panel 614 , rear ( side ) panel 616 , and top panel 618 ; as well as fold lines 613 , 615 , and 617 . blank 611 also includes inner end panels 622 , 624 ( emanating along fold lines 621 , 623 , respectively ) from which interior minor flaps 626 , 628 , 630 , 632 emanate along fold lines 625 , 627 , 629 and 631 , respectively . outer end panels 634 , 636 emanate from top panel 618 along fold lines 633 , 635 , respectively . reinforcing flanges 638 , 640 , 642 , 644 emanate from outer end panels 634 , 636 , along fold lines 637 , 639 , 641 and 643 , respectively . the end edges of rear panel 616 may be concavely bowed ( as illustrated ), notched , inclined or vertical , while the end edges of front panel 614 may be vertical ( as illustrated ), inwardly inclined from bottom to top , or concave , because this style of slot configuration may permit ease of removing and ease of stripping the waste material from the designated and created aperture in the blank sheet . as an alternative , rather than the described designated slot , a singular cut including offsets as required may be implemented thereby eliminating a need to remove waste material . in a typical articulation procedure , first , the product to be contained will be pushed onto blank 611 , which will be laid flat on a packaging apparatus . interior minor flaps 630 , 632 will be folded perpendicular to end panel 624 , and interior minor flaps 626 , 628 will be folded perpendicular to end panel 622 . end panels 622 , 624 will be folded upwardly perpendicularly to bottom panel 612 . rear ( side ) panel 616 and front ( side ) panel 614 will then be folded upwardly perpendicular to bottom panel 612 and be adhesively affixed to exterior surfaces of interior minor flaps 626 , 628 , 630 and 632 . top panel 618 is then folded down , toward and parallel to bottom panel 612 ; and outer end panels 634 , 636 are folded over and adhesively affixed to exterior surfaces of inner end panels 622 , 624 , respectively . finally , reinforcing flanges ( minor flaps ) 638 , 640 , 642 and 644 are folded along folds 637 , 639 , 641 and 643 perpendicular to outer end panels 634 , 636 , and adhesively adhered to the outer surfaces of front and rear ( side ) panels 614 , 616 . in a ninth variation of the invention ( fig2 and 26 a - c ), the container is provided with gusseted corner panel structures , instead of minor flaps emanating from the inner end panel side edges , to create a so - called “ slotless ” container . container 710 is formed from blank 711 ( fig2 ). blank 711 includes bottom panel 712 , front ( side ) panel 714 , rear ( side ) panel 716 , top panel 718 and closure flap 720 ; as well as fold lines 713 , 715 , 717 and 719 . blank 711 also includes inner end panels 722 , 724 ( emanating along fold lines 721 , 723 , respectively ) from which interior minor flaps 726 , 728 , 730 , 732 emanate along fold lines 725 , 727 , 729 and 731 , respectively . outer end panels 734 , 736 emanate from top panel 718 along fold lines 733 , 735 , respectively . reinforcing flanges 738 , 740 , 742 , 744 emanate from outer end panels 734 , 736 , along fold lines 737 , 739 , 741 and 743 , respectively . in addition , blank 711 includes gusset panels 726 a , 726 b , 730 a , 730 b , 728 a , 728 b , 732 a and 732 b ; gusset fold lines 726 c , 730 c , 728 c and 732 c ; and gusset notches 726 d , 730 d , 728 d and 732 d . blank 711 also includes clearance diecuts 716 c , 716 d . in a typical articulation procedure , first , the product to be contained will be pushed onto blank 711 , which will be laid flat on a packaging apparatus . interior end panels 722 , 724 will be folded upwardly perpendicularly to bottom panel 712 , while rear ( side ) panel 716 and front ( side ) panel 714 are drawn by the corner gusset structures to be folded upwardly perpendicular to bottom panel 712 , as shown in fig2 a - 26c . at each corner , the respective gusset panel pairs are folded inwardly , so that panels 730 b , 726 b are brought parallel to the inside surface of panel 716 , capturing and adhesively affixing panels 730 a , 726 b between them , respectively ; and panels 728 b , 732 b are brought parallel to the inside surface of panel 714 , capturing and adhesively affixing panels 728 a , 732 a between them , respectively . top panel 718 is then folded down , toward and parallel to bottom panel 712 ; and outer end panels 734 , 736 are folded over inner end panels 722 , 724 , respectively . finally , reinforcing flanges ( minor flaps ) 738 , 740 , 742 and 744 are folded along fold lines 737 , 739 , 741 and 743 , respectively , perpendicular to outer end panels 734 , 736 , and adhesively adhered to the outer surfaces of front and rear ( side ) panels 714 , 716 . when top panel 718 is folded down , closure flap 720 is preferably folded to the outside of front panel 714 , and adhesively affixed to the outer surface thereof ( fig2 c ). the resultant container 710 is thus a “ slotle ss ” container , suitable for the prevention of leakage of liquids ( if suitably coated on the inside surfaces thereof ), and otherwise suitable for the prevention of leakage of granular or particulate dry materials . in a tenth variation of the invention ( fig2 and 28 a - c ), a container similar to that of the embodiment of fig1 - 9 is provided with a second closure flap , so that the two closure flaps from the top and front panels overlap to form a reinforced “ bar ” across the front of the container , at what would otherwise be the weakest corner region , depending upon the proportions , of the sealed container . container 810 is formed from blank 811 ( fig2 ). blank 811 includes bottom panel 812 , front ( side ) panel 814 , rear ( side ) panel 816 , top panel 818 and top closure flap 820 and front closure flap 852 ; as well as fold lines 813 , 815 , 817 , 819 and 850 . blank 811 also includes inner end panels 822 , 824 ( emanating along fold lines 821 , 823 , respectively ) from which interior minor flaps 826 , 828 , 830 , 832 emanate along fold lines 825 , 827 , 829 and 831 , respectively . outer end panels 834 , 836 emanate from top panel 818 along fold lines 833 , 835 , respectively . reinforcing flanges 838 , 840 , 842 , 844 emanate from outer end panels 834 , 836 , along fold lines 837 , 839 , 841 and 843 , respectively . the end edges of panels 814 and 816 may be vertical . alternatively , the end edges of the rear panel 816 and front panel 814 preferably may be concavely bowed or notched ( as illustrated ) or inwardly inclined from bottom to top because this style of slot configuration may permit ease of removing and ease of stripping the waste material from the designated and created aperture in the blank sheet . as an alternative , rather than the described designated slot , a singular cut including offsets as required may be implemented thereby eliminating a need to remove waste material . in a typical articulation procedure , first , the product to be contained will be pushed onto blank 811 , which will be laid flat on a packaging apparatus . flaps 830 , 832 will be folded perpendicular to panel 824 , and flaps 826 , 828 will be folded perpendicular to panel 822 . panels 822 , 824 will be folded upwardly perpendicularly to bottom panel 812 . rear ( side ) panel 816 and front ( side ) panel 814 will then be folded upwardly perpendicular to bottom panel 812 , as shown in fig2 a - 28c . top panel 818 is then folded down , toward and parallel to bottom panel 812 ; and outer end panels 834 , 836 are folded over inner end panels 822 , 824 , respectively . finally , reinforcing flanges ( minor flaps ) 838 , 840 , 842 and 844 are folded along fold lines 837 , 839 , 841 and 843 perpendicular to outer end panels 834 , 836 , and adhesively adhered to the outer surfaces of front and rear ( side ) panels 814 , 816 . when top panel 818 is folded down , closure flap 820 is preferably folded to the outside of front panel 814 , and adhesively affixed to the outer surface thereof , while front closure panel 852 is folded inwardly , and affixed to the underside surface of top panel 818 , both as shown in fig2 c . the foregoing description and drawings merely explain and illustrate the invention and the invention is not limited thereto , as those skilled in the art who have the disclosure before them will be able to make modifications and variations therein without departing from the scope of the invention . | 1 |
referring now to fig1 wherein like reference numerals designate like or similar parts throughout the several views , there is illustrated a fiber optic microcable 10 embodying various features of the present invention . the microcable 10 includes an optical waveguide 13 comprising an optical fiber core 12 surrounded by a buffer 14 , a protective sheath 16 composed of an ultraviolet light cured polymeric resin 17 impregnated with reinforcing fibers 18 , and an overcoat 19 composed of an ultraviolet light cured polymeric resin 21 . by way of example , fiber core 12 may be corning single mode dispersion shifted optical fiber , and buffer 14 may be a corning cpc 3 buffer . desirable buffer characteristics include acceptable microbending isolation over a wide range of temperatures , high dimensional uniformity , good adhesion to the ultraviolet light cured first resin , and low cost . reference to the optical fiber core 12 implicitly includes reference to cladding ( not shown ) and the substrate ( not shown ) surrounding the core . it is to be understood that hereinafter , unless otherwise stated , all references to the core 12 also refer to the cladding and substrate . fibers 18 , which may be fiberglass filaments grouped as yarns or rovings , enhance the resistance of the microcable 10 to physical damage which may result from tensile or bending forces to which the microcable may become subjected . although the fibers 18 have been described as being composed of fiberglass , it is to be understood that it is within the scope of this invention for the fibers to be composed of other materials , as for example , boron , nylon , carbon graphite , ceramic , or aromatic polyamide polymers such as &# 34 ; kevlar ,&# 34 ; a product of the dupont chemical corporation , and which may be grouped as yarns , rovings or single filaments . by way of example , fibers 18 may be owens - corning fiberglass ecg150 - 1 / 0 -. 7z with a 603 - 0 finish . the fibers 18 are preferably suspended in the resin 17 generally parallel to optical fiber core 12 . the reinforcing fibers may constitute 50 to 90 percent by volume of the fiber / resin composite mixture which defines the protective sheath 16 . an important advantage of the microcable 10 is that it may be manufactured to have a generally uniformly concentric cross - sectional area attributable to rapid cure of the ultraviolet light curable resin 17 . although fibers 18 have been described as running parallel to optical fiber core 12 , it is within the scope of the invention for fibers 18 to be suspended in other patterns in the resin , as for example , a helical or woven pattern around optical fiber core 12 . referring to fig2 there is shown a system 20 for manufacturing the microcable 10 which includes fibers 18 , preferably composed of fiberglass , dispensed from storage bobbins 26 . the fibers 18 are subjected to back tension , which may be 0 . 1 newtons , and which may be controlled by textile tensioners 24 . the fibers 18 are individually drawn through ceramic guides 28a and then over a first set of guide pins 30a . the fibers proceed through a staggered series of ceramic pins 32 in a temperature controlled wetting pan 34 containing uncured ultraviolet light curable resin 17 . the uncured resin 17 is maintained at a temperature preferably in the range from 27 °- 70 ° c . to facilitate wetting the fibers 18 . any air which may become entrapped in the resin 17 which wets the fibers 18 is released as the wetted fibers pass over and under ceramic pins 32 . referring to fig2 and 3 , the wetted fibers 18 are drawn over a second set of guide pins 30b , exit wetting pan 34 and then individually pass through ceramic guides 28b . the wetted fibers proceed through ceramic guides 39 mounted in comb plate 38 so that fibers 18 are preferably radially distributed around the optical waveguide 13 . the optical waveguide 13 is fed from a spool 40 through a heater 42 preferably maintained at a temperature of about 250 ° f . which is used to drive residual moisture from the optical fiber buffer . the optical waveguide 13 is fed through the heater 42 at a speed such that the optical waveguide is exposed to the heater for a time period preferably in the range of about 1 - 2 seconds . the optical waveguide 13 then continues on through ceramic guide 43 mounted in comb plate 38 . fig2 is presented by way of example only . within the scope of the invention , fewer or greater numbers of fibers 18 may be utilized than are actually shown . after exiting comb plate 38 , fibers 18 and optical fiber core 12 with accompanying buffer 14 converge as they pass through a circular aperture 44 of a heated tungsten - carbide forming die 44a to form a matrix 46 as shown in fig2 . the diameter of aperture 44 determines the diameter and fiber / resin ratio of microcable 10 . numerical reference 47 represents alternative species of methods for curing matrix 46 . the first species is encompassed within lamp housing 48 illustrated in fig4 and 5 . the second species is encompassed within lamp housings 62 and 74 illustrated in fig6 and 8 . a single - stage method for curing matrix 46 is illustrated in fig4 and 5 wherein after exiting aperture 44 shown in fig2 the matrix 46 enters a lamp housing 48 . the matrix passes through a quartz tube 50 within the lamp housing in approximately 0 . 5 seconds through which it is irradiated at an intensity of approximately 100 , 000 microwatts / cm 2 by a single - stage electromagnetic radiation source 52 emitting ultraviolet light at a wavelength of anywhere from 290 to 400 nanometers . quartz tube 50 shields matrix 46 from infrared radiation generated by electromagnetic radiation source 52 while being transparent to ultraviolet radiation . quartz tube 50 may advantageously be filled with an inert gas such as nitrogen or helium so that matrix 46 is immersed within an inert gas atmosphere to improve cooling of the matrix 26 as the resin 17 cures and to prevent undesirable chemical reactions from occurring between atmospheric oxygen and the resin 17 . a quartz plate 53 , which may be 0 . 32 cm thick , may be mounted between electromagnetic radiation source 52 and quartz tube 50 to further shield matrix 46 from infrared radiation . the longitudinal axis of electromagnetic radiation source 52 is generally coincident with a focal axis a -- a of a semi - elliptically shaped mirror 54 . the longitudinal axis of quartz tube 50 is generally coincident with a focal axis b -- b of a semi - elliptically shaped mirror 56 . the reflective concave surface of mirror 54 faces the reflective concave surface of mirror 56 so that the reflective surfaces of both mirrors define an elliptical mirror having focal axes a -- a and b -- b . ultraviolet light from electromagnetic radiation source 52 both propagates directly towards matrix 46 and reflects off of mirror 54 to mirror 56 , and then converges on focal axis b -- b so that matrix 46 is irradiated from a 360 ° field . dry nitrogen injected into quartz tube 50 through nipples 58 displaces oxygen which can inhibit polymerization of the resin 17 and cools the matrix while it cures . the resin 17 cures almost instantaneously upon exposure to the ultraviolet light , causing the resin to adhere to the optical buffer 14 . of course , matrix 46 may be conveyed through two or more lamp housings 48 arranged in series in order to increase the ultraviolet light exposure of matrix 46 as a way of increasing the production rate of the fabrication system , providing the temperature of the matrix 46 does not reach a level that would degrade any of the materials that comprise matrix 46 . an alternative to the single - stage method for curing the resin 17 , as described above , is a two - stage curing method illustrated in fig6 , and 8 , collectively , wherein after exiting aperture 44 shown in fig2 matrix 46 enters lamp housing 62 . within the lamp housing , the matrix 46 passes through a quartz tube 64 through which it is irradiated at a medium intensity of 5000 to 10 , 000 microwatts / cm 2 by an electromagnetic radiation source 66 emitting ultraviolet light at a wavelength of approximately 290 nanometers . the ultraviolet light polymerizes the outer regions of the resin 17 . because the outer surface of the resin 17 is cured , the curing matrix 46 does not sag out of round during subsequent curing . quartz tube 64 shields matrix 46 from infrared heat generated by electromagnetic radiation source 66 while being transparent to ultraviolet radiation . the longitudinal axis of electromagnetic radiation source 66 is generally coincident with a focal axis c -- c of a semi - elliptically shaped mirror 68 . the longitudinal axis of quartz tube 64 is generally coincident with a focal - axis d -- d of a semi - elliptically shaped mirror 70 . the reflective concave surface reflective concave surface of mirror 68 faces the reflective concave surface of mirror 70 so that the reflective surfaces of both mirror define an elliptical mirror having focal axis c -- c and d -- d . ultraviolet light from electromagnetic radiation source 66 propagates directly towards matrix 46 and reflects off of mirror 68 to mirror 70 , and then converges on focal axis d -- d so that matrix 46 is irradiated from a 360 ° field . dry nitrogen injected into quartz tube 64 through nipples 72 displaces oxygen which can inhibit polymerization of the outer regions of the resin 17 and also serves to cool the matrix 46 . referring to fig6 , and 8 , after exiting lamp housing 62 , the matrix 46 enters lamp housing 74 where the partially cured resin 17 passes between four low intensity ultraviolet lamps 76 which irradiate matrix 46 with ultraviolet light having a wavelength of about 360 nanometers at a relatively low intensity of approximately 2 , 000 microwatts / cm 2 . the longer ultraviolet light wavelength is able to penetrate more deeply into the curing resin of the matrix 46 than does shorter wavelength ultraviolet light . this second curing stage completes polymerization of resin 17 . the purpose of the two - stage curing process is to limit the overall temperature rise of the matrix 46 to no more than 100 ° c . although the microcable 10 has been described as having one layer of the protective sheath 16 , it is to be understood that the microcable 10 may have one or more layers of protective sheathing as required to suit the requirements of a particular application . referring now to fig2 after the resin 17 is cured , the matrix 46 enters a traction or capstan drive 61 which feeds the matrix 46 through the various manufacturing processing stages in the manufacture of the microcable . the matrix 46 then enters a foam block 63 that preferably includes a section of open cell polyurethane foam that provides a wiping surface which tends to break away any stray fibers 18 that protrude from the surface of the protective sheath 16 . after exiting the foam block 63 , the matrix 46 is fed through an air wipe 65 that directs pressurized air over the surface of matrix 46 to blow off any broken reinforcing fibers 18 or dust particles from the surface of the protective sheath 16 of the matrix . the matrix 46 then enters a second open cell foam block 63 used to dampen vibration or strumming of the of matrix 46 generated by the air wipe 65 . an alternative to the second open cell foam block 63 may be a nipple or guide eyelet , not shown , through which the matrix passes , having a diameter slightly greater than the matrix 46 so as to eliminate vibration of the matrix 46 . the matrix 46 next is directed through a pressurized flow coating head 67 where the ultraviolet light curable resin 21 which forms the overcoat 19 is applied around the protective sheath 16 of the matrix 46 . the wall thickness of the overcoat 19 is preferably in the range of about 0 . 0007 to 0 . 0015 inches . the exit diameter of the pressurized flow coating head 67 determines the final outside diameter of the microcable 10 . by way of example , the flow coating head 67 may implemented as a fiber optic flow coating system manufactured by sancliff , inc ., worchester , mass . the matrix 46 then enters a second ultraviolet light curing station 47 in which polymerization of the resin 21 transforms a section of the matrix 46 into a completed section of microcable 10 having an unfilled overcoat 19 , as shown in fig1 . optionally , after the resin 17 has been cured , the surface of the protective sheath 16 may be washed with ions 65b provided by an ion generator 65a to prevent the build - up of static electricity on the matrix 46 and to maintain the cleanliness of the protective sheath 16 before the overcoat 19 is applied . referring to fig2 the cured microcable 10 is preferably under constant tension established by a tension control dancer arm 69 , set at a tension which may range from about 5 to 10 pounds . the microcable 10 is taken up , or spooled onto a storage spool 78 driven by means well known by those skilled in the art , as for example , by an electric motor 80 coupled to the spool 78 by a &# 34 ; v &# 34 ;- belt 82 . the fiber optic microcable 10 may then be stress relieved by soaking the cooled fiber optic microcable in an atmosphere having a temperature of approximately 70 ° c . for about four hours , and then allowing the microcable to air cool . the microcable 10 may also be stress relieved by allowing the microcable to soak at room temperature for a few days . the resin 17 preferably has a young &# 39 ; s modulus ranging from approximately 700 , 000 to 2 , 500 , 000 kpa after cure , a post - cure tensile strength of approximately 28 , 000 to 56 , 000 kpa , an uncured viscosity of less than 250 centipoise within the range of 27 ° c . to 60 ° c ., moisture absorption of less than one percent in 24 hours of water immersion after cure , strain to failure of 11 / 2 after cure , and a glass transition temperature from 60 ° c . to 105 ° c . after cure . furthermore , resin 17 polymerizes or cures when exposed to electromagnetic radiation having a wavelength anywhere from 290 to 400 nanometers . by way of example , good results have been obtained using ultraviolet light curable resins such as desoto , inc . no . 3287 - 5 - 9 , master bond , inc . no . 17d - 1a , and borden 9mku11127r for use in the protective sheath 16 , although the scope of the invention also includes the use of other suitable resins . the ultraviolet light curable resin 21 provides the microcable 10 with a smooth unfilled overcoat 19 , as shown in fig1 . the cured resin 21 should also have good adhesion to the protective sheath 16 . by way of example , resins suitable for use in the overcoat sheath 19 may include desoto , inc . no . 32b7 - 9 - 29 , although it is to be understood that other suitable resins may also be employed . obviously , many modifications and variations of the present invention are possible in the light of the above teachings . it is therefore to be understood that within the scope of the appended claims the invention may be practiced otherwise than as specifically described . | 6 |
fig1 plots energy - dependent mass attenuation coefficients ( μ / ρ )( e ) in cm 2 / g for various materials , μ denoting the attenuation , ρ the density and e the energy . on the x - axis 1 the values of the photon energy are given in kev ( kiloelectron volts ), while the associated mass attenuation coefficients in are plotted on the y - axis 2 in logarithmic form . curve 3 represents the energy - dependent characteristic of the mass attenuation coefficient for iodine , curve 4 that for calcium , curve 5 the characteristic for bony tissue , and curves 6 and 7 the energy - dependent mass attenuation coefficients for water and fatty tissue . according to curve 3 , iodine exhibits the highest mass attenuation coefficient over the entire energy range , while that for fatty tissue according to curve 7 is the lowest . most closely comparable to the progression of curve 7 for fatty tissue is the progression of the mass attenuation coefficient as a function of energy for water according to curve 6 . at lower energies , bony tissue and calcium exhibit much higher mass attenuation coefficients compared to curves 6 and 7 . at higher energies , curve 5 increasingly approximates to curves 6 and 7 for water and fatty tissue respectively . on the other hand , according to curve 4 calcium also has a noticeably greater mass attenuation coefficient in the region of 140 kev . fig2 shows four typical dual - energy spectra according to curves 8 , 9 , 10 and 11 . these spectra are normalized spectra for various voltages and pre - filterings , the quantum energy in kev being plotted on the x - axis 12 , while the normalized intensity is plotted on the y - axis 13 . curve 8 represents the energy - dependent intensity for a voltage of 60 kv with pre - filtering by 0 . 1 mm copper , while curve 9 is based on pre - filtering by 0 . 3 mm copper at the same voltage . curves 10 and 11 are each assigned to voltages of 150 kv , curve 10 representing the spectrum for pre - filtering with 0 . 1 mm copper , and curve 11 that for pre - filtering with 0 . 3 mm copper . whereas , for the lower voltages , curves 8 and 9 correspondingly show a clear peak at lower quantum energies and the respective intensity value has already fallen to 0 at 60 kev , at the higher voltages the spectra are broader and instead exhibit two smaller peaks . the different pre - filterings result in further deviations in the curve shapes , e . g . at low voltage in a shift of the peak into the higher - energy region . as the respective spectra should overlap as little as possible at lower or higher voltage , it is advisable e . g . to pre - filter at 60 kv with only 0 . 1 mm copper , but at 150 kv with 0 . 3 mm copper . fig3 and 4 show illustrations of the quantitative inaccuracy when using a constant inversion matrix as compared to a measured - value - dependent matrix . plotted on the x - axis 14 in fig3 is an actual bone thickness in grams per cm 2 ( g / cm 2 ), while the reconstructed thickness is shown on the y - axis 15 , likewise in grams per cm 2 . the exact , nonlinear inversion corresponds , for bony tissue , to curve 16 . curve 17 represents the clearly deviating characteristic when using a constant matrix , i . e . an approximation instead of the exact matrix , for 20 cm water and 0 cm bony tissue , the curve 18 the results for a constant matrix for 20 cm water and 5 cm bony tissue . the exact ratios corresponding to nonlinear inversion are given by curve 19 for water , the approximations for 20 cm water with 5 cm bony tissue by curve 20 , and for 20 cm water with 0 cm bony tissue by curve 21 . the associated reconstruction errors in grams per cm 2 ( g / cm 2 ) are plotted on the y - axis 22 of fig4 against the true bone thickness in grams per cm 2 on the x - axis 23 . curves 24 for bone and 25 for water represent the errors for 20 cm water and 5 cm bone respectively , while curves 26 and 27 for bone and water respectively show the reconstruction error for 20 cm water and 0 cm bony tissue . these curves 24 - 27 indicate that the reconstruction errors may well be in the order of several grams per cm 2 . even in the case of 20 cm water and 5 cm bony tissue according to curves 24 and 25 , deviations of almost 2 grams per cm 2 are possible at high actual bone densities . even at very low actual bone densities , the deviations are more than one gram per cm 2 . in the case of 20 cm water and 0 cm bone , the error increases to some ± 5 g / cm 2 for an actual bone thickness of 10 g / cm 2 . accordingly , for meaningful quantitative imaging it is unacceptable to disregard the measured value dependence of the matrix . lastly , fig5 and 6 show simulated results of an inventive method for image noise reduction . the illustration relates to a simulation object in the form of a homogeneous layer of water with a thickness of 20 cm above which are disposed circular disks of bone with diameters of 20 pixels each whose mass densities vary between 50 and 250 mg / cm 2 in increments of 50 mg / cm 2 . the radiation source used is an x - ray tube with a tungsten anode and internal filtering corresponding to 2 . 5 mm aluminum . the detector is a flat - panel detector with cesium iodide with a density of 100 mg / cm 2 as scintillator material . the radiation spectra employed are spectra with a voltage of 70 kv with pre - filtering of 0 . 1 mm copper and with a voltage of 150 kv with pre - filtering of 0 . 3 mm copper respectively . taken as the basis for the noise of the measured signal at the detector is a noise equivalent quantum number of 1000 , the relative standard deviation of the noise for each detector pixel corresponding to the first row 28 shows the unfiltered bone image according to the additionally specified equation ( 1 ) a ( p ) − 1 )( p ). the second row 29 shows the reconstruction result of the inventive operator smoothing method according to equation ( 2 ) a ( s p ) − 1 ( p ). this allows improved object recognition . accordingly the result shows fewer errors . row 30 finally shows the reconstruction result for combining the operator smoothing method with subsequent image smoothing according to the formula ( 3 ) sa ( s p ) − 1 ( p ). in fig6 , pixel counts are plotted on the horizontal axis 31 , while the error in grams per cm 2 ( g / cm 2 ) with noise filtering according to matrix formulas ( 1 ), ( 2 ) and ( 3 ) is plotted on the vertical axis 32 . it can be seen from this that for exact inversion without filtering according to column 33 ( for matrix formula ( 1 )) even larger errors occur , which are already significantly reduced in the case of the operator smoothing method of the invention according to column 34 ( formula ( 2 )). a further error reduction is achieved by combination with subsequent image filtering using a 5 × 5 mask according to column 35 ( formula ( 3 )). when the operator smoothing method is combined with subsequent image smoothing , the error can be continuously kept below 0 . 2 g / cm 2 . even when simply using the operator smoothing method according to column 34 without subsequent smoothing , errors of more than 0 . 4 g / cm 2 rarely occur . the inventive noise filtering which is incorporated in an inversion operator therefore provides a significant improvement in quantitative imaging in the context of dual - spectrum projection imaging . | 6 |
turning to fig1 there is shown a sheet 2 for personal time management according to the present invention . the illustrated sheet covers a period of time of one week , although it will be understood that any desired time period may be covered on a single sheet with appropriate modifications to the layout . the sheet is divided generally into an activity section 4 comprising a wide vertical column 6 divided into spaces 8 by a series of horizontal lines 10 . into each of these activity spaces 8 may be written an intended activity , appointment , action or the like . to the right , in activity section 4 , is a column 12 designated to receive an indication of the result or outcome of each such activity . in the embodiment illustrated , each indicated activity space 8 is designated with a code letter 14 to be used as will be discussed shortly . also , to facilitate use of the activity section 4 and minimize the writing required , priority column 20 , delegation column 22 and activity designation columns 24 are provided as indicated . the user may indicate the priority of the item listed in activity space 8 in the corresponding portion of priority column 20 . he may indicate in the corresponding portion of delegation column 22 a person to whom an activity set out in the corresponding activity space 8 is delegated . he may check the manner in which the activity set out in corresponding activity space 8 is to be acted upon by appropriately noting one of the columns of activity designation columns 24 . in this latter instance , while &# 34 ; think &# 34 ;, &# 34 ; write &# 34 ;, &# 34 ; call &# 34 ;, &# 34 ; see &# 34 ;, and &# 34 ; read &# 34 ; designations illustrated in these columns , it will be obvious to one skilled in the art that other activity designations may be included with , or used to replace some or all of , the illustrated activity designation columns 24 . alternatively it may be desired to relate the activities set out in activity space 8 to a particular objective of the user , and activity designation columns 24 might then be replaced with designations such as &# 34 ; corporate &# 34 ;, &# 34 ; personal &# 34 ;, &# 34 ; health and fitness &# 34 ;, &# 34 ; friends &# 34 ;, &# 34 ; community &# 34 ;, &# 34 ; training &# 34 ;, &# 34 ; coaching associates &# 34 ;, &# 34 ; career &# 34 ;, &# 34 ; travel &# 34 ;, &# 34 ; leisure &# 34 ;, &# 34 ; security &# 34 ;, &# 34 ; inflexible obligations &# 34 ;, and the like . finally , in activity section 4 is illustrated a section 30 at the top intended to receive a designation of a goal or goals for the week in question and section 32 at the bottom , for setting out a particular achievement or achievements for the week in question . it will be understood that with activity section 4 , as with other sections of the personal time management sheet according to the present invention , the format may be adopted to suit particular circumstances and layout requirements . thus , activity code numbers may be unnecessary or may be altered to take different forms , result , priority , delegation and activity designation columns 12 , 20 , 22 and 24 respectively , may be rearranged or used or not used as required or desired , and goal and achievement sections 30 and 32 may or may not be used as required or desired . to the left of activity section 4 there is provided a calendar section 40 made up of two parts , one containing a vertical column 42 extending the length of and positioned beside the activity section , and the other containing a series of blocks 44 , one block representing each day in the time period to which the sheet applies . column 42 is subdivided through its length into adjacent vertical subcolumns 46 , one such subcolumn being designated for each day in the time period . the subcolumns 46 are also further divided into portions 47a and 47b directed respectively to morning and afternoon periods of the day . it will be noted that lines 10 from activity section 4 extend through subcolumns 46 and thereby provide a grid unit 48 in each subcolumn particular to each activity space ( i . e . for each day in the time period there is a grid unit corresponding to each of the subcolumns 46 and each of the activity spaces 8 ). blocks 44 , representing monday to friday in the time period , are subdivided into a series of spaces 50 , marked by time designations 52 as indicated to sequentially designate times in a day . one such space 50 in each block 44 represents a different one of such times . it will be noted that for those blocks 44 designating saturday and sunday , the blocks are not subdivided in a manner so as to show times in those days . referring to fig2 it will be understood that fifty - two of such weekly sheets 2 , or any desired number of such sheets to cover a particular time period , may be bound into a book 60 to provide a time management instrument covering a year or other period of time . as an example of the use and operation of these sheets , at the beginning of a particular week in question , a user may set out the planned activities of which he has before him for that particular week . as well , he will have already appearing on that sheet any previously arranged appointments . if , for example , there is a meeting with henry adams on tuesday morning of that week at 9 : 15 , this appointment is / or has been recorded simply by noting henry adams &# 39 ; name in a work activity space 8 , ticking the &# 34 ; see &# 34 ; column in the activity designation columns 24 , indicating with a &# 34 ;/&# 34 ; or other appropriate notation on the same line under the tuesday morning segment of the subcolumn 46 representing tuesday in the column 42 , and writing the corresponding activity code 14 (&# 34 ; b &# 34 ; in this example ) in the calendar block 44 representing tuesday , in the 9 : 15 space 50 . if , subsequently , this appointment were changed to wednesday afternoon at 2 : 15 , instead of having to erase henry adams &# 39 ; name from the activity section 8 and move it to a different location , the user now merely places another &# 34 ;/&# 34 ; notation in the wednesday afternoon subcolumn 46 , and moves the &# 34 ; b &# 34 ; code designation from the tuesday calendar block 44 to the wednesday calendar block 44 at 2 : 15 . when an activity such as a meeting is carried out , if &# 34 ;/&# 34 ; is the designation used to indicate intended activities in subcolumns 46 , then another stroke through that designation to make an &# 34 ; x &# 34 ; may be used to indicate that that activity has been completed . many advantages which are relatively significant in documentation for time management , are achieved according to the present invention . for instance , it can be readily appreciated through the preceding example , that the need for writing is considerably lessened . this is achieved through the use of activity designation columns 24 , the integration of lines 10 between activity section 4 and columns 46 of calendar section 41 , and the use of code letters , instead of full activity designations , in calendar blocks 44 . as well , as has been previously indicated several times , activity write ups in spaces 8 do not have to be crossed off or transferred in a particular week if , for example , the designated time for that activity is changed to another time within the time period covered by that particular sheet . the basic information remains . merely the abbreviated information appearing on calendar section 41 is changed . moreover , the format according to the present invention provides more capacity for writing , if required , since activity designation spaces 8 are significantly larger than would be otherwise permitted in a traditional work sheet , of the same size , in which the activity spaces had to be incorporated with the time designation spaces 50 in calendar blocks 44 . applicant &# 39 ; s layout also permits greater information to be concentrated , in meaningful fashion , on a single page . a completed sheet , at the end of a week , may be kept as a log of completed activities for that week , as well as an indication of intended , but uncompleted activities for the week . moreover , if , at the beginning of a week , the user has set out in sequence those activities which he has ahead of him for that week , and draws a line immediately after the last such item entered in activity spaces 8 , then by recording any new activity items which arise in the course of that week below that line , at the end of the week he has a record of new activities arising during the course of the week . in this way he has a simple way of assessing old or planned work in a week with new or unplanned work . it will be understood that , while not illustrated , when a series of sheets 2 are included to make up , say , a yearly diary , appropriately formatted sheets may also be included in such a book directed towards monthly and yearly projects and objectives and their timing . thus it is apparent that there has been provided in accordance with the invention a personal time management instrument that fully satisfies the objects , aims and advantages set forth above . while the invention has been described in conjunction with specific embodiments thereof , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art in light of the foregoing description . accordingly , it is intended to embrace all such alternatives , modifications and variations as fall within the spirit and broad scope of the appended claims . | 1 |
systems and methods are provided for performing a synchronization of data . as used herein , the term multi - tenant database system refers to those systems in which various elements of hardware and software of the database system may be shared by one or more customers . for example , a given application server may simultaneously process requests for a great number of customers , and a given database table may store rows for a potentially much greater number of customers . next , mechanisms and methods for performing a synchronization of data will be described with reference to example embodiments . fig1 illustrates a method 100 for performing a synchronization of data , in accordance with one embodiment . as shown in operation 102 , a client and a server of a system are identified . in one embodiment , the client of the system may include a desktop computer , a laptop computer , a handheld device ( e . g ., a cell phone , personal digital assistant ( pda ), etc . ), or any other device capable of performing computation . in another embodiment , the server of the system may include a server computer , a cloud computing environment , a multi - tenant on - demand database system , etc . additionally , in one embodiment , the client may be one of a plurality of clients of the system . in another embodiment , the server may be one of a plurality of servers of the system . in yet another embodiment , the client and the server of the system may communicate utilizing a network . in still another embodiment , both the client and the server may store copies of the same data . for example , a copy of data stored in the server may also be stored in the client . in another example , a copy of data stored in the client may also be stored in the server . in another embodiment , the data may be associated with an application of the client . further , it should be noted that , as described above , such multi - tenant on - demand database system may include any service that relies on a database system that is accessible over a network , in which various elements of hardware and software of the database system may be shared by one or more customers ( e . g . tenants ). for instance , a given application server may simultaneously process requests for a great number of customers , and a given database table may store rows for a potentially much greater number of customers . various examples of such a multi - tenant on - demand database system will be set forth in the context of different embodiments that will be described during reference to subsequent figures . also , as shown in operation 104 , it is determined that a user has successfully logged into an application of the client . in one embodiment , the application of the client may include an application that is installed within the client . for example , the application may include a messaging application , a personal information manager , etc . in another embodiment , the application may include data that is shared with the server of the system . for example , the application may be associated with a local copy of data stored within the server of the system . in addition , in one embodiment , the user may log into the client utilizing a graphical user interface ( gui ). for example , the user may input login information ( e . g ., a user name , password , etc .) into the gui using an input device ( e . g ., a keyboard , mouse , etc .) and select an icon to confirm that such input information is correct . in another embodiment , it may be determined that the user has successfully logged into the application by comparing the input login with login information stored at the client , at the server , etc . further , in one embodiment , the user may include a customer of a service that is provided by the system . for example , the user may subscribe to one or more services provided by the server of the system . further still , as shown in operation 106 , a synchronization of data associated with the application is performed between the client and the server . in one embodiment , the data may include data stored at the client and / or server that is used by the application . for example , the data may include object data , detail data , metadata , etc . in another embodiment , the synchronization may be performed in response to the determination that the user has successfully logged into the application of the client . for example , the synchronization may be performed immediately after the user successfully logs into the application . in yet another embodiment , performing the synchronization may include determining whether the user has logged into the application for the first time . for example , if it is determined that the user has logged into the application for the first time , then one or more elements of metadata may be retrieved from the server and stored at a local cache of the client . in another example , a local database may be initialized within the client once the elements of metadata are fetched and cached at the client . in yet another example , a full synchronization may occur between the client and the server once the database is initialized . also , in one embodiment , performing the synchronization may include determining whether the user has previously logged in to the application of the client . for example , if it is determined that the user has previously logged into the application , all uncommitted modifications of the data on the client may be sent to the server . additionally , in another embodiment , performing the synchronization may include retrieving metadata from the server to the client and comparing the metadata to metadata retrieved during an earlier login ( e . g ., metadata retrieved in response to the first user login , metadata retrieved in response to a login before the current login , etc .). further , another embodiment , performing the synchronization may include conditionally clearing a local database of the client in response to the determination that differences exist between the retrieved metadata and the metadata retrieved during an earlier login . for example , in response to the determination that differences exist , the user may be asked whether to clear the local client database and perform a full synchronization between the client and server or to maintain the local client database and perform an incremental synchronization between the client and the server . further still , in one embodiment , performing the synchronization may include determining whether any dataset changes have occurred with respect to a user of the system . in another embodiment , performing the synchronization may include performing an incremental synchronization between the client and the server if it is determined that no dataset changes have occurred with respect to the user . in yet another embodiment , performing the synchronization may include performing a full incremental synchronization between the client and the server if it is determined that dataset changes have occurred with respect to the user . also , in one embodiment , a runtime synchronization may be performed while the application is running on the client . in another embodiment , the runtime synchronization may be performed at a predetermined interval . in yet another embodiment , the runtime synchronization may be performed after the initial synchronization of data is performed responsive to the user logging onto the application . in still another embodiment , the runtime synchronization may include determining whether any dataset changes have occurred with respect to the user since the last synchronization . additionally , in one embodiment , performing the runtime synchronization may include retrieving metadata from the server to the client and comparing the metadata to metadata retrieved during an earlier login if dataset changes have occurred with respect to the user since the last synchronization . in another embodiment , performing the runtime synchronization may include alerting the user in response to a determination that differences exist between the retrieved metadata and the metadata retrieved during the earlier login . in this way , the synchronization of the client and server may be integrated into a login process of the user to ensure consistency between the client and server . additionally , the system synchronization may be dynamically adjusted based on the type of login that is being performed ( e . g ., an initial login , a subsequent login , etc .). further , the client and server may be additionally synchronized while the application is running in order to ensure that data stored at both the client and server is current for a predetermined time period . further still , the system may examine and / or determine a magnitude of the differences between data at the client and server in order to determine various consistency solutions . fig2 illustrates a method 200 for performing system synchronization during an initial login , in accordance with another embodiment . as an option , the method 200 may be carried out in the context of the functionality of fig1 . of course , however , the method 200 may be carried out in any desired environment . the aforementioned definitions may apply during the present description . as shown in operation 202 , it is determined that an initial login is successful . in one embodiment , the successful login may be performed by a user logging in to an application installed at a client of a system . for example , the user may enter a user name and password into the application , which are subsequently verified by the application . additionally , as shown in operation 204 , metadata is fetched from a server of the system and saved in a local cache of the client . in one embodiment , the metadata may describe one or more types of data stored at the server . for example , the metadata may describe one or more objects stored within the system ( e . g ., an account object , an opportunity object , a lead object , etc . ), one or more fields for an object ( e . g ., a name field , an address field , a phone number field , etc .) in another embodiment , the metadata may describe one or more types of data associated with the application of the client . for example , the metadata may describe one or more objects that are used by an account of the user within the application . further , as shown in operation 206 , a data management service ( dms ) is set up at the client . in one embodiment , setting up the dms at the client may include creating a local database at the client . for example , a local database may be created at the client that includes tables for each object on the server described by the metadata . further still , as shown in operation 208 , a full synchronization is performed between the client and server of the system . for example , all user data on the server that is associated with the application of the client may be copied and sent to the client , where it may be stored in the local database of the client . in one embodiment , the data sent during the synchronization may include data of object types described by the fetched metadata . also , as shown in operation 210 , it is determined that the application on the client is ready for use . in one embodiment , it may be determined that the application on the client is ready once it is confirmed that the full synchronization has been successfully performed . in this way , the application on the client of the system may initialize and populate a local database of application data associated with the user from data stored on the server . fig3 illustrates a method 300 for performing system synchronization during a subsequent login , in accordance with another embodiment . as an option , the method 300 may be carried out in the context of the functionality of fig1 - 2 . of course , however , the method 300 may be carried out in any desired environment . the aforementioned definitions may apply during the present description . as shown in operation 302 , it is determined that a subsequent login is successful . in one embodiment , the subsequent login may include any login after an initial login . for example , the subsequent login may occur an hour after an initial login , a day after an initial login , a week after an initial login , etc . additionally , as shown in operation 304 , metadata is loaded locally from a client cache . in one embodiment , the metadata may represent all object types associated with a user of an application on the client . further , as shown in operation 306 , the dms is set up at the client . in one embodiment , setting up the dms at the client may include setting up one or more data structures in the memory of the client that reflect one or more attributes of data stored in the client . in this way , an overview of the data in the client database may be created . further still , as shown in decision 308 , it is determined whether any uncommitted items exist at the client . in one embodiment , it may be determined whether any modifications have been made to data at the client that have not yet been synchronized with the server . for example , a user may have made changes to the data on the client while the client was not connected to the server . in another example , the user may have made changes to the data on the client and may have not committed those changes , may have made the changes locally , etc . if it is determined in decision 308 that one or more uncommitted items exist at the client , then in operation 310 such items are committed ( e . g ., sent , etc .) from the dms to the server . if it is determined in decision 308 that no uncommitted items exist at the client , or if the committing of such items is confirmed in operation 312 , then in operation 314 all metadata associated with the application at the client is fetched from the server to the client . in one embodiment , the metadata may include all object types and field types associated with the application that are currently stored at the server . in this way , a summary of data stored at the server may be retrieved after it is confirmed that all local data has been sent to the server . additionally , in decision 316 it is determined whether a difference exists between the metadata fetched from the server and the metadata loaded from the client cache . if in decision 316 it is determined that differences do exist , then in decision 318 it is determined whether a user desires to immediately clear their client database . in one embodiment , immediately clearing the client database ( e . g ., wiping the database , etc .) may include removing all object types and fields from the database of the client . if in decision 318 it is determined that the user desires to immediately clear their client database , then in operation 320 the client database is cleared using the metadata stored in the client , the new metadata from the server is saved to the client , and the dms in reinitialized . in one embodiment , the dms may be set up at the client using the updated metadata retrieved from the server . further , as shown in operation 322 , a full synchronization is performed . in this way , the latest data on the server may be recreated at the client . in one embodiment , one or more data conflicts may be resolved during the synchronization . see , for example , u . s . patent application ser . no . 13 / 116 , 829 , filed may 26 , 2011 , which is hereby incorporated by reference in its entirety , and which describes exemplary techniques for resolving data conflicts . further still , if in decision 318 it is determined that the user does not desire to immediately clear their client database , then in operation 324 an incremental synchronization is performed between the client and the server . in one embodiment , the incremental synchronization may include only sending changes made to data objects and fields described by the metadata loaded from the client cache , and not sending changes or additions to new data objects and fields described by the metadata fetched from the server . in another embodiment , a full synchronization may be performed by the user at a later date . in this way , the user may not be forced to perform a full synchronization at an inconvenient time ( e . g ., during a trip , during a time of low connectivity , before a meeting , etc .). also , if in decision 316 it is determined that no differences exist , then in operation 326 the metadata fetched from the server is saved at the client . in this way , the client may have an updated description of all data associated with the application that is stored at the server . additionally , as shown in operation 328 , an incremental synchronization is performed between the client and server . in one embodiment , the client may request all application data that has changed since the last synchronization between the client and server . additionally , in decision 330 it is determined whether any dataset changes have occurred with respect to the user of the application at the client . for example , a new member may have joined a team where the user is a member , and the new member &# 39 ; s joining may increase the access of the user to additional objects within the server ( e . g ., additional account access , etc .). in another example , the user may change districts and may need access to accounts for a new district . in one embodiment , a flag may be created that notes whether dataset changes have occurred or whether new metadata exist at the server . if it is determined in decision 330 that dataset changes have occurred , then in operation 332 a full incremental synchronization is performed . in one embodiment , all data associated with the application may be requested from the server by the client , and the number of objects that need to be sent may be recalculated , but no changes may be made to the local database at the client . further , if it is determined in decision 330 that dataset changes have not occurred , then in operation 334 the incremental synchronization performed in operation 328 is continued . also , as shown in operation 336 , it is determined that the application on the client is ready for use . in this way , operations such as full synchronizations , incremental synchronizations , and client database clearing may be performed dynamically based on the state of the data within the system as well as the status of the user of the application at the client . fig4 illustrates a method 400 for performing system synchronization while an application is running , in accordance with another embodiment . as an option , the method 400 may be carried out in the context of the functionality of fig1 - 3 . of course , however , the method 400 may be carried out in any desired environment . the aforementioned definitions may apply during the present description . as shown in operation 402 , the synchronization is started between a client and server of a system while an application of the client is running . in one embodiment , a user may have already logged into an application of the client before the synchronization has started . in another embodiment , a previous synchronization may have been performed upon the user successfully logging in to the application of the client . in yet another embodiment , the synchronization may be started according to a schedule . for example , a synchronization interval may be determined , and the synchronization may start according to that interval . additionally , as shown in operation 404 , an incremental synchronization is performed . further , as shown in decision 406 , it is determined whether any dataset changes have occurred with respect to the user of the application at the client . if it is determined in decision 406 that dataset changes have not occurred , then in operation 408 the incremental synchronization performed in operation 404 is continued . for example , any objects or fields in the server that have changed since the last synchronization may be updated at the client . if it is determined in decision 406 that dataset changes have occurred , then in operation 410 metadata is fetched from the server , but such fetched metadata does not replace the metadata stored at the client . additionally , as shown in decision 412 , it is determined whether a difference exists between the metadata fetched from the server and the metadata loaded from the client cache . if in decision 412 it is determined that no differences exist , then in operation 414 a full incremental synchronization is performed . further , if in decision 412 it is determined that differences do exist , then in operation 416 the end user is alerted . in one embodiment , a notice ( e . g ., a pop up window , message , electronic mail message , etc .) may be provided to the user that differences exist between the metadata at the server and client . for example , a pop - up window may be presented to the user that may allow the user to restart the application on the client or ignore the alert and continue using the application . additionally , as shown in operation 418 , the incremental synchronization is restarted . further still , as shown in operation 420 , the synchronization is completed . in one embodiment , the synchronization may be verified as having successfully completed . in this way , data may be synchronized between the client and server of the system while the application is running on the client in order to ensure that data on the client and server is kept current . additionally , the system may ensure that data changes are detected and propagated at login and other key events , conflicting data is resolved , and users are informed of relevant events . fig5 illustrates a block diagram of an environment 510 wherein an on - demand database system might be used . environment 510 may include user systems 512 , network 514 , system 516 , processor system 517 , application platform 518 , network interface 520 , tenant data storage 522 , system data storage 524 , program code 526 , and process space 528 . in other embodiments , environment 510 may not have all of the components listed and / or may have other elements instead of or in addition to , those listed above . environment 510 is an environment in which an on - demand database system exists . user system 512 may be any machine or system that is used by a user to access a database user system . for example , any of user systems 512 can be a handheld computing device , a mobile phone , a laptop computer , a work station , and / or a network of computing devices . as illustrated in fig5 ( and in more detail in fig6 ) user systems 512 might interact via a network 514 with an on - demand database system , which is system 516 . an on - demand database system , such as system 516 , is a database system that is made available to outside users that do not need to necessarily be concerned with building and / or maintaining the database system , but instead may be available for their use when the users need the database system ( e . g ., on the demand of the users ). some on - demand database systems may store information from one or more tenants stored into tables of a common database image to form a multi - tenant database system ( mts ). accordingly , “ on - demand database system 516 ” and “ system 516 ” will be used interchangeably herein . a database image may include one or more database objects . a relational database management system ( rdms ) or the equivalent may execute storage and retrieval of information against the database object ( s ). application platform 518 may be a framework that allows the applications of system 516 to run , such as the hardware and / or software , e . g ., the operating system . in an embodiment , on - demand database system 516 may include an application platform 518 that enables creation , managing and executing one or more applications developed by the provider of the on - demand database system , users accessing the on - demand database system via user systems 512 , or third party application developers accessing the on - demand database system via user systems 512 . the users of user systems 512 may differ in their respective capacities , and the capacity of a particular user system 512 might be entirely determined by permissions ( permission levels ) for the current user . for example , where a salesperson is using a particular user system 512 to interact with system 516 , that user system has the capacities allotted to that salesperson . however , while an administrator is using that user system to interact with system 516 , that user system has the capacities allotted to that administrator . in systems with a hierarchical role model , users at one permission level may have access to applications , data , and database information accessible by a lower permission level user , but may not have access to certain applications , database information , and data accessible by a user at a higher permission level . thus , different users will have different capabilities with regard to accessing and modifying application and database information , depending on a user &# 39 ; s security or permission level . network 514 is any network or combination of networks of devices that communicate with one another . for example , network 514 can be any one or any combination of a lan ( local area network ), wan ( wide area network ), telephone network , wireless network , point - to - point network , star network , token ring network , hub network , or other appropriate configuration . as the most common type of computer network in current use is a tcp / ip ( transfer control protocol and internet protocol ) network , such as the global internetwork of networks often referred to as the “ internet ” with a capital “ i ,” that network will be used in many of the examples herein . however , it should be understood that the networks that the one or more implementations might use are not so limited , although tcp / ip is a frequently implemented protocol . user systems 512 might communicate with system 516 using tcp / ip and , at a higher network level , use other common internet protocols to communicate , such as http , ftp , afs , wap , etc . in an example where http is used , user system 512 might include an http client commonly referred to as a “ browser ” for sending and receiving http messages to and from an http server at system 516 . such an http server might be implemented as the sole network interface between system 516 and network 514 , but other techniques might be used as well or instead . in some implementations , the interface between system 516 and network 514 includes load sharing functionality , such as round - robin http request distributors to balance loads and distribute incoming http requests evenly over a plurality of servers . at least as for the users that are accessing that server , each of the plurality of servers has access to the mts ′ data ; however , other alternative configurations may be used instead . in one embodiment , system 516 , shown in fig5 , implements a web - based customer relationship management ( crm ) system . for example , in one embodiment , system 516 includes application servers configured to implement and execute crm software applications as well as provide related data , code , forms , webpages and other information to and from user systems 512 and to store to , and retrieve from , a database system related data , objects , and webpage content . with a multi - tenant system , data for multiple tenants may be stored in the same physical database object , however , tenant data typically is arranged so that data of one tenant is kept logically separate from that of other tenants so that one tenant does not have access to another tenant &# 39 ; s data , unless such data is expressly shared . in certain embodiments , system 516 implements applications other than , or in addition to , a crm application . for example , system 516 may provide tenant access to multiple hosted ( standard and custom ) applications , including a crm application . user ( or third party developer ) applications , which may or may not include crm , may be supported by the application platform 518 , which manages creation , storage of the applications into one or more database objects and executing of the applications in a virtual machine in the process space of the system 516 . one arrangement for elements of system 516 is shown in fig5 , including a network interface 520 , application platform 518 , tenant data storage 522 for tenant data 523 , system data storage 524 for system data 525 accessible to system 516 and possibly multiple tenants , program code 526 for implementing various functions of system 516 , and a process space 528 for executing mts system processes and tenant - specific processes , such as running applications as part of an application hosting service . additional processes that may execute on system 516 include database indexing processes . several elements in the system shown in fig5 include conventional , well - known elements that are explained only briefly here . for example , each user system 512 could include a desktop personal computer , workstation , laptop , pda , cell phone , or any wireless access protocol ( wap ) enabled device or any other computing device capable of interfacing directly or indirectly to the internet or other network connection . user system 512 typically runs an http client , e . g ., a browsing program , such as microsoft &# 39 ; s internet explorer browser , netscape &# 39 ; s navigator browser , opera &# 39 ; s browser , or a wap - enabled browser in the case of a cell phone , pda or other wireless device , or the like , allowing a user ( e . g ., subscriber of the multi - tenant database system ) of user system 512 to access , process and view information , pages and applications available to it from system 516 over network 514 . each user system 512 also typically includes one or more user interface devices , such as a keyboard , a mouse , trackball , touch pad , touch screen , pen or the like , for interacting with a graphical user interface ( gui ) provided by the browser on a display ( e . g ., a monitor screen , lcd display , etc .) in conjunction with pages , forms , applications and other information provided by system 516 or other systems or servers . for example , the user interface device can be used to access data and applications hosted by system 516 , and to perform searches on stored data , and otherwise allow a user to interact with various gui pages that may be presented to a user . as discussed above , embodiments are suitable for use with the internet , which refers to a specific global internetwork of networks . however , it should be understood that other networks can be used instead of the internet , such as an intranet , an extranet , a virtual private network ( vpn ), a non - tcp / ip based network , any lan or wan or the like . according to one embodiment , each user system 512 and all of its components are operator configurable using applications , such as a browser , including computer code run using a central processing unit such as an intel pentium ® processor or the like . similarly , system 516 ( and additional instances of an mts , where inure than one is present ) and all of their components might be operator configurable using application ( s ) including computer code to run using a central processing unit such as processor system 517 , which may include an intel pentium ® processor or the like , and / or multiple processor units . a computer program product embodiment includes a machine - readable storage medium ( media ) having instructions stored thereon / in which can be used to program a computer to perform any of the processes of the embodiments described herein . computer code for operating and configuring system 516 to intercommunicate and to process webpages , applications and other data and media content as described herein are preferably downloaded and stored on a hard disk , but the entire program code , or portions thereof , may also be stored in any other volatile or non - volatile memory medium or device as is well known , such as a rom or ram , or provided on any media capable of storing program code , such as any type of rotating media including floppy disks , optical discs , digital versatile disk ( dvd ), compact disk ( cd ), microdrive , and magneto - optical disks , and magnetic or optical cards , nanosystems ( including molecular memory ics ), or any type of media or device suitable for storing instructions and / or data . additionally , the entire program code , or portions thereof , may be transmitted and downloaded from a software source over a transmission medium , e . g ., over the internet , or from another server , as is well known , or transmitted over any other conventional network connection as is well known ( e . g ., extranet , vpn , lan , etc .) using any communication medium and protocols ( e . g ., tcp / ip , http , https , ethernet , etc .) as are well known . it will also be appreciated that computer code for implementing embodiments can be implemented in any programming language that can be executed on a client system and / or server or server system such as , for example , c , c ++, html , any other markup language , java ™, javascript , activex , any other scripting language , such as vbscript , and many other programming languages as are well known may be used . ( java ™ is a trademark of sun microsystems , inc .). according to one embodiment , each system 516 is configured to provide webpages , forms , applications , data and media content to user ( client ) systems 512 to support the access by user systems 512 as tenants of system 516 . as such , system 516 provides security mechanisms to keep each tenant &# 39 ; s data separate unless the data is shared . if more than one mts is used , they may be located in close proximity to one another ( e . g ., in a server farm located in a single building or campus ), or they may be distributed at locations remote from one another ( e . g ., one or more servers located in city a and one or more servers located in city b ). as used herein , each mts could include one or more logically and / or physically connected servers distributed locally or across one or more geographic locations . additionally , the term “ server ” is meant to include a computer system , including processing hardware and process space ( s ), and an associated storage system and database application ( e . g ., oodbms or rdbms ) as is well known in the art . it should also be understood that “ server system ” and “ server ” are often used interchangeably herein . similarly , the database object described herein can be implemented as single databases , a distributed database , a collection of distributed databases , a database with redundant online or offline backups or other redundancies , etc ., and might include a distributed database or storage network and associated processing intelligence . fig6 also illustrates environment 510 . however , in fig6 elements of system 516 and various interconnections in an embodiment are further illustrated . fig6 shows that user system 512 may include processor system 512 a , memory system 512 b , input system 512 c , and output system 512 d . fig6 shows network 514 and system 516 . fig6 also shows that system 516 may include tenant data storage 522 , tenant data 523 , system data storage 524 , system data 525 , user interface ( ui ) 630 , application program interface ( api ) 632 , pl / soql 634 , save routines 636 , application setup mechanism 638 , applications servers 600 1 - 600 n , system process space 602 , tenant process spaces 604 , tenant management process space 610 , tenant storage area 612 , user storage 614 , and application metadata 616 . in other embodiments , environment 510 may not have the same elements as those listed above and / or may have other elements instead of , or in addition to , those listed above . user system 512 , network 514 , system 516 , tenant data storage 522 , and system data storage 524 were discussed above in fig5 . regarding user system 512 , processor system 512 a may be any combination of one or more processors . memory system 512 b may be any combination of one or more memory devices , short term , and / or long term memory . input system 512 c may be any combination of input devices , such as one or more keyboards , mice , trackballs , scanners , cameras , and / or interfaces to networks . output system 512 d may be any combination of output devices , such as one or more monitors , printers , and / or interfaces to networks . as shown by fig6 , system 516 may include a network interface 520 ( of fig5 ) implemented as a set of http application servers 600 , an application platform 518 , tenant data storage 522 , and system data storage 524 . also shown is system process space 602 , including individual tenant process spaces 604 and a tenant management process space 610 . each application server 600 may be configured to tenant data storage 522 and the tenant data 523 therein , and system data storage 524 and the system data 525 therein to serve requests of user systems 512 . the tenant data 523 might be divided into individual tenant storage areas 612 , which can be either a physical arrangement and / or a logical arrangement of data . within each tenant storage area 612 , user storage 614 and application metadata 616 might be similarly allocated for each user . for example , a copy of a user &# 39 ; s most recently used ( mru ) items might be stored to user storage 614 . similarly , a copy of mru items for an entire organization that is a tenant might be stored to tenant storage area 612 . a ui 630 provides a user interface and an api 632 provides an application programmer interface to system 516 resident processes to users and / or developers at user systems 512 . the tenant data and the system data may be stored in various databases , such as one or more oracle ™ databases . application platform 518 includes an application setup mechanism 638 that supports application developers &# 39 ; creation and management of applications , which may be saved as metadata into tenant data storage 522 by save routines 636 for execution by subscribers as one or more tenant process spaces 604 managed by tenant management process 610 for example . invocations to such applications may be coded using pl / soql 634 that provides a programming language style interface extension to api 632 . a detailed description of some pl / soql language embodiments is discussed in commonly owned u . s . pat . no . 7 , 730 , 478 entitled , method and system for allowing access to developed applications via a multi - tenant on - demand database service , by craig weissman , filed sep . 21 , 2007 , which is incorporated in its entirety herein for all purposes . invocations to applications may be detected by one or more system processes , which manages retrieving application metadata 616 for the subscriber making the invocation and executing the metadata as an application in a virtual machine . each application server 600 may be communicably coupled to database systems , e . g ., having access to system data 525 and tenant data 523 , via a different network connection . for example , one application server 600 1 might be coupled via the network 514 ( e . g ., the internet ), another application server 600 n - 1 might be coupled via a direct network link , and another application server 600 n might be coupled by yet a different network connection . transfer control protocol and internet protocol ( tcp / ip ) are typical protocols for communicating between application servers 600 and the database system . however , it will be apparent to one skilled in the art that other transport protocols may be used to optimize the system depending on the network interconnect used . in certain embodiments , each application server 600 is configured to handle requests for any user associated with any organization that is a tenant . because it is desirable to be able to add and remove application servers from the server pool at any time for any reason , there is preferably no server affinity for a user and / or organization to a specific application server 600 . in one embodiment , therefore , an interface system implementing a load balancing function ( e . g ., an f5 big - ip load balancer ) is communicably coupled between the application servers 600 and the user systems 512 to distribute requests to the application servers 600 . in one embodiment , the load balancer uses a least connections algorithm to route user requests to the application servers 600 . other examples of load balancing algorithms , such as round robin and observed response time , also can be used . for example , in certain embodiments , three consecutive requests from the same user could hit three different application servers 600 , and three requests from different users could hit the same application server 600 . in this manner , system 516 is multi - tenant , wherein system 516 handles storage of , and access to , different objects , data and applications across disparate users and organizations . as an example of storage , one tenant might be a company that employs a sales force where each salesperson uses system 516 to manage their sales process . thus , a user might maintain contact data , leads data , customer follow - up data , performance data , goals and progress data , etc ., all applicable to that user &# 39 ; s personal sales process ( e . g ., in tenant data storage 522 ). in an example of a mts arrangement , since all of the data and the applications to access , view , modify , report , transmit , calculate , etc ., can be maintained and accessed by a user system having nothing more than network access , the user can manage his or her sales efforts and cycles from any of many different user systems . for example , if a salesperson is visiting a customer and the customer has internet access in their lobby , the salesperson can obtain critical updates as to that customer while waiting for the customer to arrive in the lobby . while each user &# 39 ; s data might be separate from other users &# 39 ; data regardless of the employers of each user , some data might be organization - wide data shared or accessible by a plurality of users or all of the users for a given organization that is a tenant . thus , there might be some data structures managed by system 516 that are allocated at the tenant level while other data structures might be managed at the user level . because an mts might support multiple tenants including possible competitors , the mts should have security protocols that keep data , applications , and application use separate . also , because many tenants may opt for access to an mts rather than maintain their own system , redundancy , up - time , and backup are additional functions that may be implemented in the mts . in addition to user - specific data and tenant specific data , system 516 might also maintain system level data usable by multiple tenants or other data . such system level data might include industry reports , news , postings , and the like that are sharable among tenants . in certain embodiments , user systems 512 ( which may be client systems ) communicate with application servers 600 to request and update system - level and tenant - level data from system 516 that may require sending one or more queries to tenant data storage 522 and / or system data storage 524 . system 516 ( e . g ., an application server 600 in system 516 ) automatically generates one or more sql statements ( e . g ., one or more sql queries ) that are designed to access the desired information . system data storage 524 may generate query plans to access the requested data front the database . each database can generally be viewed as a collection of objects , such as a set of logical tables , containing data fitted into predefined categories . a “ table ” is one representation of a data object , and may be used herein to simplify the conceptual description of objects and custom objects . it should be understood that “ table ” and “ object ” may be used interchangeably herein . each table generally contains one or more data categories logically arranged as columns or fields in a viewable schema . each row or record of a table contains an instance of data for each category defined by the fields . for example , a crm database may include a table that describes a customer with fields for basic contact information such as name , address , phone number , fax number , etc . another table might describe a purchase order , including fields for information such as customer , product , sale price , date , etc . in some multi - tenant database systems , standard entity tables might be provided for use by all tenants . for crm database applications , such standard entities might include tables for account , contact , lead , and opportunity data , each containing pre - defined fields . it should be understood that the word “ entity ” may also be used interchangeably herein with “ object ” and “ table ”. in some multi - tenant database systems , tenants may be allowed to create and store custom objects , or they may be allowed to customize standard entities or objects , for example by creating custom fields for standard objects , including custom index fields . u . s . patent application ser . no . 10 / 817 , 161 , filed apr . 2 , 2004 , entitled “ custom entities and fields in a multi - tenant database system ”, and which is hereby incorporated herein by reference , teaches systems and methods for creating custom objects as well as customizing standard objects in a multi - tenant database system . in certain embodiments , for example , all custom entity data rows are stored in a single multi - tenant physical table , which may contain multiple logical tables per organization . it is transparent to customers that their multiple “ tables ” are in fact stored in one large table or that their data may be stored in the same table as the data of other customers . while one or more implementations have been described by way of example and in terms of the specific embodiments , it is to be understood that one or more implementations are not limited to the disclosed embodiments . to the contrary , it is intended to cover various modifications and similar arrangements as would be apparent to those skilled in the art . therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements . | 7 |
while the invention may be adopted for use in various industrial structures in which a trolley conductor has to be interrupted , it is being illustrated herein as applied to a mine shaft . in fig1 there is shown a horizontal mine shaft 10 through which trolley tracks ( not shown ) have been placed to run along the floor thereof and upon which a trolley vehicle having an electric motor normally would be operated . the electricity for said trolley vehicle is derived from contact with the overhead trolley conductor 12 . erected across said mine shaft 10 there is a door structure 14 having vertical travel along support 16 , by which the entry door 18 travels up and down . the main portion of said door 18 is vertically flexible permitting it to be stored in a entry door roll 22 , which is housed within the container 24 that is supported from the horizontal structural steel 26 and attached to the bottom of the said entry door 18 is a door foot 20 . in this particular illustration the trolley conductor is in two terminal ends 12a and 12b ( shown in detail in fig2 ), with the bridge means 15 located between the opening of the terminal ends . terminal end 12b has one end attached to a seating block 36 and the other terminal end 12a is attached to a anchor block 28 . within a socket and pivotly mounted to the anchor block 28 is a bridge 34 so that when said bridge 34 is horizontal and mated to said seating block 36 there is electrical conduction between the two terminal ends 12a and 12b of the trolley conductor 12 . further , when said bridge 34 is in a down position as pictured in fig1 there is a space between said terminal ends 12a and 12b such that the vertical door 18 may pass down and seal off one portion of the horizontal mine shaft 10 . in the conductor configuration of fig1 the solid trolley conductor 12 is normally only supported by insulated supports like 30a or 30b where these supports are in turn determinately attached to a trolley support members like 32a or 32b , which are a part of the structure of the mine shaft framework . with the bridging means for the interrupted conductor of this invention , the conductor terminal end 12b is now additionally supported with trolley clamp 38b with the terminal end 12b going into the seating block 36 to be rigidly positioned . similarly , the other terminal end 12a is supported with trolley clamp 38a with the terminal end 12a going into the anchor block 28 . in addition there is the normal insulator supports 30a and 30b to the framework supporting members 32a and 32b which now secures the anchor and seating blocks thereto . for more details of the description of the invention of the trolley bridge means , please refer to fig2 and 4 wherein the solid line portions show the bridge in a horizontal position and the dotted illustration show the operation of the bridge as it is moved from its closed horizontal position to its opened vertical position . from fig2 and 3 it can be seen that on conductor terminal end 12a , the anchor block 28 has a pivot socket 42 , which is formed by a hollow between two vertically extending portions 52a and 52b of said block wherein the back end of the hollow has a vertical arresting surface 44 and wherein there is a pivot pin 46 which passes through the anchor block 28 and through a pivot hole in the bridge 34 . on the other conductor terminal end 12b there is a seating block 36 which has a hollow portion arranged as a socket 48 between two vertically extending walls 50a and 50b to engage and receive a receivable end of the bridge 34 when it is in the horizontal position . both the pivot socket 42 of the anchor block 28 and the pivot socket 48 of the seating block 36 are arranged so that there is a relatively large amount of metal overlapping the metal of the bridge so as to be sure of a good electrical contact for carrying the electricity from terminal end 12a to the terminal end 12b when in operation . in order to fully understand and appreciate the workings of the bridge means , the details of the bridge 34 are of particular importance . from fig2 and 3 it can be seen that at one extreme end of the bridge is a pivot portion 37 located within the socket 42 of the anchor block 28 where said bridge end has an arresting surface 39 integral of the pivot portion 37 of the bridge 34 and which bridge arresting surface 39 is constructed and arranged so as to engage an arresting surface 44 of the anchor block 28 in a closed arrangement . the other extreme end 31 of the bridge is an engageable end with a horizontal surface 29 which engages a similar horizontal surface 43 of the seating block 36 so that the bridge 34 is rigidly located to withstand the upward pressure from contact with the passing trolley . a further important part of the pivotal bridge are the springs 40a and 40b . these springs 40a and 40b are attached at one end to the anchor block 28 at a position 27 well above the horizontal position 46 of the pivot pin and are attached on the other end to a central position 25 of the trolley bridge 34 . the line of action of said springs 40a and 40b when the bridge is in the closed position is , therefore , well above the position of the pivot and thereby the bridge is urged by the springs 40a and 40b in an upward closed position . the upper surface 23 of the pivotal bridge 34 is arranged with two cams 33 and 35 , one being a centrally located rounded opening cam 33 , and the other being a semi - round closing cam 35 located at the pivotal end 37 . as illustrated in fig2 and 3 the door foot 20 is arranged with a horizontal surface so that when the door 18 is moving downward it will contact and slide on the opening cam 33 to then open bridge 34 , and it is assisted by the operation of the spring means 40a and 40b . it is important to note that the line of action of the springs 40a and 40b is such that when the door foot 20 is moving the opening cam surface 33 downward that when the springs line of action passes the center point of the pivot 46 that the springs 40a and 40b will then urge the bridge into a vertical open position 56 . conversely when the door 18 is moving upward the edge of the door foot 20 contacts the closing cam surface 35 to overcome the opening force until the line of action of the springs 40a and 40b passes the center point of the pivot 46 , at which time the springs will snap the bridge closed such that the pivot socket arresting surface 44 of the anchor block 28 and the stop surface 39 of the bridge 34 engage each other and hold the bridge in a firmly horizontal position against any upward pressure that may be exerted upon it by contact with the passing trolley . so as to prevent the electrical contact of the door foot 20 with the bridge &# 39 ; s opening and closing cam surfaces , it can be seen with respect to fig4 that the cam of the bridge 34 is preferably constructed with a non - conductive insulator 54 over the metal conductor of the bridge 34 . for a better understanding of the bridge means , its operation will be described in a typical mine shaft 10 configuration as illustrated in fig1 and where the actual movement of the bridge 34 can be seen from fig2 and 3 . the trolley bridge 34 is held in its closed horizontal position by the springs 40a and 40b such that said bridge 34 provides electrical conduction and mechanically indistinguishable connection across the door clearance interruption between the conductor ends 12a and 12b . electrical contact and mechanical positioning of said bridge 34 is the result of the mating of the contact end 29 of said bridge 34 with the arresting surface 43 of the seating block socket 48 and the mating of pivotal arresting surface 39 of said bridge 34 with its companion anchor block pivot socket arresting surface 44 . with the bridge 34 in such horizontal position , when the demand occurs , the mine door 18 can be closed and thereby automatically opening said bridge 34 by the following sequence of actions . as the door 18 is moved downward or closed , the door foot 20 contacts the uppermost surface of the opening cam 33 of the bridge 34 . further closing of the door 18 causes the door foot 20 to open the bridge 34 by the swinging of said bridge 34 on the anchor block pivot 46 and thereby breaking contact with the engageable mating socket 48 of the seating block 36 . continued downward movement of the door 18 further causes the door foot 20 to open said bridge 34 by the pushing along of said door foot 20 on the opening cam surface 33 against the force of the springs until the line of action of the springs 40a and 40b passes over the bridge anchor block pivot point 46 , at which time the bridge snaps open to its vertical position 56 . the mine door 18 is now free to be fully closed with no interferences . in the door opening situation , with the mine door 18 closed , the door 18 moves upward unencumbered until the door foot 20 just makes contact with the closing cam 35 of the bridge 34 . further upward motion of the door 18 now causes the door foot 20 to push along the closing cam surface against the force of the springs 40a and 40b , thereby causing the bridge 34 to swing on its pivot 46 toward the seating block 36 . again , when the line of action of the springs 40a and 40b moves passed the center of said pivot 46 the bridge 34 will snap closed , and the bridge &# 39 ; s engageable end 31 will be held in the socket 48 of the seating block 36 . the springs 40a and 40b now hold the bridge 34 in this closed horizontal position and the closing cam is socketed unobstructively for when it is demanded to close the mine door 18 again . although this particular embodiment has been shown in a specific setting , the features of the setting should in no way be considered the sole or limiting embodiment . for example , in this embodiment the briding apparatus has been shown to be connected onto an overhead trolley conductor . the invention though would work equally well as being located in a variety of positions , i . e . along the floor or walls . the invenion has also been shown to be embodied solely with an overhead door apparatus though the bridging means would work equally as well with a variety of actuating members , including gates , barrier levers etc . while in accordance with the provisions of the statutes , there is illustrated and described herein the best form of the invention now known to us . those skilled in the art may understand that changes may be made in the form of the apparatus disclosed without departure from the spirit of the invention covered by the claims , and that certain features of the invention may sometimes be used to advantage without corresponding use of other features . | 1 |
fig1 and 2 are illustrations showing the embodiments of the rf integrated circuit of the present invention . in fig1 , rf integrated circuit 1 comprises demodulation circuit 11 , modulation circuit 12 and switching circuit 13 . rf integrated circuit 1 is connected to circuit 2 comprising physical layer circuit 21 and mac circuit 22 , and circuit 2 is connected to computer 3 . demodulation circuit 11 reduces a radio frequency band signal ( here a signal of 715m - 725 mhz ) received by antenna 7 to arbitrary frequency ( from 5 mhz 20 mhz ), and it is output in physical layer circuit 21 . modulation circuit 12 raises a signal of arbitrary frequency ( from 5 mhz 20 mhz ) input from physical layer circuit 21 in a radio frequency ( a signal of 715m - 725 mhz ), and it is output to antenna 7 . physical layer circuit 21 is typically an interface circuit . in this embodiment , tt is provided with a / d converter 411 , digital to analog converter 412 between physical layer circuit 21 and rf integrated circuit 1 , but it can be established in physical layer circuit 21 , and it can be made for rf integrated circuit 1 . physical layer circuit 21 is connected to mac circuit 22 , and the signal from demodulation circuit 11 is constructed across mac circuit 22 , and the signal from mac circuit 22 is constructed across modulation circuit 12 . antenna 7 is connected to demodulation circuit 11 and modulation circuit 12 through switching circuit 13 . switching circuit 13 can change antenna 7 to either of demodulation circuit 11 and modulation circuit 12 by change signal sc from the outside . note that , demodulation circuit 11 can be comprised from intermediate frequency converter circuit 1101 and low frequency converter circuit 1102 as shown in fig2 . intermediate frequency converter circuit 1101 converts a radio frequency signal input through switching circuit 13 into intermediate frequency , and it is further converted into frequency of around 5 - 25 mhz by low frequency converter circuit 1102 . and , these frequency signals our particular frequency signal is output in physical layer circuit 21 of fig1 . also , as shown in fig2 , modulation circuit 12 can be further comprised from high frequency converter circuit 1202 with intermediate frequency converter circuit 1201 . the particular frequency signal of frequency signals from physical layer circuit 21 is converted into intermediate frequency by intermediate frequency converter circuit 1201 . even more particularly , a signal of this intermediate frequency is modulated to the signal of the radio frequency ( a 700 mhz zone ) by high frequency converter circuit 1202 , and , through switching circuit 13 , it is output to antenna 7 . an embodiment of rf integrated circuit 1 of the present invention is shown in fig3 . switching circuit 13 is set for ( at the time of the reception ) at the time of the recovery in the side as shown in the solid line by control signal sc . demodulation circuit 11 comprises low noise amplifier 111 , amplifier 112 for receive signal level adjustment , splitter 113 , received signal strength detector 114 , variable gain device 115 , image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft 116 and power amplifier 117 . the signal of the frequency 700 mhz zone from antenna terminal ant is input into image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft 116 through bpf ( a bandpass filter ) 16 and low noise amplifier 111 , amplifier 112 for receive signal level adjustment and variable gain device 115 . it is made a share wave by splitter 113 , and the output of amplifier 112 for receive signal level adjustment is output from rssi terminal through received signal strength detector 114 by an outside control unit ( it is not illustrated ). this control unit generates a gain adjustment signal of variable gain device 115 based on an input signal . rf integrated circuit 1 inputs this gain adjustment signal from reception level adjustment signal terminal rla , and variable gain device 115 is operated . image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft 116 inputs an output signal of variable gain device 115 , and it regains its health . these demodulated signals are amplified by power amplifier 117 , and it is sent out to physical layer circuit 21 ( cf . fig1 ) through a / d converter 411 ( cf . fig1 ) by receive signal terminal rx . image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft 116 consists of splitter 1161 and phase shifter 1162 and mixer 1163 , 1164 and synthesizer 1165 as shown in fig4 ( a ). splitter 1161 performs a share wave of an input signal to two signals of the aspect , and it is sent out to mixer 1163 , 1164 . the signal from local oscillator 14 is input into phase shifter 1162 , and phase shifter 1162 outputs two signals that phase shifting is different 90 degrees to mixer 1163 , 1164 . herein , mixer 1163 mixes a signal of the 90 degrees phase shifting from phase shifter 1162 with a signal from splitter 1161 , and it is sent to synthesizer 1165 . mixer 1164 mixes a signal of the 0 degrees phase shifting from phase shifter 1162 with a signal from splitter 1161 , and it is sent to synthesizer 1165 . the signal which made a signal from mixer 1164 make 90 degrees phase shifting with synthesizer 1165 and a signal from mixer 1164 are synthesized , and it is output to power amplifier 117 . switching circuit 13 is set for ( at the time of the transmission ) at the time of abnormality in the side as shown in the dotted line by control signal sc . modulation circuit 12 comprises buffer amplifier 121 , image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft 122 , variable gain device 123 , power amplifier 124 , splitter 125 and transmission signal strength detector 126 . after it is input through buffer amplifier 121 of gain 0 db in image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft 122 , and it was performed frequency modulation in image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft 122 by transmit signal input terminal tx , the signal of frequency 20 mhz from physical layer circuit 21 ( cf . fig1 ) is amplified by variable gain device 123 and power amplifier 124 . and , it is output to antenna 7 ( cf . fig1 ) through switching circuit 13 and bpf ( a bandpass filter ) 16 by antenna terminal ant . it is made a share wave by splitter 125 , and the output of power amplifier 124 is output from tssi terminal through transmission signal strength detector 126 by an outside control unit ( it is not illustrated ). this control unit generates a gain adjustment signal of variable gain device 123 based on an input signal . rf integrated circuit 1 inputs this gain adjustment signal from transmission level adjustment signal terminal tla , and variable gain device 123 is operated . image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft 122 consists of splitter 1221 and phase shifter 1222 and mixer 1223 , 1224 and synthesizer 1225 as shown in fig4 ( b ). splitter 1221 performs a share wave of an input signal to two signals of the aspect , and it is sent out to mixer 1223 , 1224 . the signal from local oscillator 14 is input into phase shifter 1222 , and phase shifter 1222 outputs two signals that phase shifting is different 90 degrees to mixer 1223 , 1224 . herein , mixer 1223 mixes a signal of the 90 degrees phase shifting from phase shifter 1222 with a signal from splitter 1221 , and it is sent to synthesizer 1225 . mixer 1224 mixes a signal of the 0 degrees phase shifting from phase shifter 1222 with a signal from splitter 1221 , and it is sent to synthesizer 1225 . the signal which made a signal from mixer 1224 make 90 degrees phase shifting with synthesizer 1225 and a signal from mixer 1224 are synthesized , and it is output to power amplifier 124 . fig5 is a conceptual diagram of the principle which shows the return modulation circuit which shares a modulation circuit with a demodulation circuit in an rf integrated circuit of the present invention by one circuit . rf integrated circuit 1 comprises working switching circuit 131 , 132 , 133 , 134 and return modulation circuit 15 . return modulation circuit 15 becomes low noise amplifier a 1 and image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft irm from local oscillator 14 and power amplifier a 2 . at the time of the recovery , switching circuit 131 , 132 , 133 , 134 is set in the side as shown in the solid line by control signal sc , respectively , and the signal of the frequency 700 mhz zone received by antenna 7 ( cf . fig1 ) is input into rf integrated circuit 1 by antenna terminal ant . that is , the receive signal is input into image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft irm through bpf 16 , switching circuit 131 , switching circuit 132 , low noise amplifier a 1 . in image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft irm , an input signal is converted into a low frequency signal ( 5 - 25 mhz ) using local oscillation signal lo from local oscillator 14 . and , this low frequency signal is sent out to physical layer circuit 21 ( cf . fig1 ) through a / d converter 411 ( cf . fig1 ) by way of power amplifier a 2 , switching circuit 133 , switching circuit 134 by transmission / receive signal input and output terminal rx / tx . at the time of the abnormality , switching circuit 131 , 132 , 133 , 134 is set in the side as shown in the dotted line by control signal sc , respectively , and the transmit signal ( 5 - 25 mhz ) that went by way of digital to analog converter 412 ( cf . fig1 ) from physical layer circuit 21 ( cf . fig1 ) is input into rf integrated circuit 1 by transmission / receive signal input and output terminal rx / tx . that is , the transmit signal is input into image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft irm through switching circuit 134 , switching circuit 132 , low noise amplifier a 1 . in image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft irm , an input signal is converted into a high frequency signal ( the signal of the frequency 700 mhz zone ) using local oscillation signal lo from local oscillator 14 . and , this high frequency signal is sent out to antenna 7 ( cf . fig1 ) via power amplifier a 2 , switching circuit 133 , switching circuit 131 , bpf 16 by antenna terminal ant . fig6 is an illustration shown in the details with rf integrated circuit 1 of fig5 more . in fig6 , in return modulation circuit 15 , it is from signal strength detector 154 and variable gain device 155 and image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft 156 and variable gain device 157 and power amplifier 158 and splitter 159 and local oscillator 14 with low noise amplifier 151 and splitter 152 and switching circuit 153 . in return modulation circuit 15 of fig6 , switching circuit 131 , 132 , 133 , 134 and switching circuit 153 is set at the time of the recovery in the side as shown in the solid line by control signal sc , respectively , and the signal of the frequency 700 mhz zone received by antenna 7 ( cf . fig1 ) is input into rf integrated circuit 1 by antenna terminal ant . that is , the receive signal is input into bpf 16 , switching circuit 131 , switching circuit 132 , low noise amplifier 151 , splitter 152 , variable gain device 155 . the signal performed a share wave of by splitter 152 is input into signal strength detector 154 through switching circuit 153 , and the signal from signal strength detector 154 is sent out to the control unit which is not illustrated by reception / transmit signal intensity signals output terminal rssi / tssi . with this control unit , a reception level adjustment signal is generated . this reception level adjustment signal is input into a control terminal of variable gain device 155 by reception level adjustment signal terminal rla , and a gain of variable gain device 155 is adjusted . in image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft 156 , a signal from variable gain device 155 is converted into a low frequency signal ( 5 - 25 mhz ) using local oscillation signal lo from local oscillator 14 . and , this low frequency signal is sent out to physical layer circuit 21 ( cf . fig1 ) through a / d converter 411 ( cf . fig1 ) by way of variable gain device 157 , power amplifier 158 , splitter 159 , switching circuit 133 , switching circuit 134 by transmission / receive signal input and output terminal rx / tx . note that , in this embodiment , at the time of the recovery , indicating signal of gain zero ( 0 db ) is input into a control terminal of variable gain device 157 . in return modulation circuit 15 of fig6 , switching circuit 131 , 132 , 133 , 134 and switching circuit 153 is set at the time of the abnormality in the side as shown in the dotted line by control signal sc , respectively , and the transmit signal ( 5 - 25 mhz ) that went by way of digital to analog converter 412 ( cf . fig1 ) from physical layer circuit 21 ( cf . fig1 ) is input into rf integrated circuit 1 by transmission / receive signal input and output terminal rx / tx . that is , the receive signal is input into image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft 156 through switching circuit 134 , switching circuit 132 , low noise amplifier 151 , splitter 152 , variable gain device 155 . note that , in this embodiment , at the time of the abnormality , indicating signal of gain zero ( 0 db ) is input into a control terminal of variable gain device 155 . in image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft 156 , an input signal is converted into a high frequency signal ( the signal of the frequency 700 mhz zone ) using local oscillation signal lo from local oscillator 14 . and , this high frequency signal is sent out to variable gain device 157 , power amplifier 158 , splitter 159 , switching circuit 133 . the signal performed a share wave of by splitter 159 is input into signal strength detector 154 through switching circuit 153 , and the signal from signal strength detector 154 is sent out to the control unit which is not illustrated by reception / transmit signal intensity signals output terminal rssi / tssi . with this control unit , a transmission level adjustment signal is generated . this transmission level adjustment signal is input into a control terminal of variable gain device 157 by transmission level adjustment signal terminal tla , and a gain of variable gain device 157 is adjusted . and , the transmit signal from switching circuit 133 is sent out to antenna 17 ( cf . fig1 ) through switching circuit 131 , bpf 16 by antenna terminal ant . 1 rf integrated circuit 2 circuits 3 computers 5 frequency 7 , 17 antennas eight or nine communications equipment 11 demodulation circuits 12 modulation circuits 13 , 131 , 132 , 133 , 134 14 switching circuit local oscillators 15 return modulation circuits 16 bpf 21 , 82 , 92 physical layer circuits 22 , 83 , 93 mac circuit 81 , 91 rf circuit 111 low noise amplifiers an amplifier for 112 receive signal level adjustment 113 , 125 , 152 , 159 , 1161 , 1221 114 splitter received signal strength detectors 115 , 123 , 155 , 157 variable gain device 116 , 122 , 156 , irm image f { hacek over ( s )} fwfffnfvf ‡ f ″ ef ˜ flft 117 , 124 , 158 , 121 a 2 power amplifier buffer amplifiers 126 transmission signal strength detectors 151 , a 1 low noise amplifier 154 signal strength detectors 411 a / d converter 412 d / a converter 1101 , 1201 intermediate frequency converter circuits 1102 low frequency converter circuits 1162 , 1222 phase shifter 1163 , 1164 , 1223 , 1224 mixer 1165 , 1225 synthesizers 1202 high frequency converter circuits ant antenna terminal lo local oscillation signal rla reception level adjustment signal terminal rx receive signal terminal sc change signal tla transmission level adjustment signal terminal a tx transmit signal input terminal | 7 |
turning now to the drawings , there is shown a portable assembly 10 for supporting and positioning an inverted power drill 12 relative to an overlying workpiece 14 , for example , the frame of an automobile , having a surface 16 . the power drill carries a drill bit 18 . the assembly 10 includes , generally , a pedestal 20 , an upright standard 22 mounted on the pedestal and an adjustable carriage 24 supporting the inverted power drill . the pedestal includes radially - extending feet 26 providing a wide , stable base . two of the feet 26 have casters or rollers 28 at their outer ends to facilitate moving the portable assembly 10 . welded to the pedestal 20 is a vertical receptacle 30 for receiving the lower end of the upright standard 22 . the standard and the receptacle may be fabricated of tubular steel stock so dimensioned that the standard 22 fits closely within the receptacle 30 . the vertical receptacle 30 and the lower portion of standard 22 are round to allow rotational movement of the carriage 24 . a threaded fastener 31 inserted through a hole in the pedestal centered under receptacle 30 engages threads ( not shown ) at the bottom of standard 22 and prevents accidental separation of the standard 22 and the pedestal 20 . removal of threaded fastener 31 allows standards of various heights to be interchangeably used in the support of assembly 10 to accommodate a variety of drilling environments . the carriage 24 is mounted , in a manner to be described , on a square tube 32 slidably received by , and adjustably positionable along , the standard 22 . such vertical adjustment permits the assembly 10 to be used with vehicles of different frame heights or with vehicles elevated to different heights . the assembly 10 includes a latch mechanism 34 mounted on the tube 32 for securing the tube 32 , and therefore the carriage and power drill , at a selected height along the standard 22 . the latch mechanism 34 is carried by a pair of side plates 36 welded to and projecting from the lower end of the tube 32 . the mechanism 34 consists of a handle 38 , pivotally mounted at 40 on the side plates 36 , and a generally vertically oriented , narrow plate 42 attached to the handle 38 adjacent the pivot 40 . a latch pin 44 secured to the lower end of the plate 42 is adapted to enter any of a plurality of vertically spaced apertures 46 formed in one of the sides of the standard 22 . a compression spring 48 , interposed between the upper end of the plate 42 and the confronting face of the tube 32 , biases the handle and plate counterclockwise ( as seen in fig2 a and 2b ), that is , to the latching position in which the pin 44 is received by one of the apertures 46 ( fig2 a ). to adjust the carriage and power drill height , the operator pulls up on the handle 38 , causing it and the plate 42 to pivot in a clockwise fashion about the pivot 40 , as shown in fig2 b , withdrawing the pin 44 from the aperture permitting the operator to slide the carriage and power drill up or down along the standard . once a new position is reached , the handle 38 is released causing the pin 44 , under the bias of the spring 48 , to enter another one of the apertures 46 thereby locking the apparatus in place vertically . the carriage 24 includes a parallel linkage 50 having a bracket 52 comprising a web portion 54 for supporting the power drill and side flanges 56 . the parallel linkage 50 includes a first pair of parallel , identical side links 58a , 58b disposed along one side of the standard 22 and a second pair of parallel side links 60a , 60b identical to and parallel to the first pair , adjacent the other side of the standard . one end of each of the link pairs is fastened by pivot pins 62 to a flange 56 of the bracket 52 at spaced apart points . the carriage 24 also includes a tilt mechanism 70 ( fig4 and 5 ) for adjusting the angle of the power drill 12 so as to facilitate the orientation of the drill bit 18 perpendicular to the workpiece surface 16 . the tilt mechanism includes a tilt control lever 72 having an outer , bifurcated end 74 with grip handles 76 and an inner end 78 mounted on a horizontal pivot shaft 80 rotatable in a sleeve 82 secured to the slidable tube 32 . the tilt control lever 72 is thereby movable up and down about a horizontal pivot axis defined by the shaft 80 and sleeve 82 . the inner end of the tilt control lever 72 includes a generally vertical extension 84 , perpendicular to the main , bifurcated portion of the lever . a vertical tilt plate 86 is welded along its forward edge to the lever extension 84 . it will thus be seen that the plate 86 can be angularly displaced or tilted in its vertical plane about the pivot by moving the tilt control lever 72 up and down . to facilitate unimpeded tilting of the plate , the lever 72 and plate 86 are laterally offset so that the plate clears the standard 22 as it is moved to different angular positions . a pair of transversely - extending sleeves 88 are welded to the tilt plate 86 adjacent the rear edge of the plate . the sleeves 88 are vertically separated by a distance equal to that separating the link pivot pins 62 on each flange of the power drill support bracket 52 . the other ends of the link pairs 58 , 60 are fastened to the tilt plate by pivot pins 90 rotatably received by the sleeves 88 thereby defining a four bar parallel linkage . the carriage 24 is locked by the operator at a selected angular position by means of a threaded rod 94 terminating in a t - handle 96 . the end of the threaded rod passes through a slot 98 in a hinged lock plate 100 and is received by a threaded hole 102 in the tilt plate . a collar 104 welded to the threaded rod clamps the tilt plate 86 against the lock plate 100 upon tightening of the threaded rod by means of the t - handle 96 . the lock plate is hingedly attached to the slidable tube 32 by means of a hinge pin 106 on a projecting tab 108 welded to the slidable tube . the ends of the lower links 58b , 60b attached to the tilt plate 86 have extensions 110 which are joined by a bracket 112 to a drill feed lever 114 having a hand grip 116 at its outer extremity . accordingly , up and down movement of the feed lever 114 causes the power drill 12 to move up and down in parallel fashion through the action of the parallel linkage 50 pivoting on the tilt plate . although the parallel linkage causes the power drill to describe an arc as it is moved up and down by the feed lever , it will be appreciated that for the small displacements involved in drilling through an automobile frame member , that motion is linear for all practical purposes . the length of the feed lever 114 is considerably greater than that of the portion of the side links 58a , 58b between the pivot pins 62 and 90 . accordingly , a substantial mechanical advantage is provided so as to reduce operator effort . the feed lever 114 includes , under bracket 112 , an air valve 118 for controlling the energization and direction of rotation of the power drill 12 via conduits and hoses ( not shown ) in a manner well known in the art . actuation of the valve 118 is controlled by a fore - and - aft extending rod 120 pivotally attached to the feed lever by means of a pivot bracket 122 , and joined to the air valve through connecting rod 124 . it will be appreciated that the invention described provides a versatile , portable inverted power drill support in which the vertical position as well as the angle of the drill may be easily adjusted so as to permit rapid installation of trailer hitches and the like to automobile frames . all operator manipulated elements , including the levers 72 and 114 and the tilt lock t - handle 96 are well removed from the vicinity of the power drill thereby minimizing risks of injury while using the equipment . while it will be obvious to those skilled in the art that the invention is susceptible of various modifications and alternative constructions , one specific , preferred embodiment thereof has been shown in the drawings and described in detail . it should be understood , however , that there is no intention to limit the invention to the specific form illustrated and described , but on the contrary , the intention is to cover all modifications , alternative constructions and equivalents falling within the spirit and scope of the invention as defined by the appended claims . for example , it will be obvious that the drill 12 may be either pneumatically or electrically powered . | 8 |
fig1 illustrates an agricultural harvesting machine in the form of a combine harvester 2 . the combine harvester 2 carries a receiving device 5 ( shown as a feed rake in this embodiment ) at its front end . the receiving device 5 carries an agricultural implement 13 , which is in the form of a grain header in the embodiment shown . the receiving device 5 is mounted on pivot shaft 3 , which is transverse to the direction of travel fr , thereby allowing the receiving device 5 to pivot in a vertical direction . holding flanges 6 are integrally formed with the receiving device 5 on its lower side . the holding flanges 6 receive piston rods 8 of lifting cylinders 9 so that cylinders 9 are pivotable about an axis 7 pointing transversely to the direction of travel fr . the lifting cylinders 9 are mounted at and are pivotable about axis 10 , which points transversely to the direction of travel fr . by pressurizing the lifting cylinders 9 or relieving them of pressure , the piston rods 8 move out of cylinders 11 of the lifting cylinders 9 or enter them . this facilitates a pivot movement of the receiving device 5 in a vertical direction about the pivot shaft 3 . the lifting cylinders 9 also provide support for the receiving device 5 . referring to fig2 support wheels 15 are connecting with the receiving device 5 at the region between the agricultural implement 13 and a front axle 14 of the machine 1 in order to provide additional support for the receiving device 5 and the agricultural implement 13 . each support wheel is provided with a wheel axle 16 . a hub 17 surrounds the wheel axle 16 . a receiving flange 18 is integrally formed with the hub 17 at its inner end at the region of the support wheels 15 . a pivot shaft 20 passes through the receiving flange 18 and points in a vertical direction . in the embodiment shown , the pivot shaft 20 is an axially locked bolt 19 . the pivot shaft 20 also passes through a guide eye 22 at a rim region 21 of the support wheels 15 . a supporting arm 23 is attached to the other end of the guide eye 22 . in the embodiment shown , associated with each support wheel 15 is such a supporting arm 23 , wherein each supporting arm 23 includes a head piece 24 at its end receiving the respective support wheel 15 . an angle profile carrier 25 is welded to the head piece 24 at the carrier vehicle side . the angle profile carrier 25 has a cross - section increasing in the direction of the front axle 14 of the carrier vehicle 1 . holding flanges 26 are associated with the front side of the front axle 14 of the agricultural machine 1 . shafts 28 pass through the holding flanges 26 ( shown in this embodiment as axially locked bolts ) and are transverse to the direction of travel fr . flange - like extensions 29 of the angle profile carriers 25 traverse the gap between adjacent holding flanges 26 and are held in place by the shafts 28 . the angle profile carriers 25 are thereby pivotable in a vertical direction about shafts 28 . this arrangement forms a pivotable connection between the supporting arm 23 of support frame 30 and the front axle 14 of the agricultural harvesting machine 1 . a holding strap 31 is formed integrally with the head piece 24 of the first supporting arm 23 on the side facing away from the respective support wheel 15 . the holding strap 31 receives the front end of a piston rod 32 of a lifting cylinder 33 so that it is pivotable about an axis 34 pointing transversely to the direction of travel fr . the cylinder end of the lifting cylinder 33 is attached to the receiving device 5 of the agricultural harvesting machine 1 so that it is pivotable about a shaft 35 also arranged transversely to the direction of travel fr . thus the respective lifting cylinder 33 forms a further supporting arm 36 of the support frame 30 , which pivotably connects the support wheel 15 to the receiving device 5 of the agricultural harvesting machine 1 . in this way , each of the support wheels 15 is connected by a support frame 30 consisting of a first supporting arm 25 and at least one further supporting arm 36 to both the agricultural harvesting machine 1 and the receiving device 5 . in an alternate embodiment , the support frame 30 is designed in one piece and is arranged on the agricultural harvesting machine 1 so that it is pivotable via one or more pivot axes 28 arranged transversely to the direction of travel fr . in other embodiments , the receiving device 5 is supported on the agricultural harvesting machine 1 by only one lifting cylinder 9 or any number of lifting cylinders 9 . this arrangement permits the association of the support wheels 15 with the receiving device 5 can be varied in a vertical direction , so that the support wheels 15 can always touch the ground 36 irrespective of the position of the receiving device 5 . this construction makes it possible to adjust the support load f 1 of the at least one support wheel 15 to be supported on the ground 37 . it is within the scope of the invention that associated with the receiving device 5 are a plurality of support wheels 15 at least some of which transmit support loads f 1 adjustable by means of lifting cylinders 33 to the ground 37 . in one embodiment , the multiple support wheels 15 are adjustable independently of one another . a particularly advantageous embodiment of the support wheels 15 , which will be described in more detail below , is achieved if this adjustability of the support load f 1 also allows regulation of the bearing pressure p of the agricultural implement 13 on the ground 37 . fig3 illustrates a control system for one embodiment of a wheel support assembly . the lifting cylinder 33 of the support wheel 15 and the lifting cylinder or cylinders 9 of the receiving device 5 are single - acting lifting cylinders . a system conduit or pipe 38 connects the piston face side of the pressure chambers 39 , 40 of the lifting cylinders 33 , 9 , respectively . the system pipe 38 has at least one pressure - limiting valve 41 which limits the pressure in the system pipe 38 and , on exceeding the pressure threshold value p c which is adjustable at the pressure - limiting valve 41 . the pressure - limiting valve is connected to the tank 42 , so that a portion of the energy - transmitting medium can run off into the tank 42 . it is contemplated that the parallel - connected pressure - limiting valve 41 can be replaced by a pressure - limiting valve 41 a connected in series with the at least one lifting cylinder 9 of the receiving device 5 and which separates the lifting cylinder 9 of the receiving device 5 from the system pipe 38 as soon as the pipe pressure has reached the set value p c both embodiments create the possibility of limiting to a fixed value the support load f transmitted by the lifting cylinder or cylinders 9 of the receiving device 5 to the axle 14 of the agricultural harvesting machine . thus , the support load f 2 at the axle 14 of the agricultural harvesting machine 1 can be limited to a fixed value . so that the piston rod 8 of the lifting cylinders 9 can nevertheless retract when the pressure - limiting valve 41 a is blocked , associated with the pressure - limiting valve 41 a at its simplest is a non - return valve 41 b which opens in the direction of an accumulator 76 . as a result , operationally related pressure peaks in the pressure chamber 40 on the piston side of the lifting cylinder or cylinders 9 of the receiving device 5 can be reduced even when the pressure - limiting valve 41 b is closed . a switchable 2 / 2 - port directional control valve 43 is also connected to a pump p integrated in the agricultural harvesting machine 1 and to a tank t . pressurization of the system pipe 38 causes the piston rods 8 , 32 to extend out of the respective lifting cylinders 9 , 33 . in the process the receiving device 5 performs a pivot movement about its upper pivot shaft 3 to a position removed from the ground . at the same time the at least one support wheel 15 , which is arranged on the receiving device 5 so as to be vertically movable by the other lifting cylinder 33 , moves towards the ground to ensure that the at least one support wheel 15 contacts the ground 37 . because the lifting cylinders 9 , 33 coupled together are single - acting , gravity - related lowering of the receiving device 5 simultaneously leads to also gravity - related retraction of the lifting cylinder 33 which receives the at least one support wheel 15 vertically movably . such a design ensures that the ratio between the support load f 1 to be transmitted by the at least one support wheel 15 and the support load f to be transmitted to the land wheels 44 of the adjacent front axle 14 is constant . this ratio corresponds to the ratio of the piston faces a 1 , a 2 of the coupled lifting cylinders 9 , 33 . the lifting cylinders 9 , 33 ( which are single - acting in fig3 ) can also be double - acting as shown in fig4 . here , the pressure chambers 39 , 40 on the piston face side are connected by a pipe system 45 to each other and to an adjustable pressure - limiting valve 46 . the pressure chambers 47 , 48 on the piston rod side of said lifting cylinders 9 , 33 are also connected by a pipe system 49 to each other and to a pressure - limiting valve 50 . both pressure - limiting valves 46 , 50 correspond in function to the pressure - limiting valve 41 already described when using single - acting lifting cylinders 9 , 33 . via a 3 / 2 - port directional control valve 51 the pipe systems 45 , 49 and hence the lifting cylinders 9 , 33 are connected to the pump p and the tank t of the agricultural harvesting machine 1 . when using double - acting lifting cylinders 9 , 33 too , pressurization of the pressure chambers 39 , 40 on the piston face side leads to lifting of the receiving device and lowering of the at least one support wheel 15 . conversely , pressurization of the pressure chambers 47 , 48 on the piston rod side of the lifting cylinders 9 , 33 coupled together leads to lowering of the receiving device 5 with simultaneous lifting of the at least one support wheel 15 . with this design too it is ensured that the at least one support wheel 15 has permanent contact with the ground 37 , wherein here the support load ratios f 1 / f now depend on the ratio of the piston faces a 1 and a 2 and on the ratio of the piston faces a 3 and a 4 on the piston rod side . it is contemplated that accumulators 76 according to fig3 can be associated with the pipe systems 38 or 45 , 49 , to avoid sudden loading . the support wheels 15 shown in fig2 can also be pivotable about the vertical pivot shaft 20 , wherein the bolt 19 forming the pivot shaft 20 is encompassed at the top by a steering lever 52 with which is associated at one end a stud 53 pointing in a vertical direction . the supporting arm 23 which receives the respective support wheel 15 has , at its end associated with the front axle 14 of the agricultural harvesting machine 1 , a stud 54 pointing in a vertical direction . on the stud 54 is pivotably arranged an angle lever 55 with which are in turn associated non - rotatably a plurality of studs 56 , 57 , 58 . a first coupling rod 59 connects the stud 53 of the steering lever 52 pivotably to a stud 56 arranged on the angle lever 55 , wherein the coupling rod 59 extends in the direction of the front axle 14 of the agricultural harvesting machine 1 above and in the region of the angle profile carrier 25 of the respective supporting arm 23 . in the embodiment shown , associated with the adjacent support wheels 15 are steering levers 52 , coupling rods 59 and angle levers 55 which are arranged inversely symmetrically to each other and which in each case form a partial steering mechanism 60 , 61 for the respective support wheel 15 . in the region of the front axle 14 , the two partial steering mechanisms 60 , 61 are coupled to each other by a connecting strut 62 pivotably connected to the rear studs 57 of the angle levers 55 . pivotably associated with one of the angle levers 55 via a further stud 58 is a steering cylinder 63 which at the other end is received by a holding flange 65 attached to the angle profile carrier 25 , so that it is also pivotable about a vertical axis 64 . by pressurization of the double - acting steering cylinder 63 , the piston rod 66 can be moved out of the steering cylinder 63 or into it , wherein the support wheels 15 perform pivot movements in the same direction about their vertical pivot shafts 20 . it is within the scope of the invention that only one support wheel 15 which is steerable according to the invention or a plurality of support wheels 15 which are steerable according to the invention are associated with the agricultural harvesting machine 1 or , if there is more than one support wheel 15 , only some of the support wheels 15 are steerable . also , the steering movement of the steered axle 67 of the agricultural harvesting machine 1 with its land wheels 68 and the steering movement of the support wheels 15 according to the invention can be coupled to each other . the agricultural harvesting machine 1 should be steered and driven reliably . accordingly , as shown in fig1 associated with each axle 14 , 67 of the agricultural harvesting machine 1 is at least one load - sensing transducer 69 , 70 which is , for example , a wire strain gauge for determining the deflection of the axles 14 , 67 or a pressure sensor for determining the tire pressure of the land wheels 44 , 68 . the load - sensing transducers 69 , 70 generate as a function of the respective support load f 2 , f 3 input signals x 2 , x 3 which in an electronic calculating unit 71 generate , as a function of a load distribution ratio which is predefined and if necessary variable as desired , an output signal x 1 which via a switching valve 72 of any design leads to pressurization or relief of pressure of the lifting cylinder 33 of the at least one support wheel 15 . in this way it is possible to adjust the support load f 1 of the at least one support wheel 15 as a function of the support loads f 2 , f 3 of the axles 14 , 67 of the agricultural harvesting machine 1 . further , associated with the at least one support wheel 15 can be a load - sensing transducer 74 which generates an input signal x 4 which is dependent upon the support load f 3 and which in the electronic calculating unit 71 can be used as a measure of the pressure p acting on the ground 37 by the agricultural implement 13 . in this way it is possible to adjust the support load distribution as a function of support of the agricultural implement 13 on the ground 37 as well . because agricultural harvesting machines designed as combine harvesters 2 have a crop storage device 73 , the mass of the agricultural harvesting machine 1 and hence the support loads f 2 , f 3 applied to the axles 14 , 67 varies constantly . to achieve continuous adaptation of the support load f 1 of the support wheel 15 in spite of support loads f 2 , f 3 varying during the harvesting process , the switching valve 72 can be designed as a proportional valve 72 known in the art whose control signal x 1 leads to permanent adaptation of the support load f 1 to the varying mass of the agricultural harvesting machine 1 . in order that , during lifting and lowering of the support wheel 15 , the effect of this change of position on the support load f 1 of this support wheel 15 remains small , the lifting cylinder 33 which allows the change of position is arranged in an essentially vertical direction on the receiving device 5 . if adaptation of the support load f 1 of the support wheel 15 to the other support loads f 2 , f 3 is not effected , it is contemplated that the lifting cylinder 33 of the support wheel 15 can also be blocked in a manner known in the art and therefore not described . to ensure , even when there is no agricultural implement 13 , that the support wheels 15 according to the invention support a minimum load on the ground 37 , on the one hand the lifting cylinders 9 which pivot the receiving device 5 can be designed as double - acting lifting cylinders 9 , so that by means of the piston rod 8 retracting into the cylinder 11 of the lifting cylinders 9 it can be fixed how high the load to be supported on the ground 37 by the support wheels 15 is to be . if the lifting cylinders 9 which pivot the receiving device 5 are single - acting , between the receiving device 5 and the agricultural harvesting machine 1 can be interposed a traction cylinder 75 which under pressurization forces the support wheels 15 according to the invention onto the ground 37 , wherein by pressurization of the traction cylinder 75 the quantity of the load f 1 to be supported can be determined . other objects , features and advantages of the present invention will be apparent to those skilled in the art . while preferred embodiments of the present invention have been illustrated and described , this has been by way of illustration and the invention should not be limited except as required by the scope of the appended claims and their equivalents . | 0 |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.