Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
next , detailed description will be made of the preferred embodiments of data rearrangement methods of the present invention with reference to the accompanying drawings . in the specification and the drawings , components having substantially similar functions will be denoted by similar reference numerals , and repeated explanation will be omitted . a data rearrangement method of the first embodiment includes a step of storing a specific rule in an address conversion table , and a step of sequentially reading addresses to store data for an arithmetic operation from the address conversion table by using a stack pointer . one - dimensional rearrangement will be described here in order to simplify explanation , but the invention is not limited to this rearrangement . fig1 is a view showing a state of the address conversion table and a position of the stack pointer in order to explain the data rearrangement method of the first embodiment which uses the address conversion table and the stack pointer . the stack pointer is a resister for holding a first address of the stack . it is generally incremented (+ 1 ) when data is pushed down ( stored ), and decremented (− 1 ) when data is popped up ( read ). the stack employs a last - in - first - out ( lifo ) structure in which first stored data is read . in fig1 , “ address : 0x8000 ” or the like represents an address in a hexadecimal form of a memory . first , information of rearrangement is pushed down in the stack to be stored as an address conversion table . addresses are sequentially stored : for example , an address ( 0x1002 ) is stored in an address ( 0x8000 ) of a memory 10 , an address ( 0x1000 ) is stored in an address ( 0x8001 ) of the memory 10 and so on . in the case of carrying out a sequential arithmetic operation by a dsp , the stack is popped up to refer to an address ( 0x1003 ) stored in an address ( 0x8004 ) indicated by the stack pointer , and data is read to be stored in the address ( 0x1003 ) of the memory 10 . after completion of the data arithmetic operation by the dsp , since a stack pointer 30 has been decremented by popping - up , an address ( 0x8003 ) is indicated this time , and reference is made to an address ( 0x1001 ) to be stored here . similarly thereafter , reference is made to the address conversion table ( fig1 ). fig2 shows a flowchart for realizing the rearrangement method of the first embodiment , and a program example . the flowchart and the program example of fig2 show a process after a conversion address is first stored in the address conversion table ( stack ), and then the stack pointer moves to a predetermined pointer position . here , a one address storage register r 0 and a one data storage register a 0 are used . in the program example , “ pop ” is a command for copying a value of a first address of the stack to a right register , “ mov ” is as previously described , a character / numeral in “( )” indicates a value of data stored in its address or register , and a character / numeral without “( )” indicates an address value or a register itself . first , in s 10 , the dsp starts an arithmetic operation , and its result is stored in the a0 register ( s 10 ). then , in s 11 , the stack is popped up , and an address ( 0x1003 ) to be stored in an address ( 0x8004 ) of the address conversion table indicated by the stack pointer is set to the r0 register ( s 11 ). then , in s 12 , the result of the arithmetic operation stored in the a0 register is stored in the address ( 0x1003 ) stored in the r0 register ( s 12 ). then , in s 13 , determination is made as so removal of the r0 register from an address conversion table area ( s 13 ). if a result of the determination shows the removal from the area , the stack pointer is returned to an initial area . if no removal is determined , the process proceeds to a next arithmetic operation ( fig2 ). if the stack pointer is returned to an initial state at a break point of the arithmetic operation , the steps s 13 , s 14 can be omitted . after the movement of the stack pointer from the address ( 0x8004 ) to an address ( 0x8000 ), an arithmetic operation is executed in an order pushed down beforehand in the stack . as described above , by using the stack pointer , data can be written in a predetermined address by a small number of processing operations . additionally , since optional rearrangement information can be written in the stack , optional rearrangement can be dealt with . these operations are difficult if a process is carried out only by hardware . the storage ( writing ) of data has been described . however , data reading can also be realized by a similar method . in this case , the program example of fig2 becomes as follows : in the program example of fig2 , the pop command and the mov command are separately executed . however , in a system which can execute a pop command and a mov command in one command , they can be executed by one command . in the program example of fig2 , the reading is carried out from the memory by the pop command , while the writing in the memory is carried out by the mov command . however , in the case of a system in which memory reading and memory writing are at separate stages , these operations are subjected to pipeline processing to enable execution by one command . an example is shown in fig3 . in the case of rearrangement during data reading shown in fig3 , if “ pop r0 ” and “ mov ( r0 ), a0 ” are in one command , reading is carried out from the memory by the pop command , and reading is also carried out from the memory by the mov command . accordingly , competition occurs at read of a state t3 . however , in the case of a system which avoids competition , even data reading can be executed by one command . as measures to avoid competition , when simultaneous reading operations occur , one reading is preferentially executed , and the other reading is executed later . this way , competition avoidance may be realized . in the case of reading from an independent memory , since no competition occurs , the operation can be executed by one command . the first embodiment has been described by way of case in which there is only one stack area . however , in the case of using a plurality of bits of rearrangement information , a plurality of stack pointers may be prepared to process a plurality of stacks . in such a case , pluralities of push commands for operating the stacks , pop commands , and mov commands to the stack pointers for “ initialize stack pointer ” are prepared . a data rearrangement method of a second embodiment further comprises , in addition to those of the method of the first embodiment , a step of calculating or or add of a read address and an offset register . the offset address is disposed , a low - order bit of a rearrangement address is stored in a stack , and or or add of a read address and the offset register is calculated to generate a rearrangement address . accordingly , a plurality of data rows can be rearranged . in this case , the “ or ” calculation means an “ or ” calculation for each bit , and the “ add ” calculation means an addition ” calculation . selection of “ or ” or “ add ” may be optionally controlled by disposing e . g ., a control register . according to the second embodiment , rearrangement of a plurality of data rows is enabled in addition to the effects provided by the first embodiment . according to a data rearrangement method of a third embodiment , a rearrangement only register is used in place of the stack pointer of the first embodiment . the use of the rearrangement only register enables updating of an optional pointer , and thus it is possible to carry out more efficient data rearrangement . fig4 is a view showing a state of an address conversion table and contents of a rearrangement only register ( rr ) in order to explain the data rearrangement method of the third embodiment which uses the address conversion table and the rearrangement only register ( rr ). fig5 shows a flowchart for realizing the rearrangement method of the third embodiment , and a program example . the flowchart and the program example of fig5 show a process after a state in which a conversion address is first stored in the address conversion table , and a predetermined pointer initial value is stored in the rearrangement only register rr . here , in addition to the rearrangement only register rr , a one address storage register r 0 and a one data storage register a 0 are used . in the program example , “ mov ” or the like is as - previously described . first , in s 30 , a dsp starts an arithmetic operation , and its result is stored in the a0 register ( s 30 ). then , in s 31 , an address ( 0x0003 ) to be stored in an address ( 0x8004 ) of the address conversion table indicated by an address value stored in the rearrangement only register rr is read , set to the r0 register , and the rearrangement only register rr is decremented (− 1 ) ( s 31 ). then , in s 32 , the result of the arithmetic operation stored in the a0 register is stored in the address ( 0x0003 ) stored in the r0 register ( s 32 ). then , in s 33 , determination is made as so removal of the r0 register from an address conversion table area ( s 33 ). if a result of the determination shows the removal from the area , the rearrangement only register rr is returned to an initial area . if no removal is determined , the process proceeds to a next arithmetic operation ( fig5 ). after the contents of the rearrangement only register rr are changed from the address ( 0x8004 ) to an address ( 0x8000 ), an arithmetic operation is executed in an order prestored in the memory . according to the third embodiment , effects similar to those of the first embodiment can be obtained . in the foregoing , the rearrangement only register rr is decremented by − 1 when the data is read from the rearrangement only register rr . however , modifications can be optionally made in accordance with purposes . for example , optional + or −, module addressing etc ., can be cited as modifications . for a modification , a register which supports all types of addressing disposed in a general register can be used . in the case of the module addressing , as in the case of the rearrangement only register , a register only for specifying a module width may be prepared , and necessary registers may also be prepared for other types of addressing . thus , the use of the module addressing eliminates a necessity of periodical resetting of the pointer to enable efficient rearrangement . according to a data rearrangement method of a fourth embodiment , data stored in an address conversion table contains byte - writing information . fig6 is a view showing a state of the address conversion table , a position of a stack pointer , and functions of a control register 40 and an offset register 50 according to the fourth embodiment . according to the first to third embodiments , the data writing is carried out with respect to a fixed bit length ( e . g ., 32 bits ). however , depending on an arithmetic operation , it is necessary to execute writing with respect to only optional bits ( e . g ., 8 bits ) of 32 bits . according to the fourth embodiment , when rearrangement information is stored in the address conversion table , a low - order bit is set as a byte - writing control bit to enable writing in an optional place . for example , as shown in table 1 , fig7 , low - order 2 bits of rearrangement information are set as byte - writing information . further , a byte - writing control register is disposed and , if byte - writing is permitted , low - order 2 bits of an address are supplied as byte - writing information to a memory . remaining high - order 14 bits are supplied as addresses to the memory ( see fig7 ). thus , according to the fourth embodiment , the setting of the low - order bit of the rearrangement information enables writing only in a predetermined bit . in the aforementioned example , 32 bits are divided into 8 bits . however , a way of division is not limited to this . when division is made , the number of bits of the byte - writing information may be set to a necessary number of bits . additionally , by installing the byte - writing control register , the memory used for rearrangement can also be used for general purposes . the preferred embodiments of the data rearrangement methods of the present invention have been described with reference to the accompanying drawings . however , the invention is not limited to the embodiments . it is apparent to those skilled in the art that various changes and modifications can be made within a scope of technical ideas specified in appended claims and , needless to say , such changes and modifications are also within the technical scope of the invention . the present invention relates to the digital processing method in digital communications or digital signal processing , and it can be applied especially to the data rearrangement method . as described above , according to the present invention , there can be provided a data rearrangement method which can reduce the number of processing operations ( the number of commands ) to shorten processing time more than the conventional method , which can be realized efficiently by a small memory capacity , and which can deal with optional rearrangement rules .	6
we have demonstrated , by using adenovirus type 5 , that we can reproduce human adenovirus infection in rabbit eyes and have shown both excellent antiviral activity and conjunctivitis therapy using ctc - 96 which we believe is unique as there is no effective drug against this virus and its pathology in the eye . in addition , we have shown ctc - 96 efficacy against adenovirus types 1 , 2 , 3 , 4 , 5 , and 7 in hela cells in tissue culture . since these human viruses cannot be grown in animal models , this provides an excellent indication of the effectiveness of ctc - 96 against a broad spectrum of adenovirus types . to determine ctc - 96 efficacy against several types of serotypes of adevirus the following procedure was followed : 1 . hela cells were confluent at the time of inoculation . 2 . virus dilutions were prepared from the known titers of the stock viruses ( 4 × 10 5 pfu / ml ; 4 × 10 4 / 0 . 1 ml ) of ad1 kmetz , ad2 wolf , ad3 holyfield , ad4 harris , , ad7a joseph , atcc . this virus inoculation yielded a virus infection with an m . o . i . ( multiplicity of infection ) of approximately 1 . 0 . 3 . 100 □ l of each ad serotype were inoculated onto cultures containing hela cells . 4 . during the adsorption period , doxovir concentrations of 500 , 250 , 100 , 50 , 10 , and 0 μg / ml were prepared in culture medium according to the dilution protocol . 5 . virus was adsorbed at 37 ° c . in a 5 % co 2 water - vapor atmosphere for 1 hour . 6 . after adsorption , the virus inocula were removed from all the wells and 2 wells each were overlayed with 1 ml of doxovir ( in tissue culture medium ) at concentrations of 500 , 250 , 100 , 50 , 10 , and 0 μg / ml . 7 . the plates were incubated at 37 ° c . in a 5 % co 2 water - vapor atmosphere for 24 hours . 8 . after 24 hours , the plates were washed . 9 . each well was refilled with 1 ml of fresh tissue culture medium without doxovir . 10 . the cells were scraped from the wells . 11 . the media and cells were then frozen at − 75 ° c . pending titrations . 12 . titration of duplicate samples were thawed from each ad serotype , doxovir concentration and its no drug control . 13 . viral titers were determined at each drug concentration . ctc - 96 has considerable advantages as an anti - viral drug : a ) because of its unique mode of action it is effective against herpes and hiv virus mutants which are resistant to currently used drugs ; b ) because the drug acts against two different viral targets in herpes virus the development of ctc - 96 - resistant mutants is deemed to be extremely rare ; and c ) because ctc - 96 has anti - inflammatory properties its use replaces the use of steroids in herpes virus and adenovirus therapeutics . steroids modulate the immune response in the areas where they are applied and increase tissue susceptibility to pathogens . efficacy of ctc - 96 against adenovirus types 1 , 2 , 3 , 4 , 5 , and 7 in culture anti - adenovirus activity of ctc - 96 was evaluated by standard cell culture using hela cells , a human cervical carcinoma immortalized cell line ( the usual host for laboratory grade adenovirus ) and anti - viral plaque - reduction assays . ctc - 96 has an inhibitory ( prophylactic ) effect on growth when virus is exposed to the drug prior to cell infection . fig1 shows adenovirus type 5 titers following direct exposure of the virus to ctc - 96 prior to hela cell infection . the data graphically depicted in fig1 were obtained as follows : varying concentrations of the ctc - 96 were mixed with concentrated human adenovirus , [ adenovirus type 5 ( ad5 )] and incubated at 37 ° c . for 60 minutes . aliquots were then diluted 500 fold into growth medium . hela cells were exposed to 100 μl of the diluted material to initiate infection . these monolayers were incubated for 24 hours at 37 % and 5 % co2 and then washed , scraped , sonicated , centrifuged and the supernatant serially diluted . these serial dilutions were plated onto indicator hela cell monolayers and adsorbed for 60 min , aspirated and a methycellulose overlay placed over the cells , which were then incubated for 3 days at 37 %. cultures were counterstained with 1 % methylene blue , allowed to dry and the plaques counted . results are expressed as mean ± sd ( where error bars are not visible they are contained within data point ). ctc - 96 also has a potentially therapeutic effect as can be seen by inhibition of viral growth in adenovirus infected cells , which are subsequently exposed to the drug . fig2 shows virus titers obtained after exposure of human adenovirus type 5 ( ad5 ) infected hela cells to ctc - 96 . these data were obtained as follows : adenovirus was adsorbed onto hela cell monolayers for 60 min at 37 %; serial dilutions of ctc - 96 were overlaid onto the minelayers . monolayers were then incubated for 24 hr at 37 ° c . and 5 % co2 . monolayers were then washed , scraped , sonicated , centrifuged and the supernatant serially diluted . these serial dilutions were plated onto indicator hela cell monolayers and adsorbed for 60 min , aspirated and a methylcellulose overlay placed over the cells , which were then incubated for 3 days at 37 %. cultures were counterstained with 1 % methylene blue , allowed to dry and the plaques counted . results am expressed as mean & amp ; sd ( where error bars are not visible they are contained within data point ). clinical results and plaque assay viral titers of three ctc - 96 treatment / dosing regimens of rabbit eyes infected with human adenovirus , adenovirus type 5 ( ad5 ), were evaluated . on “ day 1 ” animals were infected with human adenovirus type 5 by the installation of 10 6 pfu adenovirus according to our protocol of conjunctival and corneal scarification for the induction of keratoconjunctivitis . clinical conjunctivitis was observed in all animals by day 8 post - inoculation . animals were then randomized and the following experimental groups were treated with ctc - 96 or placebo in a double blind experiment : ( 1 ) placebo ( diluent alone ), 9 ×/ day , for 21 days : ( 4 rabbits ). ( 2 ) ctc - 96 50 μg / ml , 9 ×/ day , for 21 days : ( 4 rabbits ). ( 3 ) ctc - 96 50 μg / ml , 6 ×/ day , for 21 days : ( 4 rabbits ). ( 4 ) c t w 25 μg / ml , 6 ×/ day , for 21 bays : ( 4 rabbits ). clinical disease progression and resolution were evaluated by slit lamp microscopy on days 1 , 3 , 7 , 10 , 13 , 18 , 21 , 24 , 28 and 31 after initial drug dosing . the intensity of the keratitis was quantified using a clinical grading system ( 5 ). application of 25 μg / ml and 50 μg / ml prevented progression of disease severity . application of 50 μg / ml 6 or 9 times a day for 21 days resulted in complete resolution of clinical disease by day 21 while placebo treated animals continued to show symptoms for another 10 days . the results are depicted in fig3 which shows ctc - 96 treatment of adenovirus induced keratoconjunctivitis . the data in fig3 were obtained as follows : rabbits were infected with human adenovirus type 5 by the installation 10 6 pfu adenovirus according to our protocol of conjunctival and corneal scarification for the production of keratoconjunctivitis . on day 8 post - inoculation treatment with eye drops containing ctc - 96 or placebo was initiated . animals were examined for stromal keratitis and scored by the corneal disease scale of wander et al . ( 5 ). the following are the criteria for determination of conjunctival disease : area of conjunctival disease conjunctival severity 0 normal cornea . 0 normal conjunctiva . + 1 ≦ 25 % involved . + 1 mild conjunctival injection . + 2 & gt ; 25 %, ≦ 50 % involved . + 2 moderate conjunctival injection / chemosis . + 3 & gt ; 50 %, ≦ 75 % involved . + 3 severe conjunctival injection / chemosis . + 4 & gt ; 75 %, ≦ 100 % involved . + 4 pseudomembrane present . the efficacy of ctc - 96 treatment of rabbit eyes infected with human adenovirus , adenovirus type 5 ( ad5 ), was also evaluated by adenovirus recovery from tear film cultures adsorbed onto confluent hela cell monolayers . application of 50 μg / ml 6 or 9 times a day resulted in a rapid fall in viral presence in the eye with no detectable virus by day 13 while placebo treated eyes continued to show detectable virus until day 24 . fig4 shows adenovirus titers after treatment of rabbit eyes with ctc - 96 or placebo . these data were obtained by the following procedure : rabbits were infected with human adenovirus type 5 by the installation 10 6 pfu adenovirus according to our protocol of conjunctival and corneal scarification for the production of keratoconjunctivitis . on day 8 post - inoculation treatment with eye drops containing ctc - 96 or placebo was initiated . adenovirus recovery from tear film was evaluated by plaque assay on confluent hela cell monolayers . data are presented as average ± sd .	0
the static inflatable of the invention uses a single air source 20 to direct air to a single air outlet 30 . the directed air provides enough force on the interior of the figure to keep it in an upright position . for this reason , the figure cannot have inflated appendages . appendages can be wired in order to give them the inflated appearance but it is required that the air travel from the air source upward to a single exhaust in order to provide the necessary force to keep the figure upright . tether points 35 can be provided on the figure . the tethers are not needed to keep the upright position of the figure , but can be used to impart any desired movement of the figure or to counteract particularly strong winds when the figure is used outside . the air source can be made to cycle on and off . with the air source being intermittent , the figure will be provided with some degree of movement . with the air source off , the lack of air pressure provided by the air source will cause the figure to begin to deflate . as soon as the air source switches to the on condition , the figure will return to the upright position . this type of intentional imparting of movement to the figure is referred to as intentional air intervention technology . the air can be interrupted by the use of relays on fans . the use of relays can be set to a specific cycle . one such cycle is having the relays be two seconds on followed by two seconds off in a repeating pattern . if the relays on the fans are provided with sound sensing , light sensing or programmable controls , the figure can be made to move in any desired manner , including moving to music . when a single outlet is used for the exhaust of the air flowing through the figure , the vent is made large and baffles are used in the area of the vent to prevent the edges fo the vent from flailing . the elimination of flailing reduces wear and tear of the material about the vent , adding to the life span of the figure . this type of figure can be made in one of two ways . in a first manner , the figure is provided with a single leg and a single air source 20 at the base of the leg . this arrangement creates the necessary air movement in order to maintain upright positions . the singular outlet not only provides the outflow from the inflated figure , but the configuration and location of the outlet determines the magnitude and direction of reactive destabilizing forces produced by outflow from the singular outlet . this helps define and determine the particular movement pattern for the moving inflated figure . thus , the singular vent and its location , and the addition of ancillary sections of the figure provided by the arms produces a much more complex and sophisticated pattern of movement of the figure . preferably , the single outlet provides a release of gas generally symmetrically with reference to the torso central axis . while it is desirable to have this symmetrical release of gas , the ancillary sections need not be symmetrical to achieve this . in the second manner , shown in fig2 the figure has a pair spaced apart legs , a torso , a head and a pair of outwardly and upwardly extending arms . a singular vent 31 , preferably at the top of the head or at the end of only one of the arms , allowing for the continuous release of generally all of the gas being introduced into the figure at a predetermined controlled rate . for example , a figure might have one arm on one side with one large outlet and a plurality of arms on the other side with no outlets in them . baffles 51 , 52 , 53 in the figure ensure the equal distribution of internal pressure . in the second embodiment , the figure is provided with two legs 14 , 16 and an air source 22 , 24 at the base of each leg . in this instance , the torso of the figure is separated into two chambers 26 , 28 in a side by side relationship . the two air sources provide an air flow through each chamber . this type of figure is shown in fig3 . as can be seen , the figure operates as two singular tubes joined side by side , each with a single source and a single outlet . for many applications , the figure will be generally upright . this arrangement is simple and effective . on some occasions however , it may be desired that the object extend at an incline from the vertical . this could be done for visual aesthetic purposes or might simply be the convenient result of using the apparatus on an inclined surface such as a hillside . music may be provided to create the impression that the figure is dancing to the music . while the movement of the figure is random or apparently random , normally the illusion is nevertheless created that the figure is in fact dancing in the rhythm to the music . similarly lighting , particularly intermittent or internal or external strobe type lighting , may also be provided to enhance the overall effect . in the preferred form of the apparatus and method , a pair of fans are provided , each connected to the lower end of one of the legs of the figure . the fans provide a generally constant or fixed input airflow , which may be adjustable to different constant flow levels to accommodate different figures and different environmental conditions such as ambient wind . alternately , a single fan may be provided with a singular outflow , with the singular outflow going to one of the legs . similarly the figure might be provided with a single structural leg connected to a single fan . for miniature moving inflatable figures , two fans are preferred which exhaust into one port . this new design of miniature moving inflatables uses a new quiet squirrel cage fan enclosed in a housing and a figure with only one exhaust port in it . the arms of the figure are sealed . as the air is fed through the figure , the figure fills up and as the air exhausts , the weight of the figure , the fig . wants to collapse and in doing so creates a closure in the figure which causes the figure to fill up again . this process repeats itself over and over again as long as the fan continues to provide air to the figure . a squirrel cage fan , which is not only quieter , but has a higher static pressure . the opening in the head of the new design has been changed also to provide just enough air release to cause the figure to move around , but not freeze in a stall mode or fall down . there are no internal baffles inside of the new miniature moving inflatable figures but they may be added . single legged medium size moving inflatable figures can be made in an indoor version . the indoor design of the moving inflatable uses a new quiet squirrel cage fan and a redesigned figure with only one exhaust port and sealed arms . there are no internal baffles inside of this design . baffles may be added to change the form . baffles in the arm will make the arm not hollow and direct air flow . also , the exhaust port , does not necessarily need to be in the head portion for other effects . the control of the figure is built into the weight and balance of the figure as defined in the drawing . the weight of the fabric used and the angles of the cuts of the material are designed to enable the figure to dance as designed verses random movements . this figure and fan are designed primarily for indoor use , but may be used outdoors in very calm winds . the height of the figure may vary . the outdoor design is taller , and has different measurements than the indoor model . the figure has only one exhaust port in the head and has sealed arms . the only port may still be placed in the arm or other areas for different designs and effects . baffles may be used in the arms ( or other areas of the figures ) and therefore , the arms , or other areas , would not be hollow , as needed to direct the airflow . the fan used for this model is a 1 . 5 hp axial blade fan built by tubeworks , inc . other hp fans would work with other designs . a squirrel cage fan , which is not only quieter , but has a higher static pressure . the opening in the head of the new design has been changed also to provide just enough air release to cause the figure to move around , but not freeze in a stall mode or fall down . the existing single legged medium size moving inflatable figure has two sealed arms attached to it which cause drag and imbalance . that drag and imbalance is offset by the diameter of the exhaust port combined with the weight and shape of the figure itself which forces the figure to dance without touching the ground . there are no internal baffles inside of the new design but can be added for directional air as needed which would not make the figure hollow . the mid - size single fan moving inflatable figures use a new quiet squirrel cage fan and a redesigned figure with only one exhaust port in it . one arm in the design has an opening sewn into one arm at such a location that it creates movement in the figure as it appears to be waving . different figures may require placing the port in other areas , i . e ., a tail , fins , wings , ears , mouth , hats , hair , or other accessories , etc as custom designs dictate . the head and the other arm of the figure are sealed . as the air is fed through the figure , the figure fills up and as the air exhausts , the weight of the figure &# 39 ; s arm wants to collapse and in doing so creates a closure in the arm of the figure which causes the figure &# 39 ; s arm to fill up again . this process repeats itself over and over again as long as the fan continues to provide air to the figure . one air port may be placed in another area of a custom design that would react accordingly . a squirrel cage fan , which is not only quieter , but has a higher static pressure is used . the opening in the arm provides just enough air release to cause the figure &# 39 ; s arm to move around , but not freeze in a stall mode or fall down . there are no internal baffles inside of the new design but can be added to provide directional intentionally interrupted air needed in circumstances calling for this . large moving inflatable figures can be made in an indoor and an outdoor version . this new design of the indoor version uses a new quiet squirrel cage fan and only one exhaust port in it . the arms of the figure are sealed . the exhaust port is in the head of the figure . but depending on the design , the exhaust port could be in another area of the figure . while the design has two legs , two arms and a head , like a humanoid shape , ( or animal shape , or other custom shapes ) air is fed into only one leg of the figure ( or other areas , depending on design and desired effect ) and the air exhausts through one exhaust port in the head of the figure ( to achieve a desired effect , another location may be substituted , depending upon the design ). the other leg of the figure is generally the same length as the other leg , but instead of being open to accept intake air , it is sealed with a heavy material which can take the abuse of touching the ground when it bounces around in a dancing and sometime walking motion . any unlimited type of designs are possible using this technology . the trade secret is in the weight and balance of the figure and the diameter and shape of the exhaust port , combined with internal baffling . as the air is fed through the figure , the figure fills up and as the air exhausts , the weight of the figure wants to collapse and in doing so creates a closure in the figure which causes the figure to fill up again . this process repeats itself over and over again as long as the fan continues to provide air to the figure . this new design of the outdoor version generally uses a 1 . 5 hp axial blade fan but other hpfans could be used for other designs and a redesigned figure . a smaller or larger horsepower axial blade fan can be used , but it would require a redesign of the figure and the baffling to create the type of movement for each figure which was created . the actual shape of the figures can be almost any design , animal , vegetable or mineral . the key is in the weight and balance , baffling and exhaust air design which is configured specifically to each figure . the design uses a different fan , a squirrel cage fan , which is not only quieter , but has a higher static pressure , which is part of the secret to making our new design work with only one opening in the figure vs . three that we had before . the opening in the head of the new design has been changed also to provide just enough air release to cause the figure to move around , but not freeze in a stall mode or fall down . there are internal baffles inside of the new designs . the designs are multi theme characters , animals , and products , that can vary in size in dimension . in another embodiment of the invention shown in fig4 the figure is provided with an internal fly tube 40 tethered at both ends and having a base receiving the air from a single air source . the tube is sewn to the interior of the figure . this fly tube functions much like a figure having a single source and a single outlet . in this embodiment , the fly tube imparts its movements to the overall inflatable figure . appendages can be provided on the inflatable figure but they do not have outlets . the movement of the internal fly tube imparting movement to the overall figure is referred to as intentional internal intervention technology . this intentional internal intervention technology can be used in conjunction with the intentional air intervention technology , entailing the control of the air source to provide movement to the figure . i . by trapping an oversize inflated tubular structure inside of an outer inflatable structure , the interior tubular structure will hit the walls of the outer structure and cause it to move . when the outer structure is mounted atop a stable platform such that the outer structure is allowed to rock and roll on the platform , the figure will develop continuous and repetitive movements as air passes through the inflated tube and air is bled off that tube to inflate the outer structure . ii . by using a stable inflatable type figure and mounting it atop two sliding or semi rotating platforms which are mechanically driven , the legs of the figure will move with the platforms and cause movement in the figure , making it appear to walk or dance . iii . an inflatable vertically stable figure can also be made , as described in our earlier submission with multiple air outlets which do not cause the figure to move . design of the figure is such that outside forces , such as the wind , catch the figure and cause it to move or dance while the internal air causes the figure to remain somewhat stable as it fights the wind effects from outside . inflatables offer an option for those who desire less , or minimal movement in their figures than the other moving figures described herein . such figures could be preferred for users with limited space to mount the figures or those who have a printed message on the figures that they desire to be more readable as the result of the lesser movement . iv . by using an air driven , circulating air vent type mechanism , upon which a single legged , static type figure is mounted , the figure will spin around in circles as the air vent spins . while the invention has been described with reference to the preferred embodiments , variations and modifications would be apparent to one of ordinary skill in the art . the invention encompasses such variations and modifications .	6
various methods of designing printed planar reflectors are known . these methods include loading , dimensioning of microstrip patches , and blazed gratings . design of a planar reflector array for use in the present invention , is in accordance with these known design methods . a commercial cad package was used to fulfil design requirements of reflector arrays described herein . fig1 shows a side view of a planar reflector . a &# 34 ; quasi periodic &# 34 ; array of patches 61 is etched on a top surface of a grounded dielectric slab 7 having a feed 68 in the form of , for example , a horn at a &# 34 ; focal point &# 34 ; thereof . alternatively , another type of feed is used . in fig1 the dielectric slab 7 is grounded with a ground plane 5 disposed thereon on a side opposite the array of patches 61 . the attributes of the patches 61 -- dimension , loading , placement or a combination thereof -- are smoothly varied throughout the structure so that the feed location approximates the focal point of the planar reflector ; this is what is meant herein by &# 34 ; quasi periodic .&# 34 ; essentially , features of patches on a top surfaces of the planar reflector 60 are varied in a manner that enables the structure to transform an incoming spherical wave 1 emanated from the feed 68 into a reflected plane wave 2 . the function of the planar reflector 60 is analogous to a &# 34 ; planar phase front transformer &# 34 ;. of course depending upon design requirements , different features of an etched pattern on the top surface of the planar reflector are changed to obtain the required phase shift and transform the phase front of the wave that impinges on a specific locality of the reflector surface . this is well known in the art . the term top surface as used herein refers to a surface of the planar reflector 60 receiving a signal from the feed 68 ; of course , the antenna may be moved rendering the &# 34 ; top surface &# 34 ; on the bottom side of the antenna , but this is still referred to , for clarity , as the top surface . one method of creating a required phase shift pattern is by smoothly varying dimensions of reflective elements , in the form of rectangular patches , on a top surface of the planar reflector . first , the elements are arranged in a periodic configuration and cell dimensions are constant throughout the structure . it is known that a plane wave illuminating a periodic structure of rectangular patches goes through a phase shift as it is reflected . fig2 shows a typical curve of an amount of phase shift introduced in an incident wave as it is reflected from a planar reflector array , versus rectangular patch length that is used as a cell element of a periodic structure . as operating frequency of an antenna changes , the phase shift at some localities of the planar reflector goes to saturation resulting in beam squint . according to the embodiments described herein , rectangular patch lengths at each locality are dimensioned so as to introduce a required phase shift into the reflected wave from that locality . by applying this throughout the reflector array , a quasi - periodic structure -- not exactly periodic -- capable of acting as a &# 34 ; phase front transformer &# 34 ; results . the structure mimics a conventional reflector such as a parabolic reflector . a printed planar reflector is also realised by proper placement of the elements on a grounded dielectric slab . as in the previous example of planar reflector array design , a feed is disposed at a &# 34 ; focal point &# 34 ; of the planar reflector . for design , each locality of the planar reflector 60 is assumed to illuminated by a plane wave 1 whose direction is dictated by relative location of that locality with respect to a phase centre of the feed 68 . the periodicity of the elements at that specific location are adjusted so as to excite a higher order floquet &# 39 ; s mode , ( 0 ,- 1 ) in this case , in a desired direction . this procedure is applied throughout the planar reflector 60 in order to span the reflector elements in a certain lattice . a typical configuration of elements throughout the surface is shown in fig3 . the cell dimensions are adjusted to provide propagation of a desired higher order floquet &# 39 ; s mode . the direction of propagation of ( m , n ) th mode is obtained using the following relationships ; ## equ1 ## where ( m , n ) represent mode number , t x and t y are cell dimensions in x and y directions , φ inc and θ inc are propagation direction of an illuminating plane wave and φ . sub . ( mn ) and θ . sub . ( mn ) are propagation direction of a diffracted mode . the propagation direction of the ( 0 ,- 1 ) mode is determined by setting ( m , n ) to ( 0 ,- 1 ). using the above relations ( 1 ), ( 2 ) and ( 3 ) and knowing the position of the feed 68 and desired direction of propagation of the diffracted mode 2 , a lattice is determined for ensuring the propagation of the ( 0 ,- 1 ). floquet &# 39 ; s mode in the given direction . having determined the lattice , the length of the gratings -- reflective elements 61 -- and slab 7 thickness are optimised in order to maximise energy coupled into ( 0 ,- 1 ) mode . this is done for a central region of the planar reflector 60 . this region contains a highest number of reflector elements 61 . referring to fig4 a top view of a periodic structure of rectangular gratings -- reflector elements 61 -- printed on a grounded dielectric slab 7 is shown . this represents the central region of the planar reflector 60 . in the diagram of fig4 the central region is a periodic structure with a rectangular lattice . in order to determine an efficiency with which a desired ( 0 ,- 1 ) mode is excited by different localities of the planar reflector 60 , the locality is assumed to be a periodic structure of infinite extent illuminated by a plane wave 1 ( not shown ) whose direction matches the relative position of the feed 68 ( not shown ) with respect to that locality . then , the relative power coupled to each mode is derived throughout the operating frequency band . using such a method , each locality of a planar reflector array 60 is analysed to determine efficiency and so forth . of course , when only some localities are of interest , only those localities are analysed . the graph shown in fig5 shows power coupled into propagating modes for a periodic structure with characteristics of the central region of a planar reflector illuminated by a plane wave travelling along a line that connects the phase centre of the feed 68 to the central region . a moment method based algorithm was used to derive scattering characteristics of the periodic structure . such a method is described in 4 - r . mittra , c . h . chan and t . cwik , &# 34 ; techniques for analyzing frequency selective surfaces &# 34 ;, proc . of ieee . vol 76 , no . 12 , dec . 1988 , pp . 1593 - 1614 . it is evident from equations ( 1 ), ( 2 ) and ( 3 ) that k xmn and k ymn are functions of frequency and , therefore , that the planar reflector array 60 is subject to the effects of beam squint . though the embodiments described below are for reducing beam squint for planar reflectors with smoothly varying cell sizes , a same method is applicable to reduce beam squint for reflectarrays with smoothly varying element dimensions and / or other element parameters . a dual planar reflector according to the invention is shown in fig6 . the antenna is described in operation in the transmission mode . the first plane 60 is a planar reflector composed of quasi - periodic structure of rectangular grating 61 which are arranged in a smoothly varying lattice and the second plate 65 , which is parallel to the first plate 60 , is a regular periodic structure of rectangular gratings 66 arranged in a rectangular lattice . a ray 1 emanating from the feed 68 , impinges on the first reflector 60 and after being diffracted in the form of a higher order floquet &# 39 ; s mode , becomes the incident wave 2 for the second plate 65 . the second plate 65 is designed to excite ( 0 ,- 1 ) floquet &# 39 ; s mode when illuminated by ray 2 that originates from the first plate . as frequency shifts within an operating band , both the incident wave on the second plate 65 and the diffracted wave from the same plate undergo beam squint . therefore , the squint of ray 3 shown in fig6 is cancelled by the squint of the incident wave 2 on second plate 65 , which leads to stabilisation of the propagation of the outgoing ray 3 . a variational expression is derived below for use in determining dimensions of the second plate lattice so that the required cancellation occurs within the operating frequency range . ray 1 represents a spherical phase front , which is transformed into a planar phase upon reflection from the first plate 60 as ray 2 . since the second plate 65 is a regular periodic structure with rectangular lattice , ray 3 represents a planar phase front as well . noting the above descriptions of the rays 1 , 2 , and 3 and setting ( m , n ) as ( 0 ,- 1 ), φ . sub . ( 0 , 1 ). sup . ( 1 ) = 270 ° and φ inc . sup . ( 1 ) = 90 ° in equation 2 , the following relation results ; ## equ2 ## where θ inc . sup . ( 1 ) is an incident angle of the plane wave 1 travelling along a line that connects the phase centre of the feed 68 and the central region of the first plate 60 , θ . sub . ( 0 , 1 ). sup . ( 1 ) is the propagation direction of the diffracted plane wave 2 from the first reflector 60 , t y . sup . ( 1 ) is the lattice dimension along y in the central region of the reflector and λ 0 is the free space wavelength . the characteristics of the central region of the reflector are used in equation ( 4 ). beam squint of the outgoing wave from the central region of the first reflector 60 represents the beam squint caused by the whole reflector . this is due to the fact that the lattice configuration of the first reflector 60 is designed such that outgoing diffracted rays travel in a predetermined direction regardless of which locality is illuminated . a similar relation is determined for the second reflector 63 ; ## equ3 ## where θ inc . sup . ( 2 ) is the incident angle of the plane wave 2 that illuminates the second plate 65 , θ . sub . ( 0 , 1 ). sup . ( 2 ) is the propagation direction of the diffracted plane wave 3 from the second reflector 65 , t y . sup . ( 2 ) is the lattice dimension along y for the second reflector 65 and λ o is the free space wavelength . according to the present embodiment , the second plate 65 is a regular finite periodic structure of rectangular gratings . a small shift in the operating frequency of the antenna shown in fig6 causes a differential variation in the angular parameters of eq . ( 5 ). the following relation results between the angular variations and the frequency variations : ## equ4 ## recalling that the objective of the present invention is to cancel the beam squint resulting for the ray 3 , δθ . sub . ( 0 , 1 ). sup . ( 2 ) in the above equation is set to zero for a planar reflector array according to the invention . also it is evident from the geometry shown in fig6 that , combining equations ( 6 - 9 ), the following relation is defined for the lattice dimension of the second plate 65 ; ## equ5 ## where 0 . sub . ( 0 , 1 ). sup . ( 1 ) is the angle of ray 2 at the centre frequency and δθ . sub . ( 0 , 1 ). sup . ( 1 ) is the variation of the same angle throughout the operating band . both of these parameters are derived from eq . ( 4 ). calculation of the lattice dimension of the second plate 65 from eq . ( 10 ) ensures the stabilisation of the outgoing ray 3 . the lack of a constraint on t x . sup . ( 2 ), results in a degree of freedom in determining the second plate lattice geometry . this freedom allows optimisation of the second plate parameters to maximise the power coupled into the outgoing ray 3 , the outgoing ( 0 ,- 1 ) mode . the graph shown in fig7 shows simulation results for beam squint of a single planar reflector and a dual planar reflector according to the present invention . the graph of fig7 shows that the use of a second reflector according to the invention suppresses beam squint throughout a wide band . preferably , the size and location of the second reflector 65 is adjusted to maximise the energy that is captured by the second plate 65 and minimise the blockage caused by the first plate 60 . simple geometrical considerations suffice to fulfil these requirements . in an alternative embodiment , the feed is designed to reduce the effects of beam squint . the embodiment uses a feed comprising a plurality of feed elements with a single planar reflector array in order to provide signals of different frequencies from different locations . this , in effect , reduces or eliminates beam squint . referring to fig1 movement of the phase centre of a feed is classified into two types : movements along fm or tt &# 39 ;. as the reflector is located in the far field of the feed , a slight movement of the phase centre along fm does not significantly affect the relative phase of the rectangular grating elements with respect to each other . on the other hand , movement of the phase centre along tt &# 39 ;, changes the relative phase of the elements with respect to each other . this results in movement of main beam peak angle from its original position . array factor formulation is used to calculate the main beam peak angle for different locations of the phase centre . although array factor formulation is not reliable in side lobe or cross - pol . calculations , in the present example it was found to be sufficiently accurate for determining main beam angle . likely , it is sufficiently accurate for other applications of the embodiment of this 2invention . a number of computer simulations were performed and results are shown in fig8 and 9 . first , the phase centre was moved along fm as the antenna was operating in one and the same frequency and the radiation patterns were plotted for different phase centre locations . it is evident from fig8 that the main beam peak angle remains constant for slight movement of the phase centre along fm . the same numerical experiment was repeated for phase centre movement along tt &# 39 ; at two different operating frequencies . comparison of a second curve and a third curve with the antenna operating at 10 . 0 ghz shows that the main beam peak angle changes as the phase centre is shifted slightly along tt &# 39 ;. a closer look at fig9 establishes that , by proper adjustment of the location of feed phase centre along tt &# 39 ;, beam squint cancellation results . proper movement of the phase centre along tt &# 39 ; is shown to stabilise the beam peak angle in spite of a 0 . 4 ghz frequency shift . the antenna feed 168 shown in fig1 is useful for automatically altering the feed centre location relative to the planar reflector array 60 ( not shown ). this antenna feed is composed of four series fed patches 168a - 168d of different sizes . as the frequency changes within the operating band , resonance shifts from one patch to another . this results in a moving radiating region as the frequency is swept within band . the movement of the radiating region of the antenna feed is equivalent to the movement of the phase centre of the feed 168 . the antenna feed shown was designed to minimise return loss and then disposed in a location so as to substantially reduce beam squint . the planar reflector used in conjunction with the four stage feed 168 of fig1 is shown in fig1 . f 1 and f 2 represent the first 168a and last 168d -- smallest and largest -- patches of the four stage feed 168 . in this embodiment , several guidelines were used for optimising the feed design and placing it in a position that would result in beam squint cancellation . the feed dimensions were determined to minimise return loss . once design was complete , location was determined for the feed 168 such that resulting phase centre movement reduces beam squint . the procedure followed in the feed design is discussed in detail in 5 - h . pues , j . bogaers , r . preck , and van de capelle , &# 34 ; wideband quasi - log - periodic microstrip antenna &# 34 ;, iee proc . h , microwaves , opt . & amp ; ant ., 1981 , 128 , ( 3 ), pp . 159 - 163 . the initial design method comprises the following steps : dividing the desired opening band into sub - bands as wide as the bandwidth of a microstrip antenna and the resonant frequencies are selected log periodically ; calculating dimensions of the square patches and the resonant input impedance of each radiator ; dimensioning the branch lines as quarter wavelength transformers between the appropriate resonant input impedance of the resonating patch and 50 ω line where the main feed line is a simple 50 ω line ; and selecting the position of the branch lines so that the distance to the open circuit equals a multiple of half wavelength . the initial design , according to the present embodiment , assumed that a resonating patch appears as 50 ω load at an intersection of its respective branch line and a main line while other elements and the open circuit transform into high impedance at the same cross section . therefore , the incoming wave on the feed line is absorbed and radiated by the resonant patch . after completion of the initial design based on the above guidelines , a commercial software package is used to optimise the return loss performance of the feed 168 . having optimised the feed design , its location with respect to the reflector surface is determined , according to the invention , to suppress beam squint . the terms suppress , reduce , cancel , and eliminate as used herein with respect to beam squint indicate the cancellation of beam squint that would happen using a prior art reflector array antenna with a horn feed , for example . it is clear that using an embodiment with multiple feeds as herein proposed , avoids the problem of beam squint to some degree by moving the phase centre of the feed to compensate therefore . given a desired direction for the outgoing beam , the location of the four stage feed 168 is determined so that a point source that is located at f 1 or f 2 and operates at the resonant frequencies of the respective patches 168a , 168d at either of these two points gives rise to an outgoing beam 2 that travels in one same direction . the geometric locations of f 1 and f 2 are in the far field of the reflector and along ss &# 39 ; and tt &# 39 ;, respectively . as mentioned above , assuming that the planar reflector is an infinite periodic structure of the same lattice as its central region and illuminated by a plane wave propagating along the line that connects the feed phase centre and reflector centre , a straightforward method for calculating direction of higher order modes results . using these assumptions , equation ( 4 ) is used to calculate the direction of ss &# 39 ; and tt &# 39 ;. to apply equation ( 4 ) in this context , it is noted at θ . sub . ( 0 , 1 ). sup . ( 1 ) is the desired direction of the outgoing beam , λ 0 is the wavelength of the operating frequency in free space , t y . sup . ( 1 ) is the lattice dimension along y in the central region of the reflector for θ inc . sup . ( 1 ) is the unknown which gives the ss &# 39 ; or tt &# 39 ; direction depending on the valve provided for λ 0 . in summary , the geometrical location of the feed phase centre is located in the far field of the reflector 60 and on a line that stretches out from the centre of the reflector 60 along a direction given by equation ( 4 ). the same procedure is performed for upper and lower frequencies of the operating band to derive a geometric location of the feed phase centre at these two frequencies ( ss &# 39 ; and tt &# 39 ; shown in fig1 ). when θ 1 ( θ 2 ) is the direction of ss &# 39 ; ( tt &# 39 ;) and f 1 m is perpendicular to the feed surface , the following simple geometrical relation is used to derive f 1 m : ## equ6 ## as is evident to those of skill in the art , such a feed combined with a planar reflector according to the prior art and spaced therefrom as taught herein , results in a reflector antenna having substantially reduced beam squint over prior art planar reflector arrays . of course , there are practical limitations to a number of feed elements that can be implemented in such a structure . these limitations are easily determined through experimentation in design and construction of a multi - element feed for use with the present invention . measurement results for the dual planar reflector are presented below . a dual planar reflector was designed to compensate for beam squint of a single planar reflector antenna . the location of the second plate 65 was selected to minimise blockage by the first plate 60 . simple geometrical observations establish the following relation : ## equ7 ## where &# 34 ; l &# 34 ; is the first plate dimension along y axis and θ . sub . ( 0 , 1 ). sup . ( 1 ) ( θ . sub . ( 0 , 1 ). sup . ( 2 )) is the diffraction angle for the first ( second ) plate at the lowest frequency of the band . maximisation of the energy captured by the second reflector 65 is used as a constraint to determine d off and the dimension of the second reflector 65 . spatial beam broadening is taken into account in enforcing this constraint . fig1 shows a comparison between expectations as set out above and experimental results for beam squint in single and dual planar reflectors . experiments demonstrated that the array factor method provides sufficient accuracy to estimate the beam peak angle of a planar reflector . beam squint was reduced from 15 ° for a single reflector to approximately 3 ° for a dual reflector system in the band of 9 . 5 - 11 . 5 ghz . therefore , a properly designed dual planar reflector system is capable of significantly reducing beam squint over a single planar reflector . since for a given sweep angle as the distance between transmitter and receiver grows so does the sweep of a received signal measured in distance , reducing beam squint by 12 degrees is very significant even for relatively short distances such as those used terrestrially . for satellite implementation , a reduction of 12 degrees in beam squint is even more significant . the co - and cross - pol . radiation patterns for the single and dual planar reflectors are shown in fig1 and 14 . the size of the second reflector in the dual reflector system used for the simulations was not optimised . therefore , the second reflector only partially captures the incoming energy from the first reflector . therefore , lower gain and higher sidelobe levels result for the dual reflector compared to similar parameters for the single planar reflector antenna . on the other hand , the cross - pol . is approximately 5 db lower for the dual reflector antenna . this is due , in part , to the further polarisation selectivity that is introduced by the presence of the second reflector . hence , the cross - pol . of a single planar reflector is improved by using a second reflector . referring to fig1 , a graph showing measured return loss throughout the band of the phase matched feed ( shown in fig1 ) in isolation from the reflector . there are five resonances shown in the measured return loss . the simulated current distributions at various frequencies within the band indicate that the first and last resonance are attributable to the last and first ( largest 168d and smallest 168a ) patches respectively , while the second , third and fourth resonances are due to simultaneous resonance of first patch 168a and second patch 168b , second patch 168b and third patch 168c , and third patch 168c and fourth patch 168d , respectively . typical plots of the current distributions are shown in fig1 for two frequencies . this figure demonstrates the moving nature of the radiating region as the frequency shifts within the band . measured and simulated variation of the beam peak angle versus frequency is shown in fig1 for a single planar reflector fed by a four - stage microstrip feed . the microstrip feed was then substituted by an x - band horn and a similar measurement was performed . the measurement results for this later case are plotted in fig1 for comparison . the beam squint is approximately 5 ° for a microstrip fed single reflector while the same parameter was measured to be 14 ° for a horn fed reflector as the frequency is scanned from 9 . 4 ghz to 10 . 6 ghz . based on beam squint results for the microstrip fed reflector the operating band is divided into two sub - bands , namely , 9 . 4 ghz to 9 . 95 ghz and 10 . 1 ghz to 10 . 5 ghz . beam peak angle variation in each of these bands is less than 2 °. the sudden jump of the beam peak angle in the case of microstrip fed reflector around 9 . 95 ghz seems to correspond to a similar jump in current distribution . during simulation , the radiating region moves abruptly from the third patch 168c to the second patch 168d as the frequency is increased from 9 . 9 ghz to 10 . 1 ghz . the radiating region moves gradually for gradual increases of frequency beyond 10 . 1 ghz . though the above - described embodiments detail maximizing efficiency and minimising losses , this need not be performed according to the invention . preferably , an antenna is designed for maximum efficiency in a particular operation . numerous other embodiments may be envisaged without departing from the spirit and scope of the invention .	7
the present invention provides an 82 sr / 82 rb generator column for use in positron emission tomography cardiac perfusion imaging . in accordance with the invention , the generator column is filled with an ion exchange material that tightly binds 82 sr but not 82 rb . the ion exchange material is compacted to a density that permits fluid solutions to be pumped through the generator column at a rate of at least 5 ml / min at a fluid pressure of 1 . 5 pounds per square inch ( 10 kpa ). after the generator column is packed with the ion exchange material , it is conditioned with a source of excess sodium cations and loaded with a solution of 82 sr . the generator column in accordance with the invention enables low pressure injections using a peristaltic pump and facilitates precision flow control of patient elutions . advantageously , the generator column in accordance with the invention can also be reloaded with 82 sr a plurality of times . this has distinct advantages . first , residue 82 sr remaining in the column from a previous load is not wasted . second , the expense of building and conditioning the generator column is distributed over a plurality of 82 sr loads , so the overall cost of using , 82 rb for cardiac perfusion imaging is reduced . fig1 illustrates the packing of an 82 rb generator column 10 using a method in accordance with the invention . as is known in the art , the generator column 10 is constructed from stainless steel hardware components that are commercially available . in the embodiment shown in fig1 , a pair of swagelok ® reducing adaptors with nuts and ferrules 12 , 14 are connected to opposite ends of a stainless tubing 16 that is packed with an ion exchange material 18 . in one embodiment of the invention , the ion exchange material 18 is an α - hydrous tin dioxide ( sno 2 . xh 2 o , where x equals 1 - 2 ) wetted with a nh 4 oh / nh 4 cl buffer ( ph 10 ). a 25 micron filter 24 closes a bottom of the cylinder 16 at an outlet end thereof . likewise , a 25 micron filter 22 closes an inlet end of the cylinder 16 after the cylinder 16 is packed with the ion exchange material 18 . a feature of the invention is that , unlike prior art generator columns in which the ion exchange material is tightly packed so that high pressure elution is required , the ion exchange material 18 is packed only to a density that permits fluid solutions to be pumped through the generator column at a rate of at least : 5 ml / min at a fluid pressure of 1 . 5 pounds per square , inch ( 10 kpa ). as shown in fig1 , a simple and practical way of accomplishing , the required packing of the ion exchange material 18 is to repeatedly strike a side of the generator column 10 with an instrument 26 , such as a laboratory wrench , with a force that exerts about 0 . 1 joule . experience has shown that between 50 and 100 strikes are required to achieve the required density of the ion exchange material 18 . after packing of the generator column 10 is complete , a funnel 20 that was used to introduce the ion exchange material 18 into the cylinder 16 is removed and the ion exchange material is leveled with the top of the cylinder 16 . the ion exchange material packed into the generator column 10 has a density of not more than 3 g / cm 3 in the packed state . the filter 22 is then placed on top of cylinder 16 and the swagelok adapter , nut and ferrule 12 is secured to the top of the cylinder in a manner well known in the art . as will be understood by those skilled in the art , the generator column 10 in accordance with the invention is constructed under sterile conditions using sterile components and may be pressure tested for leaks after assembly . fig2 is a cross - sectional view of the generator column 10 suspended in a shielding body 40 . the shielding body 40 is made from a dense shielding material 42 , such as lead , tungsten or depleted uranium optionally encased in a stainless steel shell 44 . the shielding body 42 includes a shielding lid 50 having apertures through which extend an inlet line 34 and outlet line 36 . the inlet line 34 is connected to an inlet end 30 of the generator column 10 . the outlet line 36 is connected to an outlet end 32 of the generator column 10 . the inlet and outlet lines are connected to external tubing lines 60 , 62 using luer fittings 56 and 58 . the shielding lid 50 is likewise constructed of a shielding material 52 such as lead , tungsten or depleted uranium encased in a stainless steel shell 54 . after the generator column 10 is packed with ion exchange material 18 , as explained above with reference to fig1 , the generator column 10 must be loaded with 82 sr before patient elutions can begin . as schematically illustrated in fig2 , in one embodiment a syringe pump 80 is used to deliver 82 sr from a supply 70 through an inlet tube 60 to the generator column 10 . the 82 sr is bound by the ion exchange material 18 in the generator column 10 . waste fluid is evacuated through the outlet tube 36 and outlet line 62 to a shielded waste container 90 , in a manner known in the art . fig3 is a schematic diagram of the generator column 10 configured for daily use as an 82 rb source for cardiac perfusion imaging . a source of sterile saline solution 100 is connected to a saline supply tube 104 . the sterile saline solution 100 is pumped through the saline supply tube 104 by a pump 102 . in one embodiment of the invention , the pump 102 is a peristaltic pump . in accordance with an alternate embodiment , the pump 102 is the syringe pump 80 shown in fig2 . as understood by those skilled in the art , the pump 102 is controlled by a control algorithm that regulates a flow rate and volume of the sterile saline solution 100 pumped through the generator column 10 via the inlet tube 104 to provide an 82 rb eluate via an outlet tube 106 connected to a controlled valve 108 . the valve 108 directs the eluate through a delivery line 112 for a calibration elution or a patient elution 110 , or to a shielded waste container 90 . as is further understood by those skilled in the art , control of the system shown in fig3 is complex and not all of the fluid paths and control mechanisms are depicted because elution control is not a subject of this invention . fig4 is a flowchart illustrating principle steps in constructing the generator column 10 in accordance with the invention . the process begins by preparing the ion exchange material and packing the generator column as explained above with reference to fig1 ( step 200 ). the generator column is then conditioned by saturating the ion exchange material 18 with sodium cations . in one embodiment , this is accomplished by passing 120 ml of 2m nacl through the column at a flow rate of 0 . 5 ml / minute followed by waiting for a period of 12 hours . 500 ml of sterile saline solution is then passed through the column at a flow rate of 10 ml / minute . a nondestructive ph test is performed ( step 202 ) by testing a ph of the initial sterile saline solution passed through the column . this nondestructive ph test prolongs the life of the generator column 10 . if it is determined ( step 204 ) that the ph of the generator column 10 is not alkaline , the generator column 10 is defective and it is disposed of ( step 224 ). if the saline solution is determined in step 204 to be alkaline , the generator column is loaded with 82 sr ( step 206 ) in a manner well known in the art using the equipment briefly described above with reference to fig3 . after the 82 sr is loaded into the generator column 10 , the generator column 10 is flushed with 1 . 0 l of sterile saline solution to clear traces of tin : dioxide and any radionuclide impurities . the generator column is then eluted with sterile saline solution and the eluate is tested for trace metals ; sterility ; radionuclide purity ; pyrogens ; and ph ( step 208 ). if all of those tests are passed ( step 210 ) the generator column 10 is ready for use ( step 212 ). if any one of the tests fails , 82 sr is optionally recovered from the generator column 10 ( step 222 ) and the generator column 10 is disposed of ( step 224 ). during generator use , daily testing is performed for the purpose of patient safety and quality control , as will be described in detail with reference to fig5 . as long as all daily tests are passed , the generator column can continue to be used for patient elutions . as understood by those skilled in the art , one of the daily tests is a measure of 82 rb yield . if it is determined in step 214 that one of the daily tests failed , it is further determined whether a reload of the generator column 10 is permitted ( step 216 ). reloading is permitted if the daily test failed due insufficient 82 rb yield only . if the daily test failed for some other reason the generators column 10 cannot be further used , and the 82 sr is optionally recovered ( step 222 ) before the generator column is disposed of ( step 224 ), as described above . if an 82 sr reload is permitted , it is determined in step 218 whether the number of 82 sr reloads of the generator column 10 has exceeded a predetermined reload limit . a generator column in accordance with the invention can , be loaded with 82 sr at least three times before any significant 82 sr breakthrough occurs . if it determined in step 218 that the reload limit has been reached , certain jurisdictions require that the generator column be flushed and the eluate tested for : trace metals ; sterility ; radionuclide purity ; pyrogens ; and ph . if it is determined in step 218 that the reload limit , has not been reached , the process branches back to step 206 and the generator column is reloaded with 82 sr and steps 208 - 218 are repeated . fig5 is a flowchart illustrating principle steps involved in the daily use of the generator column 10 in accordance with the invention . prior to each day &# 39 ; s use of the generator column 10 , the generator column 10 is flushed with 50 ml of sterile saline solution ( step 300 ) in order , to remove any strontium breakthrough from the generator column 10 into the waste vessel 90 . the operator then waits for a predetermined period of time ( step 302 ) before performing a calibration elution ( step 304 ). as is well understood by those skilled in the art , under stable conditions the generator column maintains a 82 sr / 82 rb equilibrium which is achieved after about 10 minutes . consequently , the predetermined wait before a calibration elution is performed is at least 10 minutes . after the required wait , the generator column is eluted with about 15 ml of sterile saline solution at a constant flow rate of about 15 ml / minute . the calibration eluate is tested ( step 306 ) for 82 rb yield and 82 sr breakthrough . in step 308 it is determined whether the yield is above a predetermined radioactivity limit . as is understood by those skilled in the art , the half life of 82 rb is very short ( i . e . 76 seconds ). consequently , in one embodiment the 82 rb yield is measured using a positron counter during the elution , in a manner well known in , the art . in step 310 , it is determined whether the 82 sr , 85 sr breakthrough is less than a predetermined breakthrough limit . as is also understood by those skilled in the art , all jurisdictions define a threshold for permissible levels of 82 sr , 85 sr breakthrough . as is further understood by those skilled in the art , the strontium breakthrough is readily determined by testing the radioactivity of the elution after about 26 minutes has elapsed , at which time the amount of residual 82 rb is insignificant and does not distort the test results . before daily use begins , a cumulative volume of all fluids flushed and eluted through the generator column 10 is computed . since the generator column 10 in accordance with the invention is repeatedly reloaded with 82 sr , each generator column is identified by a unique identifier , in one embodiment a serial number . if the user of a generator column 10 does not have the facility to reload the generator column 10 , the user must return the generator column 10 to the manufacturer , along with a cumulative total of fluid flushed and eluted through the column during that use . likewise , when a reloaded column is supplied to a user , a cumulative volume of fluid used to flush and elute the column during all prior reload ( s ) and use ( s ) is provided to the user . control software used to control a volume of fluid used during generator column 10 flushes and elutions accepts the cumulative volume and stores it . the control software then recomputes the cumulative volume after each subsequent flush or elution of the generator column 10 . that computed cumulative volume is compared ( step 312 ) to a predefined volume limit . in accordance with one embodiment of the invention , empirical data has shown that 10 to 30 litres of sterile saline solution 100 can be pumped through the generator column 10 before significant 82 sr breakthrough is experienced , so the volume limit may be set between 10 and 30 litres . if each of the tests 308 - 312 is successfully passed , patient elutions ( step 314 ) may be performed in a manner well known in the art . after each elution , it is necessary to wait a predetermined period of time , about 5 to 10 minutes , ( step 316 ) to permit 82 rb to regenerate . after each elution , the cumulative volume is recomputed by adding to the cumulative volume a volume of fluid pumped through the generator column 10 during the patient elution . then it , is determined whether the control system date has , changed , i . e . a new day has begun ( step 318 ). if not , the cumulative volume is compared to the predetermined volume limit . if the volume limit has been exceeded , the generator column is disposed of ( step 324 ). if it is determined in step 318 that the control system date has changed , the generator column 10 must be flushed and re - tested per steps 300 - 312 , as described above . if those tests determine that the 82 rb yield is less than a predetermined limit ( step 308 ) then it is determined in step 320 whether the reload limit has been exceeded and if not the generator column 10 is returned for reload and pre - use testing ( step 322 ). otherwise , the generator column is disposed of ( step 324 ). it should be noted that if any of tests 308 - 312 fail , the generator column 10 may be returned to the manufacturer who determines whether the generator column 10 can be reloaded ( step 320 ) and disposes of the generator column 10 ( step 324 ) if it cannot be reloaded . the generator column 10 in accordance with the invention reduces the expense of cardiac perfusion imaging while ensuring compatibility with 3d pet imaging systems by enabling low pressure , low flow rate elutions that can be precisely flow controlled . research has conclusively established that the generator column 10 in accordance with the invention remains sterile and pyrogen - free for a period of at least six months when used in accordance with the procedures and limits described above . although the invention has been explained with reference to 3d pet imaging systems , it should be understood that the generator column 10 is equally compatible with 2d pet imaging systems and provides the same advantages of low cost , precise flow control , low pressure and low flow elution and a long service life . the embodiment ( s ) of the invention described above is ( are ) intended to be exemplary only . the scope of the invention is therefore intended to be limited solely by the scope of the appended claims .	0
for illustrative purposes the invention is shown as applied to an upright single door household refrigerator indicated generally at 20 . it will be understood , however , that the invention may be utilized in the construction of a wide variety of refrigerator cabinets including , for example , refrigerators having separate doors for the fresh food and frozen food compartments arranged vertically one above the other or side by side or for food freezers . with more particular reference to fig1 the refrigerator 20 comprises a main insulated cabinet 22 supported on a base 24 , the front of the cabinet being closed by a conventional door structure 26 which may be a single unit , as illustrated , or may be a dual unit depending upon the internal configuration of the refrigerator , the details of which do not form a part of the present invention and have been omitted for clarity . the major components , which comprise the cabinet , are illustrated separately in fig2 and include , in addition to the base 24 , an outer shell 28 , a plastic liner 30 and a rear panel 32 . it is a feature of the invention that the outer shell 28 is formed from a single piece of sheet metal preferably prefinished with the usual vinyl or enamel coating . the shell forms the top , side , and bottom walls 34 , 36 , 38 and 40 , respectively , of the insulated portion of the cabinet . as shown in fig4 the end edges of the shell are joined at one lower corner of the cabinet , the lower edge of the side wall 38 being inturned to form a flange 42 overlying the end of the bottom shell wall 40 to form a seam or joint held together as described below . as shown in fig3 the front and rear edges of the shell 28 are formed to receive and retain the liner 30 and the back cover plate 32 without separate attachment means . with continued reference to fig3 the forward edge of the shell 28 is turned inwardly in the form of an s - shaped section , the outer leg 44 providing a flat surface extending around the cabinet against which the door 26 seals . the two inner legs 46 and 48 of the s - shaped section provide a recess for the reception of a peripheral flange 50 formed integrally with the plastic liner 30 . also received between the legs 46 and 48 is a hot gas tube 52 connected to the refrigeration system , the tube extending around the top and two sides of the forward edge of the cabinet to prevent the accumulation of moisture at the front face of the cabinet . to insure a tight friction fit and seal between the parts , the outermost edge of the flange 50 is provided with an offset portion 54 which engages the innermost leg 48 of the s - shaped section while the main body of the flange engages the center leg 46 of the section . at its rear edge the shell is formed to provide a u - shaped section 56 with an inturned center leg 58 . received in u - shaped section is a flange 60 which extends around the periphery of the rear panel 32 . a plurality of locking tabs 62 , struck out from the body of the flange 60 , extend over the inner end of the inner leg 58 to hold the parts in assembled relation after the rear panel is snapped into place . in the manufacture of the shell 28 a piece of prefinished flat sheet stock is first punched or die cut to the form shown in fig5 . the flange portions along the forward and rearward edges of the shell are then formed after which the shell is bent along the dotted lines and brought into essentially its final configuration . the side edges of the blank from which the shell is formed are suitably notched as at 63 to accommodate the bending and to form smooth corner joints as shown in fig2 . when the shell is brought to final configuration as shown in fig2 openings 64 and 66 , punched out of the panel 40 and flange 42 , respectively , are brought into alignment as shown in fig4 . plastic corner pieces 67 as shown in fig6 are then snapped into place to cover the exposed corner joints on the front face of the shell . the base 24 , which is also of one - piece construction is formed in similar fashion from a sheet of prefinished stock . when formed in final configuration it is generally of u - shaped section having a main vertical leg 68 and upper and lower parallel inturned sections 70 and 72 , respectively . prior to the final bending operations , a plurality of hat - shaped projections 74 are struck upwardly from the upper flange 70 , the hat - shaped sections being equal in number and spacing and slightly smaller in diameter than the openings 64 and 66 formed in the cabinet shell . after the shell and base are formed to final configuration , they are assembled as shown in fig4 with the hat - shaped projections extending through the aligned openings in the shell . the hat shaped projections are then deformed by a stamping operation to the dotted line configurations shown in fig4 thus simultaneously locking the ends of the shell together , locking the base to the shell , and locking the base in final configuration . preferably the base is so arranged that its ends meet at a rear corner of the refrigerator for reasons of appearance . after assembly of the base to the shell , tubing for the refrigeration system is assembled between legs 46 and 48 of the formed front edge of the shell as shown in fig3 . the plastic liner 30 , which is also of one - piece construction and is formed in accordance with conventional methods , is then installed from the front of the cabinet by snapping the flange 50 into the front cabinet flange construction . to facilitate this operation the flange 50 is formed to the configuration shown in fig6 being of reduced depth adjacent the corners of the cabinet . when the liner is to be fitted into the shell the liner is deformed by pressing the sides inwardly , thus foreshortening the liner sufficiently to permit the outer edge of the flange 50 to pass inwardly of the inner edge of the shell flange structure . when the liner is released it snaps into the position shown in fig6 the liner being securely held in position and forming a tight peripheral seal . after assembly of the liner , the rear panel is snapped into place . the basic cabinet structure is then completed by injecting liquid foam components through suitable openings provided in the rear panel wall in accordance with conventional techniques to fill the entire space between the liner and the shell and between the liner and the rear panel with insulation which , upon hardening , also contributes substantially to the overall structural rigidity of the cabinet structure . the door structure 26 is then installed using conventional hinge and lock mechanisms . the cabinet construction of the present invention may accommodate any desired type of refrigeration system . the back panel 32 provides a convenient place for mounting the usual exterior condenser , and the back panel and liner are provided with complementary recesses 78 and 80 , respectively , to accommodate a conventional compressor , both the condenser and compressor being installed after assembly of the cabinet .	8
in the remainder of the description , analogous , similar or identical elements will be designated by the same reference number . in the remainder of the description an axial and radial orientation will be adopted , indicated by the arrows ‘ a ’ and ‘ r ’ in fig1 . in addition , radial faces oriented towards the middle of the core will be termed internal faces while the faces oriented in an opposite direction will be termed external faces . the internal and external radial faces are therefore axial end faces of the core . likewise , axial faces oriented towards the rotation axis of the shaft will be termed internal faces while axial faces oriented in an opposite direction will be termed external faces . referring to fig1 , this depicts a rotary electrical machine of the prior art , in the present case an alternator with internal ventilation of the polyphase type for a motor vehicle with a thermal engine functioning in alternator mode . naturally the alternator can also be reversible and consist of an alternator - starter also functioning in electric motor mode in particular in order to start the thermal engine of the vehicle as described in the document fr a 2 745 445 ( corresponding to u . s . pat . no . 6 , 002 , 219 ). when the machine is functioning in alternator mode it converts mechanical energy into electrical energy like any alternator . when the machine is functioning in electric motor mode , in particular in starter mode for starting the thermal engine of the vehicle , it converts electrical energy into mechanical energy . this machine comprises essentially a casing 10 and , inside it , a rotor 12 rotationally integral with a shaft , rotor shaft , single - piece shaft or central shaft 14 , referred to as the rotor shaft , and a stator 16 that surrounds the rotor 12 and comprises a body in the form of a packet of metal sheets provided with recesses , for example of the semi - closed type , for mounting a stator coil 18 forming , on each side of the stator 16 at each axial end thereof , a coil end . this stator coil 18 comprises for example a set of three - phase windings in a star or delta , the outputs of which are connected to a bridge rectifier ( not shown ) comprising rectifying elements such as diodes or transistors of the mosfet type , in particular when the machine is of the reversible type , and consists of an alternator - starter as described for example in the document fr - a - 2 . 745 . 445 ( u . s . pat . no . 6 , 002 , 219 ). the windings are obtained by means of a continuous electrically conductive wire covered with an insulating layer and mounted in the relevant recesses in the body of the stator 16 . in a variant that is not shown , for better filling of the recesses of the body of the stator 16 , the windings are produced by means of conductors in the form of bars , such as pins , connected together for example by welding . according to another variant that is not shown , in order to reduce the degree of ripple and magnetic noise , the stator coil 18 comprises two sets of three - phase windings to form a composite stator winding device , the windings being offset by thirty degrees electrical as described for example in the documents us - a1 - 2002 / 0175589 , ep - 0 . 454 . 039 and fr - a - 2 . 784 . 248 . in this case two bridge rectifiers are provided and all combinations of three - phase windings in star and / or delta are possible . in general terms the alternator is of the polyphase type and the bridge rectifier or rectifiers in particular rectify the alternating current produced in the windings of the stator 16 to a dc current in particular in order to charge the battery ( not shown ) of the motor vehicle and supply the loads and electrical consumers in the onboard system of the motor vehicle . the rotor 12 is produced in the example shown in the form of a claw rotor , as described for example in the documents us - a1 - 2002 / 0175589 and ep - a1 - 0 . 454 . 039 , comprising two pole pieces 20 , 22 , here axially juxtaposed and each having an annular - shaped transverse flange 24 provided at its external periphery with claws 26 . each claw 26 comprises an implantation portion 28 transversely oriented in the plane of the flange 24 concerned . this implantation portion 28 is extended at its external periphery by a tooth 30 of axial orientation overall . an annular air gap exists between the external peripheral face 32 of the teeth 30 and the internal periphery of the body of the stator 16 . the teeth 30 are overall trapezoidal or triangular in shape and are directed axially towards the flange 24 of the other pole piece 20 , 22 , the tooth 30 of one pole piece 20 , 22 penetrating the space existing between two adjacent teeth 30 of the other pole piece 20 , 22 , so that the teeth 30 of the pole pieces 20 , 22 are interleaved . an excitation coil 34 is located axially between the flanges 24 of the pole pieces 20 , 22 . it is carried by a part of the rotor 12 in the form of a cylindrical annular core 36 coaxial with the shaft 14 , which comprises a central bore 37 . the core 36 here consists of two axially distinct portions , each of which is produced in one piece with associated pole pieces 20 , 22 as shown in fig1 . according to a variant that is not shown , the central core 36 consists of a single piece and is distinct from the pole pieces 20 , 22 , which are arranged axially on each side of the core 36 . in the remainder of the description , the term ‘ coil ’ without qualification will be understood to be the excitation coil 34 rather than the stator coil 18 . the excitation coil 34 is therefore located in the space delimited radially by the claws 26 of the pole pieces 20 , 22 and the central core 36 . the pole pieces 20 , 22 and the core 36 are preferably made from ferromagnetic material and have the rotor shaft 14 , also made from ferromagnetic material , passing through it coaxially . for this purpose , each pole piece 20 , 22 comprises a central or fixing bore 38 that passes axially through the flange 24 and extends the central bore 37 of the part of the core 36 concerned . the wire of the excitation coil 34 is in fig1 wound on a support made from electrically insulating material ( not shown ) mounted , preferably forcibly , on the external periphery of the core 36 . this support here has a cross section roughly in the shape of a u in order to isolate the excitation coil 34 from the flanges 24 of the pole pieces 20 , 22 . according to a variant that is not shown , when the core 36 is in one part , the wire of the excitation coil 34 is wound on an insulator fixed to the core 36 and is conformed so as to prevent any contact with the flanges 24 and the teeth 30 of the pole pieces 20 , 22 . when the excitation coil 34 is activated , that is to say supplied electrically , the pole pieces 20 , 22 and the core 36 , which are produced from ferromagnetic material , are magnetized and the rotor 12 becomes an inducing rotor with the formation of magnetic poles at the claws 26 with teeth 30 on the pole pieces 20 , 22 . this inducing rotor 12 creates an induced alternating current in the stator 16 induced when the shaft 14 turns . the shaft 14 of the rotor 12 carries at its front end a pulley 40 belonging to a device for transmitting movements by means of at least one belt ( not shown ) between the alternator and the thermal engine of the motor vehicle , and carries at its rear end collecting rings 42 connected by cabled connections ( not shown ) to the ends of the excitation coil 34 of the rotor 12 . brushes belong to a brush holder shown in a general fashion at the reference 44 and are disposed so as to rub on the collecting rings 42 so as to supply the excitation coil 34 with electric current . the brush holder 44 is connected to a voltage regulator ( not shown ). the casing 10 is here in two parts , namely a front bearing 46 adjacent to the pulley 40 and a rear bearing 48 carrying the brush holder 44 and usually the bridge rectifier or rectifiers and the voltage regulator . the bearings 46 , 48 are hollow in shape and each carry centrally a ball bearing respectively 50 and 52 for the rotational mounting of the shaft 14 of the rotor 12 . for example , as illustrated in fig1 , the bearings 46 , 48 are perforated to allow the cooling of the alternator by the circulation of air . for this purpose the rotor 12 carries at least at one of its axial ends a fan intended to provide this circulation of air . in the example shown , a first fan 54 is provided on the forward frontal face of the rotor 12 and a second fan 56 , more powerful , at the rear face of the rotor 12 . each fan 54 , 56 is provided with a plurality of blades or sleeves 58 , 60 that are fixed to the external radial faces of the flanges 24 . according to a variant that is not shown , the alternator can also be cooled by a heat - transfer fluid , the casing 10 then being configured so as to comprise an appropriate circulation channel for the heat - transfer fluid . it should be noted that , in the example embodiment described , the rotor 12 comprises eight teeth 30 per pole piece and therefore eight pairs of poles . forty eight recesses are therefore provided in the body of the stator in the case in which one set of three - phase windings or two sets of three - phase windings are provided as described in the aforementioned document fr - a - 2 . 737 . 063 , or ninety six recesses in the solutions described in the aforementioned documents us - a1 - 2002 / 0175589 and ep - a1 - 0 . 454 . 039 . naturally the rotor 12 can , depending on the application , comprise a different number of pairs of poles . for example , each pole piece can comprise in a variant six teeth so that the rotor comprises six pairs of poles and the stator 16 or 72 recesses . according to a variant that is not shown , the performance of the machine , namely its power and efficiency , can also be increased using a rotor 12 that comprises , in a known fashion and for example as described in the french patent fr - 2 . 784 . 248 , a certain number of permanent magnets interposed between two adjacent teeth 30 at the periphery of the stator 16 , choosing the number of these magnets so that it is equal to or less than the number of poles on the rotor and their arrangement is symmetrical with respect to the axis of the rotor . for example , four , six or eight pairs of magnets are provided for eight pairs of poles . in a known fashion , the shaft 14 comprises portions with a non - smooth radial driving section or portion 57 , which are here knurled portions with axial serrations , as visible in fig1 , for fixing and driving the pole pieces 20 , 22 and the core 36 . the pole pieces 20 , 22 and the core 36 are thus mounted by force - fitting on the shaft 14 , so that the latter , by means of its serrations , cuts furrows in the central bore of the pole pieces 20 , 22 and in the core 36 when they are force - fitted for rotational connection of the shaft with the core 36 and the pole pieces 20 , 22 . as described previously , such a design of the rotor 12 poses problems when the rotor 12 is produced . the invention therefore proposes a rotor 12 , as shown in fig2 to 6 , that comprises at least one intermediate sleeve 58 interposed radially between each pole piece 20 , 22 and the central shaft 14 , and on which the said pole piece is mounted . in fig2 to 5 the driving portion 57 is force - fitted in a fixing bore 59 produced in the intermediate sleeve 58 distinct from the shaft 14 . in the embodiment in fig6 the shaft is axially force - fitted in a fixing bore produced in the core , the intermediate sleeve issuing from the shaft and being offset axially with respect to the fixing bore . in fig2 to 5 the intermediate sleeve 58 is interposed radially between the non - smooth driving portion 57 of the central shaft 14 and the fixing bore 38 of at least one pole piece 20 , 22 . this intermediate sleeve comprises , as described below , a cylindrical surface 60 coaxial with the shaft 14 and received in a complementary central cylindrical bore 38 , 138 of the associated pole piece 20 , 22 so as to position the pole piece coaxially with the shaft 14 . the portion 57 is here provided with reliefs so that it is non - smooth as in fig1 . the reliefs consist here of a knurling with serrations as in fig1 . according to a first embodiment of the invention that is depicted in fig2 , the rotor 12 is similar to the rotor 12 depicted in fig1 . the rotor 12 thus comprises a central shaft 14 , two pole pieces 20 , 22 that are arranged axially on each side of a core 36 , and an excitation coil 34 that extends radially around the core 36 . however , the rotor 12 comprises here an intermediate sleeve 58 that comprises a central fixing bore 59 . the driving portions 57 of the shaft 14 are force - fitted in the fixing bore 59 of the sleeve 58 . these portions 57 comprise reliefs in the form of serrations belonging to a knurling . the sleeve 58 comprises a cylindrical surface 60 , here axially oriented , that merges here with the external peripheral cylindrical surface of the sleeve 58 . the cylindrical surface 60 , which is by virtue of the invention coaxial as described below with the rotation axis of shaft 14 , is intended to receive the pole pieces 20 , 22 . according to this embodiment of the invention , the sleeve 58 is also fitted in the core 36 , so that the sleeve 58 is interposed radially between the shaft 14 and the core 36 , here in two portions , that is to say in two halves , each of which is made in one piece with its associated pole piece , 20 , 22 . for this purpose , the radial section of the cylindrical surface 60 has a shape complementary to the radial section of the central bore 38 of the pole pieces 20 , 22 . more particularly , the surface 60 has in radial section a circular shape and is in close contact with the internal periphery of the pole pieces 20 , 22 delimiting the axially oriented central bore 38 , which is therefore coaxial with the axis of the shaft 14 . the cylindrical surface 60 ( fig2 ) of the sleeve 58 is fitted in each central bore 38 of the pole pieces 20 , 22 , and consequently in the central bore of the core 36 , here in two halves and which is therefore made in one piece with the pole pieces 20 , 22 , so that the sleeve 58 is interposed radially between the driving portion 57 of the shaft 14 and the pole pieces 20 , 22 . here the sleeve 58 is also interposed radially between the driving portion 57 and the core 36 . more precisely , in fig2 and 3 , as in fig1 , two driving portions 57 are provided , with different axial lengths , namely a front portion longer than a rear portion . the front axial end of the front portion 57 extends in axial projection with respect to the front axial end of the front pole piece 20 and the sleeve 58 . this front portion extends to the rear through its rear end roughly as far as the internal end face or the internal radial face 62 of the core half 36 issuing from the front pole piece 20 and constituting the rear axial end of this core half and of the front pole piece . the rear end of this rear portion 57 extends roughly as far as a shoulder or collar 114 belonging , as in fig1 , to a collar of the shaft 14 adjacent to the rings 42 and therefore to the rear end of the shaft 14 . naturally in a variant the rear driving portion is omitted , all this depending on the torque to be transmitted . the rear end of the sleeve 58 is in abutment on the shoulder 114 , or more precisely on the front face of the collar 114 . the front end of the sleeve 58 is intended to come into abutment on the annular strut 150 in fig1 interposed axially between the front end of the sleeve 58 and the bearing 50 . the sleeve 58 is therefore intended to be mounted for axial clamping between the shoulder 114 and the strut 150 so that it makes it possible to reduce the stresses in the pole pieces 20 , 22 . in this example embodiment the front end of the shaft 14 is fitted in the sleeve 58 according to the method described below . the collar 114 limits the relative axial movement of the shaft with respect to the sleeve 58 and has here an outside diameter less than that of the tubular - shaped sleeve 58 in fig2 and 3 . the axial length of the sleeve 58 is at least equal to the sum of the axial lengths of the core 36 and the fixing bores 38 of each pole piece 20 , 22 . here each axial end of the sleeve 58 extends in the same radial plane as the external radial face of the flange 24 of the associated pole piece 20 , 22 . it should be noted that the strut 150 , in a variant , can also come into abutment on the internal periphery of the flange 24 of the front pole piece 20 . the sleeve 58 here consists of a single piece . however , the rotor 12 can also comprise a plurality of sleeves 58 that are arranged end - to - end around the shaft 14 . advantageously , the sleeve 58 is produced from a ferromagnetic material and preferably from the same material as the pole pieces 20 , 22 and the core 36 . the rotor 12 also comprises means for the axial positioning of the pole pieces 20 , 22 with respect to each other axially along the shaft 14 . in the first embodiment , the axial positioning of the pole pieces 20 , 22 is achieved by the facing internal radial faces 62 , 64 each core half 36 . these faces 62 , 64 respectively delimit the rear axial end of the pole piece 20 and the front axial end of the pole piece 22 . this is because , when the pole pieces 20 , 22 are mounted on the shaft 14 , the internal radial faces 62 , 64 of each core half 36 are in abutment against each other , thus allowing the axial positioning of the pole pieces 20 , 22 . it should be noted that each pole piece 20 , 22 comprises respectively at its rear axial end and at its front axial end a mounting bevel to facilitate its mounting on the sleeve 58 . these bevels are advantageously continuous . in addition , the rotor 12 comprises means for rotationally connecting the pole pieces 20 , 22 with the intermediate sleeve 58 , which is itself rotationally connected with here the driving portions 57 of the shaft 14 . here ( fig2 to 4 ) each pole piece 20 , 22 also comprises respectively at its front axial end and at its rear axial end a connection bevel or annular bevel part 66 . as shown in fig2 and 3 , each pole piece 20 , 22 therefore comprises two bevels , namely a connection bevel 66 and a continuous mounting bevel . thus at least one arc of the external circular rim of the central bore 38 of each pole piece 20 , 22 comprises a connection bevel 66 . as shown in fig4 , the connection bevel 66 is able to receive by crimping a deformed material part of the sleeve 58 . for this purpose , the sleeve 58 is advantageously produced from a ductile ferromagnetic material such as soft iron , which is particularly suited to crimping . the hardness of the sleeve is less than that of the central shaft 14 made from ferromagnetic material . in addition , each bevel 66 is here in two annular parts , roughly semicircular , delimited angularly by two radial end faces 68 that make it possible to rotationally lock the pole pieces 20 , 22 around the shaft 14 with respect to the sleeve 58 . it is therefore essential , in order to rotationally fix together each pole piece 20 , 22 and the sleeve 58 , for each annular bevel part 66 to extend only over an arc of the circumference of the central bore 38 of each pole piece 20 , 22 rather than over the entire circumference of the bore 38 . each annular bevel part 66 is filled with the material of the sleeve 58 , which flows , following the crimping operation , into the cavities formed by the bevel 66 . in a variant the bevel 66 comprises a number of parts greater than two , for example 3 or 4 parts . the crimping also makes it possible to lock axially , that is to say in translation , the pole pieces 20 , 22 with respect to the sleeve 58 . according to a variant of the invention that is not shown , the connection bevel is replaced or supplemented by recesses into which the material of the sleeve 58 flows . the circumferential length of the bevel 66 therefore depends on the application , in particular on the presence or not of recesses located between each bevel part . according to a variant of the invention that is not shown , the structures are reversed so that the bevel 66 in at least two parts and / or the recesses are carried by an external ridge of each axial end of the surface 60 of the sleeve 58 , and each pole piece 20 , 22 is crimped in the bevel 66 and / or the recesses . in fig2 to 4 , by virtue of the sleeve 58 , the thickness of the rotor , that is to say the distance between the front face of the front pole piece 20 and the rear face of the rear pole piece 22 , is controlled precisely . according to yet another variant of the invention depicted in fig5 , each pole piece 20 , 22 is fixed to its intermediate sleeve 58 by welding . thus a weld 69 , preferably continuous , is produced between the periphery of the external ridge of the central bore 38 of the pole piece 20 , 22 and the relevant sleeve 58 . it is possible for example to carry out welding of the tig type or welding of the laser type . it should be noted that , compared with the embodiments in fig2 and 3 , the core 36 is in this case integrated in the sleeve and constitutes the central part thereof . more precisely , in this embodiment a hub 158 is provided that replaces the sleeve 58 and the core 36 in fig2 and 3 . this hub 158 comprises a central core 36 that therefore extends in radial projection with respect to a front intermediate sleeve 58 and a rear intermediate sleeve 58 . the front sleeve 58 is dedicated to the mounting of the front pole piece 20 and the rear sleeve 58 to the mounting of the rear pole piece 22 . these intermediate sleeves 58 are arranged axially on each side of the core 36 . the pole pieces 20 , 22 are thus simplified and the central bore , here referenced 138 , of each pole piece is shorter axially than the central bore 38 in fig2 and 3 since it affects only the flange 24 of each pole piece . in addition , for the same outside diameter of the rotor , the height of the flanges 24 of the pole pieces 20 , 22 is reduced since in this embodiment the outside diameter of the surfaces 60 is greater than that in fig2 and 3 . it will be appreciated that , in this embodiment , the thickness of the rotor is controlled even more precisely . it will also be appreciated that wear on the excitation coil 34 is prevented since the distance between the pole pieces is precise , the pole pieces being in abutment against the projecting radial end faces 70 , 72 of the core 36 . in addition the external periphery of the core 36 can be of any shape , for example cylindrical , rectangular or polygonal in shape . naturally , in fig2 to 4 , the pole pieces can be fixed to the sleeve by welding . likewise in fig5 it is possible to fix the pole pieces to the sleeve by crimping . the invention also proposes a method of producing such a rotor 12 . hereinafter , the steps described and the operations that constitute them are numbered for reasons of clarity of the description ; however , these steps and these operations can be performed in any order unless mentioned otherwise . according to the teachings of the invention , the method of producing the rotor 12 of fig2 and 3 comprises a first step e 1 of mounting the intermediate sleeve 58 that is prior to the mounting of each pole piece 20 , 22 . step e 1 of mounting the sleeve 58 consists of axially force - fitting the driving portion or portions 57 of the shaft 14 in the fixing bore 59 of the sleeve 58 until the collar 114 comes into abutment on the sleeve 58 . here the shaft 14 is fitted from the front in the bore 59 in order to cut furrows in the latter by means of reliefs , here in the form of serrations , on the portion or portions 57 . this fitting is achieved with reduced forces compared with those used in fig1 so that the rear end of the shaft 14 with a smaller cross section for mounting the rings 42 is preserved . these rings , in one example embodiment , belong to a collector fitted on the smaller - diameter rear end of the shaft 14 . such a collector is described for example in the document fr a 2 710 200 , to which reference can be made . the production method also comprises a second step e 2 of adjusting the concentricity of each pole piece 20 , 22 with respect to the rotation axis of the shaft 14 . a first operation e 21 of step e 2 is implemented after the first step e 1 of mounting the sleeve 58 . during this first operation e 21 , the surface 60 of the sleeve 58 is produced before the mounting of each pole piece 20 , 22 . the surface 60 is machined in the external peripheral face of the sleeve 58 so that the cylindrical surface 60 is concentric with the rotation axis of the shaft 14 . this operation e 21 makes it possible to correct the lack of concentricity of the surface 60 of the sleeve 58 with respect to the rotation axis of the shaft 14 , due to the uneven plastic deformation of the fixing bore 59 of the sleeve 58 around the driving portion or portions 57 with reliefs , here knurled , of the shaft 14 . it will be appreciated that the sleeve 58 can be standardized in diameter and therefore that an assembly of shaft 14 and sleeve 58 can serve for mounting pole pieces 20 , 22 of different sizes in terms of diameter . the length of the sleeve 58 can easily be adjusted according to the application , the sleeve being obtained in fig2 and 3 from a tube . the second step of adjusting the concentricity e 2 also comprises a second operation e 22 of the machining the central bore 38 each pole piece 20 , 22 , and a third operation e 23 of machining the external peripheral cylindrical face of each pole piece 20 , 22 , that is to say here the external surface of the teeth 30 , in order to define a precise air gap between the rotor and stator of the rotary electrical machine . these last two operations e 22 , e 23 make it possible to adjust the concentricity of the external peripheral face 32 of each pole piece 20 , 22 with respect to the central bore 38 before the mounting of the pole piece 20 , 22 on the shaft 14 . these machining operations e 22 , e 23 can therefore be performed without any risk of damaging the excitation coil 34 . in addition , it is possible to use a lubricant during these machining operations , which makes the machining more rapid and less expensive . then a third step e 3 of adjusting the axial positioning of each pole piece 20 , 22 one with respect to the other is performed . this third step e 3 comprises here only an operation e 31 of machining the internal radial face of the associated half core 36 . this operation e 31 makes it possible to adjust the axial positioning of the pole pieces 20 , 22 with respect to each other . during a fourth step e 4 , the excitation coil 34 is positioned on the core 36 and then a fifth step e 5 of mounting the pole pieces 20 , 22 is performed . during this fifth step e 5 , the surface 60 of the sleeve 58 is fitted in the central bore 38 of the pole pieces 20 , 22 so that the internal radial faces 62 , 64 of each half core 36 are in abutment against each other . the pole pieces 20 , 22 are thus pressed against each other in order to ensure the passage of a magnetic flux between them through their internal radial faces 62 , 64 . this fifth step e 5 is implemented after the first four steps e 1 , e 2 , e 3 , e 4 . finally , a final sixth step e 6 of connection is performed after the step e 5 of mounting each pole piece 20 , 22 . during this step e 6 , the pole pieces and the sleeve 58 are connected together with respect to rotation about the axis of the shaft 14 and with respect to translation , for example by welding or crimping . according to a first variant , depicted in dotted lines in fig3 , of the first embodiment of the rotor 12 , the core 36 forms a single piece which is distinct from the pole pieces 20 , 22 . the sleeve 58 is interposed radially between the shaft 14 and each pole piece 20 , 22 on the one hand and between the shaft 14 and the core 36 on the other hand . the core 36 comprises two external radial end faces , delimiting the axial ends thereof , against each of which the internal face of the flange 24 of each pole piece 20 , 22 is pressed . in this variant , the axial positioning of one pole piece 20 , 22 with respect to the other is achieved by the internal radial face of each flange 24 , which is in abutment axially against a facing external radial face of the core 36 . thus , after easily fitting the excitation coil 34 on the core 36 , the fifth step e 5 is broken down into a step e 51 of mounting the core 36 on the shaft 14 during which the sleeve 58 is fitted in the core 36 and a step e 52 of mounting each pole piece 20 , 22 . preferably , the step e 51 of mounting the core is performed after the first step e 1 of mounting the sleeve 58 and before the fifth step e 52 of mounting each pole piece 20 , 22 . moreover , during the third step e 3 of adjusting the axial positioning , the operation e 31 of machining the internal faces 62 , 64 of the half core 36 is here replaced by an operation of machining the internal face 62 , 64 of each flange 24 . in addition , to allow a precise axial positioning of one pole piece with respect to the other , the third step e 3 of adjusting the positioning comprises a second operation e 32 of machining each external end radial face of the core 36 . then the step e 52 of mounting each pole piece 20 , 22 is implemented , after the implementation of the first five steps e 1 , e 51 , e 2 , e 3 , e 4 . the pole pieces 20 , 22 are axially fitted on each side of the core 34 on end positions of the cylindrical surface 60 of the sleeve 58 , which thus form cylindrical surfaces able to receive the pole pieces 20 , 22 . according to a second embodiment of the invention depicted in fig5 , the shaft 14 is directly fitted in the hub 158 and therefore in the central part thereof formed by the core 36 . the rotor 12 comprises here , in the aforementioned manner , two intermediate sleeves 58 that are arranged axially on each side of the core 36 and that are produced in one piece with the core 36 , and in which the driving portion or portions 57 of the shaft 14 is or are fitted . the outside diameter of the core 36 is greater than the outside diameter of the surface 60 of each sleeve 58 . thus the core 36 comprises two external end radial faces 70 , 72 that project radially with respect to the sleeves 58 and delimit the axial ends of the core 36 . the surface 60 of each sleeve 58 is fitted in the central bore 138 of the associated pole piece 20 , 22 so that the internal radial face 74 of the flange 24 of the pole piece 20 , 22 , delimiting respectively the rear axial end and the front axial end of the pole piece 20 , 22 , is in abutment against the projecting external radial face 70 , 72 facing the core 36 . the pole pieces 20 , 22 are thus positioned axially with respect to each other . in other words , the surfaces 60 are machined in a simple manner in each external cylindrical face of the axial end portions of the hub 158 comprising the core 36 . in the embodiment depicted in fig5 , each pole piece 20 , 22 is fixed to its associated intermediate sleeve 58 by welding 69 . for this purpose , two bevels 76 , 78 are produced so as to coincide respectively in the external radial face of the flange 24 of the pole piece 20 , 22 and in the external radial face of the associated sleeve 58 . according a variant shown in fig4 , the connection between each pole piece 20 , 22 and its sleeve 58 is effected by crimping . the production method described above is modified in order to be adapted to this second embodiment of the invention . thus the fifth step e 5 is broken down into a step e 51 of mounting the core 36 on the shaft 14 , during which the sleeve 58 is fitted in the core 36 , and a step e 52 of mounting each pole piece 20 , 22 . however , the step e 51 of mounting the core is performed concomitantly with the first step e 1 of mounting the sleeve since the sleeves 58 and the core 36 form a single piece in the form of a hub 158 . the step e 51 of mounting the core is therefore performed before the fifth step e 52 of mounting each pole piece 20 , 22 . in addition , during the third step e 3 of adjusting the axial positioning , the operation e 31 of machining the internal faces 62 , 64 of the half core 36 is here replaced by an operation of machining the internal face of each flange 24 . in addition , to permit a precise axial positioning of one pole piece with respect to the other , the third step of adjusting the positioning e 3 comprises a second operation e 32 of machining each external end radial face of the core 36 . advantageously the second operation e 32 of machining the core 36 is performed after the step e 51 of mounting the core 36 . this is because , when the sleeve 58 is force - fitted on the core 36 , each end face of the core 36 is liable to be deformed . thus , in order to guarantee a precise axial positioning of the pole pieces 20 , 22 and so as to permit optimum contact between each pole piece 20 , 22 and the core 36 , it is preferable to carry out the machining of the core 36 after it is mounted on the sleeve 58 . then the step e 52 of mounting each pole piece 20 , 22 is implemented , after the implementation of the first five steps e 1 , e 51 , e 2 , e 3 , e 4 . the pole pieces 20 , 22 are fitted axially on each side of the core 34 on end portions of the cylindrical surface 60 of the sleeve 58 , which thus form cylindrical surfaces able to receive the pole pieces 20 , 22 . according to a variant , not shown , of the rotor 12 , the core 36 and the two sleeves 58 are distinct elements . the shaft 14 is therefore fitted directly in the core 36 , and the driving portions of the 57 of the shaft 14 are force - fitted in the sleeves 58 , which are distributed axially on each side of the core 36 . the shaft 14 comprises in one embodiment a smooth portion between its two driving portions 57 associated with the sleeves 58 . this smooth portion serves as a centering device for the core 36 , the external periphery of the smooth portion of the shaft being in close contact with the internal periphery of the core 36 delimited by the internal bore of the core 36 . it should be noted that the driving portions 57 are shorter axially than in the embodiments in fig2 , 3 and 5 so that the sleeves 58 are less deformed than in these figures . the method of implementing this variant is similar to the method of implementing the second variant of the first embodiment . however , the step e 5 of mounting the core 36 precedes here the first step e 1 of mounting the sleeve 58 since the core 36 is mounted directly on the shaft 14 rather than on the sleeve 58 as is the case in the first embodiment . in a third embodiment depicted in fig6 , the two driving portions 157 , 257 of the central shaft 14 are shorter axially as in the aforementioned variant and , as in fig2 and 3 , the core of the rotor 12 comprises two portions 36 a , 36 b . a sleeve respectively 258 , 358 is associated with each portion of the core 36 a , 36 b . the sleeves 258 , 358 are externally smooth and are in a single piece with the central shaft 14 . these sleeves 258 , 358 therefore issue from the shaft 14 and have different outside diameters , just like the driving portions 157 , 257 . each portion 157 , 257 axially extends respectively the sleeve 258 , 358 . the portion 157 is adjacent to the collar 114 . the outside diameter of the driving portion 257 is roughly equal to the outside diameter of the sleeve 258 . the outside diameter of the sleeve 258 is less than the outside diameter of the driving portion 157 . the outside diameter of the sleeve 358 is less than the outside diameter of the portion 257 and is therefore less than the outside diameters of the sleeve 258 and of the portion 157 with the largest outside diameter . the internal bores of the portions 36 a , 36 b are also stepped in diameter . each core portion has internally two portions with different diameters in order to cooperate respectively each with one of the portions 157 , 257 and the associated sleeve 258 , 358 of the shaft 14 . as can be seen in this fig6 the portion 36 b has a first part with an inside diameter less than that of its second part . this first part is delimited centrally by a cylindrical centering bore intended to come into close contact with the smooth external periphery of the sleeve 358 thus constituting a centering sleeve for the portion 36 b and the pole piece 20 . the second part of this portion 36 b is shorter axially than the first portion and is intended to come into engagement with the driving portion 257 that is harder than the core portion 36 b so that , when the shaft 14 is force - fitted in the portion 36 b , the portion 257 cuts furrows in the second part for rotational connection of the shaft 14 with the pole piece 20 . the second part is therefore delimited centrally by a fixing bore . likewise the portion 36 a has internally two parts , referred to as the third and fourth parts , with different diameters . the third part has an inside diameter less than that of the fourth part . this third part is delimited centrally by a cylindrical centering bore intended to come into close contact with the smooth external periphery of the sleeve 258 , thus constituting a centering sleeve for the portion 36 a and the pole piece 22 . the fourth part of this portion 36 a is shorter axially than the third part and is intended to come into engagement with the driving portion 357 that is harder than the core portion 36 a so that , when the shaft 14 is force - fitted in the portion 36 a , the portion 357 cuts furrows in the fourth part for rotational connection of the shaft 14 with the pole piece 22 . the fourth part is therefore delimited internally by a fixing bore . thus the inside diameter of the first part is less than the inside diameter of the second part , roughly equal to the inside diameter of the third , which is less than the inside diameter of the fourth part . the result of the above and fig6 is that each intermediate sleeve 258 , 358 comprises at its external periphery a cylindrical surface coaxial with the central shaft 14 , which is associated with each pole piece 20 , 22 and which is received in a complementary central cylindrical bore of the associated pole piece 20 , 22 , so as to position the associated pole piece 20 , 22 coaxially with the shaft 14 . each intermediate sleeve 258 , 358 is interposed radially between the core portion 36 a , 36 b and the shaft 14 . in this fig6 the second part emerges at the internal end face 62 of the portion 36 b while the fourth part emerges at the external end face of the portion 36 a . a groove 300 is provided at the front end of the shaft 14 . during an operation of crimping the external face of the pole piece 20 the material of the pole piece 20 is made to flow into this groove 300 so that the pole pieces 20 , 22 are finally locked axially between the collar 114 and the material 301 of the pole piece 20 . thus the sleeves 258 and 358 and the pole pieces 20 , 22 are machined in advance . the step e 1 of mounting the sleeves 258 , 358 consists of producing a single - piece shaft with the sleeves 258 , 358 . the second step e 2 of adjusting the concentricity is easier since the first operation e 21 of step e 2 consists of machining the external periphery of the sleeves 258 , 358 of the single - piece shaft 14 , steps e 22 , e 23 , e 3 , e 4 being performed in the aforementioned manner . it should be noted that , during step e 23 , helical grooves 302 are produced at the external periphery of the rotor 12 in order to cut the eddy currents developed at the external peripheral face of the pole pieces as described in the document fr 2 774 524 . naturally this is applicable to the other embodiments . step e 5 consists of fitting the sleeves 258 , 358 in the central bore of the pole pieces so that the internal faces of the portions 36 a , 36 b are in abutment against each other and pressed so as to ensure passage of the magnetic flux . this step is performed easily since the sleeve 358 and the driving portion 257 pass through the cylindrical central bore of the pole piece 22 without any problem , the sleeve 258 coming into centering contact with the pole piece 22 before the driving portions are force - fitted in the second and fourth portions of the pole pieces 20 , 22 . afterwards the crimping in the groove 300 is carried out , the collar 114 being in abutment on the pole piece 22 so that step e 6 is simplified . for the requirements of the description , the rotor 12 has been described here arranged in an alternator . however , the rotor 12 is not limited to this application . in a rotor produced according to the prior art , the force that is necessary for mounting the pole pieces directly on the driving portion of the shaft is very high . consequently the axial distance between the two pole pieces is poorly controlled and it is necessary to provide a wide tolerance gap . by virtue of the teachings of the invention , the force sufficient for mounting the pole pieces 20 , 22 on their associated intermediate sleeve 58 is sufficiently reduced to substantially decrease this tolerance gap . in a rotor according to the prior art , it is thus necessary to provide a large clearance between each axial end of the excitation coil and the flange of each pole piece . the rotor 12 produced according to the teachings of the invention makes it possible to obtain a more precise axial positioning of the pole pieces 20 , 22 with respect to each other . it is therefore possible to install a longer excitation coil 34 between the two pole pieces 20 , 22 , which makes it possible to increase the power of the alternator . advantageously , the precision of the axial distance between the two pole pieces 20 , 22 of a rotor 12 according to the invention is improved compared with that of a rotor according to the prior art . it is thus possible to provide a excitation coil 34 that best occupies the space between the external periphery of the core 36 and the claws of the pole pieces , particularly in the context of the embodiment in fig5 . it is also possible to better adjust the axial length of the stator body with respect to the axial length between the two pole pieces . likewise , the axial distance between the two pole pieces 20 , 22 being better controlled , a rotor 12 according to the teachings of the invention makes it possible to arrange more powerful fans at the two ends of the rotor 12 without increasing the axial size of the alternator . thus the rear fan 56 in fig1 is in a variant a ventilation device comprising two superimposed fans as described for example in the document wo 2004 / 106748 ( corresponding to u . s . patent application 2007 / 041843 ), to which reference should be made . this ventilation device with two superimposed fans makes it possible to properly cool the excitation coil ends of the stator coil 18 , in particular when this stator coil 18 comprises , in the aforementioned manner , two three - phase windings in a delta offset by 30 ° and each connected to a bridge rectifier . this arrangement , associated with a mounting of permanent magnets between the teeth 30 , when the number of pairs can be less than or equal to the number of pairs of poles of the rotor , makes it possible to properly adjust the characteristic curve of the alternator ( current intensity according to the number of revolutions per minute of the alternator ) according to the application . another advantage is that it is also possible to reduce the axial size of the alternator . the ratio between the outside diameter of the core and the outside diameter of the rotor can also be better controlled . in general terms the power of the alternator is better controlled and the losses thereof are reduced . by virtue of the invention it is possible not to modify the shaft 14 of the rotor 12 and therefore to use a shaft 14 of the standard type . naturally all combinations are possible . thus in fig5 the internal bore of the hub 158 can be configured like that in fig6 and therefore comprise four parts for receiving the shaft 14 in fig6 . the groove 300 can comprise annular sectors separated by bands of material , each sector being filled by the material of the pole piece , which flows following the crimping operation so that a rotational locking is achieved as in fig3 and 4 . the presence of the collar 114 is not obligatory , the movement of the shaft being able to be programmed by means of a device . the driving portions 57 , 157 , 257 can have another shape and comprise for example a plurality of projections . while the form of apparatus herein described constitute a preferred embodiment of this invention , it is to be understood that the invention is not limited to this precise form of apparatus , and that changes may be made therein without departing from the scope of the invention which is defined in the appended claims .	7
next , exemplary embodiments according to the invention will be described with reference to the drawings . fig1 shows an image forming apparatus 10 according to a first exemplary embodiment of the invention . this image forming apparatus 10 has a main body 12 of the image forming apparatus , a paper feeding apparatus 14 disposed on the lower part of the main body 12 , and a paper discharge unit 16 formed on the upper part of the main body 12 . the paper feeding apparatus 14 has a sheet tray 18 and sheets to be used as a transfer medium are stacked on the sheet tray . a feed roll 20 is disposed on an upper part of one end of the sheet tray 18 , and a retard roll 22 is disposed being opposed to the feed roll 20 . the sheet positioned at the highest position of the sheet tray 18 is picked up by the feed roll 20 and then , the sheet is brushed and conveyed in combination with the feed roll 20 and the retard roll 22 . the sheet conveyed from the sheet tray 18 is temporarily stopped by a resist roll 24 , and at a timing , the sheet goes through between a photoconductor unit 26 and a transfer unit 28 and through a fixing apparatus 30 , and is discharged to the paper discharge unit 16 to be described later by a paper discharge roll 32 . on the front side of the image forming apparatus main body 12 ( namely , the right side in fig1 ), a front cover 11 as a first opening and closing unit is disposed . the front cover 11 is mounted rotatably ( movably ) by an axis 15 as a support unit with respect to the image forming apparatus main body 12 and the front cover 11 is rotated around the axis 15 so as to be opened to the front side of the image forming apparatus main body 12 . in addition , on the upper side of the image forming apparatus main body 12 , an upper cover 13 as a second opening and closing unit is disposed . the upper cover 13 is rotated by an axis 17 as a support unit with respect to for the image forming apparatus main body 12 so as to be opened to the upper side of the image forming apparatus main body 12 . the upper cover 13 is closed so as to overlap the front cover 11 in a closed state , from the front side . in other words , the upper cover 13 as being closed may interfere with the front cover 11 being opening or closing . therefore , unless the upper cover 13 is opened , the front cover 11 cannot be opened . in addition , after closing the front cover 11 , the upper cover 13 is closed . in the interior part of the image forming apparatus main body 12 , the photoconductor unit 26 , the transfer unit 28 , a power source unit 34 , and a control unit 36 are disposed . the photoconductor unit 26 is used as a mounted member detachably mounted in the interior part of the image forming apparatus main body 12 and includes a photoconductor unit main body 38 . for example , four sub units 50 are supported by the photoconductor unit main body 38 . each of sub units 50 has a photoconductor 40 . a charging apparatus 42 used as a charging unit provided with a charging roll for uniformly charging the photoconductor 40 , a developing apparatus 44 used as a developing unit for developing a latent image formed on the photoconductor 40 with a development agent image ( a toner ), a charge removal apparatus 46 used as a charge removing unit for removing electricity from the photoconductor 40 by irradiating a light to the transcribed photoconductor 40 , and a cleaning apparatus 48 as a development agent removing unit for removing the development agent remaining in the photoconductor 40 after transfer is made are provided around the photoconductor 40 . four sub units 50 may include one for forming a yellow toner image , one for forming a magenta toner image , one for forming a cyan toner image , and one for forming a black toner image , from an upstream in a sheet conveying direction , which is the lower side in the gravity direction , and a yellow toner image , a magenta toner image , a cyan toner image , and a black toner image are formed on the surfaces of respective photoconductors 40 . each of four sub units 50 can be attached and detached in the interior part of the photoconductor unit main body 38 . each of optical writing apparatuses 56 includes a laser exposure apparatus and they are arranged on the positions corresponding to respective photoconductors 40 on the rear face side of the photoconductor unit 26 so as to form a latent image by irradiating a laser to the uniformly charged photoconductor 40 . the transfer unit 28 is used as a structure and is arranged in a longitudinal direction being opposed to the photoconductor unit 26 on the front side of the photoconductor unit 26 . the transfer unit 28 has a transfer unit main body 29 . in the interior part of the transfer unit main body 29 , two support rolls 58 are mounted in a vertical direction and a conveying belt 60 is hanged on the two support rolls 58 . in addition , in the interior part of the transfer unit main body 29 , a transfer roll 62 is mounted so as to be opposed to each photoconductor 40 across the conveying belt 60 . the conveying belt 60 is a member for conveying the sheet and serves to realize a conveying function of the sheet ( the transfer medium ). in addition , the transfer roll 62 is a member used for transfer , which is a part of an image forming function . in this way , the transfer unit 28 has at least one member for realizing at least one of the image forming function and the transfer medium conveying function . in the image forming apparatus 10 that is constructed as described above , the photoconductor 40 is uniformly charged by the charging apparatus 42 , a latent image is formed by the optical writing apparatuses 56 , and the latent image is developed by the developing apparatus 44 so as to form a development agent image ( a toner image ). the development agent images formed on the photoconductor 40 are transferred on the sheet conveyed by the conveying belt 60 in the order from the lower one by using the transfer roll 62 of the transfer unit 28 to be fixed on the sheet by the fixing apparatus 30 . fig2 shows the front cover 11 and the transfer unit 28 , fig3 shows the front cover 11 , and fig4 shows the transfer unit 28 . as shown in fig2 and 4 , the transfer unit 28 is disposed on the side of the image forming apparatus main body 12 and by using an axis 94 used as a support unit , the transfer unit 28 is mounted so as to be capable of rotating with respect to the image forming apparatus main body 12 as shown by an arrow direction in the drawing . in addition , as shown in fig2 and 3 , as described above , the front cover 11 is mounted on the image forming apparatus main body 12 by using the axis 15 , and as shown by an arrow in the drawing , the front cover 11 is rotatably opened and closed with respect to the image forming apparatus main body 12 . in fig2 and 3 , the front cover 11 as being closed for the image forming apparatus main body 12 is illustrated . the image forming apparatus 10 according to the first embodiment has a fixing mechanism 130 used as a fixing unit , which is used for fixing the front cover 11 at a closed position . the fixing mechanism 130 has a fixing member 132 and the fixing member 132 is rotatably mounted in the image forming apparatus main body 12 around an axis 134 . in addition , the fixing member 132 has an operation unit ( not illustrated ) that is used for the operation by an operator and a contact unit 140 contacting a protrusion 138 for fixing , which is used for fixing the front cover 11 . in addition , the fixing mechanism 130 has a bias member 146 , for example , made of a coil spring , and the bias member 146 biases the fixing member 132 so as to be rotated around the axis 134 in a clockwise direction around the axis 134 . although the fixing mechanism 130 is disposed on the both sides , the right and left sides of the front cover 11 one by one , namely , two in total , fig2 shows the fixing mechanism 130 located on the left side . a constraining member 70 is mounted on the both sides , namely , the right and left sides of the front cover 11 . the constraining member 70 is used for constraining the front cover 11 and the transfer unit 28 and configures a constraining unit . the constraining member 70 is mounted on the front cover 11 by using the axis 72 to be supported around the axis 72 so as to be capable of rotating for the front cover 11 . in the constraining member 70 , a groove 74 is formed , into which a protrusion 80 of a transfer unit main body , formed on the transfer unit main body 29 as a protrusion portion , can be inserted , and a pressing face 76 for pressing the transfer unit main body &# 39 ; s protrusion 80 is formed . in addition , in a constraining member 70 , for example , a bias member 78 made of an elastic body such as a coil spring is mounted , and the bias member 70 is biased in a direction rotating in an anticlockwise direction around the axis 72 by the bias member 78 . on the both sides , namely , the right and left sides of the front cover 11 , a sliding member 82 is mounted so as to be capable of sliding with respect to the front cover 11 . a guide hole 83 is formed on the sliding member 82 and a protrusion 85 for mounting , formed on the side of the front cover 11 , is inserted into the guide hole 83 . on the protrusion 85 for mounting , for example , one end portion of a bias member 84 made of an elastic body such as a coil spring is mounted , and being pressed by other end portion of the bias member 84 , the sliding member 82 is biased in an inverse direction to the protrusion 85 for mounting ( the upper direction in fig2 ). in addition , on the both sides , namely , the right and left sides of the front cover 11 , a notch 86 is formed so as to be capable of inserting the transfer unit main body &# 39 ; s protrusion 80 disposed on the transfer unit main body 29 . on the lower side of the notch 86 in fig2 , a guide face 88 for guiding a movement of the transfer unit main body &# 39 ; s protrusion 80 is formed . in addition , one end portion of the bias member 98 , for example , made of an elastic member such as a coil spring is fixed to the side face in the inside of the front cover 11 via a fixing portion 90 . the bias member 98 has other end portion contacting the transfer unit main body 29 . therefore , the bias member 98 may press the transfer unit 28 to a main body frame 12 a forming a part of the image forming apparatus main body 12 so as to be rotated around the axis 94 in an anticlockwise direction . therefore , being biased by the bias member 98 , the transfer unit 28 is positioned and fixed to a usage position shown in fig2 where the transfer unit 28 is used for forming an image . due to the bias member 98 , an appropriate figuration other than a configuration that the transfer unit 28 is positioned being pressed to the main body frame 12 a can be selected , for example , a configuration that the transfer unit 28 is pressed to the photoconductor 40 of the photoconductor unit 26 and a configuration that the transfer unit 28 is positioned being pressed to the both of the main body frame 12 a and the photoconductor unit 26 or the like . in other words , the bias member 98 may bias the transfer unit 28 so as to be pressed to at least any of the image forming apparatus main body 12 and a mounted member such as the photoconductor 40 and the photoconductor unit 26 , mounted in the interior part of the image forming apparatus main body 12 . in this way , the bias member 98 is disposed between the front cover 11 and the transfer unit 28 and is used as a bias unit for biasing the transfer unit 28 to the image forming apparatus main body 12 or the like . further , in fig2 , the constraining member 70 , the bias member 78 , the sliding member 82 , the bias member 84 , and the notch 86 or the like disposed only on the left side are illustrated , however , as described above , they are disposed on the both sides , namely , the right and left sides one by one . fig5 shows a state in which the front cover 11 and the transfer unit 28 are assembled in the image forming apparatus main body 12 . further , in fig5 , the illustration of the constraining member 70 is omitted . as shown in fig5 and the above - described fig2 , the transfer unit main body 29 is assembled in the front cover 11 so that the transfer unit main body &# 39 ; s protrusion 80 as a protrusion portion of the transfer unit main body 29 is inserted from the inside into the notch 86 shaped in a reversed l as the notch portion of the front cover 11 . the transfer unit main body &# 39 ; s protrusion 80 contacts the sliding members 82 disposed on the both sides of the front cover 11 via the front cover 11 provided with the notch 86 . in addition , the upper part of the constraining member 70 contacts the upper cover 13 in the closed state as shown in fig2 . then , the contact unit 140 of the fixing member 132 of the fixing mechanism 130 may contact the protrusion for contact 138 , and the front cover 11 is fixed to the image forming apparatus main body 12 . the notches 86 are disposed on the both sides of the front cover 11 in a condition of a reversed l ( namely , shaped in a reversed l ) as described above , and the transfer unit main body &# 39 ; s protrusion 80 disposed in the transfer unit 28 is located at the positions shown in fig2 and fig5 so as to be released from constraint of the constraining member 70 , namely , is located at a constraining released position . with reference to fig6 to 9 , the opening and closing operation of the front cover 11 and the upper cover 13 and the moving operation of the transfer unit 28 will be described below . in fig6 to 9 , the illustration of the fixing mechanism 130 is omitted . in order to open the front cover 11 and the upper cover 13 from a state in which they are closed , as shown in fig6 , the operation to open the upper cover 13 is carried out by the operator . by opening the upper cover 13 , the front cover 11 can be opened moving from the position interfering with a locus of opening and closing of the front cover 11 . then , when the operator operates an operation unit ( not illustrated ) of the front cover 11 , the fixing mechanism 130 is released , and the operation for opening the front cover 11 is carried out . in this time , the transfer unit main body &# 39 ; s protrusion 80 is located at a constraint release position . then , if the front cover 11 is rotated in a clockwise direction around the axis 15 , the transfer unit main body &# 39 ; s protrusion 80 disposed on the transfer unit main body 29 may press down the sliding member 82 that is biased upward ( fig7 ), and when the front cover 11 is further rotated , the transfer unit main body &# 39 ; s protrusion 80 may move to the position of the guide face 88 in the notch 86 over the sliding member 82 ( fig8 ). describing this further in detail , fig8 shows the front cover 11 and the transfer unit 28 when the front cover 11 is opening . here , since the front cover 11 and the transfer unit main body 29 are supported by the support portions ( the axis 15 , the axis 94 ), which are disposed on different positions ( the position displaced horizontally or vertically from the main body of the image forming apparatus ) of the image forming apparatus main body 12 , a relative position with respect to the front cover of the transfer unit main body &# 39 ; s protrusion 80 may move in a vertical direction of the image forming apparatus main body 12 in accordance with opening and closing of the front cover 11 . therefore , in combination with opening of the front cover 11 , the transfer unit main body &# 39 ; s protrusion 80 may press down the sliding member 82 to overleap the sliding member 82 at an opening and closing position . then , when the transfer unit main body &# 39 ; s protrusion 80 moves to the guide face 88 , the transfer unit main body &# 39 ; s protrusion 80 is guided into the guide face 88 and this allows the front cover 11 to open . in accordance with this , the transfer unit 28 may move so as to be rotated in the clockwise direction around the axis 94 . then , the front cover 11 and the transfer unit 28 are continuously rotated in the clockwise direction up to the position where the transfer unit main body &# 39 ; s protrusion 80 contacts a lower end portion 104 of the notch 86 , and then , the front cover 11 and the transfer unit 28 are in the state to be opened with respect to the image forming apparatus main body 12 . fig9 shows a state in progress since the front cover 11 and the transfer unit 28 are opened with respect to the image forming apparatus main body 12 ( not illustrated ) till the front cover 11 shown in the above - described fig4 is closed to be arranged on the position where the transfer unit 28 is used for forming an image . in order to shift a state in which the front cover 11 and the transfer unit 28 are opened with respect the image forming apparatus main body 12 into a state in which the front cover 11 is closed to be arranged on the position where the transfer unit 28 is used for forming an image , the operation by the operator for closing the front cover 11 , namely , the operation for rotating the front cover 11 in an anticlockwise direction around the axis 15 will be carried out . when the front cover 11 moves so as to be rotated around the axis 15 in the anticlockwise direction due to the operation by the operator , the transfer unit main body &# 39 ; s protrusion 80 may move so as to be separated from the lower end portion 104 within the notch 86 as being guided by the guide face 88 of the notch 86 . then , in combination with closing of the front cover 11 , the transfer unit 28 may move in the anticlockwise direction around the axis 94 . when the transfer unit 28 moves in the anticlockwise direction , as shown in fig9 , the transfer unit main body &# 39 ; s protrusion 80 is in a state to be fitted in the groove 74 of the constraining member 70 . in other words , the transfer unit main body &# 39 ; s protrusion 80 is in a state in which the front cover 11 is constrained with the transfer unit 28 each other , namely , a constrained state . in this case , before the transfer unit main body &# 39 ; s protrusion 80 is fitted in the groove 74 , the transfer unit main body &# 39 ; s protrusion 80 may press the face of the sliding member 82 continued to the guide face 88 in a substantially vertical direction . however , since the sliding member 82 is disposed so as to move only in a direction in parallel with the guide face 88 , it is not feared that the transfer unit main body &# 39 ; s protrusion 80 is deviated from the guiding direction of the guide face 88 before the transfer unit main body &# 39 ; s protrusion 80 is fitted in the groove 74 , and the transfer unit main body &# 39 ; s protrusion 80 fails to be fitted in the groove 74 . in this way , the constraining member 70 and the transfer unit main body &# 39 ; s protrusion 80 are used as a constraining unit for constraining the front cover 11 and the transfer unit 28 . here , in order to prevent the constraining member 70 from being released upon receipt of a movement in the clockwise direction due to the force that the transfer unit main body &# 39 ; s protrusion 80 receives from the bias member 98 , it is desirable that the rotational axis 72 is arranged so that the direction of the force that the constraining member 70 receives from the transfer unit main body &# 39 ; s protrusion 80 due to the bias member 98 and a virtual line connecting the transfer unit main body &# 39 ; s protrusion 80 and the rotational axis 72 substantially coincide with each other . with the front cover 11 and the transfer unit 28 shown in fig9 constrained , the left end portion of the bias member 98 contacts the transfer unit main body 29 . therefore , the front cover 11 and the transfer unit 28 are in a state in which one member presses the other member with each other . in addition , in the state shown in fig9 , the transfer unit main body 29 is separated from the main body frame 12 a without contacting the main body frame 12 a . in this way , since the front cover 11 and the transfer unit 28 are constrained and the transfer unit main body 29 is separated from the main body frame 12 a , when closing the front cover 11 , the front cover 11 never receive a force in a direction opened to the image forming apparatus main body 12 due to the bias member 98 . in addition , even in the case that the transfer unit main body 29 contacts the main body frame 12 a , a reaction force that the front cover 11 receives is decreased because the front cover 11 and the transfer unit 28 are constrained . the operator carries out the operation that the operator opens the upper cover 13 from the state shown in fig9 in which the front cover 11 is closed . during closing of the upper cover 13 , the upper cover 13 may contact the constraining member 70 so as to press the constraining member 70 and rotate the constraining member 70 against a bias force of the bias member 78 in the clockwise direction around the axis 72 . then , when the constraining member 70 is rotated in the clockwise direction , the transfer unit main body &# 39 ; s protrusion 80 fitted in the groove 74 is detached from the groove 74 . then , since the transfer unit main body &# 39 ; s protrusion 80 is detached from the groove 74 , constraint between the front cover 11 and the transfer unit 28 is released . since constraint between the front cover 11 and the transfer unit 28 is released , the transfer unit 28 is biased in a direction so that the transfer unit 28 is rotated around the axis 94 in the anticlockwise direction by means of the bias member 98 and the transfer unit main body 29 is pressed by the main body frame 12 a . then , as shown in the above - described fig4 , the transfer unit 28 is positioned and fixed to a usage position where the transfer unit 28 is used for forming an image or the like . fig1 shows the front cover 11 that is used for a second exemplary embodiment of the invention . although the front cover 11 used for the above - described first embodiment is provided with the sliding member 82 , in this second embodiment , the front cover 11 is not provided with the sliding member 82 . in addition , according to this embodiment , a connection mechanism 110 used as a connecting unit for connecting the image forming apparatus main body 12 to the front cover 11 is mounted on the front cover 11 . the connection mechanism 110 has a first connection member 112 and a second connection member 114 . the first connection member 112 and the second connection member 114 are connected so that they can rotate with each other by using an axis 116 . on other end side of the axis 116 of the first connection member 112 , a protrusion 118 is formed toward the side of the front cover 11 , and the protrusion 118 is guided to a guide groove 120 formed on the front cover 11 . in addition , on the other end side of the axis 116 of the first connection member 112 , a press face 113 is formed . the second connection member 114 is mounted rotatably in the image forming apparatus main body 12 by using an axis 122 . in addition , according to this second embodiment , a support unit 124 is disposed on the front cover 11 so as to be protruded toward the inside of the image forming apparatus main body 12 . although the connection mechanism 110 and the support unit 124 are disposed on the both side , the right and left sides of the front cover 11 one by one , namely , two in total , fig1 only shows the connection mechanism 110 and the support unit 124 , which are located on the left side . in addition , the image forming apparatus 10 according to this second embodiment has the fixing mechanism 130 used as a fixing unit , which is used for fixing the front cover 11 at a position where the front cover 11 is closed , as in the first embodiment fig1 shows a state in which the front cover 11 and the transfer unit 28 are assembled in the image forming apparatus main body 12 . fig1 shows such a state that the transfer unit 28 is arranged at a usage position where it is used for forming an image or the like , and the front cover 11 and the upper cover 13 are closed to the image forming apparatus main body 12 . according to the above - described first embodiment , the transfer unit 28 is attached so as to be capable of rotating for the image forming apparatus main body 12 by using the axis 94 . on the contrary , according to this second embodiment , the transfer unit 28 is disposed to the support unit 124 of the front cover 11 so as to be capable of rotating by using the axis 94 . further , the same parts as the first embodiment are given the same reference numerals and the detailed explanation is herein omitted . with reference to fig1 to 15 , the opening and closing operations of the front cover 11 and the upper cover 13 and the moving operation of the transfer unit 28 according to the second embodiment will be described . further , in fig1 to 15 , the illustration of the fixing mechanism 130 is omitted . in order to open the front cover 11 and the upper cover 13 from a state in which they are closed , the operation to open the upper cover 13 is carried out by the operator as shown in fig1 , as in the above - described first embodiment . by opening the upper cover 13 , the upper cover 13 is separated from the constraining member 70 and the front cover 11 can be opened moving from the position interfering with a locus of opening and closing of the front cover 11 . then , when the operator operates an operation unit ( not illustrated ) of the front cover 11 , the fixing mechanism 132 is released , and as shown by an arrow in fig1 , the front cover 11 will start to rotate around the axis 15 in the clockwise direction . when the front cover 11 starts to rotate , in combination with this , the protrusion 118 is guided to the guide groove 120 and the first connection member 112 starts to rotate around the axis 116 in the clockwise direction . then , since the first connection member 112 starts to rotate , the transfer unit main body &# 39 ; s protrusion 80 29 is pressed in a right direction by the press face 113 . then , since the transfer unit main body &# 39 ; s protrusion 80 29 is pressed in the right direction , the transfer unit 28 starts to move so as to rotate around the axis 94 in the clockwise direction in combination with the front cover 11 . fig1 shows the front cover 11 that moves from the state shown in fig1 so as to be rotated around the axis 15 in the clockwise direction being biased by the bias member 98 and the transfer unit 28 that rotationally moves around the axis 94 in the clockwise direction in combination with movement of the front cover 11 . in this state , being pressed to the press face 113 of the first connection member 112 , the transfer unit main body &# 39 ; s protrusion 80 moves to the right side within the notch 86 . then , the transfer unit main body &# 39 ; s protrusion 80 moves to be fitted in the groove 74 of the constraining member 70 so as to be in the state such that the front cover 11 and the transfer unit 28 are constrained each other . in other words , in combination with opening of the front cover 11 , the front cover 11 and the transfer unit 28 are constrained each other . fig1 shows the state that the front cover 11 is further opened from the state shown in fig1 , for example , when the operator carries out the operation for opening the front cover 11 and the front cover 11 moves due to an effect by gravity . in this state , the front cover 11 may rest for the image forming apparatus main body 12 so that the protrusion 118 contacts the lower end portion of the guide groove 120 and the front cover 11 is opened to the maximum for the image forming apparatus main body 12 . fig1 shows the state in progress since the front cover 11 and the transfer unit 28 are opened for the image forming apparatus main body 12 ( refer to fig1 ) till the front cover 11 shown in the above - described fig1 is closed to be arranged on the position where the transfer unit 28 is used for forming an image . in order to shift a state in which the front cover 11 and the transfer unit 28 are opened with respect to the image forming apparatus main body 12 into a state in which the front cover 11 is closed to be arranged on the position where the transfer unit 28 is used for forming an image , the operation by the operator for closing the front cover 11 , namely , the operation for rotating the front cover 11 in an anticlockwise direction around the axis 15 will be carried out . in the state shown in fig1 , the front cover 11 and the transfer unit 28 are constrained each other and the left end portion of the bias member 98 contacts the transfer unit main body 29 . therefore , the front cover 11 and the transfer unit 28 are in the state that one presses other each other . in addition , in the state shown in fig1 , the transfer unit main body 29 is separated from the main body frame 12 a . in this way , since the front cover 11 and the transfer unit 28 are constrained and the transfer unit main body 29 is separated from the main body frame 12 a , when the transfer unit 28 is arranged on a usage position where the transfer unit 28 is used for forming an image or the like , the front cover 11 does not receive a force in a direction of being opened to the image forming apparatus main body 12 from the bias member 98 in the case of closing the front cover 11 , as in the first embodiment . the operator carries out the operation to close the upper cover 13 from the state in which the front cover 11 is closed shown in fig1 . in the progress of closing the upper cover 13 , the upper cover 13 contacts the constraining member 70 so as to press the constraining member 70 and rotate the constraining member 70 around an axis 72 in the clockwise direction against a bias force of a bias member 78 . then , when the constraining member 70 is rotated in the anticlockwise direction , the transfer unit main body &# 39 ; s protrusion 80 fitted in the groove 74 is detached from the groove 74 . then , since the transfer unit main body &# 39 ; s protrusion 80 fitted in the groove 74 is detached from the groove 74 , constraint between the front cover 11 and the transfer unit 28 is released , the transfer unit 28 is biased in a direction so that the transfer unit 28 is rotated around the axis 94 in the anticlockwise direction , and the transfer unit main body 29 is pressed by the main body frame 12 a . then , as shown in the above - described fig1 , the transfer unit 28 is positioned and fixed to the usage position where the transfer unit 28 is used for forming an image or the like . fig1 shows the front cover 11 and the transfer unit 28 that are used for a third exemplary embodiment according to the invention . according to the above - described first and second embodiments , the image forming apparatus 10 has the front cover 11 and the upper cover 13 . on the contrary , in this third embodiment , the upper cover 13 is not disposed but the front cover 11 is only disposed . in addition , the image forming apparatus 10 according to this third embodiment has a fixing mechanism 130 as a fixing unit , which is used for fixing the front cover 11 , as in the first and second embodiments and in addition , according to this third embodiment , the transfer unit 28 is mounted so as to be capable of being rotated for the image forming apparatus main body 12 by using the axis 94 , as in the above - described first embodiment . in addition , according to this third embodiment , a protrusion portion 71 is disposed so as to be protruded in a direction of a paper face , and in the state shown in fig1 , the downward face of an operation unit 136 contacts the protrusion portion 71 . in order to open the front cover 11 from the closed state , the operator may carry out the operation of the fixing member 132 . in other words , the operator may pull the operation unit 136 of the fixing member 132 upward . when the operation unit 136 is pulled upward , the fixing member 132 is rotated around the axis 134 in the anticlockwise direction against the bias force of a bias member 146 . then , since the fixing member 132 is rotated , the contact unit 140 is separated from the protrusion for fixing 138 to be in a state so that the front cover 11 can be opened . the front cover 11 and the transfer unit 28 are continuously rotated in the clockwise direction up to the position where the transfer unit main body &# 39 ; s protrusion 80 is in the state of contacting the lower end portion 104 of the notch 86 , and the front cover 11 and the transfer unit 28 are in the state of being opened to the image forming apparatus main body 12 . further , the same parts as the first embodiment are given the same reference numerals and the explanation thereof is herein omitted . fig1 to 19 illustrate the operation till the front cover 11 is closed and the moving operation of the transfer unit 28 . fig1 shows the state in progress since the front cover 11 is opened for the image forming apparatus main body 12 till the front cover 11 shown in the above - described fig1 is closed to be arranged on the position where the transfer unit 28 is used for forming an image . in order to shift a state in which the front cover 11 and the transfer unit 28 are opened for the image forming apparatus main body 12 into a state in which the front cover 11 is closed to be arranged on the position where the transfer unit 28 is used for forming an image , the operation by the operator for closing the front cover 11 , namely , the operation for rotating the front cover 11 in the anticlockwise direction around the axis 15 will be carried out . in the operation by the operator , if the front cover 11 is moved so as to be rotated around the axis 15 in the anticlockwise direction , the transfer unit main body &# 39 ; s protrusion 80 is guided into the guide face 88 and this allows the transfer unit main body &# 39 ; s protrusion 80 to move within the notch 86 so as to be separated from the lower end portion 104 . then , in combination with closing of the front cover 11 , the transfer unit 28 is moved in the anticlockwise direction in the anticlockwise direction around the axis 94 . in addition , when the transfer unit main body &# 39 ; s protrusion 80 is moved from the state shown in fig1 , the transfer unit main body &# 39 ; s protrusion 80 is fitted in the groove 74 of the constraining member 70 . then , when the transfer unit main body &# 39 ; s protrusion 80 is fitted in the groove 74 of the constraining member 70 , the front cover 11 and the transfer unit 28 are constrained each other . in this way , the constraining member 70 and the transfer unit main body &# 39 ; s protrusion 80 are used as a constraining mechanism for constraining the front cover 11 and the transfer unit 28 in combination with the operation for closing the front cover 11 . with the transfer unit main body &# 39 ; s protrusion 80 fitted in the groove 74 and the front cover 11 and the transfer unit 28 constrained , the left end portion of the bias member 98 contacts the transfer unit main body 29 . therefore , the front cover 11 and the transfer unit 28 are in a state in which one member presses the other member with each other . in addition , in this state , the transfer unit main body 29 is separated from the main body frame 12 a without contacting the main body frame 12 a . in this way , since the front cover 11 and the transfer unit 28 are constrained and the transfer unit main body 29 is separated from the main body frame 12 a , when the transfer unit 28 is arranged on the usage position where the transfer unit 28 is used for forming an image or the like , also in this third embodiment , upon closing of the front cover 11 , the front cover 11 does not receive a force in a direction of being opened to the image forming apparatus main body 12 from the bias member 98 . further , although it is preferable that the front cover 11 does not receive the bias force from the bias member 98 in the case of closing the front cover in any embodiment , there is no problem if the bias force is given to an extent such that the operability of the opening and closing unit is not damaged . from the state shown in fig1 , the operator will carry out the operation of the front cover 11 . in other words , the front cover 11 is moved so as to be rotated in the anticlockwise direction around the axis 15 . then , due to the above - described operation , the protrusion for fixing 138 formed in the front cover 11 is moved from the side of a press face 142 to the side of the contact unit 140 . when the protrusion for fixing 138 is detached from the press face 142 , the fixing member 132 is biased by the bias member 146 to be rotated around the axes 134 in the clockwise direction . then , as shown in fig1 , by rotating the fixing member 132 , the protrusion for fixing 138 is fitted in the contact unit 140 , the fixing member 132 contacts the constraining member 70 , and then , pressing the constraining member 70 , the constraining member 70 is rotated in the anticlockwise direction around the axis 72 against the bias force of the bias member 78 . then , if the constraining member 70 is rotated in the anticlockwise direction , the transfer unit main body &# 39 ; s protrusion 80 fitted in the groove 74 is detached from the groove 74 . then , since the transfer unit main body &# 39 ; s protrusion 80 is detached from the groove 74 , constraint between the front cover 11 and the transfer unit 28 is released . since constraint between the front cover 11 and the transfer unit 28 is released , the transfer unit 28 is biased in a direction so that the transfer unit 28 is rotated around the axis 94 in the anticlockwise direction by means of the bias member 98 and the transfer unit main body 29 is pressed by the main body frame 12 a . then , as shown in the above - described fig1 , the transfer unit 28 is positioned and fixed to the usage position where the transfer unit 28 is used for forming an image or the like . as described above , the invention can be applied to an image forming apparatus such as a copying machine , a facsimile , and a printer having an opening and closing unit and a structure , for example , a transfer unit .	6
there has thus been outlined , rather broadly , the more important features of the invention in order that the detailed description thereof that follows may be better understood and in order that the present contribution to the art may be better appreciated . there are , of course , additional features of the invention that will be described hereinafter and which will form the subject matter of the claims appended hereto . in this respect , before explaining at least one embodiment of the invention in detail , it is to be understood that the invention is not limited in its application to the details of construction and to the arrangements of the components set forth in the following description or illustrated in the drawings . the invention is capable of other embodiments and of being practiced and carried out in various ways . also , it is to be understood that the phraseology and terminology employed herein are for the purpose of descriptions and should not be regarded as limiting . looking at fig1 it can be seen that the feces collection device 2 has a rollable collection housing assembly 4 , a collection blade rotor assembly 6 rotatably affixed at the front of the collection housing assembly 4 , and a telescoping handle assembly 8 pivotally attached to the rear of the housing assembly 4 . looking at the combination of fig2 , 3 , 6 , 7 , 8 , 9 and 11 the collection housing assembly 4 has a generally cuboid physical configuration having a fixed bottom plate 10 with two side wall plates 12 extending therefrom to which a top curved front plate 14 and a rear handle bracket 16 are affixed . bounded by the side wall plates 12 , the bottom plate 10 and the handle bracket 16 is a rear disposal hatch 18 which is pivotally mounted to side wall plates 12 and encloses the back end of the collection housing assembly 4 . also pivotally mounted to the side wall plates 12 and residing between the handle bracket 16 and the front plate 14 is a top bag removal hatch 20 . on the front bottom of the collection housing assembly 4 is an adjustable , spring loaded scoop 22 . the scoop 22 has at least one torsion device 36 that biases the scoop 22 to its fully down position closest to the ground . the sides of the scoop 22 have threaded studs 32 extending normally therefrom and passing through arced slots 34 cut through the side wall plates 12 . these arced slots define the rotatable travel of the scoop 22 from its full down to fully up positions . there are threaded fasteners ( wingnuts ) 35 threadingly engaged with the studs 32 and a flat washer utilized so that the tightening of the threaded fasteners 34 will secure the scoop 22 in a fixed position relative to its fully down position . at the rear of the collection housing there are two fully rotatable caster wheels 24 affixed to the bottom plate 10 . looking at fig3 , 10 , 13 and 14 it can be seen that the collection blade rotor assembly 6 is a multi vaned rotor 42 made of an axle 38 from which a series or set of series of variable length blades 44 extend . the distal and proximate ends of the axle 38 pass through orifices in the side wall plates 12 and are affixed thereafter to substantially identical wheels 40 such that when the wheels rotate , the rotor 42 also rotates within the cavity of the collection housing device 4 . a bushing assembly may optionally be affixed to the side wall plates 12 and utilized to stabilize and smooth out the rotation of the axle 38 . as can be seen in fig1 and 12 the rotor assembly 6 may have differing physical configuration of the blades . however common to all of the rotor blade configurations is the sizing of the blades , relative to each other . experimentation has shown that optimally a series of three blades increasing length works best . in the present invention the front blade is ½ inch shorter than the intermediate blade which is ½ inch shorter than the back blade . in this way the feces is segmented and collected in three horizontal sections . this size differential is best implemented as 1 . 5 , 2 and 2 . 5 inch long blades . this ½ inch increasing blade length in the direction of rotation for the second and third blades in the three blade series has been experimentally proven to best effect collection of solid feces in the dimensions commonly excreted by dogs . when the rotor 42 is rotated such that the back blade resides perpendicular to the ground there is ⅛ inch clearance between the tip of the back blade and the scoop plate . this tolerance of clearance has been experimentally proven to best effect collection of semi - solid feces . the three blade series is repeated at least two times on the axle 38 to form the multi vaned rotor 42 . the leading edge or lip 46 of the longest blade ( the back blade ) is bent 33 degrees from the plane of the blade away from the direction of counterclockwise rotation as represented by arrow 48 . this prevents the collection of unwanted gravel and jamming of gravel between the rotor 42 and the spring loaded scoop 22 . although the lip 46 is bent for the size of gravel commonly encountered there is a broad range of angles that will work better on different sizes of gravel . these range between 10 and 50 degrees . the tip of each of the blades whether bent or not , has been beveled on at least one side to at least 30 degrees . the alternate embodiment blade 43 utilizes the same lip configuration and blade sizing as the preferred embodiment but has the blades configured in a helical manner . looking at fig1 and 14 it can be seen that the scoop 22 is a bucket with and open front and back adapted to ensure that the partial feces contacted and flung backwards by the collection blade rotor assembly 6 travels to its final destination of the internal cavity of the housing assembly 4 rather then back onto the user &# 39 ; s feet or legs . the scoop 22 has orifices in its side walls 50 that allow it to be mounted about the axle 38 for limited pivotable motion about the axle 38 . the scoop 22 can only move through the range of pivotable motion allowed by the physical interference between the studs 32 extending from the scoop &# 39 ; s side walls 50 and the arced slots 34 on the scoop &# 39 ; s housing &# 39 ; s side wall plates 12 through which the studs 32 pass . in the preferred embodiment , the torsion devices 36 are wound springs with one end affixed to the scoop 22 and the other end affixed to the collection housing assembly 4 , although there is a plethora of torsion devices well known in the field that would work equally as well . the scoop &# 39 ; s bottom plate 52 has a pointed tip 54 that is bent upward 33 degrees from the plane of the bottom plate 52 . this helps eliminate the collection of non fecal mater such a stones and twigs . the pointed tip 54 has an included angle of 114 degrees . this configuration works well to slide under the feces and support it from movement while the three rotor blades dissect the feces into three longitudinal sections and fling them into the internal cavity of the housing 4 . fig1 and 14 illustrate the movement of the scoop 22 from its upper position ( fig1 ) to its bottom position ( fig1 ). regardless of the position of the scoop 22 , the ⅛ inch clearance between the tip of the back rotor blade and the pointed tip 54 of the scoop &# 39 ; s bottom plate 52 is always maintained as both rorate about the axle 38 . inside the housing 4 there is a feces collection bag retention flange 60 adapted to secure a feces collection bag 62 for the collection of feces flung into the housing by the action of the collection blade rotor assembly 6 . the flange 60 is constrained by a set of guides in the housing 4 and may be accessed by opening the top bag removal hatch 22 and sliding out the flange 60 with the attached fecal collection bag 62 for disposal . when there is no fecal collection bag 62 installed , the feces flung into the housing 4 will just remain in the inner cavity . the device 2 can then be emptied by tilting rearward the device 2 with the tip handle 64 and opening rear disposal hatch 18 . the tip handle is a curved extension of the top curved front plate 14 and is adapted for three finger operation . looking at fig4 and 5 it can be seen that the handle assembly 8 is both extendable in a telescoping manner via the handles consecutive hollow tube sizes and the spring loaded locking button 26 . the handle t bar 28 is also made of hollow tubing such that a flexible water line 30 can be extended from one side of the t bar 28 , down through the hollow handle telescoping tubes and extend down into the collection housing assembly 4 from the top through a slot formed through the bag removal hatch 20 . with this design , the handle assembly 8 can be pivoted fore and aft to direct a jetted spray of water throughout the internal cavity of the collection housing assembly 4 to cleanse it . for ease of washing the internal surfaces of the housing 4 and the rotor 42 are to be coated in a non sticking surface treatment or coating such as polytetrafluoroethylene ( ptfe ). the water is introduced through a hose connector 66 affixed to one side of the t bar 28 . in operation the user need only open the top bag removal 22 , slide out the feces collection bag retention flange 60 , wrap the open end of a feces collection bag 62 around the flange 60 and reinstall the flange 60 . if the surface for feces collection is extremely rocky , the scoop 22 may be raised to a higher position that the torsion springs bias it to , and the threaded fasteners 34 tightened to secure the scoop 22 in a fixed position . otherwise the scoop 22 will be left in its automatic tensioning mode , biased downward by torsion to the lowest position . the handle assembly 8 is telescopically adjusted to the correct height for the user and the device 2 is pushed over a feces while the user walks at a normal cadence . the combination of the larger front wheels 40 and the pivotable caster wheels 34 at the rear provide optimal turning and steering in tight spaces . the pointed tip 54 of the scoop &# 39 ; s bottom plate 52 slides under the feces and the multi vaned rotor 42 segments the feces into three horizontal sections and flings the sections into the internal cavity of the housing 4 . if a feces collection bag 62 was not initially installed , the user need only empty the housing 4 by tilting the device 2 rearward with the tip handle 64 and opening rear disposal hatch 18 . after emptying the feces collection bag 62 or the housing 4 , a hose is attached to the hose connector 66 on the t bar 28 , the rear disposal hatch 18 and top bag removal hatch 20 are closed , and the water is turned on . the user tilts the handle assembly 8 fore and aft to flush out the internal cavity of the housing . the end of the water line 30 may optionally have a watter spinning or jetting device to direct the water spray pattern to optimally reach all areas of the internal cavity as is well known in the art . it is known that the collection blade rotor 42 may be comprised of various combinations of different sized blades in repeating series or not . however experimentation has shown that using 2 series of the three blade grouping with the blade configurations as detailed herein works optimally for the collection of solid and semi solid feces over a wide variety of terrains . the above description will enable any person skilled in the art to make and use this invention . it also sets forth the best modes for carrying out this invention . there are numerous variations and modifications thereof that will also remain readily apparent to others skilled in the art , now that the general principles of the present invention have been disclosed . it is important , therefore , that the claims be regarded as including such equivalent constructions insofar as they do not depart from the spirit and scope of the present invention .	4
the programmable logic controller together with the inputs - outputs system according to the invention is a logic controller having a basic structure of the type shown in fig1 . each coupler including on / off couplers has a coupler memory me . the dialogue between each coupler c1 , c2 , etc . and the processing unit cpu is structured by logical channels that are characterized firstly by one or several &# 34 ; job &# 34 ; functions . for example for the &# 34 ; counting &# 34 ; job , a logical channel may carry out one or several of the following &# 34 ; job &# 34 ; functions : counting , discounting , counting / discounting , frequency meter , position measurement . secondly , the logical channel is characterized by the physical channels that it uses . for example in the case of a counting coupler with four counters , a logical channel contains physical interface channels for counting sensors such as proximity detectors or optical position encoders and physical channels for inputs from services such as validation of counting or counter pre - selection . the user program is broken down into tasks . a task is a set of instructions periodically executed by the processing unit processor p . the manufacturer &# 39 ; s program activates the inputs - outputs manager i before executing a task in order to acquire information originating from a logical channel . at the end of the task , the manufacturer &# 39 ; s program activates the inputs - outputs manager ( mark i on the fig1 ) to make it send information to the logical channel . a data structure is associated with each logical channel of a given coupler ( see fig2 to 4 ), that we will call language interface . this data structure is invariable regardless of the coupler and regardless of the logical channel . its size and contents depend on the job function to be carried out . it is stored in a coupler memory mc , the contents of this memory being swapped ( received or sent ) on or to an identical memory area in the processing unit memory m2 . the data structure is structured by exchange type ( see fig3 ): periodic input exchange : the contents are sent from memory mc to memory m2 . it generally contains information produced periodically , for example the numeric value of a sensor . periodic output exchange : the contents are received from memory m2 . it generally contains information communicated periodically by the user program . exchange at the request of the user program : this area has parts with contents which are received from memory m2 , and parts with contents which are sent to memory m2 . it contains information processed &# 34 ; non - periodically &# 34 ; by the user program . configuration exchange when the user program is started ; this area is received from memory m2 . it contains information defined by the user to start the job function . the user program accesses information stored in the memory m2 of the processing unit cpu in the form of the data structure using the syntax described above . if a logical channel , for example 0 or 1 is considered , area i contains information that is generated by this logical channel . area q contains orders or commands of the processing unit that are to be sent to the logical channel . area m depends on the job function and may contain &# 34 ; status &# 34 ; type information , specific command parameters , and setting parameters . this information is exchanged at the request of the user program . the status parameters contain channel faults and possibly the operating state of the logical channel . specific command parameters are commands which are different from the q area , only in that they are sent at the request of the user program , for example an order to move to a given position at a given speed . setting parameters are information sent to the logical channel to describe the variable characteristics of the operations part . for example , one of the parameters for an axis control coupler is the gain of the process position . area k contains configuration parameters , in other words parameters of sensors or actuators working with the coupler . these are constants for a given operations part . referring to fig5 the various areas i , q , m and k are also structured into memory sub - areas called object types . these sub - areas are as follows : &# 34 ; bits &# 34 ; sub - area coded x or default sub - area ( if nothing is specified for the object type ): the information stored is binary , for example start counting ; the &# 34 ; words &# 34 ; sub - area coded w : the information stored is of the numeric type coded on 16 bits , for example the numeric value of a temperature sensor . the &# 34 ; double words &# 34 ; sub - area coded d : the information stored is of the numeric type coded on 32 bits , for example the numeric value of a temperature sensor . each sub - area contains several items of information or elements of the same type . a given element is identified by its &# 34 ; rank &# 34 ;, the value of which is equal to the position of the element relative to the beginning of the sub - area . therefore each information element is defined by an object type and a rank inside each area . the rank identifies the position of the element measured from the beginning of the sub - area . therefore each information element is defined by an object type and a rank inside each area . the topological address is defined by the coupler address associated with the logical channel number . couplers such as c1 and c2 installed in the main rack r are accessed by an address equal to the coupler number defined on 1 or 2 digits . for example the address 1 . 0 is the logical channel 0 of the coupler located in slot 1 in the main rack r . % id 1 . 0 will then be the value of the logical counting channel 0 on the counting coupler located in slot 1 in the main rack r . now referring to fig3 exchanges concerning i , m and k are implicitly handled by the manufacturer &# 39 ; s program . a set of user program instructions manages exchanges in the m area between the processing unit and logical channels . m setting parameters are accessible in read / write in the processing unit memory by the user program . a data structure may be associated with each coupler . it is called a coupler language interface and has the same structure and the semantic as the interface associated with the channel . its size and contents depend on the coupler type . the language interface syntax associated with the coupler is : the logical channel may also send information to the processing unit in addition to the various exchange types defined above . this exchange type is called an event controlled exchange . for example in a logical counting channel , exceeding a limit may cause the value of the current measurement ( counter value ) to be transmitted to the processing unit . when an event controlled exchange takes place , the logical channel sends information to the processing unit cpu to update all or part of area i . when an event is received , the manufacturer &# 39 ; s program activates part of the manufacturer &# 39 ; s program associated with this event . thus referring to fig7 it is seen that a &# 34 ; capture order &# 34 ; event generated by the logical channel triggers processing that forms part of the manufacturer &# 39 ; s program . this processing is denoted % evt5 . event controlled processing enables the user to associate a program sequence with each event sent by a logical channel of a coupler to the processing unit . the configuration of the coupler will now be described , with reference to fig6 . it is firstly necessary to choose the coupler family ( on / off , communication , analog , axis positioning or control , counting ), and then to choose a coupler reference ( reference 1 , 2 , 3 , etc . ), belonging to this job . when the coupler has been chosen , a logical channel can then be configured by making it support a number of job functions . for example if a logical counting channel is chosen , the job function will be configured by choosing one or several of the following job functions : counting function , discounting function , counting / discounting function , frequency meter function . the system reserves the processing unit memory area which will be used by the language interface , when associating the job function . the operation is called &# 34 ; instantiation &# 34 ;. when the job function has been chosen , the values in area k and area m can then be defined using the software screens . obviously , it is possible to imagine alternatives and improvements to details , and even to use equivalent means , without departing from the scope of the invention .	6
various examples for the preparation of the coating layers according to the invention are described below . 460 parts by weight of 1 , 6 - hexanediol and 70 parts of trimethylolpropane are esterified with 167 parts of adipic acid , 56 parts of o - phtalic acid and 247 parts of i - phtalic acid , until a free oh radical content of about 4 . 3 % by weight is reached and the acid index ( din 53 . 402 ) is about 1 . the slightly ramified polyesterpolyalcohol thus obtained constitutes the polyalcohol component for the reactive mixture . to the polyesterpolyalcohol , one adds 0 . 1 % by weight of a fluoroalkyl ester as an extending agent and 1 % by weight of bissebacate ( 1 , 2 , 2 , 6 , 6 - pentamethyl - 4 - piperidyle ) as a light - protective agent . for the preparation of the reactive mixture , 100 g of an essentially trifunctional polyisocyanate , namely a biuret of 1 , 6 - hexamethylenediisocyanate , having a free nco radical content of 23 % by weight , is heated with 216 g of the above described polyester polyalcohol , to a temperature of 80 ° c . ; they are agitated at this temperature for 10 minutes . the nco / oh equivalent ratio of the reaction mixture is thus 1 . after these two components are mixed , the reactive mixture is spread with a scraper , forming a layer , which is 0 . 5 mm thick , on flat sheets which have been preheated to 70 ° c . for the hardening of the layer , the coated glass sheets are kept at a temperature of 90 ° c . for 30 minutes , for example , in a thermostatically controlled forced air oven . after the coating layers thus prepared are hardened and conditioned at 20 ° c . under a relative humidity of 50 %, the polyurethane layers are detached from the glass supports so that their mechanical properties can be determined ; the sheets are measured for their traction resistance and extension under traction according to din standard 53455 , as well as the e module conforming to din standard 53457 . resistance to the spread of cracks is also determined according to graves , in compliance with din standard 53515 . in addition , abrasion resistance is determined according to ece standard r - 43 and resistance to scratching according to erichsen is measured on polyurethane layers attached to glass supports . in the determination of scratch resistance according to erichsen , an experimental assembly as described in din standard 53799 is utilized , with the exception that the conical scratching diamond utilized has a conical angle of 50 degrees and a curve radius of 15 μm at the vertex of the cone . to evaluate scratch resistance , the highest applied load of the scratching diamond for which no visible , permanent damage to the surface can be identified , is relied on . the evaluation of the state of the surface of the polyurethane layers is effected visually . the results of the mechanical measurements are summarized in table 1 below . the table also indicates , for the various mechanical properties , the ranges in which the measured values must be located so that the polyurethane coating meets the criteria concerning usage comportment and , specifically , concerning the self - repairing properties . the same procedure as in example 1 is followed , but taking 81 . 3 g of a polyetherpolyalcohol having a molecular weight of about 450 , obtained by the condensation of 1 , 2 propylene oxide with 2 , 2 bis ( hydroxymethyl )- 1 - butanol having a free oh radical content of about 11 . 5 as a polyalcohol , and adding to the polyalcohol , 0 . 05 % by weight with respect to the weight of the polyalcohol , dibutyltin dilaurate , as a catalyst , 0 . 1 % by weight of a fluoroalkyl ester , as an extending agent , 1 % by weight of 1 , 2 , 2 , 6 , 6 - pentamethyl - 4 - piperidyle , as a light - protective agent . table 1__________________________________________________________________________ extentsion resistance traction under to crack e abrasion scratch resistance traction spreading module cloudness resistance n / mm . sup . 2 % n / mm n / mm . sup . 2 % p__________________________________________________________________________limit values 5 - 40 60 5 - 20 2 - 20 4 10of the requiredrangeexample 1 9 . 87 131 . 1 11 . 8 6 . 46 2 . 71 24comparative 10 . 4 115 6 . 5 13 . 0 3 . 5 12example__________________________________________________________________________ table 1 shows that all of the mechanical properties of the layer according to the example are within the required limits . to examine the influence of the open atmosphere on the condition of the surface , a certain number of test pieces are exposed openly to the elements , in this case , for a duration of several months . at the end of this period , no alteration of the surface of the polyurethane layer could be seen . luster measurements indicate a very low rate of loss , under 1 %, of luster . this loss of luster is more than 50 % in the case of the control sample , despite the utilization of a light - protective agent . for the preparation of the reactive mixture , 100 g of an essentially trifunctional polyisocyanate containing 1 , 6 hexamethylenediisocyanate - based isocyanurate radicals , having a free nco radical content of 21 . 5 % by weight , is mixed vigorously , for 10 minutes at 40 ° c ., with 94 . 2 g of a trifunctional polycaprolactone having a free oh radical content of 9 . 3 % by weight . the nco / oh ratio is thus 1 . additives previously incorporated into the the polycaprolactone are 0 . 015 % by weight with respect to the weight of the polycaprolactone , dibutyletain dilaurate as a reaction catalyst , 0 . 1 % by weight of a fluoroalkyl ester as an extending agent and 1 % by weight of bis sebacate ( 1 , 2 , 2 , 6 , 6 - pentamethyl - 4 piperidyle ) as a light - protective agent . after mixing these two components , the reactive mixture is applied , with a scraper , forming a coating which is 0 . 5 mm thick , on glass sheets which have been preheated to 70 ° c . the layer is again hardened at 90 ° c . for a period of 30 minutes in a thermostatically controlled forced air oven . to examine the effects of aging under different surrounding conditions , glass plates coated with this polyurethane layer are kept under these different conditions , and the mechanical and optical properties are subsequently determined . table 2 below is a summary of the results of the mechanical property measurements , with the various test pieces having been exposed to the following operations : test piece a : measurement immediately after the hardening of the polyurethane layer . test piece b : kept for 21 days in the laboratory under normal surrounding conditions . test piece c : kept for 2 hours at 60 ° c . in a forced air oven . test piece d : kept for 7 days at 50 ° c . under relative atmospheric humidity of 100 %. table 2__________________________________________________________________________ extension resistance traction under to crack e abrasion scratch resistance traction spreading module cloudness resistance n / mm . sup . 2 % n / mm n / mm . sup . 2 % p__________________________________________________________________________limit values 5 - 40 60 5 - 20 2 - 20 4 10of the requiredrangetest piece a 24 . 0 119 . 9 9 . 5 8 . 8 2 . 3 34test piece b 22 . 4 100 . 8 11 . 7 11 . 8 2 . 1 46test piece c 24 . 0 121 . 5 13 . 1 9 . 7 2 . 5 41test piece d 29 . 5 114 13 . 8 13 . 1 2 . 15 35__________________________________________________________________________ the measurement results again show that even after the most varied artificial aging treatments , the physical - mechanical properties fall within the required limits , i . e ., no significant alteration in these properties could be seen . another series of test pieces was exposed directly to the elements for several months , by exposing glass panes endowed with the coating layers , to the direct action of the outside atmosphere . after exposure , a visual examination of the coating layer was conducted as well as luster measurements according to din standard 67530 . the visual evaluation indicated that there was no visible alteration of the surface or in the depth of the coating layer . the luster measurements indicate an extremely small degree of decrease in superficial luster , of about 0 . 5 % compared with the values measured on the same samples before exposure to the elements . the coating layer according to the invention can be utilized in all of the aforementioned applications . it is also utilized in combination with a polyurethane coating having energy absorbant properties to form a two - layer sheet , as described , for example , in european patent publication nos . 0 132 198 and 0 133 090 , with this two - layer sheet being advantageously utilized in compound safety panes . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein .	1
for a detailed description of the preferred embodiment the reader is referred to the appended figures in which like components are given like numerals for ease of reference . for quick reference all of the reference numerals are listed in table i below and their corresponding parts identified with the figures in which the parts are identified . the parts may be shown in other figures but are identified by the reference numerals in the listed figures only . referring first to fig1 and 2 , the device is shown in its initial state with the applicator holding body 1 and the applicator plunger body 2 are molded as one plastic part along with and connected by a flexible living hinge 13 . the two bodies are in the form of rectangular leaves or slabs . in fig4 the needle carrier 3 is seen to be captured laterally and vertically by a carrier track slot 31 contacting the carrier sliding track 18 . fig3 shows that actuator pin 11 is captured by applicator locking slot 10 on the needle carrier 3 preventing any angular motion around the pivot point defined by the living hinge 13 . locking slot detent 37 , located in the applicator locking slot 10 , allows a light snap fit between actuator pin 11 and the needle carrier 3 to temporarily retain the needle carrier 3 in this locked position . the distal end of the hypodermic needle 12 is safely stowed in the needle safety cavity 14 . referring now to fig1 , 6 a and 18 , capsule assembly 35 comprising collapsible vessel or container 4 , capsule closure 6 and capsule closure inner ring 28 , is positioned in the applicator holding body 1 . this capsule assembly contains a pre - loaded medication dose in the capsule inner cavity 22 . the inner cavity 22 is sealed by compressing the vessel neck 36 between the capsule closure wall 29 and the capsule sealing ring 30 located on the capsule closure inner ring 28 . this seal is retained by the capsule closure retainer latch 25 snapping into the capsule closure inner ring 28 . the inner cavity 22 is also sealed by membrane 8 located in the capsule closure 6 . the sealing label 34 , as shown on fig1 , seals the capsule luer seal cavity 24 and the membrane 8 from contaminants . the capsule assembly 35 is positioned by capsule holding cavity 5 . due to the elastic properties of the vessel 4 , an additional retainer comprising capsule retaining ring slot 26 on applicator holding body 1 and capsule retaining ring 7 , part of the capsule closure 6 , is required to hold the capsule assembly 35 stable . referring to fig5 and 5a , needle carrier is pushed by means of finger push interface 21 to a position where the actuator pin 11 is in the driving track 9 . this allows angular movement of living hinge 13 between applicator holding body 1 and applicator plunger body 2 . as seen in fig1 , the plastic needle carrier 3 is molded around the hypodermic needle 12 creating piercing needle 20 at the proximal end and hypodermic needle 12 at the distal end . hypodermic needle 12 is thus a double ended canula and sharp at both ends . as seen in fig7 and 8 , folding the applicator plunger body 2 along living hinge 13 toward the applicator holding body 1 drives actuator pin 11 towards the distal end of the applicator holding body 1 in a circular motion as defined by a pivot point along the axis of living hinge 13 . this motion is translated to the needle carrier 3 by means of the driving track 9 . the needle carrier 3 travels through the carrier aperture 16 and along sliding track 18 , captured by carrier track slot 31 , until the circular driving track 9 axis becomes coincident with the axis of the living hinge 13 . at this point the actuator pin 11 travels concentric to the circular driving track 9 and further lateral movement of the needle carrier 3 is stopped . at this point , as seen in fig1 a , the needle carrier 3 has pushed needle 20 through membrane 8 in the capsule closure 6 allowing medication to flow through to hypodermic needle 12 . also , carrier retainer ring 17 has permanently snapped into carrier locking notch 23 and carrier luer seal body 19 on the needle carrier 3 has seated into capsule luer seal cavity 24 to form a luer seal . in the injection phase , further folding of the applicator plunger towards the applicator holding body 1 as shown in fig7 and 8 causes the plunger 15 to contact the vessel 4 . the vessel 4 is made from a pliable elastomer and is collapsed by the plunger 15 which is shaped to substantially conform to the vessel . the vessel collapses , reducing the volume of the inner cavity 22 thereby pushing the contents of the vessel through hypodermic needle 12 . referring now to fig1 – 16 , storage of the needle is shown after injecting the medication . the needle 12 is stowed in a safe position inside plunger 15 by folding the applicator body 2 180 ° allowing the hypodermic needle 12 to pass through the carrier aperture 16 and into the safety slot 27 . continuing to fold causes the hypodermic needle 12 to be sprung to one side by deflecting surface 33 and then captured by snapping back to its normal position in the top of the safety slot 27 . the foregoing description of the invention has been directed to a particular preferred embodiment of the present invention for the purposes of explanation and illustration . it will be apparent to those skilled in the art that many modifications and changes in the apparatus may be made without departing from the scope and spirit of the invention . it is therefore intended that the following claims cover all equivalent modifications and variations as fall within the scope of the invention as defined by the claims .	0
many of the functional units described in this specification have been labeled as modules , in order to more particularly emphasize their implementation independence . for example , a module may be implemented as a hardware circuit comprising custom vlsi circuits or gate arrays , off - the - shelf semiconductors such as logic chips , transistors , or other discrete components . a module may also be implemented in programmable hardware devices such as field programmable gate arrays , programmable array logic , programmable logic devices , or the like . modules may also be implemented in software for execution by various types of processors . an identified module of executable code may , for instance , comprise one or more physical or logical blocks of computer instructions which may , for instance , be organized as an object , procedure , or function . nevertheless , the executables of an identified module need not be physically located together , but may comprise disparate instructions stored in different locations which , when joined logically together , comprise the module and achieve the stated purpose for the module . indeed , a module of executable code could be a single instruction , or many instructions , and may even be distributed over several different code segments , among different programs , and across several memory devices . similarly , operational data may be identified and illustrated herein within modules , and may be embodied in any suitable form and organized within any suitable type of data structure . the operational data may be collected as a single data set , or may be distributed over different locations including over different storage devices , and may exist , at least partially , merely as electronic signals on a system or network . fig1 illustrates a schematic block diagram of one embodiment of a representative virtual tape system 100 in accordance with the present invention . the system 100 includes an automated library unit 102 , at least one virtual tape server 104 , and at least one host 106 . each host 106 may be a mainframe computer . alternatively , the host 106 may be a server or personal computer using a variety of operating systems . the host 106 and the virtual tape server 104 are connected via a storage area network ( san ) 108 or similar communications channel . the communications channel 108 in one embodiment may be a ficon or escon . the automated tape library unit 102 includes a library manager 110 , one or more data drive devices , which may be tape drive units 112 , an accessor 114 , and a plurality of media cartridges 116 . the plurality of media cartridges 116 may be stored in one or more media cartridge storage bins ( not identified ). the library manager 110 , which includes at least one computing processor ( not shown ), is interconnected with , and controls the actions of , the tape drive units 112 and the accessor 114 . the library manager 110 typically also includes one or more hard disk drives ( not shown ) for memory storage , as well as , a control panel or keyboard ( not shown ) to provide user input . the control panel may be a computer in communication with the library manager 110 so that a user can control the operating parameters of the automated tape library unit 102 independently of the host 106 . in fig1 , three tape drive units 112 a , 112 b , and 112 c are shown . the present invention is operable with one or any larger number of tape drive units 112 . the tape drive units 112 may share one single repository of cartridges 116 . alternatively , the tape drive units 112 may independently correspond to and utilize multiple repositories of cartridges 116 . the tape drive units 112 may advantageously be distributed over multiple locations to decrease the probability that multiple tape drive units 112 will be incapacitated by a disaster in one location . the interconnections between the library manager 110 , the tape drive units 112 , and the accessor 114 are shown as dashed lines to indicate that the library manager 110 transmits and receives control signals , rather than data to be stored or retrieved , to the tape drive units 112 and / or the accessor 114 . data for storage or retrieval may instead be transmitted directly between the virtual tape server 104 and the tape drive units 112 via a network 118 , which may be a storage area network ( san ), a local area network ( lan ), a wide area network ( wan ), or a different type of network , such as the internet or a direct connection between the virtual tape server 104 and the tape drive devices 112 . the accessor 114 may be a robotic arm or other mechanical device configured to transport a selected cartridge 116 between a storage bin and a tape drive unit 112 . the accessor 114 typically includes a cartridge gripper and a bar code scanner ( not shown ), or similar read system , mounted on the gripper . the bar code scanner is used to read a volume serial number ( volser ) printed on a cartridge label affixed to the cartridge 112 . in alternative embodiments , the tape drive units 112 may be replaced by optical disk drives or other magnetic drives . similarly , the cartridges 116 may contain magnetic media , optical media , or any other removable media corresponding to the type of drive employed . fig2 illustrates a schematic block diagram depicting one embodiment of the virtual tape server 104 of fig1 . the virtual tape server 104 may take the form of a computer with a bus , processor , memory , and the like . these elements have been omitted from fig2 to more clearly depict the various executable modules and data blocks of the virtual tape server 104 . as shown , the virtual tape server 104 includes a file system manager 202 , a hierarchical storage manager 204 , a storage manager server 206 , an automated storage manager administrator 208 , and at least one direct access storage device ( dasd ) cache 210 . the dasd cache 210 may take the form of one or more virtual tape drives to contain data in the form of a logical , or virtual , volume 212 . the dasd cache 210 may also be the location where a database 214 for the storage manager server 206 is stored . other executable modules and data blocks may also be present on the dasd cache 210 , but are omitted to focus on the present invention . the file system manager 202 handles the actual dasd 210 read and write commands from the host 106 , in one embodiment , via the hierarchical storage manager 204 . the storage manager server 206 controls the interface communications between the dasd 210 and the drive devices 112 . the storage manager server 206 is controlled by the automated storage manager administrator 208 . the automated storage manager administrator 208 monitors and directs the operation of the file system manager 202 , the hierarchical storage manager 204 , and the storage manager server 206 , and communicates control information to and from the library manager 110 . the dasd cache 210 is used to hold a plurality of logical , or virtual , volumes 212 from the physical volumes , or memory cartridges 116 . a read or write command from the host 106 is processed by the virtual tape server 104 via the dasd 210 prior to transferring the updated logical volume 212 from the dasd cache 210 to the physical volume 116 . the transfer of the updated logical volume 212 from the dasd cache 210 to a physical volume 116 may occur in a variety of ways . in one embodiment , the logical volume 212 resident on the dasd cache 210 may be the only copy of that logical volume 212 . at a time determined by the virtual tape server 104 , the logical volume 212 maybe premigrated to a physical volume 116 . such volume premigration provides for the virtual tape system 104 to make a copy of the logical volume 212 resident on the dasd cache 210 and store it on a physical volume 116 . the principal copy of the logical volume 212 remains on the dasd cache 210 for potential accesses by the host 106 . if the host 106 does not access the logical volume 212 on the dasd cache 210 within a certain time frame , the virtual tape server 104 may decide to complete the migration of the logical volume 212 to the physical volume 116 . in this instance , the virtual tape server 104 insures that the copy on the physical volume 116 is the most recent , or active , data and removes the logical volume 212 from the dasd cache 210 to provide memory for other data as required . the virtual tape server 104 illustrated also includes a read - only recovery module 216 that is configured to recover a selective dual copy of a logical volume that is on a read - only physical volume . referring to fig3 , a schematic block diagram illustrates one embodiment of a read - only recovery module 302 given by way of example of a read - only recovery module 216 as shown in fig2 . the read - only recovery module 302 depicted includes an identification module 304 , a recall module 306 , and a reconciliation module 308 . the identification module 304 is configured to identify a logical volume 212 on physical volume 116 . in one embodiment , the identification module 304 may be further configured to identify the location of a selective dual copy of the logical volume 212 that is located on a separate and distinct physical volume 116 . the selective dual copy of the logical volume 212 may be referred to as a backup copy of the logical volume 212 . identification of these logical volumes 212 , their locations on respective physical volumes 116 , and attributes associated with each logical volume 212 provides the virtual tape server 104 with at least some of the information necessary to recall the selective dual copy of the logical volume 212 when the primary copy may become unavailable , either temporarily or permanently . the recall module 306 is configured to recall the selective dual copy of the logical volume 212 to the dasd cache 212 of the virtual tape server 104 when the primary logical volume 212 is on a read - only physical volume 116 that is inaccessible . a physical volume 116 may be placed in a read - only state when the vts system 100 is unable to access part or all of the information stored on the media cartridge 116 . such inaccessibility is very likely to be due to physical damage or wear on the cartridge 116 that may not be reparable . the vts system 100 may attempt to recover information from the primary physical volume 116 using multiple techniques commonly known in the preset art . among these techniques are switching media drives 112 , reverse - reading , and the like . following this attempted recovery , the read - only recover module 302 may , in one embodiment , employ the recall module 306 to recall the selective dual copy of any or all logical volumes 212 not presently recovered from the primary physical volume 116 . the reconciliation module 308 is employed by the read - only recovery module 302 following a successful recovery of at least one logical volume 212 or portion thereof . the reconciliation module 308 in one embodiment includes a stripping module 310 and a removal module 312 . the stripping module 310 is configured to remove active data dependencies from the read - only physical volume 116 following a successful recall of at least some of the data on the physical volume 116 . the removal module 312 is configured to remove reference to the physical volume 116 from which the data has been recovered from a data management software database of physical volume 116 . referring to fig4 , a schematic flowchart diagram depicts one embodiment of a logical volume access method 400 that may be employed by the vts system 100 . the method 400 starts 402 by querying 404 the storage manager server 106 within the virtual tape server 104 for a list of physical volumes 116 that are indicated as read - only . the method 400 continues with the selection of one of the read - only physical volumes 116 and further selection 406 of a logical volume stored on the selected physical volume 116 . the selected logical volume 212 may be identified by a corresponding volser that is unique to the logical volume 212 . having identified a target logical volume 212 that the virtual tape server 104 attempts to access , the virtual tape server 104 in one embodiment determines 408 if a copy of the identified logical volume 212 is resident on the dasd cache 210 . if a copy of the identified logical volume 212 is resident on the dasd cache 210 , the virtual tape server 104 determines 410 if the logical volume 212 on the dasd cache 210 is a premigrated copy . a copy of the logical volume 212 that is not premigrated is assumed to be active data ( the most recent copy of the logical volume ) and the method 400 ends 412 . a copy of the logical volume 212 that is a premigrated copy may be marked 414 as an active copy . alternately , it may be assumed that the premigrated copy of the logical volume 212 that resides on the dasd cache 210 is active data . in either case , the logical volume access method 400 ends 412 . if it is determined 408 that a copy of the target logical volume 212 is not resident on the dasd cache , the virtual tape server 104 attempts to access 416 a copy of the logical volume on the primary physical volume 116 that is indicated to be in a read - only state . if such access is determined 418 to be successful , for example if the logical volume 212 on the physical volume 116 is accessible , the virtual tape server recalls 420 the logical volume 212 or accessible portions thereof to the dasd cache 210 . any data recalled at this point is marked 422 as active data and the database 214 of the storage manager server 206 is reconciled 424 as discussed previously . the method 400 then ends 412 . if it is determined 418 that the logical volume 212 on the physical volume 116 is not accessible , the read - only recovery module 302 attempts to recover 426 the selective dual copy of the logical volume 212 . the method 400 then ends 412 . referring to fig5 , a schematic flowchart diagram depicts one embodiment of selective dual copy recovery method 500 given by way of example of a selective dual copy recovery step 426 of fig4 . the method 500 begins 502 as the recall module 306 of the recovery module 302 accesses 504 the selective dual copy of the logical volume 212 on the secondary physical volume 116 . after the recall module 306 accesses 504 the selective dual copy , the recovery module 302 determines 506 if the data in the selective dual copy is active data . if it is determined 506 that the selective dual copy does not contain active data , the selective dual copy recall and recovery fails 508 and the method 500 ends 510 . a selective dual copy of a logical volume 212 that does not contain active data is of no use to the host 106 because some or all of the information has been superceded by revised or new data . if it is determined 506 that the selective dual copy does contain active data , and is therefore the data requested by the host 106 , the recovery module 302 recalls 512 the selective dual copy of the logical volume 212 and stores it in the dasd cache 210 of the virtual tape server 104 . the recalled logical volume 212 now residing in the dasd cache 210 is marked 514 as active data ready to be accessed by the host 106 . at a time determined by the virtual tape server 104 , the logical volume 212 may be premigrated or migrated to at least one physical volume 116 , as described previously . in one embodiment , at a time determined by the virtual tape server 104 , the virtual tape server 104 reevaluates the constructs associated with the logical volume 212 to determine if the logical volume still requires a selective dual copy . the logical volume 212 is premigrated or migrated to at least one physical volume 116 , as described previously . in some implementations , if a selective dual copy is required , the logical volume 212 is premigrated or migrated to at least one other physical volume 116 , as described previously . once the selective dual copy of the logical volume 212 is recalled 512 and marked 514 as active data , in one embodiment , the database 214 of the storage manager server 206 is reconciled 516 in a manner similar to that of step 424 and the method 500 ends 510 . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .	6
according to the invention , butyrolactam alkoxylate ( bla ) of formula ( b ) and mixtures of formula b with compounds ( a ), and ( c ) to ( k ) generally reduce the level of deposits produced in bench prescreening tests for auto engine intake valve deposits ( ivd ) [ e . g ., see stride test ] and / or combustion chamber deposits ( ccd ) [ e . g ., see torid test ]. gasolines with bld additives of formula ( a ) give higher torid values than gasoline without bld . we have discovered that our compositions ( e . g ., bla + piba ) lower the level of bench test ivd deposits without increasing the level of bench test ccd deposits , even though each alone gives a higher or equivalent level of bench ccd deposits . we have found that mixtures of bla ( formula ( b )), with at least one of polyethers ( pe ) and polyisobutylene amine ( piba ) generally lower the level of bench test ivd deposits ( table 4 ) and generally improves ( above ) the level of bench test ccd deposits ( table 5 ). table 3 &# 39 ; s torid values show that gasolines with mixtures of these additives have lower ccd values than the gasoline alone and gasoline with piba alone . this is in contrast to results which show that piba and similar compounds in the absence of the polymeric butyrolactam alkoxylates increase the level of bench ccd deposits . we have also found that mixtures of bld with alkoxylates and / or piba generally lower the level of bench test ivd deposits and generally improves ( above ) the level of bench test ccd deposits . preferred compounds ( cmpd .) and mixtures of compounds ( e . g ., cmpd . a & amp ; d ) of this invention are shown below . n is an integer from 9 to 35 inclusive ( preferably 20 - 35 ) r 1 , r 2 , r 3 , and r 4 are independently selected from the group consisting of h , and c 1 - c 100 alkyl , or taken together with the two carbons between r 1 and r 2 , or r 3 and r 4 form an aliphatic ring of 5 - 8 carbon atoms ( preferably h and c 1 - c 80 alkyl , more preferably h and c 1 - c 10 alkyl , most preferably h and c 1 - c 3 alkyl ), e , f and g are integers from 0 to 50 inclusive ( preferably 1 - 35 , more preferably 20 - 35 ) wherein at least one of e , f and g are not 0 , r 5 and r 5 ′ are independently selected from the group consisting of h , ch 3 , and ch 2 ch 3 , y is an integer from 1 - 50 inclusive ( preferably 1 - 35 , more preferably 20 - 35 ), r 6 is h or c 1 - c 20 alkyl , and r 7 is c 1 - c 25 alkyl or cycloalkyl , preferably c 1 - c 4 linear or branched alkyl . alkyl groups may be branched or unbranched . branched alkyl groups are generally preferred . compound a can be used alone . compound b can be used alone . any combination of compounds a through k , inclusive can be used . preferred two component mixtures comprise : a & amp ; c , a & amp ; d , b & amp ; c , and b & amp ; d . preferred three component mixtures comprise : a & amp ; c & amp ; d , and b & amp ; c & amp ; d . the above compounds alone or in combination can also be mixed with propylene oxide and / or propylene glycol . these butyrolactam derivatives and mixtures are preferably employed at concentrations of 5 - 5 , 000 ppm , preferably 100 - 2 , 500 ppm , most preferably 100 - 1 , 000 ppm . additized gasoline mixtures preferably contain 0 . 0005 - 0 . 5 wt % additive in the gasoline with economically maximum levels of 1 wt % additive ( and additive by - products ) of the gasoline . the gasolines which may be additized either by blending or by separate injection of the additive directly into the gas tank or into the engine utilizing such gasolines , can be ordinary unleaded gasoline of any grade , containing other , typical gasoline additives ordinarily added to such gasolines , e . g ., other detergents , deicing additives , anti - knock additives , corrosion , wear , oxidation , anti - rust , etc ., additives known to the art . as is readily apparent and already known in the industry , however , the skilled practitioner will have to ensure compatibility between the additives employed . the gasoline can also be any of the currently fashionable reformulated gasolines , i . e ., those containing various oxygenated compounds such as ether ( mtbe , etbe , tame , etc .) or alcohols ( methanol , ethanol ) in various concentrations . preferred base fuels include unleaded gasoline , oxygenated unleaded gasoline , and petroleum hydrocarbons in the gasoline boiling range . examples of functionalized polymeric detergents include polyolefinic amines , polyolefinic ether amines , polyolefin oxides , alkyl pyrrolidones and their copolymers with olefins or dienes . the polymers employed are those which depolymerize at the conditions typically encountered in the engine combustion chamber , i . e ., about 400 ° c . preferred polyolefin amines include : polybutylene amine , polyisobutylene amine , polypropylene amine ( mw 800 - 2000 ). preferred polyetheramines include : polyethylene oxide amines , polypropylene oxide amines , polybutylene oxide amines , polyisobutylene oxide amines , and mixed polyolefinic oxide amines ( mw 800 - 2000 ). the additives described above can be added directly to the gasoline or separately injected into the fuel system of the engine . alternatively , the additives can be added to the lubricating oil and from that environment favorably affect ccd and ivd . the additives can also be encapsulated to overcome any odor , toxicity or corrosivity concerns which may arise with any one or group of additives within the aforesaid recitations . the compounds and mixtures shown in table 1 , as added to the gasoline , are the preferred embodiments of this invention . because the additives are usually not 100 % pure , mixtures of these compounds with smaller amounts of reaction products , contaminants , enantiomers , degradation products , and similar compounds are considered to be part of this invention . not only are monomers rarely pure , but polymerization almost never produces perfect polymers . this invention includes polymers based on the listed monomers , but incorporating a minority of polymer chain units that differ from the ideal units shown in the specification . for example , different atoms of the monomer can sometimes be used as polymer linkages . also , reaction products , contaminants , enantiomers , degradation products , and monomer by - products can be incorporated into the polymer . tables 2 and 4 contain data on the performance of the above additives in the stride test . this is a bench test for intake valve deposits . the ivd bench test apparatus ( called stride ) has been disclosed in u . s . pat . no . 5 , 492 , 005 , which is incorporated by reference . surrogate test related to intake deposit evaluation ( stride ) is a laboratory apparatus that can be used to study the effects of fuel composition , additives , and transport on intake valve deposit ( ivd ) formation . the apparatus uses a syringe pump to slowly deliver fuel to the horizontal end face of a small cylindrical nub where the deposit is formed and weighed . unlike other surrogate tests the cyclic temperature of intake valves in engines is simulated by cycling the nub temperature . in the stride test , deposits are formed on the end face of a metal nub . the nub is small ( 6 . 35 mm diameter by 17 . 5 mm long ). the shape of the nub face is a concave shallow cone . compared with flat or convex shapes the concave shape increases the amount of gasoline retained on the nub face . it also makes the deposit formation less sensitive to slight misalignments of the nub from vertical . initially nubs were fabricated from 410 stainless steel because of its similarity to bmw 325 engine intake valves , however the amount of stride deposit formed on aluminum and brass nubs was similar to the amount made on steel nubs . in a stride test the nub is forced inside the coils of a cable heater . a shielded thermocouple is inserted into the hole on the axis of the nub . the thermocouple tip is about 0 . 5 mm below the nub surface . the nub &# 39 ; s small mass , about 3 . 5 g , makes it possible to cycle its temperature during the stride test by controlling the electric power to the coiled cable heater . to assure that the increase in nub weight is due solely to the deposit , the thermocouple , cable heater , and nub are held together solely by friction . no cement or heat transfer compounds are used . a bell shaped glass shield surrounds the nub and cable heater . the glass shield prevents turbulence within the fume hood from disturbing the delivery of gasoline and from affecting the nub temperature . it carries a blanketing flow of air that is filtered through molecular sieves and a drier . other atmospheres could be supplied , such as inert gas , simulated engine exhaust , or blow - by gas . the nub temperature is programmable . the maximum heating rate is 100 ° c ./ min ; the maximum cooling rate is 50 ° c ./ min ; and the operating range is from room temperature to 400 ° c . during initial construction , the nub surface temperature was measured by a thermocouple spot - welded to the nub face . the surface temperature was found to be less than the control thermocouple temperature . typically , with the control thermocouple temperature at 300 ° c ., the surface temperature is 270 ° c . except in the film boiling regime described below , each drop impact , which occurs about once every 3 seconds , temporarily decreases the surface temperature an additional 20 ° c . until the drop has completely vaporized . temperatures mentioned in this paper are the control thermocouple temperature , not surface temperature . gasoline is delivered to the nub face through a hypodermic needle attached to a syringe pump . the flow rates are usually constant during a test , between 1 . 5 ml / h and 40 ml / h . ( if desired , by wiring the syringe pump power through the alarm relays on the temperature controller , the fuel delivery can be stopped at nub temperatures greater than the high - alarm temperature setting or less than the low - alarm temperature setting .) the fuel supply needle is usually pressed into contact with the center of the nub face . for low flow rates ( about 1 . 5 ml / h ) or when making deposits from heavier liquids such as lubricants or diesel fuel , the needle is raised about 1 mm above the surface allowing drops to fall freely onto the nub face . raising the needle prevents deposit from accumulating on the needle tip . special procedures were necessary for weighing the stride deposit . the amount of stride deposit is typically less than one milligram . therefore , the nubs are weighed on a five - place balance ( 0 . 00001 g displayed resolution ). to improve the repeatability of the determination of the deposit mass the nub is weighed five consecutive times before and five consecutive times after each stride test . the five nub weights are then averaged to get a final nub weight . the procedure for weighing nubs is further complicated because the unloaded balance seldom returns to exactly zero tare after each weighing . so , the residual tare ( usually within ± 0 . 05 mg of zero ) is subtracted from the indicated nub weight after each of the five weighings . this procedure of subtracting the residual tare after each weighing decreases the variance and was recommended by the balance manufacturer . for the above procedure , ninety - four weighings of the same unused nub over a period of a year gave a standard deviation of 0 . 029 mg , in good agreement with the advertised standard deviation of 0 . 03 mg . the invention is further illustrated by the following non - limiting examples and comparison . in the preferred stride test , gasoline is delivered at a rate of 10 ml / hour to a 0 . 3 cm 2 stainless steel nub surface ( e . g ., a stride nub ). the surface temperature is cycled from 150 to 300 ° c . over 8 minutes . the test length is 4 hours . additives that reduce ivd in ic engines give low levels of stride deposits relative to base fuel . the results in tables 2 and 4 are reported on a relative basis as % reduction (−) or increase (+) over the base fuel deposits . table 2 shows that compounds b ( 1 ) to b ( 10 ) reduce the level of stride deposits . table 2 and 4 shows that compound d ( piba ), and compounds c & amp ; d ( piba + pe ) substantially lower the level of stride deposits . the stride test compared to an engine test is shown in fig1 . the stride procedure successfully emulates ivd from a honda es6500 generator set . the honda generator &# 39 ; s engine is a two cylinder carbureted gasoline engine of 360 ml displacement . for non - additized base gasolines and base gasolines containing commercial additive packages ( a ) and ( b ), ivd was measured after operating the generator at 2 . 4 kw and 3000 rev / min for 20 h . fig1 shows the percentage below base gasoline &# 39 ; s stride deposit for commercial additive packages ( a ) and ( b ) together with the percentage below the base gasoline &# 39 ; s ivd from the honda generator . both commercial additive package ( a ) and ( b ) significantly reduce the level of deposits below base fuel levels in both the stride and honda generator engine test . in another example , bla lowers base deposits levels associated with ccd . additives were tested for their propensity to produce ccd or lower base gasoline ccd levels using the torid - asd ( additive severity diagram ) bench test . the generic ccd bench test apparatus ( called torid ) has been partially disclosed in u . s . patent application ser . no . 021 , 478 , filed feb . 10 , 1998 , which is incorporated by reference . the torid - asd test involves placing several mg of a sample onto a sample holder surface . the sample is prepared from a mixture of the candidate additive and ccd precursors ( toluene soluble ccd from a 1993 trc fleet test ). the sample is held at constant temperature for one hour while it is exposed to a pulsing hexane flame . the concentration of base gasoline ccd precursors and surface temperatures are chosen to be close to those that exist on the walls of a combustion chamber . 2 mg of the additive is combined with 2 mg of soluble ccd deposit precursors . the ccd precursors are the toluene soluble fraction of homogenized ccd collected from a ten car fleet test for ccd ( sae paper # 972836 ). the 4 mg mixture of additive and ccd precursor is placed on a stainless steel nub surface and held at a constant temperature for one hour while hexane is delivered into a surrounding chamber and ignited with a glow coil every 0 . 5 sec to simulate the combustion chamber flame . the weight of the deposit formed on the nub surface reflects the deposit forming tendency . torid - asd results at 300 ° c . are associated with deposit forming tendency at higher mileage . table 3 contains the torid - asd performance on the base ccd deposit precursors . at 300 ° c . compound d ( piba ) and mixture c & amp ; d ( pe & amp ; piba ) increase the level of deposits . at 300 ° c . compounds b ( 1 ), b ( 2 ), b ( 5 ), b ( 6 ), b ( 7 ), b ( 8 ), b ( 9 ), and b ( 10 ) lower the level of deposits . the torid - asd test compared to an engine test is shown in fig2 . commercial additive packages ( a ) and ( b ) were tested at 300 ° c . in torid - asd and referenced to the deposits produced from 2 mg . of soluble ccd deposit precursors from base gasoline . the torid - asd procedure successfully emulates ccd from a honda es6500 generator set . the honda generator &# 39 ; s engine is a two cylinder carbureted gasoline engine of 360 ml displacement . for non - additized base gasolines and base gasolines containing commercial additive packages ( a ) and ( b ), ccd was measured after operating the generator at 2 . 4 kw and 3000 rev / min for 20 h . fig2 shows the percentage above base gasoline &# 39 ; s ccd for commercial additive packages ( a ) and ( b ). commercial additive package ( a ) significantly increases the level of deposits over base fuel levels in both the torid - asd and honda generator engine tests . commercial additive package ( b ) resulted in only slightly elevated level of deposits over base fuel levels in both the torid - asd and honda generator engine tests . table 4 shows that compound d ( piba ), and mixture c & amp ; d ( pe + piba ) substantially lower the level of stride deposits . table 4 shows that bla + piba , all bla + piba + pe mixtures , and mixtures of c & amp ; f and c & amp ; k listed substantially lower the level of stride deposits . in another example , mixtures of bla with piba and piba + pe lower deposits levels associated with ccd relative to piba alone . table 5 contains the torid - asd performance on the base ccd deposit precursors and mixtures of bla with piba and mixtures of bla with piba and pe . for reference , table 5 also shows the performance of piba and pe . below base deposit levels are found at 300 ° c . for bla + piba + pe additives cmpd . b ( 4 )& amp ; c & amp ; d , cmpd . b ( 5 )& amp ; c & amp ; d , and cmpd . b ( 11 )& amp ; c & amp ; d and bla + piba additive cmpd b ( 6 )& amp ; d . above base deposit levels are found for cmpd . d ( piba ). while the mixtures cmpd . b ( 4 )& amp ; d and cmpd . b ( 6 )& amp ; d ( dld + piba ) are above base at 300 ° c . there is substantially less deposits than would be expected based on their individual behavior . the synergistic relationship of mixtures is shown in table 6 . [ 0046 ] table 6 observed predicted torid - asd torid - asd deposit deposit gasoline additive mg at 300 ° c . mg at 300 ° c . 2 mg base + 2 mg cmpd . b ( 4 ) & amp ; d 0 . 64 0 . 80 2 mg base + 2 mg cmpd . b ( 6 ) & amp ; d 0 . 52 0 . 79 in another example , mixtures of bla compound b with compounds a , c , and / or k lower base deposits levels associated with ccd . additives are tested for their propensity to produce ccd or lower base gasoline ccd levels using the torid - asd ( additive severity diagram ) bench test as in example 2 . torid - asd results at 300 ° c . are associated with deposit forming tendency at higher mileage . mixtures of compound b with compounds c , f , i , or k are also tested with and without compound d ( piba ). in another example , mixtures of bld compounds a , g , and i with compounds g , h , and / or j lower base deposits levels associated with ccd . additives are tested for their propensity to produce ccd or lower base gasoline ccd levels using the torid - asd ( additive severity diagram ) bench test as in example 2 . torid - asd results at 300 ° c . are associated with deposit forming tendency at higher mileage . mixtures of compound b with compounds c , f , i , or k are also tested with and without compound d ( piba ). in another example , mixtures of compounds c through k lower base deposits levels associated with ccd . additives are tested for their propensity to produce ccd or lower base gasoline ccd levels using the torid - asd ( additive severity diagram ) bench test as in example 2 . torid - asd results at 300 ° c . are associated with deposit forming tendency at higher mileage . compound c , e , f , g , h , i and k individually and in mixtures with each other are also tested with and without compound d ( piba ).	2
the makers of this invention propose that survival of pps derived cardiomyocyte grafts can be improved by suppressing danger signals that typically triggers the process of rejection . in particular , it is a theory of this invention that uric acid and other factors made by graft cells that do not survive the transplant exacerbate a rejection response . this can stimulate inflammatory or immune meditated tissue destruction , causing the lysis of more cells — leading to a snowball effect that may prevent any of the engrafted cells from surviving . this disclosure shows how decreasing the amount of uric acid in or around the engrafted tissue can improve graft survival . decrease in the concentration of uric acid can be effected by inhibiting the transplanted cells from producing it , or by providing a mechanism ( in the transplanted cells , or the host , or both ) that enables the uric acid to be removed more quickly . uric acid accumulation from transplanted cells can be decreased either by pretreating the cells with allopurinol which inhibits xanthine oxidase , by pretreating the intended recipient with allopurinol or uricase ( which diminishes endogenous uric acid ), or by pretreating both the cells and the recipient in this way . this in turn prevents exacerbation of the rejection response directed against the engrafted tissue , which improves survival and leads to extended function of the graft . decreasing the amount of uric acid present can be combined with a treatment that diminishes the extent of apoptosis in the graft . for example , heat shock , culturing with erythropoietin , pretreatment with anti - inflammatory agents , or a combination of these manipulations can greatly enhance survival of engrafted pps derived cells . by treating the cells both to decrease apoptosis and limit uric acid production , the number of cells that initially survive the transplant is increased , and the immune effects of the non - surviving cells is minimized . prototype “ primate pluripotent stem cells ” ( pps cells ) are pluripotent cells derived from pre - embryonic , embryonic , or fetal tissue at any time after fertilization , and have the characteristic of being capable under appropriate conditions of producing progeny of several different cell types that are derivatives of all of the three germinal layers ( endoderm , mesoderm , and ectoderm ), according to a standard art - accepted test , such as the ability to form a teratoma in 8 - 12 week old scid mice . the term includes both established lines of stem cells of various kinds , and cells obtained from primary tissue that are pluripotent in the manner described . pps cell cultures are described as “ undifferentiated ” when a substantial proportion of stem cells and their derivatives in the population display morphological characteristics of undifferentiated cells , clearly distinguishing them from differentiated cells of embryo or adult origin . cell populations described as over 75 %, 90 %, or 98 % homogeneous for cells of one tissue type contain cells that are typical of that organ or tissue type as a stated minimum percentage . it is recognized that cell populations either in vivo or in tissue culture vary someone in phenotype , comprising cells bearing different markers and having different functions . for example , skin may contain epithelial cells , fibroblasts , and endothelial cells . nevertheless , if taken from a single tissue , the population will typically still be homogeneous according to this definition . the term “ uric acid ” means not only the acid form of the compound ( c 5 h 4 n 4 o 3 ), but also the conjugate base , salts thereof , and any chemically equivalent form that may be present in a biological environment such as an allograft transplant site . general methods in cell biology , protein chemistry , and antibody techniques can be found in current protocols in protein science ( j . e . colligan et al . eds ., wiley & amp ; sons ); current protocols in cell biology ( j . s . bonifacino et al ., wiley & amp ; sons ) and current protocols in immunology ( j . e . colligan et al . eds ., wiley & amp ; sons .). reagents , cloning vectors , and kits for genetic manipulation referred to in this disclosure are available from commercial vendors such as biorad , stratagene , invitrogen , clontech , and sigma - aldrich co . cell culture methods are described generally in the current edition of culture of animal cells : a manual of basic technique ( r . i . freshney ed ., wiley & amp ; sons ); general techniques of cell culture ( m . a . harrison & amp ; i . f . rae , cambridge univ . press ), and embryonic stem cells : methods and protocols ( k . turksen ed ., humana press ). tissue culture supplies and reagents are available from commercial vendors such as gibco / brl , nalgene - nunc international , sigma chemical co ., and icn biomedicals . other references include allopurinol : a medical dictionary , bibliography , and annotated research guide ( icon health publications ), and how do you solve a problem like urea ( r . rogers & amp ; o . hammerstein ii , rca ). this invention can be practiced using stem cells of various types . particularly suitable for use in this invention are primate pluripotent stem ( pps ) cells derived from tissue formed after gestation , such as a blastocyst , or fetal or embryonic tissue taken any time during gestation . non - limiting examples are primary cultures or established lines of embryonic stem cells or embryonic germ cells , as described below . the techniques of this invention can also be implemented directly with primary tissue , deriving differentiated cells such as neural cells directly from early embryonic cells without first establishing an undifferentiated cell line , or harvesting committed progenitors from neural tissue or other samples obtained from fetal or adult material . embryonic stem cells can be isolated from blastocysts of primate species ( u . s . pat . no . 5 , 843 , 780 ; thomson et al ., proc . natl . acad . sci . usa 92 : 7844 , 1995 ). human embryonic stem ( hes ) cells can be prepared from human blastocyst cells using the techniques described by thomson et al . ( u . s . pat . no . 6 , 200 , 806 ; science 282 : 1145 , 1998 ; curr . top . dev . biol . 38 : 133 ff ., 1998 ) and reubinoff et al , nature biotech . 18 : 399 , 2000 . equivalent cell types to hes cells include their pluripotent derivatives , such as primitive ectoderm - like ( epl ) cells , outlined in wo 01 / 51610 ( bresagen ). hes cells can be obtained from human preimplantation embryos ( thomson et al ., science 282 : 1145 , 1998 ). alternatively , in vitro fertilized ( ivf ) embryos can be used , or one - cell human embryos can be expanded to the blastocyst stage ( bongso et al ., hum reprod 4 : 706 , 1989 ). the zona pellucida of the blastocyst is removed , and the inner cell masses are isolated . the intact inner cell mass can be plated on mef feeder layers , and after 9 to 15 days , inner cell mass derived outgrowths are dissociated into clumps , and replated . es - like morphology is characterized as compact colonies with apparently high nucleus to cytoplasm ratio and prominent nucleoli . resulting es cells are then routinely split every 1 - 2 weeks . hps cells can be propagated continuously in culture , using culture conditions that promote proliferation while inhibiting differentiation . traditionally , es cells are cultured on a layer of feeder cells , typically fibroblasts derived from embryonic or fetal tissue ( thomson et al ., science 282 : 1145 , 1998 ). scientists at geron have discovered that hps cells can be maintained in an undifferentiated state even without feeder cells . the environment for feeder - free cultures includes a suitable culture substrate , such as matrigel ® or laminin . the cultures are supported by a nutrient medium containing factors that promote proliferation of the cells without differentiation ( wo 99 / 20741 ). such factors may be introduced into the medium by culturing the medium with cells secreting such factors , such as irradiated primary mouse embryonic fibroblasts , telomerized mouse fibroblasts , or fibroblast - like cells derived from hps cells ( u . s . pat . no . 6 , 642 , 048 ). medium can be conditioned by plating the feeders in a serum free medium such as knock - out dmem ( gibco ), supplemented with 20 % serum replacement ( u . s . 2002 / 0076747 a1 , life technologies inc .) and 4 ng / ml bfgf . medium that has been conditioned for 1 - 2 days is supplemented with further bfgf , and used to support hps cell culture for 1 - 2 days ( wo 01 / 51616 ; xu et al ., nat . biotechnol . 19 : 971 , 2001 ). alternatively , fresh non - conditioned medium can be used , if supplemented with added factors ( like a fibroblast growth factor or forskolin ) that promote proliferation of the cells in an undifferentiated form . exemplary is a base medium like x - vivo ™ 10 ( biowhittaker ) or obsf ™- 60 ( quality biological inc . ), supplemented with bfgf at 40 - 80 ng / ml , and optionally containing stem cell factor ( 15 ng / ml ), or flt3 ligand ( 75 ng / ml ). these medium formulations have the advantage of supporting cell growth at 2 - 3 times the rate in other culture systems ( wo 03 / 020920 ). under the microscope , es cells appear with high nuclear / cytoplasmic ratios , prominent nucleoli , and compact colony formation with poorly discernable cell junctions . primate es cells typically express the stage - specific embryonic antigens ( ssea ) 3 and 4 , and markers detectable using antibodies designated tra - 1 - 60 and tra - 1 - 81 . undifferentiated hes cells also typically express the transcription factor oct - 3 / 4 , cripto , gastrin - releasing peptide ( grp ) receptor , podocalyxin - like protein ( podxl ), and human telomerase reverse transcriptase ( htert ), as detected by rt - pcr ( us 2003 / 0224411 a1 ). the illustrations provided in the example section ensue from work done with human embryonic stem cells . however , except where otherwise specified , the invention can be practiced using multipotent cells of any vertebrate species , including pluripotent stem cells from humans ; non - human primates , and other non - human mammals . by no means does the practice of this invention require that a human blastocyst be disaggregated in order to produce the hps or embryonic stem cells for practice of this invention . hes cells can be obtained from established lines obtainable from public depositories ( for example , the wicell research institute , madison wis . u . s . a ., or the american type culture collection , manassas va ., u . s . a .). human embryonic germ ( heg ) cells can be prepared from primordial germ cells as described in shamblott et al ., proc . natl . acad . sci . u . s . a . 95 : 13726 , 1998 and u . s . pat . no . 6 , 090 , 622 . u . s . patent publication 2003 / 0113910 a1 reports pluripotent stem cells derived without the use of embryos or fetal tissue . it may also be possible to reprogram other progenitor cells into hps cells by using a factor that induces the pluripotent phenotype ( chambers et al ., cell 113 : 643 , 2003 ; mitsui et al ., cell 113 : 631 , 2003 ). under appropriate conditions , any cell with appropriate proliferative and differentiation capacities can be used for the derivation of differentiated tissues for use according to this invention . differentiated cell preparations for use in transplantation can be made from pps cells according to established methods . by way of illustration , neural cells can be generated from pps cells according to the method described in international patent publication wo 01 / 88104 and wo 03 / 000868 ( geron corporation ). undifferentiated pps cells or embryoid body cells are cultured in a medium containing one or more neurotrophins and one or more mitogens , generating a cell population in which at least ˜ 60 % of the cells express a2b5 , polysialylated ncam , or nestin and which is capable of at least 20 doublings in culture . exemplary mitogens are egf , basic fgf , pdgf , and igf - 1 . exemplary neurotrophins are nt - 3 and bdnf . the proliferating cells can then be caused to undergo terminal differentiation by culturing with neurotrophins in the absence of mitogen . cell populations can be generated that contain a high proportion of cells staining for tyrosine hydroxylase , a characteristic of dopaminergic neurons . oligodendrocytes can be generated from pps cells by culturing them as cell aggregates , suspended in a medium containing a mitogen such as fgf , and oligodendrocyte differentiation factors such as triiodothyronine , selenium , and retinoic acid . the cells are then plated onto a solid surface , the retinoic acid is withdrawn , and the population is expanded . terminal differentiation can be effected by plating on poly - l - lysine , and removing all growth factors . populations can be obtained in which over 80 % of the cells are positive for oligodendrocyte markers ng2 proteoglycan , a2b5 , and pdgfrα , and negative for the neuronal marker neun . see pct publication wo 04 / 007696 ( keirstead ). hepatocytes can be generated from pps cells according to the method described in u . s . pat . no . 6 , 458 , 589 and pct publication wo 01 / 81549 ( geron corporation ). undifferentiated pps cells are cultured in the presence of an inhibitor of histone deacetylase . in an exemplary method , differentiation is initiated with 1 % dmso ( 4 days ), then 2 . 5 mm of the histone deacetylase inhibitor n - butyrate . the cells obtained can be matured by culturing 4 days in a hepatocyte culture medium containing n - butyrate , dmso , plus growth factors such as egf , hepatocyte growth factor , and tgf - α . other effective hepatocyte differentiation protocols are described in u . s . ser . no . 10 / 810 , 311 . cardiomyocytes or cardiomyocyte precursors can be generated from pps cells according to the method provided in wo 03 / 006950 . the cells are cultured in a growth environment comprising fetal calf serum or serum replacement , and optionally a cardiotrophic factor that affects dna - methylation , such as 5 - azacytidine . spontaneously contracting cells can then be separated from other cells in the population , by density centrifugation . further process steps can include culturing the cells so as to form cardiac bodies , removing single cells , and then dispersing and reforming the cardiac bodies in successive iterations , as described in u . s . ser . no . 10 / 805 , 099 . hematopoietic cells can be made by coculturing pps cells with murine bone marrow cells or yolk sac endothelial cells was used to generate cells with hematopoietic markers ( u . s . pat . no . 6 , 280 , 718 ). hematopoietic cells can also be made by culturing pps cells with hematogenic cytokines and a bone morphogenic protein , as described in u . s . 2003 / 0153082 a1 and wo 03 / 050251 . osteoblasts and their progenitors can be generated from pps cells according to the method described in wo 03 / 004605 . pps - derived mesenchymal cells are differentiated in a medium containing an osteogenic factor , such as bone morphogenic protein ( particularly bmp - 4 ), a ligand for a human tgf - β , receptor , or a ligand for a human vitamin d receptor . cells that secrete insulin or other pancreatic hormones can be generated by culturing pps cells or their derivatives in factors such as activin a , nicotinamide , and other factors listed in wo 03 / 050249 . chondrocytes or their progenitors can be generated by culturing pps cells in microaggregates with effective combinations of differentiation factors listed in wo 03 / 050250 . in principle , any transplanted cells or tissue at risk for rejection will benefit from the immunotolerance strategy described in this application . according to this invention , the allograft cells or the recipient subject , or both , are prepared for transplantation in such a way so as to decrease the production of uric acid , related compounds , and other factors that exacerbate inflammation , immune recognition or rejection of the transplanted tissue . improved survival of the allograft tissue can be accomplished by adapting the therapeutic cell population to decrease production of factors such as uric acid , or to increase the rate that uric acid is metabolized or removed , or both . xanthine oxidase which dying cells use to produce uric acid can be inhibited with compounds such as allopurinol , oxypurinol , and bof - 4272 ( kogler et al ., cardiovasc res . 59 : 582 , 2003 ; naito et al , biol pharm bull . 25 : 674 , 2002 ; shi et al ., nature 425 : 516 , 2003 ). pre - treatment of the cells with low levels of tungsten would deplete cellular levels of molybdenum , a necessary co - factor for xanthine oxidase ( suzuki et al ., proc . natl . acad . sci . usa 95 : 4754 , 1998 ), and may also reduce uric acid production . another way to reduce xanthine oxidase activity in the cells is to decrease the amount of xanthine oxidase mrna . transient inactivation just before administration can be accomplished by treating the cell with mrna antisense , ribozyme , or sirna that is complementary or specific for the xanthine oxidase gene sequence . longer - term activation can be accomplished by inactivating or modifying the gene encoding xanthine oxidase on one or both alleles , or by introducing a transgene encoding rna antisense , ribozyme , or sirna . the transgene can be placed under control of a promoter inducible with compounds such as tetracycline ( shockett et al ., proc . natl . acad . sci . usa 92 : 6522 , 1995 ; rossi et al ., molec . cell 6 : 723 , 2000 ) or heavy metals ( yan et al ., biochim . biophys . acta 1679 : 47 , 2004 ). in this way , the genetic alteration can be done at any stage , allowing xanthine oxidase to be down - regulated just before administration by combining the cells with the inducing compound . alternatively or in addition , the allograft tissues can be adapted by causing them to express an enzyme that degrades or causes sequestration of the exacerbating factor . for uric acid , suitable enzymes are uricase , and natural or recombinant forms of urate oxidase ( e . g ., rasburicase ™, fasturtec ™, elitek ™). a gene sequence encoding the enzyme ( or a catalytically active fragment thereof ) is used to transfect the cell , either at the stage of the undifferentiated pps cell , or subsequent to differentiation . the enzyme may be expressed within the cell , or exported so as to create a milieu free of uric acid near the transplant site . vectors such as lipofectamine conjugates and adenovirus can be used for transient expression , or vectors such as retrovirus , lentivirus , and adeno - associated virus can be used in situations where long - term expression by the cell and its progeny is more desirable . methods and reagents for producing genetically altered pps cells and their progeny are described in u . s . ser . no . 09 / 849 , 022 , which is hereby incorporated herein by reference . a further adaptation of the allograft cells before transplant can be done to minimize the extent of initial cell death , which otherwise provides the initial burst of uric acid production . one means of making the cells less subject to apoptosis is to activate akt kinase activity ( matsui et al ., circulation 104 : 330 , 2001 ). this can be done , for example , by culturing with growth factors such as erythropoietin ( epo ), insulin , and igf - 1 , and gp130 activators such as il - 6 , cardiotropin , il - 11 , and cntf . another way of activating atk kinase is by heat shock : raising the temperature of the cells by about 6 ° c . above normal culture temperatures for 15 min to 2 h at a suitable period ( say , 1 or 3 days ) prior to use for transplantation or preparation of the medicament . alternatively or in addition , the cells can be treated with a non - steroidal anti - inflammatory agent such as ibuprophen . the subject to receive the transplant can also be adapted to reduce exacerbating factors from accumulating in the milieu of the allograft . for uric acid , the subject can be treated locally or systemically with one or more of the aforementioned inhibitors of xanthine oxidase . they can also be treated locally or systemically with one or more of the enzymes and other substances that metabolize or sequester uric acid , such as uricase or urate oxidase . local treatment with a vector causing transient expression of uricase or urate oxidase is also contemplated , preceding , concurrently , or shortly following implantation of the allograft tissue . once the cells or the transplant subject , or both , have been adapted as described , the allograft can then be put in place by a suitable procedure for administration of cells to the target site . the use of the materials of this invention in accordance with standard surgical methods is the responsibility of the treating clinician . following treatment , patients are monitored for general health , survival of the allograft cells , and recovery of physiological function associated with the transplant tissue . the prepared cell population is typically supplied in the form of a pharmaceutical composition , comprising an isotonic excipient prepared under sufficiently sterile conditions for human administration . effective cell and medicine combinations can be packaged and distributed separately , or in separate containers in kit form , or ( for simultaneous administration to the same site ) they can be mixed together . this invention also includes reagent systems for the production of differentiated cells to be used with this invention . an example is a set or combination of cells that exist at any time during manufacture , distribution , or use of the differentiated cell populations , comprising any combination of two or more cell populations described in this disclosure , such as the differentiated cell population used for therapy , in combination with undifferentiated pps cells from which they were derived . for general principles in formulating cell compositions , the reader is referred to cell therapy : stem cell transplantation , gene therapy , and cellular immunotherapy ( g . morstyn & amp ; w . sheridan eds ., cambridge university press , 1996 ). compositions and combinations intended for pharmacological distribution and use are optionally packaged with written instructions for a desired purpose , such as the regeneration of tissue function , genetic therapy , or induction of immune tolerance . the example that follows is provided by way of further illustration , and is not meant to limit the claimed invention . experiments conducted elsewhere have shown that the vast majority of engrafted cardiomyocytes derived from neonatal or adult animals , die within 1 - 7 days after transplant into the hearts of recipient animals . a significant fraction of cell death is attributed to apoptosis , and the inclusion of a heat shock treatment to the cells before transplant confers significant protection from apoptosis ( zhang et al ., j mol cell cardiol . 33 : 907 , 2001 ). under some conditions , when hes - derived cardiomyocytes are transplanted into the hearts of acutely infarcted scid / bg mice , only a small percentage of cells survive . the makers of this invention have discovered that cardiac improvement upon grafting with hes derived cardiomyocytes ( measured by echocardiography ) is considerably enhanced when the grafts are pre - treated with erythropoietin , ibuprophen , allopurinol , or a combination of these agents , followed by transplantation into animals optionally pre - conditioned with allopurinol and uricase . cardiomyocytes were differentiated from human embryonic stem ( hes ) cells and purified by density gradient centrifugation on percoll ™, according to established methods ( wo 03 / 006950 ). they were adapted to decrease uric acid production upon engraftment by culturing for 24 hours in standard differentiation medium ( containing 20 % fbs ) to which had been added 50 μg / ml allopurinol , or 0 . 5 units / ml human recombinant erythropoietin ( epo ). alternatively , the cells were heat shocked in standard differentiation medium ( 20 % fbs ) by incubating at 43 ° c . for 45 minutes , and then transferring to a 37 ° c . incubator 24 h prior to harvest . recipient mice were prepared to decrease uric acid production by the engrafted cells by daily injection of 800 μg allopurinol and / or 10 μg uricase intramuscularly for each of the 3 days before transplant . the transplant experiments were performed using a mouse model for coronary infarction in an external research laboratory under a research agreement with geron corporation . the left anterior descending artery was ligated as follows . mice were anesthetized in an isoflurane inhalation chamber and received intraperitoneal injection of ketanest / xylazine ( 50 mg / kg ). they were then intubated and ventilated for the entire surgical procedure . rectal temperature was maintained at 37 ° c . by a thermostatically regulated heating pad . one ligation with a 9 . 0 silk stitch was performed on the proximal 2 mm portion of the artery . a pale area demarcated on the surface of the left ventricle resulted in significant left ventricular ischemia encompassing the middle and apical portion of the ventricle . using a 25 g needle , 0 . 25 - 2 × 10 6 cells ( suspended in differentiation medium without serum ) were injected into the demarcated area . immediately afterwards , a chest tube ( 16 g angio - cath ) was inserted and the chest was closed in layers . ventilation was maintained until there was sufficient spontaneous breathing , and extubation followed . the ventricular diameter was measured after three weeks by echocardiography . fractional shortening ( a measure of ventricular diameter )≡[( diameter at diastole minus diameter at systole )÷( diameter at diastole )]. results are shown in table 1 . reduction of uric acid by adapting the cardiomyocytes or recipient animals with allopurinol correlates with an increased functional improvement ( 24 %) compared with the control ( 13 %), or animals transplanted with cardiomyocytes without any adaptation ( 19 %). this is consistent with improved acceptance of the transplanted cells by the host , due to decreased uric acid production leading to a less severe rejection response . pretreating the cells with epo or heat shock also correlated with improved function . epo protects cells in both the brain and the heart from ischemia - induced death by activation of the akt kinase pathway , the same pathway that is activated in some cells by heat shock . the inventors hypothesize that the beneficial effects of epo shown in table 1 are due to its anti - apoptotic effects on the hes - derived cells . the lower fractional shortening observed after engraftment of heat shocked hes - derived grafts may be due to either less efficient induction of protective effects , or the fact that heat shock actually stimulates apoptosis in some cell types . the compositions and procedures described in this disclosure can be effectively modified by routine optimization without departing from the spirit of the invention embodied in the claims that follow .	2
fig3 depicts a wireless communication device 302 configured to receive power from its own transmissions , according to an embodiment . as shown , the wireless communication device 302 includes direct current ( dc ) power source ( s ) 306 that provide power to a modulator 310 , power amplifier ( s ) 312 , and components performing other functions of the wireless communication device transmitter ( tx ) 308 which may include a transmit processor having a time variant transmit carrier frequency or frequencies ( fc or fc ( s )). the wireless communication device 302 further includes ( optional ) regulators 314 , 316 , 318 that respectively provide correct voltage and / or current regulation to the components 308 , the modulator 310 , and the power amplifier ( s ) 312 . the modulator 310 may include a voltage controlled oscillator and phase lock loop to select a given transmit frequency from a range of possible transmit frequencies . the power amplifier 312 amplifies a power of a modulated signal output from the modulator 310 . the output of the power amplifier 312 ( also referred to herein as “ tx signal power ”) is transmitted through a transmit antenna 328 into free space . remote receiver antenna ( s ) 332 may then receive the radiated signal and process the received signal , thus allowing wireless communication of information between the wireless device 302 and the remote wireless device 340 . rf transmit ( tx ) signal power radiated by transmit antenna ( s ) 328 may be high in order to compensate for the distance from remote receiver antenna ( s ) 332 and to compensate for any signal power lost due to dc power signal ( s ) circuitry objects blocking the signal path . as is well known , rf signal power degrades by distance squared . for example , if transmit antenna ( s ) 328 transmit 1 - 2 watts of rf signal power , the remote receiver antenna ( s ) 332 might only receive a few uw of rf signal power . this low level of rf signal power is typically enough for functional wireless communication . as shown , the wireless communication device 302 includes an energy receiver 320 that includes an energy receiver ( erx ) antenna 330 and energy receiver circuitry element ( s ) 322 configured to receive a time variant communication signal and alternating current ( ac ) to dc converter ( s ) 324 configured to convert the received communication signal into dc power . that is , rf transmission signal power generated by the transmit antenna ( s ) 328 is received and converted into dc power which can provide electrical power to the wireless device 302 for operation and / or battery charging . the energy receiver 320 further includes a dc power management circuit 326 that can provide proper voltage levels of dc power to circuits ( or components ) within the wireless communication device 302 . as shown , the energy receiver antenna ( s ) 330 are placed within a short , fixed distance d short ( s ) from transmit antenna ( s ) 328 . because the distance between the transmit antenna ( s ) 328 and the energy receiver antenna ( s ) 330 is short , a substantial amount of transmission signal power can be received at the energy receiver antenna ( s ) 330 and converted for dc power use . one approach for receiving and converting such transmission signal power is described in u . s . pat . no . 8 , 416 , 721 , which is hereby incorporated by reference in its entirety . fig4 illustrates matched energy receiver antennas substantially covering the surface of a wireless communication device 400 , according to an embodiment . as shown in panel a , the wireless communication device 400 includes transmit antenna ( s ) 402 and one or more matched energy receiver antenna ( s ) 404 covering a surface of the wireless phone device 400 . illustratively , the frequency of the energy receiver antenna ( s ) 404 are deliberately matched to the transmission frequency of the wireless device &# 39 ; s 400 own transmit antenna ( s ) 402 . panel b illustrates a graph of the transmission signal power spectral envelope density versus frequency in the wireless communication device 400 having energy receiver antenna ( s ) 404 matching the frequency of transmit antenna ( s ) 402 . as shown , the frequency 401 of the energy receiver antenna is matched to the frequency center of the transmit antenna . the matching of the frequency of the energy receiver antenna ( s ) 404 to the transmission frequency of the transmit antenna ( s ) 402 permits the energy receiver antenna ( s ) 404 to most efficiently receive the transmission power radiated onto the surface of the wireless phone device 400 . in one embodiment , the surface of the wireless device 400 may be maximally covered by energy receiver antenna ( s ) 404 , except for areas needed for other critical functions , such as the screen , key pad , and transmit / receiver antennas . in another embodiment , energy receiver antenna ( s ) 404 may also be placed under the key pad , screen , etc . trial and error and / or antenna software simulation may be used to determine the spacing needed between energy receiver antenna ( s ) 404 and transmit antenna ( s ) 402 to prevent interference to the transmission and receiving functions required by the wireless device 400 . more specifically , an effective distance between the energy receiver antenna ( s ) 404 and the transmit / receiver antenna ( s ) may be determined based on various optimization factors , such as maximizing the energy received , with the least amount of interference to the transmission , and placing the energy receiver antenna ( s ) at an effective distance to the transmit antenna ( s ) 404 . experience has shown that , in a particular embodiment , a 34 % power consumption reduction was achieved when the surface of a typical wireless device was covered with matched antenna ( s ), with the entire back surface and the left , right , and bottom sides covered with matched antenna ( s ) and only the keypad , screen and half an inch within the transmit / receiver antenna being left un - covered . further , no significant transmission / reception signal impairment was measured . fig5 illustrates mismatched energy receiver antennas substantially covering the surface of a wireless communication device 500 , according to an embodiment . as shown , the wireless communication device 500 includes antenna ( s ) for transmission of signals as well as energy receiver antenna ( s ) 504 configured to receive transmission power from the transmit antenna ( s ) 502 so that the transmission power can be converted to energy for use by the wireless communication device 500 . the energy receiver antenna ( s ) 504 are deliberately weakened so as to not efficiently receive the transmission power radiated by the transmit antenna 502 ( s ). a number of organic and non - organic materials such as human tissue , printed circuit boards , wireless device casing , are capable of absorbing radiated rf transmission power to varying degrees . for example , human tissue acts as an inefficient antenna which does not match a transmit antenna frequency center . in one embodiment , the energy receiver antenna ( s ) 504 may be constructed from such materials . in another embodiment , energy receiver antenna ( s ) 504 may be deliberately weakened by shifting the frequency center of the energy receiver antenna ( s ) 504 away from the frequency center of the transmit antenna ( s ) 502 by , e . g ., calibrating the energy receiver antenna ( s ) 504 to be mismatched with the transmit antenna ( s ) 502 . panel b illustrates a graph of the transmission signal power spectral envelope density versus frequency in the wireless communication device 500 having mismatched energy receiver antenna ( s ) 504 . this mismatching makes the energy receiver antenna ( s ) 504 less efficient at receiving the transmission power radiated onto the surface of the wireless device 500 . as a result , one or more mismatched energy receiver antenna ( s ) 504 may be placed next to the transmit / receiver antenna 502 , at a closer distance than matched energy receiver antennas could be placed , without affecting normal rf functions . because transmission rf power degrades by distance squared , less efficient energy receiver antennas placed closer to the transmit antenna ( s ) 502 may actually be equal to or more efficient than matched energy receiver antennas placed further away from the transmit antenna ( s ) 502 . illustratively , the wireless device 500 is maximally covered by the mismatched energy receiver antenna ( s ) 504 , except for regions needed for other critical functions , such as a key pad , display screen , and transmit / receiver antenna ( s ). in another embodiment , energy receiver antenna ( s ) may also be placed underneath the key pad and / or the display screen . if necessary to prevent interference to transmission / reception functions , the spacing between the energy receiver antenna ( s ) 504 and transmit / receiver antennas may be obtained by trial and error and / or antenna software simulation . experience has shown that in a particular embodiment , in which a wireless devices with non - matching transmit antennas having different communication standards / frequencies than energy receiver antennas were placed in close proximity to the energy receiver antennas , the energy receiver antennas still received non - matching transmission power which could be converted to dc power . in addition , no substantial transmission / reception signal power degradation was measured . fig6 illustrates combining matched and mismatched energy receiver antennas to substantially cover the surface of a wireless communication device 600 , according to an embodiment . as shown in panel a , the wireless communication device 600 includes two rows of mismatched , and deliberately less efficient , antenna ( s ) 604 placed close to the wireless device &# 39 ; s 600 transmit antenna ( s ) 602 . as discussed , the deliberately less efficient antenna ( s ) 604 may be , e . g ., made of materials capable of absorbing radiated rf transmission power but not interfering with transmission or reception of rf signals . the less efficient antenna ( s ) 604 may also have frequency center ( s ) that are mismatched with frequency center ( s ) of the transmit antenna ( s ) 602 . the wireless device 600 also includes rows of matched antennas 606 placed further away from the wireless device &# 39 ; s 600 transmit antenna ( s ) 602 than the mismatched antenna ( s ) 604 are placed . as discussed , the matched antenna ( s ) 606 can receive radiated transmission power more efficiently than the mismatched antennas 604 . panel b illustrates a graph of the transmission signal power spectral envelope density versus frequency in the wireless communication device 600 having both matched energy receiver antenna ( s ) 606 and mismatched energy receiver antenna ( s ) 604 . once again , to prevent interference to the transmission / reception functions of the wireless device 600 , the spacing needed between energy receiver antenna ( s ) 604 , 606 and transmit / receiver antenna ( s ) may be obtained by trial and error and / or antenna software simulation . by using both mismatched antennas 604 and matched antennas 606 , it is possible to maximize the space on the surface of the wireless device 600 on which energy receiver antennas are placed . fig7 depicts use of energy receiver antennas as electrical shields in a wireless communication device 700 , according to an embodiment . as shown , the wireless communication device 700 includes a transmit antenna 710 and electronic circuitry components 740 mounted on a substrate 730 . the transmit antenna 710 , electronic circuitry components 740 , and substrate 730 may be similar to the transmit antenna 110 , electronic circuitry components 140 , and substrate 130 of the wireless communication device 100 , discussed above . rather than the electrical signal shields 150 of the wireless communication device 100 , however , the wireless communication device 700 includes energy receiver antennas 750 . the energy receiver antenna ( s ) 750 may have any feasible shape , including the same shape as the electrical signal shields 150 . in addition to receiving radiated transmission power , the energy receiver antenna ( s ) 750 may also perform the same function as the electrical signal shields 150 , namely preventing internally generated electrical signals from radiating out and affecting the function of other devices and preventing externally generated electrical signals from radiating in to affect the function of the electronic circuitry components 740 . as a result , energy receiver antennas 750 may replace electrical signal shields which are grounded . replacing such electrical signal shields with energy receiver antennas 750 permits maximal use of available space for energy receiver antennas . advantageously , wireless devices disclosed herein include energy receiver antennas that receive the wireless devices &# 39 ; own transmission signals that are radiated onto the surfaces of the wireless devices . the received transmission signals are then converted to dc power that can be provided to various components of the wireless devices . doing so reduces power consumption by the wireless devices and extends battery life . while the forgoing is directed to embodiments of the present invention , other and further embodiments of the invention may be devised without departing from the basic scope thereof .	8
it has now been unexpectedly discovered that topically applied n - acetyl - d - glucosamine or n - acetylgalactosamine containing compositions exfoliate the skin . combinations of n - acetyl - d - glucosamine and n - acetylgalactosamine can also be used . these compositions which exfoliate the skin can also include chitin to enhance the process of exfoliation . it is known that amino sugars are capable of modulating the adhesion of keratinocytes , in vitro . it is disclosed by brysk , m . in “ glycoproteins modulate adhesion in terminally differentiated keratinocytes ,” that n - acetylglucosamine , n - acetylneuraminic acid and n - acetylgalactosamine are involved in the dissociation of aggregates of glycoproteins that bind corneocytes together . specifically , amino sugars are known to inhibit the reaggregation of corneocytes which have been dissociated into single squames by homogenization in ether . further , amino sugars in the form of n - acetylglucosamine have been used as an oral nutrient supplement in conjunction with other topical cosmetic products , such as for example , products offered by life - force , inc . which include n - acetyl - d - glucosamine in the form of a pill taken as a nutritional supplement . however , it is not suggested in the prior art to formulate a pharmaceutical or cosmetic composition for topical application to the skin using n - acetylglucosamine as an exfoliant . in fact , in wo97 / 12597 it is disclosed that when studied to determine its efficacy as a topical desquamating agent , n - acetyl - d - glucosamine was not found to be effective . the exfoliant in wo97 / 12597 is a compound comprising a chain of carbohydrates linked by a linking moiety to an alkyl or alkenyl chain . further , wo97 / 12597 , incorporated herein by reference , only includes n - acetyl - d - glucosamine as one of the units forming the carbohydrate portion which is linked by the linking moiety to the alkyl or alkenyl chain for desquamation of the skin . it is not disclosed in wo97 / 12597 that n - acetyl - d - glucosamine alone can exfoliate the skin . compositions for topical application containing n - acetyl - d - glucosamine have been disclosed for example , in jp 59013708 , wo 98 / 152576 , and u . s . pat . no . 5 , 866 , 142 , each incorporated herein by reference . to soften and moisturize the skin , a cosmetic containing an n - acetyl amino sugar is disclosed in jp 59013708 . a composition for alleviating itching and pain containing n - acetyl - d - glucosamine is disclosed in wo 98 / 52576 . in u . s . pat . no . 5 , 866 , 142 , a composition for exfoliating the skin has been disclosed , which includes n - acetyl - d - glucosamine . the presence of n - acetyl - d - glucosamine contributes to enhancing the amount of hyaluronic acid which the skin naturally produces in greater quantities in response to exfoliation , induced by other compounds such as histidine . however , no exfoliating activity is attributed to n - acetyl - d - glucosamine . a cosmetic composition containing n - acetylglucosamine and having good adhesion to the skin ( i . e ., does not lift off of the skin ) is disclosed in jp 8188526 . however , the prior art does not disclose the ability of glucosamine , and particularly , n - acetyl - d - glucosamine , to exfoliate the skin . the composition of the present invention contains an exfoliating - effective amount of n - acetyl - d - glucosamine , n - acetylgalactosamine , or a combination thereof . by the term “ exfoliating - effective amount ,” as used in the present specification , is meant an amount which is effective to cause exfoliation of the skin . the amount of n - acetyl - d - glucosamine , n - acetylgalactosamine , or a combination thereof , in the present invention will vary depending on the desired strength or intensity of exfoliation . the n - acetyl - d - glucosamine or n - acetylgalactosamine is present in the composition in an amount of about 0 . 01 to about 25 . 0 percent of the weight of the composition ; preferably 0 . 5 to about 10 . 0 percent , and more preferably about 1 . 0 to 5 . 0 percent of the weight of the composition . the n - acetyl - d - glucosamine or n - acetylgalactosamine per se is added directly to the cosmetic or pharmaceutical composition by admixing ; alternatively , extracts of materials containing substantial quantities of n - acetylglucosamine or n - acetylgalactosamine as a component can be used to provide the same concentration . these compositions can also contain chitin . the amounts of chitin in the composition are also present in exfoliating - effective amounts as previously described . the intensity of exfoliation can also be controlled by the frequency with which the compositions are applied to the skin and the compositions are applied periodically for a period of time sufficient to exfoliate the skin . accordingly , the compositions are applied to the skin for a period of at least 2 months , and preferably for at least 4 months , during which time the compositions are applied on a weekly basis . however , a preferred method of obtaining the benefits of the composition is via chronic topical application of the composition to exfoliate the skin . it is suggested , as an example , that “ chronic ” application be within a range of from about once per week to about 4 to 5 times weekly , preferably daily , most preferably twice daily . by “ chronic ” application , it is meant herein that the period of topical application may be over the lifetime of the user , preferably for a period of at least about 6 months to about 20 years , more preferably from about 1 year to about 10 years , and still more preferably from about 2 years to about 5 years , thereby resulting in regular desquamation , which may aid in reducing the appearance of fine lines and wrinkles due to chronological aging or photoaging . the method of the present invention may include applying in addition to the exfoliating effective amount of n - acetyl - d - glucosamine or n - acetylgalactosamine , other optional components , depending on the intended end use of the compositions . these include , but are not limited to , additional exfoliants , preservatives , fragrances , emollients , antiseptics , antiinflammatories , antibacterials , stabilizers , antioxidants , vitamins , pigments , dyes , humectants , and propellants , as well as other classes of materials the presence of which in the compositions may be cosmetically , medicinally , or otherwise desired . such components can be found in the ctfa international cosmetics ingredients dictionary . examples of additional exfoliants include but are not limited to chemical exfoliants such as ahas , for example , lactic acid , or bhas , for example , salicylic acid , or physical exfoliants such as pumice , polyethylene , walnut shell powder , and the like , or combinations thereof . the amount of additional exfoliants alone or in combination will depend on the type of exfoliant and the strength of exfoliation desired . preservatives employed , may be in an amount of from about 0 . 01 to about 2 . 00 percent , preferably from about 0 . 02 to about 1 . 00 percent , of the formula weight . examples of suitable preservatives are bha , bht , propyl paraben , butyl paraben or methyl paraben or an isomer , homolog , analog or derivative thereof . for topical application , according to the method of the present invention , the compositions can also be formulated with a variety of cosmetically and / or pharmaceutically acceptable vehicles . accordingly , the compositions of the present invention comprise a pharmaceutically or cosmetically acceptable carrier , in an amount appropriate to accommodate the other components of the formulation . the term “ pharmaceutically and / or cosmetically acceptable vehicle ” refers to a base , for either pharmaceutical or cosmetic use , within which n - acetyl - d - glucosamine or n - acetylgalactosamine is soluble and which will not cause harm to humans or other recipients . as used herein , “ pharmaceutical ” or “ cosmetic ” will be understood to encompass both human and animal pharmaceuticals or cosmetics . there are few limitations on the type of base which is suitable for the compositions containing n - acetyl - d - glucosamine or n - acetylgalactosamine . the vehicle may be aqueous , nonaqueous or a combination thereof appropriate for the formulation desired . the compositions can be prepared in any form convenient for topical application to the skin . such forms include , but are not limited to gels , creams , dispersions , emulsions ( water - in - oil or oil - in - water ), suspensions , creams , lotions , gels , foams , mousses and the like . in a preferred embodiment , the carrier is a suspension , dispersion or emulsion . the emulsion may be an oil - in - water emulsion , or a water - in - oil emulsion . these emulsions contain one or more oil components , an aqueous component , and a specific emulsifier component chosen depending on the nature of the desired emulsion . a composition , according to the present invention is prepared as follows : to prepare the composition , the materials are combined in the order above by mixing . the composition is topically applied to the skin for exfoliation . a composition , according to the present invention is prepared as follows : to prepare the composition , the materials are combined in the order above by mixing . the composition is topically applied to the skin for exfoliation . a composition according to the present invention , containing n - acetyl - d - glucosamine , is studied to determine the effect on desquamation . a panel of individuals is selected to participate in the test . the selected participants are 15 females between ages 21 and 65 years . participants are given the composition to take home and self administer on their right hand two times a day , once in the morning after washing and once in the evening at least 15 minutes before bedtime for 4 weeks . the left hand is the untreated control sample . participants are allowed to use only the composition being studied and are to log its use in a daily diary . at intervals of 2 and 4 weeks , the participants return for testing without applying the composition for at least 12 hours . the participants are tested without moisturizer or any other product on the skin of their hands . their skin is acclimated to an environment of about 70 ° f ., and about 40 percent relative humidity for about 20 minutes . skin exfoliation is measured with d - squame discs and image analysis . specifically , the amount of flakes removed from the skin surface using d - squame discs are measured . firmly and evenly , 4 d - squame discs are pressed on the back of each hand using a hand held uniform pressure device . the discs are removed by gently pulling them away from the skin . after removal , the discs are mounted on clear microscope slides and evaluated with an image analyzer , optima . a camera takes a picture of the slide and the average gray value is measured to determine the corresponding density of stratum corneocytes . denser samples have higher gray value differences . results show that the composition reduces skin flakiness after 2 weeks and 4 weeks of treatment when compared to untreated control hand area . after 2 weeks there is about a 15 . 8 percent decrease and after 4 weeks there was about 16 . 3 percent decrease in skin flakiness , thereby showing its utility in desquamation .	8
referring now in detail to the drawings for the purpose of illustrating a preferred embodiment of the present invention , the safety boat assembly as shown in fig1 and 3 includes a body member 1 which contains a front cabin 3 and a rear cabin 4 disposed in the middle and rear portions thereof , respectively , and a front chamber 2 disposed in the front portion thereof for containing an air bag 2 &# 39 ; disposed therein . the body member 1 is provided with a plurality of side chambers 5 attached to both sides thereof for containing a plurality of air bags 5 &# 39 ; disposed therein . the front cabin 3 is provided with an air passing cylinder attached to the interior of a front wall 3 &# 39 ; for containing a rectangular , tubular air inlet member 7 at an opening 6 &# 39 ; disposed at the air passing cylinder 6 . the air inlet member 7 extends to the bottom surface of the front cabin 3 and contains a circular tube 7 &# 39 ; disposed therein for readily introducing the air through apertures 16 , as shown in fig8 when the boat assembly is capsized . a tubular supporting member 17 attached to the interior of the front wall 3 &# 39 ; of the front cabin 3 is adapted to receive a tubular pole 8 . the tubular supporting member 17 and tubular pole 8 have a rectangular configuration for tightly engaging the pole 8 within the supporting member 17 . the tubular pole 8 contains a dense material 8 &# 39 ; disposed in lower portion thereof for increasing the pole &# 39 ; s weight and that of the boat assembly so as to stabilize the boat assembly in heavy waves . the tubular pole 8 is made of a solid material such as metal , hard plastic , or the like . also , the tubular pole 8 has a plurality of apertures 18 for adjusting the pole 8 to the supporting member 17 by aligning a bolt 19 through an aperture 18 disposed in the supporting member 17 . if necessary , the pole 8 can be moved to jut out of the bottom surface of the boat assembly as shown in fig4 so as to allow one to easily grasp it and return the capsized boat assembly 1 to its upright position . a light device 9 -, as shown in fig1 and 2 , is attached to the interior of the wall 3 &# 39 ; of the front cabin 3 . the light device 9 contains a battery b , a on / off gravity switch 9 &# 39 ;, and a light bulb 20 . the light bulb 2 . is automatically lighted by the gravity switch when the boat assembly is turned over ( fig1 ). the light device 9 is provided near a view finding window 10 for allowing one to observe the outside scene with the lightened bulb 20 when the boat assembly 1 is capsized . a wall 4 &# 39 ; disposed between the front cabin 3 and the rear cabin 4 is provided with a rectangular u - shaped pipe 13 having an engagement member 13 &# 39 ;. the u - shaped pipe 13 is arranged on both sides of the wall 4 &# 39 ; for introducing fresh air from the front cabin 3 to the rear cabin 4 when the boat assembly is capsized as shown in fig9 , and 11 . the u - shaped pipe 13 is mounted to the wall 4 by a screw 14 having a short rubber cover 15 through the engaging member 13 &# 39 ; thereof ( fig1 ). air bag side chambers 5 are attached to the body member 1 by the screws 14 having the short rubber cover 15 disposed at both ends thereof . also , the screws 14 disposed in the lower portion of the side wall in the cabins 3 and 4 have a long rubber cover 15 &# 39 ; for use by passengers as a grasping handle ( fig1 and 4 ). the cabins 3 and 4 are adapted to receive hooks 12 &# 39 ; of a safety belt 12 for securing the passengers to the cabins 3 and 4 ( fig1 ). in operation , when the boat assembly is turned over during sailing , the passenger is prevented frm being separated from the boat assembly since the passenger is secured to the safety belt i2 which is attached to the interior walls of the cabins 3 and 4 , and the passenger is able to grasp the handle 15 &# 39 ;. at this time , as shown in fig7 the fresh air in the atmosphere is introduced into the front cabin 3 through the plurality of apertures 16 disposed in the tubular air inlet member 7 and the opening 6 &# 39 ; of the air passing cylinder 6 . and the fresh air is introduced from the front cabin 3 to the rear cabin 4 through the u - shaped pipe 13 for supplying the fresh air to the victim ( fig1 ). at this time , simultaneously , the light bulb 20 is lighted by the on / off gravity switch and the victim can observe the outside scene through the view finding window 10 ( fig1 ). also , the capsized boat assembly can be easily returned to its upright position by using the end portion of the pole 8 which extends out of the bottom surface thereof with little effort being required by the rescuer . further according to the present invention , the probability of being capsized by a strong wind or waves is greatly reduced because of the gravity function of the dense material 8 &# 39 ; disposed in the lower portion of the rectangular pole 8 . this dense material may be mercury , for example . also , the safety boat assembly of the present invention contains the plurality of air bags 2 &# 39 ; and 5 &# 39 ; disposed within the cabins 3 and 4 , and air bag side chambers 5 for improving the floating force thereof . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included in the scope of the following claims .	1
the plug 1 of the invention has the shape of an elongated rod or pin ( see fig1 to 4 ). the plug has a side surface 10 and at least one end surface 11 and an opposite end 12 . the exact shape of this opposite end 12 is not critical ; it may be a tapered point or a flat surface , as shown in the drawings . on the side surface 10 it is possible to provide grooves 13 which start at said opposite end 12 and terminate at a distance spaced from said end face 11 , as shown in fig3 . these grooves are intended to facilitate the passage of air to the outside of the mold . such plugs can very easily be provided by molding a plastic material . in accordance with one aspect of the present invention , the grooves 13 , when they are present , do not extend to the molding surface of the walls of the tire mold . they therefore do not extend to the end surface 11 . a ring 14 , having a uniform , non - grooved surface , which is , for instance , cylindrical or slightly frustoconical , remains . as can be clearly noted from fig3 and 4 , said side surface 10 , which is at least partially frustoconical , is such that the cross section of said plug 1 decreases in the direction towards the side where said grooves 13 extend to the opposite end 12 . the vent of the invention is therefore embodied by a simple insert mounted in a hole made on the mold in the manner explained below . in fig5 there can be noted one of the conventional parts constituting a tire mold , namely a shell 2 intended to mold one of the sidewalls of the tire . the inner surface 20 of said shell 2 constitutes an exact image of the outer surface of the sidewall of the tire which it is desired to mold . at all the desired places , a hole such as 3 is drilled through said shell 2 . it therefore makes it possible to place the interior molding cavity i in communication with the exterior e of the mold . the hole 3 and the plug 1 are designed so as to present , for instance , an h7 / m6 fitting . the next step consists in inserting the plug 1 in the hole 3 , preferably from the side on which the molding surface 20 is located ( see fig5 and 6 ), until the side face 11 arrives practically at the level of the molding surface 20 of the shell 2 ( see fig7 ). of course , if the plug 1 has grooves 13 , it is necessary that the end 130 of these grooves be inserted to the inside of the thickness of the shell 2 in order that these grooves do not extend to the level of the molding surface 20 . in view of the fittings provided , there is no operating clearance between the plug 1 and the shell 2 . due to the fact that the hardness of the plastic material is definitely less than the hardness of the metallic material constituting the shell 2 , when the plug 1 is embedded within the hole 3 , the metallic material effects a slight machining of the side surface 10 of the plug 1 . this causes the appearance of small chips such as 15 which remain on the side of the inner cavity of the mold . the final step for the building of a vent consists in leveling the plug 1 by means of a cutting tool in order to produce a molding surface 19 which is located exactly , in its entirety , along the extension of the molding surface 20 of the wall which surrounds the plug 1 ( fig8 ). the mold which is thus obtained therefore has a plug 1 made of a material the hardness of which is definitely less than the hardness of the material essentially constituting the said wall 2 , said plug 1 having , prior to mounting , a cross section circumscribed in the cross section of the said hole 3 , at least on the side intended to be flush with said molding surface , said plug 1 being force - fitted in said hole 3 . in the final step , the said end face 11 of said plug 1 , possibly after leveling in order to form a molding surface 19 , is located completely along the extension of the molding surface 20 of the wall 2 bordering said hole 3 . of course , on basis of the present description , many variations and adaptations would be apparent to a person skilled in the art . the fittings cited are by way of example . it is sufficient in order to prevent the flow of rubber causing burrs that the plug 1 remains fixed firmly on the inside of the molding wall . it is necessary , of course , that the pressure of the raw rubber which acts on the molding surface 11 does not make it possible to drive the plug 1 further into the hole 3 . the propensity towards crushing of vents designed in this manner is far less than that which could be noted in the case of slit - shaped vents or in the case of holes of extremely small diameter . however , it is possible that in the long run a loss of effectiveness of the venting produced will be noted . in such case , the renewal operation is extremely simple and inexpensive . it is sufficient , by the use of a punch of a suitable diameter less than the diameter of the hole 3 which can be inserted in the hole 3 from the outside e of the mold to remove the plug 1 from the hole 3 and replace it with a new plug . the vent proposed by the present invention does not have any moving parts . it does not rely on any deformation or internal flexibility in order to permit the venting . if the materials used for this plug have a hardness which is very much less than the hardness of the material constituting the mold , it is possible to use force - fittings without it being necessary to respect a narrow tolerance for the molding of the plug 1 . it is possible to use plastic materials without it being possible to detect harmful influences due to the smaller thermal conductivity of the plugs as compared with the molding wall . the state of vulcanization of the rubber molded by means of a mold equipped in this manner is entirely comparable to that which is obtained with molds equipped with metal vents or mold not equipped with a venting vent . the present invention , used with other venting techniques of greater rate of flow , makes it possible to obtain the necessary venting in all the final molding places which present a greater difficulty in venting . it contributes to producing a mold which permits the molding of a tire which has no defect in appearance . its industrial use proves extremely reliable .	8
hereinafter , the orally administrable sebum secretion inhibiting composition comprising a collagen hydrolysate of the present invention and the food or drink product containing the composition are described . collagen is a main protein component constituting connective tissue in animals and is characterized by having a collagen triple helical structure . a total of not less than 30 types of collagen have been reported which are respectively termed type i , type ii , and so on . type i collagen is the primary component of the derma , ligaments , tendons , bones and the like ; and type ii collagen is the primary component of articular cartilage . further , type iv collagen is mainly contained in a basal membrane , which is the undercoat of all epithelial tissues . type i collagen is the most abundant collagen in the body . in the sebum secretion inhibiting composition of the present invention , the collagen origin is not limited , and usable are those derived from mammals such as cow , pig , etc ., birds such as chicken , ostrich , etc ., fishes such as sharks , etc . those derived from livestock such as cow , pig , chicken , etc ., are easily obtainable in a large amount , hence particularly preferable . further , the type of collagen is not limited and any type can be used , or a plurality of collagen types may be used in mixture . in the present invention , the collagen hydrolysate ( hereinafter sometimes referred to as collagen peptide ) refers to a low molecular collagen obtained by hydrolyzing collagen with an acid , alkali or enzyme . for example , a collagen hydrolysate can be obtained by immersing skins and joints of animals such as pig , cow and chicken or scales and skins of fish in an acid or alkali solution to extract gelatin and treating the extracted gelatin with an enzyme or acid . the gelatin refers to the collagen pre - treated with an acid or alkali and then solubilized by heat hydrolysis . the sebum secretion inhibiting composition of the present invention is for oral administration , but the dosage form is not limited and can be administered in the form of , for example , tablets , capsules , drinks , etc . further , the sebum secretion inhibiting composition of the present invention may be administered by being contained in a food or drink product , and , in that case , the food or drink product in which the composition is contained are not limited , and examples include carbonated drinks , nutritional drinks , liquors , sweets , nutritional food products , frozen sweets , dairy products , meats , etc ., and food products as a raw material to be used for these products . the sebum secretion inhibiting composition of the present invention refers to a composition which inhibits sebum secreted from skin and the skin may be derived from any site of the body , but face , head , chest , back , armpits , genital area , etc ., known as the areas where sebaceous glands are dense have abundant sebum secretion , hence are included as target sites . hereinafter , the present invention will be described in detail with reference to examples . however , the present invention is not limited to the following examples . for the collagen hydrolysate , a commercial “ collagen peptide ” ( pig ) having a molecular weight of 20000 or less was used . the collagen peptide used was obtained by immersing the pig skin in an acid or alkali solution to extract gelatin and further enzymolyzing the extracted gelatin . the collagen peptide is mainly derived from pig type i collagen . for the test meal containing the collagen peptide , a powder test meal comprising the composition shown in table 1 was prepared . the powder test meal contains 10000 mg of collagen peptide and 100 mg of vitamin c per meal . vitamin c is added because it is required to synthesize collagen in vivo . sixteen men in their twenties and thirties as the subjects orally ingested the powder test meal . the subjects took one meal of the powder test meal added to milk , juice , miso soup or the like at any convenient time once a day for 12 consecutive days . the sebum amount of the subjects was measured before , during and after the ingestion of the powder test meal . on the measurement day , the subjects washed their faces with warm water and a facial soap at 1 p . m ., and 2 hours later , i . e ., around 3 p . m ., the measurement was carried out . the measurement was carried out , using an optical sebum measurement apparatus , triplesense ( moritex precision corporation ), by pressing the sensor part of the measurement apparatus against a spot about 3 cm below the eye on the face of the subject . the value ( arbitrary unit a . u .) indicated as an oil content measurement value by the measurement apparatus was referred to as the sebum value . before ingesting the powder test meal , 10 of the subjects had a sebum amount of 40 a . u . or more , whereas 6 subjects had a sebum amount of below 40 a . u . these groups were termed as the preingestion sebum amount ≧ the 40 - group and the preingestion sebum amount & lt ; the 40 - group , respectively . table 2 shows the average value of the sebum amount of all subjects , the average value of the sebum amount of the preingestion sebum amount ≧ the 40 - group and the average value of the sebum amount of the preingestion sebum amount & lt ; the 40 - group before ingesting the powder test meal , 1 week and 2 weeks after the start of ingestion and 1 week after the completion of ingestion . similarly , the results in the form of graph are shown in fig1 . in fig1 , δ represents the average value for all subjects , ∘ represents the average value of the sebum amount of the preingestion sebum amount ≧ the 40 - group , and □ represents the average value of the sebum amount of the preingestion sebum amount & lt ; the 40 - group . after ingesting the powder test meal , all groups had reduced sebum amounts in comparison with before ingestion which revealed that the sebum secretion was inhibited owing to the ingestion of the powder test meal . in particular , the sebum secretion inhibitory effect was significant in the preingestion sebum amount ≧ the 40 - group which leads to the presumption that people with oily skin inherently are most likely to benefit the effect . the effect already started showing within 1 week after the ingestion and the sebum amount increased again 1 week later from the ingestion which leads to the presumption that the effect can be attained in a comparatively short period of time . the same test was also carried out for the group which did not ingest the powder test meal but the sebum inhibitory effect was not observed . examples of application of the deodorized collagen peptide obtained based on the above test results to drink or food products or compositions , are shown below . using the present product ( collagen peptide ) prepared by the methods described in example 1 , a drink , a powder , a tablet , a chewing gum , a candy , a tablet candy , a gummy jelly , a chocolate and a sorbet were produced with the following formula . collagen peptide 5 . 0 parts by weight high fructose corn syrup 8 . 0 parts by weight sugar 4 . 0 parts by weight flavor 0 . 5 parts by weight vitamin c 0 . 5 parts by weight after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . collagen peptide 5 . 0 parts by weight sucralose 0 . 005 parts by weight stevioside 0 . 008 parts by weight rebaudioside 0 . 008 parts by weight acesulfame potassium 0 . 01 parts by weight peach flavor 0 . 5 parts by weight vitamin c 0 . 5 parts by weight after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . after adjusting ph to 3 . 8 using an acidifier , the drink was prepared to be 100 parts by volume with purified water . after adjusting ph to 6 . 5 using sodium bicarbonate , the drink was prepared to be 100 parts by volume with purified water . after adjusting ph to 6 . 5 using sodium bicarbonate , the drink was prepared to be 100 parts by volume with purified water . hereinabove , the present invention has been described with reference to examples but can be carried out without being limited to these embodiments of the present invention . this application claims the priority to the japanese patent application no . 2009 - 297848 , filed on dec . 28 , 2009 , and the contents of which is hereby incorporated by reference as a part of the present application .	0
fig1 illustrates the pin - out required for a chip package 2 to perform a typical binary multiplication of two 32 - bit words 4 , 6 to generate a 64 - bit product word 8 , each bit requiring an individual external pin 9 on the chip package 2 for connection . this leaves only four additional pins for connection to power and control 10 , assuming the total pin - out of the chip package 2 in fig1 is 132 , which is equal to the proposed next largest industry standard . of course , fig1 is only an example and the connection of power and control 10 to the chip package 2 may require more than 4 pins . what fig1 establishes is that there are many cases in which the pin - out is so critical that each pin on the package 2 must be used to connect a different signal to the chip without duplication . fig2 illustrates a semiconductor chip 20 embodying a large scale integrated circuit having input / output ports comprising a plurality of conductive pads 22 located on its top surface along its periphery , the pads 22 surrounding complex integrated circuitry defined in thin film layers on the top surface thereof . the integrated circuit 20 is mounted on a thin metal film 30 deposited on a recessed floor 32 of a chip package 34 . the chip package 34 typically comprises an insulator material such as plastic or alumina or other ceramic , as is well known in th art . many of the elements on the chip 20 require a common supply voltage to be connected to each of them , thus requiring the supply voltage to be distributed throughout the top surface of the chip 20 . this is accomplished by means of a conductive bus 24 defined in one of the same thin film layers , the bus meandering about the top surface of the chip 20 . in the prior art , one end 24 ( a ) of the bus 24 would be connected to the nearest pad 22 ( a ) only . accordingly , the width of the bus must be sufficiently large in order to avoid unacceptable voltage drops along the length of the bus . the width of the bus 24 can be reduced without increasing such voltage drops by connecting the opposite end 24 ( b ) of the bus 24 to another nearby pad 22 ( b ), which would in turn be connected to the same supply voltage to which the first pad 22 ( a ) is connected . in this case , the width of the bus 24 can be reduced by a factor of four for a given voltage drop per - unit length along the bus 24 . however , the prior art requires the dedication of two external circuit package pins to carry the same supply voltage to the bus 24 where both ends of the bus 24 are connected to two different pads as shown in fig2 . as discussed previously in connection with fig1 there are many cases in which the use of more than one external pin to carry the same signal or voltage is unacceptable because there are no extra pins or at least the margin of pin - out is extremely limited . external connection of the pads 22 is achieved by forming or patterning a plurality of conductive bases 36 on the surface of a raised floor 38 surrounding the recessed floor 32 . each conductive base 36 is associated with an external pin 40 which is bonded on to the corresponding conductive base 36 . in an alternative embodiment , the conductive film 30 on which the integrated circuit 20 rests acts as a ground plane and is connected to one of the conductive bases 36 ( a ) located at one corner of the raised floor 38 . in the prior art , the pad 22 ( a ) is connected to the nearest conductive base 36 ( b ) by a thin wire and the corresponding pin 40 ( a ) is connected to the supply voltage to be carried by the bus 24 . the trade - off is immediately apparent because either : ( a ) the width of the bus 24 must be disadvantageously large to minimize resistive losses , or ( b ) the opposite bus end 24 ( b ) must be connected through the pad 22 ( b ) and an additional pin 40 ( c ) to the same supply voltage to which the pin 40 ( a ) is connected ( thus using more than one pin for the same voltage ). in the present invention , this trade - off is avoided by means of a surrounding conductive ring 50 which is patterned or formed at the same time the conductive bases 36 are formed on the raised floor 38 . the surrounding ring 50 is integrally formed with one of the bases 36 ( c ) which is bonded to a pin 40 ( b ). the width of the surrounding conductive ring 50 is sufficiently large so that there are no significant voltage drops along its length . as illustrated in fig2 both ends 24 ( a ), 24 ( b ) of the bus 24 are connected to the corresponding pads 22 ( a ) 22 ( b ) through wires 52 ( a ) 52 ( b ) to different nearby points on the conductive ring 50 . as described previously , the double - ended connection of the bus 24 to the supply voltage or signal applied to the pin 40 ( b ) permits a four - fold reductin in the width of the bus 24 . if the integrated circuit 20 has a plurality of such busses , the resulting savings in space on the chip is potentially enormous . while the number of pins 40 formed on the package is necessarily limited by considerations described previously , the number of chip pads 22 is at the discretion of the circuit designer . accordingly , many such busses similar to the bus 24 may be formed on the chip and may be connected to a plurality of points through various ones of the pads 22 to the ring 50 to permit a significant decrease in bus geometry and attendant savings in space on the chip without increasing the required pin - out . the extra space thus saved may be occupied by additional integrated circuitry , thus increasing the versatility of the chip . in another embodiment of the invention , a second surrounding conductive ring 54 may be provided and used in the same manner that the surrounding conductive ring 50 is used as illustrated in fig2 . although the presently preferred embodiment includes only one such surrounding conductive ring 50 , it is contemplated that a plurality of such rings may be provided and would be limited in number only by the available space on the raised floor 38 . a surrounding ring may also be provided on the bottom floor 32 or elsewhere near the chip 20 .	7
as shown in fig1 the system is provided on vehicle 10 which has a body section 12 outlined in dot - dash line and wheels with inflated tires indicated as a , b , c and d . the tire air pressure monitoring system of the present invention is electrically operated and derives its power from the battery 14 , one side of which , preferably the negative side , is connected to ground as indicated at 16 and the other or positive side is connected through an ignition switch 18 to activate a timer 20 which , when the ignition switch 18 is initially turned on , closes a switch 22 ( see fig2 ) in the line 24 leading to the pickup solenoid or sensor actuator , as will be described hereinbelow , is indicated at 26 ( see fig3 ). the timer switch 22 and the motion detector switch 30 individually and in combination provide a means to prevent activation of the solenoid unless certain conditions are met . a motion detector 28 controls a switch 30 by holding the switch 30 in closed ( conducting ) position if no motion is sensed but is immediately moves the switch 30 to an open ( non - conducting ) position ( not shown ) to break the connection in line 24 and disconnect the pickup or activating solenoids 26 . the solenoids each have a base retracted position to which the solenoid ( and the contact elements mounted thereon is driven , for example , by a spring or the like as represented by the arrow 25 so that the retracted position is a fail safe position with the electrical contact elements 66 , 68 and 70 withdrawn as will be described below to review , as shown in fig2 when the ignition switch 18 is initially closed , the timer 20 is activated and closes the switch 22 and since the switch 30 will normally be closed if the vehicle is not in motion , power is sent to the solenoids 26 via the line 24 until the timer 20 completes its cycle at which time the switch 22 will open . the timer is set to provide sufficient time ( e . g . about 10 to 60 seconds ) for the operator to read the pressures in the tires a , b , c and d as will be described below . in the illustrated arrangement , the line 32 delivers power to the sensor system 34 and via one of the movable contact elements 66 , 68 or 70 delivers power to the pressure sensor 62 on the wheel ( a , b , c , or d ) when the solenoids 26 are activated , if power is required to operate the sensor which of course will depend on the type of sensor being used . referring back to fig1 a sensor system 34 is provided on each of the wheels a , b , c and d and each sensor system 34 includes a set of non - rotating contact elements 66 , 68 and 70 mounted for movement by the solenoid 26 and a set of movable contact ( annular contact ribbons 52 , 54 and 56 ) that are mounted to rotate with the sensor 62 that is fixed relative to the wheel . when the solenoids 26 are activated , the sensor systems 34 feeds back signals to the display unit 36 on chassis 12 ( see fig1 ). the digital display unit 36 displays the left front displays the left front tire pressure as indicated by display unit lf , the right front tire pressure as indicated by display unit rf , the left rear tire tire pressure as indicated by display unit lr and the right rear tire tire pressure as indicated by display unit rr . these display units indicate the tire pressure in their respective tire when both the timer switch 22 and the motion detector switch 30 are in the closed ( conducting ) position and the solenoid 26 for each of the tires is activated . if the system is employed with vehicles having more ( or less ) tire that are to be monitored obviously the number of sensors and the number of displays will be changed as required . attention is directed to fig3 which further illustrates one form of the sensor system 34 , which includes three annular contact ribbons 50 , 52 and 54 that are connected via lines 56 , 58 and 60 to the pressure sensor 62 mounted on the wheel and in communication with the tire to determine the air pressure or sense the air pressure within its tire . in the version illustrated in fig3 the annular contact rings 50 , 52 and 54 are mounted on a disk 64 which rotates with the wheel . in the illustrated arrangement , the side of the disk to be contacted by the movable , retractable , electrical contact elements 66 , 68 and 70 is covered by a protective coating 72 which overlies the front face of the disk 64 ( face facing the contacts 66 , 68 and 70 ). obviously it is unnecessary to cover the whole face of the disk with coating , only the conductor strips need be protected and thus only the strips need be coated sufficiently to protect them . one system for mounting the annular conductive strips or ribbons 50 , 52 and 54 is to place them in a groove and then fill the groove with the protective coating . obviously the ribbons must each be electrically isolated from the other and from the disk or mounting e . g . wheel rim . each of these contact elements 66 , 68 and 70 is provided with a sharpen end point 74 which will penetrate the coating 72 when the solenoid 26 is activated to move the contacts 66 , 68 and 70 toward the disk 64 . i . e . extension of the solenoid 26 to activated position forces the sharpen ends 74 through the protective coating 72 and into contact with the annular connectors 50 , 52 and 54 respectively . in the arrangement shown in fig4 the pickup disk 64 is shown in position to be mounted on the disk 80 of the disk brake and is connected to the pressure sensor 62 via the connectors schematically indicated at 82 , i . e . equivalent to the wires 56 , 58 and 60 . mounted fixed to the axial 84 is a backup plate 86 to which the pickup solenoid 26 is fixed . in this illustration to the left of the two vertical dotted lines , all of the elements rotate with the wheel , whereas those elements to the right of the two vertical dotted lines are fixed to the chassis . the system shown in fig5 is essentially the same as the system shown in fig4 with the exception that a brake drum 88 replaces the disk 80 and the annular conducting ribbons extends circumferentially around the inner side of the wheel rim so that they in effect to form a right circular cylinder as opposed to a flat disk . however , other than this , the ribbon connections will be the same and the protective 72 will simply overlie these contacts . obviously , this positioning of the annular ribbons requires that the motion of the solenoid 26 be at right angles to the motion of the solenoid shown in fig4 i . e . in fig4 the motion of the solenoid is indicated by the arrow 90 is substantially parallel to the axis of rotation whereas in fig5 the movement of the solenoid as indicated by the arrow 92 is substantially radial to the axis or rotation of the tire . it is preferred to have the solenoid move the contacts in an axial direction relative to the axis of rotation i . e . as shown in fig4 but in those cases where the wheel structure does not easily accommodate such a system radial movement of the contacts by the solenoid will be used as indicated in fig5 . while the system of fig4 has been shown with disk brakes and the system of fig5 with drum brakes the systems may be interchange and the system of fig5 used with disk brake or the system of fig4 with drum brakes , if the wheel configuration is suitable . the contacts 66 , 68 and 70 will now be described in more detail with in relation to fig6 , 8 and 9 . in each case , a block 100 is mounted on the solenoid rod 102 and is thus moved by action of the solenoid 26 when the solenoid 26 is activated from a retracted or inactive position as illustrated to an active position wherein the contact elements 66 , 68 and 70 are projected forward as indicated by the arrow 104 to drive the sharpen ends 74 through the protective coating 72 and into contact with their respective ribbons 50 , 52 and 54 . in the arrangement shown in fig6 the contact elements 66 , 68 and 70 are simply clamped in an insulated block and the wiring connections are connected from these contact elements 66 , 68 and 70 to their respective display 36 ( in each of the below described embodiments the contact elements 66 , 68 and 70 are similarly connected to their respective portion of the display 36 ). in the fig7 embodiment , a spring schematically indicated at 106 , 108 and 110 is used to bias its respective the contact elements 66 , 68 and 70 to an extended position while permitting each one of these contacts 66 , 68 or 70 to independently move rearwardly , i . e . in the direction of the arrow 112 . this springing of the contact elements better ensures that the coating 72 is not damaged should there be some relative movement between the contacts 66 , 68 or 70 and their respective rings 54 , 52 and 50 i . e . such movement will simply drive the contact elements in the direction of the arrow 112 to minimize any damage to the coating 72 . fig8 shows a system similar to fig6 and 7 but wherein in a single spring 114 biases all of the contact elements 66 , 68 and 70 in the direction of the arrow 104 while permitting movement of all simultaneously in the direction of the arrow 112 . in the embodiment of fig9 each of the contact elements 66 , 68 and 70 is wound to form its respective coil springs 116 , 118 and 120 each of which operates similarly to its corresponding springs 106 , 108 and 110 in the fig7 embodiment to permit rearward movement should the vehicle accidentally be put into motion when the solenoid 26 is in extended position and the contact elements are in their active position . having described the invention , modifications will be evident to those skilled in the art without departing from the scope of the invention as defined in the appended claims .	1
referring now to the drawings , fig1 shows a perspective view of a vehicle 1 with a part of the roof broken away to show the driver 16 operating the vehicle 1 . in fig1 , the vehicle 1 is depicted as an automobile but the invention is equally suitable for other types of vehicles , including but not limited to vans , trucks , pick - up trucks , and sports utility vehicles . in fig1 , the invention is shown as installed on all corners of vehicle 1 . however , this depiction is to illustrate several possible embodiments and it is not intended or required that the invention be installed on all corners of the vehicle 1 to achieve the desirable objects of the invention . a left front corner camera mirror assembly 102 is located at the left front corner of the vehicle 1 , and a right front corner camera mirror assembly 103 is located at the right front corner of the vehicle 1 . also shown in fig1 is a left rear corner camera mirror assembly 104 and a right rear corner camera mirror assembly 105 . in fig1 , these camera mirror assemblies 102 , 103 , 104 and 105 are shown on the exterior of the vehicle 1 , but it is not intended that these camera mirror assemblies be limited to external installation . also depicted in fig1 is a left monitor 106 and a right monitor 119 within the vision of the driver 16 . also shown in fig1 is a left light image 107 entering the left front corner camera mirror assembly 102 , and a left light image 108 entering the right front corner camera mirror assembly 103 , as well as a right light image 109 entering the right front corner camera mirror assembly and a right light image 110 entering the left front corner camera mirror assembly 102 . in addition a forward light image 111 is shown entering the right front corner camera mirror assembly and a forward light image 112 is shown entering the left front corner camera mirror assembly . fig1 also shows a left light image 113 entering the left rear corner camera mirror assembly 104 , a left light image 114 entering the right rear corner camera mirror assembly 105 , a right light image 115 entering the left rear corner camera mirror assembly 104 and a right light image 116 entering the right rear corner camera mirror assembly 105 . in addition a rear light image 117 is shown entering the right rear corner camera mirror assembly and a rear light image 118 is shown entering the left rear corner camera mirror assembly . fig2 shows the left side view of a vehicle 1 operated by a driver 16 with certain embodiments of the invention . a left front corner camera mirror assembly 102 is shown on the left front exterior of the vehicle 1 and a left rear corner camera mirror assembly 104 is shown on the left rear exterior of the vehicle 1 . the forward light image 112 is shown entering the left front corner camera mirror assembly 102 and a rear light image 118 is shown entering the left rear corner camera mirror assembly 104 . fig3 shows a plan view of a vehicle 1 with certain embodiments of the invention . a left front corner camera mirror assembly 102 is located at the left front corner of the vehicle 1 , and a right front corner camera mirror assembly 103 is located at the right front corner of the vehicle 1 . also shown in fig3 are a left rear corner camera mirror assembly 104 and a right rear corner camera mirror assembly 105 as well as a left monitor 106 and a right monitor 119 . also shown in fig3 is a left light image 107 entering the left front corner camera mirror assembly 102 , and a left light image 108 entering the right front corner camera mirror assembly 103 , as well as a right light image 109 entering the right front corner camera mirror assembly and a right light image 110 entering the left front corner camera mirror assembly 102 . in addition a forward light image 111 is shown entering the right front corner camera mirror assembly and a forward light image 112 is shown entering the left front corner camera mirror assembly . fig3 also shows a left light image 113 entering the left rear corner camera mirror assembly 104 , a left light image 114 entering the right rear corner camera mirror assembly 105 , a right light image 115 entering the left rear corner camera mirror assembly 104 and a right light image 116 entering the right rear corner camera mirror assembly 105 . in addition a rear light image 117 is shown entering the right rear corner camera mirror assembly and a rear light image 118 is shown entering the left rear corner camera mirror assembly . fig4 shows a schematic view of a camera mirror assembly 102 installed in the left front corner of a vehicle 1 . in fig4 a left facing mirror 123 is shown in position ahead of a left front camera 120 with a receiving lens 120 a . in this arrangement the left facing mirror is positioned at an angle to receive a left light image 107 and reflect the left light image to the receiving lens 120 a and into the left front camera 120 . by means of a transmission cable 121 , the left light image 107 is displayed on the left monitor 106 within the vision of the driver 16 . in this embodiment as depicted in fig4 , the left facing mirror 123 will only block a portion of the receiving lens 120 a allowing a forward light image 112 to be received by the receiving lens 120 a . into the left front camera 120 and transmitted by the transmission cable 121 to the left monitor 106 within the vision of the driver 16 . the left light image 107 would be displayed as a lower image 125 on the left monitor 106 and the forward light image 112 would be displayed as an upper image 124 on the left monitor 106 or the images could be reversed . while the embodiment depicted in fig4 is shown with a transmission cable 121 for transmitting a light image from the camera 120 to the left monitor 106 , it is not intended that the transmission of the light image be limited to cable and alternative means such as fiber optic cable or wireless transmission may be employed . as shown in fig4 left front camera 120 is not aimed directly forward but is angled to the right at an angle 112 a to enhance the vision of the driver 16 in left turn situations where the vehicle 1 is turning into the direction of oncoming traffic which is difficult to see because of vehicles directly ahead . it is intended that this orientation be reversed in right hand drive vehicles and countries . while the angle 112 a may be fixed to suit an optimum placement to enhance the vision of the driver 16 , an alternate embodiment not shown would comprise a pivotal mount and turning means to turn the camera on the pivotal mount to the most advantageous position at the control of the driver 16 . although not shown it is understood that the camera mirror assemblies and monitors will normally receive power from the vehicle electrical service and such electrical service may be wired directly to such elements or wired integrally with the transmission cables . fig5 shows a schematic view of a camera mirror assembly 103 installed in the right front corner of a vehicle 1 . in fig5 a right facing mirror 129 is shown in position ahead of a right front camera 126 with a receiving lens 126 a . in this arrangement the right facing mirror is positioned at an angle to receive a right light image 109 and reflect the right light image to the receiving lens 126 a and into the right front camera 126 . by means of a transmission cable 127 , the right light image 109 is displayed on the right monitor 119 within the vision of the driver 16 . in this embodiment as depicted in fig5 , the right facing mirror 129 will only block a portion of the receiving lens 126 a allowing a forward light image 111 to be received by the receiving lens 126 a into the right front camera 126 and transmitted by the transmission cable 127 to the right monitor 119 within the vision of the driver 16 . the right light image 109 would be displayed as a lower image 131 on the right monitor 119 and the forward light image 111 would be displayed as an upper image 130 on the right monitor 119 or the images could be reversed . while the embodiment depicted in fig5 is shown with a transmission cable 127 for transmitting a light image from the camera 126 to the right monitor 119 , it is not intended that the transmission of the light image be limited to cable and alternative means such as fiber optic cable or wireless transmission may be employed . it is intended that the embodiments depicted in fig4 and 5 can be used together or separately . likewise , while not shown an alternate embodiment would comprise a pivotal mount and turning means to turn either or both cameras on pivotal mounts to the most advantageous position at the control of the driver 16 . fig6 shows a schematic view of an alternative right front camera mirror assembly 103 . in this embodiment the right front camera 126 and receiving lens 126 a are in line with a right pivoting mirror assembly 132 and a left pivoting mirror assembly 133 . the right pivoting mirror assembly 132 is hinged to swing a mirror 132 a on pivot 132 b into position to receive a right light image 109 and reflect the right light image 109 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . likewise , the left pivoting mirror assembly 133 is hinged to swing a mirror 133 a on pivot 133 b to receive a left light image 108 and reflect the left light image 108 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . when not in a position to receive and reflect a light image each mirror is retracted to allow the other mirror to receive and reflect a light image or both mirrors are retracted to allow a forward light image 111 to be received by the receiving lens 126 a into the right front camera 126 and transmitted by the transmission cable 127 to the left monitor 119 within the vision of the driver 16 . while the embodiment depicted in fig6 is shown with a transmission cable 127 for transmitting a light image from the camera 126 to the left monitor 106 , it is not intended that the transmission of the light image be limited to cable and alternative means such as fiber optic cable or wireless transmission may be employed . an alternate embodiment not shown would comprise a pivotal mount and turning means to turn the camera on the pivotal mount to the most advantageous position at the control of the driver 16 . likewise , it is not intended that the position of the pivoting mirrors be limited to one of two positions . in fig6 , the left monitor 106 is depicted with a forward image 134 showing the forward light image 111 , a left image 135 showing the left light image 108 , and a right light image 136 showing the right light image 109 . also shown are a forward image control button 134 a , a left image control button 135 a , and a right image control button 136 a . when the forward image control button 134 a is activated , both the right pivoting mirror assembly 132 and the left pivoting mirror assembly 133 are in their retracted positions allowing the forward light image 111 to reach the receiving lens 126 a . when the left image control button 135 a is activated , the mirror 133 a swings into position on pivot 133 b to receive a left light image 108 and reflect the left light image 108 to the receiving lens 126 a . when the right image control button 136 a is activated , the mirror 132 a swings into position on pivot 132 b to receive a right light image 109 and reflect the left light image 109 to the receiving lens 126 a . the pivoting mirror assemblies may be activated by any suitable mechanism such as an electrical solenoid , vacuum control or gears . fig7 shows a schematic view of another alternative right front camera mirror assembly 103 installed in the right front corner of the vehicle 1 . in this embodiment the right front camera 126 and receiving lens 126 a are in line with a pyramid pivoting mirror assembly 137 with a right pivoting mirror 137 a and a left pivoting mirror 137 b . the right pivoting mirror 137 a is hinged on pivot 137 c to swing into position to receive a right light image 109 and reflect the right light image 109 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . likewise , the left pivoting mirror 137 b is hinged on pivot 137 d to swing into position to receive a left light image 108 and reflect the left light image 108 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . when not in a position to receive and reflect a light image each mirror is retracted to allow a forward light image 111 to be received by the receiving lens 126 a into the right front camera 126 and transmitted by the transmission cable 127 to the left monitor 119 within the vision of the driver 16 . while the embodiment depicted in fig7 is shown with a transmission cable 127 for transmitting a light image from the camera 126 to the left monitor 106 , it is not intended that the transmission of the light image be limited to cable and alternative means such as fiber optic cable or wireless transmission may be employed . the pivoting mirror assemblies may be activated by any suitable mechanism such as an electrical solenoid , vacuum control or gears . as shown in fig7 , the left light image 108 would be displayed as a left image 139 on screen 122 of the left monitor 106 and the right light image 109 would be displayed as right image 138 on screen 122 of the left monitor 106 . when the mirrors 137 a and 137 b were retracted then the screen 122 would display the forward image 111 . an alternate embodiment not shown would comprise a pivotal mount and turning means to turn the camera on the pivotal mount to the most advantageous position at the control of the driver 16 . likewise , it is not intended that the position of the pivoting mirrors be limited to one of two positions . fig8 shows a schematic view of a camera mirror assembly 105 installed in the right rear corner of a vehicle 1 . in fig8 a left facing mirror 143 and a right facing mirror 142 are shown in crisscross position one above the other and ahead of a right rear camera 140 with a receiving lens 140 a . in this arrangement the left facing mirror 143 is positioned at an angle to receive a left light image 114 and reflect the left light image 114 to the receiving lens 140 a and into the right rear camera 140 . likewise , the right facing mirror 142 is positioned at an angle to receive a right light image 116 and reflect the right light image 116 to the receiving lens 140 a and into the right rear camera 140 . by means of a transmission cable 141 , the left light image 114 and right light image 116 are displayed on either the left monitor 106 or the right monitor 119 within the vision of the driver 16 . although not shown , it is understood that the left light image 114 and right light image 116 could be displayed as side by side images or top and bottom images on either monitor in a manner similar to that depicted in fig4 and fig7 . likewise , the mirror arrangement depicted in fig8 would be equally applicable to any corner camera mirror assembly , both front and rear . also , while the embodiment depicted in fig8 is shown with a transmission cable 141 for transmitting a light image from the camera 140 to a monitor , it is not intended that the transmission of the light image be limited to cable and alternative means such as fiber optic cable or wireless transmission may be employed . an alternate embodiment not shown would comprise a pivotal mount and turning means to turi the camera on the pivotal mount to the most advantageous position at the control of the driver 16 . fig9 shows a schematic view of another alternative right front camera mirror assembly 103 installed in the right front corner of the vehicle 1 . in this embodiment the right front camera 126 and receiving lens 126 a are in line with a pyramid mirror assembly 144 with a right facing mirror surface 144 a and a left facing mirror surface 144 b . the right facing mirror surface 144 a is in a position to receive a right light image 109 and reflect the right light image 109 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . likewise , the left facing mirror surface 144 b is in a position to receive a left light image 108 and reflect the left light image 108 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . while the embodiment depicted in fig9 is shown with a transmission cable 127 for transmitting a light image from the camera 126 to the left monitor 106 , it is not intended that the transmission of the light image be limited to cable and alternative means such as fiber optic cable or wireless transmission may be employed . an alternate embodiment not shown would comprise a pivotal mount and turning means to turn the camera on the pivotal mount to the most advantageous position at the control of the driver 16 . as shown in fig9 , the left light image 108 would be displayed as a left image 139 on screen 122 of the left monitor 106 and the right light image 109 would be displayed as right image 138 on screen 122 of the left monitor 106 . fig1 is a schematic of a camera installed in the left front corner of vehicle 1 to receive a forward light image 112 into the receiving lens 120 a and into the left front camera 120 for transmission by cable 121 to the left monitor 106 within the vision of the driver 16 . the left front camera 120 is not aimed directly forward but is angled to the right at an angle 112 a to enhance the vision of the driver 16 in left turn situations where the vehicle 1 is turning into the direction of oncoming traffic which is difficult to see because of vehicles directly ahead . it is intended that this orientation be reversed in right hand drive vehicles and countries . while the angle 112 a may be fixed to suit an optimum placement to enhance the vision of the driver 16 , an alternate embodiment not shown would comprise a pivotal mount and turning means to turn the camera on the pivotal mount to the most advantageous position at the control of the driver 16 . fig1 shows a perspective view of the dashboard 145 of a vehicle with the driver observation system and depicts the steering wheel 146 and a left monitor 106 and a right monitor 119 both mounted on the dashboard 145 in the sight of the driver . on the steering wheel are also shown a set of left control buttons 148 and right control buttons 147 to control the screen images presented on the monitors as generally depicted in the embodiments shown in fig4 through 10 in accord with the camera mirror assemblies installed on a vehicle . it is understood that these controls could select left , right , forward and rear light images or any combination and said controls would serve to activate any motors or driving devices to position the mirrors , the cameras or the camera mirror assemblies in the desired position or otherwise activate any feature of the camera such as focus or zoom . likewise , it is understood that these controls could be mounted on the monitors or other location within the reach of the driver . fig1 shows a schematic of a camera mirror assembly housing 149 for encasing a right front corner camera mirror assembly 103 as depicted in fig6 , where the right front camera 126 and receiving lens 126 a are in line with a right pivoting mirror assembly 132 and a left pivoting mirror assembly 133 . the right pivoting mirror assembly 132 is hinged to swing a mirror 132 a on pivot 132 b into position to receive a right light image 109 and reflect the right light image 109 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . likewise , the left pivoting mirror assembly 133 is hinged to swing a mirror 133 a on pivot 133 b to receive a left light image 108 and reflect the left light image 108 to the receiving lens 126 a and into the right front camera 126 for transmission by cable 127 to the left monitor 106 within the vision of the driver 16 . in fig1 , a right pivoting mirror motor 150 is shown to move the mirror 133 a on pivot 133 b , and a left pivoting mirror motor 151 is shown to move the mirror 132 a on pivot 132 b . also shown is a control module 155 to activate the motors 151 and 150 in accord with the control instructions from the driver 16 . it is intended that the camera mirror assembly housing 149 be of material of adequate strength and stiffness to hold the components in proper position and to be impervious to weather conditions . as shown in fig1 , the housing 149 has right light image aperture 152 to permit the reception of a right light image ; a left light image aperture 153 to permit the reception of a left light image ; and a forward light aperture 154 to permit the reception of a forward light image . it is intended that said apertures be of rigid transparent material such as tempered glass or plastic and made an integral part of the housing 149 to maintain protection against weather and entrance of foreign matter into the camera mirror assembly . it is understood also , that the pivoting mirror motors 150 and 151 may be any suitable drive mechanism whether electrically , hydraulically , vacuum or pneumatically powered . although not shown an alternate embodiment would comprise a pivotal mount and turning means to turn the housing 149 on the pivotal mount to the most advantageous position at the control of the driver 16 . fig1 shows a plan view of a vehicle 53 with the invention attempting a left turn from a common turning lane 57 across an oncoming traffic lane 59 with an oncoming vehicle 56 while facing an opposing turning vehicle 55 in the common turning lane 57 . in this depiction , the vehicle 53 will have moved from the traffic lane 58 into the common turning lane 57 to turn left across the opposing lane 59 . in this situation the driver of vehicle 53 would have a clear view of oncoming traffic in lane 59 except for the opposing vehicle 55 coming in the opposite direction and attempting a left turn across traffic lane 58 . at this point , the driver of vehicle 53 must nose the vehicle out into the oncoming lane to see any oncoming vehicles 56 . when equipped with the driver observation system , the left front corner of the vehicle 53 need only extend slightly to the left so that a forward light image 112 would be received at the left front corner camera mirror assembly and transmitted to the vision of the driver . in contrast , a vehicle 54 without the invention would have to turn into the oncoming traffic lane 59 a sufficient distance to allow the driver to see the oncoming traffic from the controls of the vehicle . this increased distance could be enough to cause an accident . fig1 shows a plan view of a vehicle 60 with the invention attempting to turn left onto an intersecting street from a cross street 66 by crossing an opposing lane 64 to reach a merging lane 65 . a parked vehicle 61 obstructs the vision of the driver of vehicle 60 . when equipped with the driver observation system , vehicle 60 need only proceed slightly forward to receive a left light image 107 at the left front corner camera mirror assembly and have that image transmitted to the driver . in contrast , a vehicle 63 without the invention would have to proceed almost half the length of the vehicle forward to allow the driver to see oncoming traffic . the camera can be any commercially available unit with or without focusing or zoom features .	1
the terms used in this specification generally have their ordinary meanings in the art , within the context of the invention , and in the specific context where each term is used . certain terms that are used to describe the invention are discussed below , or elsewhere in the specification , to provide additional guidance to the practitioner regarding the description of the invention . for convenience , certain terms may be highlighted , for example using italics and / or quotation marks . the use of highlighting has no influence on the scope and meaning of a term ; the scope and meaning of a term is the same , in the same context , whether or not it is highlighted . it will be appreciated that same thing can be said in more than one way . consequently , alternative language and synonyms may be used for any one or more of the terms discussed herein , nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein . synonyms for certain terms are provided . a recital of one or more synonyms does not exclude the use of other synonyms . the use of examples anywhere in this specification including examples of any terms discussed herein is illustrative only , and in no way limits the scope and meaning of the invention or of any exemplified term . likewise , the invention is not limited to various embodiments given in this specification . unless otherwise defined , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains . in the case of conflict , the present document , including definitions will control . the invention provides a method to achieve quality examination of microarrays while still allowing the same arrays to be used for hybridization . the nanogold on a stained dna microarray could be dissolved with bromine - bromide treatment . the same array after destaining was subjected to hybridization and gold staining . this qualitative examination was simple and reliable , and it needed only an inexpensive pc scanner detector . because a flatbed scanner can easily detect a spot size of approximately 100 μm , this approach should be able to reach the sensitivity of 1 fmol or less with a simple flatbed pc scanner detector . the method can also be used in homemade and commercial microarrays . it can be applied to direct hybridization between probe dna and mrna without the need for pcr because of the charge - charge interaction for detection . better quantitative measurement should also be expected . the invention is related to a colorimetric method for quality control of an array . the quality analysis of probe spots is obtained by using gold nanoparticles &# 39 ; positive charges to label dna through electrostatic attraction . the spots may also be detected by a personal computer scanner . gold nanoparticles deposited on glass surface may be dissolved in a bromine - bromide solution . the same microarray treated with gold particles staining and de - staining may still be used for subsequent hybridization reactions without diminished efficiency . this approach makes quality control of individual microarray chips feasible . because dna microarray chips are very expensive , the method disclosed in this invention is to assure the quality of dna chips in a cost - saving and time - efficient manner . the method of the invention uses positively charged gold nanoparticles to detect dna microarray hybridization . commercially available positively charged gold nanoparticles , which are coated with amino groups on the surface can be used . [ sun , y . ; fan , w . h . ; mccann , m . p . golovlev , v . anal . biochem . 2005 , 345 , 312 - 9 ]. cationic nanogold labels anionic dna due to a charge - charge interaction . gold particles that deposit on the surface of dna chips are visible . the technique is easy to perform with sensitivity comparable to fluorescent dye labeling method . id . the approach is simple and the detection may be achieved by a simple personal computer scanner , which costs much less than a laser scanner . the method of the invention can be used as a platform for microarray users to compare the data to those from different laboratories and different array systems to obtain actual results . the method uses 250 nm gold nanoparticles that are coated with positively charged functional groups on the surface to stain arrays without silver enhancement [ cao , y . c . ; jin , r . ; mirkin , c . a . science , 2002 , 289 , 1757 - 60 ]. cationic gold particles attract to the anionic dna or rna molecules resulting in the deposition of gold particles on the surface . the results are visible and may be scanned directly by a high - performance flatbed scanner rather a laser scanner . gold nanoparticles are soluble in a bromine - bromide solution , which converts au 0 into au 3 + [ dequaire , m . ; degrand , c . ; limoges , b . anal . chem . 2000 , 72 , 5521 - 8 ]. the method combines these two steps to analyze a spotted array before hybridization . the same array may then be used for performing subsequent hybridization . oligonucleotide probes immobilized on glass surface and labeled with positively charged gold nanoparticles are visible to the naked eye . in bromine - bromide solution gold particles can be oxidized and form auric ions ( au 3 + ) and thus become soluble [ shearstone , j . r . ; allaire , n . e . ; getman , m . e . ; perrin , s . biotechniques , 2002 , 32 , 1051 - 7 ]. while the present disclosure is directed to the analysis of the quality of nucleic acid - based microarrays by binding with gold nanoparticles , the underlying methodologies for determining charge phenomena on solid - liquid interface can be adopted for the analysis of interaction of colloidal particles and biopolymers tethered on the surface of a microarray . models for describing surface charge on a microarray surface are known , such as the gouy - chapman - stern - graham model . [ behrens s h , grier d g . j chem phys . 2001 ; 115 ( 14 ): 6716 - 6721 ]. these models predict selective binding of colloidal particles to target molecules at a certain range of solution ph and solution ionic strength . an initial analysis of the optimal ph range for selective binding of nanoparticle and bio - polymers on a solid substrate can be performed by taking into consideration the chemical composition and the density of chemical groups on the substrate , as well as the composition and the size of the probe and target molecules . [ su , y . et al . anal biochem . 2007 feb . 15 ; 361 ( 2 ): 244 - 252 .] the models can be applied for determination of experimental conditions for characterization of the quality of microarrays comprising peptides , proteins and other biopolymers ( in addition to nucleic acids ), using detectable nanoparticles for staining and destaining as disclosed herein . for example , when the interaction of bovine serum albumin ( bsa ) with gold colloids and surfaces was studied to determine the surface charge and coverage , the results suggested that bsa binding to gold nanoparticles and gold surfaces occurs by an electrostatic mechanism when citrate is present . [ brewer s h , glomm w r , johnson m c , knag m k , franzen s . langmuir . 2005 sep . 27 ; 21 ( 20 ): 9303 - 9307 ]. prestaining an immobilized array by gold particles can eliminate defective arrays or non - homogenous spots . the same array could be used to do hybridization after dissolving gold particles . one could also acquire the intensity data of each spots before hybridization to compare with that after hybridization . staining with gold nanoparticles before hybridization provides a cost - efficient method to obtain characterization of a spotted array . gold nanoparticles deposited on the array surface could be dissolved by bromine - bromide solution . the same array could be used to hybridize with target dna . the technique was easy to operate and requires no expensive instruments . in conclusion , the method of using gold nanoparticles staining and bromine - bromide solution dissolving to qualify dna microarrays is an easy and inexpensive way to perform array quality control . the technique makes quality control and hybridization on each array possible . the bromine - bromide destaining methods for dissolving gold nanoparticles disclosed herein can be applied towards allowing the use of a nucleic acid microarray in a plurality of successive hybridization reactions . the method comprises the steps of : staining a microarray comprising target nucleic acids hybridized to complementary nucleic acid probes immobilized on a surface of the microarray with gold nanoparticles ; optionally , visualizing the stained pattern on the microarray ; and destaining the microarray by dissolving the gold particles with a bromine - bromide solution , wherein the destained microarray is suitable for a subsequent round of hybridization reaction analysis . in one embodiment , the bromine - bromide destaining solution is about 10 − 4 m br 2 in about 1m hbr . without intent to limit the scope of the invention , exemplary instruments , apparatus , methods and their related results according to the embodiments of the present invention are given below . note that titles or subtitles may be used in the examples for convenience of a reader , which in no way should limit the scope of the invention . moreover , certain theories are proposed and disclosed herein ; however , in no way they , whether they are right or wrong , should limit the scope of the invention so long as the invention is practiced according to the invention without regard for any particular theory or scheme of action . probes with the desired sequences , as used by sun and coworkers [ sun , y . ; fan , w . h . ; mccann , m . p . golovlev , v . anal . biochem . 2005 , 345 , 312 - 9 ], were synthesized ( mdbio , taipei , taiwan ) and dissolved in deionized water at a concentration of 2 . 0 μm . the sequences of the probes are listed in table 1 . the samples were dissolved in deionized water , followed by mixing with equal volume of 99 . 5 % dimethyl sulfoxide ( dmso ) to 1 μm . the mixed probes were spotted onto corning ultra - gaps slides ( corning , acton , mass ., usa ) with the spotbot personal microarrayer ( telechem international , sunnyvale , calif ., usa ). the delivery volume for each spot was estimated to be 12 . 5 nl with spot diameter of approximately 600 μm . the quantity of the probe dna was estimated to be 12 . 5 fmol . the spotted arrays were vacuum - dried at room temperature overnight . the probes were immobilized onto the slide surface by an ultraviolet ( uv ) crosslinker ( cl - 1000 , uvp , upland , calif ., usa ) with uv energy of 600 mj . gold nanoparticle - staining of dna microarrays was performed by using a protocol provided in the staining kit ag12 ( sci - tec , knoxville , tenn ., usa ). cationic nanogold particles attract negatively charged dnas due to charge - charge interactions . briefly , 10 μl of gold colloids and 4 μl of activator were mixed and left the solution standing for 1 min , followed by the addition of 500 μl of buffer . the gold solution was transferred to an array surface with 18 × 18 mm 2 area and incubated for 10 min at room temperature . the slide was rinsed in water and air - dried . gold particles that were aggregated from 250 - nm nanoparticles on hybridization spots were clearly visible . all staining results were scanned and analyzed by an auro - gen microarray system ( sci - tec ), which consisted of a modified personal computer scanner with software for data analysis . nanogold - stained arrays were incubated in a 1 - ml bromine - bromide solution with 10 − 4 m br 2 in 1 m hbr for 10 min to dissolve gold particles . the slides were subsequently washed thoroughly by deionized water and dried with air . these bromine - bromide - treated arrays were used for subsequent experiments . to dissolve nanogold - dna labeling and staining , nanogold - stained arrays were incubated with 1 ml bromine - bromide solution ( 10 − 4 m br 2 in 1m hbr ) for 10 min . the slide was washed thoroughly with deionized water and air dried . array prehybridization was processed with the following procedures . incubation of the array was performed in a buffer containing 5 × saline sodium citrate ( ssc ) and 0 . 1 % sodium dodecyl sulfate ( sds ) with 0 . 1 % bovine serum albumin ( bsa ) at 42 ° c . for 20 min . the array was subsequently washed with deionized water twice and then allowed to air dry . hybridization was completed as follows . the target double stranded dna , m13mp18 , was denatured at 95 ° c . for 10 min and then cooled on ice immediately for 5 min . the size of m13mp18 was 7250 bp . samples were prepared with approximately 600 fmol of denatured dna mixed with 10 μl of pronto ! universal hybridization buffer ( corning ). the total volume of the mixture was 20 μl . the mixture was pipetted onto the array surface and covered with a glass cover slip . hybridization was performed at 42 ° c . overnight . after hybridization was completed , the slide was washed with 2 × ssc and 0 . 1 % sds at 42 ° c . for 5 min and with 0 . 1 × ssc at room temperature twice for 2 min . the array was then dried by compressed air and stained by gold nanoparticles . a microrna ( mirna ) microarray ( ncode multi - species mirna microarray , invitrogen , carlsbad , calif ., usa ) was used to stain with gold nanoparticles . the array was treated with prehybridization solution at 42 ° c . for 20 min to wash away the solution for spotting process . the array was washed with deionized water twice and allowed to air dry . positively charged gold nanoparticles were used to stain the array , and the array was detected by a pc scanner detector as described previously ( fig5 ). the pattern was roughly the same between the first and second stainings . therefore , it indicated that our method of microarray staining by gold particles and destaining by bromine - bromide solution can be applied to commercially - available spotted microarrays . it was discovered that repeatedly staining and stripping of nanogold particles from dna arrays were feasible . gold particles deposited on array surfaces were stable and directly visible without using a laser scanner ( fig1 a ). the staining results were scanned by an inexpensive flatbed scanner and analyzed by imaging software for quantitative analysis of aggregates of gold nanoparticles . a gold dissolving solution , 10 − 4 m br 2 in 1m hbr , was added to dissolve gold particles on slides for 10 min . this staining - dissolution process was repeated three times . the very same array was stained and destained three times , and the results after the first and third stainings are shown in fig1 a and b , respectively . the third staining ( fig1 b ) was as strong as the first one ( fig1 a ), with a spot intensity correlation coefficient of more than 0 . 99 ( r 2 & gt ; 0 . 97 ) ( fig1 c ). the result indicated that the treatment of a gold nanoparticle - stained array with bromine - bromide solution to remove gold nanoparticles had little or no impact on the subsequent gold particle - staining efficiency . the concentration ratio of br 2 / hbr may be adjusted . it was found that if the concentration of hbr was too low , the concentration of br 2 must be raised , which would impact the results of hybridization , increase background noise , and even lose spots signals . if the concentration of hbr was increased , the background noise of dna array after hybridization would increase and make spots signals invisible the measurement of gold staining is due to the aggregation of nanogold into a micrometer size cluster . it is based on the colorimetric measurement similar to colloidal suspensions when colloid particles aggregate . it has a good linear relationship between the intensity and the quantity of nanoparticles . these results confirmed that staining of microarrays with gold nanoparticles and destaining with bromine - bromide solution to remove the gold nanoparticles did not change the staining efficiency of the gold particles . because gold nanoparticles are dissolved during the interaction with bromine - bromide solution , these gold nanoparticles cannot be used again for labeling . as shown in fig2 a - 2c , the gold dissolving solution could be used on a hybridized array . the staining and destaining process could also be applied to a hybridized array . the dna microarray was hybridized with denatured dna targets at 42 ° c . overnight . after hybridization and postwashing , the array was stained by nanogold . signals for the spots with complementary targets were clearly visible , whereas spots with noncomplement targets were not observed ( fig2 a ). bromine - bromide solution was then added to the array surface to dissolve and remove the gold particles . the same array was then stained by gold particles . the staining result was approximately the same as the first staining ( fig2 b ). the intensity coefficient correlation of these two staining results was greater than 0 . 99 ( r2 & gt ; 0 . 97 ) ( fig2 c ). repeated staining and destaining processes did not hurt the next staining efficiency for hybridized dna . target dna labeled with cy5 was used for hybridization . after hybridization , the fluorescent intensity was detected by a fluorescence detector . the array was also stained by gold nanoparticles and detected by the gold signal . to compare the fluorescent intensity and gold intensity , the coefficient correlation was 0 . 97 ( r2 & gt ; 0 . 94 ). the detection limits in the hybridization with cy5 and gold staining were comparable ( fig3 ). when a dna microarray is prepared by a spotter , poor - quality arrays can be made from defects in the spotting pins and / or inappropriate sample preparation . currently , it is not easy to pinpoint these bad chips or spots in a chip after fabricating . arrays fabricated without homology spots and / or with missing spots could be found with our approach . examples are shown in fig4 a and b . the defected arrays could be excluded from the hybridization process for quality control . only well - spotted arrays were picked for hybridization . with our approach , the quality of a spotted array could be thoroughly examined after array fabrication . when the probe density distributions of these spots were well documented , these defected arrays could still be used , if necessary the quality of a dna - spotted array was visible after array fabrication . arrays fabricated without homology and with missing spots ( fig4 a and 4b ) can be eliminated from subsequent experiments and only well spotted dna arrays used for hybridization . this ability to cull all substandard arrays is essential for maintaining array quality control ( array qc ). prehybridization treatment of a bromine - bromide solution was assessed . fig6 a shows the staining results of a dna microarray before prehybridization . the array was stained by gold nanoparticles . lane 1 : control probe ( taf2ht ); lane 2 : blank ( spotting control , 50 % dmso ); lane 3 : target probe ( pc101 ). the stained dna microarray was then dissolved by bromine - bromide treatment to remove gold nanoparticles . after removal of nanogold staining , the same dna array then performed hybridization and nanogold particle staining ( fig6 b ). fig6 a shows probe staining results of a dna array before hybridization . fig6 b shows staining results of a dna array after hybridization . in fig6 b , dna array had been stained for probes and destained with hbr / br2 , and subsequently hybridized with dna target . fig6 c shows the staining results of a dna array that was hybridized directly . m13mp1 , a phage dna , was the complementary target of pc101 , which was a probe design based on m13mp18 . to check the effects of gold staining and destaining on the hybridization process , we hybridized denatured target dna to two separate arrays in the same condition . for comparison , the other dna array was hybridized and stained with gold nanoparticles under the same condition but had not been treated with nanogold particle staining and dissolving process before the hybridization ( fig6 c ). array prehybridization , hybridization , postwashing , and staining with gold particles were performed in the same condition . in the experiment , no obvious differences between these two arrays were observed ( fig6 b and c ). therefore , hybridization specificity was maintained without any effect from the dissolution of gold particles with bromine - bromide solution . this result confirmed that quality arrays could be obtained without compromising the quality of hybridization . nanogold staining based on charge - charge interaction is reliable and simple for the characterization of dna chips . each hybridization spot on a chip could be characterized and documented . the nanogold on a stained dna microarray could be dissolved with bromine - bromide treatment . the same array after destaining was subjected to hybridization and gold staining . array prehybridization is an important step in array hybridization . we also tried to check any effect of prehybridization on nanogold staining with a pc scanner detector . there are two main purposes for prehybridization . the first is to block the array surface with short dna or other reagents so that nonspecific binding of dna to the surface is reduced to a minimum . the second is to wash off nonimmobilized probes . therefore , we pursued the effect of prehybridization on the staining process . we found that the spots stained by nanogold were weaker after prehybridization ( fig7 ). two major reasons were that ( i ) some oligonucleotides immobilized on the slide surface may be washed off to pursue hybridization with probes and targets at similar oligonucleotide sizes ( fig8 ). after hybridization was completed , signals from the complementary probe were approximately a factor of 2 of those from the noncomplementary probe ( fig8 ). this indicated that the signal reduction was mostly from the washout process on some probes that were weakly bound to the surface rather than from the change of electric charge . this result could also be used to explain the much weaker signals for the spots with noncomplementary probes ( fig2 ) compared with the corresponding spots ( fig1 ). one of the concerns about using nanogold labeling based on charge - charge interaction is the potential background from probe oligonucleotides that may reduce the distinction between hybridized spots and nonhybridized spots . in fig6 b and c , we observed a high distinction between signals from complementary and noncomplementary hybridization because the length of the target dna was much longer than that of the probe dna . with nanogold labeling using charge - charge interactions , we found that it was highly preferable to have target nucleic acids much longer than the probe dna . therefore , for long probes , such as those used for cdna arrays , the signal - to - noise ratio will be worse with this approach . all publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference . although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding , it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claim .	2
one or more of the present embodiments are explained according to fig1 with reference to the control of a technical system t in the form of a gas turbine . in the left - hand part p 1 of fig1 , an embodiment of the regulating method that is executed online during the operation of the gas turbine is represented . in contrast , in the right - hand part p 2 of fig1 , method acts with which parts of the method in the section p 1 are generated are represented . the method acts in the section p 2 are executed offline here ( e . g ., not during the operation of the technical system ) and constitute in this sense preparatory steps for the implementation of the method according to one or more of the present embodiments on a gas turbine . the control method of the turbine in the section p 1 includes a conventional regulating method based on a first regulator co 1 and a second regulator co 2 . the first regulator co 1 is realized in a manner known as a table - based regulator and outputs , for a state x of the gas turbine at the current time , an action a 0 that is to be carried out at the turbine . in this context , the actions that are to be carried out for corresponding states are stored in the table for the states . the second regulator co 2 is realized in the form of a learnt action selection rule . the states of the gas turbine include , for example , one or more of the state variables , described above , of a turbine , and the actions relate to the changes in one or more actuation variables of the gas turbine . these actuation variables may be the change in the setting of fuel ratios by one of more fuel injection valves , and the change in position of vanes in the gas turbine and , for example , of inlet guide vanes , as has also been described above . according to fig1 , the regulator co 1 therefore determines an action a 0 based on the current state x of the gas turbine by accessing a table . the current state x and the action a 0 are supplied to the regulator co 2 in the form of a learnt action selection rule . this rule includes a simulation model sm of the gas turbine that models the dynamic behavior of the turbine . this simulation model interacts with a control rule cp that determines an optimum first action a 1 as a function of the current state x of the gas turbine by taking into account the action a 0 . the degree to which an action is optimum is based on a suitable reward function . the simulation model sm was previously learnt by a neural network nn that accesses a database db in which training data in the form of states x previously assumed by the technical system , actions a carried out in these states , and resulting subsequent states x ′ are stored . the control rule cp was generated by a control generator cg that accesses the training data from the database db . the regulator co 2 therefore outputs , as a function of a current action x , an action a 1 that is to be executed on the technical system . such types of regulators are known from the prior art and are therefore not described in detail . for example , the regulator co 2 may be based on a recurrent neural network , as is described , for example , in document [ 4 ] below . in the embodiment of the regulator described , the regulator is realized as an offset regulator that specifies an offset or a variation that is added to the action a 0 . as a result of this , the first action a 1 is obtained . conventionally , this action a 1 is supplied to the regulator co 1 , which then carries out this action as action a on the technical system . the states x that are assumed by the gas turbine and the actions a that are carried out in these states , with resulting subsequent states x ′, are stored in the database db , which has already been mentioned above and which may be used to learn the neural network nn or the control generator cg . within the scope of the method according to one or more of the present embodiments , an exploration module em is provided as a further module . the exploration module em may be connected as required and therefore used within the scope of the regulation of the gas turbine . when the exploration module is connected , the first action a 1 is no longer supplied directly to the regulator co 1 but instead is transferred to the exploration module em and to the action selection module as there . in addition , the exploration module receives the current state x of the gas turbine . the exploration module em serves to explore the space of the states of the gas turbine ( e . g ., to search for states that have not been assumed by the gas turbine ). since this module is used during the ongoing operation of the technical system , the exploration of new states is to occur in an imperceptible way . the new states are to be selected such that the operation of the gas turbine is not perceptively impaired . for example , the emissions of pollutants and / or the combustion chamber accelerations and therefore the humming of the combustion chamber should not increase too much . an exploration rule ep that may be defined differently depending on the refinement is stored in the exploration module em . the exploration rule specifies here , based on the current state x of the gas turbine , a second action a 2 , which is in turn an offset or a variation that is added to the first action a 1 in the event of the exploration rule being applied . the exploration rule may be realized in different ways depending on the application case . for example , the exploration rule may randomly determine a second action a 2 based on the current state x . the exploration rule may be defined based on the methods in documents [ 1 ] to [ 3 ] below or may be an ε greedy exploration , which is known . the exploration rule may , if appropriate , be defined by expert knowledge . the second action a 2 , which is determined with the exploration rule , is supplied to the action selection module as , which interacts with a simulation model sm of the gas turbine . this simulation model corresponds to the simulation model of the regulator co 2 and was determined by the learning of the neural network nn . in the action selection module as , the simulation model sm determines which subsequent states x ′ of the technical system the application of the action a 1 varied with the action a 2 will lead to . in this context , the subsequent states are considered for a predetermined future time interval . in the action selection module as , predetermined value ranges for specific state variables of the subsequent states of the gas turbine are stored . for example , in this context , an upper threshold value for the humming of the combustion chamber and / or the emissions of nitrogen oxide are stored . if this threshold value of the state variables is exceeded by at least one of the subsequent states , the second action a 2 is not permissible . in this case , the originally determined action a 1 is transmitted by the action selection module to the regulator co 1 , which then carries out this action . if , in contrast , the corresponding threshold values of the state variables of the subsequent states are not exceeded , the second action a 2 , which is determined by the exploration rule ep , is fed to the regulator co 1 in addition to the action a 1 . the regulator then carries out the sum of the two actions . in this way , it is provided that exploration of the state space of the gas turbine to the extent of new states is carried out only when specific limiting values of the emission of pollutants and of the humming of the combustion chamber are not exceeded . this results in the operation of the gas turbine not being adversely affected by the exploration . the exploration therefore takes place in an imperceptible way and is not perceived by the operator of the gas turbine . in modifications of the method described above , if appropriate , a plurality of exploration rules ep may also be stored in the exploration module em . in this context , a plurality of second actions a 2 are determined by the exploration modules , and subsequently , all the second actions having subsequent states that lie within the corresponding limiting values of the state variables are determined . an action is then selected from these second actions in accordance with a predetermined criterion . this may be , for example , the action that gives rise to subsequent states having state variables that are furthest away from the threshold values if the priority is placed on safe operation of the technical system . if , in contrast , the priority is placed on good exploration of the state space , that second action a 2 , which gives rise to subsequent states having state that variables are closest to the corresponding threshold values , may also be used . the exploration module em may , if appropriate , also be used in a regulating method that uses only the table - based regulator co 1 . in this case , the first action corresponds to the action a 0 that is sent to the exploration module em and processed there in a way analogous to that described above . the embodiment of the method according to one or more of the present embodiments that is described above has a series of advantages . for example , exploration of the state space of the technical system to the extent of new states is also achieved imperceptibly within the scope of regulated operation of a technical system . these new states together with the actions carried out therein , and the subsequent states therefore extend the set of data relating to the technical system . the data may be used as training data in corresponding methods for learning simulation models or action selection rules of the technical system . within the scope of the exploration , the exploration does not give rise to undesired operating states of the technical system that , under certain circumstances , trigger warnings or alarms . instead , the exploration is configured by defining corresponding threshold values such that the exploration takes place imperceptibly and does not adversely affect the operation of the technical system . the elements and features recited in the appended claims may be combined in different ways to produce new claims that likewise fall within the scope of the present invention . thus , whereas the dependent claims appended below depend from only a single independent or dependent claim , it is to be understood that these dependent claims may , alternatively , be made to depend in the alternative from any preceding or following claim , whether independent or dependent . such new combinations are to be understood as forming a part of the present specification . while the present invention has been described above by reference to various embodiments , it should be understood that many changes and modifications can be made to the described embodiments . it is therefore intended that the foregoing description be regarded as illustrative rather than limiting , and that it be understood that all equivalents and / or combinations of embodiments are intended to be included in this description . [ 1 ] michael kearns and satinder singh , “ near - optimal reinforcement learning in polynomial time ”, in proceedings of the 15th international conference on machine learning , pp . 260 - 268 ( 1998 ). [ 2 ] ronen i . brafman and moshe tennenholtz , “ r - max — a general polynomial time algorithm for near - optimal reinforcement learning ”, journal of machine learning research , 3 , 213 - 231 , ( 2003 ). [ 3 ] alexander l , strehl and michael l . littman , “ an analysis of model - based interval estimation for markov decision processes .”, journal of computer and system sciences , 74 ( 8 ), 1309 - 1331 , ( 2008 ).	6
referring now to fig1 the actuator is shown as connected to a mini - vent 10 and a main window 12 , each of which is independently movable generally upwardly but slightly inclined to the right as indicated by the side edges of the main window 12 . suitable guide and sealing means are provided between the adjacent edges of the closure members . the mini - vent includes a bracket 14 having an elongated slot 16 therein which receives a pin 18 carried at the end of an arm 20 which has a fixed pivot mounting indicated at 22 . the arm 20 has a cam follower indicated generally at 24 which is movable in a cam slot 66 provided in an actuating gear 28 . as will be described subsequently , the cam slot 66 includes an inclined camming portion effective to move the arm 20 between the limiting positions shown , and another portion which is concentric with the pivot mounting 30 of the gear . when the follower is in the concentric portion of the cam slot , the arm 20 is of course retained against movement while the gear may be further rotated to produce movement of the main window . the gear 28 is driven in rotation by a pinion 32 which may in turn be driven by a hand crank or if desired , by power means . the periphery of the gear 28 includes an untoothed portion referred to herein as a toothed gap , the location of which is indicated at 34 for a purpose which will presently appear . the main window 12 is vertically movable by means which include an upwardly inclined guide tube 36 and a rod ( not shown ) in said tube fixedly secured to a bracket 38 which is attached to the lower edge of the window 12 . vertical movement of the rod in the tube effects guided generally up and down movement of the window in a manner which is familiar in the art such for example as shown in werner u . s . pat . no . 3 , 280 , 509 . a transmission which includes push - pull mechanism indicated generally at 40 is connected between the input pinion 32 and the window supporting rod . this may comprise a flexible cable the major portion of which is confined within a tube 42 . the cable is wrapped with wire which transforms it into a flexible rack 44 engageable with one side of a driving rack pinion later to be described , which constitutes a part of a compound pinion 46 . in fig1 the portion of the flexible rack engageable by the rack driving pinion which forms a part of the compound pinion 46 is shown in elevation but it will of course be understood that in the actual construction a portion of the tube 42 in which the flexible cable is longitudinally movable is cut away at only one side to permit meshing engagement between the teeth of the rack driving pinion and the flexible rack . as more fully described in the werner patent identified above , the flexible rack , by virtue of being confined in the tube 42 , can serve as an effective motion transmitting means both in tension and compression . in other words , the flexible rack constitutes a push - pull element which may be suitably connected to the bracket 38 , which in turn is connected to the lower end of the main window 12 . the arm 20 is shown in its two limiting positions and the main window bracket 38 is also shown in its two limiting positions . in accordance with the present invention , rotation of a hand wheel or other actuator connected to the pinion 32 is effective to move the mini - vent 10 from closed to open position and continued movement of the pinion 32 in the same direction then initiates downward movement of the main window 12 which is carried to completion . reverse movement of the pinion 32 first moves the main window 12 and then moves the mini - vent 10 to its closed position . referring now to fig2 and following , the actuator construction is shown in enlarged scale . the construction illustrated in its entirety in fig2 and 3 comprises a mounting plate 50 of generally rectangular configuration and provided adjacent its corners with openings 52 by means of which the plate may be attached to suitable support structure inside the vehicle door . the plate 50 is a sheet metal stamping and is configurated as best illustrated in sectional views 10 and 11 . for example , in fig1 a rib 54 is provided having a convexly rounded top surface engageable with the gear 28 to support the gear while at the same time minimizing frictional resistance to its rotation . connected to the support plate 50 is a mounting bracket 56 , the two plates preferably being welded together and adapted to support movable elements of the operator as will subsequently be described . the support plate or bracket 56 is also in the form of a sheet metal stamping configurated to provide suitable reinforcement and to cooperate with the movable elements of the operator . thus , as seen in fig1 , the edge of the support plate or bracket 56 is reversely bent as indicated at 58 to provide a convexly rounded support surface engageable with the opposite side of the gear 28 . the surfaces of the rib 54 and the bent portion 58 provides adequate support for the gear 28 . the pinion 32 for rotating the gear 28 is journaled for rotation in housing cup 60 welded or otherwise suitably secured to the mounting plate 50 , and an opening 62 is provided in the support plate to receive the shaft portion at one end of the pinion 32 . in order to provide for swinging movement of the arm 20 between the positions illustrated in fig2 and 3 , the gear 28 is provided with a cam slot 66 having the major portion thereof extending concentrically with respect to the pivot mounting 30 of the gear 28 . the pivot mounting 22 of the arm 20 is best seen in fig1 and comprises a rivet extending through registering openings adjacent one end of the arm 20 and in the support plate 56 . the arm 20 adjacent the pivoted end thereof is provided with a cam follower indicated generally at 68 . the cam follower includes a follower roller 70 , preferably formed of a low friction material such for example as an acetyl resin , having an annular groove intermediate its ends , the ends of the roller being enlarged as indicated at 74 . the reduced intermediate cam follower portion of the roller is indicated at 76 . the cam slot 66 is provided at one end with a circular enlargement 77 of a size which permits the roller to be introduced into alignment with the slot and then moved longitudinally along the slot with the edges of the slot received in the annular groove 79 . adjacent one end , the slot 66 includes an abruptly radially inwardly curved portion 78 . it will be apparent that when the follower 76 of the arm 20 occupies the position shown in fig2 it is at the inner end of the abruptly curved portion 78 of the cam slot . accordingly , as the gear 28 is moved clockwise from the position illustrated in fig2 the follower roller is forced to move along the path indicated at 80 concentric with the pivot mounting 22 of the arm 20 , until the arm reaches the position illustrated in fig3 . at this time the cam follower portion 76 occupies a portion of the slot 66 which is concentric with the pivot mounting 30 of the gear 28 . accordingly , at this time continued rotation of the gear 28 may take place without causing movement of the arm 20 . the additional movement of the gear 28 as referred to , which takes place without movement of the arm 20 , is used to effect longitudinal movement of the flexible rack 44 . for this purpose a compound pinion element 46 , best illustrated in fig1 and 13 , is provided . the compound pinion element is mounted for rotation by a pin 84 and includes a first pinion portion 86 having teeth adapted to mesh with the teeth on the toothed portion of the gear 28 . in addition , the compound pinion element 46 includes a cable drive rack pinion portion 88 the teeth of which are adapted to mesh with the rack teeth formed by the wire convolutions indicated at 90 surrounding the flexible cable 92 , these elements together making up the flexible rack 44 . it will be observed that the pin 84 extends between the mounting plate 50 and the support plate 56 , thus providing a secure mounting for the compound pinion element 46 . it will be observed from fig1 that the flexible rack , at the point where it is in mesh with the rack pinion 88 , is supported by an appropriately curved shoulder portion 94 of the mounting plate 50 . it may further be observed from fig1 that the mounting plate is suitably stamped as indicated at 96 to receive a portion of the tube 42 extending between the plates . as best seen in fig4 the gear 28 has a portion of its periphery provided with teeth 98 , these teeth being discontinued throughout a gap indicated at 100 , so that at one side of the gap there is provided a tooth designated at 102 which is adapted to move into and out of mesh with the gear pinion 86 . associated with the gear 28 at the gap is a stop plate 104 adapted to be welded or otherwise secured to the gear 28 as indicated at 106 . as best illustrated in fig1 the stop plate 104 is formed as a sheet metal stamping having an arcuate channel 107 designed to permit movement of the cam follower roller 70 therethrough and includes a peripheral portion 108 shaped to extend beyond the upper end of the gear pinion 86 as seen in this figure , into engagement with stop cam 110 provided on the compound pinion element 46 . the stop cam 110 , as best illustrated in fig1 may conveniently be formed integrally with the compound pinion and includes a concave arcuate stop surface 112 the radius of curvature of which is equal to its displacement from the pivot mounting of the gear 28 . the arrangement is such that as the gear 28 is rotated in a counterclockwise direction , the tooth 102 moves out of meshing engagement with the teeth of the gear pinion 86 just as the arcuate stop surface 112 moves into engagement with a flange 114 provided at the edge of the stop plate 104 . thereafter , the gear may continue to rotate although no rotation is transmitted to the pinion 86 , which is out of mesh with the teeth of the gear . at the same time , the compound pinion element 46 is blocked against rotation as a result of engagement between the surface 112 of the compound pinion and the confronting surface of the flange 114 . the foregoing is more readily apparent from an inspection of fig5 - 9 . in fig5 the tooth 102 of the gear 28 is positioned between teeth designated 116 and 118 of the pinion 86 . at this time the arcuate concave surface 112 of the stop cam 110 engages the outwardly convex surface 120 of the flange 114 of the stop plate 104 . further counterclockwise movement of the gear 28 is permitted since its tooth 102 will not engage the tooth 118 of the pinion 86 . at the same time the surface 120 of the stop cam 110 engages the concentric surface of the flange 114 so that as the gear 28 rotates in a counterclockwise direction , the pinion 86 is blocked against rotation . since the pinion 86 is formed as an integral part with the flexible rack drive pinion 88 , this means that the flexible cable is blocked against longitudinal movement and the main window 12 is thus blocked against vertical movement . this means that at this time the main window cannot be opened by forces applied directly to the window , constituting a safety feature . referring now to fig6 it will be observed that the flange 114 of the stop plate has an abruptly curved tail portion 122 . as the gear 28 moves clockwise from the position shown in fig5 to the position shown in fig6 the concave cam surface 112 of the stop cam 110 is moved to the position illustrated by engagement between teeth 102 and 116 . fig7 illustrates the relative position produced by further clockwise movement of the gear 28 at which time the second tooth of the gear engages the tooth 118 of the pinion 86 , the concave stop surface 112 having moved into engagement with the abruptly curved end portion 122 of the flange . the positions illustrated in fig8 and 9 represent the result of further movement and illustrate the gear 28 as assuming driving relation to the pinion 86 with of course no interference between the flange 114 of the stop plate 104 and the concavely curved surface 112 of the stop cam 110 . it is apparent from fig1 that the rack pinion 88 , the gear pinion 86 , and the stop cam 110 all occupy different planes of rotation so that while the stop plate 104 moves from a position of engagement with the stop cam 110 , the compound cam element 46 may make a plurality of revolutions . briefly reviewing the operation , and referring particularly to fig2 and 3 , fig2 may be considered as representing the relationship of parts after the arm 20 has just been moved to its uppermost position , thus moving the mini - vent 10 to closed position . the rotation of the gear 28 which moved the arm 20 to the position illustrated in fig2 had previously moved the main window 12 to closed position . at this time it will be observed that the flange 114 of the stop plate 104 is engaged with the concave cam surface of the stop cam 110 . if now , the driving pinion 32 is rotated in a counterclockwise direction , the result will be to rotate the gear 28 in a clockwise direction . at this time the gap 100 of the gear 28 is opposite the pinion 86 so that rotation of the gear will not effect rotation of the pinion and in fact , rotation of the pinion is blocked by engagement between its cam surface 112 and the surface of the flange 114 of the blocking plate 104 . however , clockwise rotation of the gear 28 will immediately cause counterclockwise swinging movement of the arm 20 about its pivot mounting 22 as a result of the engagement between the cam follower portion 76 and the abruptly curved portion 78 of the cam slot 68 . this movement of the arm 20 is completed by the time the gear 28 has moved to a position such that the cam follower portion 76 enters into the portion of the cam slot 66 which is concentric with the pivot mounting of the gear . at this time of course further rotation of the gear will not result in movement of the arm 20 and it will be retained in the lowermost position illustrated in fig3 . just as the cam follower portion 76 enters into the portion of the cam slot 66 which is concentric with the gear 28 , the sequence of events illustrated in fig5 - 9 occurs , as a result of which the toothed portion of the periphery of the gear 28 enters into a meshing condition with the pinions 86 which is thus driven in rotation , rotation of the pinion 86 and hence of the rack pinion 88 is permitted as a result of disengagement of the flange 114 of the stop plate 104 from the concave cam surface 112 of the stop cam 110 . continued rotation of the gear pinion 32 will result in continued rotation of the gear 28 , which in turn will result in multiple rotation of the pinions 86 and 88 in a counterclockwise direction as seen in fig2 and 3 . this means that the portion of the flexible rack or cable 44 in mesh with the pinion 86 is pushed upwardly , which results in downward movement of the end of the flexible rack connected to the bracket 38 . this in turn will result in movement of the window 12 from the full line position illustrated in fig1 to the lower dotted line position thereof . while the flexible rack is subjected to compressive forces at this time , it is confined in the tube 42 or in a suitably formed confining portion of the tube 36 which guides the window support bracket 38 . in order to accommodate the length of the flexible rack moving past the pinion 46 as the window 12 is moved upwardly , there is provided a curved tube 126 adapted to receive and confine such portion of the flexible rack . when the window 12 reaches the fully opened position illustrated in dotted lines in fig1 its further movement is arrested . in order to close the window , the input manually operated pinion 32 is driven in the reverse direction ; namely , in a clockwise direction , thus imparting counterclockwise movement to the gear 28 which in turn will result in clockwise movement of the pinions 86 and 88 and will cause corresponding downward movement of the flexible rack 44 past the pinion 88 . this continues until the window 12 reaches the uppermost fully closed position at which time the coaction between the stop plate 104 and the stop cam 110 prevents further rotation of the pinions 86 and 88 while the abruptly curved portion 88 of the cam slot 66 moves the mini - vent actuating arm 20 clockwise or upwardly to close the mini - vent .	4
in fig1 there is shown a foot pressure adapter 10 having a shoe 12 worn by a person indicated by the ankle 14 , first , second , and third shoe - mounted adapter portions 16a - 16c , respectively , of four shoe - mounted adapter portions 16a - 16d ( 16d is shown in fig2 but not fig1 ) and an adjustable portion 18 of the foot pressure adapter 10 . the shoe 12 , the first , second , third and fourth shoe - mounted adapter portions 16a - 16d and the adjustable portion 18 cooperate together to provide pressure adjustment of the foot during motion for greater comfort , effectiveness , and freedom from injury , particularly in sports . the fourth shoe - mounted adapter portion 16d is hidden from view in fig1 but its location is shown in fig2 . while a specific shoe 12 is shown in fig . the invention may be applied to any type of footwear and may be an integral part of the footwear or formed separately or parts of it may be sold separately from the shoe as a kit with the first , second , third and fourth shoe - mounted adapter portions 16a - 16d being later attached such as by an adhesive . the first , second , third and fourth shoe - mounted adapter portions 16a - 16d are fasteners for fastening to corresponding parts of the adjustable portion 18 and may be of different types . in the preferred embodiment , the first , second , third and fourth shoe - mounted adapter portions 16a - 16d and their corresponding mating portions on the adjustable portion 18 are interlocking fabric members known generically as hook and loop fasteners . in the preferred embodiment , the hook and loop fasteners are of the type sold under the trademark poly - lock by consumer care located at sheboygen falls , wis . or of the type sold under the trademark velcro by velcro u . s . a . inc . located at manchester , n . h . but other types of fasteners may be used such as buttons or snap - on fasteners . although in the preferred embodiment the upper and lower fastening points are held together by adjustable and removable fastener members , some of the removable fasteners may be replaced by stitching the shoe and strap together . with this arrangement , some flexibility in the adjustability of the foot support is lost when parts of the straps are stitched to the shoe but this embodiment may under some circumstances be desirable . however , there should always be at least one fastener which is removably attachable with its corresponding mating part to permit a foot to be easily inserted and removed . preferably , the removable fastener is a lower one . in fig2 there is shown an exploded perspective view of the foot pressure adapter 10 , having outside and inside members or sections 20 and 22 which overlap to form a common adjustable portion 18 . the outside section 20 is a right - hand section in fig2 and the inside section 22 is a left - hand section in fig2 . the outside and inside sections 20 and 22 are designed to cooperate together and , in the preferred embodiment , are designed to be movably fastened together so that the sections are easy to use and yet permit adjustment of pressure on the foot during use . in the embodiment of fig1 and 2 , the shoe laces are not used but shoe laces may be used if desired . although the right - hand section 20 and the left - hand section 22 , in the preferred embodiment , are fabricated as separate units , they may be one combined unit with the adjustability built in by stretchable members or flexible members which may be , accordion - like , changed in size . the right - hand section 20 includes a first shoe - adjusting portion 30 , a strap portion 32 , a second shoe - adjusting portion 34 and a right - left adjusting section 36 . similarly , the left - hand section 22 includes a first shoe - adjusting portion 40 , a strap portion 42 , a second shoe - adjusting portion 44 and a right - left adjusting section 46 . the first and second shoe - adjusting portions 30 , 40 , 34 and 44 , strap portions 32 and 42 , and the right - left adjusting portions 36 and 46 serve substantially the same function for opposite sides of a shoe in the right - hand section 20 and left - hand section 22 and are not described separately in their entirety with the understanding that the descriptions of one will , in appropriate cases , be applicable to the descriptions of the other . the first shoe - adjusting portion 30 , the second shoe - adjusting portion 34 and the right - left adjusting section 36 are all attached to a single flexible member and the strap portion 32 is formed in the single flexible member . similarly , the first shoe - adjusting portion 40 , the second shoe - adjusting portion 44 and the right - left adjusting section 46 are attached to a single plastic member and the strap portion 42 is formed in the plastics member . as best shown in fig2 each of the shoe - mounted adapter portions 16a through 16d receives a corresponding one of the shoe - adjusting portions 30 , 44 , 34 and 40 to stretch the strap portions 32 and 42 over the arch of the foot from a location near the heel of the shoe to a location near the tongue of the shoe on the opposite side of the arch of the foot . with this structure , the right - hand and left - hand adjustment portions 20 and 22 work together to form supports which are adjustable in position and extend over the arch and then downwardly to the bottom of the arch . the adjustable portion 18 is completely removable and replaceable and adjustable at four locations to accommodate the particular support that is needed . however , if desired , fewer than all four of the shoe - adjusting portions need be removable so that the sides of the shoe can be spread to insert a foot with the others remaining permanently in place . moreover , instead of hook and loop fasteners , other materials , such as buttons or hooks , may be used to fasten the members in place . in fig3 there is shown a bottom view of the right - hand and the left - hand sections 20 and 22 of the adjustable portion 18 ( fig1 and 2 ) of the foot pressure adapter 10 ( fig1 and 2 ) having from left to right as shown in fig2 the left - hand first shoe - adjusting portion 40 , the left - hand strap portion 42 , the right - left adjusting portion 46 , the right - hand second shoe - adjusting portion 34 , the left - hand second shoe - adjusting portion 44 , the right - left adjusting portion 36 , the right - hand strap portion 32 , and the right - hand first shoe - adjusting portion 30 . the right - left adjusting sections 36 and 46 each contain fingers which are interleaved with the fingers of the other right - left adjusting section . this interlocking relationship of the right - hand and left - hand sections 20 and 22 permit both the right - hand and left - hand first shoe - adjusting portions 30 and 40 to be positioned on the bottom of the adjustable portion 18 and adjacent to each other and both the right - hand and left - hand second shoe adjusting portions 34 and 44 to be positioned on the bottom of the adjusting portion 18 at the left and right extremes of the adjustable portion 18 . thus all four of the shoe adjusting portions 40 , 34 , 44 , and 30 face in the same direction and downwardly . to adjustably fasten the second shoe - adjusting portion 44 to the second shoe mounted adapter portion 16b ( fig2 ), the second shoe - adjusting portion 44 is a hook and loop fastening member 50 attached to the right - left adjusting section 46 such as by an adhesive to form a single unit therewith . to permit easy adjustment , the underside of the bottom hook and loop fastening member 50 is adapted to engage the second shoe mounted adapter portion 16b ( fig2 ) in any of a plurality of positions . with this arrangement , the adjustable portion 18 and the shoe - mounted adapter portions 16a - 16d may be fastened in any of angular positions with respect to each other or may be directly aligned and may be offset slightly to only partly overlap or more fully coincide depending on the user &# 39 ; s comfort . in fig4 there is shown an exploded perspective view of the adjustable portion 18 illustrating one method of forming the interlocking relationship between the outside and inside sections 20 and 22 . as shown in the view , the right - left adjustment sections 36 and 46 each include a different one of the two sets of fingers 54a - 54i and 56a - 56i respectively . the individual fingers of each set of fingers is spaced from adjacent fingers by apertures to receive the other set of fingers in an interlocking relationship . in the preferred embodiment , the two sets of fingers are integrally formed with corresponding ones of the right - hand strap portion 32 and the left - hand strap portion 42 , each being cut from a single flexible plastic member to be able to bend around a shoe to provide support thereto . each of the plurality of fingers 54a - 54i and each of the plurality of fingers 56a - 56i are spaced from the adjacent fingers in the same set a sufficient distance to permit fingers of the opposite set to fit between them in an interlaced fashion so that the right - hand and left - hand sections 20 and 22 are adjustably connected with the right - left adjustment sections 36 and 46 and strap portions 32 and 42 overlapping . in the preferred embodiment , the fingers are formed by cutting slots in a single piece of plastic , leaving a section at the end . the right - hand right - left adjustment section 36 has an integrally formed end section 58 to which the second shoe adjustment portion 34 is attached and the left hand right - left adjustment section 46 has an integrally formed end section 60 to which the second shoe adjustment portion 44 is attached . one of the end sections , which in the illustrated embodiment is the end section 60 , includes a plurality of slots 62a - 62h connecting the slots between corresponding ones of the fingers 56a - 56i to permit the fingers 56a - 56i to be separated for insertion between the fingers 54a - 54i . the second shoe adjusting portion 44 closes these slots in the end section 60 to hold the right and left hand sections 20 and 22 together . with this arrangement , the second shoe - adjusting portion 44 ( fig2 and 4 ) is fastened to the second shoe mounted adapter portion 16b ( fig2 ) slightly beyond the median of the arch of a foot and the strap portion 42 pulled over the median of the arch and downwardly so that the left - hand first adjusting portion 40 ( fig2 and 4 ) is fastened at a location inwardly and close to the side of the arch . a similar member overlaps and exerts the same type of pressure on the opposite side of the foot with the pressure adjustment members being adjustable in an angle to change the direction of the pressure as the foot is articulated . to make a foot pressure adapter 10 , the shoe mounted portions 16a - 16d ( fig1 and 2 ) may be sewn in place or , if it is desirable to utilize a kit , adhesive may be used to position the hook and loop . the area of the hook and loop must be sufficient to provide holding power and support in the use of the shoe and have enough area to permit positioning at different angles . the area of the shoe mounted portions 16b and 16c fig1 and 2 ) at the top fastening position should be between one and ten square inches and the corresponding hook and loop section of the adjustable portions 44 and 34 ( fig2 and 4 ) should have an area within the corresponding range but not necessarily the same area . the areas are chosen to permit partial overlapping but also to permit at least one square inch of engaging surfaces . the area of the hook and loop fastening members in the lower fastening position should be in a similar range of areas . to fabricate the adjustable portion of the foot pressure adapter , in the preferred embodiment , strips are cut out or molded of strong flexible plastic and the hook and loop or other fasteners are fastened in place . to form the interlaced section , open fingers such as the plurality of fingers 54a - 54i ( fig4 ) are cut with spaces between them sufficiently wide to accommodate the fingers of the mating member so that the right and left - hand portions 20 and 22 ( fig2 and 4 ) may be interlaced to expose their fastening members on the bottom side . the second pressure members may be utilized to close the ends of the plurality of fingers shown at 54a - 54i and the corresponding parts on its mating member such as by adhesive or heat sealing or solvent sealing or stitching or the like . in fig5 and 6 , there are shown an exploded perspective view and a bottom view of another embodiment of the foot pressure adapter , similar to the foot pressure adapter 10 and made in the same manner except that one end of each adjustable member ( referred to in the embodiment of fig5 and 6 by the reference numeral 18a ) is connected to the inside surface of the shoe or under the insole 17 so that it is above the shank of the shoe and under the medial longitudinal arch of the foot instead of being on the outside surface of the shoe . in fig5 there is shown a portion of a foot pressure adapter having a shoe 12a , first , second , third and fourth shoe - mounted adapter portions 16e - 16h , and the insole 17 of the shoe respectively . the shoe - mounted portion 16g and insole 17 are exploded away for illustration but the shoe mounted portion 16g is actually fastened at 16i under the insole 17 in the preferred embodiment for comfort of the user although the shoe mounted portions 16e and 16g can be mounted above the insole 17 instead of below it . a corresponding adjustable portion 18a of this embodiment of foot pressure adapter is shown in fig6 . the shoe 12a , the first , second , third and fourth shoe - mounted adapter portions 16e - 16h and the adjustable member 18a are directly analogous to the correspondingly numbered parts of the embodiment of fig1 - 4 and cooperate together in the same manner to provide pressure adjustment of the foot during motion for greater comfort , effectiveness , and freedom from injury , particularly in sports . however , the adapter portions 16e - 16h and adjustable member 18a are adapted to mount to the inside surface of the shoe 12a . in fig6 there is shown a bottom view of the foot pressure adapter of the common adjustable portion 18a having outside and inside members or sections 20a and 22a , which overlap . the outside and inside members 20a and 22a of the common adjustable portion 18a are substantially the same as the outside and inside members 20 and 22 of common adjustable portion 18 of the embodiments of fig1 - 4 except that the shoe adjusting portions 40a and 30a face in the opposite directions and are on opposite sides of the flexible strips forming the adjustable portion 18a from the shoe adjusting portions 34a and 44a in the embodiment of fig5 and 6 instead of all of the shoe adjusting portions facing in the same direction and being attached to the same side of the flexible strips of the common adjustable portion as is the case with the shoe adjusting portions 40 , 34 , 44 , and 30 in the embodiment of fig1 - 4 . the reason the shoe adjusting portions 40a and 30a face in the opposite directions and are on opposite sides of the flexible strips forming the support for the entire adjustable portion 18a from the shoe adjusting portions 34a and 44a , is that the shoe adjusting portions 40a and 30a are mounted to an inside surface of the shoe 12a . thus , the shoe adjusting portions 34a and 44a fit outside of the shoe 12a and are fastened to the shoe mounted adjustable portions 16h and 16f ( fig5 ) and the shoe adjusting portions 40a and 30a extend inside the shoe and are fastened to the shoe - mounted adjusting portions 16e and 16g . for this purpose , the shoe adjusting portions 40a and 30a face the opposite surface of the flexible backing member from the shoe adjusting portions 34a and 44a . to provide support to a foot , the foot pressure adapter 10 is positioned to maintain the foot in proper alignment and reduce over extension . when in use , as the foot is being articulated , it is held in a pre - selected manner by the foot support 10 to : ( 1 ) keep the foot aligned ; and ( 2 ) prevent over supination and over pronation . to adjust the foot pressure adapter 10 , the user attaches the adjustable portion 18 or the adjustable portion 18a to the shoe . the adjustable portion 18 is adjusted by the user after putting the shoe on his or her foot . in attaching the adjustable portion 18 , the second shoe - adjusting portions 34 and 44 ( fig2 and 4 ) are first positioned on the corresponding second and third shoe - mounted adapter portions 16b and 16c ( fig2 ). in positioning the second shoe - adjusting portions 34 and 44 ( fig2 and 4 ) on the corresponding second and third shoe - mounted adapter portions 16b and 16c ( fig2 ), an angle is selected along the direction of the medial foot arch . with this angle , the second adjustment portions 34 and 44 may slant together at the lower part of the arch and apart at the top or the reverse of this angular direction and may make any of a plurality of angles with respect to each other to accommodate different directions and amounts of support along a portion of the arch . after the second shoe - adjusting portions 34 and 44 ( fig2 and 4 ) have been positioned and fastened to the second and third shoe mounted adapter portions 16b and 16c ( fig2 ), the right and left - hand first shoe - adjusting portions 30 and 40 ( fig2 and 4 ) are pulled backwardly and fastened to the the first and fourth shoe mounted adapter portions 16a and 16d ( fig2 ) to provide the desired amount of support . this amount can be tested by articulating the foot to be sure that resistance is provided when the foot is articulated to its useful extremes to prevent over extending the foot . the angle of motion can be controlled by adjusting the pressure and some guidance can be provided by the appearance of the heel of the shoe so that an adjustment may be made which compensates for wear on the outer or inner edges of the heel indicating unaligned movement . in attaching the adjustable portion 18a , the first shoe adjusting portions 30a and 40a are attached to the corresponding third and fourth shoe mounted adapter portions 16g and 16e under the insole . the user then puts the shoe on his or her foot and selects an angle for the attachment of the second shoe adjusting portions 34a and 44a to the first and second shoe mounted adapter portions 16f and 16h to provide maximum comfort as in the embodiment 18 . thus , the support exerts more pressure in some areas than others to accommodate sore spots and to provide adequate support for different shaped arches . generally , this pressure is applied through the flexible member over the arch in both directions and downwardly at an angle to a plane perpendicular to the medial plane of the arch and making a 75 degree solid angle outside and 60 degree solid angle inside with respect to the orthogonal plane . the purpose of the adjustable shoe is to turn the uppermost point of the arch to redistribute the weight on the bottom of the foot by changing the shape of the shoe to accommodate the needs of the individual . the foot in accommodating the adjusted shape of the shoe redistributes the weight to the outside of the foot to correct pronation or redistributes the weight to the inside of the foot to correct supination . to change the shape of the shoe when running , as much of the perimeter surface as possible is engaged by the flexible members . from the above description , it can be understood that the foot support of this invention has several advantages , such as : ( 1 ) it provides protection against over extending movement of the foot ; ( 2 ) it is useful in maintaining a proper alignment of the foot in use ; ( 3 ) it may be easily fastened to and used with existing shoes such as with a kit ; and ( 4 ) it is adjustable to the needs of the individual and the different shaped foot arches of the individual . although a preferred embodiment of the embodiment has been described with some particularity , many modifications and variations in the invention are possible within light of the above teachings . therefore , it is to be understood that , within the scope of the appended claims , the invention may be practiced other than as specifically described .	0
in one embodiment , the purging composition for extrusion and injection molding machines is defined as comprising a cellulose ether and at least one solvent selected from among a water - soluble polyhydric alcohol , polyhydric alcohol ether , polyhydric alcohol ester , and ethanolamine . the water - soluble solvent is one or more solvents selected from among water - soluble polyhydric alcohols , polyhydric alcohol ethers , polyhydric alcohol esters , and ethanolamines . any of these solvents may be used as long as the cellulose ether is melted therein on heating . the polyhydric alcohols are preferably those having a molecular weight of up to 300 , more preferably up to 150 , and examples include ethylene glycol , propylene glycol , diethylene glycol , dipropylene glycol , 1 , 3 - propanediol and glycerol . the polyhydric alcohol ethers are preferably monoethers , diethers and triethers of monofunctional aliphatic compounds having 1 to 6 carbon atoms , especially 1 to 4 carbon atoms , and examples include ethylene glycol ethyl ether and tripropylene glycol methyl ether . the polyhydric alcohol esters are preferably monoesters , diesters and triesters of monofunctional aliphatic carboxylic acids having 1 to 6 carbon atoms , especially 1 to 4 carbon atoms , and examples include ethyl glycolate , glyceryl monoacetate or glyceryl diacetate . suitable ethanolamines include monoethanolamine and diethanolamine . the cellulose ether used herein is preferably selected from among alkyl celluloses , hydroxyalkyl celluloses , hydroxyalkyl alkyl celluloses or stearyl ethers thereof , and cellulose - based enteric substrates such as hydroxyalkyl alkyl cellulose acetate succinates and hydroxyalkyl alkyl cellulose phthalates . inter alia , alkyl celluloses , hydroxyalkyl celluloses , hydroxyalkyl alkyl celluloses , hydroxyalkyl alkyl cellulose stearoxy ethers , and cellulose - based enteric substrates are preferred . most preferred among others are methyl cellulose ( mc ), hydroxypropyl methyl cellulose ( hpmc ), hydroxyethyl methyl cellulose ( hemc ), hydroxyethyl ethyl cellulose ( heec ), hydroxypropyl cellulose ( hpc ), hydroxyethyl cellulose ( hec ), hydroxypropyl methyl cellulose acetate succinate ( hpmcas ), and hydroxypropyl methyl cellulose phthalate . illustrative examples include alkyl celluloses such as methyl cellulose ( mc ) having a methoxyl content of 10 to 40 wt %; hydroxyalkyl celluloses such as hydroxypropyl cellulose ( hpc ) having a hydroxypropoxyl content of 40 to 70 wt % and hydroxylethyl cellulose ( hec ) having a hydroxyethoxyl content of 30 to 70 wt %; hydroxyalkyl alkyl celluloses such as hydroxypropyl methyl cellulose ( hpmc ) or hydroxyethyl methyl cellulose ( hemc ) having a methoxyl content of 10 to 40 wt % and a hydroxylalkyl content of 3 to 30 wt % and hydroxyethyl ethyl cellulose ( heec ) having an ethoxyl content of 5 to 20 wt % and a hydroxyethoxyl content of 10 to 45 wt %; hydroxylpropyl cellulose stearoxyether having a stearyloxyhydroxypropoxyl content of 0 . 2 to 0 . 6 wt %, hydroxypropyl methyl cellulose acetate succinate ( hpmcas ) having an acetyl content of 5 to 14 wt %, a succinoyl content of 4 to 18 wt %, a methoxyl content of 20 to 26 wt % and a hydroxypropoxyl content of 5 to 10 wt % and hydroxypropyl methyl cellulose phthalate having a carboxybenzoyl content of 21 to 35 wt %, a methoxyl content of 18 to 24 wt %, and a hydroxypropoxyl content of 5 to 10 wt %. these cellulose ethers may be used alone or in admixture of two or more . a degree of substitution may be determined according to the zeisel - gc method described in j . g . gobler , e . p . samsel and g . h . beaber , talanta , 9 , 474 ( 1962 ). for the cellulose ether used herein , a higher weight average molecular weight is preferred to gain hardness in the gel state whereas a lower weight average molecular weight is preferred to gain fluidity in the gel state . provided that a viscosity of a 2 wt % aqueous solution as measured at 20 ° c . by ubbelohde &# 39 ; s viscometer according to jis k2283 - 1993 is an index corresponding to the weight average molecular weight of cellulose ether , those cellulose ethers having a viscosity of at least 3 mpa · s , especially at least 40 mpa · s are desirable . the upper limit of viscosity is desirably up to 300 , 000 mpa · s . the concentration of cellulose ether in the solvent is not particularly limited as long as the cellulose ether can melt in the solvent upon heating and form a gel upon cooling . it is desirable for the object of the invention that a high concentration of cellulose ether form a gel . it is desirable from this standpoint that the concentration of cellulose ether in the solvent be at least 10 % by weight , preferably 20 to 80 % by weight , and more preferably 40 to 70 % by weight . if cellulose ether is present in excess , part thereof may not melt even upon heating . the purging composition of the invention may be either ( i ) a mixture obtained by mixing and dispersing the cellulose ether and the solvent near room temperature ( 0 ° c . to 40 ° c .) or ( ii ) a product obtained by mixing and dispersing the cellulose ether and the solvent , heating the mixture so that the nonionic cellulose ether is melted in the solvent , cooling the solution down to near room temperature ( 0 ° c . to 50 ° c .) for solidification , and grinding the solid . a mixer is used for mixing and dispersing the cellulose ether and the solvent . suitable mixers include spray mixers , typically spartan granulator ( dalton co ., ltd . ), flexomix ( hosokawa micron corp . ), ploughshare type mixers ( lodige gmbh and pacific machinery & amp ; engineering co ., ltd . ), nauta mixers such as hi - blender , cone type blenders , and v blenders . inter alia , a spray mixer is preferred since it ensures that the solvent is uniformly added to cellulose ether ( typically alkyl cellulose ) to form a uniform dispersion . fig1 illustrates one exemplary agitation mixer which is advantageously used in the practice of the invention and commercially available under the trade name of spartan granulator from dalton co ., ltd . the mixer generally designated at 1 includes a tank 2 . a first rotating shaft ( or rotor ) 3 is rotatably mounted in the tank 2 and horizontally extended inward from a portion of one side wall of the tank 2 which is disposed near the center in height direction . the rotor 3 is provided with a plurality of impeller pins 4 projecting radially from its outer periphery . the rotor 3 is rotated in one direction by a drive ( not shown ) such as a motor while the impeller pins 4 are integrally rotated in the same direction . a second rotating shaft 5 is rotatably mounted in the tank 2 at another side wall and opposed to the rotor 3 . the second rotating shaft 5 is rotated in a direction opposite to the rotor 3 ( i . e ., counter - rotated ) by a drive ( not shown ) such as a motor . the second rotating shaft 5 is provided with ribbon or cage - shaped mixing arms 6 which each extend radially along the inside of the other side wall and axially along the top and bottom walls of the tank 2 . as the second rotating shaft 5 is counter - rotated , the arms 6 are integrally rotated in the opposite direction . a two - fluid nozzle 7 is provided in one sidewall of the tank for feeding compressed air and the solvent into the tank . the tank 2 includes an inlet 8 at the top for feeding the cellulose ether . the cellulose ether particles are fluidized at a suitable rate . an agitation mixer is like spartan granulator as shown in fig1 , in which a rotor with a plurality of impeller pins is horizontally mounted at the center of the tank . provided that the mixer tank has a diameter of 250 mm and a volume of 2 liters and is charged with 0 . 5 kg of cellulose ether particles , the rotor with impeller pins is preferably rotated at 1 , 500 to 10 , 000 rpm , more preferably 2 , 000 to 7 , 000 rpm . if the rotational speed is too low , the solvent may not come in uniform contact with the cellulose ether . if the rotational speed is too high , the impeller pins may be severely worn and the mixer be damaged . it is desirable to use an agitation mixer having a first horizontal shaft with radial impeller pins and a second horizontal shaft with ribbon or cage - shaped mixing arms which enclose the impeller pins and rotate around the impeller pins in a counter direction , as illustrated in fig1 . while powder particles are agitated and fluidized by the impeller pins rotating at a high speed , the arms create countercurrent flows . then the overall fluid is uniformly agitated in the tank without stagnation . for this reason , the provision of a second shaft with ribbon or cage - shaped arms which turn around the impeller pins in a counter direction is desirable . the second shaft with arms is preferably counter - rotated at 10 to 1 , 000 rpm , more preferably 20 to 100 rpm . if the rotational speed is too low , some portions of powder may stagnate . if the rotational speed is too high , particles impinge against each other too fast , allowing for pulverizing action . typically a two - fluid nozzle depicted at 7 in fig1 is used as the means for adding the solvent to the cellulose ether . as to the structure of a two - fluid nozzle , the nozzle includes a central nozzle for injecting the solvent and an outer nozzle enclosing the central nozzle for injecting compressed air . then the solvent is carried by compressed air and injected or sprayed to surfaces of cellulose ether particles . the two - fluid nozzle preferably has an injection angle of 30 ° to 110 °, more preferably 45 ° to 100 °, and even more preferably 50 ° to 80 °. if the angle of the two - fluid nozzle is outside the range of 30 ° to 110 °, the solvent may attach to the inner wall , impeller pins and / or arms of the mixer rather than cellulose ether particles . the solvent is preferably fed at a rate of 1 to 500 g / min , more preferably 2 to 20 g / min . if the feed rate is too low , a longer time may be necessary until the desired product is obtained , leading to low productivity . if the feed rate is too high , the solvent may not uniformly attach to cellulose ether particles . when the solvent is sprayed as droplets and added to the cellulose ether particles , the average diameter of droplets is preferably smaller than the average particle size of the cellulose ether . specifically the average diameter of sprayed droplets is up to 1 / 10 , preferably up to 1 / 50 of the average particle size of cellulose ether . if the average diameter of droplets is too large , it may be difficult to achieve uniform addition to all cellulose ether particles in fluidized state . it is noted that the average diameter of droplets is measured by a particle size measurement system based on laser diffractometry . when the purging composition in chip form ( ii ) is desired , the heating temperature for melting the cellulose ether in the solvent should desirably be equal to or lower than the boiling point of the solvent . although the temperature varies somewhat with the type of both the solvent and the cellulose ether used , it is preferably lower than the boiling point of the solvent by 10 to 70 ° c ., more preferably by 10 to 40 ° c . the purging composition in form ( ii ) is obtained by heating , melting and extruding the mixture in a hot - melt extruder ( minilab by thermo fisher scientific inc .) and cooling the extrudate in a room temperature atmosphere down to near normal temperature ( 0 ° c . to 50 ° c .) for solidification . during the cooling step following the dispersing , mixing , heating and melting step , an additive may be added in such an amount as not to inhibit formation of the composition . the additive used herein is preferably one having no or minimum water content . exemplary additives include pigments and dyes , inorganic materials such as cements , alumina , inorganic hydroxides ( e . g ., aluminum hydroxide and magnesium hydroxide ), and clay materials ( e . g ., bentonite , talc and kaolin ), and organic materials which are hardly melted at the heating temperature . the purging composition in form ( ii ) is characterized in that it resumes solution form when heated again to the temperature region used for melting . this purging composition can be handled as solid at the service temperature , i . e ., normal temperature of 0 ° c . to 50 ° c ., and is miscible with water or another solvent like solutions . the solid thus obtained can be worked into a form readily usable as the purging composition , for example , by pelletizing on a cutter into pellets for ease of melting on use as the purging composition . by further grinding to a particulate or powder form , particle size adjustment is possible . for the grinding purpose , a jet mill , roller mill , ball mill , knife mill , mesh mill or cutter mill may be used , with the cutter mill capable of grinding at relatively low temperature being preferred . if the mill becomes hot , grinding may be performed while blowing cold air . the method of cleaning an extrusion or injection molding machine using the purging composition thus obtained is carried out in the same manner as the normal extrusion or injection molding operation except that the purging composition is used instead of the proper resin to be extrusion or injection molded . the temperature during the purging step is preferably equal to or higher than the melting point of the resin ( which remains in the machine and is to be removed ) and equal to or lower than the boiling point of the solvent and specifically in the range of 100 to 230 ° c . more specifically 110 to 180 ° c . examples of the resin to be purged or removed include polyolefin resins such as polyethylene and polypropylene , chlorinated resins such as vinyl chloride and vinylidene chloride , polystyrene , polyphenylene oxide , polyamide resins , fluoro - resins such as polytetrafluoroethylene , cellulose derivatives such as acetyl cellulose and nitrocellulose , and vinyl resins such as polyvinyl alcohol . examples are given below by way of illustration and not by way of limitation . there was provided an agitation mixer including a mixing tank , a horizontal rotor disposed at the tank center and having impeller pins , and a horizontal counter - rotating shaft opposed to the rotor and having ribbon - shaped mixing arms which surround the pins and turn around the pins . it is commercially available under the trade name of spartan granulator rmo - 4h ( working volume 2 l ) from dalton co ., ltd . to the mixer , 0 . 5 kg of a cellulose ether as shown in table 1 ( having a viscosity and substituent as shown in table 2 ) was fed . the rotor with impeller pins was rotated at 4 , 700 rpm , and the ribbon - shaped mixing arms were counter - rotated around the rotor pins at 25 rpm , thereby keeping cellulose ether particles in the fluidized state for 1 minute . next , 100 g of a solvent as shown in table 1 was fed to the mixer and sprayed through a two - fluid nozzle along with compressed air at 20 ° c ., a pressure of 0 . 03 mpa and a feed rate of 15 g / min . in this way , the solvent was sprayed onto surfaces of cellulose ether particles so that the cellulose ether might be present in a concentration as shown in table 1 . the purging composition consisting of spray treated cellulose ether particles was admitted into a hot - melt extruder ( haake minilab ii by thermo fisher scientific inc .) for purging any residual resin material ( to be described below ) out of the extruder . specifically , after a molding compound consisting of 100 parts by weight of zirconia powder and 18 parts by weight of a polyacrylic binder ( trade name ceramo ib - 27 by dai - ichi kogyo seiyaku co ., ltd .) was molded at 150 ° c ., some resin compound was left in the extruder . the purging composition was applied to remove this residual resin . since the resin to be removed melted at 150 ° c ., the purging temperature was set equal to or higher than the melting point of both the contaminant to be removed and the purging composition , as shown in table 1 . the purging composition was extrusion molded at the temperature and a discharge rate of 20 cm / min into a sheet of 5 mm wide and 2 mm thick along with the residual resin . two minutes after the extrudate was no longer discharged , the lid of the melt extruder was opened for inspecting the purging composition which was left in the extruder . the remaining purging composition was taken out and weighed to be less than 1 g , demonstrating that the extruder could be fully cleaned simply after rinsing without abrasion of the extruder parts . as in examples 1 to 16 , 100 g of a solvent as shown in table 1 was sprayed onto surfaces of particulate cellulose ether having a viscosity and substituent as shown in table 2 so as to provide a cellulose ether concentration as shown in table 1 , except that a mixture of two cellulose ethers was used . the purging composition consisting of spray coated cellulose ether particles was admitted into a hot - melt extruder ( haake minilab ii ) for purging any residual compound ( to be described below ) out of the extruder . specifically , after a 1 : 2 powder mixture of nifedipine ( daito co ., ltd .) and hydroxypropyl methyl cellulose acetate succinate ( hpmcas ) ( aqoat by shin - etsu chemical co ., ltd .) was molded at 160 ° c ., some mixture was left in the extruder . the purging composition was applied to remove this residual compound . since the compound to be removed melted at 160 ° c ., the purging temperature was set equal to or higher than the melting point of both the contaminant to be removed and the purging composition , as shown in table 1 . the purging composition was extrusion molded at the temperature and a discharge rate of 20 cm / min into a sheet of 5 mm wide and 2 mm thick along with the residual compound . two minutes after the extrudate was no longer discharged , the lid of the melt extruder was opened for inspecting the purging composition which was left in the extruder . the remaining purging composition was taken out and weighed to be less than 1 g , demonstrating that the extruder could be fully cleaned simply after rinsing without abrasion of the extruder parts . as in examples 1 to 16 , 100 g of a solvent as shown in table 3 was sprayed onto surfaces of particulate cellulose ether having a viscosity and substituent as shown in table 2 so as to provide a cellulose ether concentration as shown in table 3 . the purging composition consisting of spray coated cellulose ether particles was admitted into a hot - melt extruder ( haake minilab ii by thermo fisher scientific inc .) and extrusion molded at a temperature as shown in table 3 and a discharge rate of 20 cm / min into a sheet of 5 mm wide and 2 mm thick . the sheet was then placed in a melt extruder ( capilograph e - 3b by toyo seiki seisakusho , ltd .) at a heating temperature as shown in table 3 , held therein for 5 minutes , and extruded at a discharge rate of 50 cm / min into a rod having a diameter of 1 mm . the rod was cooled to a chip - forming temperature as shown in table 3 and chopped by a digital cutter ( zkc - 16t by i tec corp .) into chips of 1 mm diameter and about 1 mm long . the purging composition in chip form was admitted into a hot - melt extruder ( haake minilab ii ) for purging any residual resin material ( to be described below ) out of the extruder . specifically , after a molding compound consisting of 100 parts by weight of zirconia powder and 18 parts by weight of a polyacrylic binder ( trade name ceramo ib - 27 by dai - ichi kogyo seiyaku co ., ltd .) was molded at 150 ° c ., some resin compound was left in the extruder . the purging composition was applied to remove this residual resin . since the resin to be removed melted at 150 ° c ., the purging temperature was set equal to or higher than the melting point of both the contaminant to be removed and the purging composition , as shown in table 3 . the purging composition was extrusion molded at the temperature and a discharge rate of 20 cm / min into a sheet of 5 mm wide and 2 mm thick along with the residual resin . two minutes after the extrudate was no longer discharged , the lid of the melt extruder was opened for inspecting the purging composition which was left in the extruder . the remaining purging composition was taken out and weighed to be less than 1 g , demonstrating that the extruder could be fully cleaned simply after rinsing without abrasion of the extruder parts . as in examples 1 to 16 , 100 g of a solvent as shown in table 3 was sprayed onto surfaces of particulate cellulose ether having a viscosity and substituent as shown in table 2 so as to provide a cellulose ether concentration as shown in table 3 , except that a mixture of two cellulose ethers was used . as in examples 19 to 34 , the purging composition consisting of spray coated cellulose ether particles was worked into chips . the purging composition in chip form was admitted into a hot - melt extruder ( haake minilab ii ) for purging any residual compound ( to be described below ) out of the extruder . specifically , after a 1 : 2 powder mixture of nifedipine ( daito co ., ltd .) and hpmcas ( aqoat by shin - etsu chemical co ., ltd .) was molded at 160 ° c ., some compound was left in the extruder . the purging composition was applied to remove this residual compound . since the compound to be removed melted at 160 ° c ., the purging temperature was set equal to or higher than the melting point of the contaminant to be removed and the purging composition , as shown in table 3 . the purging composition was extrusion molded at the temperature and a discharge rate of 20 cm / min into a sheet of 5 mm wide and 2 mm thick along with the residual compound . two minutes after the extrudate was no longer discharged , the lid of the melt extruder was opened for inspecting the purging composition which was left in the extruder . the remaining purging composition was taken out and weighed to be less than 1 g , demonstrating that the extruder could be fully cleaned simply after rinsing without abrasion of the extruder parts . although some preferred embodiments have been described , many modifications and variations may be made thereto in light of the above teachings . it is therefore to be understood that the invention may be practiced otherwise than as specifically described without departing from the scope of the appended claims .	2
referring to the drawings and firstly to fig , 1 there is illustrated a lasso handling device 9 according to the present invention which typically comprises a device 9 adapted to handle lasso &# 39 ; s of variable loop size with speed and accuracy , the device 9 including a tubular extended pole 10 which can be adjustable in length . the pole 10 has a free end 11 and a handle end 12 . mounted on the tubular pole 10 adjacent to the free end 11 is a channel shaped clamping member or line gripper 13 . the clamping member 13 as shown more clearly in fig3 and fig9 to 12 is resilient and comprises an elongated channel shaped member of part circular form in cross section and having a pair of opposite curved side flanges or jaws 14 . inwardly directed teeth like ribs 15 are provided adjacent the free longitudinal edges of the flanges or jaws 14 and define a restricted entrance 16 into the interior 17 of the channel shaped member 13 . the leading end of the channel shaped member 13 is tapered . the channel shaped member 13 is provided with a mounting flange 18 on its topside , that is the side opposite the flanges or jaws 14 with the mounting flange 18 extending longitudinally of the channel shaped clamping member 13 and the mounting flange 18 and includes on one side a shallow recess 19 complimentary to the tube shape of the pole 10 . spaced apertures 20 are provided in the mounting flange 18 and extend through to the “ channel ” side of the member 13 to accept screws 21 which may be driven into apertures in the tubular pole 10 to hold the flange 18 to the tubular pole 10 . a resilient hook 22 is connected to an adjustable sliding sleeve 23 as shown in fig2 and 4 to 8 which circumscribes the tubular pole 10 between the channel shaped member 13 and the handle end 12 , the hook 22 being defined by an elongated member or arm 24 extending from the sleeve 23 and longitudinally of the pole 10 and terminating in an enlarged jaw 25 which extends towards the pole 10 and which defines with the pole 10 a restricted mouth for capturing the rope of the lasso as described below . the resilient hook 22 is shaped to accept ropes of various sizes in an indent section 26 formed in the member 24 . the resilience of the hook 22 is achieved by the length of the arm or member 24 and the resilient hook 22 can be constructed of any resilient material such as plastic or metal . the adjustable sliding sleeve 23 can be constructed of material such as plastic or metal . the resilient hook 22 and the adjustable sleeve 23 are attached and may be formed as a single component such as by an integral moulding or formed as separate joined components . the lasso handling device 9 is particularly suited to handling a rope 27 which has a loop 28 to define a lasso , the rope 27 being of the type having an eyelet 29 at one end defined by an end portion 30 of the rope 27 which is looped back on itself and secured such as by means of a splice 31 to a further portion of the rope 27 as shown in fig1 , 14 , 15 , 16 and 17 . the splice 31 which constitutes a transversely enlarged portion of the rope 27 can be engaged with the channel shaped member 13 by being pressed into the entrance 16 in the member 13 to cause the flanges or jaws 14 to be resiliently deflected and to be received in the interior 17 of the member 13 with the splice 31 being gripped resiliently by the flanges or jaws 14 . in the embodiment illustrated in fig1 , 13 and 14 the splice 31 is positioned to be resiliently gripped by the channel shaped clamping member 13 such that the eyelet 29 is positioned rearwardly of the channel shaped clamping member 13 . this configuration allows the free end of the rope 27 to be held by the resilient hook 22 transversely to the tubular pole 10 . for this purpose , the rope 27 is pushed past the jaw 25 of the resilient hook 22 and is held transversely in the indent section 26 formed in the arm 24 of the resilient hook 22 . the rope 27 is held by the arm or member 24 against the tubular pole 10 as shown in fig8 to form a braking action to prevent the adjustable sliding sleeve 23 moving longitudinally along the tubular pole 10 until the rope 27 is released from the jaw 22 . the free end of the rope 27 passes across the indent section 26 of the resilient hook 22 and through the eyelet 29 to form the loop 28 . the free end of the rope 27 passes back to the handle end 12 of the tubular pole 10 and is held by the operator 33 . the fast release of the rope 27 from the resilient hook 22 is facilitated by the contraction of the lasso loop 28 around the caught object 34 as shown in fig1 and 16 . the free end of the rope 27 held firmly by the operator 33 effectively causes the rope 27 to pivot around the fixed point of the eyelet 29 creating a force exceeding the force required by the resilient hook 22 to hold the rope 27 and the rope is thus forcibly ejected from the resilient hook 22 in the direction d . release of the rope 27 with the splice 31 from the channel shaped clamp 13 is affected by the operator 33 sharply pulling the tubular pole 10 back in the direction a as illustrated in fig1 . the channel shaped clamp moves from the large diameter splice 31 to the smaller diameter of the rope 27 which cannot be held leaving the released lasso loop 28 around the caught animal or object 34 . referring to fig1 and 19 the lasso size can be adjusted by the movement of the adjustable sleeve 23 in direction b along the pole 10 to lessen the lasso size as illustrated in fig1 and in direction c to increase the lassos size as illustrated in fig1 . fig1 illustrates an enlarged lasso loop 28 held and supported by the channel shaped clamping member 13 and the resilient hook 22 . the rope 27 held by the channel shaped clamping member 13 has an increased diameter , increased by diameter build up material such as tape or velcro 35 as illustrated in fig2 . release of the rope 27 is similar to that as described above with reference to fig1 within in this case release of the diameter build material 35 from the channel shaped clamping member 13 being affected by the operator 33 pulling the tubular pole 10 back in the direction a . the channel shaped clamping member 13 moves from the large diameter 35 to the smaller diameter of the rope 27 and cannot be held leaving the released lasso loop 28 around the caught animal or object 34 . it will be appreciated that the channel shaped clamping member 13 and the resilient hook 22 may be varied in size to suit various sized lasso ropes 27 with which the lasso handing device 9 is to be used . furthermore , the clamping member 13 and hook 22 may be of various different configurations and designs . whilst the resilience of the resilient hook 22 may be due to the inherent resilient in the arm 24 of the hook 22 , the arm 24 alternatively may be relatively rigid and joined to the sleeve member 23 through a resilient connection , for example via a spring loaded pivot or through are resilient plastics connection . the use of the term “ comprising ” or derivatives thereof as used throughout the specification and claims are taken to specify the presence of the stated features , integers and components referred to but not preclude the presence or addition of one or more other feature / s , integer / s , component / s or group thereof . whilst the above has been given by way of illustrative embodiment of the invention , all such variations and modifications thereto as would be apparent to persons skilled in the art are deemed to fall within the broad scope and ambit of the invention as defined in the appended claims .	1
in certain embodiments , the optical glucose measurement system measures glucose concentration levels using glucose - sensing chemical indicator systems . such indicator systems preferably comprise a fluorophore operably coupled to a glucose binding moiety . preferably , the glucose binding moiety acts as a quencher with respect to the fluorophore ( e . g ., suppresses the fluorescent emission signal of the fluorophore in response to excitation light when it associates with the fluorophore ). in preferred embodiments , as the glucose binding moiety binds glucose ( e . g ., as glucose concentrations rise ), it dissociates from the fluorophore , which then generates a fluorescent emission signal upon excitation . accordingly , in such embodiments , the higher the glucose concentration , the more glucose bound by the binding moiety , the less quenching , and the higher the fluorescence intensity of the fluorophore upon excitation . the optical glucose measurement system measures , in certain embodiments , the glucose concentrations intravascularly and in real - time through the use of such fluorophore - quencher indicator systems . the glucose - sensing indicator systems can be immobilized in a hydrogel . the hydrogel can be inserted into an optical fiber such that light may be transmitted through the hydrogel while at least a portion of the hydrogel is in contact with blood . the hydrogel is preferably permeable to blood and analytes , specifically glucose . the optical fiber together with the hydrogels can comprise a glucose sensor that is placed in a mammalian ( human or animal ) blood vessel . in certain embodiments , light is transmitted into the glucose sensor from a light source . the light source can be a light emitting diode that emits an optical excitation signal . the optical excitation signal can excite the fluorophore systems in the presence of glucose , such that the fluorophores emit light at an emission wavelength . in certain embodiments , the fluorophore systems can be configured to emit an optical emission signal at a first wavelength having an intensity related to the blood glucose concentration in the blood vessel . the light can be directed out of the glucose sensor such that the light is detected by a light sensitive module ( or detector system ) that can comprise at least one detector . detectors include any component capable of converting light into a measurable signal , and may include but are not limited to photomultipliers , photodiodes , diode arrays , or the like . the at least one detector can be configured to measure the intensity of the emission wavelength because the intensity of the emission wavelength , in certain embodiments , is related to the glucose concentration present in the blood . in certain embodiments , the light sensitive module ( or detector system ) comprises an interference filter , an amplifier , and / or an analog - to - digital converter . the light sensitive module ( or detector system ) can also comprise a microspectrometer , spectrometer , or the like . various non - glucose related factors can effect the measurements of the intensity of the emission wavelength , resulting in measurement errors . in certain embodiments , the measurement errors are eliminated or are substantially eliminated or reduced by employing a ratio of certain signals . the measurement errors that may be eliminated include but are not limited to changes in the intensity of the light generated from the light source ( s ), changes in the coupling efficiency of light into the optical fibers , bending of the optical fiber and the ensuing loss of light from the fiber , changes in the sensitivity of the detection circuit due to , for example , temperature or age or duration of use . in certain embodiments , the ratio of certain signals is unaffected by changes in the light source intensity , the coupling efficiency of the light source into the optical fibers , bending of the optical fibers or the like . the ratio of certain signals can be the ratio of an emission signal to an excitation signal . in certain embodiments , the ratio of certain signals is the ratio of an emission signal to a second optical signal . the second signal may be the excitation light signal which is transmitted through the optical system , through the sensor and indicator system , and reflects back at least in part from the sensor into the light sensitive module ( or detector system ). alternatively , the second signal may be generated by a separate reference light , for example red light , which is not absorbed by the indictor system . the second signal may be generated by certain fluorophores as a second emission signal at a different wavelength — the intensity of which is independent of glucose . any light that is propagated through the optical system , can be either not altered by the glucose concentration or is the excitation light . light not altered by the glucose concentration can be detected by the light sensitive system ( or detector system ) and may be used as the second or reference light signal . from the disclosure herein , it will be apparent to those of ordinary skill in the art that other sources of measurement errors may also be eliminated by employing a ratio of certain of certain signals . system without a beamsplitter and using a reference light that does not cause the fluorophore to fluoresce with reference to fig1 , the foregoing disclosure applies to certain embodiments comprising at least three light sources . with reference to fig1 a , the foregoing disclosure applies to certain embodiments comprising two light sources . in certain embodiments , the light sources 101 are light - emitting diodes ( led &# 39 ; s ); however , other types of light sources may also be employed . one of the light sources 101 a can be a reference light ( for example , red ) whereas the other two light sources ( 101 b and 101 c ) are excitation lights having different wavelengths ( for example , blue1 and blue2 ). in certain embodiments , light is transmitted from each of the light sources 101 a - c through a optical module comprising a collimator lens 102 a - c , an interference filter 103 a - c , and / or a focusing lens 104 a - c . the light impinging on , transmitting through or striking the interference filter 103 preferably falls within a certain degree of collimation , in order for the interference filter 103 to optimally block light outside the desired band spectrum . the collimator lens 102 can be an aspheric lens but other types of collimator lens may also be employed . the interference filter can be replaced with other types of filters for example wratten filters . the interference filter 103 can block a portion of the spectrum of each light that is transmitted from the light sources 101 . in certain embodiments , the interference filter 103 blocks the portion of spectrum that overlaps with the emission wavelength generated from the fluorophore systems . for example , if a system that employs a blue excitation light to produce a green emission , then an interference filter is preferably used to narrow the band of blue excitation , because the blue excitation light may comprise both blue and green light . an unfiltered excitation blue that comprises green light can produce inaccurate green emission signal because the green light from the excitation light will add to the green emission signal of the fluorophore to produce a green light of greater intensity . the interference filter 103 can be a short pass filter that blocks all wavelengths beyond a certain point . the interference filter 103 can be a band pass filter that only allows a particular band of wavelengths to pass through the filter . in certain embodiments , the system 100 employs interference filters 102 b and 102 c that are band pass filters because , in certain embodiments , the excitation lights 101 b and 101 c have similar wavelengths . the use of two band pass filters can avoid frequency overlap between the two excitation lights , thereby resulting in two excitation lights with two distinct bands . the use of the interference filter 103 can avoid the wavelength overlap between the excitation and emission wavelengths . in certain embodiments , the resulting light from the interference filters 103 a - c can be transmitted through a focusing lens 104 a - c . the focusing lens 104 a - c directs the light into the respective optical fibers 105 a - c . the optical fiber lines 105 may each comprise a single fiber or a bundle of fibers . the use of the fiber bundles can reduce the amount of dead space when the fibers are joined to the single fiber 108 . in certain embodiments , each of the fiber optic lines 105 comprises a bundle of fibers that are bundled together to form a fiber bundle 106 . the fiber bundle 106 can be connected to a single fiber optic line 108 . a measurement taken across the cross - section of fiber optic line 108 can show an uneven distribution of light . for example , some areas of the fiber may be darker than other areas of the fiber . in certain embodiments , a mode - mixing scrambler 109 is used to distribute the light such that the light is transmitted more uniformly across the optical fiber . the mode - mixing scrambler 109 can be configured to cause the light traveling down the fiber to lose the higher mode light . in certain embodiments , higher mode light is light propagating with large angles of incidence . in certain embodiments , higher mode light with an angle of incidence greater than the critical angle will pass out of the optical fiber . the mode - mixing scrambler 109 can be a length of fiber that is curved around a particular radius to create an optical fiber with a lower critical angle . light transmitted through the mode - mixing scrambler 109 can result in a low - mode light that tends to travel straighter in the fiber . the single optical fiber 108 can be connected to another fiber optic line 110 . the fiber optic line 110 may be a bundle of fibers or a single fiber . in this embodiment , the light sensitive module ( or detector system ) comprises two detectors 112 , 121 . a portion of the light traveling through optical fiber 108 can be transmitted through the fiber optic line 110 and can be measured using the light sensitive module ( or detector system ) comprising a first detector 112 . in certain embodiments , the signal produced from the first detector 112 can be amplified by an amplifier 113 . the amplified signal can be converted from an analog signal to a digital signal by the analog - to - digital converter 114 . in certain embodiments , the digital signal is transmitted to a data processing device 124 for storage and ratiometric processing . the data processing device 124 can be any data processing device of any type known in the art , for example , microprocessor , embedded processor , multiprocessor , general purpose computer , special purpose processor , computational devices , digital signal processor , microcontroller , programmable gate array or any combinations thereof . in certain embodiments , the single optical fiber 108 is connected to another fiber optic line 111 . the fiber optic line 111 may be a bundle of fibers 115 or a single fiber . a portion of the light traveling through the fiber optic line 108 can be transmitted through the fiber optic line 111 and into the glucose sensor 117 . in certain embodiments , the cross - section of line 111 comprises a bundle of fibers 115 a placed around a larger single fiber 115 b before connecting to glucose sensor 117 at a first end 117 a . the glucose sensor 117 can be an optical fiber . in certain embodiments , the glucose sensor has a mirror or reflective surface 117 b at a second end of the glucose sensor 117 . the fluorophore system of the glucose sensor can be embedded within , immobilized or otherwise associated with hydrogels that reside within holes or cavities 116 in the optical fiber . the fluorophore system can emit a fluorescent light when glucose is present and when the fluorophores are excited by an excitation light 101 b , 101 c . in certain embodiments , the fluorophore system comprises a dual exciter - single emitter dye ( for example , a dye that produces a single emission peak in response to two different excitation lights ). of course other fluorophore systems may be used , including inter alia , single excitation - single emission , dual excitation - dual emission , and single excitation - dual emission ). the emission intensity can be directly related to the glucose concentration ( that is , the greater the concentration of glucose , the stronger the intensity of light emitted by the fluorophore system ). in certain embodiments , the emission intensity is inversely related to the glucose concentration ( that is , the greater the concentration of glucose , the lower the intensity of light emitted by the fluorophore system ). a portion of the excitation and emission wavelengths can be transmitted into the fiber optic line 118 . the fiber optic line 118 may be a single fiber line , as shown in cross - section 119 , or a bundle of optical fibers ( not shown ). the light transmitted through fiber optic line 118 can be filtered through an interference filter 120 . the interference filter 120 can block the excitation lights generated from the light sources 101 b and 101 c . the remaining light spectrum comprises emission wavelengths from the fluorophore reporters and the reference light from the light source 101 a . in certain embodiments , the remaining light spectrum is measured using the light sensitive module ( or detector system ) comprising a second detector 121 . the signal produced by the second detector 121 can be amplified by an amplifier 122 . the amplified signal can be converted from an analog signal to a digital signal by an analog - to - digital converter 123 . in certain embodiments , the resulting digital signal is transmitted to computer 124 for storage and ratiometric processing . the optical glucose measurement system 100 can be configured to pulse light from the light sources 101 . for example , the system 100 may transmit light from the reference light source 101 a for one second , and then wait one second , and then transmit light from the first excitation light source 101 b for one second , and then wait one second , and then transmit light from the second excitation light source 101 c for one second and then wait one second before repeating this light pulsation pattern . in certain embodiments , the system 100 would continuously repeat such a light pulsation pattern until the system 100 was turned off . the pulse frequency and duration could vary greatly depending on the desired effect as will be appreciated by one skilled in the art . the ambient light can affect the intensity of the emission wavelengths . in certain embodiments , the optical glucose measurement system 100 accounts for ambient light effects by taking a first measurement of the light intensity in the system 100 when one of the light sources 101 is on and then taking a second measurement of the light intensity in the system when all the light sources 101 are off . the ambient light effect can be eliminated by subtracting the second measurement from the first measurement . the bending of the fiber optic lines affects the intensity of the emission wavelengths . the bending of the fiber can create light loss from the fiber optic line . in certain embodiments , the temperature changes affect the performance of the detectors and amplifiers of the system 100 , thereby affecting the intensity of the emission wavelength that is detected . there can be factors that affect emission wavelength intensity that do not relate to changes in glucose concentration . to account for the fiber bending , the temperature changing , and other non - glucose related effects on emission wavelength intensity , the system 100 is configured , in certain embodiments , to employ ratiometric calculations to eliminate non - glucose related intensity changes . the second detector 121 can be configured to measure emission wavelength emitted from the fluorophore system in the sensing cavities 116 . in certain embodiments , the detector 121 measures the reference light generated from light source 101 a . the fiber bending , the temperature changing , and other non - glucose related factors can affect the intensity of the reference light and the emission wavelength in the same way , thereby allowing ratiometric calculations to eliminate non - glucose related effects on light intensity . the ratiometric calculation employed can involve dividing the measured emission wavelength by the measured reference light , where both measurements are taken at the second detector 121 . the ratio of the measured emission wavelength to the measured reference light can cross referenced with a pre - determined function that correlates this ratio to the amount of glucose present . in certain embodiments , the ratio of measured emission wavelength to measured reference light changes only if the glucose concentration changes . the reference light emitted from light source 101 a can be affected by various factors in the system 100 , whereas , for example , the first excitation light emitted from light source 101 b is unaffected . the system 100 can account for such disparate changes between the reference light and the excitation lights by periodically measuring these lights over time at the first detector 112 . in certain embodiments , a ratio is produced that compares the periodic measurements with the first measurement of each light , for example , reference light at time equals zero seconds divided by reference light at time equals one second . a similar ratio can be created for the excitation lights . for example , if the reference light ratio does not equal one then a change occurred in the reference light that should be accounted for before determining the glucose concentration . for example , if a change to the reference light was detected at the first detector 112 , then the reference light measured at the second detector 121 should be adjusted to account for this change . for example , if the reference light measurement at the first detector 112 increased then the reference light measured at the second detector 121 must be decreased . in certain embodiments , the decrease is determined by multiplying the measured reference light at the second detector 121 by the following , ( reference light at time = 00 / reference light at time = 1 ), where the reference light measurements were taken from the first detector 112 . the same ratiometric calculations can be completed for the emission wavelengths detected at the second detector 121 except that the first and second excitation lights are measured instead of the reference light . the emission signals and the reference signal can be affected by various factors such that the percent change in all the signals is essentially the same . in certain embodiments these changes can be corrected for by taking the ratio of the emission signal and the reference signal after they are adjusted for changes over time as previously described . examples of such factors include but are not limited to fiber bending which can result in a loss of light from the fiber . in certain embodiments , the glucose sensing chemistry is immobilized within the hydrogels in cavities 116 . with reference to fig1 b , in certain embodiments , the glucose sensor 117 is a solid optical fiber with a series holes drilled straight through the sides of the optical fiber . the holes can be filled with the hydrogels 116 . the series of holes that can be drilled through the glucose sensor 117 are in some embodiments evenly spaced horizontally and evenly rotated around the sides of the glucose sensor 117 to form a spiral or helical configuration . the series of holes can also be drilled through the diameter of the glucose sensor . with reference to fig1 c , in certain embodiments , the glucose sensor is a solid optical fiber with a series of holes drilled through the sides of the fiber at an angle . the series of holes drilled at an angle , which can be filled with hydrogel 116 , are in some embodiments evenly spaced horizontally and evenly rotated around the sides the glucose sensor 117 . with reference to fig1 d , in certain embodiments , the optical fiber comprises a groove along the length of the optical fiber , wherein the groove is filled with hydrogel 116 . the depth of the groove can extend to the center of the optical fiber . in certain embodiments , the groove spirals around the optical fiber . the groove can configured to spiral around the optical fiber to complete at least one rotation . in certain embodiments , the groove spirals around the optical fiber to complete multiple rotations around the optical fiber . with reference to fig1 e , in certain embodiments , the glucose sensor 117 is a solid optical fiber with triangular wedges cut from the fiber . the triangular wedge areas can be filled with hyrdrogel 116 . the triangular wedges cut - outs can be evenly spaced horizontally and around the sides of the glucose sensor 117 . in certain embodiments , all light traveling in the glucose sensor 117 is transmitted through at least one hole or groove filled with hydrogel . the hyrdogels can be associated with a plurality of fluorophore systems . the fluorophore systems can comprise a quencher with a glucose receptor site . when there is no glucose present to bind with the glucose receptor , the quencher can prevent the fluorophore system from emitting light when the dye is excited by an excitation light . in certain embodiments , when there is glucose present to bind with the glucose receptor , the quencher allows the fluorophore system to emit light when the dye is excited by an excitation light . the emission produced by the fluorophore system can vary with the ph of the solution ( for example , blood ), such that different excitation wavelengths ( one exciting the acid form of the fluorophore and the other the base form of the fluorophore ) produce different emissions signals . in preferred embodiments , the ratio of the emissions signal from the acid form of the fluorophore over the emission signal from the base form of the fluorophore is related to the ph level of the blood . an interference filter can be employed to ensure that the two excitation lights are exciting only one form ( the acid form or the base form ) of the fluorophore . system using a beamsplitter and a reference light source that does not cause the fluorophor to fluoresce , for example , a red light source with reference to fig2 a , in certain embodiments , the optical glucose measurement system 100 measures glucose concentrations intravascularly and in real - time through the use of fluorophores . in certain embodiments , the optical glucose measurement system 200 comprises at least three light sources as shown in fig2 a . the light sources 101 can be light - emitting diodes ; however , other types of light sources may also be employed . in certain embodiments , one of the light sources 201 a is a reference light ( for example , red ) whereas the other two lights sources 201 b , 201 c are excitation lights having different wavelengths ( for example , blue1 and blue2 ). the optical glucose measurement system 200 can be configured to pulse light from the light sources 201 as described above with reference to fig1 . in certain embodiments , light is transmitted from each of the light sources 201 through an optical module comprising a collimator lens 202 , an interference filter 203 , and / or a focusing lens 204 . the resulting substantially collimated light can be transmitted through an interference filter 203 that blocks a portion of the spectrum of each light . the inference filter 203 can block the portion of spectrum that overlaps with the emission wavelengths generated from the glucose sensing fluorophore systems 208 , which correspond to the hydrogels 116 as described above with reference to fig1 . the resulting light from the interference filter 203 can be transmitted through a focusing lens 204 . the focusing lens 204 can be configured to direct the light into the fiber optic lines 205 . the fiber optic lines 205 may each comprise a single fiber or a bundle of fibers . the use of fiber bundles can reduce the amount of dead space when the fibers are joined to the single fiber 206 . in certain embodiments , each of the fiber optic lines 205 comprises a bundle of fibers that are bundled together to form a fiber bundle 206 . the fiber bundle 206 can comprise a single optical fiber 210 surrounded by fiber optic lines 205 . the fiber optic line 210 can comprise a bundle of fiber optic lines . the fiber bundle 206 can be configured to connect to a first end of a glucose sensor 207 . the glucose sensor 207 can comprise a single optical fiber 207 a that further comprises a hydrogel 208 as described above in reference to fig1 b , 1 c , 1 d , and 1 e . the glucose sensor 207 can comprise a mirror or a reflective surface 209 that is attached to a second end of the glucose sensor 207 . in certain embodiments , the hydrogel 208 comprises fluorophore systems that emit a fluorescent light when glucose is present and when the dyes are excited by an excitation light 201 b , 201 c . the fluorophore systems can comprise a single exciter - single emitter dye . in certain embodiments , the fluorophore systems comprise a single exciter - dual emitter dye . the fluorophore systems can comprise a dual exciter - single emitter dye . in certain embodiments , the fluorophore systems comprise a dual exciter - dual emitter dye . the excitation light can be configured to generate from the light sources 201 b , 201 c and the reference light generated from the light source 201 a are transmitted into the glucose sensor . in certain embodiments , the excitation light excites the fluorophore systems when glucose is present . the excitation light , the reference light and the emission light can be reflected off the mirror or reflective surface 209 and into the fiber optic line 210 . in certain embodiments , the excitation light , the reference light and the emission light is transmitted into the fiber optic line 210 . the light transmitted through optical fiber 210 can be transmitted through a collimator lens 211 . in certain embodiments , the resulting light is substantially collimated , and is transmitted to a beam splitter 212 . the beam splitter 212 can be configured to reflect substantially all emission light and substantially all reference light , while transmitting substantially all excitation light . the beam splitter 212 can be an interference filter that can be designed to work at a substantially forty - five degree angle . in certain embodiments , the beam splitter 212 is a glass surface with a coating that will reflect light having a certain wavelength and allow all other light to pass through the beam splitter 212 . the beam splitter can be positioned at a substantially forty - five degree angle relative the direction of the light traveling from the collimator lens 211 . in certain embodiments , the beam splitter 212 reflects all of the emission light and a portion of the reference light . the beam splitter 212 can transmit or allow the excitation light and the remaining portion of the reference light to pass through the beam splitter 212 . the reference light can have a spectral bandwidth . in certain embodiments , the beam splitter 212 divides the reference spectral band light at a wavelength near the point where the reference light experiences maximum amplitude in order to minimize intensity changes due to spectral shifts in the reference light . in this embodiment , the light sensitive module ( or detector system ) comprises two detectors 215 a , 215 b . the emission light and the portion of reference light that can be reflected by the beam splitter 212 can be measured using the light sensitive module ( or detector system ) comprising a first detector 215 a . in certain embodiments , the signal produced by detector 215 a is amplified by amplifier 216 a . the amplified signal can be converted from an analog to a digital signal by an analog - to - digital converter 217 a . the digital signal can be transmitted to computer 218 for storage and ratiometric processing . in certain embodiments , the excitation light and the portion of the reference light that is transmitted through the beam splitter 212 is measured by a second detector 215 b . the signal produced by detector 215 b can be amplified by amplifier 216 b . in certain embodiments , the amplified signal is converted from an analog to a digital signal by an analog - to - digital converter 217 b . the digital signal is transmitted to computer 218 for storage and ratiometric processing . the optical glucose measurement system 200 can determine the glucose concentration in the blood by taking the ratio of the emission light over the excitation light , wherein the emission light is measured at the first detector 215 and the excitation light is measured at the second detector 216 . in certain embodiments , the ratio of the emission light to the excitation light is cross referenced with a pre - determined function that correlates this ratio to the glucose concentration in the blood . the ratio of the emission light to the excitation light is known as the glucose ratio . the glucose ratio can , in certain embodiments , be unaffected by changes in the light source intensity , the coupling efficiency of the light source into the optical fibers , bending of the optical fibers or the like . in certain embodiments , the ratio of emission light over excitation light changes only if the glucose concentration changes . the detectors 215 , 216 and the amplifiers 215 a , 216 a can be affected by various factors , such as temperature , that result in variances in the measured light intensity . these variances created by the two detectors 215 , 216 and two amplifiers 215 a , 216 a can be eliminated or substantially eliminated by taking the ratio of the reference light measured at the first detector 215 and the reference light measured at the second detector 216 . in certain embodiments , the foregoing ratio compares the differences between the first detector 215 system and the second detector system 216 . the optical glucose measurement system 200 can determine the ratio of the reference light measured at the first detector 215 and the reference light measured at the second detector 216 at time equals zero , and this ratio is used as a reference ratio to compare with measurements taken at subsequent periods . in certain embodiments , a difference between the reference ratio and subsequent ratios indicates that a change has occurred in one of the detectors systems . for example , the foregoing ratio equals to 1 / 1 at time equals zero , whereas the ratio equals to 1 / 10 at time equals one . in this example , the two ratios are not equal because the second detector 216 has measured a signal that is ten times the signal that was measured at time equals zero , therefore , to account for this disparity the inverse of the foregoing ratio at time equals one , specifically the ratio of 10 / 1 , is multiplied against the glucose ratio . system with a beamsplitter but without a nonfluoresing ( for example , red ) reference light source with reference to fig2 b , certain embodiments comprise at least three light sources 201 b , 201 c , 201 d ( for example , blue1 , blue2 , and blue3 ). the first excitation light 201 b and the second excitation light 201 c can be transmitted through collimator lenses 202 b , 202 c , and interference filters 203 b , 203 c , and focusing lenses 204 b , 204 c . in certain embodiments , the light from the light sources 201 b , 201 c are transmitted through fiber optic lines 205 b , 205 c , wherein the fiber optic lines may comprise a single optical fiber or a bundle of fibers for the reasons discussed above . the fiber optic lines 205 b , 205 c can surround a fiber optic line 210 , which is shown in fig2 a . in certain embodiments , the fiber optic line 210 may comprise a single optical fiber or a bundle of fiber optic lines . the fiber optic lines 205 b , 205 c , and 210 can connect to a first end of a glucose sensor 207 wherein the excitation lights can shine through the hydrogels 208 thereby exciting the fluorophore systems immobilized in the hydrogels 208 . in certain embodiments , a mirror 209 is attached to a second end of the glucose sensor 207 . the emission light and the excitation light can be reflected off the mirror or reflective surface 209 and into fiber optic line 210 . the light transmitted by fiber optic line 210 can be directed to collimator lens 211 . as described above with reference to fig2 a , in certain embodiments , the light resulting from the collimator lens 211 strikes a beam splitter 212 that either reflects the light or allows the light to pass through the beam splitter 212 . as described above with reference to fig2 a , the wavelengths are detected and measured . as described above with reference to fig2 a , the ratio of the reflected light ( the emission light ) over the transmitted light ( the excitation light ) can be related to glucose concentrations in the blood . in certain embodiments , the foregoing ratio is known as the glucose ratio . similar to the embodiment described above with reference to fig2 a , the glucose ratio can be adjusted by ratiometric calculations . as described in fig2 a above , the embodiment depicted in fig2 b comprises a light sensitive module ( or detector system ) comprising two detectors that may be affected by various factors in different ways . therefore , ratiometric calculations can be employed to eliminate non - glucose related light intensity changes . in certain embodiments , a third light source 201 d can be used to provide a reference signal used in the ratiometric calculations . the light generated by the light source 201 d can be transmitted through a collimator lens 202 d . in certain embodiments , a focusing lens 204 d focuses the resulting light from the collimator lens 202 d into a optical fiber 210 which transmits the light through collimator lens 211 . the light generated by the light source 201 d can comprise two colors of different wavelengths . the two colors can be the same as the excitation light and the emission wavelength . for example , in a system where the excitation light is blue and the emission wavelength is green , then light generated by the light source 201 d is a blue light comprising both blue and green light . in certain embodiments , the beam splitter 212 will reflect the green light while allowing the blue to pass through the lens . the reflected green light can be measured at detector 215 a and the transmitted light is measured at detector 215 b . ratiometric calculations can be performed by taking the ratio of the reflected light over the transmitted light at time equals zero , wherein this ratio is used as a reference ratio . in certain embodiments , the foregoing ratio is taken at subsequent times and compared to the reference ratio . where subsequent ratios do not equal the reference ratio , the inverse of the subsequent ratio can be multiplied against the glucose ratio , as described above with reference to fig2 a . system where the beam splitter is replaced with a beam splitting polarizer the systems described above may be augmented , in certain embodiments , by substituting the beam splitter 212 as described above with a beam splitter that reflects s - polarized light towards the first detector 215 a in the light sensitive module while allowing p - polarized light to pass through the beam splitter 212 and to the second detector 215 b in the light sensitive module . in certain embodiments , an interference filter is placed before the first detector 212 that blocks all excitation light before transmitting the remaining light ( emission light and reference light ) to first detector 215 a . an interference filter can be placed before the second detector 215 b that blocks all emission light before transmitting the remaining light ( excitation light and reference light ) to the second detector 215 b . the disadvantage of this system is that some of the emission and excitation signals are not being fully measured . the systems described above , with reference to fig2 a , may be augmented to include only two light sources 201 a , 201 b and the corresponding optical module comprising collimator lenses , interference filters , and focusing lenses , as shown in fig2 c or to include more than three light sources ( figure not shown ). the systems described above with reference to fig2 a and 2b and 2 c , in certain embodiments , can be augmented by partially coating the mirror 209 with a paint that partially absorbs the reference light to compensate for the saturation of reference light at the first detector 215 a . describes ways to deal with large intensity differences between the various signals the systems described above with reference to fig2 a and 2b and 2 c produce relatively small amounts of emission light relative to the amount of excitation light . to compensate for these disparate signal intensities , in certain embodiments , the amplifier gain for the first amplifier 216 a can be set higher than the amplifier gain for the second amplifier 216 b 6 . in certain embodiments , the beam splitter 212 is configured to transmit more reference light through the beam splitter in order to compensate for the high gain amplification at amplifier 216 . instead of adjusting the beam splitter 212 as described above , an interference filter can be employed to block a portion of the reference light transmitted to the first detector 215 a in order to compensate for the high gain amplification at the amplifier 216 a . with reference to fig3 , certain embodiments comprise at least two light sources . in certain embodiments , the light sources 301 generate excitation light that is transmitted through a optical module comprising a collimator lens 302 , an interference filter 303 , and / or a focusing lens 304 . the resulting light from collimator lens 302 can be transmitted to interference filters 303 . the resulting light from interference filters 303 can be focused by focusing lens 304 into fiber optic lines 305 . in certain embodiments , fiber optic lines may be a single fiber or a bundle of fibers surrounding optical fiber 309 . the fiber optic line 309 may be a single fiber or a bundle of fibers . the fiber optic lines 305 , 309 can be bundled together at junction 306 and are connected at glucose sensor 307 . as described above with reference to fig3 , the glucose sensor 307 can comprise hydrogels 307 a . the emission light and the excitation lights can be transmitted from the glucose sensor into the fiber optic line 309 , as described above with reference to fig2 . in certain embodiments , the fiber optic line 309 is connected to a light sensitive module comprising a microspectrometer 310 that measures the entire spectrum of light in the glucose measurement system 300 . the ratio of emission light over the corresponding excitation light can be related to the concentration of glucose as described above with reference to fig2 . as described above with reference to fig2 , the ratio of the emissions light ( for example , the acid form ) produced by the first excitation light over the emission light ( for example , the base form ) produced by the second excitation light can be related to ph levels in the test solution , for example blood . the microspectrometer can be the uv / vis microspectrometer module manufactured by boehringer ingelheim . any microspectrometer can be used . alternatively , the microspectrometer could be substituted with other spectrometer , such as those manufactured by ocean optic inc . in certain embodiments described above , the ratiometric calculations require measurements of various light intensities . these measurements can be determined by measuring the peak amplitudes at a particular wavelength or wavelength band . these measurements can be determined by calculating the area under the curve between two particular wavelengths as for example with the output from a microspectrometer . the use of a microspectrometer and / or spectrometer can allow the glucose measurement system 300 to be easily changed when different fluorophore systems are employed . for example , if the system 300 is manufactured with a fluorophore system that emits a green emission wavelength and if later research and development shows that a fluorophore system that emits a red emission wavelength is better at detecting glucose concentrations , then in such a situation one would only need to replace the glucose sensor and the software to perform the ratiometric calculations . in such an example , one would not need to change interference filters or beam splitters . uses a beam splitter or at least two fibers going directly to the two detectors the systems described above with reference to fig3 can be augmented by comprising a light sensitive module comprising two interference filters 312 a , 312 b and two detectors 313 a , 313 b as shown in fig3 a . in certain embodiments , substantially half of the emission light and half of the excitation light are transmitted from the glucose sensor into the fiber optic line 309 and the remainder of the emission light and the excitation lights are transmitted from the glucose sensor into the fiber optic line 309 a . the interference filter 312 a can be configured to block the excitation lights and allow the emission light to pass to detector 313 a where the emission light is measured . the signal produced by the detector 313 a can be amplified by the amplifier 314 a and converted into a digital signal by analog - to - digital converter 315 a and transmitted to computer 316 . the interference filter 312 b can be configured to block the emission light and allow the excitation lights to pass to detector 313 b where the excitation light is measured . in certain embodiments , the signal produced by the detector 313 b can be amplified by the amplifier 314 b and converted into a digital signal by analog - to - digital converter 315 b and transmitted to computer 316 . similar to the above disclosure referring to fig1 , ratiometric calculations can be employed to substantially eliminate or reduce non - glucose related factors affecting the intensity of the measured emission light and measured excitation light . in certain embodiments , the measured emission light is divided by the measured excitation light , wherein such calculations substantially eliminate or reduce non - glucose related factors affecting the intensity of the lights . alternatively , the bifurcated fibers 309 , 309 a can be substituted with a single fiber or fiber bundle 309 and a beam splitter 315 , as illustrated for example in fig3 b . system using a spectrometer in conjunction with a single exciter and dual emitter fluorophore the systems described above with reference to fig3 can be augmented by including only one light source , and a fluorophore system that is a single exciter , dual emitter fluorophore system . with reference to fig4 , in certain embodiments , the light generated by the single light source 401 is transmitted through a optical module comprising a collimator lens 402 , an interference filter 403 , and / or a focusing lens 404 as described above . the resulting light can be filtered through an interference filter 403 . the resulting light can be focused by a focusing lens 404 into a fiber optic line 405 , which may be a single fiber or a bundle of fibers . the fiber optic line 405 can surround a fiber optic line 410 as both fiber optic lines connect to the first end of the glucose sensor 407 . in certain embodiments , a mirror or reflective surface 409 is attached to the second end of the glucose sensor 407 . the fiber optic line 410 may be a single fiber or a bundle of fibers . the glucose sensor can comprise hydrogels that further comprise a fluorophore system that produces two emission wavelengths , a first emission wavelength and a second emission wavelength . in certain embodiments , the fluorophore system is excited by the light generated by light source 401 . in certain embodiments , the fiber optic line 410 is connected to a light sensitive module comprising a microspectrometer 411 that measures the entire spectrum of light in the glucose measurement system 400 . data from the microspectrometer 411 can be transmitted to computer 412 for processing . the microspectrometer 411 can allow system 400 to simultaneously measure the excitation light intensity as well as both emission light intensities . similar to the above disclosure referring to fig1 , ratiometric calculations are employed to substantially eliminate or reduce non - glucose related factors affecting the intensity of the measured emission light and measured excitation light . the measured emission light can be divided by the measured excitation light , wherein such calculations substantially eliminate or reduce non - glucose related factors affecting the intensity of the lights . the first emission wavelength can be related to the concentration of acid in the blood . in certain embodiments , the second emission wavelength is related to the concentration of base in the blood . the ratio of intensities of the first emission light over the second emission light can be related to the ph level of the blood . as described above with reference to fig2 , the ratio of the first emission light over the excitation light can be related to the glucose concentration in the blood . as described above with reference to fig2 , the ratio of the second emission light over the excitation light can be related to the glucose concentration in the blood . system using two fluorophores , one as a glucose and ph indicator the other as a reference , in the same gel the systems described above with reference to fig3 , 3 a , 3 b , and 4 can be augmented , as shown in fig5 , 5 a , 5 b and 6 by immobilizing two fluorophore systems in the hydrogels 509 , 510 , and by not attaching a mirror or other reflective surface at the second end of the glucose sensor 508 ( for example , mirror or reflective surface 511 in fig5 , 5 a , 5 b , and 6 is not a feature in these foregoing embodiments ). with reference to fig5 , 5 a , 5 b , and 6 in certain embodiments , a portion of the light that is transmitted into the glucose sensor 508 is reflected back and into fiber 512 . another portion of the light that is transmitted into the glucose sensor 508 can be transmitted through the glucose sensor 508 and into the blood stream . a portion of the light that is transmitted into the blood stream can be reflected off of various particles in the blood and back into the glucose sensor 508 . accordingly , the intensities of the excitation and emission signals as well as the ratio of the excitation and emission signals are varying over time in response to various parameters other than changes in glucose ( for example , varying degrees of excitation light re - entering the glucose sensor 508 ). in certain embodiments , these changes are accounted for by using a reference light produced by a second fluorophore system . with reference to fig5 , in certain embodiments , for example where the first fluorophore is a single exciter , dual emitter , the first fluorophore system produces a first and a second emission light intensity in response to a first excitation light , that is related to glucose and ph , as described above with reference to fig4 . with reference fig5 a , 5 b , and 6 in certain embodiments , for example where the first fluorophore is a dual exciter , single emitter , the first fluorophore system produces a first and second emission light intensity in response to a first and second light , that is related to glucose and ph , as described above with reference to fig3 , 3 a , and 3 b . the second fluorophore system can produce a third emission wavelength that does not change with glucose concentration changes or ph level changes and it excites at least one of the same excitation wavelengths as the first fluorophore system . the third emission wavelength can be used as a reference light . the ratio of the first emission light over the reference light can produce a ratiometric corrected ratio that is related to glucose and is independent of light source intensity changes , coupling efficiency and fiber bending . in certain embodiments , the ratio of the second emission light over the reference light produces a ratiometric corrected ratio that is related to glucose and is independent of light source intensity changes , coupling efficiency and fiber bending . the ratio of these two ratios can be related to the ph and is independent of the light source intensity , coupling efficiency , fiber bending , and the concentration of the first fluorophore . in certain embodiments , the systems described above with reference to fig5 , 5 a , 5 b and 6 comprises a mirror 511 attached at the second end of the glucose sensor 508 . system where the use of the two fluorophore system above can be employed so as to eliminate the need for holes in the fiber and a mirror the systems described above with reference to fig5 , 5 a , 5 b and 6 can be augmented to exclude a mirror at the second end of the glucose sensor and the holes in the sensor ( 509 and 510 ) and to include a tubular permeable membrane or some other means of containing and attaching a uniform hydrogel mixture to the end of the fiber comprising two fluorophore systems as described above with reference to fig5 a , 5 b and 6 . in certain embodiments , the tubular permeable membrane or container means resembles a receptacle or pouch or sack for containing a uniform hydrogel mixture . alternatively , the end of the glucose sensor fiber 508 can also comprise a cavity or receptacle formed within the end of the fiber , wherein the cavity or receptacle is configured to contain the hydrogel mixture . system where the second fluorophore is not in the gel , but is coated on the mirror and the mirror embedded into the end of the fiber . this allows the second fluorophore to be sensitive to ph and other analytes ( that is , a larger number of fluorophores to choose from ) since it is isolated from the blood by being embedded in the end of the fiber with reference to fig5 , 5 a , 5 b and 6 , in certain embodiments the systems described above are augmented to include a mirror 511 that is at least partially coated with a second dye . the second dye can be a reference dye as described above with reference to fig5 , 5 a , 5 b , and 6 . as previously described , the second dye is preferably not sensitive to changes in glucose and ph levels in the blood when the second dye is immobilized in the hyrdrogels that are exposed to the blood . to avoid exposing the second dye to the blood , in certain embodiments , the mirror 511 is at least partially coated with a second dye and embedded in the end of the fiber . in this embodiment the intrinsic insensitivity of the second dye to glucose , ph or any other blood constituents is not required . system as in example 11 but instead of a mirror coated with the reference fluorophore the fluorophore is embedded into a second optical fiber which is attached to the end of the first optical fiber the systems described above with reference to fig5 , 5 a , 5 b and 6 can be augmented to include a second fiber . with reference to fig7 for example , in certain embodiments , the second fiber 610 is attached to the second end of the glucose sensor , wherein the second fiber is embedded with a fluorophore . when light is shown through the second fiber the fiber can be configured to emit a second emission wavelength . the second fiber can be hydrophobic and as such the embedded fluorophore is not exposed to changes in the blood , for example ph or glucose concentration . the embedded dye can be a reference dye as described above with reference to fig5 , 5 a , 5 b , and 6 . in this embodiment , the intrinsic insensitivity of the second dye to glucose , ph or any other blood constituents may not be required . system where the spectrometer is replaced with two beam splitter in series allowing the separate detection of up to three different wavelength bands . for example with a single exciter and dual emitter fluorophore both emission signals as well as the excitation signal can be measured . with a two fluorophore system again both emission as well as the excitation signal can be measured the systems described above with reference to fig4 , 5 , and 7 may substitute the microspectrometer or spectrometer with a beam splitter as described above with reference to fig2 a and 2b . the systems described above with reference to fig4 , 5 , and 7 may substitute the microspectrometer ( or spectrometer ) in the light sensitive module with two beam splitters such that for example , a first beam splitter reflects excitation light to a first detector and then a second beam splitter reflects emission wavelengths to a second detector , while allowing all remaining wavelengths ( for example , a second emission wavelength or reference light ) to pass through the two beam splitters and into a third detector . in certain embodiments , ratiometric calculations would be employed as described above . system where both the collimating and focusing lens can be eliminated by using the spatial filtering characteristics of the optical fiber specifically the numerical aperture — to only allow light passing through the filter within a defined angle of incidence range to enter the fiber with reference to all of the foregoing systems described above , in certain embodiments , the light transmitted from the light sources does not travel through an optical module comprising a collimator lens , an interference filter , and a focusing lens before being transmitted through the glucose sensor . instead , as shown in fig6 a for example , the optical module comprises only the interference filters , 303 a and 303 b , which block the portion of spectrum that overlaps with the emission wavelength , are disposed between the light source and optical fibers . the collimator and focusing lenses are not used in this embodiment . in such embodiments , the optical fiber itself is used as a spatial filter . the light source can attach to an interference filter , which is attached to an optical fiber that acts as a spatial filter ( as shown in fig6 a ). by selecting an optical fiber having a certain acceptance angle or a numerical aperture , the optical fiber restricts the angle of light allowed to enter the optical fiber . the use of the optical fiber as a spatial filter is advantageous for several reasons . there are fewer pieces to assemble when using only the optical fiber as a spatial filter as oppose to using a collimator lens , a focusing lens , and a housing to house these components . the use of the optical fiber as a spatial filter is also less expensive than using a collimator lens , and a focusing lens . the amount of light coupled into the fiber by using the optical fiber as a spatial filter is substantially the same as the amount of light coupled into the fiber by using a collimator lens , and a focusing lens . with reference to all of the foregoing systems described above , in certain embodiments , the interference filter may be replaced with other types of filters , for example , wratten filters . the indicator system ( also referred to herein as a fluorophore system ) can comprise a fluorophore operably coupled to a quencher . in certain embodiments , the fluorophore system comprises a polymer matrix comprising a fluorophore susceptible to quenching by a viologen , a viologen quencher with quenching efficacy dependent on glucose concentration , and a glucose permeable polymer , wherein said matrix is in contact with blood in vivo . preferably the fluorophore is a fluorescent organic dye , the quencher is a boronic acid functionalized viologen , and the matrix is a hydrogel . “ fluorophore ” refers to a substance that when illuminated by light at a particular wavelength emits light at a longer wavelength ; i . e . it fluoresces . fluorophores include but are not limited to organic dyes , organometallic compounds , metal chelates , fluorescent conjugated polymers , quantum dots or nanoparticles and combinations of the above . fluorophores may be discrete moieties or substituents attached to a polymer . fluorophores that may be used in preferred embodiments are capable of being excited by light of wavelength at or greater than about 400 nm , with a stokes shift large enough that the excitation and emission wavelengths are separable by at least 10 nm . in some embodiments , the separation between the excitation and emission wavelengths may be equal to or greater than about 30 nm . these fluorophores are preferably susceptible to quenching by electron acceptor molecules , such as viologens , and are resistant to photo - bleaching . they are also preferably stable against photo - oxidation , hydrolysis and biodegradation . in some embodiments , the fluorophore may be a pendant group or a chain unit in a water - soluble or water - dispersible polymer having molecular weight of about 10 , 000 daltons or greater , forming a dye - polymer unit . in one embodiment , such dye - polymer unit may also be non - covalently associated with a water - insoluble polymer matrix m 1 and is physically immobilized within the polymer matrix m 1 , wherein m 1 is permeable to or in contact with analyte solution . in another embodiment , the dye on the dye - polymer unit may be negatively charged , and the dye - polymer unit may be immobilized as a complex with a cationic water - soluble polymer , wherein said complex is permeable to or in contact with the analyte solution . in one embodiment , the dye may be one of the polymeric derivatives of hydroxypyrene trisulfonic acid . the polymeric dyes may be water - soluble , water - swellable or dispersible in water . in some embodiments , the polymeric dyes may also be cross - linked . in preferred embodiments , the dye has a negative charge . in other embodiments , the dye molecule may be covalently bonded to the water - insoluble polymer matrix m 1 , wherein said m 1 is permeable to or in contact with the analyte solution . the dye molecule bonded to m 1 may form a structure m 1 - l 1 - dye . l 1 is a hydrolytically stable covalent linker that covalently connects the sensing moiety to the polymer or matrix . examples of l 1 include lower alkylene ( e . g ., c 1 - c 8 alkylene ), optionally terminated with or interrupted by one or more divalent connecting groups selected from sulfonamide (— so 2 nh —), amide —( c ═ o ) n —, ester —( c ═ o )— o —, ether . — o —, sulfide — s —, sulfone (— so 2 —), phenylene — c 6 h 4 —, urethane — nh ( c ═ o )— o —, urea — nh ( c ═ o ) nh —, thiourea — nh ( c ═ s )— nh —, amide —( c ═ o ) nh —, amine — nr — ( where r is defined as alkyl having 1 to 6 carbon atoms ) and the like , or a combination thereof . in one embodiment , the dye is bonded to a polymer matrix through the sulfonamide functional groups . in some embodiments , useful dyes include pyranine derivatives ( e . g . hydroxypyrene trisulfonamide derivatives and the like ), which have the following formula : wherein r 1 , r 2 , r 3 are each — nhr 4 , r 4 is — ch 2 ch 2 (— och 2 ch 2 —) n x 1 ; wherein x 1 is — oh , — och 3 cooh , — conh 2 , — so 3 h , — nh 2 , or ome ; and n is between about 70 and 10 , 000 . in one embodiment , the dyes may be bonded to a polymer through the sulfonamide functional groups . in other embodiments , the dye may be one of the polymeric derivatives of hydroxypyrene trisulfonic acid . in some embodiments , the fluorescent dye may be 8 - hydroxypyrene - 1 , 3 , 6 - trisulfonate ( hpts ). the counterions can be h + or any other cation . hpts exhibits two excitation wavelengths at around 450 nm and around 405 nm , which correspond to the absorption wavelengths of the acid and its conjugate base . the shift in excitation wavelength is due to the ph - dependent ionization of the hydroxyl group on hpts . as the ph increases , hpts shows an increase in absorbance at about 450 nm , and a decrease in absorbance below about 420 nm . the ph - dependent shift in the absorption maximum enables dual - excitation ratiometric detection in the physiological range . this dye has a molecular weight of less than 500 daltons , so it will not stay within the polymer matrix , but it can be used with an anion exclusion membrane . in another embodiment , the fluorescent dye may be polymers of 8 - acetoxy - pyrene - 1 , 3 , 6 - n , n ′, n ″- tris -( methacrylpropylamidosulfonamide ) ( acetoxy - hpts - ma ): it is noted that dyes such as acetoxy - hpts - ma ( above ) having no anionic groups , may not give very strong glucose response when operably coupled to a viologen quencher , particularly a viologen quencher having only a single boronic acid moiety . in another embodiment , the fluorescent dye may be 8 - hydroxy - pyrene - 1 , 3 , 6 - n , n ′, n ″- tris -( carboxypropylsulfonamide ) ( hpts - co 2 ): in another embodiment , the fluorescent dye may be 8 - hydroxy - pyrene - 1 , 3 , 6 - n , n ′, n ″- tris -( methoxypolyethoxyethyl (˜ 125 ) sulfonamide ) ( hpts - peg ): it is noted that dyes such as hpts - peg ( above ) having no anionic groups , may not provide a very strong glucose response when operably coupled to a viologen quencher , particularly a viologen quencher having only a single boronic acid moiety . representative dyes as discrete compounds are the tris adducts formed by reacting 8 - acetoxypyrene - 1 , 3 , 6 - trisulfonylchloride ( hpts - cl ) with an amino acid , such as amino butyric acid . hydroxypyrene trisulfonamide dyes bonded to a polymer and bearing one or more anionic groups are most preferred , such as copolymers of 8 - hydroxypyrene - 1 - n -( methacrylamidopropylsulfonamido )- n ′, n ″- 3 , 6 - bis ( carboxypropylsulfonamide ) hpts - co 2 - ma with hema , pegma , and the like . this dye may be used with a quencher comprising boronic acid , such as 3 , 3 ′- obbv . of course , in some embodiments , substitutions other than cys - ma on the hpts core are consistent with aspects of the present invention , as long as the substitutions are negatively charged and have a polymerizable group . either l or d stereoisomers of cysteine may be used . in some embodiments , only one or two of the sulfonic acids may be substituted . likewise , in variations to hpts - cysma shown above , other counterions besides nbu 4 + may be used , including positively charged metals , e . g ., na + . in other variations , the sulfonic acid groups may be replaced with e . g ., phosphoric , carboxylic , etc . functional groups . other examples include soluble copolymers of 8 - acetoxypyrene - 1 , 3 , 6 - n , n ′, n ″- tris ( methacrylamidopropylsulfonamide ) with hema , pegma , or other hydrophilic comonomers . the phenolic substituent in the dye is protected during polymerization by a blocking group that can be removed by hydrolysis after completion of polymerization . such suitable blocking groups , as for example , acetoxy , trifluoroacetoxy , and the like , are well known in the art . fluorescent dyes , including hpts and its derivatives are known and many have been used in analyte detection . see e . g ., u . s . pat . nos . 6 , 653 , 141 , 6 , 627 , 177 , 5 , 512 , 246 , 5 , 137 , 833 , 6 , 800 , 451 , 6 , 794 , 195 , 6 , 804 , 544 , 6 , 002 , 954 , 6 , 319 , 540 , 6 , 766 , 183 , 5 , 503 , 770 , and 5 , 763 , 238 ; and co - pending u . s . patent application ser . nos . 11 / 296 , 898 , 11 / 671 , 880 , 11 / 782 , 553 , and 60 / 954 , 204 ; each of which is incorporated herein in its entirety by reference thereto . the snarf and snafl dyes from molecular probes may also be useful fluorophores in accordance with aspects of the present invention . the structures of snarf - 1 and snafl - 1 are shown below . additionally , a set of isomeric water - soluble fluorescent probes based on both the 6 - aminoquinolinium and boronic acid moieties which show spectral shifts and intensity changes with ph , in a wavelength - ratiometric and calorimetric manner may be useful in accordance with some embodiments of the present invention ( see e . g ., badugu , r . et al . 2005 talanta 65 ( 3 ): 762 - 768 ; and badugu , r . et al . 2005 bioorg . med . chem . 13 ( 1 ): 113 - 119 ); incorporated herein in its entirety by reference . another example of a fluorescence dye that may be ph and saccharide sensitive is tetrakis ( 4 - sulfophenyl ) porphine ( tspp )— shown below . tspp may not work optimally in blood , where the porphyrin ring may react with certain metal ions , like ferric , and become non - fluorescent . additional examples of ph sensitive fluorescent indicators that may be useful for simultaneous determination of ph and glucose in the sensor of the present invention are described in us 2005 / 0233465 and us 2005 / 0090014 ; each of which is incorporated herein by reference in its entirety . in accordance with broad aspects of the present invention , the analyte binding moiety provides the at least dual functionality of being able to bind analyte and being able to modulate the apparent concentration of the fluorophore ( e . g ., detected as a change in emission signal intensity ) in a manner related to the amount of analyte binding . in preferred embodiments , the analyte binding moiety is associated with a quencher . “ quencher ” refers to a compound that reduces the emission of a fluorophore when in its presence . quencher ( q ) is selected from a discrete compound , a reactive intermediate which is convertible to a second discrete compound or to a polymerizable compound or q is a pendant group or chain unit in a polymer prepared from said reactive intermediate or polymerizable compound , which polymer is water - soluble or dispersible or is an insoluble polymer , said polymer is optionally crosslinked . in one example , the moiety that provides glucose recognition in the embodiments is an aromatic boronic acid . the boronic acid is covalently bonded to a conjugated nitrogen - containing heterocyclic aromatic bis - onium structure ( e . g ., a viologen ). “ viologen ” refers generally to compounds having the basic structure of a nitrogen containing conjugated n - substituted heterocyclic aromatic bis - onium salt , such as 2 , 2 ′-, 3 , 3 ′- or 4 , 4 ′- n , n ′ bis -( benzyl ) bipyridium dihalide ( i . e ., dichloride , bromide chloride ), etc . viologen also includes the substituted phenanthroline compounds . the boronic acid substituted quencher preferably has a pka of between about 4 and 9 , and reacts reversibly with glucose in aqueous media at a ph from about 6 . 8 to 7 . 8 to form boronate esters . the extent of reaction is related to glucose concentration in the medium . formation of a boronate ester diminishes quenching of the fluorphore by the viologen resulting in an increase in fluorescence dependent on glucose concentration . a useful bis - onium salt is compatible with the analyte solution and capable of producing a detectable change in the fluorescent emission of the dye in the presence of the analyte to be detected . bis - onium salts in the embodiments of this invention are prepared from conjugated heterocyclic aromatic di - nitrogen compounds . the conjugated heterocyclic aromatic di - nitrogen compounds are selected from dipyridyls , dipyridyl ethylenes , dipyridyl phenylenes , phenanthrolines , and diazafluorenes , wherein the nitrogen atoms are in a different aromatic ring and are able to form an onium salt . it is understood that all isomers of said conjugated heterocyclic aromatic di - nitrogen compounds in which both nitrogens can be substituted are useful in this invention . in one embodiment , the quencher may be one of the bis - onium salts derived from 3 , 3 ′- dipyridyl , 4 , 4 ′- dipyridyl and 4 , 7 - phenanthroline . in some embodiments , the viologen - boronic acid adduct may be a discrete compound having a molecular weight of about 400 daltons or greater . in other embodiments , it may also be a pendant group or a chain unit of a water - soluble or water - dispersible polymer with a molecular weight greater than about 10 , 000 daltons . in one embodiment , the quencher - polymer unit may be non - covalently associated with a polymer matrix and is physically immobilized therein . in yet another embodiment , the quencher - polymer unit may be immobilized as a complex with a negatively charge water - soluble polymer . in other embodiments , the viologen - boronic acid moiety may be a pendant group or a chain unit in a crosslinked , hydrophilic polymer or hydrogel sufficiently permeable to the analyte ( e . g ., glucose ) to allow equilibrium to be established . in other embodiments , the quencher may be covalently bonded to a second water - insoluble polymer matrix m 2 , which can be represented by the structure m 2 - l 2 - q . l 2 is a linker selected from the group consisting of a lower alkylene ( e . g ., c 1 - c 8 alkylene ), sulfonamide , amide , quaternary ammonium , pyridinium , ester , ether , sulfide , sulfone , phenylene , urea , thiourea , urethane , amine , and a combination thereof . the quencher may be linked to m 2 at one or two sites in some embodiments . for the polymeric quencher precursors , multiple options are available for attaching the boronic acid moiety and a reactive group which may be a polymerizable group or a coupling group to two different nitrogens in the heteroaromatic centrally located group . these are : a ) a reactive group on a first aromatic moiety is attached to one nitrogen and a second aromatic group containing at least one — b ( oh ) 2 group is attached to the second nitrogen ; b ) one or more boronic acid groups are attached to a first aromatic moiety which is attached to one nitrogen and one boronic acid and a reactive group are attached to a second aromatic group which second aromatic group is attached to the second nitrogen ; c ) one boronic acid group and a reactive group are attached to a first aromatic moiety which first aromatic group is attached to one nitrogen , and a boronic acid group and a reactive group are attached to a second aromatic moiety which is attached to the second nitrogen ; and d ) one boronic acid is attached to each nitrogen and a reactive group is attached to the heteroaromatic ring . preferred embodiments comprise two boronic acid moieties and one polymerizable group or coupling group wherein the aromatic group is a benzyl substituent bonded to the nitrogen and the boronic acid groups are attached to the benzyl ring and may be in the ortho - meta or para - positions . in some embodiments , the boronic acid substituted viologen as a discrete compound useful for in vitro sensing may be represented by one of the following formulas : where n = 1 − 3 , x is halogen , and y 1 and y 2 are independently selected from phenyl boronic acid ( o - m - or p - isomers ) and naphthyl boronic acid . in other embodiments , the quencher may comprise a boronic acid group as a substituent on the heterocyclic ring of a viologen . the quencher precursors suitable for making sensors may be selected from the following : the quencher precursor 3 , 3 ′- obbv may be used with hpts - lysma or hpts - cysma to make hydrogels in accordance with preferred aspects of the invention . preferred quenchers are prepared from precursors comprising viologens derived from 3 , 3 ′- dipyridyl substituted on the nitrogens with benzylboronic acid groups and at other positions on the dipyridyl rings with a polymerizable group or a coupling group . representative viologens include : r ′ is — b ( oh ) 2 in the ortho - meta - or para - positions on the benzyl ring and r ″ is h —; or optionally r ″ is a coupling group as is defined herein or a substituent specifically used to modify the acidity of the boronic acid such as fluoro - or methoxy - l is a divalent moiety that covalently connects the sensing moiety to a reactive group that is used to bind the viologen to a polymer or matrix . examples of l include those which are each independently selected from a direct bond or , a lower alkylene having 1 to 8 carbon atoms , optionally terminated with or interrupted by one or more divalent connecting groups selected from sulfonamide (— so 2 nh —), amide —( c ═ o ) n —, ester —( c ═ o )— o —, ether — o —, sulfide — s —, sulfone (— so 2 —), phenylene — c 6 h 4 —, urethane — nh ( c ═ o )— o —, urea — nh ( c ═ o ) nh —, thiourea — nh ( c ═ s )— nh —, amide —( c ═ o ) nh —, amine — nr — ( where r is defined as alkyl having 1 to 6 carbon atoms ) and the like . z is either a polymerizable ethylenically unsaturated group selected from but not limited to methacrylamido -, acrylamido -, methacryloyl -, acryloyl -, or styryl - or optionally z is a reactive functional group , capable of forming a covalent bond with a polymer or matrix . such groups include but are not limited to — br , — oh , — sh , — co 2 h , and — nh 2 . boronic acid substituted polyviologens are another class of preferred quenchers . the term polyviologen includes : a discrete compound comprised of two or more viologens covalently bonded together by a linking group , a polymer comprised of viologen repeat units in the chain , a polymer with viologen groups pendant to the chain , a dendrimer comprised of viologen units , preferably including viologen terminal groups , an oligomer comprised of viologen units , preferably including viologen endgroups , and combinations thereof . polymers in which mono - viologen groups form a minor component are not included . the preferred quenchers are water soluble or dispersible polymers , or crosslinked , hydrophilic polymers or hydrogels sufficiently permeable to glucose to function as part of a sensor . alternatively the polyviologen boronic acid may be directly bonded to an inert substrate . a polyviologen quencher as a polymer comprised of viologen repeat units has the formula : in another embodiment , the polyviologen boronic acid adducts are formed by covalently linking two or more viologen / boronic acid intermediates . the bridging group is typically a small divalent radical bonded to one nitrogen in each viologen , or to a carbon in the aromatic ring of each viologen , or one bond may be to a ring carbon in one viologen and to a nitrogen in the other . two or more boronic acid groups are attached to the polyviologen . optionally , the polyviologen boronic acid adduct is substituted with a polymerizable group or coupling group attached directly to the viologen or to the bridging group . preferably the polyviologen moiety includes only one such group . preferably , the bridging group is selected to enhance cooperative binding of the boronic acids to glucose . the coupling moiety is a linking group as defined previously with the proviso that the linking group is optionally further substituted with a boronic acid , a polymerizable group , an additional coupling group , or is a segment in a polymer chain in which the viologen is a chain unit , a pendant group , or any combination thereof . glucose - binding quenchers are known and many have been used in analyte detection . see e . g ., u . s . pat . nos . 6 , 653 , 141 , 6 , 627 , 177 and co - pending u . s . patent application ser . nos . 11 / 296 , 898 , 11 / 671 , 880 , 11 / 782 , 553 , 60 / 915 , 372 and 60 / 949 , 145 ; each of which is incorporated herein in its entirety by reference thereto . for embodiments that are to be used in vitro , the sensing components are used as individual ( discrete ) components . the analyte , dye and quencher are mixed together in liquid solution , the change in fluorescence intensity is measured , and the components are discarded . polymeric matrices which can be used to trap the components to prevent leaching need not be present . for in vivo applications , the sensor is used in a moving stream of physiological fluid which contains one or more polyhydroxyl organic compounds or is implanted in tissue such as muscle which contains said compounds . therefore , it is preferred that none of the sensing moieties escape from the sensor assembly . thus , for use in vivo , the sensing components are preferably part of an organic polymer sensing assembly . soluble dyes and quenchers can be confined by a semi - permeable membrane that allows passage of the analyte but blocks passage of the sensing moieties . this can be realized by using as sensing moieties soluble molecules that are substantially larger than the analyte molecules ( molecular weight of at least twice that of the analyte or greater than 1000 preferably greater than 5000 ); and employing a selective semipermeable membrane such as a dialysis or an ultrafiltration membrane with a specific molecular weight cutoff between the two so that the sensing moieties are quantitatively retained . preferably the sensing moieties are immobilized in an insoluble polymer matrix , which is freely permeable to glucose . the polymer matrix is comprised of organic , inorganic or combinations of polymers thereof . the matrix may be composed of biocompatible materials . alternatively , the matrix is coated with a second biocompatible polymer that is permeable to the analytes of interest . the function of the polymer matrix is to hold together and immobilize the fluorophore and quencher moieties while at the same time allowing contact with the analyte , and binding of the analyte to the boronic acid . to achieve this effect , the matrix must be insoluble in the medium , and in close association with it by establishing a high surface area interface between matrix and analyte solution . for example , an ultra - thin film or microporous support matrix is used . alternatively , the matrix is swellable in the analyte solution , e . g . a hydrogel matrix is used for aqueous systems . in some instances , the sensing polymers are bonded to a surface such as the surface of a light conduit , or impregnated in a microporous membrane . in all cases , the matrix must not interfere with transport of the analyte to the binding sites so that equilibrium can be established between the two phases . techniques for preparing ultra - thin films , microporous polymers , microporous sol - gels , and hydrogels are established in the art . all useful matrices are defined as being analyte permeable . hydrogel polymers are used in some embodiments . the term , hydrogel , as used herein refers to a polymer that swells substantially , but does not dissolve in water . such hydrogels may be linear , branched , or network polymers , or polyelectrolyte complexes , with the proviso that they contain no soluble or leachable fractions . typically , hydrogel networks are prepared by a crosslinking step , which is performed on water - soluble polymers so that they swell but do not dissolve in aqueous media . alternatively , the hydrogel polymers are prepared by copolymerizing a mixture of hydrophilic and crosslinking monomers to obtain a water swellable network polymer . such polymers are formed either by addition or condensation polymerization , or by combination process . in these cases , the sensing moieties are incorporated into the polymer by copolymerization using monomeric derivatives in combination with network - forming monomers . alternatively , reactive moieties are coupled to an already prepared matrix using a post polymerization reaction . said sensing moieties are units in the polymer chain or pendant groups attached to the chain . the hydrogels useful in this invention are also monolithic polymers , such as a single network to which both dye and quencher are covalently bonded , or multi - component hydrogels . multi - component hydrogels include interpenetrating networks , polyelectrolyte complexes , and various other blends of two or more polymers to obtain a water swellable composite , which includes dispersions of a second polymer in a hydrogel matrix and alternating microlayer assemblies . monolithic hydrogels are typically formed by free radical copolymerization of a mixture of hydrophilic monomers , including but not limited to hema , pegma , methacrylic acid , hydroxyethyl acrylate , n - vinyl pyrrolidone , acrylamide , n , n ′- dimethyl acrylamide , and the like ; ionic monomers include methacryloylaminopropyl trimethylammonium chloride , diallyl dimethyl ammonium . chloride , vinyl benzyl trimethyl ammonium chloride , sodium sulfopropyl methacrylate , and the like ; crosslinkers include ethylene dimethacrylate , pegdma , trimethylolpropane triacrylate , and the like . the ratios of monomers are chosen to optimize network properties including permeability , swelling index , and gel strength using principles well established in the art . in one embodiment , the dye moiety is derived from an ethylenically unsaturated derivative of a dye molecule , such as 8 - acetoxypyrene - 1 , 3 , 6 - n , n ′, n ″- tris ( methacrylamidopropylsulfonamide ), the quencher moiety is derived from an ethylenically unsaturated viologen such as 4 - n -( benzyl - 3 - boronic acid )- 4 ′- n ′-( benzyl - 4ethenyl )- dipyridinium dihalide ( m - sbbv ) and the matrix is made from hema and pegdma . the concentration of dye is chosen to optimize emission intensity . the ratio of quencher to dye is adjusted to provide sufficient quenching to produce the desired measurable signal . in some embodiments , a monolithic hydrogel is formed by a condensation polymerization . for example , acetoxy pyrene trisulfonyl chloride is reacted with an excess of peg diamine to obtain a tris -( amino peg ) adduct dissolved in the unreacted diamine . a solution of excess trimesoyl chloride and an acid acceptor is reacted with 4 - n -( benzyl - 3 - boronic acid )- 4 ′- n ′-( 2 hydroxyethyl ) bipyridinium dihalide to obtain an acid chloride functional ester of the viologen . the two reactive mixtures are brought into contact with each other and allowed to react to form the hydrogel , e . g . by casting a thin film of one mixture and dipping it into the other . in other embodiments , multi - component hydrogels wherein the dye is incorporated in one component and the quencher in another are preferred for making the sensor of this invention . further , these systems are optionally molecularly imprinted to enhance interaction between components and to provide selectivity for glucose over other polyhydroxy analytes . preferably , the multicomponent system is an interpenetrating polymer network ( ipn ) or a semi - interpenetrating polymer network ( semi - ipn ). the ipn polymers are typically made by sequential polymerization . first , a network comprising the quencher is formed . the network is then swollen with a mixture of monomers including the dye monomer and a second polymerization is carried out to obtain the ipn hydrogel . the semi - ipn hydrogel is formed by dissolving a soluble polymer containing dye moieties in a mixture of monomers including a quencher monomer and through complex formation with the fluorophore . in some embodiments , the sensing moieties are immobilized by an insoluble polymer matrix which is freely permeable to polyhydroxyl compounds . additional details on hydrogel systems have been disclosed in us patent publications nos . us2004 / 0028612 , and 2006 / 0083688 which are hereby incorporated by reference in their entireties . the polymer matrix is comprised of organic , inorganic or combinations of polymers thereof . the matrix may be composed of biocompatible materials . alternatively , the matrix is coated with a second biocompatible polymer that is permeable to the analytes of interest . the function of the polymer matrix is to hold together and immobilize the fluorescent dye and quencher moieties while at the same time allowing contact with the analytes ( e . g ., polyhydroxyl compounds , h + and oh − ), and binding of the polyhydroxyl compounds to the boronic acid . therefore , the matrix is insoluble in the medium and in close association with it by establishing a high surface area interface between matrix and analyte solution . the matrix also does not interfere with transport of the analyte to the binding sites so that equilibrium can be established between the two phases . in one embodiment , an ultra - thin film or microporous support matrix may be used . in another embodiment , the matrix that is swellable in the analyte solution ( e . g . a hydrogel matrix ) can be used for aqueous systems . in some embodiments , the sensing polymers are bonded to a surface such as the surface of a light conduit , or impregnated in a microporous membrane . techniques for preparing ultra - thin films , microporous polymers , microporous sol - gels , and hydrogels have been established in the prior art . in one preferred embodiment , the boronic acid substituted viologen may be covalently bonded to a fluorescent dye . the adduct may be a polymerizable compound or a unit in a polymer . one such adduct for example may be prepared by first forming an unsymmetrical viologen from 4 , 4 ′- dipyridyl by attaching a benzyl - 3 - boronic acid group to one nitrogen and an aminoethyl group to the other nitrogen atom . the viologen is condensed sequentially first with 8 - acetoxy - pyrene - 1 , 3 , 6 - trisulfonyl chloride in a 1 : 1 mole ratio followed by reaction with excess peg diamine to obtain a prepolymer mixture . an acid acceptor is included in both steps to scavange the byproduct acid . the prepolymer mixture is crosslinked by reaction with a polyisocyanate to obtain a hydrogel . the product is treated with base to remove the acetoxy blocking group . incomplete reaction products and unreacted starting materials are leached out of the hydrogel by exhaustive extraction with deionized water before further use . the product is responsive to glucose when used as the sensing component as described herein . alternatively , such adducts are ethylenically unsaturated monomer derivatives . for example , dimethyl bis - bromomethyl benzene boronate is reacted with excess 4 , 4 ′- dipyridyl to form a half viologen adduct . after removing the excess dipyridyl , the adduct is further reacted with an excess of bromoethylamine hydrochloride to form the bis - viologen adduct . this adduct is coupled to a pyranine dye by reaction with the 8 - acetoxypyrene - tris sulfonyl chloride in a 1 : 1 mole ratio in the presence of an acid acceptor followed by reaction with excess aminopropylmethacrylamide . finally , any residual amino groups may be reacted with methacrylol chloride . after purification , the dye / viologen monomer may be copolymerized with hema and pegdma to obtain a hydrogel . immobilizing means , e . g ., hydrogels , are known and many have been used in analyte detection . see e . g ., u . s . pat . nos . 6 , 653 , 141 , 6 , 627 , 177 and co - pending u . s . patent application ser . nos . 11 / 296 , 898 , 11 / 671 , 880 , and 11 / 782 , 553 ; each of which is incorporated herein in its entirety by reference thereto . to a solution of hpts - cysma ( 1 × 10 − 5 m in ph 7 . 4 pbs ) was added increasing amounts of 3 , 3 ′- obbv ( 30 mm in meoh ) and the fluorescence emission measured after each addition . fig8 gives the relative emission change ( stem - volmer curve ) upon addition of 3 , 3 ′- obbv indicating the quenching of hpts - cysma with 3 , 3 ′- obbv . the fluorimeter settings were as follows : 1 % attenuation , ex slit 8 nm , em slit 12 nm , 486 nm ex λ , 537 nm em λ . hpts - cysma ( 1 × 10 − 5 m ) and 3 , 3 ′- obbv ( 3 × 10 − 3 m ) were titrated with a stock solution of glucose ( 31250 mg / dl ) in ph 7 . 4 pbs and the fluorescence emission measured after each addition of glucose the relative change upon addition of glucose is given in fig9 . hpts - cysma ( 2 mg ), 3 , 3 ′- obbv ( 15 mg ), n , n ′- dimethylacrylamide ( 400 mg ), n , n ′- methylenebisacrylamide ( 8 mg ), hcl ( 10 μl of 1 m solution ), and va - 044 ( 1 mg ) were dissolved in water and diluted to 1 ml in a volumetric flask . the solution was freeze - pump - thawed ( 3 ×), injected into a mold containing a 0 . 005 ″ polyimide spacer and polymerized at 55 ° c . for 16 h . the resultant film was placed in ph 7 . 4 phosphate buffer and was tested in a flow cell configuration with increasing amounts of glucose ( 0 , 50 , 100 , 200 , 400 mg / dl ). the relative fluorescence change upon addition of glucose is given in fig1 . the fluorimeter settings were as follows : ex slit 8 nm , em slit 3 . 5 nm , 515 nm cutoff filter , 486 nm ex λ , 532 nm em λ . in certain embodiments , the examples , systems and methods set forth in the foregoing disclosure may be embodied in part or in whole in software that is running on a computing device . the functionality provided for in the components and modules of the computing device may comprise one or more components and / or modules . for example , the computing device may comprise multiple central processing units ( cpus ) and a mass storage device , such as may be implemented in an array of servers . in general , the word “ module ,” as used herein ( except where it is used in connection with the optical and light sensitive modules described above ), refers to logic embodied in hardware or firmware , or to a collection of software instructions , possibly having entry and exit points , written in a programming language , such as , for example , java , c or c ++. a software module may be compiled and linked into an executable program , installed in a dynamic link library , or may be written in an interpreted programming language such as , for example , basic , perl , lua , or python . it will be appreciated that software modules may be callable from other modules or from themselves , and / or may be invoked in response to detected events or interrupts . software instructions may be embedded in firmware , such as an eprom . it will be further appreciated that hardware modules may be comprised of connected logic units , such as gates and flip - flops , and / or may be comprised of programmable units , such as programmable gate arrays or processors . the modules described herein are preferably implemented as software modules , but may be represented in hardware or firmware . generally , the modules described herein refer to logical modules that may be combined with other modules or divided into sub - modules despite their physical organization or storage . in certain embodiments , the computing device communicates with one or more databases that store information , including credit data and / or non - credit data . this database or databases may be implemented using a relational database , such as sybase , oracle , codebase and microsoft ® sql server as well as other types of databases such as , for example , a flat file database , an entity - relationship database , and object - oriented database , and / or a record - based database . in certain embodiments , the computing device is ibm , macintosh , or linux / unix compatible . in certain embodiments , the computing device comprises a server , a laptop computer , a cell phone , a personal digital assistant , a kiosk , or an audio player , for example . in certain embodiment , the computing device includes one or more cpus , which may each include microprocessors . the computing device may further include one or more memory devices , such as random access memory ( ram ) for temporary storage of information and read only memory ( rom ) for permanent storage of information , and one or more mass storage devices , such as hard drives , diskettes , or optical media storage devices . in certain embodiments , the modules of the computing are in communication via a standards based bus system , such as bus systems using peripheral component interconnect ( pci ), microchannel , scsi , industrial standard architecture ( isa ) and extended isa ( eisa ) architectures , for example . in certain embodiments , components of the computing device communicate via a network , such as a local area network that may be secured . the computing is generally controlled and coordinated by operating system software , such as the unix , vxworks , windows 95 , windows 98 , windows nt , windows 2000 , windows xp , windows vista , linux , sunos , solaris , palmos , blackberry os , or other compatible operating systems or real - time operating systems . in other embodiments , the computing device may be controlled by a proprietary operating system . conventional operating systems control and schedule computer processes for execution , perform memory management , provide file system , networking , and i / o services , and provide a user interface , such as a graphical user interface (“ gui ”), among other things . the computing device may include one or more commonly available input / output ( i / o ) devices and interfaces , such as a keyboard , mouse , touchpad , microphone , and printer . thus , in certain embodiments the computing device may be controlled using the keyboard and mouse input devices , while in another embodiment the user may provide voice commands to the computing device via a microphone . in certain embodiments , the i / o devices and interfaces include one or more display device , such as a monitor , that allows the visual presentation of data to a user . more particularly , a display device provides for the presentation of guis , application software data , and multimedia presentations , for example . the computing device may also include one or more multimedia devices , such as speakers , video cards , graphics accelerators , and microphones , for example . in certain embodiments , the i / o devices and interfaces provide a communication interface to various external devices . for example , the computing device may be configured to communicate with one or more networks , such as any combination of one or more lans , wans , a virtual private network ( vpn ), or the internet , for example , via a wired , wireless , or combination of wired and wireless , communication links . the network communicates with various computing devices and / or other electronic devices via wired or wireless communication links . although the foregoing invention has been described in terms of certain embodiments and examples , other embodiments will be apparent to those of ordinary skill in the art from the disclosure herein . moreover , the described embodiments have been presented by way of example only , and are not intended to limit the scope of the inventions . indeed , the novel methods and systems described herein may be embodied in a variety of other forms without departing from the spirit thereof . accordingly , other combinations , omissions , substitutions and modifications will be apparent to the skilled artisan in view of the disclosure herein . thus , the present invention is not intended to be limited by the example or preferred embodiments . the accompanying claims provide exemplary claims and their equivalents are intended to cover forms or modifications as would fall within the scope and spirit of the inventions .	0
using sage ( serial analysis of gene expression ) profiling , the present inventors were able to identify previously unrecognized , angiogenesis - specific markers that discriminate between non - proliferative and pathologic endothelial cells . in addition , a set of previously identified angiogenesis - specific markers from other tumor types ( colon and / or brain ) were found to be expressed in breast tumor endothelium as well . we identified 111 human genes that were expressed at significantly higher levels in breast tumor endothelium than in normal breast endothelium . see table 1 . additional such genes which can be used similarly to the 11 human genes are shown in table 2 . we have named these markers bems breast tumor endothelial markers ). bems that are expressed in both colon and breast tumor epithelium are identified in table 3 . bems that are expressed in both brain and breast tumor epithelium are identified in table 4 . bems that are expressed in each of brain , colon , and breast tumor epithelium are identified in table 5 . endothelial cells ( ecs ) represent only a minor fraction of the total cells within normal or tumor tissues , and only those ec transcripts expressed at the highest levels would be expected to be represented in libraries constructed from unfractionated tissues . the genes described in the current study should therefore provide a valuable resource for basic and clinical studies of human breast angiogenesis in the future . isolated and purified nucleic acids , according to the present invention are those which are not linked to those genes to which they are linked in the human genome . moreover , they are not present in a mixture such as a library containing a multitude of distinct sequences from distinct genes . they may be , however , linked to other genes such as vector sequences or sequences of other genes to which they are not naturally adjacent . the nucleic acids may represent either the sense or the anti - sense strand . nucleic acids and proteins although disclosed herein with sequence particularity , may be derived from a single individual . allelic variants which occur in the population of humans are included within the scope of such nucleic acids and proteins . those of skill in the art are well able to identify allelic variants as being the same gene or protein . given a nucleic acid , one of ordinary skill in the art can readily determine an open reading frame present , and consequently the sequence of a polypeptide encoded by the open reading frame and , using techniques well known in the art , express such protein in a suitable host . proteins comprising such polypeptides can be the naturally occurring proteins , fusion proteins comprising exogenous sequences from other genes from humans or other species , epitope tagged polypeptides , etc . isolated and purified proteins are not in a cell , and are separated from the normal cellular constituents , such as nucleic acids , lipids , etc . typically the protein is purified to such an extent that it comprises the predominant species of protein in the composition , such as greater than 50 , 60 70 , 80 , 90 , or even 95 % of the proteins present . using the proteins according to the invention , one of ordinary skill in the art can readily generate antibodies which specifically bind to the proteins . such antibodies can be monoclonal or polyclonal . they can be chimeric , humanized , or totally human . any functional fragment or derivative of an antibody can be used including fab , fab ′, fab2 , fab ′ 2 , and single chain variable regions . so long as the fragment or derivative retains specificity of binding for the endothelial marker protein it can be used . antibodies can be tested for specificity of binding by comparing binding to appropriate antigen to binding to irrelevant antigen or antigen mixture under a given set of conditions . if the antibody binds to the appropriate antigen at least 2 , 5 , 7 , and preferably 10 times more than to irrelevant antigen or antigen mixture then it is considered to be specific . techniques for making such partially to fully human antibodies are known in the art and any such techniques can be used . according to one particularly preferred embodiment , fully human antibody sequences are made in a transgenic mouse which has been engineered to express human heavy and light chain antibody genes . multiple strains of such transgenic mice have been made which can produce different classes of antibodies . b cells from transgenic mice which are producing a desirable antibody can be fused to make hybridoma cell lines for continuous production of the desired antibody . see for example , nina d . russel , jose r . f . corvalan , michael l . gallo , c . geoffrey davis , liise - anne pirofski . production of protective human antipneumococcal antibodies by transgenic mice with human immunoglobulin loci infection and immunity april 2000 , p . 1820 - 1826 ; michael l . gallo , vladimir e . ivanov , aya jakobovits , and c . geoffrey davis . the human immunoglobulin loci introduced into mice : v ( d ) and j gene segment usage similar to that of adult humans european journal of immunology 30 : 534 - 540 , 2000 ; larry l . green . antibody engineering via genetic engineering of the mouse : xenomouse strains are a vehicle for the facile generation of therapeutic human monoclonal antibodies journal of immunological methods 231 11 - 23 , 1999 ; yang x - d , corvalan j r f , wang p , roy c m - n and davis c g . fully human anti - interleukin - 8 monoclonal antibodies : potential therapeutics for the treatment of inflammatory disease states . journal of leukocyte biology vol . 66 , pp401 - 410 ( 1999 ); yang x - d , jia x - c , corvalan j r f , wang p , c g davis and jakobovits a . eradication of established tumors by a fully human monoclonal antibody to the epidermal growth factor receptor without concomitant chemotherapy . cancer research vol . 59 , number 6 , pp1236 - 1243 ( 1999 ); jakobovits a . production and selection of antigen - specific fully human monoclonal antibodies from mice engineered with human ig loci . advanced drug delivery reviews vol . 31 , pp : 33 - 42 ( 1998 ); green l and jakobovits a . regulation of b cell development by variable gene complexity in mice reconstituted with human immunoglobulin yeast artificial chromosomes . j . exp . med . vol . 188 , number 3 , pp : 483 - 495 ( 1998 ); jakobovits a . the long - awaited magic bullets : therapeutic human monoclonal antibodies from transgenic mice . exp . opin . invest . drugs vol . 7 ( 4 ), pp : 607 - 614 ( 1998 ); tsuda h , maynard - currie k , reid l , yoshida t , edamura k , maeda n , smithies o , jakobovits a . inactivation of mouse hprt locus by a 203 - bp retrotransposon insertion and a 55 - kb gene - targeted deletion : establishment of new hprt - deficient mouse embryonic sbem cell lines . genomics vol . 42 , pp : 413 - 421 ( 1997 ); sherman - gold , r . monoclonal antibodies : the evolution from &# 39 ; 80s magic bullets to mature , mainstream applications as clinical therapeutics . genetic engineering news vol . 17 , number 14 ( august 1997 ); mendez m , green l , corvalan j , jia x - c , maynard - currie c , yang x - d , gallo m , louie d , lee d , erickson k , luna j , roy c , abderrahim h , kirschenbaum f , noguchi m , smith d , fukushima a , hales j , finer m , davis c , zsebo k , jakobovits a . functional transplant of megabase human immunoglobulin loci recapitulates human antibody response in mice . nature genetics vol . 15 , pp : 146 - 156 ( 1997 ); jakobovits a . mice engineered with human immunoglobulin yacs : a new technology for production of fully human antibodies for autoimmunity therapy . weir &# 39 ; s handbook of experimental immunology , the integrated immune system vol . iv , pp : 194 . 1 - 194 . 7 ( 1996 ); jakobovits a . production of fully human antibodies by transgenic mice . current opinion in biotechnology vol . 6 , no . 5 , pp : 561 - 566 ( 1995 ); mendez m , abderrahim h , noguchi m , david n , hardy m , green l , tsuda h , yoast s , maynard - currie c , garza d , bemmill r , jakobovits a , klapholz s . analysis of the structural integrity of yacs comprising human immunoglobulin genes in yeast and in embryonic sbem cells . genomics vol . 26 , pp : 294 - 307 ( 1995 ); jakobovits a . yac vectors : humanizing the mouse genome . current biology vol . 4 , no . 8 , pp : 761 - 763 ( 1994 ); arbones m , ord d , ley k , ratech h , maynard - curry k , otten g , capon d , tedder t . lymphocyte homing and leukocyte rolling and migration are impaired in l - selectin - deficient mice . immunity vol . 1 , no . 4 , pp : 247 - 260 ( 1994 ); green l , hardy m , maynard - curry k , tsuda h , louie d , mendez m , abderrahim h , noguchi m , smith d , zeng y , et . al . antigen - specific human monoclonal antibodies from mice engineered with human ig heavy and light chain yacs . nature genetics vol . 7 , no . 1 , pp : 13 - 21 ( 1994 ); jakobovits a , moore a , green l , vergara g , maynard - curry k , austin h , klapholz s . germ - line transmission and expression of a human - derived yeast artificial chromosome . nature vol . 362 , no . 6417 , pp : 255 - 258 ( 1993 ); jakobovits a , vergara g , kennedy j , hales j , mcguinness r , casentini - borocz d , brenner d , otten g . analysis of homozygous mutant chimeric mice : deletion of the immunoglobulin heavy - chain joining region blocks b - cell development and antibody production . proceedings of the national academy of sciences usa vol . 90 , no . 6 , pp : 2551 - 2555 ( 1993 ); kucherlapati et al ., u . s . pat . no . 6 , 1075 , 181 . antibodies can also be made using phage display techniques . such techniques can be used to isolate an initial antibody or to generate variants with altered specificity or avidity characteristics . single chain fv can also be used as is convenient . they can be made from vaccinated transgenic mice , if desired . antibodies can be produced in cell culture , in phage , or in various animals , including but not limited to cows , rabbits , goats , mice , rats , hamsters , guinea pigs , sheep , dogs , cats , monkeys , chimpanzees , apes . antibodies can be labeled with a detectable moiety such as a radioactive atom , a chromophore , a fluorophore , or the like . such labeled antibodies can be used for diagnostic techniques , either in vivo , or in an isolated test sample . antibodies can also be conjugated , for example , to a pharmaceutical agent , such as chemotherapeutic drug or a toxin . they can be linked to a cytokine , to a ligand , to another antibody . suitable agents for coupling to antibodies to achieve an anti - tumor effect include cytokines , such as interleukin 2 ( il2 ) and tumor necrosis factor ( tnf ); photosensitizers , for use in photodynamic therapy , including aluminum ( iii ) phthalocyanine tetrasulfonate , hematoporphyrin , and phthalocyanine ; radionuclides , such as iodine - 131 ( 131 i ), yttrium - 90 ( 90 y ), bismuth - 212 ( 212 bi ), bismuth - 213 ( 213 bi ), technetium - 99m ( 99m tc ), rhenium - 186 ( 186 re ), and rhenium - 188 ( 188 re ); antibiotics , such as doxorubicin , adriamycin , daunorubicin , methotrexate , daunomycin , neocarzinostatin , and carboplatin ; bacterial , plant , and other toxins , such as diphtheria toxin , pseudomonas exotoxin a , staphylococcal enterotoxin a , abrin - a toxin , ricin a ( deglycosylated ricin a and native ricin a ), tgf - alpha toxin , cytotoxin from chinese cobra ( naja naja atra ), and gelonin ( a plant toxin ); ribosome inactivating proteins from plants , bacteria and fungi , such as restrictocin ( a ribosome inactivating protein produced by aspergillus restrictus ), saporin ( a ribosome inactivating protein from saponaria officinalis ), and rnase ; tyrosine kinase inhibitors ; ly207702 ( a difluorinated purine nucleoside ); liposomes containing antitumor agents ( e . g ., antisense oligonucleotides , plasmids which encode for toxins , methotrexate , etc . ); and other antibodies or antibody fragments , such as f ( ab ). those of skill in the art will readily understand and be able to make such antibody derivatives , as they are well known in the art . the antibodies may be cytotoxic on their own , or they may be used to deliver cytotoxic agents to particular locations in the body . the antibodies can be administered to individuals in need thereof as a form of passive immunization . characterization of extracellular regions for the cell surface and secreted proteins from the protein sequence is based on the prediction of signal sequence , transmembrane domains and functional domains . antibodies are preferably specifically immunoreactive with membrane associated proteins , particularly to extracellular domains of such proteins or to secreted proteins . such targets are readily accessible to antibodies , which typically do not have access to the interior of cells or nuclei . however , in some applications , antibodies directed to intracellular proteins may be useful as well . moreover , for diagnostic purposes , an intracellular protein may be an equally good target since cell lysates may be used rather than a whole cell assay . computer programs can be used to identify extracellular domains of proteins whose sequences are known . such programs include smart software ( schultz et al ., proc . natl . acad . sci . usa 95 : 5857 - 5864 , 1998 ) and pfam software ( babeman et al ., nucleic acids res . 28 : 263 - 266 , 2000 ) as well as psortii . typically such programs identify transmembrane domains ; the extracellular domains are identified as immediately adjacent to the transmembrane domains . prediction of extracellular regions and the signal cleavage sites are only approximate . it may have a margin of error + or − 5 residues . signal sequence can be predicted using three different methods ( nielsen et al , protein engineering 10 : 1 - 6 , 1997 , jagla et . al , bioinformatics 16 : 245 - 250 , 2000 , nakai , k and horton , p . trends in biochem . sci . 24 : 34 - 35 , 1999 ) for greater accuracy . similarly transmembrane ( tm ) domains can be identified by multiple prediction methods . ( pasquier , et . al , protein eng . 12 : 381 - 385 , 1999 , sonnhammer et al ., in proc . of sixth int . conf . on intelligent systems for molecular biology , p . 175 - 182 , ed j . glasgow , t . littlejohn , f . major , r . lathrop , d . sankoff , and c . sensen menlo park , calif . : aaai press , 1998 , klein , et . al , biochim . biophys . acta , 815 : 468 , 1985 , nakai and kanehisa genomics , 14 : 897 - 911 , 1992 ). in ambiguous cases , locations of functional domains in well characterized proteins are used as a guide to assign a cellular localization . putative functions or functional domains of novel proteins can be inferred from homologous regions in the database identified by blast searches ( altschul et . al . nucleic acid res . 25 : 3389 - 3402 , 1997 ) and / or from a conserved domain database such as pfam ( babeman et . al , nucleic acids res . 27 : 260 - 262 1999 ) blocks ( henikoff , et . al , nucl . acids res . 28 : 228 - 230 , 2000 ) and smart ( ponting , et . al , nucleic acid res . 27 , 229 - 232 , 1999 ). extracellular domains include regions adjacent to a transmembrane domain in a single transmembrane domain protein ( out - in or type i class ). for multiple transmembrane domains proteins , the extracellular domain also includes those regions between two adjacent transmembrane domains ( in - out and out - in ). for type ii transmembrane domain proteins , for which the n - terminal region is cytoplasmic , regions following the transmembrane domain is generally extracellular . secreted proteins on the other hand do not have a transmembrane domain and hence the whole protein is considered as extracellular . membrane associated proteins can be engineered to delete the transmembrane domains , thus leaving the extracellular portions which can bind to ligands . such soluble forms of transmembrane receptor proteins can be used to compete with natural forms for binding to ligand . thus such soluble forms act as inhibitors and can be used therapeutically as anti - angiogenic agents , as diagnostic tools for the quantification of natural ligands , and in assays for the identification of small molecules which modulate or mimic the activity of a bem : ligand complex . alternatively , the endothelial markers themselves can be used as vaccines to raise an immune response in the vaccinated animal or human . for such uses , a protein , or immunogenic fragment of such protein , corresponding to the intracellular , extracellular or secreted bem of interest is administered to a subject . the immogenic agent may be provided as a purified preparation or in an appropriately expressing cell . the administration may be direct , by the delivery of the immunogenic agent to the subject , or indirect , through the delivery of a nucleic acid encoding the immunogenic agent under conditions resulting in the expression of the immunogenic agent of interest in the subject . the bem of interest may be delivered in an expressing cell , such as a purified population of breast tumor endothelial cells or a population of fused breast tumor endothelial and dendritic cells . nucleic acids encoding the bem of interest may be delivered in a viral or non - viral delivery vector or vehicle . non - human sequences encoding the human bem of interest or other mammalian homolog can be used to induce the desired immunologic response in a human subject . for several of the bems of the present invention , mouse , rat or other ortholog sequences can be obtained from the literature or using techniques well within the skill of the art . endothelial cells can be identified using the markers which are disclosed herein as being endothelial cell specific . antibodies specific for such markers can be used to identify such cells , by contacting the antibodies with a population of cells containing some endothelial cells . the presence of cross - reactive material with the antibodies identifies particular cells as endothelial . similarly , lysates of cells can be tested for the presence of cross - reactive material . any known format or technique for detecting cross - reactive material can be used including , immunoblots , radioimmunoassay , elisa , immunoprecipitation , and immunohistochemistry . in addition , nucleic acid probes for these markers can also be used to identify endothelial cells . any hybridization technique known in the art including northern blotting , rt - pcr , microarray hybridization , and in situ hybridization can be used . one can identify breast tumor endothelial cells for diagnostic purposes , testing cells suspected of containing one or more bems . one can test both tissues and bodily fluids of a subject . for example , one can test a patient &# 39 ; s blood for evidence of intracellular and membrane associated bems , as well as for secreted bems . of particular interest in this context is the testing of breast duct fluid . intracellular and / or membrane associated bems may be present in bodily fluids as the result of high levels of expression of these factors and / or through lysis of cells expressing the bems . populations of various types of endothelial cells can also be made using the antibodies to endothelial markers of the invention . the antibodies can be used to purify cell populations according to any technique known in the art , including but not limited to fluorescence activated cell sorting . such techniques permit the isolation of populations which are at least 50 , 60 , 70 , 80 , 90 , 92 , 94 , 95 , 96 , 97 , 98 , and even 99 % the type of endothelial cell desired , whether normal , tumor , or pan - endothelial . antibodies can be used to both positively select and negatively select such populations . preferably at least 1 , 5 , 10 , 15 , 20 , or 25 of the appropriate markers are expressed by the endothelial cell population . populations of endothelial cells made as described herein , can be used for screening drugs to identify those suitable for inhibiting the growth of tumors by virtue of inhibiting the growth of the tumor vasculature . populations of endothelial cells made as described herein , can be used for screening candidate drugs to identify those suitable for modulating angiogenesis , such as for inhibiting the growth of tumors by virtue of inhibiting the growth of endothelial cells , such as inhibiting the growth of the tumor or other undesired vasculature , or alternatively , to promote the growth of endothelial cells and thus stimulate the growth of new or additional large vessel or microvasculature . inhibiting the growth of endothelial cells means either regression of vasculature which is already present , or the slowing or the absence of the development of new vascularization in a treated system as compared with a control system . by stimulating the growth of endothelial cells , one can influence development of new ( neovascularization ) or additional vasculature development ( revascularization ). a variety of model screening systems are available in which to test the angiogenic and / or anti - angiogenic properties of a given candidate drug . typical tests involve assays measuring the endothelial cell response , such as proliferation , migration , differentiation and / or intracellular interaction with a given candidate drug . by such tests , one can study the signals and effects of the test stimuli . some common screens involve measurement of the inhibition of heparanase , endothelial tube formation on matrigel , scratch induced motility of endothelial cells , platelet - derived growth factor driven proliferation of vascular smooth muscle cells , and the rat aortic ring assay ( which provides an advantage of capillary formation rather than just one cell type ). drugs can be screened for the ability to mimic or modulate , inhibit or stimulate , growth of tumor endothelium cells and / or normal endothelial cells . drugs can be screened for the ability to inhibit tumor endothelium growth but not normal endothelium growth or survival . similarly , human cell populations , such as normal endothelium populations or breast tumor endothelial cell populations , can be contacted with test substances and the expression of breast tumor endothelial markers and / or normal endothelial markers determined . test substances that decrease the expression of breast tumor endothelial markers ( bems ) are candidates for inhibiting angiogenesis and the growth of tumors . in cases where the activity of a bem is known , agents can be screened for their ability to decrease or increase the activity . for those breast tumor endothelial markers identified as containing transmembrane regions , it is desirable to identify drug candidates capable of binding to the bem receptors found at the cell surface . for some applications , the identification of drug candidates capable of blocking the bem receptor from its native ligand will be desired . for some applications , the identification of a drug candidate capable of binding to the bem receptor may be used as a means to deliver a therapeutic or diagnostic agent . for other applications , the identification of drug candidates capable of mimicking the activity of the native ligand will be desired . thus , by manipulating the binding of a transmembrane bem receptor : ligand complex , one may be able to promote or inhibit further development of endothelial cells and hence , vascularization . for those breast tumor endothelial markers identified as being secreted proteins , i . e ., extracellular , it is desirable to identify drug candidates capable of binding to the secreted bem protein . for some applications , the identification of drug candidates capable of interfering with the binding of the secreted bem it is native receptor . for other applications , the identification of drug candidates capable of mimicking the activity of the native receptor will be desired . thus , by manipulating the binding of the secreted bem : receptor complex , one may be able to promote or inhibit further development of endothelial cells , and hence , vascularization . expression can be monitored according to any convenient method . protein or mrna can be monitored . any technique known in the art for monitoring specific genes &# 39 ; expression can be used , including but not limited to elisas , sage , microarray hybridization , western blots . changes in expression of a single marker may be used as a criterion for significant effect as a potential pro - angiogenic , anti - angiogenic or anti - tumor agent . however , it also may be desirable to screen for test substances that are able to modulate the expression of at least 5 , 10 , 15 , or 20 of the relevant markers , such as the tumor or normal endothelial markers . inhibition of bem protein activity can also be used as a drug screen . test substances for screening can come from any source . they can be libraries of natural products , combinatorial chemical libraries , biological products made by recombinant libraries , etc . the source of the test substances is not critical to the invention . the present invention provides means for screening compounds and compositions that may previously have been overlooked in other screening schemes . nucleic acids and the corresponding encoded proteins of the markers of the present invention can be used therapeutically in a variety of modes . bems can be used to stimulate the growth of vasculature , such as for wound healing or to circumvent a blocked vessel . the nucleic acids and encoded proteins can be administered by any means known in the art . such methods include , using liposomes , nanospheres , viral vectors , non - viral vectors comprising polycations , etc . suitable viral vectors include adenovirus , retroviruses , and sindbis virus . administration modes can be any known in the art , including parenteral , intravenous , intramuscular , intraperitoneal , topical , intranasal , intrarectal , intrabronchial , etc . specific biological antagonists of bems can also be used to therapeutic benefit . for example , antibodies , t cells specific for a bem , antisense to a bem , interferance rna to a bem , and ribozymes specific for a bem can be used to restrict , inhibit , reduce , and / or diminish tumor or other abnormal or undesirable vasculature growth . such antagonists can be administered as is known in the art for these classes of antagonists generally . anti - angiogenic drugs and agents can be used to inhibit tumor growth , as well as to treat diabetic retinopathy , rheumatoid arhritis , psoriasis , polycystic kidney disease ( pkd ), and other diseases requiring angiogenesis for their pathologies . mouse counterparts to human bems can be used in mouse cancer models or in cell lines or in vitro to evaluate potential anti - angiogenic or anti - tumor compounds or therapies . their expression can be monitored as an indication of effect . mouse bems can be used as antigens for raising antibodies which can be tested in mouse tumor models . mouse bems with transmembrane domains are particularly preferred for this purpose . mouse bems can also be ued as vaccines to raise an immunological response in a human to the human ortholog . the above disclosure generally describes the present invention . all references disclosed herein are expressly incorporated by reference in their entireties . a more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only , and are not intended to limit the scope of the invention . function of bem proteins was determined using bioinformatics tools . bems that are putative functional receptors with short cytoplasmic tails make particularly interesting targets . unigene id function omimid protein hs . 181418 kiaa0152 gene product — 055545 hs . 25691 receptor ( calcitonin ) activity 605155 005847 modifying protein 3 hs . 9598 sema domain — bab212835 protein kinases were identified among the bems . these are particularly good druggable targets , especially for small molecules . unigene id function omimid protein hs . 100009 cyclin - dependent 123828 kinase 3 hs . 143897 dysferlin , limb girdle 603009 np_003485 muscular dystrophy 2b ( autosomal recessive ) hs . 184367 ca2 +- promoted ras baa25464 inactivator hs . 246857 mitogen - activated 602896 np_620708 protein kinase 9 hs . 75087 fast kinase 606965 np - 079372 hs . 296323 serum / glucocorticoid 602958 np_005618 regulated kinase hs . 246857 mitogen - activated 602986 np_620708 protein kinase kinases with non - protein substrates were also identified . these similarly are believed to be exceedingly good druggable targets . unigene id function omimid protein hs . 118625 hexokinase 1 142600 np_277035 hs . 82689 tumor rejection antigen ( gp96 ) 191175 np_003290 1 unigene id function omimid protein hs . 91143 jagged 1 ( alagille syndrome ) 601920 np_000205 hs . 119206 insulin - like growth factor 602867 np_001544 binding protein 7 hs . 1516 insulin - like growth factor 146733 np_001543 binding protein 4 hs . 211573 heparan sulfate proteoglycan 2 142461 np_005520 ( perlecan ) hs . 75111 protease , serine , 11 ( igf 602194 np_002766 binding ) hs . 8546 notch homolog 3 ( drosophila ) 600276 np_000426 phosphatases , like kinases , are readily amenable to screening for inhibitors , especially small molecule inhibitors : unigene id function omimid protein hs . 8997 a protein 1a 140550 np_005336 hs . 205353 iphosphate diphosphohydrolase 601752 np_001767 hs . 43666 phosphatase type iva , member 606449 np_116000 hs . 6147 c1 domain - containing — np_056134 ophosphatase & amp ; tensin - like unigene id function omimid protein hs . 17170 g protein - coupled receptor 4 600551 np_005273 the cellular location of the bems was determined to be either cytoplasmic , etracellular , membrane , or nuclear , as shown below . unigene id function omimid protein hs . 75415 beta - 2 - microglobulin 109700 np_004039 hs . 821 biglycan 301870 np_001702 hs . 172928 collagen , type i , alpha 1 120150 np_000079 hs . 119571 collagen , type iii , alpha 1 120180 np_000081 ( ehlers - danlos syndrome type iv , autosomal dominant ) hs . 119129 collagen , type iv , alpha 1 120130 np_001836 hs . 75617 collagen , type iv , alpha 2 120090 np_001837 hs . 235368 collagen , type v , alpha 3 120216 np_056534 hs . 159263 collagen , type vi , alpha 2 120240 np_001840 hs . 78409 collagen , type xviii , alpha 1 120328 np_085059 hs . 278625 complement component 4b 120820 np_000583 hs . 230 fibromodulin 600245 np_002014 hs . 211573 heparan sulfate proteoglycan 2 142461 np_005520 ( perlecan ) hs . 1516 insulin - like growth factor 146733 np_001543 binding protein 4 hs . 119206 insulin - like growth factor 602867 np_001544 binding protein 7 hs . 49215 integrin - binding sialoprotein 147563 np_004958 ( bone sialoprotein , bone sialoprotein ii ) hs . 79339 lectin , galactoside - binding , 600626 np_005558 soluble , 3 binding protein hs . 106747 likely homolog of rat and np_067639 mouse retinoid - inducible serine carboxypeptidase hs . 365706 matrix gla protein 154870 np_000891 hs . 151738 matrix metalloproteinase 9 120361 np_004985 ( gelatinase b , 92 kda gelatinase , 92 kda type iv collagenase ) hs . 699 peptidylprolyl isomerase b 123841 np_000933 ( cyclophilin b ) hs . 75111 protease , serine , 11 ( igf 602194 np_002766 binding ) hs . 25338 protease , serine , 23 hs . 78224 ribonuclease , rnase a family , 180440 aah05324 1 ( pancreatic ) hs . 111779 secreted protein , acidic , 182120 np_003109 cysteine - rich ( osteonectin ) hs . 82085 serine ( or cysteine ) 173360 np_000593 proteinase inhibitor , clade e ( nexin , plasminogen activator inhibitor type 1 ), member 1 hs . 179573 tem10 , col1a2 involved in 120160 np_000080 tissue remodeling hs . 356624 tem11 , nidogen ( enactin ) 131390 np_002499 hs . 5831 tissue inhibitor of 305370 np_003245 metalloproteinase 1 ( erythroid potentiating activity , collagenase inhibitor ) hs . 82689 tumor rejection antigen ( gp96 ) 1 191175 np_003290 abounader , r ., lal , b ., luddy , c ., koe , g ., davidson , b ., rosen , e . m ., and laterra , j . ( 2002 ). in vivo targeting of sf / hgf and c - met expression via u1snrna / ribozymes inhibits breast tumor growth and angiogenesis and promotes apoptosis . faseb j 16 , 108 - 10 . bart , j ., groen , h . j ., hendrikse , n . h ., van der graaf , w . t ., vaalburg , w ., and de vries , e . g . ( 2000 ). the blood - brain barrier and oncology : new insights into function and modulation . cancer treat rev 26 , 449 - 62 . bernsen , h . j ., rijken , p . f ., oostendorp , t ., and van der kogel , a . j . ( 1995 ). vascularity and perfusion of human breast tumors xenografted in the athymic nude mouse . br j cancer 71 , 721 - 6 . bowers , d . c ., fan , s ., walter , k . a ., abounader , r ., williams , j . a ., rosen , e . m ., and laterra , j . ( 2000 ). scatter factor / hepatocyte growth factor protects against cytotoxic death in human glioblastoma via phosphatidylinositol 3 - kinase - and akt - dependent pathways . cancer res 60 , 4277 - 83 . chen , h ., centola , m ., altschul , s . f ., and metzger , h . ( 1998 ). characterization of gene expression in resting and activated mast cells . j exp med 188 , 1657 - 68 . guerin , c ., wolff , j . e ., laterra , j ., drewes , l . r ., brem , h ., and goldstein , g . w . ( 1992 ). vascular differentiation and glucose transporter expression in rat breast tumors : effects of steroids . ann neurol 31 , 481 - 7 . hobbs , s . k ., monsky , w . l ., yuan , f ., roberts , w . g ., griffith , l ., torchilin , v . p ., and jain , r . k . ( 1998 ). regulation of transport pathways in tumor vessels : role of tumor type and microenvironment . proc natl acad sci usa 95 , 4607 - 12 . holash , j ., maisonpierre , p . c ., compton , d ., boland , p ., alexander , c . r ., zagzag , d ., yancopoulos , g . d ., and wiegand , s . j . ( 1999 ). vessel cooption , regression , and growth in tumors mediated by angiopoietins and vegf . science 284 , 1994 - 8 . huminiecki , l ., and bicknell , r . ( 2000 ). in silico cloning of novel endothelial - specific genes . genome res 10 , 1796 - 806 . lamszus , k ., laterra , j ., westphal , m ., and rosen , e . m . ( 1999 ). scatter factor / hepatocyte growth factor ( sf / hgf ) content and function in human breast tumors . int j dev neurosci 17 , 517 - 30 . marx , j . ( 2001 ). caveolae : a once - elusive structure gets some respect . science 294 , 1862 - 5 . roberts , w . g ., and palade , g . e . ( 1997 ). neovasculature induced by vascular endothelial growth factor is fenestrated . cancer res 57 , 765 - 72 . shinoura , n ., shamraj , o . i ., hugenholz , h ., zhu , j . g ., mcblack , p ., warnick , r ., tew , j . j ., wani , m . a ., and menon , a . g . ( 1995 ). identification and partial sequence of a cdna that is differentially expressed in human brain tumors . cancer lett 89 , 215 - 21 . st croix , b ., rago , c ., velculescu , v ., traverso , g ., romans , k . e ., montgomery , e ., lal , a ., riggins , g . j ., lengauer , c ., vogelstein , b ., and kinzler , k . w . ( 2000 ). genes expressed in human tumor endothelium . science 289 , 1197 - 202 . stan , r . v ., arden , k . c ., and palade , g . e . ( 2001 ). cdna and protein sequence , genomic organization , and analysis of cis regulatory elements of mouse and human plvap genes . genomics 72 , 304 - 13 . tamagnone , l ., artigiani , s ., chen , h ., he , z ., ming , g . i ., song , h ., chedotal , a ., winberg , m . l ., goodman , c . s ., poo , m ., tessier - lavigne , m ., and comoglio , p . m . ( 1999 ). plexins are a large family of receptors for transmembrane , secreted , and gpi - anchored semaphorins in vertebrates . cell 99 , 71 - 80 . vajkoczy , p ., and menger , m . d . ( 2000 ). vascular microenvironment in breast tumors . j neurooncol 50 , 99 - 108 . vajkoczy , p ., schilling , l ., ullrich , a ., schmiedek , p ., and menger , m . d . ( 1998 ). characterization of angiogenesis and microcirculation of high - grade breast tumor : an intravital multifluorescence microscopic approach in the athymic nude mouse . j cereb blood flow metab 18 , 510 - 20 . vick , n . a ., and bigner , d . d . ( 1972 ). microvascular abnormalities in virally - induced canine breast tumors . structural bases for altered blood - brain barrier function . j neurol sci 17 , 29 - 39 .	2
an endless belt 10 comprises a lengthwise supporting structure 20 of twisted strands embedded in an elastomeric matrix 21 , such as a mixture of polychloroprene rubber or natural rubber or any type commonly known in the manufacture of power drive endless belts , for its good adhesion properties . such belt is advantageously of the “ striated ” type , i . e . its inner surface 22 is shaped like teeth 23 , the pitch p of which is standardized , as well as their triangular cross - section as shown ( v belt ) or their trapezoidal cross - section , each reference character h , j , k , l and m in the iso standard 9981 also defining the belt thickness , as measured between the tooth bottom 24 and the outer surface of the belt . the belt 10 cooperates with pulleys 11 , 12 , 13 , 14 , 15 , 16 , etc ., the rims of which have a profile conjugate with that of teeth 23 , that is they have grooves arranged in the same way and with a cross - section which is similar to that , e . g . triangular or trapezoidal , of the teeth 23 , which they receive when the drive system is operating . the belt 10 comprises two strands 17 and 18 . the v - shaped belts intended for automotive drive systems generally have six teeth with a width 1 = 3 . 56 mm , i . e . a total belt width l of 21 . 36 mm . according to the present invention , the twisted strands are made up of adipamide polytetramethylene or polyamide 4 . 6 . these are resins prepared by polycondensing 1 . 4 - diaminobutane and adipic acid , for instance those marketed under the name of stanyl by the dsm company . such resins in the shape of yams are then prepared into twisted strands . therefore , belts usable under severe operating conditions , such as those prevailing in drive systems for automotive applications , can be obtained by selecting the twisted strand size and pitch p for the belt to exhibit a stress - elongation diagram having , for instance between 1 % and 10 % of elongation , an average slope in the range from 12 dan /% of elongation per width centimeter and per strand to 20 dan /% of elongation per width centimeter and per strand , and preferably substantially equal to 17 dan /% of elongation per width centimeter and per strand . said slope may , more preferably , range from 12 and 15 dan % of elongation per width centimeter and per strand . besides , the method for manufacturing belts according to the invention differs from that implemented in conventional belts for automotive applications , wherein the twisted strands are kept tensioned during the whole manufacturing process . in the conventional method , the twisted strands are first stretched and then helically wound onto the drum carrying the gum sheets . the tensioned twisted strands in the winding condition are still under tension when the blank is cured . for such curing , the blank is generally arranged in a mold shaped like the belts to be produced , and then it is pressed by radial expansion onto the inner wall of the mold . such radial expansion increases the tension of the twisted strands . said tension disappears at the end of the curing process , when the blank is extracted from the mold and such tension cancellation results in shrinkage and thus in a smaller length of the belt . in order to avoid such shrinkage , in said conventional method , the twisted strands are tightened upon cooling from the curing temperature down to the ambient temperature , which means that they retain their length and that all shrinkage is prevented . when the belt has been mounted , the operating temperature fluctuations result in length changes and , more especially when its temperature increases , the belt is brought back to its initial state , and the twisted strands tend to shorten , which results in an increase in the service stresses in the belt . as the belt temperature is decreasing , the length tends to increase and the belt slacks , which phenomena is even aggravated by the permanent strain resulting from the twisted strand creep . on the contrary , when a belt is manufactured according to the present invention , the twisted strands are helically wound on a drum carrying gum sheets at a nominal tension which should ideally be null but which , in practice , is very low or almost null , corresponding to a winding operation under the lowest possible tension , being understood that some very low or almost null ( e . g . below 5 n ) residual stresses always remain , which fact cannot be avoided if only owing to the stresses resulting from the weight of the twisted strands . afterwards , during the pressure curing process , the blank is pressed onto the inner wall of the mold without any radial expansion and therefore the twisted strands present an almost null residual stress . after extraction and during the cooling process , the blank cools down without being tensioned . once the cooling is over , the twisted strands present no tension at all . thus , an advantage of a belt according to the invention resides in that the operating temperature fluctuations have much less influence on the belt that when said conventional method is implemented . such smaller changes in the belt length as a function of temperature also result in a lower tension change , which prevents the belts from slipping on the pulleys , and reduces the generated noise . one major problem in automotive applications is the acyclic feature owing to the nonuniform time distribution of the alternating piston loads . this leads to a severe stressing of the belts and , more particularly , to a residual stress after stabilization ( that is after some operating period ) which is quite lower than in the case of drive systems without an acyclic feature , such as the drive systems from an electric motor . owing to such severe stresses , up to now it has not been possible to provide belts having an elastic modulus suitable for the so - called automatic mounting of the belt in a car drive system . most remarkably , the belts according to the present invention , which have an average slope ranging from 12 to 20 dan /% of elongation per width centimeter and per strand , exhibit a stable operating tension after about ten hours of operation , which is in the order of 14 to 20 dan per width centimeter and per strand . good results are obtained with twisted strands having a diameter ranging from 0 . 7 to 1 . 3 mm , the distance between twisted strands being in the range from 0 to 4 d , and preferably in the range from 0 to 2 d . fig3 a shows the case of two driving belts in the automotive field , comprising six 3 . 56 mm - wide teeth and polyamide 4 . 6 twisted strands 20 , manufactured according to the above - mentioned method ( winding under an almost null nominal tension , curing and cooling without tensioning ) . the belt according to curve i ( twisted strands , 470 dtex x 6 x 3 ) has an average slope , between 1 % and 10 % of elongation ( curve drawn using the least - squares method ), which amounts to 17 dan /% of elongation per width centimeter and per strand . the belt corresponding to curve ii has an average slope , between 1 % and 10 % of elongation , which amounts to 11 dan /% of elongation per width centimeter and per strand . the elongation test , used for such diagrams , is carried out , for instance , on a 200 mm - long strand retained between two jaws , the one 30 being stationary and the other 31 being movable , using a dynamometer ( refer to fig3 b ). the sole object of the above - mentioned average slope is to provide a characteristic value for the stress - elongation diagrams , obtained by means of the least - squares method , but such curves should in no way be regarded as straight lines since , as a matter of fact , at each point they do have a slope , the value of which varies appreciably along the curve . a car belt according to curve i and comprising six 3 . 56 mm - wide teeth has been mounted onto a drive system without any fixed tighteners . the mounting operation has been performed by stretching the belt to fit it onto the pulleys of the drive system . once released , the belt is in position with a 2 % elongation , which corresponds to an initial elongation force of 80 dan per strand ( refer to curve i ), that is substantially 13 dan per tooth and per strand . after a few hours of operation , the stabilized tension has been measured . its value amounted substantially to 6 dan per tooth and per strand . such tension remains stable and the belt exhibits a long service life . a car belt according to curve ii and comprising six 3 . 56 mm - wide teeth has been mounted onto a drive system without any fixed tighteners . the mounting operation has been performed by stretching the belt to fit it onto the pulleys of the drive system . after a few hours of operation , the stabilized tension has been measured . its value was quite below 6 dan per tooth and per strand , and the belt was inclined to slip on the pulleys , which generated noise and the service life of the belt was not very satisfactory . another restraint should be taken into account , especially as regards the filtering properties concerning the high - order harmonic components of the speed and voltage signal output by the receiving device . such phenomena is more particularly marked when high inertia are present , i . e . when the motor vehicle is provided with an alternator . fig4 a and 4 b illustrate this filtering phenomena . each one shows , in terms of time , the rotation speed of the main shaft ( curve m ), here that of a diesel engine at idle speed , and that of the shaft ( curve a ) of a receiving device 14 . the belt 10 transmits the speed , resulting from the rotation of the pulley 11 , to pulleys 12 , 14 , 15 and 16 of the receiving devices , more particularly the pulley 14 , which drives the alternator having a torque of 3 . 5 10 - 3 kg . m 2 . curve a in fig4 a has been obtained by means of a conventional belt , comprising polyester twisted strands , after a 48 - hour operating time , the belt having reached a stabilized operating tension . it can be seen that curve a shows a repetitive anomaly 40 having a more or less stable shape and corresponding to a slope interruption during deceleration . such anomaly originates more particularly in the fact that the belt passes over to the pulley 14 the acyclic operation of the engine ( cf . curve m ). this phenomena is all the more marked as the engine has a more acyclic property . by way of information , a four - cylinder gasoline engine has an acyclic property in the order of 6 - 7 %. such property is in the order of 4 - 5 % for a six - cylinder gasoline engine , but it ranges generally from 10 to 15 % for a diesel engine . some diesel engines even have an acyclic property as high as 20 - 25 %. said anomalies 40 are due to the conjugate effect of the engine acyclic property and of the receiving device inertia , and they increase with the acyclic value of the engine and with the inertia of the receiving device . the curve shown in fig4 b has been obtained using a belt according to the invention , and corresponding to curve i in fig3 a , after a 48 - hour operating period . the belt has reached a stabilized operating tension of 15 dan per width centimeter and per strand . it can be seen that said anomaly 40 has completely disappeared . the belt according to the invention has the quite remarkable property of being capable of filtering the high - order harmonic components of the speed signal output by the receiving device . the suppression of such anomalies 40 means a longer service life of the belt . the automatic mounting of a belt into a car drive system involves high tensile stresses . the mounting operation may be performed more easily by means of the tools to be described with reference to fig5 a , 5 b and 6 . the mounting tool 40 , shown in detail in fig5 a and 5 b , has a central part 41 provided with a square opening 42 for receiving a complementary part 51 of an actuating wrench 50 . it should be noted that the lever 50 may be an integral part of the tool 40 . the tool 40 has an inclined conical part 43 , at the top end of which a guiding flat surface 44 is provided , and a l - shaped member having a leg 49 extending from the central part 42 and whose flat underside 48 is intended to rest on the surface 61 of the pulley 60 , and an end flap 46 bent substantially at right angle in relation to the leg 49 , and the inner surface 47 of which abuts against the rim 63 of the pulley 60 . the leg 49 is crowned by a guiding area 45 substantially in the shape of an arc of a circle . the object of the method according to the invention consists in fitting the belt by a lever effect , using the mounting tool 40 , which is guided along the girth ( 62 , 63 ) of the pulley 60 , whether the latter remains fixed or is capable of rotating about a driving shaft received in its central opening 65 . the conical part 43 , bounded by the inclined flat surface 44 , and the part 45 make it possible to guide , by a ramp effect , the side portion 27 of belt 10 from the side portion 26 already accommodated in the groove 62 of the pulley 60 , up to the side portion 28 , which stands apart from the surface 61 . this is performed by bearing on the lever 50 . the procedure is as follows . the tool 40 is positioned so that the surface 48 of the leg 49 rests on the surface 61 of the pulley 60 , and that the conical part 43 and the surface 47 of the flap 46 abut against the girth of the pulley 60 , that is the rim 63 . of course , it would be possible to obtain such thrust effect by pressing the tool 40 into the groove 62 of the pulley 60 . the belt 10 is prepositioned in the ramp constituted by parts 43 , 44 and 45 . by operating the lever 50 in the direction of arrow f , the tool 40 is moved along the girth of the pulley 60 in the direction of arrow f ′, which results in the fitting of the belt 10 into the groove 62 . should the pulley 60 be fixed , such travel of the tool 40 is performed with a sliding motion . if the pulley 60 is capable of rotating , such travel of the tool 40 attends the rotational motion of the pulley 60 . anyhow , the lever effect combined with the ramp effect provide an easy fitting . more particularly , such mounting operation takes place in the plane of the pulley 60 or close to it , which results in the fact that this method is suitable for an exchange in the engine compartment , usually of limited accessibility in automotive vehicles .	5
referring initially to fig1 , an applicator assembly including a spray tip assembly according the present disclosure is shown generally as applicator assembly 10 . applicator assembly 10 includes a manifold or base 20 , an elongated shaft 30 extending from manifold 20 , and a spray tip assembly 50 positioned on a distal end 30 b of elongated shaft 30 . applicator assembly 10 further includes an insert 40 configured to be received within spray tip assembly 50 and distal of elongated shaft 30 . with reference now to fig2 , manifold 20 includes a substantially y - shaped member having first and second proximal extension 22 , 24 and a distal extension 26 . proximal extensions 22 , 24 are configured for operable engagement with a first and second source of component ( not show ), e . g . syringe . distal extension 26 is configured for operable engagement with elongated shaft 30 , as will be discussed in further detail below . manifold 20 further includes first and second component channels 23 , 25 . first and second component channels 23 , 25 fluidly communicate the first and second sources of component with a first and second lumen 33 , 35 formed in elongated shaft 30 . while manifold 20 , as shown , is configured to receive only two sources of component , it is envisioned that manifold 20 may be configured to receive more than two sources of component . referring back to fig1 , elongated shaft 30 defines a substantially solid body of silicone , plastic , polymer or other flexible material . as noted above , elongated shaft 30 includes first and second component lumen 33 , 35 extending the length thereof . a wire 36 composed of a malleable material also extends the length of elongated shaft 30 . wire 36 is configured to maintain elongated shaft 30 in a bent or flexed configuration after elongated shaft 30 has been bent or flexed to accommodate a given procedure . elongated shaft 30 is secured to distal extension 26 of manifold 20 such that first and second component lumen 33 , 35 align with first and second component channels 23 , 25 , respectively . alternatively , elongated shaft 30 may be integrally formed with manifold 20 . elongated shaft 30 may further include grooves , detents or otherwise be configured for secure engagement with spray tip assembly 50 . with reference now to fig3 - 6 , spray tip assembly 50 defines a substantially cylindrical body 52 having an open proximal end 52 a and a substantially closed distal end 52 b . open proximal end 52 a is configured to receive distal end 30 b of elongated shaft 30 ( fig3 ). as will be discussed in further detail below , distal end 52 b includes an outlet 59 configured to eject a thoroughly mixed solution . spray tip assembly 50 may be composed of silicone or other suitable biocompatible materials . in one embodiment , spray tip assembly 50 is composed of a silicone elastomer , for example , tufel ® ii 94706 , a silicone rubber compound or lim ® 6071 , a liquid silicone rubber , available from momentive performance materials , waterford , n . y . through testing , it has been found that a spray tip assembly 50 composed of silicone having a 70 durometer , spray tip assembly 50 is capable of unclogging itself during operation . the flexible nature of silicone permits spray tip assembly 50 to flex under the increased pressure experienced during a clog of spray tip assembly 50 . the flexion of spray tip assembly 50 dislodges any clog that may form therein . additionally , the non - wetting surface characteristic ( hydrophobicity ) of silicone may assist in preventing the clogging of spray tip assembly 50 . the ability of spray tip assembly 50 to unclog itself during operations permits the continuous use of applicator assembly 10 without the need to repeatedly change spray tip assembly 50 . in this manner , the length of the procedure may be reduced and the expense of using multiple spray tip assemblies is eliminated . still referring to fig3 - 6 , spray tip assembly 50 includes a first chamber 54 , an intermediate chamber 56 and a final chamber 58 . first chamber 54 defines a substantially cylindrical cavity for receiving distal end 30 b of elongated shaft 30 . as will be discussed in further detail below , first chamber 54 is configured such that distal end 30 b of elongated shaft 30 is received pressed flush against insert 40 . it is envisioned , however , that first chamber 54 may be configured such that distal end 30 b of elongated shaft 30 is proximally spaced from insert 40 so as to form an initial mixing space for the first and second components . intermediate chamber 56 defines a substantially cylindrical cavity configured to receive insert 40 . intermediate chamber 56 includes ribs or spacers 56 a for maintaining insert 40 ( shown in phantom in fig6 ) centered within intermediate chamber 56 . insert 40 includes a solid , substantially cylindrical member positioned within intermediate chamber 56 to force the first and second components to flow around insert 40 in the space recreated by ribs 56 a . in an alternative embodiment ( fig3 a ), insert 40 ′ may extend proximally from intermediate chamber 56 into first chamber 54 , thereby creating an initial mixing space 41 ′ between distal end 30 b of elongated shaft 30 and intermediate chamber 56 about a proximal end 40 a ′ of insert 40 ′. in this manner , the first and second components flowing from first and second component lumen 33 , 35 may initially mix prior to entering intermediate chamber 56 . inserts 40 , 40 ′ may be composed of silicone or other suitable biocompatible material . with reference still to fig3 - 6 , final chamber 58 defines a substantially cylindrical cavity having a tapered distal portion 58 a . spray tip assembly 50 includes slots 57 formed therein fluidly communicating intermediate chamber 56 and final chamber 58 . slots 57 define opposed openings angling outwardly from final chamber 58 between a line tangent to final chamber 58 and about twenty degrees ( 20 °) counter - clockwise from the tangent line . as will be discussed in further detail below , slots 57 direct the partially mixed first and second components from within intermediate chamber 56 into final chamber 58 . although shown as a pair of opposed openings , it is envisioned that spray tip assembly 50 may include only a single slot 57 ( fig6 a ), or may alternatively include three or more slots 57 ( shown in phantom , fig6 a ). outlet 59 is configured to atomize the thoroughly mixed solution into a cone - shaped spray . as shown , from proximal to distal , outlet 59 includes a first cylindrical portion 59 a , a second cylindrical portion 59 b , and a recessed portion 59 c . it is envisioned , however , that outlet 59 may be formed without second cylindrical portion 59 b . the operation of applicator assembly 10 will now be described as relates to the figures . prior to use , insert 40 is received within intermediate chamber 56 of spray tip assembly 50 . as discussed above , insert 40 is positioned such that fluid passing through intermediate chamber 56 is forced around insert 40 in the space created by ribs 56 a . spray tip assembly 50 is selectively received on distal end 30 b of elongated shaft 30 . as discussed above , manifold 20 may be integrally formed with elongated shaft 30 , or instead it may be necessary to secure elongated shaft 30 to manifold 20 manually prior to use , making sure that first and second component channels 23 , 25 are aligned with first and second component lumen 33 , 35 . first and second source of component ( not shown ) are next connected to first and second proximal extensions 22 , 24 , respectively . once secured to manifold 20 , first and second source of components may be activated , e . g . depression of syringe plungers ( not shown ), to initiate the flow of first and second components within first and second component channels 23 , 25 , respectively . the first and second components flow through first and second component channels 23 , 25 , through first and second component lumen 33 , 35 , respectively , and into spray tip assembly 50 . the first and second components flowing from first and second component lumen 33 , 35 encounter insert 40 retained with intermediate chamber 56 . first and second component lumen 33 , 35 are spaced such that the first and second components may flow around insert 40 in the space created by ribs 56 a in between insert 40 and spray tip assembly 50 . the initially mixed first and second components are then forced into slots 57 where they are directed radially inward toward final chamber 58 . the flow of the mixture through slots 57 imparts a swirling motion to the mixture as the mixture enters final chamber 58 . thereafter , the thoroughly mixed solution is atomized as it is ejected through outlet 59 in a cone - shaped spray . turning to fig7 - 10 , an alternate embodiment of the present disclosure is shown generally as applicator assembly 110 . applicator assembly 110 is substantially similar to applicator assembly 10 , and will therefore only be described as relates to the differences therebetween . with reference initially to fig7 and 8 , applicator assembly 110 includes a manifold or base 120 configured to receive a pair of check valves 105 , an elongated shaft 130 extending from manifold 120 , and a spray tip assembly 150 positioned on a distal end of elongated shaft 130 . an insert 140 is received within spray tip assembly 150 and a shrink tube 160 is received about spray tip assembly 150 . referring to fig7 , first and second component channels 123 , 125 extend from a distal end of manifold 120 . first and second component channels 123 , 125 are configured to fluidly communicate with first and second component lumen 133 , 135 extending through elongated shaft 130 . this configuration permits for a more secure fluid seal between manifold 120 and elongated shaft 130 . with reference now to fig9 and 10 , insert 140 is substantially similar to insert 40 , including a substantially cylindrical member configured to be received within spray tip assembly 150 . as shown , insert 140 includes hemispherical recess 141 on both a first and second end thereof , however , it is envisioned that hemispherical recess 141 may be formed on a single end thereof . recess 141 is configured to create turbulence in the flow of the first and second components as they encounter insert 140 , thereby assisting in the mixing of the components . still referring to fig9 and 10 , shrink tube 160 is received about spray tip assembly 150 to prevent the excess radial expansion / flexion of spray tip assembly 150 during operation . shrink tube 160 may also assist in securing spray tip assembly 150 to elongated shaft 130 . with reference now to fig1 , spray tip assembly 150 is substantially similar to spray tip assembly 50 , described hereinabove , including radially extending slots 157 . a gutter or annular recess 157 a is formed about slots 157 . gutter 157 a is configured to direct the partially mixed first and second components into slots 157 . although the illustrative embodiments of the present disclosure have been described herein with reference to the accompanying drawings , it is to be understood that the disclosure is not limited to those precise embodiments , and that various other changes and modifications may be effected therein by one skilled in the art without departing from the scope or spirit of the disclosure .	1
this invention involves the device and procedure for at least partially closing the mouth of an aneurysm , typically a small - necked aneurysm , and a method of placing that device in the vasculature . these closure devices may be used to maintain the presence of vaso - occlusive devices such as coils in an aneurysm . fig1 is a plan view of an inventive device ( 100 ). it is made up , conceptually , of three major components . the first component is closure region ( 102 ). closure region ( 102 ) is generally chosen by the physician introducing the device into the body to generally approximate the size of the aneurysm opening to be closed . it need not be that large in that the closure region may be sized so that only a portion of the aneurysm opening is covered . in this instance , the closure region merely operates to prevent passage of fresh blood into the aneurysm itself . to some extent , this partial closure will prevent the direct impingement of flowing blood on the weakened back wall of the aneurysm . closure region ( 102 ) may be larger than the opening into the aneurysm but it need not be . generally , it is most desirable to minimize the amount of material placed in these devices since that also minimizes the stiffness of the device when it is placed into the body through the vasculature . extending outwardly from the central or closure region ( 102 ) are a number of struts . the struts are usually paired so that they extend from the closure region ( 102 ) in generally opposite directions . in fig1 axial struts ( 104 ) extend in generally opposite directions from closure region ( 102 ). axial struts ( 104 ) are typically longer than their circumferential struts ( 106 ) since axial struts ( 104 ) are generally used to extend along the wall of an artery and parallel to the axis of the artery . axial struts ( 104 ), it may be said , point in the direction of blood flow in the artery into which they are placed . generally , the axial length ( 105 ) of the device is functionally simply long enough to prevent the device from rotating in the lumen of the blood vessel into which it is placed . similarly , the circumferential struts ( 106 ) extend outwardly from the closure region ( 102 ) and have a length ( 107 ) which desirably is greater than half of the circumference of the vessel into which it is placed so to maintain the closure region ( 102 ) reasonably firmly against the mouth of the aneurysm . the device ( 100 ) typically may be made of metallic or polymeric materials . typical metallic materials include stainless steel and the nickel - titanium alloys often used for their superelastic or shape - memory properties , the most common of which is known as nitinol . thin polymeric sheets of reasonably pliable materials or composites of polymers and polymeric or metallic fibers . these devices desirably are constructed of materials which are not thrombogenic or may be coated with anti - thrombogenic materials . they may be coated with materials which are slippery and have a tendency , therefore , not to create occlusions . inherently slippery polymers , such as many of the fluorocarbons and hydrophilic polymers , e . g ., polyvinyl pyrrolidone , are members of these groups . as noted above , these devices should be as thin as is reasonably possible so to make easy the insertion of the device . depending upon the material used , stainless steel or superelastic alloys might be as thin as 0 . 25 mils ( 0 . 00025 inches ) up to 15 mils , although typically no thicker than 7 - 12 mils . fig2 through 5 show various configurations and aspect ratios of devices made according to this invention . fig2 in particular , shows a device ( 200 ) in which the closure region ( 202 ) is circular and one axial strut ( 204 ) is longer than its opposing strut ( 206 ). such a configuration may be desirable in instances where the aneurysm is on the exterior of a turn in an artery . in this variation , the circumferential struts ( 208 ) are narrow and of fairly short length . fig3 shows another variation in which the closure region ( 300 ) in which the closure region ( 302 ) and the axial struts ( 304 ) and ( 306 ) each have identical diameters ( as viewed vertically in fig3 ). the circumferential struts ( 308 ) are also shown . fig4 shows a similar variation ( 400 ) in which the closure region ( 402 ) and the axial struts ( 404 ) and ( 406 ) have the same diameter . it should be noted that in fig4 the upstream strut ( 404 ) is the same length as is the downstream strut ( 406 ). in contrast , the upstream strut ( 306 ) is shorter in fig3 than is the downstream strut ( 304 ). fig5 shows still another variation of the invention ( 500 ). this variation may be used to cover a stent which has an oval mouth or is a so - called &# 34 ; wide - mouth &# 34 ; aneurysm . the device has the noted longitudinal struts ( 502 ) and supplemental longitudinal struts ( 504 ). the circumferential struts include , by area , the supplemental longitudinal struts ( 504 ). each of these struts emanates from the closure region ( 508 ). fig6 a and 6b show the positioning of the inventive device ( 100 ) in an artery ( 122 ) over an aneurysm ( 124 ). the aneurysm has a mouth ( 120 ) as it enters the wall of artery ( 122 ). fig6 a is a cross - section side view of placement of the device ( 100 ) showing the desired positioning of the closure region ( 102 ) about the aneurysm opening ( 120 ). the fig6 a depiction also shows the positioning of the axial or longitudinal struts ( 104 ) along the axis of artery ( 122 ). the placement of circumferential struts ( 106 ) is also seen . it should be emphasized that fig6 a and 6b show that the circumferential struts ( 106 ) desirably extend more than 180 ° around the circumference of the artery . this permits the device to stay in place and snugly against the mouth ( 120 ) of the aneurysm ( 124 ). fig7 a show a simplified procedure for placing the device ( 100 ) in the opening ( 120 ) of aneurysm ( 124 ). desirably , device ( 100 ) is rolled tightly against a core wire ( 150 ) with a sheath ( 152 ) holding the rolled device ( 100 ) in place . the assembly is delivered to the mouth of aneurysm ( 124 ) using a catheter ( 154 ) of known design and size . it is desirable that the sheath ( 152 ) be marked using radio - opaque markers ( 156 ) of some type so that the device can be readily positioned about the mouth ( 120 ) of aneurysm ( 124 ). from the exterior of the body , core wire ( 150 ) is held in place while sheath ( 152 ) is pulled proximally to expose the inventive device and allow it to unroll . fig7 b shows the inventive device ( 100 ) in place and the delivery catheter ( 154 ) being withdrawn along with sheath ( 152 ) and core wire ( 150 ). fig8 shows , in partial cross - section , another way of delivering the inventive device to a selected site in the body . in this variation , the neck bridge ( 100 ) is likely constructed of a material which is deformable by the use of the balloon ( 170 ) into the final shape as outlined in the discussion relating to fig6 a and 6b above . the balloon ( 170 ) is not of a critical design except that it be of a size and toughness suitable for expanding the noted device much in the same way that a balloon is used to place a stent . the balloon ( 170 ) along with its associated components in the overall assembly may , for instance , be that found in u . s . pat . no . 5 , 135 , 494 , to engelson et al . the guidewire ( 172 ) may be used both as a guidewire per se and , in conjunction with a bead placed on the guidewire body , as a valving means for closing the single lumen catheter ( 174 ) and inflating the balloon ( 170 ). the closing valve seat ( 176 ) used in conjunction with the unshown bead on the guidewire body may be seen on the distal portion of the catheter body ( 174 ) just proximal of the catheter distal end . an optional sheath ( 178 ) is shown the sheath is to protect the neck bridge ( 100 ) during its transit through the delivery catheter ( 180 ). the device ( 100 ) is delivered to the chosen site , the balloon ( 170 ) is inflated and the device is left in at the chosen site . fig9 shows another variation in which the inventive device ( 100 ) is delivered using an electrolytic joint ( 184 ) to secure a self - expanding version of the neck bridge ( 100 ). in this variation , a simple wire having the neck bridge ( 100 ) wound onto its distal end is introduced into the vasculature . release of the neck bridge ( 100 ) is accomplished by imposition of a current into wire ( 188 ). the electrolytic joint ( 184 ) erodes and the neck bridge ( 100 ) self expands . use of electrolytic joints in deploying implants is described , for instance , in u . s . pat . no . 5 , 122 , 136 , to guglielmi et al , and others . the inventive device discussed above may be at least partially covered by , e . g ., radio opaque materials to help with the location of the device in the body using a fluoroscope , or with lubricious materials , e . g ., fluorocarbonaceous polymers ( ptfe , fep , etc .) or hydrophilics ( polyvinylpyrolidone , etc .) or silicones if the user sees such a need . many alterations and modifications may be made by those of ordinary skill in this art , without departing from the spirit and scope of this invention . the illustrated embodiments have been shown only for purposes of clarity and the examples should not be taken as limiting the invention as defined in the following claims , which are intended to include all equivalents , whether now or later devised .	0
hereinafter , embodiments of the present invention will be described with reference to the drawings . [ 0038 ] fig1 a is an exploded view of a square shaped battery 100 according to embodiment 1 of the present invention . fig1 b shows an assembled structure of the square shaped battery 100 according to embodiment 1 . as shown in fig1 a and 1b , the square shaped battery 100 includes an electrode plate group 17 and a pair of power collectors 12 attached to both sides of the electrode plate group 17 for collecting electric power therefrom . the electrode plate group 17 includes a belt - like positive electrode plate 9 , a belt - like negative electrode plate 10 , and a belt - like separator 11 . the separator 11 is interposed between the positive electrode plate 9 and the negative electrode plate 10 . the electrode plate group 17 in formed by rolling up the positive electrode plate 9 , the negative electrode plate 10 , and the separator 11 interposed therebetween . the positive electrode plate 9 is formed of foamed nickel so as to have an unfilled portion having a 2 mm width at an end thereof . the unfilled portion is filled with a positive electrode material mainly composed of nickel hydroxide . a nickel lead is attached to the portion filled with the positive electrode material . the capacity of the positive electrode plate 9 is about 7 ah . the negative electrode plate 10 is formed by punched metal which is coated with a negative electrode material mainly composed of hydrogen occlusion alloy so as to leave an uncoated portion having a 2 mm width at an end thereof . the capacity of the negative electrode plate 10 is about 10 ah . the separator 11 is formed by nonwoven polypropylene fabric . the pair of power collectors 12 are provided on the both sides of the electrode plate group 17 such that the width direction of the electrode plate group 17 is perpendicular to faces of the pair of power collectors 12 . the pair of power collectors 12 are connected to both sides of the electrode plate group 17 by a laser weld at 20 mm intervals . the electrode plate group 17 is connected to external positive and negative terminals ( not shown ) through the pair of power collectors 12 . the pair of power collectors 12 are connected to the external positive and negative terminals at upper end portions 121 by resistance - welding . nickel wax having a low melting temperature is applied to welding portions 122 of the pair of power collectors 12 . a case ( not shown ) for containing the square shaped battery 100 is made of resin . the case containing the square shaped battery 100 is filled with electrolyte , and the square shaped battery 100 is charged and discharged at 0 . 1 c for activation . the capacity of the square shaped battery 100 is about 7 ah . the pair of power collectors 12 , which are provided on both sides of the electrode plate group 17 for collecting electric power from the electrode plate group 17 , results in the electrode plate group 17 being able to output high power . [ 0048 ] fig2 is an exploded view of a square shaped battery 100 a according to embodiment 2 of the present invention . in fig2 like elements are indicated by like reference numerals used for the square shaped battery 100 of fig1 a and 1b , and detailed descriptions thereof are omitted . a pair of power collectors 12 include a power collector 12 e and a power collector 12 f . the power collector 12 e is connected to an external positive terminal at an upper end 121 thereof by resistance - welding . the power collector 12 f is connected to an external negative terminal at a lower end 125 thereof by resistance - welding . in the square shaped battery 100 a according to embodiment 2 , the pair of power collectors 12 collect electric power in opposite directions ( directions represented by arrows a and b ), i . e ., an electric current taken out from the electrode plate group 17 by the power collector 12 e flows in the power collector 12 e in a direction indicated by arrow a , and an electric current taken out from the electrode plate group 17 by the power collector 12 f flows in the power collector 12 f in a direction indicated by arrow b . since the pair of power collectors 12 collect electric power in opposite directions , electric currents flow smoothly from the electrode plate group 17 . [ 0053 ] fig3 is an exploded view of a square shaped battery 100 b according to embodiment 3 of the present invention . in fig3 like elements are indicated by like reference numerals used for the square shaped battery 100 of fig1 a and 1b , and detailed descriptions thereof are omitted . in the square shaped battery 100 b according to embodiment 3 , the pair of power collectors 12 are connected to both sides of the electrode plate group 17 by a laser weld at intervals of d 1 (= 10 mm ). by increasing the number of power collection points ( welding portions 122 ), power collection efficiency further increases . [ 0056 ] fig4 is an exploded view of a square shaped battery 100 c according to embodiment 4 of the present invention . in fig4 like elements are indicated by like reference numerals used for the square shaped battery 100 of fig1 a and 1b , and detailed descriptions thereof are omitted . in the square shaped battery 100 c according to embodiment 4 , for each of the pair of power collectors 12 , a welding interval d 2 in an upper portion is narrower than a welding interval d 3 in a lower portion . the upper portion of the power collector 12 is connected to a side of the electrode plate group 17 by a laser weld at intervals of d 2 = 10 mm . the lower portion of the power collector 12 is connected to a side of the electrode plate group 17 by a laser weld at intervals of d 3 = 20 mm . a welding point ( welding portion 122 ) in the lower portion of the electrode plate group 17 does not greatly contribute to power collection . accordingly , it is preferable that welding points are concentrated in the upper portion of the power collector 12 . [ 0061 ] fig5 is an exploded view of a square shaped battery 100 d according to embodiment 5 of the present invention . in fig5 like elements are indicated by like reference numerals used for the square shaped battery 100 c of fig4 and detailed descriptions thereof are omitted . in the square shaped battery 100 d according to embodiment 5 , a pair of power collectors 12 a each have bent portions 123 . the bent portions 123 suppress expansion of the sides of the electrode plate group 17 . as shown in fig5 each of the pair of power collectors 12 a has a “ u ”- shape so as to bind the electrode plate group 17 . since each of the pair of power collectors 12 a has bent portions 123 , i . e ., each of the pair of power collectors 12 a has a “ u ”- shape which binds the electrode plate group 17 , expansion of the sides of the electrode plate group 17 can be suppressed . with such a structure , reliability of power collection is improved . [ 0065 ] fig6 is an exploded view of a square shaped battery 100 e according to embodiment 6 of the present invention . in fig6 like elements are indicated by like reference numerals used for the square shaped battery 100 d of fig5 and detailed descriptions thereof are omitted . in the square shaped battery 100 e according to embodiment 6 , a pair of power collectors 12 b each have protrusions 124 at welding points thereof so as to secure a larger area for welding than that of embodiments 1 through 5 . with the protrusions 124 at the welding points , nickel wax is effectively applied to the welding points . thus , welding efficiency improves since a larger welding area is secured . [ 0069 ] fig7 is an exploded view of a square shaped battery 100 f according to embodiment 7 of the present invention . in fig7 like elements are indicated by like reference numerals used for the square shaped battery 100 e of fig6 and detailed descriptions thereof are omitted . in the square shaped battery 100 f according to embodiment 7 , a pair of power collectors 12 c each have protrusions 124 at welding points thereof so as to secure a larger area for welding . each protrusion 124 has a hollow portion 124 a . with the hollow portions 124 a of the protrusions 124 located at the welding points , a larger area again to that of embodiment 6 can be secured for welding , and accordingly , welding efficiency further improves . furthermore , nickel wax is more effectively applied to the welding points . [ 0073 ] fig8 is an exploded view of a square shaped battery 100 g according to embodiment 8 of the present invention . in fig8 like elements are indicated by like reference numerals used for the square shaped battery 100 of fig1 a and 1b , and detailed descriptions thereof are omitted . in the square shaped battery 100 g according to embodiment 8 , a pair of power collectors 12 d each have a central portion 126 in which a rib ( protrusion ) is not provided . while the pair of power collectors 12 d are welded to the electrode plate group 17 , the central portions 126 are pressed against the electrode plate group 17 . with such a structure , even when the electrode plate group 17 is not tightly rolled up , unevenness of welding can be suppressed . as a result , welding efficiency improves . table 1 shows measurement results of an output characteristic for the square shaped batteries 100 , 100 a to 100 g ( embodiments 1 - 8 ), the conventional square shaped battery 900 described with reference to fig9 ( conventional 1 ), and the conventional square shaped battery 1000 described with reference to fig1 ( conventional 2 ). for each battery , after soc had been adjusted to 60 %, the battery was subjected to a large current discharge . based on the result of the large current discharge , a current value with which 10 seconds or more can be secured before a voltage value reaches 1 v was selected , and the selected current value was multiplied by 1 v . the result of the multiplication was obtained as an output characteristic . the unit of the output characteristic is “ w ”. each value of the output characteristic is an average of 10 samples . as shown in table 1 , the square shaped battery 100 according to embodiment 1 of the present invention can produce electrical power about 20 % higher than the conventional square shaped battery 1000 ( conventional 2 ). this is because the pair of power collectors 12 efficiently collect electric power from the electrode plate group 17 which can produce high electric power . the square shaped battery 100 a according to embodiment 2 of the present invention can produce still higher electrical power . this is because the pair of power collectors collect electric power in opposite directions , and accordingly , electric currents flow smoothly . in the square shaped battery 100 a , the pair of power collectors 12 can more efficiently collect electric power from the electrode plate group 17 which can produce high electric power . the square shaped battery 100 b according to embodiment 3 of the present invention can produce electrical power about 10 % higher than the square shaped battery 100 according to embodiment 1 . this means that power collection efficiency is further increased by increasing the number of power collection points . the square shaped battery 100 c according to embodiment 4 of the present invention can produce electrical power comparable to that produced by the square shaped battery 100 b according to embodiment 3 . this means that a welding point in the lower portion of the electrode plate group 17 does not greatly contribute to power collection . accordingly , it is preferable that welding points are concentrated in the upper portions of the power collectors 12 . the output characteristic of the square shaped battery 100 d according to embodiment 5 of the present invention is higher than that of the square shaped battery 100 c according to embodiment 4 by about 4 %. this is because the power collector 12 a has bent portions 123 so as to have a “ u ”- shape which binds the electrode plate group 17 . with such a structure , expansion of the sides of the electrode plate group 17 can be suppressed , whereby reliability of power collection is improved . the output characteristic of the square shaped battery 100 e according to embodiment 6 of the present invention is higher than that of the square shaped battery 100 d according to embodiment 5 by about 4 %. this is because each power collector 12 b has protrusions 124 at welding points thereof , and accordingly , nickel wax is effectively applied to the welding points . with such a structure , welding efficiency improves while a larger welding area is secured . the output characteristic of the square shaped battery 100 f according to embodiment 7 of the present invention is higher than that of the square shaped battery 100 e according to embodiment 6 by about 4 %. this is because each protrusion 124 at a welding point of the power collectors 12 has a hollow portion 124 a so that a larger area can be secured for welding , such that welding efficiency is further improved . furthermore , with the hollow portions 124 a , nickel wax can be more effectively applied to the welding points . the output characteristic of the square shaped battery 100 g according to embodiment 8 of the present invention is higher than that of the square shaped battery 100 f according to embodiment 7 by about 4 %. this is because unevenness of welding can be suppressed even when the electrode plate group 17 is not tightly rolled up , and accordingly , welding efficiency improves . as described hereinabove , the present invention can provide a high - power square shaped battery . further , the present invention can provide a square shaped battery from which electric power can be sufficiently collected . furthermore , the present invention can provide a square shaped battery in which an electrochemical reaction resistance can be reduced . with a structure of a square shaped battery according to the present invention , the facing area of electrode plates can be increased while reducing the number of electrode plates . the higher amount of power produced by the larger facing area can also be efficiently utilized . as a result , a high power battery can be provided . various other modifications will be apparent to and can be readily made by those skilled in the art without departing from the scope and spirit of this invention . accordingly , it is not intended that the scope of the claims appended hereto be limited to the description as set forth herein , but rather that the claims be broadly construed .	7
the decrease in semiconductor device sizes has resulted in vlsi integrated circuit chips with a large number of circuits per chip . the increase in circuits per chip has resulted in increased demand for interconnections to the chip . in order to meet the demand for the higher number of interconnections the use of bga interconnection technology is being used extensively . bga or solder ball technology has shown it can provide the high interconnection density required by allowing for close spacing of the interconnects as well as utilizing the total area of the semiconductor chip . the new micron sized devices have been shown to be susceptible to alpha particle emissions that cause significant errors . lead and lead alloys emit small amounts of alpha particles . in order to minimize the deleterious effects of the alpha particles copper pillars have been used . see u . s . patent application publication u . s . 2002 / 0033412a1 herein incorporated by reference . the pillars displace the lead based solder and move it to a distance from the semiconductor devices as to minimize the alpha particle effects . the present invention discloses a package design and method of manufacture for semiconductor chips that utilize pillar interconnections . the present invention is shown in fig2 b . the semiconductor chip 20 that includes solder tipped copper pillars 22 is molded in an opaque encapsulant 26 that surrounds the chip and the pillar . lead - tin solder balls or solder paste 24 of different compositions are attached to the solder tip pillars and extend beyond the encapsulant for connection to the next level of package . the molded encapsulant 26 is fashioned to have a grid of castellations 28 that isolate each solder ball as shown in fig2 a . a second embodiment of the present invention utilizes a lead frame tape without any serrations , which results in a semiconductor chip package as shown in fig3 b and 3a . in a third embodiment of the present invention the lead frame tape is serrated in a manner , which delineates each individual semiconductor chip package with a castellation 28 as shown in fig4 b and 4a . the cga module designs shown in fig2 a - 4 b satisfy the demands of a first level package . semiconductor chip 20 is molded in an encapsulant for environmental protection , the solder balls or solder paste of the cga are properly positioned for the next level of assembly and reliably connected to the semiconductor chip pillars . the method of manufacture of the cga semiconductor module of the present invention and disclosed herein consists of the following steps : in a first embodiment of the invention , a lead frame tape 32 shown in fig5 is etched to provide castellations to be formed during the molding process . the lead frame tape is etched to allow for better mold compound flow . semiconductor chips 20 are attached to the lead frame tape 32 by soldering , as shown in fig6 . as shown in fig6 the lead frame tape openings 29 are offset from the chip pillars 22 . the lead frame tape 32 with a multiplicity of semiconductor chips 20 is molded in an encapsulant 26 , shown in fig7 . heat is applied to the lead frame tape in order to melt the solder connecting the chips to the lead frame tape . the lead frame tape is then removed as shown in fig8 . solder is then introduced to the assembly and solder balls 24 are formed and connected to the semiconductor chip pillars 22 , fig9 . a dicing process is used to produce the individual modules containing one semiconductor chip and its cga interconnects . in the second embodiment of the invention , the same method of manufacture is used except that the lead frame tape 32 is not etched , with the resultant structure being shown in fig3 a and 3b . in the third embodiment of the invention , the same method of manufacture is used with the exception that the lead frame tape 32 is etched and serrated in such a manner as to delineate each individual semiconductor chip as shown in fig4 a and 4b . the present invention , the design and method of manufacture of a cga semiconductor chip package has been shown to satisfy the demands placed on a semiconductor chip first level package . it protects the semiconductor and interconnects from environmental exposure and allows for use of a bga interconnect to the next level of package . although the invention has been described and illustrated with reference to specific illustrative embodiments thereof , it is not intended that the invention be limited to those illustrative embodiments . those skilled in the art will recognize that variations and modifications can be made without departing from the spirit of the invention . it is therefore intended to include within the invention all such variations and modifications which fall within the scope of the appended claims and equivalents thereof .	7
advantages of the present invention will become more apparent from the detailed description given herein after . however , it should be understood that the detailed description and specific examples , while indicating preferred embodiments of the invention , are given by way of illustration only , since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description . copper can take on the cuprous cu + and cupric cu 2 + oxidation states . the cupric hydroxide , also called copper ( ii ) hydroxide compounds of the invention are represented by formula i : copper ( ii ) hydroxide is prone to decomposition to the oxide , as is represented by formula ii : the inventors found that this decomposition is catalyzed by metal species such as iron . the inventors believe that the true catalytic species is fe 2 + occluded ( interstitially ) in the crystal lattice of cu ( oh ) 2 , which changes its molecular structure on being oxidized to fe 3 + and destroys the cu ( oh ) 2 crystal to form more stable product , cuo . furthermore , the cuo produced catalyzes the dehydration reaction forming more cuo . therefore , inhibition of this reaction is necessary to obtain a stable product . copper ( ii ) hydroxide is described in the kirk othmer encyclopedia of chemical technology as being produced by a reaction of a copper salt solution and sodium hydroxide to form a blue , gelatinous , voluminous precipitate of limited stability . efforts are concentrated at stabilizing the product , especially in industrial production . usually ammonia or phosphates are incorporated into the hydroxide to produce a color - stable product . the ammonia processed copper hydroxide is almost stoichiometric and copper content as high as 64 % is not uncommon . the phosphate - produced material is lower in copper and has a finer particle size and higher surface area than ammonia processed hydroxide . other methods of production generally rely on the formation of an insoluble copper precursor prior to the formation of the hydroxide . ( kirk othmer encyclopedia of chemical technology , fourth ed ., vol . 7 , p . 508 ( john wiley & amp ; sons 1993 )). however , the products produced by these methods are not stable enough to dry by use of spray drying . copper hydroxide is almost insoluble in water ( 3 μg / l ) but readily dissolves in mineral acids and ammonia forming salt solutions or copper amine complexes . the hydroxide is somewhat amphoteric dissolving in excess sodium hydroxide solution for form trihydroxycuprate cu ( oh ) 3 − and tetrahydrocuprate cu ( oh ) 4 − . copper ( ii ) hydroxide has been conventionally prepared by the addition of sodium hydroxide , naoh , to a salt of copper and decomposing at a temperature above 100 ° c . in the presence of excess alkali , the decomposition occurs at temperatures above 50 ° c . when ferrous impurities are present in copper - containing raw materials , the inventors have found it feasible to precipitate out the ferrous ion an aqueous solution by oxidizing it to ferric ion , especially to ferric phosphate . the ferrous ion is oxidized using common oxidants such as h 2 o 2 , hypochlorite ( bleach ), cl 2 , o 2 , o 3 , etc . the possible range of oxidizing agents includes singlet oxygen , triplet oxygen , singlet or triplet oxygen containing gas , ozone , ozone containing gas , chlorine , chlorine containing gas , chlorine dioxide , chlorine dioxide containing gas , hypochlorite ion , and chlorite ion . blowing air through the solution will also oxidize ferrous ion to ferric ion , but the oxygen in air oxidizes the ion rather slowly . mixtures of oxidizing agents can also be used . moreover , the oxidation of ferrous ion proceeds slowly . therefore , heating of the reaction mixture is preferable to elevate the conversion efficiency . the heating temperature can range from about 20 ° c . to 130 ° c . a preferred heat temperature range is about 80 - 100 ° c . a preferable temperature is about 100 ° c . utilization of the appropriate counterion will make the oxidation more efficient and promote precipitation of the ferric salt . the utilization of phosphate ion both increases the efficiency of oxidation and simultaneously precipitates ferric ion . alternatively , fluoride ion has been found to be effective . it is known that aqueous cupric ion precipitates forming a basic salt such as tribasic cupric sulfate cuso 4 3cu ( oh ) 2 , cupric oxychloride cucl 2 3cu ( oh ) 2 , cupric basic carbonate cuco 3 3cu ( oh ) 2 , etc . by increasing the solution ph . the inventors found that the formation of the basic salts begins at a ph of about 3 . 5 and is complete at a ph of about 7 . the preferable ph for obtaining the basic copper salt is a ph of about 6 . however , the precipitation of ferric ion as ferric oxide or phosphate is the more efficient at the higher ph . as a result , the ph best suited for the precipitation of ferric ion is concluded to be a ph of about 1 - 4 and preferably about 3 . 5 . most common bases can be used to raise the ph to the 1 - 4 range . preferred bases include aqueous nh 3 , na 2 co 3 , k 2 co 3 and khco 3 . the hardly soluble ferric compounds such as ferric oxide and ferric phosphate in copper hydroxide do not greatly decrease the stability of copper hydroxide against the decomposition to form cuo and h 2 o . however , it is preferable to remove the precipitate formed from the oxidized cupric solution in order to obtain a purer product . next , a base is added to the filtrate to bring the ph to about 6 . the basic copper salts , such as cuso 4 3cu ( oh ) 2 , cucl 2 3cu ( oh ) 2 , cuco 3 3cu ( oh ) 2 , etc ., precipitate out . these salts can then be harvested . when the ph of the reaction mixture or a suspension of basic salt is elevated to a ph of about 8 or more , the basic salts suspended in the solution are converted to cupric hydroxide . the complete conversion to copper hydroxide product is attained by adding additional base until the ph rises to about 12 . the bases used to precipitate the cupric hydroxide can be an alkali metal hydroxide and / or an alkaline earth metal hydroxide . examples of the bases include koh , naoh , lioh , ca ( oh ) 2 , mg ( oh ) 2 , etc . the bases used to precipitate the cupric hydroxide can also be a carbonate such as k 2 co 3 or na 2 co 3 . also , the basic copper salts ( cuso 4 3cu ( oh ) 2 , cucl 2 3cu ( oh ) 2 , cuco 3 3cu ( oh ) 2 , etc .) can be converted to copper hydroxide by rinsing the salts and adding a base . a strong base such as naoh or koh is apt to give an unstable product against the dehydrating decomposition reaction , presumably caused by the drastic ph change at the interface of added base solution and the copper containing solution forcing unselective precipitation to the existing species . as a result , a weak base such as sodium carbonate or bicarbonate and nh 3 is preferable . the removal of ferrous ion is highly satisfactory when copper sulfate is used as the raw material . however , copper chloride solutions are more difficult to purify and copper sulfate solutions . the reason for the difficulty associated with copper chloride may be in view of the notably higher coordination potential of chloride ion compared to sulfate ion , which leads to soluble coordination products , especially in chloride concentrations greater than about 2 m . copper hydroxide can be prepared by using the mother liquor left after crystallization of copper sulfate using the ferrous removal method of the invention . the ferric hydroxide product was sufficiently stable so that the product can be dried by spray drying . removal of solids formed during the process , which can be either ferric ion or cupric hydroxide product , can be performed using a number of methods . solids can be removed using filtration , centrifugation or decantation . on an industrial scale , filter presses or drum centrifuges can be used . five ml of 85 % h 3 po 4 and 0 . 8 ml of 50 % h 2 o 2 were added dropwise to 100 ml of a copper sulfate solution that had been prepared from 25 g of industrial grade cuso 4 5h 2 o . a 3 m solution of na 2 co 3 solution was used to adjust the ph to 3 . 5 . the solution was then heated to 100 ° c . and kept at 100 ° c . with stirring overnight . the solution was cooled to 40 ° c . and the solution was adjusted to a ph of 3 . 5 using 3 m na 2 co 3 . a precipitate formed and was filtered off . 3 m na 2 co 3 was added to the filtrate under vigorous stirring to rapidly reach a ph of 6 . then the 3 m na 2 co 3 was added dropwise until a ph of 12 was attained . the mixture was stirred for 24 hours . a deep blue precipitate was formed . the precipitate was filtered , washed and dried at 110 ° c . to obtain copper hydroxide product . five ml of 85 % h 3 po 4 and 2 ml of bleach containing 6 % active chlorine were added dropwise to 100 ml of a solution containing 14 . 4 g of acs reagent grade cucl 2 2h 2 o . a 3 m solution of na 2 co 3 solution was used to adjust the ph to 3 . 5 . the solution was then heated to 100 ° c . and kept at 100 ° c . with stirring overnight . after allowing to cool to 25 ° c ., a small quantity of precipitate formed and was filtered off . aqueous 5 m nh 3 was added to the filtrate under vigorous stirring to adjust the ph to 6 . the supernatant solution was decanted off and the precipitate formed was rinsed repeatedly by decantation . the precipitate was re - suspended , and a 3 m na 2 co 3 solution was added dropwise until the ph was adjusted to 12 . a deep blue precipitate formed , and the precipitate was filtered and rinsed . the copper hydroxide product was dried at 80 ° c . a 3000 l charge of water containing 30 l of 85 % h 3 po 4 and 25 l of 50 % h 2 o 2 were added under vigorous stirring to 3000 l of mother liquor left after the crystallization of copper sulfate . the mother liquor contained 79 g of cu ion per liter . aqueous 15 m nh 3 was added to the solution until a ph of 3 . 5 was attained . the resultant mixture was heated to 85 ° c . and kept overnight at that temperature while maintaining a ph of 3 . 5 by injecting 8 m nh 3 when needed . the solution was allowed to cool to 50 ° c . a precipitate formed and it was removed using a filter press . 15 m nh 3 was added to the filtrate under vigorous stirring until a ph of 6 was attained . the precipitate was rinsed by decantation 3 times . after the final decantation , the precipitate was re - suspended and 3 m na 2 co 3 was added until the ph reached 12 . the mixture was kept stirring overnight . deep blue copper hydroxide was obtained by drum filtration and spray dried . it is to be understood that the foregoing descriptions and specific embodiments shown herein are merely illustrative of the best mode of the invention and the principles thereof , and that modifications and additions may be easily made by those skilled in the art without departing for the spirit and scope of the invention , which is therefore understood to be limited only by the scope of the appended claims .	2
as a first component at least one of the compounds of the following formulas ( 1 - 1 ) and ( 1 - 2 ); as a second component at least one of the compounds of the following formula ( 2 ); and as a third component at least one of the compounds of the following formulas ( 3 - 1 ) to ( 3 - 4 ) ## str2 ## in which r 1 , r 2 and r 3 each independently represent an alkyl group of 1 - 10 carbons wherein any one of the -- ch 2 -- groups may be replaced by -- o -- or -- ch ═ ch --; r 4 , r 5 and r 6 each independently represent an alkyl group of 1 - 10 carbons wherein any one of the -- ch 2 -- groups may be replaced by -- o -- or -- ch ═ ch --, or wherein one or more hydrogen atoms may be replaced by fluorine atoms ; r 7 represents cl , f or an alkyl group of 1 - 10 carbons wherein any one of the -- ch 2 -- groups may be replaced by -- o --; r 8 , r 9 and r 11 each independently represent an alkyl group of 1 - 10 carbons ; r 10 represents an alkyl group of 1 - 10 carbons wherein any one of the -- ch 2 -- groups may be replaced by -- o --; a , represents trans - 1 , 4 - cyclohexylene or trans - 1 , 3 - dioxane - 2 , 5 - diyl ; a 2 , a 3 , a 4 , a 5 and a 7 each independently represent trans - 1 , 4 - cyclohexylene or 1 , 4 - phenylene ; a 6 represents 1 , 4 - phenylene which may be substituted by f ; z 1 represents -- coo --, -- ch 2 ch 2 -- or a single bond ; z 2 represents -- c . tbd . c -- or a single bond ; m and n each independently represent 0 or 1 ; and x 1 , x 2 and x 3 each independently represent h or f . in one embodiment of the liquid crystal composition , the first component comprises 5 - 50 % by weight , the second component comprises 5 - 40 % by weight and the third component comprises 10 - 70 % by weight , based on the total weight of the liquid crystal composition . the liquid crystal composition of the invention may further comprise as a fourth component at least one of the compounds of the following formula ( 4 ) ## str3 ## wherein r 12 represents an alkyl group of 1 - 10 carbons and x 4 represents h or f . in one embodiment of said liquid crystal composition , the first component comprises 5 - 50 % by weight , the second component comprises 5 - 40 % by weight , the third component comprises 10 - 70 % by weight and the fourth component comprises not more than 35 % by weight , preferably 5 % to 30 % by weight , of at least one of the compounds of formula ( 4 ), based on the total weight of the liquid crystal composition . the liquid crystal composition of the invention may further comprise as a fourth component at least one of the compounds of the following formula ( 5 ) ## str4 ## wherein r 13 represents an alkyl group of 1 - 10 carbons ; a 8 represents trans - 1 , 4 - cyclohexylene or 1 , 4 - phenylene ; p represents 0 or 1 ; and x . represents h or f . in one embodiment of said liquid crystal composition , the first component comprises 5 - 50 % by weight , the second component comprises 5 - 40 % by weight , the third component comprises 10 - 70 % by weight and the fourth component comprises not more than 25 % by weight , preferably 5 % to 20 % by weight , of at least one of the compounds of formula ( 5 ), based on the total weight of the liquid crystal composition . the liquid crystal composition of the invention may further comprises as a fourth component at least one of the compounds of formula ( 4 ) and as a fifth component at least one of the compounds of formula ( 5 ). in one embodiment of said liquid crystal composition , the first component comprises 5 - 50 % by weight , the second component comprises 5 - 40 % by weight , the third component comprises 10 - 70 % by weight , the fourth component comprises not more than 35 % by weight , preferably 5 % to 30 % by weight , of at least one of the compounds of formula ( 4 ) and the fifth component comprises not more than 25 % by weight , preferably 5 % to 20 % by weight , of at least one of the compounds of formula ( 5 ), based on the total weight of the liquid crystal composition . further , the present invention provides a liquid crystal display device using each of the above - described liquid crystal compositions according to the present invention . preferred examples of the compounds of formula ( 1 - 1 ) used in the liquid crystal composition of the invention can include those of the following formula ( 1 - 1 - 1 ) ## str5 ## wherein r represents an alkyl group of 1 - 10 carbons , an alkoxymethyl group of 2 - 9 carbons or an alkenyl group of 2 - 10 carbons . preferred examples of the compounds of formula ( 1 - 2 ) used in the liquid crystal composition of the invention can include those of the following formulas ( 1 - 2 - 1 ) and ( 1 - 2 - 2 ) ## str6 ## wherein each r independently represents an alkyl group of 1 - 10 carbons , an alkoxymethyl group of 2 - 9 carbons or an alkenyl group of 2 - 10 carbons . preferred examples of the compounds of formula ( 2 ) used in the liquid crystal composition of the invention can include those of the following formulas ( 2 - 1 ) to ( 2 - 8 ) ## str7 ## wherein each r independently represents an alkyl group of 1 - 10 carbons , each ri independently represents an alkyl group of 1 - 10 carbons or an alkenyl group of 2 - 10 carbons and r &# 34 ; represents an alkyl group of 1 - 10 carbons or an alkoxymethyl group of 2 - 9 carbons . preferred examples of the compounds of formula ( 3 - 1 ) used in the liquid crystal composition of the invention can include those of the following formulas ( 3 - 1 - 1 ) to ( 3 - 1 - 4 ) ## str8 ## wherein each r independently represents an alkyl group of 1 - 10 carbons , each r &# 39 ; independently represents an alkyl group of 1 - 10 carbons or an alkoxy group of 1 - 10 carbons , each r &# 34 ; independently represents an alkyl group of 1 - 10 carbons or an alkenyl group of 2 - 10 carbons and t represents an integer of 0 to 8 . preferred examples of the compounds of formula ( 3 - 2 ) used in the liquid crystal composition of the invention can include those of the following formulas ( 3 - 2 - 1 ) to ( 3 - 2 - 7 ) ## str9 ## wherein each r independently represents an alkyl group of 1 - 10 carbons , r &# 39 ; represents an alkyl group of 1 - 10 carbons or an alkoxy group of 1 - 10 carbons , r &# 34 ; represents an alkenyl group of 2 - 10 carbons and t represents an integer of 0 to 8 . preferred examples of the compounds of formula ( 3 - 3 ) used in the liquid crystal composition of the invention can include those of the following formulas ( 3 - 3 - 1 ) to ( 3 - 3 - 2 ) ## str10 ## wherein r and r &# 39 ; each independently represent an alkyl group of 1 - 10 carbons . preferred examples of the compounds of formula ( 3 - 4 ) used in the liquid crystal composition of the invention can include those of the following formulas ( 3 - 4 - 1 ) to ( 3 - 4 - 2 ) ## str11 ## wherein r and r &# 34 ; each independently represent an alkyl group of 1 - 10 carbons and r &# 39 ; represents an alkyl group of 1 - 10 carbons or an alkoxymethyl group of 2 - 9 carbons . preferred examples of the compounds of formula ( 4 ) used in the liquid crystal composition of the invention can include those of the following formulas ( 4 - 1 ) and ( 4 - 2 ) ## str12 ## wherein each r independently represents an alkyl group of 1 - 10 carbons . preferred examples of the compounds of formula ( 5 ) used in the liquid crystal composition of the invention can include those of the following formulas ( 5 - 1 ) to ( 5 - 4 ) ## str13 ## wherein each r independently represents an alkyl group of 1 - 10 carbons . a role of each compound constituting the liquid crystal composition of the invention will be explained below . the compounds of formulas ( 1 - 1 ) and ( 1 - 2 ) are characterized in that a dielectric anisotropy is high , a rate of change of a dielectric anisotropy to a temperature change is substantially identical with a rate of change of an elastic constant to a temperature change and a stability to heat and ultraviolet ray is high . thus the compounds of formulas ( 1 - 1 ) and ( 1 - 2 ) are used for the purpose of reducing the threshold voltage and further reducing the temperature dependence of threshold voltage , while keeping the stability of the liquid crystal composition to heat and ultraviolet ray high . the compounds of formula ( 2 ) have a dielectric anisotropy substantially equal to or less than that of the compounds of formulas ( 1 - 1 ) and ( 1 - 2 ). thus the compounds of formula ( 2 ) are used for the purpose of further reducing the threshold voltage of the liquid crystal composition . the compounds of formula ( 3 - 1 ) are characterized in that a dielectric anisotropy is approximately zero and a viscosity is low . thus the compounds of formula ( 3 - 1 ) are used for the purpose of reducing the viscosity of the liquid crystal composition and simultaneously adjusting the threshold voltage of the liquid crystal composition . the compounds of formula ( 3 - 2 ) are characterized in that a dielectric anisotropy is approximately zero , a clearing point is high and a viscosity is low . thus the compounds of formula ( 3 - 2 ) are used for the purpose of increasing the clearing point of the liquid crystal composition , simultaneously reducing the viscosity and adjusting the threshold voltage . the compounds of formula ( 3 - 3 ) are characterized in that a dielectric anisotropy is approximately zero , a clearing point is high , a viscosity is low and an optical anisotropy is high . thus the compounds of formula ( 3 - 3 ) are used for the purpose of increasing the clearing point of the liquid crystal composition , simultaneously reducing the viscosity and further adjusting the optical anisotropy and threshold voltage of the liquid crystal composition . the compounds of formula ( 3 - 4 ) are characterized in that a dielectric anisotropy is approximately zero , a viscosity is low and a clearing point is especially high . thus the compounds of formula ( 3 - 4 ) are used for the purpose of increasing the clearing point of the liquid crystal composition , simultaneously reducing the viscosity and adjusting the threshold voltage . the compounds of formula ( 4 ) are characterized by having a slightly lower positive dielectric anisotropy than those of formulas ( 1 - 1 ) and ( 1 - 2 ) as well as high clearing point . thus the compounds of formula ( 4 ) are used for the purpose of adjusting the clearing point and threshold voltage of the liquid crystal composition . the compounds of formula ( 5 ) have a slightly lower positive dielectric anisotropy than those of formulas ( 1 - 1 ) and ( 1 - 2 ). thus the compounds of formula ( 5 ) are used for the purpose of adjusting the threshold voltage of the liquid crystal composition . a preferable component ratio of the compound constituting the liquid crystal composition of the invention and the reason therefor will be explained below . incorporating a large quantity of the compounds of formulas ( 1 - 1 ) and ( 1 - 2 ) into the liquid crystal composition may result in raising the lower - limit temperature of a nematic phase in the liquid crystal composition . for this reason , it is desirable that the compounds of formulas ( 1 - 1 ) and ( 1 - 2 ) make up not more than 50 % by weight of the liquid crystal composition . further , it is desirable that the compounds of formulas ( 1 - 1 ) and ( 1 - 2 ) make up not less than 5 % by weight of the liquid crystal composition for the reasons of reducing the threshold voltage and further reducing the temperature dependence of threshold voltage while keeping high stability of the liquid crystal composition to heat or ultraviolet . incorporating a large quantity of the compounds of formula ( 2 ) into the liquid crystal composition may result in raising the lower - limit temperature of a nematic phase in the liquid crystal composition . for this reason , it is desirable that the compounds of formula ( 2 ) make up not more than 40 % by weight of the liquid crystal composition . further , it is desirable that the compounds of formulas ( 2 ) make up not less than 5 % by weight of the liquid crystal composition in order to reduce more the threshold voltage of the liquid crystal composition . incorporating a large quantity of the compounds of formulas ( 3 - 1 ) to ( 3 - 4 ) into the liquid crystal composition may result in raising the threshold voltage of the liquid crystal composition . for this reason , it is desirable that the compounds of formulas ( 3 - 1 ) to ( 3 - 4 ) make up not more than 70 % by weight of the liquid crystal composition . further , it is desirable that the compounds of formulas ( 3 - 1 ) to ( 3 - 4 ) make up not less than 10 % by weight of the liquid crystal composition in order to reduce the viscosity of the liquid crystal composition as low as possible . incorporating a large quantity of the compounds of formula ( 4 ) into the liquid crystal composition may result in raising the lower - limit temperature of a nematic phase in the liquid crystal composition . for this reason , it is desirable that the compounds of formula ( 4 ) make up not more than 35 % by weight of the liquid crystal composition . incorporating a large quantity of the compounds of formula ( 5 ) into the liquid crystal composition may result in raising the lower - limit temperature of a nematic phase in the liquid crystal composition . for this reason , it is desirable that the compounds of formula ( 5 ) make up not more than 25 % by weight of the liquid crystal composition . each of the compounds constituting the composition of the present invention can be synthesized by the prior art processes . of the compounds of formulas ( 1 - 1 ) and ( 1 - 2 ), the method of synthesizing those of formulas ( 1 - 1 - 1 ) and ( 1 - 2 - 1 ) is disclosed in japanese patent kokai 10 - 251186 ( japanese patent application 9 - 72708 ). of the compounds of formula ( 2 ), the method of synthesizing those of formulas ( 2 - 2 ) and ( 2 - 7 ), respectively is disclosed in japanese patent kokai 59 - 176240 and 4 - 300861 . of the compounds of formulas ( 3 - 1 ) and ( 3 - 2 ), the method of synthesizing those of formulas ( 3 - 1 - 2 ) and ( 3 - 2 - 2 ) is disclosed in japanese patent kokai 1 - 308239 . of the compounds of formula ( 3 - 3 ), the method of synthesizing those of formula ( 3 - 3 - 1 ) is disclosed in japanese patent kokai 63 - 152334 . of the compounds of formula ( 3 - 4 ), the method of synthesizing those of formula ( 3 - 4 - 2 ) is disclosed in japanese patent kokai 2 - 237949 . of the compounds of formula ( 4 ), the method of synthesizing those of formula ( 4 - 1 ) is disclosed in japanese patent kokai 58 - 0552 . of the compounds of formula ( 5 ), the method of synthesizing those of formula ( 5 - 2 ) is disclosed in japanese patent kokai 2 - 233626 . other liquid crystalline compounds than each compound represented by the above - mentioned formula can be used in admixture therewith in the liquid crystal composition within the range of not injuring the object of the present invention . to the liquid crystal composition of the invention may be added chiral dopants for the purpose of inducing the helical structure of liquid crystal molecules to adjust necessary twist angle . the liquid crystal composition of the invention can be also used as a liquid crystal composition for guest - host ( gh ) mode by incorporating therein dichroic dyes such as those of merocyanines , styryl derivatives , azo compounds , azomethines , azoxy compounds , quinophthalones , anthraquinones and tetrazine derivatives , etc . further , the liquid crystal composition of the invention can be used as a liquid crystal composition for a polymer - dispersion type display device and for electrically controlled birefringence ( ecb ) mode and dynamic scattering ( ds ) mode . the liquid crystal composition of the invention is prepared by a process conventional per se . in general , a process can be employed wherein various compounds are mixed and dissolved each other at an elevated temperature . this invention is further illustrated by the following examples and comparative examples in which all parts and percentages (%) are by weight unless otherwise indicated . further , the compounds used in the examples and comparative examples are expressed by the symbols as shown below . ______________________________________ symbol______________________________________1 ) left terminal group r - c . sub . n h . sub . 2n + 1 - n - c . sub . n h . sub . 2n + 1 ch ═ chc . sub . m h . sub . 2m - nvm - c . sub . n h . sub . 2n + 1 oc . sub . m h . sub . 2m - nom - ch . sub . 2 ═ chc . sub . n h . sub . 2n - vn - ch . sub . 2 ═ ch -- v - c . sub . n h . sub . 2n + 1 ch ═ ch -- nv - cf . sub . 2 ═ ch -- vff - cf . sub . 2 ═ chc . sub . n h . sub . 2n - vffn - 2 ) ring structure -( a . sub . 1 )-, -( a . sub . n )- ## str14 ## h ## str15 ## b ## str16 ## py ## str17 ## d ## str18 ## b ( f ) ## str19 ## b ( f , f ) 3 ) linking group - z . sub . 1 -, - z . sub . n --- ch . sub . 2 ch . sub . 2 -- 2 -- coo -- e -- c . tbd . c -- t -- cf . sub . 2 o -- cf2o4 ) right terminal group - x -- cn -- c -- oc . sub . n h . sub . 2n + 1 -- on -- f -- f -- c . sub . n h . sub . 2n + 1 -- cl -- cl -- ch ═ ch . sub . 2v -- ch ═ cf . sub . 2vff5 ) example of indication3 - hb ( f , f ) cf2ob ( f , f )-- c ## str20 ## 1v2 - beb ( f , f )-- c ## str21 ## ______________________________________ for the characteristics of the liquid crystal composition , the upper limit of the nematic phase temperature range was expressed as t ni , the lower limit of the nematic phase temperature range was expressed as t c , the viscosity was expressed as η , the optical anisotropy was expressed as δn , the threshold voltage was expressed as vth , the temperature dependence of threshold voltage was expressed as δ , the stability to heat was expressed as dh , the stability to ultraviolet ray was expressed as duv and the steepness was expressed as γ . t ni was determined by measuring the temperature of a nematic - isotropic phase transition during the temperature rising process using a polarization microscope . t c was judged by a liquid crystal phase which appeared after the liquid crystal composition was allowed to stand for 30 days in a freezer at 0 ° c ., - 10 ° c ., - 20 ° c ., - 30 ° c . and - 40 ° c ., respectively . for example , when a liquid crystal composition is in a nematic state at - 20 ° c ., and in a crystallized or smectic state at - 30 ° c ., t c of the liquid crystal composition was expressed as & lt ;- 20 ° c . η was measured at 20 ° c . δn was measured at 25 ° c . by using a lamp with a wavelength of 589 nm for light source . vth was measured at 25 ° c . δ was determined from the following equation ( a ) using vth measured at 20 ° c . and 50 ° c . lower δ means smaller temperature dependence of threshold voltage . in which vth50 represents vth at 50 ° c . and vth20 represents vth at 20 ° c . vth at 20 ° c ., 25 ° c . and 50 ° c . refers to the value of voltage applied when a rectangular wave having a frequency of 32 hz is applied in the normally white mode using a cell having a thickness of 9 . 0 μm and a twist angle of 80 ° and a transmittance of light passing through the cell becomes 90 %. dh was determined from the following equation ( b ). lower dh means higher stability to heat . in which iha represents an electric current value flowing into a liquid crystal composition after heating and ihb represents an electric current value flowing into a liquid crystal composition before heating . the liquid crystal composition was heated in an air at 150 ° c . for one hour . the electric current value was determined by placing the liquid crystal composition into a cell for evaluation ( a tn cell having a cell thickness of 10 μm and an electrode area of 1 cm 2 , provided with two opposite glass substrates deposited diagonally with silicon dioxide ) and applying a rectangular wave of 3 v and 32 hz to the cell . the electric current was measured at 25 ° c . duv was determined from the following equation ( c ). lower duv means higher stability to ultraviolet ray . in which iuva represents an electric current value flowing into a liquid crystal composition after exposure to ultraviolet ray and iuvb represents an electric current value flowing into a liquid crystal composition before exposure to ultraviolet ray . the exposure of the liquid crystal composition to ultraviolet ray was carried out by exposing for 20 minutes the liquid crystal composition contained in the cell for evaluation to ultraviolet ray emitted from an extra - high pressure mercury lump ( manufactured by ushio electric inc .) having an energy of 12 mw / cm 2 , with a distance between a light source and an object being 20 cm . the electric current value was measured in a similar manner as mentioned above . γ was determined from the following equation ( d ). more approach of γ to 1 means better steepness . in which v20 and v80 refer to the value of voltage applied when a transmittance of light passing through the cell in the normally yellow mode becomes 20 % and 80 %, respectively . the measurement of v20 and v80 was carried out by using a cell having a twist angle of 240 ° and a thickness of ( 0 . 80 / δn ) μm and applying a rectangular wave having a frequency of 70 hz at 25 ° c . the liquid crystal composition used in the measurement of v20 and v80 was prepared by adding cholesteryl nonanoate based on 100 parts of the liquid crystal composition so that a ratio ( d / p ) of a cell thickness d and a pitch length p in the twist becomes 0 . 50 . the composition ( example 5 ) with the lowest threshold voltage of the compositions disclosed in japanese patent kokai 7 - 300582 was prepared in the following manner . ______________________________________4o1 - beb ( f )- c 8 % 1o1 - hbeb ( f )- c 5 % 3 - h2b ( f ) eb ( f )- c 7 % 3 - hb - c 8 % 1o1 - hb - c 7 % 3 - hhb ( f , f )- f 10 % 2 - hbb - f 5 % 3 - hbb - f 5 % 1o1 - hh - 3 8 % 1o1 - hh - 5 7 % 3 - hhb - 3 14 % 2 - btb - 1 4 % 1 - btb - 6 8 % 4 - btb - 4 4 % ______________________________________ ______________________________________ t . sub . ni = 70 ° c . t . sub . c & lt ; - 30 ° c . η = 24 . 3 mpa • s δn = 0 . 127 vth = 1 . 40 v δ = 0 . 005 v /° c . dh = 1 . 95 μa duv = 5 . 80 μa______________________________________ a liquid crystal composition prepared by adding 1 . 60 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 118 of γ . this composition had poor stability to heat and ultraviolet ray and poor steepness . the composition ( example 6 ) with the lowest threshold voltage of the compositions disclosed in japanese patent kokai 7 - 300585 was prepared in the following manner . ______________________________________ 5o1 - hbeb ( f )- c 10 % 1v2 - beb ( f , f )- c 10 % 2 - heb - c 8 % 3 - heb - c 4 % 2 - hbb - f 5 % 3 - hbb - f 5 % 5 - pyb ( f )- f 7 % 3 - hhb ( f , f )- f 10 % 3 - hh - 4 10 % 3 - hb - o2 10 % 3 - hhb - 1 6 % 3 - hb ( f ) tb - 2 8 % 3 - hb ( f ) tb - 3 7 % ______________________________________ ______________________________________ t . sub . ni = 77 . 8 ° c . t . sub . c & lt ; - 30 ° c . η = 31 . 0 mpa • s δn = 0 . 140 vth = 1 . 17 v δ = 0 . 003 v /° c . dh = 1 . 75 μa duv = 4 . 95 μa______________________________________ a liquid crystal composition prepared by adding 1 . 40 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 125 of γ . this composition had poor stability to heat and ultraviolet ray and poor steepness . the composition ( example 5 ) with the lowest threshold voltage of the compositions disclosed in japanese patent kokai 7 - 300584 was prepared in the following manner . ______________________________________ 3o1 - beb ( f )- c 8 % 5o1 - hbeb ( f )- c 8 % v2 - hb - c 7 % 1v2 - hb - c 7 % 2 - beb - c 8 % 3 - beb - c 4 % 3 - hhb ( f , f )- f 10 % 5 - heb - f 5 % 7 - heb - f 5 % 3 - hh - 4 10 % 2 - btb - o1 8 % 3 - h2btb - 2 5 % 3 - h2btb - 3 5 % 3 - hb ( f ) tb - 2 5 % 3 - hb ( f ) tb - 3 5 % ______________________________________ ______________________________________ t . sub . ni = 73 . 4 ° c . t . sub . c & lt ; - 30 ° c . η = 28 . 0 mpa • s δn = 0 . 151 vth = 1 . 33 v δ = 0 . 004 v /° c . dh = 2 . 03 μa duv = 5 . 37 μa______________________________________ a liquid crystal composition prepared by adding 1 . 68 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 112 of γ . this composition had poor stability to heat and ultraviolet ray and poor steepness . as the composition analogous to that of the present invention , the composition illustrated in composition example 19 of wo 96 / 11897 was prepared in the following manner . ______________________________________ 3 - hbcf2ob ( f , f )- c 6 % 5 - hbcf2ob ( f , f )- c 6 % 3 - hb ( f , f ) cf2ob - c 6 % 5 - hb ( f , f ) cf2ob - c 6 % 2o1 - beb ( f )- c 2 % 3o1 - beb ( f )- c 8 % 2 - hb ( f )- c 5 % 3 - hb ( f )- c 7 % 3 - hhb ( f )- c 3 % 2 - hhb ( f )- f 5 % 3 - hhb ( f )- f 5 % 5 - hhb ( f )- f 5 % 3 - h2btb - 2 4 % 3 - h2btb - 3 4 % 3 - h2btb - 4 4 % 3 - hb ( f ) tb - 2 4 % 3 - hb ( f ) tb - 3 4 % 3 - hb ( f ) tb - 4 4 % 3 - hhb - 1 6 % 3 - hhb - 3 3 % 3 - hhb - o1 3 % ______________________________________ ______________________________________ t . sub . ni = 97 . 7 ° c . t . sub . c & lt ; - 20 ° c . η = 38 . 4 mpa • s δn = 0 . 141 vth = 1 . 52 v δ = 0 . 013 v /° c . dh = 0 . 05 μa duv = 0 . 10 μa______________________________________ a liquid crystal composition prepared by adding 1 . 70 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 113 of γ . this composition had high threshold voltage , high temperature dependence of threshold voltage and poor steepness . the following liquid crystal composition comprising the first , second and third components was prepared . ______________________________________compounds of formulas ( 1 - 1 ) or ( 1 - 2 ): 2 - hb ( f , f ) cf2ob ( f , f )- c 8 % 3 - hb ( f , f ) cf2ob ( f , f )- c 8 % 4 - hb ( f , f ) cf2ob ( f , f )- c 7 % 5 - hb ( f , f ) cf2ob ( f , f )- c 7 % compound of formula ( 2 ): 3 - hb - c 25 % compounds of formulas ( 3 - 1 ) to ( 3 - 4 ): vff - hhb - 1 9 % vff2 - hhb - 1 21 % 3 - hb ( f ) tb - 2 5 % 3 - hb ( f ) tb - 3 4 % 1o1 - hbbh - 5 6 % ______________________________________ ______________________________________ t . sub . ni = 90 . 3 ° c . t . sub . c & lt ; - 30 ° c . η = 37 . 3 mpa • s δn = 0 . 134 vth = 1 . 20 v δ = 0 . 002 v /° c . dh = 0 . 03 μa duv = 0 . 04 μa______________________________________ a liquid crystal composition prepared by adding 1 . 87 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 058 of γ . this composition had low threshold voltage , low temperature dependence of threshold voltage and high stability to heat and ultraviolet ray . the following liquid crystal composition comprising the first , second and third components was prepared . ______________________________________compounds of formulas ( 1 - 1 ) or ( 1 - 2 ): 2 - hb ( f , f ) cf2ob ( f , f )- c 5 % 3 - hb ( f , f ) cf2ob ( f , f )- c 5 % 4 - hb ( f , f ) cf2ob ( f , f )- c 5 % 5 - hb ( f , f ) cf2ob ( f , f )- c 5 % 2 - db ( f , f ) cf2ob ( f , f )- c 5 % 3 - db ( f , f ) cf2ob ( f , f )- c 5 % 4 - db ( f , f ) cf2ob ( f , f )- c 5 % 5 - db ( f , f ) cf2ob ( f , f )- c 5 % compound of formula ( 2 ): 3 - hb - c 15 % compounds of formulas ( 3 - 1 ) to ( 3 - 4 ): 3 - hhb - 1 3 % 3 - hhb - o1 3 % 3 - hhb - f 3 % vff2 - hhb - 1 21 % 3 - h2btb - 2 5 % 3 - h2btb - 3 4 % 1o1 - hbbh - 5 3 % 5 - hbbh - 3 3 % ______________________________________ ______________________________________ t . sub . ni = 86 . 8 ° c . t . sub . c & lt ; - 30 ° c . η = 39 . 6 mpa • s δn = 0 . 132 vth = 1 . 10 v δ = 0 . 003 v /° c . dh = 0 . 02 μa duv = 0 . 03 μa______________________________________ a liquid crystal composition prepared by adding 1 . 83 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 060 of γ . this composition had low threshold voltage , low temperature dependence of threshold voltage and high stability to heat and ultraviolet ray . the following liquid crystal composition comprising the first , second and third components was prepared . ______________________________________compounds of formulas ( 1 - 1 ) or ( 1 - 2 ): 2 - hb ( f , f ) cf2ob ( f , f )- c 7 % 3 - hb ( f , f ) cf2ob ( f , f )- c 7 % 4 - hb ( f , f ) cf2ob ( f , f )- c 6 % 5 - hb ( f , f ) cf2ob ( f , f )- c 6 % compound of formula ( 2 ): 2o1 - beb ( f )- c 5 % 3 - hb - c 3 % 1v2 - beb ( f , f )- c 8 % 3 - beb ( f , f )- c 2 % compounds of formulas ( 3 - 1 ) to ( 3 - 4 ): 3 - hb - o2 7 % 3 - hheb - f 5 % 5 - hheb - f 5 % 3 - hbeb - f 6 % vff - hhb - 1 6 % vff2 - hhb - 1 10 % 2 - btb - 1 8 % 3 - hb ( f ) tb - 2 5 % 3 - hb ( f ) tb - 3 4 % ______________________________________ ______________________________________ t . sub . ni = 80 . 1 ° c . t . sub . c & lt ; - 30 ° c . η = 36 . 0 mpa • s δn = 0 . 141 vth = 1 . 15 v δ = 0 . 004 v /° c . dh = 0 . 04 μa duv = 0 . 02 μa______________________________________ a liquid crystal composition prepared by adding 1 . 94 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 065 of γ . this composition had low threshold voltage , low temperature dependence of threshold voltage and high stability to heat and ultraviolet ray . the following liquid crystal composition comprising the first , second and third components was prepared . ______________________________________compounds of formulas ( 1 - 1 ) or ( 1 - 2 ): 2 - db ( f , f ) cf2ob ( f , f )- c 6 % 3 - db ( f , f ) cf2ob ( f , f )- c 6 % 4 - db ( f , f ) cf2ob ( f , f )- c 6 % 5 - db ( f , f ) cf2ob ( f , f )- c 5 % compound of formula ( 2 ): 3 - beb ( f )- c 6 % 3o1 - beb ( f )- c 5 % 3 - heb ( f , f )- c 5 % 3 - h2b ( f , f )- c 5 % compounds of formulas ( 3 - 1 ) to ( 3 - 4 ): 2 - btb - o1 7 % 3 - hhb - 1 6 % 2 - hhb - cl 6 % 4 - hhb - cl 6 % 5 - hhb - cl 6 % 3 - hheb - f 6 % 5 - hheb - f 6 % 3 - hb ( f ) tb - 2 5 % 3 - hb ( f ) tb - 3 4 % 1o1 - hbbh - 5 4 % ______________________________________ ______________________________________ t . sub . ni = 86 . 8 ° c . t . sub . c & lt ; - 20 ° c . η = 46 . 2 mpa • s δn = 0 . 135 vth = 1 . 01 v δ = 0 . 003 v /° c . dh = 0 . 02 μa duv = 0 . 02 μa______________________________________ a liquid crystal composition prepared by adding 1 . 90 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 054 of γ . this composition had low threshold voltage , low temperature dependence of threshold voltage and high stability to heat and ultraviolet ray . the following liquid crystal composition comprising the first , second and third components was prepared . ______________________________________compounds of formulas ( 1 - 1 ) or ( 1 - 2 ): 2 - hb ( f , f ) cf2ob ( f , f )- c 5 % 3 - hb ( f , f ) cf2ob ( f , f )- c 5 % 4 - hb ( f , f ) cf2ob ( f , f )- c 5 % 5 - hb ( f , f ) cf2ob ( f , f )- c 5 % 1v2 - hb ( f , f ) cf2ob ( f , f )- c 3 % 3o1 - hb ( f , f ) cf2ob ( f , f )- c 3 % 5 - b ( f , f ) cf2ob ( f , f )- c 2 % 1v2 - b ( f , f ) cf2ob ( f , f )- c 2 % 3o1 - b ( f , f ) cf2ob ( f , f )- c 2 % compound of formula ( 2 ): 1v2 - hb - c 10 % 3 - hb - c 8 % 3 - hb ( f )- c 7 % 3 - hb ( f , f )- c 3 % compounds of formulas ( 3 - 1 ) to ( 3 - 4 ): v - hhb - 1 6 % vff2 - hhb - 1 19 % 1o1 - hbbh - 4 5 % 1o1 - hbbh - 5 5 % 5 - hbb ( f ) b - 2 5 % ______________________________________ ______________________________________ t . sub . ni = 83 . 7 ° c . t . sub . c & lt ; - 30 ° c . η = 38 . 0 mpa • s δn = 0 . 127 vth = 1 . 15 v δ = 0 . 003 v /° c . dh = 0 . 02 μa duv = 0 . 04 μa______________________________________ a liquid crystal composition prepared by adding 1 . 92 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 053 of γ . this composition had low threshold voltage , low temperature dependence of threshold voltage and high stability to heat and ultraviolet ray . the following liquid crystal composition comprising the first , second and third components was prepared . ______________________________________compounds of formulas ( 1 - 1 ) or ( 1 - 2 ): 2 - db ( f , f ) cf2ob ( f , f )- c 4 % 3 - db ( f , f ) cf2ob ( f , f )- c 4 % 4 - db ( f , f ) cf2ob ( f , f )- c 4 % 1v2 - db ( f , f ) cf2ob ( f , f )- c 3 % 3o1 - db ( f , f ) cf2ob ( f , f )- c 3 % compound of formula ( 2 ): 3 - beb ( f , f )- c 4 % 3o1 - beb ( f , f )- c 9 % 3 - hb - c 6 % 2 - beb - c 5 % compounds of formulas ( 3 - 1 ) to ( 3 - 4 ): 3 - hb - o2 2 % 5 - hh - vff 15 % 3 - hhb - f 3 % 3 - hhb - o1 4 % vff2 - hhb - 1 14 % 3 - hb ( f ) tb - 2 7 % 3 - hb ( f ) tb - 3 7 % 3 - h2btb - 2 6 % ______________________________________ ______________________________________ t . sub . ni = 85 . 7 ° c . t . sub . c & lt ; - 30 ° c . η = 23 . 7 mpa • s δn = 0 . 141 vth = 1 . 22 v δ = 0 . 005 v /° c . dh = 0 . 03 μa duv = 0 . 03 μa______________________________________ a liquid crystal composition prepared by adding 2 . 02 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 048 of γ . this composition had low threshold voltage , low temperature dependence of threshold voltage and high stability to heat and ultraviolet ray . the following liquid crystal composition comprising the first , second and third components was prepared . ______________________________________compounds of formulas ( 1 - 1 ) or ( 1 - 2 ): 2 - db ( f , f ) cf2ob ( f , f )- c 5 % 3 - db ( f , f ) cf2ob ( f , f )- c 4 % 4 - db ( f , f ) cf2ob ( f , f )- c 4 % 5 - db ( f , f ) cf2ob ( f , f )- c 4 % compound of formula ( 2 ): 1v2 - beb ( f , f )- c 14 % 3 - hb - c 8 % compounds of formulas ( 3 - 1 ) to ( 3 - 4 ): v2 - hh - vff 5 % 5 - hh - v 5 % 3 - hb - o2 7 % 3 - hheb - f 5 % 5 - hheb - f 5 % 3 - hbeb - f 6 % vff - hhb - 1 6 % vff2 - hhb - 1 10 % 3 - hh - 4 3 % 3 - hb ( f ) tb - 2 5 % 3 - hb ( f ) tb - 3 4 % ______________________________________ ______________________________________ t . sub . ni = 84 . 9 ° c . t . sub . c & lt ; - 30 ° c . η = 27 . 9 mpa • s δn = 0 . 124 vth = 1 . 12 v δ = 0 . 005 v /° c . dh = 0 . 03 μa duv = 0 . 04 μa______________________________________ a liquid crystal composition prepared by adding 1 . 76 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 063 of γ . this composition had low threshold voltage , low temperature dependence of threshold voltage and high stability to heat and ultraviolet ray . the following liquid crystal composition comprising the first , second , third and fourth components was prepared . ______________________________________compounds of formulas ( 1 - 1 ) or ( 1 - 2 ): 2 - db ( f , f ) cf2ob ( f , f )- c 5 % 3 - db ( f , f ) cf2ob ( f , f )- c 5 % 4 - db ( f , f ) cf2ob ( f , f )- c 5 % 5 - db ( f , f ) cf2ob ( f , f )- c 5 % 2 - hb ( f , f ) cf2ob ( f , f )- c 5 % 3 - hb ( f , f ) cf2ob ( f , f )- c 5 % compound of formula ( 2 ): 2o1 - beb ( f )- c 6 % 3 - hb ( f )- c 5 % compounds of formulas ( 3 - 1 ) to ( 3 - 4 ): 5 - hh - vff 15 % 2 - btb - 1 7 % 3 - hb ( f ) tb - 3 6 % 3 - hhb - 1 3 % compounds of formula ( 4 ) 2 - hhb ( f )- c 14 % 3 - hhb ( f )- c 9 % 3 - hhb - c 5 % ______________________________________ ______________________________________ t . sub . ni = 84 . 5 ° c . t . sub . c & lt ; - 30 ° c . η = 47 . 0 mpa • s δn = 0 . 134 vth = 1 . 02 v δ = 0 . 003 v /° c . dh = 0 . 05 μa duv = 0 . 03 μa______________________________________ a liquid crystal composition prepared by adding 1 . 59 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 057 of γ . this composition had low threshold voltage , low temperature dependence of threshold voltage and high stability to heat and ultraviolet ray . the following liquid crystal composition comprising the first , second , third and fourth components was prepared . ______________________________________compounds of formulas ( 1 - 1 ) or ( 1 - 2 ): 2 - db ( f , f ) cf2ob ( f , f )- c 5 % 3 - db ( f , f ) cf2ob ( f , f )- c 5 % 4 - db ( f , f ) cf2ob ( f , f )- c 5 % 5 - db ( f , f ) cf2ob ( f , f )- c 5 % compound of formula ( 2 ): 3 - hb - c 20 % 1v2 - beb ( f , f )- c 10 % compounds of formulas ( 3 - 1 ) to ( 3 - 4 ): 3 - hhb - 3 12 % 3 - hhb - o1 5 % 3 - hheb - f 3 % 5 - hheb - f 3 % 3 - h2btb - 2 5 % 3 - h2btb - 3 5 % compounds of formula ( 5 ): 2 - hbeb ( f , f )- f 3 % 3 - hbeb ( f , f )- f 5 % 5 - hbeb ( f , f )- f 3 % 3 - hheb ( f , f )- f 2 % 3 - hhb ( f , f )- f 2 % 3 - hhb ( f )- f 2 % ______________________________________ ______________________________________t . sub . ni = 82 . 8 ° c . t . sub . c & lt ; - 30 ° c . η = 37 . 1 mpa · sδn = 0 . 130vth = 1 . 08 vδ = 0 . 004 v /° c . dh = 0 . 05 μaduv = 0 . 04 μa______________________________________ a liquid crystal composition prepared by adding 1 . 75 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 070 of γ . this composition had low threshold voltage , low temperature dependence of threshold voltage and high stability to heat and ultraviolet ray . the following liquid crystal composition comprising the first , second , third , fourth and fifth components was prepared . ______________________________________compounds of formulas ( 1 - 1 ) or ( 1 - 2 ): 2 - hb ( f , f ) cf2ob ( f , f )- c 5 % 3 - hb ( f , f ) cf2ob ( f , f )- c 5 % 4 - hb ( f , f ) cf2ob ( f , f )- c 5 % 5 - hb ( f , f ) cf2ob ( f , f )- c 5 % compound of formula ( 2 ): 1v2 - beb ( f , f )- c 10 % 3o1 - beb ( f )- c 4 % 3 - hb ( f )- c 12 % compounds of formulas ( 3 - 1 ) to ( 3 - 4 ): 3 - hheb - f 6 % 5 - hheb - f 6 % 3 - hhb - 1 8 % 3 - hhb - o1 4 % 3 - hhb - f 5 % 3 - hhb - 3 7 % 3 - hb ( f ) tb - 2 2 % compound of formula ( 4 ): 3 - hhb ( f )- c 10 % compound of formula ( 5 ): 3 - hhb ( f )- f 6 % ______________________________________ ______________________________________t . sub . ni = 94 . 9 ° c . t . sub . c & lt ; - 20 ° c . η = 44 . 5 mpa · sδn = 0 . 120vth = 1 . 16 vδ = 0 . 003 v /° c . dh = 0 . 02 μaduv = 0 . 03 μa______________________________________ a liquid crystal composition prepared by adding 2 . 01 parts by weight of cholesteryl nonanoate to 100 parts by weight of the above liquid crystal composition had 1 . 060 of γ . this composition had low threshold voltage , low temperature dependence of threshold voltage and high stability to heat and ultraviolet ray . as shown in the above examples , the present invention can provide the liquid crystal compositions for stn , especially having low threshold voltage , low temperature dependence of threshold voltage and high stability to heat and ultraviolet ray , while satisfying general characteristics required for the stn display mode .	2
in the figures , corresponding parts of the drill have the same reference numbers . the drill front end shown generally at 1 includes the forward portion of a drill casing 2 containing an electric motor ( not shown ) controlled by a trigger switch 3 mounted on a pistol - grip 4 that is gripped by one hand of a user when the drill is in use . the motor rotates a drill drive shaft 5 that can be reciprocated between two axially displaced positions , shown respectively in fig1 and 2 , by a solenoid mechanism in a cylindrical box 6 surrounding the shaft 5 . an arrow 7 shows the direction of rotation of the shaft 5 . the casing 2 has a forward extension 8 that can be rotated about the axis of the shaft 5 and also turned through ninety degrees in the same plane as the axis of the shaft . the shaft 5 carries a cylindrical gear 10 that reciprocates with the shaft and is rotated by it . the gear 10 has a ring of parallel teeth having tapered ends to assist their meshing with the teeth of a circular toothed track 12 extending around one side of a disc 13 . in practice only one quarter of the length of track 12 is used . the track teeth also have tapered ends to assist their meshing with the gear 10 . the disc 13 is pivotally mounted on a spindle 14 extending between the extension 8 and a collar 15 through which the shaft 5 is a close sliding fit . opposite ends of the used section of the track 12 are respectively provided with stops 16 and 17 that limit the angle to which the gear 10 can travel around the track 12 when the shaft 5 is rotated . as explained above , the connection between the casing 2 and the extension 8 allows the extension 8 two freedoms of movement . one freedom of movement includes a rotational movement of the extension 8 through 180 . degree . about the axis of the shaft 5 as shown in successive fig4 to 8 , and the second freedom of movement allows the extension 8 to rotate through ninety degrees about the axis of pivot 14 as shown in successive fig2 to 4 . the casing 8 carries two rotatable drill drive chucks 20 and 21 that project at right angles to one another , as shown in fig1 . the chuck 20 is shown in the driving position of the drill 1 and is illustrated supporting a conventional removable drill bit 23 . the other chuck 21 is illustrated supporting a counter - sinking bit 24 at a position at which it extends downwardly forwardly of the pistol - grip 4 of the drill 1 . in the position of the drive shaft 5 illustrated in fig1 , the gear 10 is positioned forwardly of the track 12 so that the gear 10 and track 12 are not in mesh . however , if the mechanism in the box 6 is operated , the shaft 5 is retracted to the right of fig1 bringing the teeth of the gear 10 into mesh with the teeth of the track 12 . to establish a driving connection to the chuck 20 , 21 in use , the forward end of the shaft 5 is of hexagonal cross - section and fits within a socket of complementary cross - section of whichever of the chucks 20 , 21 is in the driving position at the left - hand end of the drive shaft 5 . the operation of the chuck - changing mechanism shown in the drawings will now be described . with the parts of the drill 1 in the positions shown in fig1 , the trigger 3 can be squeezed so that the drive from the drill motor ( not shown ) is transmitted through the shaft 5 to rotate the drill bit 23 in order to make a drill hole . when a drill hole of the appropriate depth has been formed , its mouth can be countersunk by bringing the chuck 21 and the countersinking bit 24 to the drive position in place of the drill bit 23 . this is achieved by squeezing a second trigger 9 positioned above the trigger 3 . it should be noted that a user of the drill 1 can squeeze the second trigger 9 with the same hand as is holding the pistol - grip 4 and operating the first trigger 3 . the action of pressing the trigger 9 is to energise a sequencing circuit that carries out the following steps : the drill drive motor is first temporarily de - energised and the mechanism in the box 6 is operated against the resilient bias of a spring ( not shown ) to withdraw the forward end - portion of the shaft 5 from the socket in the chuck 20 . simultaneously the gear 10 is brought into mesh with the teeth of the used section of the track 12 . this is shown in fig2 . the user maintains the trigger 9 depressed and the sequencing circuit then re - energises the driving motor ( not shown ) so that the gear 10 is rotated to drive the disc 13 in its own plane in a clockwise direction by way of the meshing gear 10 and track 12 . this displaces the two chucks 20 , 21 angularly so that the chuck 21 moves towards the driving position formerly occupied by chuck 20 and the chuck 20 moves towards a vertically upward position . successive stages in this movement are shown in fig3 and 4 . when the chuck 20 reaches the position shown in fig4 , the gear 10 abuts the stop 16 so that further rotation of the disc 13 about the axis of the spindle 14 is prevented . one freedom of movement of the extension 8 has then been completed . as the gear 10 cannot rotate further along the track 12 , further rotation of the drive shaft 5 causes the extension 8 and disc 13 to rotate bodily around the axis of the drive shaft 5 . this moves the chuck 20 from the position shown in fig4 through the successive positions shown in fig5 , 6 and 7 to the position shown in fig8 at which the chuck 20 is positioned directly in front of the pistol - grip 4 . during this rotation of the chuck 20 the second chuck 21 remains in the driving position of the drill 1 as shown . once the chuck 20 has reached the position shown in fig8 and 9 , a mechanical switch ( not shown ) is operated by the extension 8 to stop operation of the mechanism in the box 6 and de - energise the drill drive motor ( not shown ). the spring ( not shown ) associated with the mechanism in the box 6 then advances the front - end of the drive shaft towards the front of the drill 1 . this forward movement of the drive shaft 5 disengages the gear from the track 12 ( as shown in fig1 ), and the forward end of the drive shaft 5 then enters the socket in the back of the chuck 21 to establish a driving engagement between the drive shaft 5 and the chuck 21 . on completion of this movement of the shaft 5 , the forward movement of the drive shaft 5 operates a switch ( not shown ) to allow the operation of the trigger 3 to energise the drive motor ( not shown ) once again and enable the countersinking bit 24 in the chuck 21 to be used . if it is again required to interchange the positions of the chucks 20 and 21 , the above procedure is repeated as shown in the sequence of fig1 to 18 . the mechanism in the box 6 is operated to withdraw the drill shaft 5 from the chuck 21 against the force of the resilient spring bias ( not shown ), and to temporarily de - energise the electrical circuit to prevent operation of the drill motor ( not shown ) from the trigger 3 . as shown in fig1 the withdrawal movement of the shaft 5 brings the gear 10 into mesh once again with the teeth of the arcuate track 12 as shown in fig1 . when the trigger 9 is now squeezed , the electrical circuit to the motor ( not shown ) is again energised by the sequencing circuit but in a way which reverses its direction of rotation . the shaft 5 is now rotated in the direction indicated by the arrow in fig1 , to rotate the disc 13 in a counterclockwise direction , as shown in fig1 , about the axis of the spindle 14 . the counterclockwise movement of the disc 13 moves the chuck 21 upwardly and brings the chuck 20 into alignment with the drive shaft 5 , as shown in fig1 . this movement is completed when the track 12 has turned through ninety degrees and the gear 10 abuts the stop 17 at the end of the track 12 . when this occurs , further rotation of the track 12 is prevented and the turning movement of the shaft 5 is imparted to turn the disc 13 and extension 8 bodily about the axis of the shaft 5 . this brings the chuck 21 from a vertically upwards position shown in fig1 , through the stages shown in fig1 , 15 and 16 , to the vertically downwards position shown in fig1 when it is located a short distance in front of the pistol - grip 4 . this movement is terminated by the actuation of a switch ( not shown ) responsive to movement of the extension 8 . the mechanism in the box 6 is de - energised by the switch to allow the resilient spring bias ( not shown ) on the shaft 5 to move the shaft 5 axially in a forward direction to bring its free end - portion into engagement with the socket at the back of the chuck 20 . simultaneously the gear 10 is disengaged from the track 12 and the parts of the drill 1 assume the positions shown in fig1 . the trigger 9 , which initiated the interchange of the two chucks 20 and 21 , is then released automatically by the forward movement of the shaft 5 to allow the drill 1 to be again operated by squeezing the trigger 3 . in a modification ( not shown ) of the above - described arrangement , the extension 8 carries two opposed spaced parallel tracks 12 which share a common axis of rotation and respectively mesh with the teeth of the gear 10 on its opposite sides . the gear 10 is thus trapped between the two tracks so that a dynamically strong arrangement results in which the risk of the teeth of the gear 10 being forced out of engagement with the teeth of the tracks 12 when under load , is greatly reduced . the additional track 12 used in this modification turns freely about the axis of the spindle 14 and thus is simply an idler and does not participate in the transmission of drive between the shaft 5 and the chuck 20 / 21 at the driving position in front of the extension 8 .	1
embodiments of the present invention will be described below with reference to the drawings . fig1 to 4 show a first embodiment of a bar code scanning device of the present invention . fig1 is a top view schematically showing the configuration of the bar code scanning device . fig2 is a sectional view of fig1 taken along line x — x in the same figure . fig3 is a perspective view showing how the bar code scanning device ( only an integral part is disclosed ) of the first embodiment irradiates a target bar code with a scanning beam . fig4 is a sectional view showing an integral part of the bar code scanning device of the first embodiment and which is useful in explaining the operation of an applied laser beam . this bar code scanning device 1 comprises a visible laser diode ( hereafter referred to as an “ ld ”) provided inside a housing 2 ( hereafter referred to as a “ card housing ”) of a compact flash card size and acting as a light source for generating a laser beam , a laser beam scanning section 4 for applying the laser beam generated by the light source to a target bar code 100 as a scanning beam , a pair of sensors 5 for obtaining reflected light provided when the beam is reflected from the bar code , to generate a detection signal based on the intensity of the reflected light , a circuit substrate 7 having an electronic circuit such as a signal processing section 6 for processing the signal detected by the sensor 5 and controlling driving of the laser beam scanning section 4 , and a connection terminal 8 for connection to a processing apparatus such as an external computer . the card housing 2 has a window portion 9 formed opposite the connection terminal 8 and through which the scanning beam from the laser light scanning section is emitted . additionally , the circuit substrate 7 has a notch portion 10 and is substantially u - shaped . the pair of sensors 5 are provided on opposite ends of the window 9 on the circuit substrate 7 , and the circuit substrate 7 ( pcb 7 ) is connected to the ld 3 arranged in the notch portion . further , the laser beam scanning section 4 is arranged in the notch portion and supported by the card housing 2 . the laser beam scanning section 4 comprises an incident optical system 11 on which a laser beam generated by the ld 3 is incident , a laser beam reflecting section 12 including a micromirror for reflecting the laser beam from the incident optical system 11 , an emitting optical system 13 for emitting the laser beam from the laser beam reflecting section 12 to the bar code 100 as a scanning beam , and a scan driving section composed of an electromagnetic driving coil ( not shown ) and a pair of magnets 14 provided around the micromirror for driving the laser beam reflecting section 12 . in this configuration , a reflecting surface of the micromirror of the laser beam reflecting section 12 is arranged substantially parallel with the circuit substrate 7 and under an optical axis of a laser beam . in addition , the incident optical system 11 and the emitting optical system 13 are each formed of a composite free shaped prism comprising two integrally molded optical system each composed of a free - curved - surface optical system , and are arranged over the laser beam reflecting section 12 in such a manner as to sandwich the optical axis of a laser beam emitted from the ld 3 between themselves and the laser beam reflecting section 12 . the ld 3 , the laser beam scanning section 4 , and the window portion 9 are arranged within the notch portion 10 along the optical axis so that a parallel line ( an axial principal ray or an extension of the optical axis ) of the optical axis of a laser beam emitted from the ld 3 is substantially orthogonal to a longitudinal center line of the window portion 9 . in this case , the signal processing section 6 mounted on the circuit substrate 7 comprises a drive control section for controlling emission of a laser beam from the light source and driving of the laser beam scanning section 4 , a decoder for processing a detection signal from the sensors 5 to generate bar code information , and other components . well known techniques are used for control signals provided by the drive control section to drive the scanning mechanism and for processing executed by the decoder for signals detected by the sensors ; detailed description of these techniques is thus omitted . additionally , the connection terminal 8 has a standard pin array that can be connected to a card slot formed in a notebook computer , a pda terminal of an electronic handbook or the like , or a portable mail terminal . in this embodiment , a connector with two rows of 25 pins , that is , a total of 50 pins are used to meet the compact flash card standards . the configurations of the incident optical system , the laser beam reflecting section , and the emitting optical system are described in detail in u . s . ser . no . 09 / 541 , 027 , previously disclosed by the applicant , and the configurations and operations of the laser beam are described in detail in u . s . pat . no . 6 , 188 , 504 , also previously disclosed by the applicant ; these configurations and operations are thus omitted . then , the operation of the bar code scanning device configured as described above will be described . as shown in fig4 a laser beam from the ld 3 is reflected inside the incident optical system 11 twice and collected and directed to the laser beam reflecting section 12 . in the laser beam reflecting section 12 , the micromirror is swung by a drive shaft 15 ( which comprises , as sohwn in fig1 or fig2 a pair of torsion bars for supporting said micromirror 12 ) that extends almost parallel to the laser beam emitted from the ld 3 . the micromirror swings so , because of the relation between the magnetic field of the magnet 14 and the current supplied to the electromagnetic driving coil . this vibration yields a scanning beam to be linearly scanned , which is then directed to the emitting optical system 13 for emitting the scanning beam . in the emitting optical system 13 , as in the incident optical system 11 , the scanning beam is reflected twice , has its scanning angle widened , and is optically adjusted such that a scanning line provided by the scanning beam is straight . the scanning beam is then emitted to the bar code 100 trough the window portion 9 . to perform the linear scanning efficiently , the micromirror 12 is swung by the drive shaft 15 in the laser - beam scanning section 4 , at a resonant frequency equal or nearly equal to the frequency of the control signal ( a periodically varying signal ). reflected light obtained when the bar code 100 is irradiated with the scanning beam is detected by the pair of sensors 5 arranged near the opposite ends of the window 9 ; the sensors 5 then generate a signal proportional to the intensity of the detected reflected light . the signal output from the sensors 5 is processed by the signal processing section 6 arranged on the circuit substrate 7 in the card housing 2 and is then decoded into bar code information . then , a system such as that shown in fig9 and described later is used to transmit this bar code information to an interior of a portable information terminal or to a host computer such as a personal computer , where a required process such as sales or stock management is executed . according to the first embodiment of the present invention configured as described above , each section is arranged such that the parallel line ( the axial principal ray or the extension of the optical axis ) of the optical axis of the laser beam emitted from the light source is substantially orthogonal to the longitudinal center line of the light source , thereby enabling the size of the housing to be reduced . additionally , since the laser beam is reflected twice in each of the incident and emitting optical systems relative to a thickness direction of the housing , the length of an optical path can be increased despite the reduced size of the housing , thereby allowing a scanning angle required to scan the bar code to be easily obtained . further , since the laser beam scanning section is arranged in the notch portion of the circuit board , an increase in the thickness of the housing can be prevented to enable the device to be built into a card housing having a thickness equal to or smaller than that of the type 2 card housing according to the pcmcia standards or a compact - flash - sized card housing , specifically a thickness of 5 . 0 mm or smaller . next , a second embodiment of the present invention will be described . fig5 to 8 show the second embodiment of the bar code scanning device according to the present invention . fig5 is a top view schematically showing the configuration of the bar code scanning device of the second embodiment . fig6 is a sectional view of fig5 taken along line y — y in the same figure . fig7 is a perspective view showing how the bar code scanning device ( only an integral part is disclosed ) of the second embodiment irradiates a target bar code with a scanning beam . fig8 is a front view showing an integral part of the bar code scanning device of the second embodiment and which is useful in explaining the laser beam scanning section . in the bar code scanning device 1 according the second embodiment , the micromirror 12 that is the laser beam reflecting section of the laser beam scanning section 4 is provided parallel with a thickness direction of the card housing , that is , arranged so as to stand up , and instead of the incident optical system 11 and the emitting optical system 13 , a focusing lens 20 is provided in front of the ld 3 . thus , a laser beam from the ld 3 is applied to the micromirror 12 at an angle of 70 ° ( when the mirror is stationary ), and the micromirror 12 is vibrated around the shaft 15 by a current for a control signal flowing through the electromagnetic driving coil 30 provided around the mirror and by magnetic fields generated by the magnet 14 , to generate a scanning beam , which is then applied to the bar code 100 via the window portion 9 . the process executed after obtaining reflected light from the bar code is similar to that in the first embodiment . in this embodiment , as in the first embodiment , the ld 3 and the laser beam scanning section 4 ( including the focusing lens 20 ) are arranged inside the notch portion 10 . according to the second embodiment of the present invention configured as described above , the laser beam scanning section is arranged in the notch portion of the circuit board as in the first embodiment to enable the thickness of the housing to be reduced , thereby making the housing smaller . thus , the device can be built into a card housing having a thickness equal to or smaller than that of the type 2 card housing according to the pcmcia standards or a compact - flash - sized card housing , specifically a thickness of 5 . 0 mm or smaller . in addition , instead of the incident optical system 11 and the emitting optical system 13 , the focusing lens 20 is provided in front of the ld 3 , thereby enabling further weight reduction . a system having the bar code scanning device 1 according to the first and second embodiments integrated thereinto will be simply explained with reference to fig9 . the bar code scanning device 1 is installed in a card slot in a portable information terminal in such a manner that its window portion is directed to an exterior of the terminal . the terminal is further connected to a desk top type host computer 300 through a cable 400 . in such a system , a trigger switch provided in the portable information terminal 200 is operated to apply a scanning beam to the bar code 100 through the window portion of the bar code scanning device 1 built into the card slot in the terminal 200 . light reflected from the bar code is received and processed as described above to read bar code information . the bar code information is transmitted to an interior of the terminal 200 or to the host computer 300 connected thereto via the cable 400 , where a required process such as sales or stock management is executed . the above described embodiments have been described in connection with the one - dimensional linear scanning method of executing scanning along a single axis , but it is possible to use an all - direction scanning method of using continuous scan lines angularly displaced relative to one another based on an all - direction scanning pattern so as to accommodate various bar codes or a two - dimensional raster scanning method of using continuous scan lines along a first scan axis , the continuous scan lines being displaced from one another along a second vertical axis . alternatively , the plurality of scanning methods can be switched by means of mode switching . furthermore , in each of the above described embodiments , the scanning beam is emitted from the window portion of the housing in a substantially horizontal direction , but it may be emitted therefrom in an oblique direction by arranging the mirror in the window portion or setting the shape of the reflecting surface of the emitting optical system as appropriate . if the scanning beam is set to be emitted obliquely downward from the window portion , then it is emitted downward when a user scans the bar code with the portable information terminal in his or her hand , so that the user can operate the bar code without the need to direct the terminal downward . consequently , the scanning device can be operated more easily . additionally , each embodiment has been described taking by way of example the electromagnetic driving method using the electromagnetic driving coil and the magnet , but the driving method is not limited to this . it is possible to use an electrostatic driving method used for static motors or a piezoelectric driving method used for ultrasonic motors or the like and using a piezoelectric vibrator . fig1 is a perspective view showing a laser beam scanning section using the electrostatic driving method . as shown in this figure , the laser beam scanning section using the electrostatic driving method has , instead of the electromagnetic driving coil , two movable electrodes 51 provided on a surface of the laser beam reflecting section 12 which is opposite to the reflecting surface and a fixed electrode 52 located opposite the movable electrodes . then , when a voltage is applied between the fixed electrode and one of the two movable electrodes 51 , a static attractive force is generated between the movable electrode 51 and the fixed electrode 52 . this static attractive force moves the movable electrode 51 around the drive shaft 15 toward the fixed electrode 52 to bias the laser beam reflecting section 12 . then , when a switch 53 is switched to apply a voltage between the other movable electrode and the fixed electrode to bias the laser beam reflecting section 12 in the opposite direction . repeating this operation allowed the laser beam applied to the rear surface of the movable electrode 51 to be scanned , so that the resulting scanning beam is emitted from the window portion to the bar code . this laser beam scanning section using the electrostatic driving method allows a drive coil , a detection coil , a permanent magnet , and a magnetic yoke to be omitted , thereby enabling the size and weight of the bar code scanning device to be further reduced compared to the electromagnetic driving method . further , each embodiment has been described in connection with the scan device built into the compact flash card housing , but the present invention is not limited to this . variations or changes may be made to the configuration without deviating from the spirits of the present invention . in addition , in either embodiment , a driving power supply to the compact flash card may be obtained from the host computer , or the card may comprise a built - in power source so as to be driven without an external power supply . since the spirits of the above described present invention are sufficiently apparent from the above description , those skilled in the art can use , without any further description , their current knowledge to easily employ the present invention for various applications without excluding features of the present invention definitely constituting the comprehensive or basic characteristics thereof . these applications should be and are intended to be understood within the contents or scope shown in the claims . as described above , the bar code scanning device according to the present embodiment has the following effects : first , the bar code scanning device is compatible with general computers including notebook and desktop personal computers ; it is also inexpensive and light . second , the bar code scanning device can be integrated into a card slot employed in the notebook computer , so as to be connected to the computer . third , a scan device ( a scanning mechanism , a beam generating light source , sensors , and a major part of a processing circuit ) can be provided in a card housing of a thin card such as a pc card according to the pcmcia standards or a compact flash card . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents .	6
the matters defined in the description such as a detailed construction and elements are provided to assist in a comprehensive understanding of the embodiments of the invention and are merely exemplary . accordingly , those of ordinary skill in the art will recognize that various changes and modifications of the embodiments described herein can be made without departing from the scope and spirit of the invention . also , descriptions of well - known functions and constructions are omitted for clarity and conciseness . reference will now be made in detail to exemplary embodiments of the present invention , examples of which are illustrated in the accompanying drawings . the exemplary embodiments are described below in order to explain the present invention by referring to the fig1 to 4 . fig1 shows a control block diagram of a tv 100 according to an exemplary embodiment of the present invention . as shown in fig1 , the tv 100 according to an exemplary embodiment of the present invention includes a broadcasting receiver 10 , a signal processing unit 20 , a display unit 30 , a connection unit 40 , an externally connected hard disc drive ( hdd ) controller 41 , a built - in hdd 50 , a data storage module 60 , a user selector 70 , a user interface ( ui ) generator 80 and a controller 90 . the broadcasting receiver 10 includes an antenna 11 , a digital tuner 13 and an analog tuner 15 . the signal processing unit 20 includes a moving picture experts group ( mpeg ) decoder 21 , an national television system committee ( ntsc ) decoder 23 , an mpeg encoder 27 and a scaler 25 . the digital tuner 13 and the analog tuner 15 tune a digital broadcasting signal and an analog broadcasting signal which are respectively received through the antenna 11 into a broadcasting signal of a frequency band ( channel ) that corresponds to a tuning control signal of the controller 90 . the digital broadcasting signal of the tuned particular channel is output in the form of a transport stream through a vestigial side band ( vsb ) demodulation process and an error correction process in a demodulator ( not shown ). the digital broadcasting signal output in the form of the transport stream is separated into various kinds of additional data which are defined as a video signal , an audio signal and program and service information protocol information ( psip ) by a demultiplexer ( not shown ) and is output in the form of a bit - stream . the video signal of the moving picture experts group ( mpeg ) signal type separated through the demultiplexer is decoded by the mpeg decoder 21 . moreover , the analog video signal according to the national television system committee ( ntsc ) signal type tuned by the analog tuner 15 is decoded by the ntsc decoder 23 . the analog video signal and the digital video signal which undergo the decoding are displayed on the display unit 30 through the scaler 25 . here , the display unit 30 may be one of various types such as a digital light processing ( dlp ), a liquid crystal display ( lcd ), and a plasma display panel ( pdp ). the scaler 25 converts a video signal so that when displayed it fits a vertical frequency , a resolution , an aspect ratio , or the like , of the display unit 30 . in the meantime , an audio signal is decoded by an audio decoder ( not shown ) and output to a speaker ( not shown ). the mpeg encoder 27 encodes an analog broadcasting signal and converts the analog broadcasting signal into an mpeg signal type . the encoded digital data by the mpeg encoder 27 is output to an externally connected hdd 200 through the connection unit 40 by the externally connected hdd controller 41 , or output to the built - in hdd 50 . the analog broadcasting signal is transformed into a digital form through the mpeg encoder 27 and is stored in a storage medium such as the built - in hdd 50 or the externally connected hdd 200 . the connection unit 40 is connected with an external storage medium including the externally connected hdd 200 and a video cassette recorder ( vcr ) 300 . in order to store data in the externally connected hdd 200 or read data stored in the externally connected hdd 200 , the externally connected hdd controller 41 interfaces with the externally connected hdd 200 via the connection unit 40 . moreover , the analog broadcasting signal can be stored in the external vcr 300 under the control of the controller 90 . in the meantime , the data storage module 60 according to the exemplary embodiment of the present invention includes a priority storage unit 61 , a reservation information storage unit 63 and an electronic program guide ( epg ) storage unit 65 . the priority storage unit 61 stores storage priority information of storage media for the reserve - recording of broadcasting programs . the reservation information storage unit 63 stores channel information , and information on a start time and an end time of a broadcasting program of which is selected as a reserve - recording . the epg storage unit 65 stores epg information , which is guide information relating to broadcasting programs . the epg information is included among the various kinds of additional data that is separated by the demultiplexer under the control of the controller 90 . the user selector 70 can include a menu key provided in a wireless remote control and a key signal generator generating a key signal in response to a key stroke so as to perform a channel selection of the tv 100 , a selection of a priority of storage media and a selection of a reserve - recording function . here , the user selector 70 may include any one of a mouse , a keyboard , or the like , or may be included in a main body panel of the digital television 100 . the ui generator 80 generates an epg information table ( refer to fig3 ) for a ui selection menu that is used for the selection of a priority of the storage media and / or reserve - recording of broadcasting programs under the control of the controller 90 . the controller 90 receives a key signal from the user selector 70 and controls a corresponding function to be performed . the controller 90 is implemented by a microcomputer , a cpu and / or a processor . the controller 90 controls the ui generator 80 to produce a priority setting menu , if a priority setting function of the storage media is selected through the user selector 70 . the produced priority setting menu is synthesized in the scaler 25 together with a broadcasting signal which is currently being processed and displayed on the display unit 30 . a user can set up a priority for a desired sequence of storage media through the user selector 70 . the set up priority information is stored in the priority storage unit 61 under the control of the controller 90 . if an epg information display function is selected through the user selector 70 , the controller 90 reads the epg information stored in epg storage unit 65 and controls the ui generator 80 to produce an epg table . in the case that a reserve - recording function of the broadcasting programs is selected on the epg information table through the user selector 70 , the reservation information of the selected broadcasting programs is stored in the reservation information storage unit 63 . in the meantime , according to the reservation information stored in the reservation information storage unit 63 , the controller 90 controls a power source ( not shown ) to apply electrical power to the elements in the tv 100 , including the broadcasting receiver 10 and the signal processing unit 20 , that are necessary for the reserve - recording before the start time of the reserved program . the reserved program is the broadcasting program to be reserve - recorded . the controller 90 controls the reserved programs to be recorded in the storage media according to the start time and end time of the reserved programs and the priority set up in the priority storage unit 61 . here , if it is determined that the storage medium according to a highest priority has insufficient storage capacity or is not connected to the connection unit 40 , the controller 90 can control the reserved program to be recorded in a storage medium having the next highest priority . the more detailed description of the controller 90 will be described later . fig2 is a flowchart for establishing a priority for storage media according to an exemplary embodiment of the present invention . if a particular key on the remote control is manipulated ( s 100 ), and thus , if a corresponding key input signal is applied to the controller 90 in the tv 100 , the controller 90 controls the ui generator 80 to produce a settings menu of the tv 100 . the generated settings menu is synthesized with a broadcasting signal which is currently being processed in the scaler 25 , and is displayed on the display unit 30 ( s 101 ). if a user selects the reserve - recording function in the settings menu displayed on the display unit 30 ( s 102 ), the controller 90 controls the ui generator 80 to produce a menu for the reserve - recording function to be displayed on the display unit 30 according to a corresponding key input signal ( s 103 ). next , if a function of setting a storage medium is selected in the menu for reserve - recording through the user selector 70 ( s 104 ), the controller 90 controls the ui generator 80 to produce a list of the storage media to be displayed on the display unit 30 ( s 105 ). if selection of the priority of the storage media on the list is completed through the user selector 70 ( s 106 ), the controller 90 controls the priority information selected through the user selector 70 to be stored in the priority storage unit 61 ( s 107 ). in this manner , a user can establish the priority so that the reserved program can be stored in a desired storage medium . fig3 shows an epg information table illustrating a reserve - recording method of the tv 100 according to an exemplary embodiment of the present invention . the tv 100 according to the exemplary embodiment of the present invention can select a reserve - recording function using epg information . if a user selects an epg display function through the user selector 70 , information relating to broadcasting programs is indicated by hour and by channel in an epg information table as shown in fig3 . a user may select the reserve - recording of a desired program using the epg information table . if a desired program is selected through the user selector 70 and is subsequently selected as the reserve - recording program , the controller 90 controls the selected reservation program information to be stored in the reservation information storage unit 63 . accordingly , with the reservation information and priority information , the reserved program of the corresponding channel is reserve - recorded in the corresponding storage medium . fig4 is a flowchart view illustrating a control operation of the tv 100 performing a reserve - recording according to an exemplary embodiment of the present invention . if it becomes time to perform a reserve - recording of a corresponding reserved program ( s 200 ), components of tv 100 needed to perform the reserve - recording are automatically turned on ( s 201 ). here , the components of tv 100 needed to perform the reserve - recording can be set up to turn on several minutes before the start time of the reserved program . the controller 90 controls the storage media as well as the broadcasting receiver 10 and the signal processing unit 20 required to perform the reserve - recording . the controller 90 confirms the priority information of the storage media stored in the priority storage unit 61 ( s 202 ), to thereby check the storage medium of the highest priority . more specifically , the controller 90 determines whether or not a corresponding storage medium exists ( s 203 ). for example , in the case that the priority of the storage media is set up in the sequence of the built - in hdd 50 , the externally connected hdd 200 , and the vcr 300 , the controller 90 first determines whether or not the built - in hdd 50 exists ( s 203 ). if the built - in hdd 50 does not exist in the first priority , the controller 90 checks the storage medium of the next priority ( s 204 ). that is , the controller 90 sequentially determines whether or not the externally connected hdd 200 and the vcr 300 which are the next priority in succession , are connected to the connection unit 40 . here , in case of the externally connected hdd 200 , the controller 90 can communicate with the externally connected hdd 200 through an ieee 1394 interface . also , in case of the vcr 300 , the controller 90 can communicate with the vcr 300 through universal asynchronous receiver / transmitter ( uart ) communications such as rs - 232c . if the storage medium having the highest priority exists or is connected to the tv 100 , the controller 90 confirms whether or not the storage space is sufficient ( s 205 ). if the storage space is not sufficient , the controller 90 checks the storage space of the storage medium having the next highest priority ( s 204 ). in this manner , the controller 90 confirms whether or not the storage medium can perform the recording function according to the priority information which is stored in the priority storage unit 61 . the storage medium having the next highest priority performs the recording function if the storage medium having the higher priority car not perform the recording function . here , it can be confirmed whether or not the storage space in the storage medium is sufficient by estimating an amount of data for the reserved program from information on the playtime included in the epg information . if the storage space in the corresponding storage medium is sufficient ( s 205 ), the controller 90 controls the broadcasting receiver 10 to tune the corresponding reserved program and the signal processing unit 20 to process the tuned reserved program to then be recorded in the corresponding storage medium ( s 206 ). it is then determined if the reservation time haws ended ( s 207 ). meanwhile , the controller 90 receives broadcasting signals of the tuned channel and analyzes whether or not data output from the mpeg decoder 21 and the ntsc decoder 23 is effective , prior to be recorded on the storage medium . for digital broadcasting , the controller 90 analyzes the transport data stream output from the mpeg decoder 21 and then determines whether or not a video packet identifier ( pid ) and an audio pid match the reservation information . for analog broadcasting , the controller 90 checks whether or not the cvbs signal output from the ntsc decoder 23 has a normal synchronization signal ( sync ). if the controller 90 determines that the received channel broadcasting signal is normal , the received channel broadcasting signal is recorded in the corresponding storage medium according to the storage priority . for example , if the sequence of priority of the storage media is set up as the built - in hdd 50 , the externally connected hdd 200 , and the vcr 300 and the reserved program is a digital broadcast , the controller 90 controls the built - in hdd 50 to store the tuned reserved program . if the built - in hdd 50 does not have sufficient storage space , the controller 90 controls the externally connected hdd 200 to store the reserved program under the control of the externally connected hdd controller 41 . if the reserved program is an analog broadcast , the controller 90 controls the mpeg encoder 27 to convert the tuned reserved program into a digital signal to be stored in the built - in hdd 50 . if the built - in hdd 50 does not have sufficient storage space , the controller 90 controls the externally connected hdd 200 to store the reserved program under the control of the externally connected hdd controller 41 . accordingly , the storage medium is selected according to the priority and it is checked whether or not the storage medium can store a reserved program . as a result , the reserved program can be automatically recorded according to the storage priority , to thereby provide users with convenience . exemplary embodiments of the present invention can also be embodied as computer - readable codes on a computer - readable recording medium . the computer - readable recording medium is any data storage device that can store data which can thereafter be read by a computer system . examples of the computer - readable recording medium include , but are not limited to , read - only memory ( rom ), random - access memory ( ram ), cd - roms , magnetic tapes , floppy disks , optical data storage devices , and carrier waves ( such as data transmission through the internet via wired or wireless transmission paths ). the computer - readable recording medium can also be distributed over network - coupled computer systems so that the computer - readable code is stored and executed in a distributed fashion . also , functional programs , codes , and code segments for accomplishing the present invention can be easily construed as within the scope of the invention by programmers skilled in the art to which the present invention pertains . as described in the above , according to exemplary embodiments of the present invention , provided are the display apparatus and the control method in which a priority of storage media for reserve - recording is set in advance , and broadcasting programs to be reserve - recorded are selected and automatically recorded on a respective corresponding storage media . while certain exemplary embodiments of the invention has have been shown and described hereinwith reference to a certain preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims and their equivalents .	7
in accordance with the present invention , a physical layer serial data stream is first captured by a digital oscilloscope ( such as a lecroy ® x - stream based digital oscilloscope ). the captured data stream is then is analyzed by a protocol specific waveform decoder to create combined physical layer and data layer view for more complete interpretation of data and easy debugging of bus , communication , and other possible problems . the waveform decoder translates the captured data stream of the physical layer in to a sequence of bits ( 1 &# 39 ; s and 0 &# 39 ; s ) and groups the bits into the various parts of the message as defined by the specified protocol . the data bits can be viewed simultaneously with the original captured signal . as is shown in fig3 , a screen shot depicting an acquired and decoded data stream 310 is shown of a display 300 . multiple messages may be captured in a single acquisition . each message may include a separate id field . decoded data from these id fields is shown in fig3 at 320 . thus all of the data signal information for each message is depicted bunched up corresponding to each noted id information 320 . for example , physical layer data stream information corresponding to a message located at id 0x4bc is shown on display 300 bunched below a corresponding id label . once data for the various messages has been acquired , separated out and decoded according to the applicable protocol , decoded data ( from a single message ) can be viewed , along with the original captured signal . referring next to fig4 , a screen shot depicting such data corresponding to a single message is shown . a display 400 displays decoded data and original captured signal corresponding to id 0x4bc , noted above . shown in display 400 is a portion 410 of the original captured signal 310 corresponding to a selected message id ( in this case id 0x4bc ), as well as stuff bits 420 inserted into the data signal 410 . according to the protocol employed for decoding the data stream , different parts of the message are identified and differentiated , for example highlighted in different colors . of course , any other appropriate methods of delineating the portions of the decoded message may be employed . as shown in fig4 , the decoded message is divided into an id field 430 , a data length control ( dlc ) field 432 , a data field 435 , a crc checksum field 440 , and an acknowledge field 442 . while not shown , one embodiment displays the bit rate associated with each of the data messages . bit rate of a signal is an important measurement , and is used in many analysis tools . being shown the bit rate would allow a visual confirmation , and therefore notice of any deviation , from an intended bit rate . in addition to being able to view a single message displayed on the screen , a user may filter the messages based upon message id , and / or any data sequences within the signal . a data sequence will contain many messages . while paging through a sequence of data structures , stopping each time on a message having the desired id is possible , it is far more convenient for a user to view all messages that have a particular id , corresponding to a particular system event . in this way , the messages would be displayed adjacent each other , if desired , or shown in context of the data signal . the user could additionally , request that all messages including a particular sequence of data be shown . finally , upon filtering , instead of scrolling through each of the designated messages , a table could be displayed , indicating each portion of the signal that meets the filter criteria , and an indication of the locating thereof in the signal ( i . e . bit offset , time offset , etc .). traditionally , to determine whether a signal had reached a predetermined threshold , and was therefore considered a “ 1 ” or a “ 0 ”, the signal was looked at to determine whether it had crossed the threshold during the bit period . however , this results in a bias against the prior value . thus , if a value starts below a threshold , a single spike above the threshold would result in a determination that the bit value had changed . this would be true , even if for most of the bit period the value was below the threshold , and the spike was a result of noise . this would result in an error . therefore in accordance with the invention the value of the signal during the entire bit period is averaged . in such a manner , a single spike from noise would not result in an incorrect determination of the value at the bit period . while on display 400 , the averaging of the value during the bit period would avoid an error , a user could still view the signal associated with the bit period to see whether the shape of the waveform gives any clue as to why the signal spiked across the threshold . furthermore , analysis of the data stream in other ways is also possible . for example , once an average of each of the bit values has been determined , these values can be grouped as selected by a user , either in accordance with a parameter defined by a protocol , or any other desired bit sequence , to for a measurable value , which can then be graphed to show any drift in the value , or other patterns that might arise as a result of some systematic changes in the system . more information is available about the system , and can be viewed by a user as a trend graph , histogram , or results of a statistical analysis , perhaps to account for various changes in the signal . in any event , the accumulation of this data can be used in any number of ways , as desired by the user and implemented on a digital oscilloscope , to generate additional information regarding the consistency and / or integrity of the acquired signal . according to the protocol employed , or in accordance with another interpretation database , symbolic names that correspond to the data bits in the header and data parts of the message may be applied to the decoded data . thus , after decoding a particular bit sequence ( preferably in accordance with the averaging scheme noted above ), that bit sequence can be interpreted by any interpretation scheme that was applied during coding to determine a message that was encoded into the data . in this manner , the oscilloscope can use such a database or other interpretation scheme to translate the data bits into corresponding symbolic names and display them simultaneously with the original waveform . the database can be as simple as in the case of rs232 where it would contain the ascii code to map to each byte , or it can be complex to have different mapping for each field or sub field within the message . as noted above , a user could filter the symbolic results to view all messages in a data signal corresponding to a particular symbolic name . these results could also be shown in a table , as noted above . while this invention is applicable to any serial data communications standard , the initial embodiment of the invention is applied to canbus which is a serial data bus used in automotive applications . as a way to reduce costs and weight , improve emissions and efficiency , and meet consumer demand for convenience features , vehicles are becoming more laden with electronics . a typical vehicle electronics system ( with can and lin modules ) is shown generally at 500 in fig5 . the electronics system includes a canbus 510 , various sensors 520 and electronic control units ( ecu ) 530 for driving the various components and transmitting and receiving various data via bus 510 . with the increase in the complexity of the electronics systems in cars , the process of debugging errors in the system has similarly become more complicated . a debugger must currently use a dso to verify the functioning of the various system components , and debug “ modules ”, each including an ecu ( electronic control unit ) 530 , and various sensor inputs 520 . the complete module comprises a “ node ” on the electronic bus in the car . the module monitors the sensor inputs and serial data messages that are generated by the various portions of the module , and sends serial data messages generated in accordance with this data onto the bus . these transmitted serial data messages are received , interpreted and used by other modules in the system . more electronic features in the car means more “ nodes ” on the bus , and the growth of installed nodes tracks with the growth of automotive electronics , about 15 %/ year . it is essential for a debugger to measure timing between serial data messages on a signal bus and sensor signals received from various other nodes in the car to verify proper operation . if a particular module is not operating correctly , the debugger may need to investigate the functioning of the various systems in relation to the timing of the transmitted serial data signal . this will in turn require that the electronic test equipment be able to trigger on the serial data signal to understand what is happening before and after the portion of the signal around the trigger . due to the large number of signals present , a 4 - channel dso would therefore be desirable . once a module is installed in a vehicle , unforeseen interactions can occur with other modules or parts in the vehicle . module suppliers , or their end customer ( a car manufacturer ) may perform testing after the various modules have been assembled into a vehicle to debug “ system ” problems . this may require a visit by the module supplier a vehicle lot or other location where an assembled vehicle is available . a vehicle ( s ) may be driven around until a particular desired error or other signal occurs , at which point the dso must trigger on the signal , and capture the signal for extensive analysis . system debugging can take a significant amount of time and require a highly skilled debugger . in accordance with the invention , the can analysis sub - system supports four combinable functions : 1 ) trigger ( on message id and data ). 2 ) physical layer analysis ( bad bit detection , signal specs verification ). 3 ) can protocol decoding functions . 4 ) can symbolic interpretation functions . the system in accordance with the can bus embodiment of the invention consists of one or more software packages running on either multipurpose or dedicated test measurement equipment . a preferred embodiment would be to run the software on a multi - channel dso and a dedicated hardware platform including various inputs and underlying computing functions to support the trigger requirements of the system . the hardware package therefore preferably includes a serial hardware trigger . the hardware trigger interfaces with the dso , and the software packages implement the various user interfaces , drive the trigger module and the various analysis modules . the software and hardware interact in accordance with the invention allowing all common observations in accordance with the can protocol from the can bus . such a configuration is shown in fig1 . of course , other appropriate configurations , such as including the trigger hardware and software in a single dso unit may also be used . referring to fig1 , the preferred hardware design will now be described . fig1 shows an arrangement of a complete system 1700 constructed in accordance with a preferred embodiment invention when the system is set up for triggering on events occurring on a can bus and viewing the corresponding can analog signals as well as other signals . a can trigger unit 1710 is provided and includes an input port 1712 for receiving can bus data . unit 1710 further comprises a physical layer receiving module 1714 for receiving the can analog signal , and an evaluation module 1716 for evaluating the captured message . during evaluation , unit 1710 analyzes the input can signal , looking for any of a predefined number of trigger criteria . upon determination that an event in the can data has met one of the one or more predefined trigger criteria , a trigger signal is output from evaluation module 1716 of unit 1710 to an oscilloscope 1720 . a can probus adapter 1723 feeds the can trigger pulse output by can trigger unit 1710 into the oscilloscope 1720 . as is shown , oscilloscope 1720 may also receive directly the canbus signals on input ports 1722 and any other signals desired on input channels 1724 . the presence of the canprobus adapter 1723 identifies which input channel is to be used , and thus which input channel was the source of can trigger and allows automation of various related set - ups . upon receipt of a trigger from can trigger unit 1710 , oscilloscope 1720 marks the corresponding portion of the input can signal , and preferably annotates the type of trigger condition that resulted in the trigger , if desired . this portion of the can signal ( if not the entire signal ) is then stored for later review by a user . in addition to viewing the can signal , any other signals can be viewed while triggering on can , which is one of the benefits of the invention . some users will not always want to view the can signal in a particular case , but rather will trigger on the can signal while viewing some other correlated signals of interest to the user . thus , the user can easily determine the effect of a particular trigger condition occurring on the can bus may have on those other correlated signal . in an alternate embodiment , the can trigger is input via an external trigger input and four other signals can be viewed , each on one channel of a four channel dso . referring next to fig1 , a general software design construction of the system in accordance with a preferred embodiment of the invention will now be described . the can analyser of the invention is implemented by providing a software can manager , indicated generally at 1800 , to a manager &# 39 ; s collection of control software on a digital sampling oscilloscope ( dso ). three executives ( control programs ) are included , a can src executive , a can waveform / protocol decode executive 1840 and a badbit locator executive 1870 . as is shown in fig1 , canbus data is received by one or more channels 1802 , corresponding to channels input at input ports 1722 of fig1 . can src executive 1810 receives the input canbus data and performs various functional processing of the data to generate a processed data signal in accordance with the received analog data signal . this generated digital data stream is first passed to a trace renderer 1820 to be displayed on a screen , along with the other generated display information , as will be described below . a measure manager 1890 also receives the generated digital data stream from can src executive 1810 and controls which measurements are to be computed and displayed . thus data input thereto is measured in accordance with various desired computations , and the results are displayed by parameter renderer 1892 . a badbit executive 1870 receives the data signals from can src executive 1810 in response to one or more trigger events . as will now be described , this badbit executive 1870 contains the necessary controls for implementing the ability to locate bad bits in a data signal . the input to bad bit executive is the output from the can src executive 1810 . in accordance with the invention , the timing of the badbit executive 1870 must be time aligned with the can trace ( output of can src executive .) a can tie ( time interval error ) unit 1872 measures the variation of the standard tie component that is immune to inter - message gaps . the algorithm utilized by unit 1872 resynchronises to the nominal bit rate at the beginning of each can message because the messages are emitted asynchronously onto the can bus . the ties are then fed into a track component 1874 in order to view their distribution , time aligned with the source trace . a mask compare unit 1878 then compares the calculated tie to a predetermined mask 1876 to determine if the tie measurements are out of specification . in order to facilitate viewing , a trace renderer 1880 generates a display of the tie data received from track component 1874 , the tolerance mask 1876 is displayed by a mask renderer 1882 based upon display information generated by mask compare unit 1878 , and a cursor is displayed by cursor renderer 1884 based upon cursor information also provided from mask compare unit 1878 , with violation markers displayed thereon . the tolerance mask width is controlled by a user selection as a percentage of the nominal bit rate . time interval errors exceeding the predefined tolerance will appear as spikes outside the mask . in a preferred embodiment , on very poor signals , the maximum number of violation markers will be limited to 200 so that a user may still properly interpret the information . referring once again to fig1 , can waveform decode executive 1840 receives the output from can src executive 1810 . a can slicer component 1842 of can waveform decode executive 1840 decomposes the can data stream into packets , one packet for each message . the can slicer component implements a pll to properly recover the clock for the data signal and properly time the phase of the pll with the start of each data packet . this method of synchronizing an analog signal of a serial data stream may be implemented in accordance with the method and apparatus described in co - pending and commonly - owned u . s . application ser . no . 10 / 673 , 735 , filed sep . 29 , 2003 , entitled “ method and apparatus for analyzing serial data streams ”, the entire contents of which are incorporated herein by reference . the algorithm employed by the slicer scans the waveform , looking for the packets and any spaces separating them . then each can message segment ( or packet ) can be submitted to an analog nrz to digital converter 1844 because the data within the packet is now guaranteed to be nrz . this component converts the analogue data into a logical bit vector , with associated bit times . the conversion relies on the nominal bit rate , the transition level between 0 and 1 and the sample point within the bit . the user may select all these values , but the defaults are preferably set to 125 kbits , 50 % level , 50 % sampling point . a typical frame message including an 11 bit identifier in accordance with invention may 154 bits . an example of the bits and their definitions may be as follows . a can decoder 1846 receives all of the packets digitized by the analog nrz to digital converter 1844 , each containing a raw bit vector with associated bit times , and processes them , one message at a time . the can decoder 1846 primarily extracts the id and data information , but it also verifies the coherency of the message ( stuff error , crc errors , dlc incoherent with data length , form error , no acknowledgement ). at this stage , there is no longer any analogue information in the processed data signal . the algorithm in can decoder 1846 starts by removing the stuff bits inserted by the can chip when the signal was emitted . the algorithm then computes the crc on the message . then the message is determined to include an 11 bit id or 29 bit id . the id is then extracted , as well as the dlc , the data bytes and the crc . the extracted crc is compared against the computed crc . all of this information , as well as the possible errors are wrapped into a structure containing the raw bit vector , the raw bit times and the decoded message , further including the packet type , the packet id , the number of data bytes , the actual data , the checksum data , and the state of the acknowledge field . finally a can annotator 1848 uses the information contained in the structures described above to annotate the waveform displayed on screen , according to the user selected viewing criteria . the annotator uses the basic primitives to annotate by providing information for cursors and labels . the annotation elements are positioned onto the trace by using the bit time array , converted into pixel positions . the following table 1 governs the preferable colors ( of course other types of designations are possible ). in accordance with the invention , once the digital information has been decoded into hexid information by can waveform decoder 1846 , a protocol decode executive 1850 may be employed to further interpret the decoded information , to convert it from a hex format into various more easily understood symbols in accordance with definitions in the applied encoding protocol . the protocol decode executive 1850 allows the selection of a database corresponding to the protocol of the decoded data needed for the analog signal received . the protocol decoder receives the output of the can waveform decoder 1846 , and transforms the hex id into a symbol . when the protocol database is in use , two noticeable things happen : the trigger can be set using symbols and the decoding shows symbols . the interpreted data is then forwarded to a can protocol renderer 1852 to be displayed in the screen with the other displayed information . the user is able to control the compound processing chain from a single point in the system . some of the controls that are accessible to the user act upon the source choice for input data , some upon the bit extractor ( level and sample point ) that allow the user to customize the analysis performed by the system , some upon the viewing characteristics of the signal ( view group ). these features will now be described in greater detail . can manager 1800 offers a set of dialogs to a user , from which various can analysis actions of the invention can be controlled . these dialogs will be described below . because of the modularity of the software functions , these dialogs may be updated and supplemented as desired , either by addition of the functionality , or by the user voluntarily choosing a different software package for implementation . in accordance with the invention , the can software sub - system is implemented via a graphical user interface ( gui ) on a dedicated hardware platform , of running on a pre - existing dso . the gui includes a number of dialogs for defining and performing various analysis functions in accordance with the invention . an example of a first of these dialogs is shown in fig6 . upon implementation of a can analysis routine as selected by a user , in accordance with an embodiment of the invention , a can analysis dialog is opened ( see fig6 ). initially the dialog shows 2 tabs allowing for selection between them by a user , can analysis tab 610 and can trace tab 710 . ( as the various dialogs are selected , more tabs will appear , including the following : source selection , the physical layer analysis , waveform decode , protocol decode and pattern search ). upon selection of can analysis tab 610 , a user is presented with a number of selections to define the analysis that is to be performed on an acquired waveform . thus , a user is presented with a number of analysis options 620 ( including decode , monitor , physical analysis , pattern search , generator , and is also provided with analysis setup options 630 which allows for setting various bit rates , threshold levels for distinguishing between bits , and the like . a can trigger , may also be accessed via a short cut button 640 on can analysis tab 610 . upon selection of a can trace tab 710 , a user is presented with a plurality of selections for setting the various display and interpretation functions for the incoming can data signal . thus , a user may turn the display of the trace function on by selecting the radio button 715 , and select the source that is being analyzed by the system at source type selection 720 ( such as an h signal , l signal , or the difference between these signals ). the user is also invited to define various parameters for the display of the can trace on a screen at zoom section 730 . typically the functions described with respect to fig6 and 7 would be set up before signal acquisition , but of course these menus could be accessed at any time to modify the various settings . while using the analysis system in accordance with the invention , it is contemplated that the user regularly switches between the can trigger menu , the various waveform decode dialog tabs and the regular functions of the dso , as will be described below . the user would normally set - up the can trigger conditions for the events that are to be captured . then , either before or after the waveform is captured , the user would setup the waveform decoding features of the invention to observe message content and other predefined conditions of the waveform , before and after a defined trigger point . users may be using the analysis system of the invention to look for pathology in a message content caused by distorted , noisy and / or misaligned signals . thus , the system would be set up to trigger on various error conditions , or other predefined signal irregularities . in accordance with the invention , subsequent review of the waveform corresponding to an error in the decoded information is easily implemented , because when a waveform labeling function is activated , messages interpreted from the decoded data in the waveform are labeled and “ hooked ” to the waveform . all types of messages defined in the can specs are identified ( data , remote , error and overload ). each time a message is interpreted , the message is hooked to the waveform ( as noted above ) so that upon review of the waveform , a user can view all of the interpreted messages , along with the digital data and underlying received waveform associated with the interpreted message . when a message is beyond recognition ( bad bit definition , undershoot , spikes , incorrect stuff bits ) for the can decoder because the analog waveform is too distorted and / or corrupted , an icon indicating that the message was not recognized as one of the predefined messages will be used , as is shown in fig1 . fig1 depicts a display 1300 including a data signal 1310 , and a portion 1320 of signal 1310 which when decoded from the analog data signal in accordance with the applicable protocol , generates an unrecognized bit sequence . thus , the display attaches a label “ undefined error ” to indicate that the bit sequence is not recognized . thus , a trigger request can be defined in accordance with a particular data sequence in the digital data , or can be defined to trigger on an unrecognizable data sequence . from the can analysis tab 610 a user may select a can trigger button 640 , which will bring the user to a can trigger module ui dialog , as shown in fig8 . the can trigger tab 810 allows a user to access the can trigger setup , allowing for simple or advanced features to be selected . if a user selects the simple button 820 , the user can set the trigger to operate by finding a single can message , preferably by a message id . the canprobus adapter will automatically detect on which dso channel the can trigger is input . the trigger condition may be only on the can id , only on the data , or any combination of both . alternately , when the advanced capability is present and selected at button 830 ( see fig9 ), the user can set the trigger using symbolic names , or combinatorial logic on various id , data and other fields present in the message . the symbolic info translates the message id into text like vehicle_speed , and the data into physical values i . e 12 m / s so that the user can employ more user - friendly terms in order to define the events to be reviewed . in accordance with the invention , a user is able to visualize the content of the can signal , with different levels of detail , in a format that is appropriate for the user in a particular application . for example , the output may be displayed in hexadecimal , ascii , or the like . the precise methods for defining the various display and selection parameters will be discussed below . as is shown in fig1 , when displaying many can messages 1010 a - 1010 g within one screen , an overview of the can stream 1005 is first displayed . each message includes the message id above the packet including the message when the packet is healthy . an error designation , and preferably , a recognizable icon , flags one or more sick messages ( see 1010 d for example ). when zooming on those flagged messages , a user is able to see the underlying analog data signal that is the cause of the incoherent message . various labels , indicating various interpreted messages , portions of the signal , etc . are attached to the first edge of a corresponding packet and float along with the packet when the gain or offset for viewing the signal is changed . the regular time cursors ( grid ) shown in fig1 can also be used to measure absolute time and time intervals between events of interest . the events of interest can be on different waveforms . for example , if the time delay between a temperature sensor change and its broadcast on the can bus is desired to be reviewed , the reference cursor may be positioned on the temperature sensor read out , and the difference cursor on the corresponding can message identified by its id . if the delay between a query to a can node and its reply is desired , the cursors can be positioned on the remote and data frame , both on the analog can signal . when zooming onto a decoded can waveform , more details of the particular waveform will be shown . fig1 shows a zooming in on message containing annotated fields main fields 1110 . stuff bits 1120 and crc checksum bits 1130 are delineated in some desired manner , such as by making them a different color , or the like . fig1 depicts zooming in on a particular error message , such as 1010 d of fig1 fig1 includes similar fields as those shown in fig1 . the annotation behavior described above is governed by the concept of annotation density . the annotation density represents the total number of annotations displayed on the signal ( text , icons , arrows , and color - coded sections ) per screen . at any given zoom factor and taking into account the user selectable viewing items , the annotation density should not exceed a certain predefined threshold limit . in order to present a display with a reasonable amount of information , the total volume of annotation at any given zoom factor should be limited . the determination of which annotations to remove when necessary ( i . e ., when a display is zoomed out ) is generally governed by the importance of each of the annotations . for example , when showing 500 can messages on screen , only a colored strip may appear . it would be impractical to show every message &# 39 ; s id . therefore only error messages , which are the most important to the user when taking a wide overview of the bus , should be displayed . in fig6 at can analysis tab 610 , if a user selects the decode analysis option from the analysis options 620 , a can waveform decode ui dialog is opened , as is shown generally at 1150 in fig1 . this dialog implements the waveform decode executive 1840 of fig1 . as is shown in fig1 , the user can select various portions of the decoded waveform to be displayed . by selecting one or more radio buttons from show annotation section 1160 , the user can display stuff bits , id information , decoded data , crc data and acknowledgement data . during signal acquisition , it may be desirable to determine the integrity of the acquired data signal . in accordance with the invention , the user is presented with a can physical layer bad bits locator , and associated measurement tools ui dialog , as will be described below . this dialog module comprises a physical layer verification module and is made up of two parts , a bad bit locator ( implementing the badbit executive 1870 of fig1 ) and a general signal measurement tool implementing measure manager 1890 of fig1 . both tools may be turned on from main can tab 610 , using the tick boxes in the analysis options section of the dialog . when accessing the various measurement tools , when this view is selected , the can manager automatically turns on various measurements that enable a user to measure the various signal amplitudes , time variations between bits within a packet , and timing variations between various packets . when utilizing the badbit locator , the can manager automatically sets up the processing chain needed to identify bad bits , one of the biggest worries of hardware engineers working on can . a dedicated bad bit tab allows the setting of a few parameters as is further desired . both physical layer analysis tools operate on the source data stream selected in fig7 . the raw data ( canh and canl ) can optionally be displayed by ticking the “ trace on ” selection 715 of fig7 . referring next to fig1 , a screen shot depicting the results of use of the bad bits locator tool is shown . the badbits locator shows , on a display 1410 , a can trace 1420 ( designated the can signal ), and a badbit trace 1430 , both being drawn by trace rendered 1880 of fig1 . the badbit trace is indicative of the time interval error of the various bits of can trace 1420 . both traces are time aligned . a bad bit in can is a bit whose observed width is not within a user specified tolerance of the nominal bit width of a standard bit on the can bus . this bad bit appears in the badbit trace 1430 as a spike outside the normal value of the trace . the bad bit in can trace 1420 is time aligned with the spike on badbit trace 1430 so it is easy to pinpoint the portion of the can trace generating the bad bit , and to zoom onto the can trace to more closely examine the portion generating the bad bit reading . a mask 1440 ( implementing mask 1876 , mask compare 1878 , and mask renderer 1882 of fig1 ) around badbit trace 1430 assists in locating the bad bits , with circles 1450 showing actual mask violations . the vertical mask tolerance ( vertical width of the mask , and deviation of the mask from a center , average value ) reflects the user &# 39 ; s expressed tolerance for bad bits on his can signal . for example , when working on a 100 kbit / second can line , the bit width is 10 μs . if the user specifies a 10 % tolerance on the bit timing , the mask width has to be set to 10 % of 10 μs , therefore 1 μs . when zooming into the waveform , the user can observe the bad bits in more details , while retaining the bad bit locator time aligned with the can trace . the zoom function maintains the can trace and the badbit trace time aligned . these parameters , such as bad bit tolerance and zoom are set using a dialog box depicted in fig1 . as is shown , by selecting a signal integrity tab 1510 , a user can access the setup menu 1520 to set the bit timing tolerance , the measurements menu 1530 to select the measurement setup sub - menu to make various measurements on the waveform , and the view menu 1540 to define whether the timing reference level and / or the bit mask should be shown on the display . the user may also select from a number of buttons for storing data and menu selections , automatically selecting a scale of the display , and the like . also shown in fig1 , the user may select the zoom tab 1550 to implement various zoom features on the display of the traces to allow for a more detailed view thereof , as discussed above . in addition to decoding the acquired analog signal into digital representations thereof , as noted above , the user can request that the decoded data be interpreted into various can messages , thus implementing the can protocol decoder 1850 of fig1 . in accordance with the invention , the can protocol decode module allows performance of this function , as is shown in fig1 . therefore , as noted with respect to fig1 , this module goes one step further than the waveform decode module by interpreting and showing the symbolic can messages instead of the decoded hexadecimal values . for example , instead of showing “ id = 0x123 , data byte 2 = 0x78 ” the display may read “ vehicle_speed = 1 . 2 m / s ”. as is shown in fig1 , upon selection of a protocol decode tab 1610 the user is first able to indicate the protocol file 1620 that is to be used in interpreting the decoded digital data . additionally , at section 1630 the user is able to request some choices to govern the symbolic annotation level and thus define what is shown in the display , including symbolic ids , physical data and physical units , and the density of the annotation on various zoomed traces . therefore , in accordance with the invention , a user is able to capture an analog waveform representative of a digital information signal , and decode the analog waveform to generate digital data . any errors in the digital data ( or analog data , if desired ) will generate a trigger in the detector , thus associating the digital data with the error to a particular portion of the underlying information signal . the user is then able to view the portion of the analog signal that generated the digital error . in the use of a canbus system , the invention allows for a user to monitor canbus messages , and upon the occurrence of a particular predetermined event , view wither the data on the canbus , or the reaction of other parameters to the situation that generated the trigger condition . thus , a complex analysis that conventionally required a great number of calculations by a user can be performed relatively simply and efficiently . it will thus be seen that the objects set forth above , among those made apparent from the preceding description , are efficiently attained and , because certain changes may be made in carrying out the above method and in the construction ( s ) set forth without departing from the spirit and scope of the invention , it is intended that all matter contained in the above description and shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described and all statements of the scope of the invention which , as a matter of language , might be said to fall therebetween .	6
by way of example an application in the field of automotive electronics is described . in the present application a system of up to 30 stations forms a network , each of the individual stations performing different security - related tasks , while the entire system should be optimized with respect to its power consumption so as to ensure that the battery of the on - board power supply is not drained excessively even in the case of comparatively long parking periods . the secure operation is achieved by the reliable operation of the station and by its well - defined default behavior in the case of faults . for this purpose , each station employs an integrated element whose basic elements include a watchdog , two supply voltages and a signal converter . as a first measure the control signals of the individual elements on the integrated circuit are linked to one another so as to allow only the seven operating conditions of a complete station which are required for the application , three of the seven operating conditions being modes of operation for the application : as required by the application , the stations change over between normal operation and power - saving operation or standby operation , the change - over to normal operation being faster and the power saving being smaller in the standby mode than in the power - saving mode . the reduction of the possible operating conditions is achieved in that the individual elements can be set only jointly to another operating condition by means of a single serial code word from the microcontroller to the integrated circuit . the linkage enables the optimum default behavior for the application to be determined and a self - contained default behavior to be established even in the case of a continuously malfunctioning microcontroller . fig1 is a block diagram of a station in accordance with the invention . this station includes an integrated circuit 10 comprising some elements to be described hereinafter , and a microcontroller 40 connected to the integrated circuit 10 and also constructed as an integrated circuit in the customary manner . via a connection 41 the microcontroller 40 controls peripheral circuits 42 , which depend on the application and which may include , for example , switches for loads of comparatively high power . the integrated circuit 10 is further connected to a bus 6 , to which further stations are connected , and has an input 7 via which so - called wake - up requests are applied , which issue for example from manually operated switches or from sensors . via a terminal 9 the integrated circuit 10 receives an operating voltage which is higher than that required for the power supply of the microcontroller 40 , the peripheral circuit 42 and given elements of the integrated circuit 10 . the supply voltage vb is applied to two voltage regulators 12 and 14 to derive the lower supply voltage for the relevant circuits . the voltage regulator 12 generates a voltage v1 , which is only applied to the microcontroller 40 via a line 13 . the voltage regulator 14 generates a voltage v2 , which is applied to a transmit - receive circuit 20 within he integrated circuit 10 and also to the peripheral circuit 42 . the voltage regulators 12 and 14 can be turned off individually or jointly by a monitoring circuit 22 via the line 23 . the integrated circuit 10 further includes an oscillator 18 , which controls a watchdog timing circuit 16 . the watchdog can alternatively be arranged outside the integrated circuit 10 , preferably in the microcontroller . moreover , there has been provided an interface circuit 28 , which receives control words from the microcontroller 40 or which specifically transmits status words . a reset control circuit 24 generates a reset signal or an interrupt signal for the microcontroller 40 on the line 25 or it receives from this microcontroller a restart signal , which restarts the monitoring period . a circuit 26 converts the wake - up signals received via the input 7 or from the transmit - receive circuit 20 into control signals for the control circuit 24 . the watchdog 16 is connected to the interface circuit 28 via the connection 17c to enable it to be set to given monitoring periods by control words from the microcontroller 40 and to enable the settings of the monitoring periods and , if applicable , any further conditions to be reported to the microcontroller . furthermore , the watchdog circuit 16 is connected to the control circuit 24 via a connection 17a in order to transmit to this circuit reset signals or interrupt signals for the microcontroller 40 or in order to receive a restart signal from the microcontroller . moreover , the watchdog circuit 16 is connected to the monitoring circuit 22 via a connection 17b in order to turn on or turn off the voltage regulators 12 and 14 via this monitoring circuit . in addition , the interface circuit 28 is connected to the monitoring circuit 22 so as to allow the voltage regulators 12 and 14 to be also turned off by control signals from the microcontroller 40 . the monitoring circuit 22 monitors the non - regulated input voltage and can thus detect whether the voltage has been doubled by &# 34 ; jump - starting &# 34 ; and application - related elements should be protected by disabling them . moreover , the monitoring circuit detects the loss of the input voltage by means of the attendant sudden voltage drop , as a result of which the station still can store any volatile data and terminate the program in a sensible manner , a local energy buffer providing the power supply to the station for the last - mentioned operations before a final loss of the supply voltage . furthermore , the monitoring circuit can detect a temporary drop in the input voltage as a result of overloading , for example when the engine is started , so that the station can turn off application - related loads in order to spare the battery . the transmit - receive circuit 20 is connected to the microcontroller 40 via a connection 21 to supply the data received from the bus to the microcontroller or to receive the data transmitted by the latter . the elements 16 , 18 , 22 , 24 and 26 are essentially powered with the supply voltage vb , so that they are constantly active , even when the voltage regulators 12 and 14 are inoperative . fig2 to 4 graphically represent the operating conditions , where v1 represents the supply voltage for the microcontroller and v2 the supply voltage for the periphery and the signal converter and can be turned on and turned off . in normal operation the signal converter ( sf ) can transmit and receive serial data and in its power - saving mode ( standby ) it can only receive wake - up requests . moreover , the signal converter can present a high impedance with respect to the lines to other stations in the system . in normal operation the watchdog ( wd ) has short periods for software monitoring as well as long and very long periods for the cyclic wake - up of the station from the standby mode and the power - saving mode , respectively . moreover , the watchdog monitors the microcontroller after a reset ( starting ). in this embodiment the various self - monitoring functions , warning functions and reset sources are divided into warning functions by means of interrupts when the microcontroller is not impaired in its program execution , for example and default functions through reset when the microcontroller operation is impaired temporarily , for example in the case of unanswered warm start , for example as wake - up , and autonomous microcontroller - independent permanent default operation in the case of microcontroller failure , for example in the case of persistent incorrect supply voltage at the microcontroller , unanswered cold or warm start of the microcontroller , overtemperature cut - out ( protection against self - destruction of the integrated components ). 50 mode change ; only in nb , bb and sb by the microcontroller , 52 bb with v1 on , v2 on / off , sf standby , wd long / off , 53 sb with v1 off , v2 off , sf standby , wd very long / off , 54 ws with v1 on , v2 as before , sf as before , wd starting for reset pulses , 55 ks with v1 on , v2 off , sf = standby , wd starting , reset = v1 controlled ( for wdh . -& gt ; pulse ), 56 ur with v1 off , v2 off , sf in high - impedance state , wd off , 62 int masked wake - up requirement ( if wake - up requests are neither int masked nor reset masked : default to reset ), in fig3 the following state number in addition has the meaning 72 no wake - up request for a long time or overtemperature cut - out , 73 wake - up request ( if previous state &# 34 ; ks &# 34 ;) or overtemperature protection no longer necessary . in fig4 the following state number in addition has the meaning 50a change of mode , the microcontroller itself being capable of selecting an arbitrary default behavior , 74 masked interrupts : errors in sf , v2 undervoltage , jump start , overtemperature warning , interrupt at terminal 30 , in all the figures the references have the following means scw serial code word for selection of the mode of operation and triggering of the wd ,	6
now referring to fig1 fig1 shows a perspective view of one example of a multi - ply assembly 100 of the present invention . multi - ply assembly 100 is comprised of a plurality of plies 112 . plies 112 are advantageously fabricated from thermoplastic prepreg material 110 , wherein thermoplastic prepreg material 110 is comprised of a plurality of carbon fibers 102 and thermoplastic resin 104 . further , plies 112 are cut and stacked to form a first layer 120 and a second layer 130 of multi - ply assembly 100 . plies 112 of first layer 120 are cut and placed so that carbon fibers 102 align along a warp direction 122 , wherein warp direction 122 is oriented at zero degrees with respect to multi - ply assembly 100 . plies 112 of second layer 130 are cut and placed so that carbon fibers 102 align along a non - warp direction 132 , herein non - warp direction 132 runs parallel to ply seams 134 . those skilled in the art , having the benefit of this disclosure , will understand non - warp direction 132 may be oriented at substantially any angle within a range of angles relative to warp direction 122 depending on the structural requirements of the object under construction . for example , the non - warp direction may be offset from the warp direction at 45 °, 30 °, 135 °, or 120 °. such offsets are known to be useful in the construction of composite sabot parts . structural requirements and the design of the desired composite part advantageously determine the angle selected . spot welds 136 are advantageously placed substantially equidistant from and on either side of ply seams 134 . by advantageously placing spot welds 136 along ply seams 134 , and therefore along non - warp direction 132 , multi - ply assembly 100 is held together with substantially no warping or undulations and may be cut by conventional cutting methods . now referring to fig2 a , fig2 a shows a cross - sectional side view of one example of a first means for welding 200 . first means for welding 200 is shown above multi - ply assembly 100 , as first means for welding 200 forms spot welds 136 ( shown in fig1 ) on multi - ply assembly 100 . first means for welding 200 is comprised of a first pressure cylinder 210 attached to a weld housing 220 . weld housing 220 contains a plurality of welding tips 224 , wherein welding tips 224 are mounted to and heated by a plurality of electric heaters 222 . weld housing 220 is insulated from electric heaters 222 by insulation 228 . welding tips 224 are conical in shape and are advantageously tapered to welding ends 223 to concentrate heat from electric heaters 222 to welding ends 223 . by concentrating the heat to welding ends 223 , welding contact time , or more commonly welding &# 34 ; cycle time &# 34 ;, between welding tips 224 and thermoplastic prepreg material 110 of multi - ply assembly 100 is reduced . reducing cycle time still allows first layer 120 and second layer 130 to bond ; however , less heat is transferred through thermoplastic prepreg material 110 , which substantially eliminates warping and undulation around spot welds 136 ( shown in fig1 ). in use , multi - ply assembly 100 is placed on a non - thermal transferring substrate 230 , such as wood or firebrick . substrate 230 further reduces warping and undulation by thermally insulating multi - ply assembling 100 during welding and by not adhering to multiply assembly 100 after welding . cycle time , welding temperature , and welding pressure are controlled by a means for controlling 240 . means for controlling 240 may comprise a conventional controller , for example , including a personal computer or the like . the means for controlling may advantageously include conventional input devices such as a keyboard and mouse . the means for controlling 240 may alternatively comprise conventional electronics mounted within a control panel having manual or automatic controls as desired for controlling system parameters such as , for example , welding period , pressure , temperature and other system parameters . another alternative for control means 240 may advantageously be a numerically encoded control system . such controls may be designed using standard engineering design techniques . in the example embodiment , means for controlling 240 is in communication with first pressure cylinder 210 to control cycle time and welding pressure . means for controlling 240 also controls electric heaters 222 to control welding temperature . in one useful embodiment , temperatures for electric heaters 222 that heat welding tips 224 , range from 350 degrees fahrenheit to 800 degrees fahrenheit . now referring to fig2 a and 2b , fig2 b is a bottom view of one example of first means for welding 200 using welding tips 224 of the present invention taken generally along line 2b -- 2b of fig2 a . as in fig2 a , welding tips 224 are mounted to and heated by electric heaters 222 . welding tips 224 taper to welding ends 223 to advantageously concentrate the heat from electric heaters 222 to welding ends 223 . now referring to fig2 a , 2b , and 2c , fig2 c is a bottom view of an alternative example of first means for welding 200 using a plurality of hollow welding tips 226 of the present invention . hollow welding tips 226 are mounted to and heated by electric heaters 222 . hollow welding tips 226 taper to hollow welding ends 225 to advantageously concentrate the heat from electric heaters 222 . additionally , hollow - welding tips 226 advantageously have hollow centers 227 that extend into hollow welding tips 226 . hollow welding ends 225 advantageously contact a smaller area of thermoplastic prepreg material 110 of multi - ply assembly 100 than welding ends 223 of welding tips 224 . reducing the amount of thermoplastic prepreg material 110 subject to heat still allows first layer 120 and second layer 130 to bond during the welding cycle . however , less heat is transferred through thermoplastic prepreg material 110 , which further eliminates warping and undulation around spot welds 136 ( shown in fig1 ). now referring to fig3 fig3 shows a side view of one example of a second means for welding 300 . second means for welding 300 has a second pressure cylinder 302 mounted to a top platen 310 . top platen 310 travels vertically along a plurality of guides 304 to a bottom platen 320 . both top platen 310 and bottom platen 320 are electrically heated in a range from 350 degrees fahrenheit to 800 degrees fahrenheit . a plurality of heat pins 360 , comprising a plurality of bottom heat pins 362 and a plurality of top heat pins 364 , are mounted to top platen 310 and bottom platen 320 , respectively . heat transfers from top platen 310 to top heat pins 364 and from bottom platen 320 to bottom heat pins 362 . top heat pins 364 and bottom heat pins 362 simultaneously weld a top multi - ply assembly 330 and a bottom multi - ply assembly 340 into a layup 350 . by welding top multi - ply assembly 330 and bottom multi - ply assembly 340 simultaneously , the welding cycle time is reduced and less heat is transferred to thermoplastic prepreg material 110 of layup 350 . thus , layup 350 is held together with substantially no warping or undulations and may be cut by conventional cutting methods . cycle time , welding temperature , and welding pressure are controlled by means for controlling 540 . means for controlling 540 may advantageously be built similarly to means for controlling 240 described above . means for controlling 540 is in communication with second pressure cylinder 302 to control cycle time and welding pressure , and means for controlling 540 is in communication with top platen 310 and bottom platen 320 to control welding temperature . now referring to fig4 a , fig4 a is a bottom view of one example of top platen 310 of the present invention taken generally along line 4a -- 4a of fig3 . top platen 310 has heat pins 360 . now referring to fig4 b , fig4 b is a partial detailed view of one example of heat pins 360 of the present invention as depicted in fig4 a . heat pins 360 are mounted to top platen 310 . heat pins 360 comprise a plurality of circular heat pins 410 , a plurality of rectangular heat pins 420 , a plurality of triangular indexing pins 430 , and a plurality of square indexing pins 440 . circular heat pins 410 , rectangular heat pins 420 , triangular indexing pins 430 , and square indexing pins 440 have circular hollow centers 412 , rectangular hollow centers 422 , triangular hollow centers 432 , and square hollow centers 442 , respectively , to reduce the amount of thermoplastic prepreg material 110 ( shown in fig3 ) subject to heat during welding . reducing the amount of thermoplastic prepreg material 110 subject to heat still allows top multi - ply assembly 310 and bottom multi - ply assembly 320 ( shown in fig3 ) to bond during the welding cycle . however , less heat is transferred through thermoplastic prepreg material 110 , which further eliminates warping and undulation of layup 350 ( shown in fig3 ). now referring to fig5 and 6 , fig5 is a top view of one example of layup 350 of the present invention taken generally along line 5 -- 5 of fig3 . layup 350 is overlaid with a layup pattern 500 . layup pattern 500 is comprised of a plurality of thermoplastic prepreg segments 510 , wherein thermoplastic prepreg segments 510 are cut from layup 350 and assembled into a kit 600 . as thermoplastic prepreg segments 510 are placed into kit 600 , thermoplastic prepreg segments 510 are welded at first weld point 610 to kit 600 at second weld point 612 . thermoplastic prepreg segments 510 are held together after being cut from layup 350 by welds from heat pins 360 ( shown in fig4 b ) as indicated by a plurality of weld marks 520 . weld marks 520 comprise a plurality of circular weld marks 522 , a plurality of rectangular weld marks 524 , a plurality of triangular indexing marks 526 , and a plurality of square indexing marks 528 made by heat pins 360 . moreover , layup 350 is large enough for two substantially identical kits 600 to be assembled from thermoplastic prepreg segments 510 . thus , thermoplastic prepreg segments 510 are divided into a plurality of left thermoplastic prepreg segments 512 and a plurality of right thermoplastic prepreg segments 514 . left thermoplastic prepreg segments 512 are marked with square indexing marks 528 , but not triangular indexing marks 526 and right thermoplastic prepreg segments 514 are marked with triangular indexing marks 526 , but not square indexing marks 528 . after being cut from layup 350 , thermoplastic prepreg segments 510 are separated into left thermoplastic prepreg segments 512 and right thermoplastic prepreg segments 514 according to whether thermoplastic prepreg segments 510 have square indexing marks 528 or triangular indexing marks 526 . the left and right thermoplastic prepreg segments may advantageously be laid out in a symmetrical pattern on the layup . the respective indexing marks identify the pieces during assembly . thus the indexing marks facilitate assembly , decrease assembly time , and reduce erroneous mix and matching of pieces between the left and right kits or wedges . in one example of the invention , a thermoplastic prepreg panel patterned for use in a composite sabot was welded along the pattern shown in fig5 . the pattern shown comprises a thermal thermoplastic prepreg having 2 layers with 2 plies of varying orientations in each layer . the welding temperature was controlled in a range from 700 to 800 degrees . the welding cycle time was 15 seconds per cycle , and welding pressure was controlled in a range from 150 to 175 psi . it will be understood that this example is by way of illustration only and not by way of limitation of the present invention . the invention has been described herein in considerable detail in order to comply with the patent statutes and to provide those skilled in the art with the information needed to apply the novel principles of the present invention , and to construct and use such exemplary and specialized components as are required . however , it is to be understood that the invention may be carried out by specifically different equipment and devices , and that various modifications , both as to the equipment details and operating procedures , may be accomplished without departing from the true spirit and scope of the present invention . more specifically , materials for thermoplastic prepreg material 110 may be chosen from a wide array of materials to serve the intended purpose . the material may be selected from a wide array of fibrous materials , epoxies , and resins to serve the intended function and accommodate manufacturing processing to achieve the integral structure as indicated herein . the thermoplastic prepreg material 110 may also have any number of fiber orientations and plies . layup 350 may have any number of thermoplastic prepreg segments 510 . further , top platen 310 and bottom platen 320 may have any number of heat pins 360 to accommodate the number of thermoplastic prepreg pieces 510 on layup 350 . these and other modifications are all intended to be within the true spirit and scope of the present invention .	1
in one aspect , the invention comprises a microwave emitting or delivery device , referred to herein as an energy delivery device ( edd ), that provides a controlled delivery of energy to the skin and / or its underlying layers . the use of the device of the invention induces regeneration of the skin and particularly areas having collagen fibers . typically , the degree of fibrous bundling or cross - linking in these areas increases with age , resulting in fine lines , wrinkles , and eventually pronounced fissures or furrows . in general , the devices and methods of the invention and the energy delivery device are used in direct contact with the surface of the skin and the emitted energy affects tissue below the surface of the skin , especially the underlying collagen fiber layer , such as the dermis or epidermis . treatment of the collagen fibers affects the cross - links in the fibrous material causing it to heal or regenerate . the healing or regenerating tissue will impart an improved appearance to the surface of the skin , removing wrinkles and fine lines . thus , the appearance of desired areas or portions of the skin &# 39 ; s surface are improved . in a preferred embodiment , the method of the invention encompasses a treatment mode wherein the tissue is skin and the emitted microwaves are directed to an area of the body where aged or wrinkled skin is present , such as around the eyes , lips , chin , neck , and forehead . the devices and methods of the invention can be adapted and used with a variety of tissues and other targets at a variety of energy penetrating depths . while skin tissue is discussed in general here , other tissue can also be treated . for example , the devices and methods disclosed herein may be utilized to good advantage on uterine tissue and / or in the treatment of endometriosis . thus , while the use on skin tissue is discussed in particular , the invention is not limited to use with any particular tissue or target . in preferred aspects , the invention comprises an edd tip or probe . once a target area has been identified for treatment , the energy delivered depends on the patient , the type of skin , the size of the wrinkles or other skin blemish or area , and the desired or appropriate temperature for the treatment . the duration of the pulses of the microwave energy of the preferred wavelength is chosen for the type of treatment desired . depending on the treatment desired , a microwave pulse can be about 1 msec in length , or between about 1 msec and 100 msec , or between about 1 msec and 10 msec . in a generic version of the microwave emitting device , the power supplied from the microwave generator or source can be applied in a range of about 0 . 1 - 100 watts per probe or tip and , preferably , in a range of about 1 - 15 watts per tip . while preferably only one tip is used , more than one can also be used . a coaxial cable of 50 ohm can be used to supply power to the edd tip or tips . the power may be applied in short high power pulses , preferably in the microwave frequency range of about 300 mhz - 30 ghz , and most preferably at a wave frequency of about 2 . 45 ghz . treatment is continued for a desired length of time in accordance with the desired results . the amount of energy delivered to disrupt or break the fibrous bonds depends on the condition of the skin . an electromagnetic field , particularly in the microwave region between 300 mhz and 10 ghz , is effective at treating these fibrous layers . in various embodiments , the microwave delivery device and treatment regimen provides a controlled delivery of electromagnetic energy to the skin . the control system employed can comprise or include a pulse controller for selecting the desired average power and duration of the energy pulse delivered to the edd tip . the control system employed is used for selection of the frequency , pulse width and amplitude , pulse interval , etc . the microwaves are generated by different oscillators delivering a sinusoidal signals at a frequency in the range of about 433 mhz to about 5800 mhz to the edd . the pulse duration can be controlled , but preferably about a 10 msec pulse , the intensity of which is in the range of about 0 . 1 - 20 w , is used . a standing wave ratio indicator can be used to both adjust the position of the edd or the pressure the edd exerts on the skin , and to control the power transmitted to the skin so as to adjust the required transmitted power to the skin . in optimal procedures , the skin , at the treatment area , is gently straightened or flattened , for example by hand or by one or more appropriate devices that do not interfere with the microwave delivery . the energy is thus delivered into , or as close as possible to , the wrinkled area and / or inside the flattened area of a wrinkle or fissure . in other optional embodiments , a vacuum can be used around the edd tip so that the skin is flattened by the vacuum action in one example of the devices and methods of treating skin or layers of skin , the edd tip receives microwave energy from a source fed through a flexible , coaxial line . a single tip is generally used , where the tip is either pointed or blunt - ended at the distal end designated to be in contact with the skin during use . in a preferred embodiment , the tip is a shielded , directional emitter of microwave energy having a central microwave conductor , such as a rigid wire , that terminates in a blunt shape at the distal end , and where the distal end extends beyond a metallic shield that surrounds a portion of the conductor or rigid wire . one or more dielectric compounds or media with appropriate dielectric properties , such as teflon , is positioned in the space between the shield and the rigid wire . the shield design and shape can vary and the distance between the distal end of the central conductor and the shield can vary , but a preferred distance is between about 0 . 1 mm and 5 mm . the proximal end of the conducting tip is functionally connected to the waveguide originating in the generator ( e . g ., via a coaxial cable ). the features of the handheld unit can include an on / off switch and an intensity control knob or actuator for controlling the pulse , for example the pulse length and / or pulse energy . the length of the tip is generally designed for use at one or more frequencies , and as noted a preferred frequency is about 2 . 45 ghz . various frequencies and tip lengths can be selected and a system incorporated in the handheld unit can be structured to accommodate different , interchangeable tips that connect to the same waveguide and controllable generator . in a preferred embodiment , the tip is disposable and can be removed and replaced for use with different patients . a connection point within the handheld unit , for example , connects the coaxial cable or other flexible waveguide to the rigid waveguide ending in the tip . also , the tip can have differing diameters in the range of about 0 . 5 mm to 5 mm . more generally and as noted , the distal end of the tip can comprise a short tapered shape , a conical shape , or any other size and / or shape that can be inserted into a wrinkled region or fissure in the skin to be treated . the tip can also include a dielectric compound to provide impedance matching with the treatment area . optionally , a tube carrying gas or liquid can extend from the handheld unit , along the waveguide and within the unit housing , to provide cooling gas or liquid to the treatment site . a similar tube can be used for suction to provide a negative pressure at the treatment site . the gas , fluid , and / or vacuum lines can be controlled , according to the amount of energy delivered , or controlled independently . an exemplary system for the handheld microwave energy delivery device comprises a handheld unit coupled to one or more flexible lines that are functionally connected to a generator or source of pulsed microwave energy , gas , or liquid supply , vacuum , and a computer - controlled circuit to control the timing , frequency , power and pulse duration of the microwave energy . the computer - controlled circuit can also be used to processes or monitor and optimize operation using feedback data such as the reflected standing wave ratio , as known in the art . the treatment of different skin conditions and areas can involve differences in reflected waves , and adjusting one or more of several parameters can control the energy delivery from the tip of the device . the handheld unit can consist of a housing and switches for initiating and terminating the pulse , adjusting the frequency , power or pulse duration , for initiating and terminating vacuum , and optionally for cooling air or liquid supply . indicator lights on the handheld housing can also be connected to the reflected energy monitor , or other measuring sensor in the system . preferably , the edd device employs bipolar microwave energy delivery to affect a small treatment area and / or ensure consistent delivery of energy to the skin . however , unipolar and combination of unipolar / bipolar devices can also be used according to the invention . a temperature sensor ( e . g ., a thermocouple of thermistor ) can optionally be incorporated at the distal part of the edd device , and the sensor can be linked to a control device so as to control or limit the heating at the skin surface . other embodiments and advantages of the invention are set forth in part in the description that follows , and in part , will be understood from this description , or may be learned from the practice of the invention . for a more complete understanding of the invention and some advantages thereof , reference is now made to the following descriptions taken in connection with the accompanying drawings . fig1 schematically represents the edd 10 as a handheld unit including a handheld housing 20 and a tip portion 22 . fig2 represents an exploded view of the edd 10 in order to show the components . handheld housing 20 includes the main body ( 1 ), which can be of plastic or other materials , and which is designed to have an ergonomic form to hold by hand . the sleeve ( 2 ) is generally textured and formed to fit comfortably in the hand without sliding . the coaxial cable ( 3 ) connects the edd 10 ( in particular , the metallic core 5 ) to the base station ( not shown ). the replaceable edd tip portion 22 unit is generally composed of a metallic antenna body ( 4 ) ( preferably silver coated copper ), a metallic core ( 5 ) ( preferably silver coated copper ), and a dielectric ( 6 ) ( preferably teflon ) disposed between the metallic core 5 and the antenna body 4 ( seen in fig3 and 4 ). a protective cap ( 7 ) can be used to protect the tip portion 22 of the edd 10 . fig3 and 4 are cross - sectional views of the edd 10 illustrating possible connections between the replaceable tip unit 22 of the edd 10 and the coaxial cable ( 3 ). the coaxial cable ( 3 ) is held in the main body ( 1 ). the shielding ( 11 ) of the coaxial cable ( 3 ) is in contact with the antenna body ( 4 ). fig3 represents a gripping or snap - on mechanism ( 12 ) between the core ( 14 ) of the coaxial cable ( 3 ) and the core ( 5 ) of the replaceable unit . fig4 represents a connection by interlocking the core ( 14 ) of the coaxial cable and the core ( 5 ) of the replaceable unit . of course , other methods of connecting the coaxial cable 3 and the core 5 are within the spirit and scope of the present invention . the core ( 5 ) of the replaceable edd tip 22 can be of different diameters ( e . g ., about 0 . 5 mm to 5 mm ) depending on the tissue to be treated . the protective cap ( 7 ) can be fixed to the tip or antenna body by a click - on design or mechanism ( 13 ), a threaded connection , a friction fit , or any other suitable method . the protective cap ( 7 ) protects the tip of the core ( 5 ) from mechanical damage or contamination . the protective cap ( 7 ) can be made out of an insulating material . fig5 illustrates the relative dimensions of the core 5 and the dielectric 6 . in use , the metallic core 5 of the edd tip 22 is in contact at its distal end with a complex impedance z b , which is the impedance of the contact plan between the edd tip 22 and the skin being treated . z b is highly frequency dependent . at its proximal end , the core 5 is in contact with the coaxial cable 3 , for which the impedance may be represented as z 0 . z 0 is typically about 50 ohms . one function of metallic core 5 is impedance matching — that is , to enable efficient transmission of the wave from z 0 to z b . for this matching , the core 5 may be constructed out of two stages , as shown in fig5 . stage 1 is of length l 1 and has a characteristic impeadance z 1 . stage 2 is of length l 2 and has a characteristic impedance z 2 . as known in the art , the impedance of a coaxial wave guide depends on the permittivity and the inner and outer diameters of the dielectric . this impedance is frequency independent , and can be calculated using the equations where d 3 and d 4 are , respectively , the inner and outer diameter of the stage 1 of the dielectric and d 1 and d 2 are , respectively , the inner and outer diameter of stage 2 of the dielectric . the first step in calculating the dimensions of the two stages of core 5 is to determine the impedance z b . for this , a coaxial cable with a chosen length of l , chosen diameters d 1 and d 2 , and of characteristic impedance z 2 ( typically about 50 ohms ) may be attached to a network analyzer . as shown in fig3 and 4 , the core 5 is longer than the antenna body 4 by a distance d , which is preferably about 1 mm . this “ tip ” ( e . g ., the exposed length of core 5 ) may be placed on the skin , and , using the network analyzer to measure impedance , z b may be calculated according to the equation where λ is the wavelength in the dielectric having permittivity ε r . the second step is to calculate the length l 2 of stage 2 . l 2 is preferably calculated in order to define a characteristic impedance z c of the interface between stage 1 and stage 2 that is real only ( e . g ., lacking an imaginary component ). l 2 can be found using the equation z c = z b e − 2γl 2 . the third and final step is to match z c with z 0 ( e . g ., about 50 ohms ). since z c is designed to be real - only , an impedance transformer can be used . the length l 1 of stage 1 is preferably a quarter wavelength ( e . g ., λ / 4 ), and z 1 is given by the equation z 1 =√{ square root over ( z c * z 0 )}. in order to perform the above calculations , an electromagnetic field distribution simulation software may be used . in particular , it is desirable for the electromagnetic field distribution simulation software to account for each discontinuity between stages . the length of core 5 can be reduced by using a dielectric with intermediate or high permittivity . for example , in order to calculate l 2 , one needs to know z b . in order to have a real - only z c , two solutions of l 2 are possible . preferably , the solution which gives the minimum value of z c is chosen . the following equation may be employed : z 1 =√{ square root over ( z c min * z 0 )}, where and where γ is the reflection coefficient of the core 5 as measured by the network analyzer . the following table provides some representative values for the core 5 . fig6 - 9 represent possible assemblies between the handheld portion 20 and the tip portion 22 . fig6 represents an assembly comprising a snap or click mechanism between the tip portion 22 and the handheld portion 20 . fig7 represents a bolt assembly or mechanism between the tip portion 22 and the handheld portion 20 fig8 represents a bayonet - type connection between the tip portion 22 and the handheld portion 20 . fig9 represents a clamping - type connection between the tip portion 22 and the handheld portion 20 . fig1 - 12 illustrate steps that may be carried out in detaching the tip portion 22 from the handheld portion 20 . fig1 represents an assembly whereby a snap or click mechanism connects the protective cap ( 7 ) to the edd 10 . fig1 and 12 represent the removal / extraction of the tip portion 22 . by following the illustrated steps , a user can extract the tip portion 22 , including core 5 , antenna 4 , and dielectric 6 , without touching it . fig1 is a block diagram of an exemplary complete system of the invention and its operation . the distal end rf part relates to the edd tip , here depicted by the symbol for an antenna . fig1 illustrates an exemplary energy density field of the energy delivered by edd 10 in tissue . the power of the microwaves delivered to the skin can be controlled manually or automatically . the automatic control may be based on an optional feedback loop that is activated , for example , by one or more of the following sensory devices : skin temperature measurement or monitoring by thermocouples , thermistors , or ir optic sensors , reflected wave monitoring system , and the like . the temperature of the tissues underlying the skin surface can be monitored by radiometers or ir optic sensors , for example , or other mechanisms or methods known or available in the art . the feedback system preferably adjusts the microwave power in order to obtain optimal treatment of the specific tissues without overheating that may cause damage . a timer can also be set to prevent excess treatment . it is known in the art that the depth of penetration of microwaves into tissue is frequency dependent . the table below gives the depth of penetration as a function of frequency for tissues with high water content ( e . g ., muscle , internal organs such as the liver and the heart , and connective tissue with little fat ). in view of the above , the frequency of the microwaves can be varied so as to more effectively treat the tissues at the desired depth . this goal can be achieved by waves that carry a number of frequency components or by alternatively mixing pulses of different frequency . as described , the edd tip portion 22 can be replaced . this property provides distinct functions or advantages , for example enabling the user to select and use the tip portion optimal to the specific need and / or to replace the tip portion for each new patient . the size and / or shape of the terminal ( e . g ., distal ) part of the edd tip portion may vary according to need : it can be flat , curved , conical , or have the form of a cylinder running parallel to the skin surface . such a cylinder tip can , for example , be placed along a wrinkle to obtain optimal treatment of an elongated or long target area with one “ shot ” or application . preferably , the tip portion is designed in order to generate a microwave field that is generally restricted to a volume of about 10 mm 3 , taking into consideration both the size and shape of the tip portion as well as the tissue penetration of the selected microwave frequency . to avoid the contamination of the skin of one patient by the use of the same tip on more than one patient , the tip can be covered by a specially constructed protection cover that does not interfere with the spread of the microwave field from the tip to the tissues . the protection cover can be made of a dielectric having dielectric properties that ensure impedance matching between the tip and the tissues . alternatively the protective cover can have electric conductivity similar to that of the skin but be impermeable to bacteria and viruses as well as other contaminants . this could be , for example , a hard gel , wet cellophane , or the like . a material that improves the tip — tissue impedance matching , such as a gel with the proper dielectric properties , can optionally be added to the gap between the tip and the underlying skin . of course , as described above , it is also contemplated that the tip may be replaced between patients . the following examples and forgoing description are intended to show merely optional configurations for the devices of the invention . variations , modifications , and additional attachments can be made by one of skill in the art . thus , the scope of the invention is not limited to any specific example or any specific embodiment described herein . furthermore , the claims are not limited to any particular embodiment shown or described here . in a first example , a shielded , directional tip is used on a device of the invention and applied directly against the surface of the skin without water , hydrating solutions , or other liquids . the tip has a blunt end to maximize the contact surface of the conductor with the skin . the aperture or distance between the shield and the tip ( e . g ., dimension d in fig3 ) can be varied by changing tips , thereby changing the energy or field shape or size . a preferred aperture is about 1 mm . the tip is preferably a silver coated copper wire , but can be coated , for example with gold to prevent skin reactions in sensitive skin . in another example of a device in accordance with the invention , the distal end optionally includes a vacuum ( negative pressure ) line to apply negative pressure to a selected area to be treated . the tip cover is optionally transparent to allow the user to visually monitor the placement of the tip in a wrinkle or fissure . water or an aqueous solution can be applied to the skin to be treated . the layer of material between the surface where microwaves are emitted and the tissue can affect the ability or efficiency of the microwaves to penetrate the heated tissue , as known in the art . for treatment around the mouth or at the upper lip , the duration of the treatment varies by condition of the skin , but can be between about 1 minute and 20 minutes , typically with pauses to avoid excessive tissue heating . typically , visual changes in the exterior appearance of the skin dictate the amount of treatment for a particular subject or condition . an exemplary treatment regimen includes settings to deliver approximately 0 . 5 - 20 j / sec , using approximately 10 msec pulses with 10 msec intervals in between pulses . the treatment duration can vary from about 20 sec to about 90 sec per treatment site . this regimen is particularly suited for facial rhytides , perioral rhytides , and lentigo , especially on arms , hands , and legs . the treatment area can be cleaned and a hydrating gel and / or analgesic gel can be applied prior to treatment . during treatment the probe is gently applied against the surface of the skin to ensure electrical coupling and delivery of energy below the surface . heating of the tissue by resistive ( or ohmic ) heating is generally desired in a small area of tissue , which is typically the tissue below the surface in direct contact with the distal end of the treatment tip . methods that avoid burning or implication of physical marks at the surface of the skin are desired , and treatment regimens and varying energy pulses , pulse lengths , frequency , or all of these can accomplish this . in another example of a device of the invention , two or more tips or delivery tips are positioned to be adjacent and to engage adjacent areas of skin . energy setting and control is substantially the same for each tip . for a double tip aspect , two parallel and adjacent waveguides from the proximal to the distal end are fed by a single switch within the housing . this may be a single pole double throw rf switch having a single input from a coaxial waveguide with parallel outputs feeding to individual coaxial waveguides coupled to each tip . one skilled in the art can devise and create numerous other examples according to this invention . examples may also incorporate additional imaging , thermometry , and other elements known in the art . as but one example , the device and method disclosed herein may be employed in combination with other tissue treatment devices and methods , collectively referred to herein as “ secondary tissue treatment devices ,” such as the use of laser , ipl , or radiofrequency devices . one skilled in the art is familiar with techniques and devices for incorporating the invention into a variety of devices and of designing improved devices though the use of the concepts presented here .	0
the principles of the present invention and their advantages are best understood by referring to the illustrated embodiment depicted in fig1 - 5 , in which like reference numbers describe like parts . as explained briefly previously , the present invention detects the type of call being made early in the call setup series of messages and adjusts the speed of the signalling channel to match the speed of the channel to be used for the final communication after setup is complete . this is accomplished in a gsm ( global system for mobile communications ) system by checking the service type requested by the mobile station as given in the cm_service_req message and altering the channel assignment as appropriate , before completing the remainder of the call setup process , to the type of channel , sdcch or tch / f , that will be used by the mobile station for the remainder of the communication . in a gsm system the sdcch channel is a low speed signalling channel normally used for call setup and low priority messages while the tch / f channel is higher speed and is normally used for voice traffic . according to one embodiment of the present invention , the network initially assigns either a slow speed channel such as a sdcch channel or a higher speed channel such as a tch / f channel to a mobile station requesting a channel , in accordance with the setup procedures desired by a network provider . as soon as the cm ( communication management ) service request message is received from a mobile station , the bsc ( base station controller ) checks the message , unlike prior art approaches , to determine the type of service requested by the mobile station . if the initial channel assignment is determined to be inappropriate to the type of service requested , channel switching is performed at this time . the remainder of the call setup process is then completed at the speed to be used by the mobile station for the actual communication . thus , a tch / f ( full traffic channel ) is always used for the remainder of the setup messages for voice calls since the setup time of voice and user generated data calls are delay sensitive and the setup time should be a short as possible . on the other hand , a sdcch or similar type slow signalling channel is used to complete the remainder of the setup process for other types of calls , such as short message services and location updates , which are not as delay sensitive as perceived by the mobile station user . the approach used in this invention allows the reduction of the call setup delay by up to 50 percent while keeping the call blocking probability rate at a level similar to that provided by the initial early assignment ( ea ) approach where there is no change in system configuration of channel types available . it has been determined that if the system configuration is changed such that a plurality of sdcch or similar type slow signalling channels are combined to form one or more additional traffic channels , the call blocking probability can , in many instances of network size and configuration , be reduced . this is as compared to the blocking probability that would have occurred in the prior art early assignment approach while still reducing the call setup delay by as much as 50 percent as compared to the prior art ea approach . thus a higher radio channel capacity is provided at each cell of the network . fig1 is a block diagram of a standard cellular system in accordance with gsm standards . a block 10 labeled pstn represents the public switched telephone network and is shown connected to a block 12 designated as a mobile switching center and is often referred to by the acronym of msc . the msc 12 is shown connected to three bsc ( base station controller ) blocks 14 , 16 and 18 . although each bsc would be connected to and control a plurality of btss ( base station transceiver ) s , only three btss are shown connected to bsc 16 and as illustrated where the cells of the btss are designated as 20 , 22 and 24 . likewise , bsc 18 is connected to bts cells 26 , 28 and 30 . the bts cell blocks are shown in hexagonal format which is the industry standard representation of a cell within which a mobile station may reliably receive communications from that particular transceiver . within bts cell 20 are shown two cars 32 and 34 representing mobile stations able to use the cellular network via the bts for cell 20 . these mobile stations may leave bts cell 20 and enter bts cell 22 and continue communications via the bts of cell 22 as is known to those skilled in the art . for completeness of description , a mobile station 36 is shown within bts cell 26 . in fig2 a series of messages are shown as taking place between the ms ( mobile station ), the bts that defines a cell within which the ms is located , the bsc for that bts and the msc when a system is configured to operate in an ea ( early assignment ) mode . when the ms , such as 32 in fig1 wishes to initiate a call , a channel request 50 is sent . after several messages are exchanged between the bts 16 and the bsc 16 , an immediate assignment message 52 is returned to the ms 32 . the channel assigned is a sdcch channel , a slow speed control channel defined in gsm standards for use in an ea configuration . the ms responds with a cm ( communication management ) service request message 54 . although message 54 includes data as to whether the request for service is voice or non - voice ( i . e . short message service ), the prior art gsm standard was such that the bsc 16 does not read this information . rather the service request is merely passed on to the msc as message 56 . it should be noted that , as used in this document , the term “ voice ” includes relatively high speed user supplied data that might be generated from a computer or fax as opposed to low speed short message service data . the msc confirms the connection to the bsc with message 58 and returns an acceptance message 60 to the ms 32 . after identity , authentication and cipher mode messages are exchanged between ms 32 and msc 12 , a setup complete message 62 is transmitted from the ms 32 to msc 12 . after a call proceeding message 64 is transmitted , the msc 12 issues an assignment request message to the bsc 16 to activate a tch / f channel , a full rate traffic or voice quality channel , in those instances where the original request 54 indicated a voice quality transmission request . as known to those skilled in the art , the sdcch channel does not have a traffic mode that needs to be altered . when the assignment of a voice channel is completed as indicated by message 68 the rf ( radio frequency ) channel used for the previous signalling is released for use by another ms wishing to establish communication or for other network messages such as location updates of mss . the message diagram of fig3 for the prior art gsm standard vea option is very similar to that of fig2 . however , as explained previously , all the messages shown after the immediate assignment message 52 are transmitted at the voice message rate and thus there is no release of the signalling channel as occurred in connection with message 70 of fig2 . further , rather than activate a voice or data channel , as occurred in connection with message 67 in fig2 after the occurrence of message 66 , the transmission mode of the channel is merely modified as indicated in message 80 to indicate a speech or data communication mode rather than a signalling mode . as previously indicated , for a system using the vea option of fig3 all messages , including those with a low priority , use the same speed channels . in other words , with the vea option , the sdcch channels are not used by the ms . the term “ priority ” as used herein refers to how the system responds to service requests . voice and higher speed user generated data will be considered to have a higher priority that short message service and location update type data . if ms 32 is calling another ms , such as 36 , the call setup for ms 36 will use substantially identical messages and identical message speeds as originally used by ms 32 . thus with the ea option , all the signalling messages after initial contact , with regard to ms 36 setup , would also be at the sdcch speed . a comparison of the message diagram of fig4 with fig3 will show that the mode of operation and the messages are identical until after cm service request message 54 . in the present invention the software of the bts , the bsc and msc is modified such that the bsc reads the data in the service request message 54 . the network provider may optionally setup and use the present invention to initially assign and use either slow speed sdcch or high speed tch / f signalling channels and then soon thereafter switch to the speed appropriate to the type or priority of service requested . it will first be assumed that the network provider sets up the system to initially use the sdcch signalling channels . if the bsc ascertains that the service requested is low priority such as for “ short message service ”, the bsc skips all the messages in dash line block 90 and continues with message 56 as would occur in the prior art vea option configuration . however , the messages would be in the slow message format of sdcch to conserve telephony bandwidth . further the channel mode would not need to be modified from signalling to communication was illustrated by message 80 in fig3 . on the other hand , if bsc 16 ascertains from forwarded message 54 that the service requested is for a voice priority communication , a channel activate message 92 is issued by bsc 16 . this message 92 operates in a manner substantially identical to the message set initiated by msc 12 with messages 66 and 67 . after the ms is reassigned to a high speed channel , the original slow speed channel is released for further use by the release message 94 in a manner substantially identical to that occurring with message 70 in connection with the ea option of fig2 . thus the service request signalling message 56 is transmitted to msc 12 in a high speed mode as are the remainder of the signalling messages . it will now be assumed that the network provider sets up the system to initially use the tch / f signalling channels . if the bsc ascertains that the service requested is high priority such as for voice , the bsc skips all the messages in dash line block 90 and continues with message 56 as would occur in the prior art vea option configuration . the channel mode would be modified from signalling to communication as illustrated by message 80 in fig3 but would remain in the fast format . on the other hand , if bsc 16 ascertains from forwarded message 54 that the service requested is for non - voice uses , a channel activate message 92 is issued by bsc 16 . this message 92 operates in a manner substantially identical to the message set initiated by msc 12 with messages 66 and 67 . after the ms is reassigned to a low speed channel , the original tch / f channel is released for further use by the release message 94 in a manner substantially identical to that occurring with message 70 in connection with the ea option of fig2 . thus the service request signalling message 56 is transmitted to msc 12 in a low speed mode as are the remainder of the signalling messages to conserve telephony bandwidth . the message diagram of fig5 shows the manner in which a ms such as 36 receives a call in accordance with the present invention . a paging message 100 is sent from msc 12 to bsc 18 and included therein is information as to the priority of the communication . the paging request message 102 is eventually received by ms 36 and it requests a channel as shown by message 104 in a manner similar to what would occur if it were initiating a call instead of receiving a call . the bsc 18 instructs the bts to assign a channel as previously indicated by the paging message from the msc . all the remaining messages follow the format of the gsm standard for the vea option of fig3 . although the invention has been described with reference to specific embodiments , these descriptions are not meant to be construed in a limiting sense . various modifications of the disclosed embodiments , as well as alternative embodiments of the invention will become apparent to persons skilled in the art upon reference to the description of the invention . it is therefore , contemplated that the claims will cover any such modifications or embodiments that fall within the true scope of the invention .	7
a recording system 10 can selectively position a pickup head 20 at a pre - recorded region 32 or a rewritable region 34 of a disc 12 based on characteristics , such as the frequency , period , or pulse width of the wobble signal . the pre - recorded region 32 and the rewritable region 34 have track wobbles that are modulated according to different types of modulation . depending on whether the pickup head 20 is at the pre - recorded region 32 or the rewritable region 34 , the characteristics of the wobble signal will be different . because the pre - recorded region 32 and the rewritable region 34 record data use different modulation methods , it is useful to determine whether the pickup head 20 is located at the pre - recorded region 32 or the rewritable region 34 before attempting to read data from or write data to the disc 12 . in one example , the optical disc 12 is a blu - ray disc , available from sony corporation , tokyo , japan . fig5 shows an example of the track wobble in the rewritable region 34 , which includes monotone wobbles 46 and minimum shift keying ( msk ) marks 48 . each monotone wobble has a shape that can be represented by a cosine function : cos ( 2π × f wob × t ), where f wob represents the frequency of the track wobble ( referred to as the “ wobble frequency ”), and t represents time . in one example , the period of each monotone wobble is 69 t , and the half - period is 34 . 5 t , where t corresponds to the length of a channel bit . the frequency and period can be measured from the signals output by the pickup head 20 . in general , the term “ half - period ” refers to a time duration in which the signal either is high or low , and the term “ period ” refers to a time duration that includes one high interval and one low interval . a minimum shift keying mark 48 includes three segments 50 , 52 , and 54 . the first and third segments , 50 and 54 , each has a cosine wobble with a frequency 1 . 5 × f wob , and the second segment 52 has a cosine wobble with a frequency f wob . in one example , in the first and third segments 50 and 54 , the period of the wobble is 46 t ( and the half - period is 23 t ). in the second segment 52 , the period of the wobble is 69 t . in one example , the average period of the track wobble in the rewritable region 34 is 66 . 8 t , so that the average half - period is 33 . 4 t . referring to fig6 , in one example , the pre - recorded region 32 includes a high frequency modulated ( hfm ) groove 60 in which the track wobble is bi - phase modulated . the hfm groove 60 stores data , referred to as permanent information and control ( pic ) data , with synchronization patterns placed in between frames of the pic data . the portions of the pre - recorded region 32 that store pic data are divided into bit cells 62 , each bit cell 62 storing one bit of data and having , e . g ., a length of 36 t . a centerline 64 of the hfm groove 60 deviates from an average centerline 66 according to a bi - phase modulation . a bit value 0 is represented by a transition at the start ( e . g ., 68 ) of a bit cell 62 , and no transition until the start of the next bit cell . a bit value 1 is represented by a transition at the start and near the middle ( e . g ., 70 ) of a bit cell 62 . in one example , in the portions of the pre - recorded region 32 storing the pic data , the half - periods are either 18 t or 36 t , and the average half period is about 24 . 3 t . referring to fig7 , an example of a synchronization pattern 72 that includes eight bit cells 74 , each bit cell 74 storing one bit of information and has a length 1 t . in the synchronization pattern 72 , a bit value 1 is represented by a transition ( e . g ., 76 ) at the beginning of a bit cell 74 , and a bit value 0 is represented by no transition . the longest half - period of the track wobble in the pre - recorded region 32 occurs in the synchronization pattern 72 , such as 78 , which has three bit cells 74 and has a half - period of 54 t . referring to fig8 , a wobble signal generator 80 includes a quad - section photo detector 82 that has four photo detectors pd_a , pd_b , pd_c , and pd_d for detecting the laser beam 22 , and their outputs are represented as a , b , c , and d , respectively . the outputs of photo detectors pd_a and pd_d are added by an adder 84 , and the outputs of photo detectors pd_b and pd_c are added by an adder 86 . an output 88 of the adder 86 is subtracted from an output 90 of the adder 84 by a subtractor 92 , which generates a push - pull signal 94 having a value ( a + d )−( b + c ). the push pull signal 94 passes through a band - pass filter ( or low pass filter ) 96 , generating a wobble signal 98 . the wobble signal 98 represents a filtered push - pull signal . a comparator 100 compares the wobble signal 98 with a reference voltage v ref and generates a pulse signal 102 . the pulse signal 102 is forwarded to a frequency detector 104 and a jitter meter 106 to determine the frequency and period , respectively , of the pulse signal 102 . in the description below , the term “ wobble frequency ” will be used to refer to the frequency of the pulse signal 102 . the frequency and period values are sent to a wobble type detector 108 to determine the wobble type at the current pickup head location . depending on whether the pickup head 20 is at an hfm groove or a wobble groove , the pulse signal 102 is sent to a bi - phase demodulator 110 or an msk demodulator 112 , respectively , to retrieve data contained in the track wobble . the wobble type detector 108 generates a selection signal 114 to control a switch 116 for determining whether the pulse signal 102 is processed by the demodulator 110 or 112 . fig9 shows an example of a push - pull signal 120 that is generated when the pickup head 20 is at the pre - recorded region 32 , where the track wobble is bi - phase modulated . a pulse signal 122 is derived from the push - pull signal 120 . the horizontal axis 124 represents time , and the vertical axis 126 represents the amplitude of the signal . the pulse signal 122 has pulse widths having values 18 t , 36 t , and 54 t . the pulse widths of the pulse signal 122 correspond to the half - periods of the push - pull signal 120 . referring to fig1 , a chart 130 shows a comparison of the track wobble frequencies and periods for the two types of grooves in the pre - recorded region 32 and rewritable region 34 when certain encoding schemes are used . in the description below , the groove in the pre - recorded region 32 will be referred to as the hfm groove , and the groove in the rewritable region 34 will be referred to as the wobble groove . in the wobble groove , the longest half - period is 34 . 5 t , whereas in the hfm groove , the longest half - period is 54 t . in the wobble groove , the shortest half - period is 23 t , whereas in the hfm groove , the shortest half - period is 18 t . in the wobble groove , the average period is about 66 . 8 t , whereas in the hfm groove , the average period is about 48 . 5 t . in the wobble groove , the standard deviation of the period length is about 5 . 72 t , whereas in the hfm groove , the standard deviation is about 13 . 96 t . in the wobble groove , the standard deviation of the pulse width is about 3 . 04 t , whereas in the hfm groove , the standard deviation is about 8 . 86 t . both in the wobble groove and the hfm groove , the period length can have several values . in the wobble groove , about 3 % of the period is 46 t , about 6 % is 51 . 75 t , about 6 % is 63 . 25 t , and about 84 % is 69 t . by comparison , in the hfm groove , about 49 % of the period is 36 t , about 34 % is 54 t , about 16 % is 72 t , and less than 1 % is 108 t . both in the wobble groove and the hfm groove , the pulse width can have several values . in the wobble groove , about 6 % of the pulse width is 23 t , about 6 % is 28 . 75 t , and about 87 % is 34 . 5 t . by comparison , in the hfm groove , about 66 % of the pulse width is 18 t , about 33 % is 36 t , and about 1 % is 54 t . the above values can be obtained by measuring the signal 98 or the pulse signal 102 ( fig8 ) for a known disc 12 . in one example , when the recording system 10 operates under a constant linear velocity mode , and the disc is rotated at 1 × speed , the channel code has a bit rate of 66 mhz . the monotone wobble 46 in the rewritable region 34 has a period equal to 69 t , and thus has a frequency equal to 956 . 52 khz . when the pickup head 20 is at the hfm groove , the linear velocity of the pickup head 20 relative to the rotating disc 12 is about 5 . 28 meter / second , and the disc rotates at about 37 . 8 hz ( revolutions per second ). referring to fig1 , the recording system 10 uses a process 140 to move the optical pickup head 20 to a location in the pre - recorded region 32 . after the power of the optical recording system 10 is turned on ( 142 ), the pickup head 20 is moved ( 144 ) to a position that is near 24 mm from the center 44 of the center hole 46 of the disc 12 . this position would place the pickup head 20 in the rewritable region 34 , at a location that is close to the pre - recorded region 32 . the spindle motor 16 of the recording system 10 is turned on ( 146 ) and rotated at a fixed rotation speed ( e . g ., 37 . 8 hz ). the laser of the pickup head 20 is turned on ( 148 ). the position of the pickup head 20 is adjusted to focus the laser beam 22 on the groove of the servo track 30 . the pickup head 20 starts tracking the servo track 30 . a pulse signal 102 is generated from the reflected laser beam 22 using the wobble signal generator 80 and the comparator 100 ( fig8 ). the average wobble frequency w 0 of the pulse signal 102 is detected and stored ( 152 ) in a memory . the average wobble frequency represents an average of the frequency of track wobble measured over a predetermined period of time . the pulse signal 102 is demodulated ( 154 ) by the msk demodulator 112 to obtain address information . the track number between the current position to a specified position in the pre - recorded region 32 is calculated . based on the calculated track number , the pickup head 20 is moved ( 156 ) to the specified position in the pre - recorded region 32 . the average wobble frequency w 1 is detected and stored ( 158 ) in the memory . the wobble frequencies w 0 and w 1 are compared ( 160 ) with pre - stored threshold values , such as those shown in the chart 130 of fig1 , to determine ( 162 ) whether the pickup head 20 is at the pre - recorded region 32 . for example , for a blu - ray disc rotating at 1 × speed , the channel bit frequency is 66 mhz , and the average period of the hfm groove is about 48 . 5 t , so the average frequency of the hfm groove is larger than 1 . 36 mhz . if the average frequency of the pulse signal 102 is greater 1 . 3 mhz , the system determines that the pickup head 20 is at the hfm groove of the pre - recorded region 32 , and the process 140 ends ( 164 ). if the pickup head 20 is not at the pre - recorded region 32 , the wobble frequency w 1 is compared with pre - stored threshold values , such as those shown in the chart 130 , to determine ( 166 ) whether the pickup head 20 is at the rewritable region 34 . for example , when the channel bit frequency is 66 mhz , and the average period of the wobble groove is about 66 . 8 t , the average wobble frequency is about 988 khz . if the wobble frequency w 1 is less than 1 mhz , then the recording system 10 determines that the pickup head 20 is at the rewritable region 34 . if the system 10 determines 166 that the pickup head 20 is not at the rewritable region 34 , the process 140 jumps to step 144 to reposition the pickup head 20 in the rewritable region 34 . if the pickup head 20 is at the rewritable region 34 , the process 140 jumps to step 154 to determine the address information and re - attempt to position the pickup head 20 at the pre - recorded region 32 . in an alternative example , in step 160 , instead of comparing the wobble frequency with pre - stored values , the wobble frequencies w 0 and w 1 stored in steps 152 and 158 are compared with each other . for example , if the difference between w 0 and w 1 is less than a tolerance value , the system 10 determines that the pickup head 20 is at the rewritable region 34 at steps 162 and 166 . if the difference between the average wobble frequencies w 0 and w 1 is larger than a tolerance value , the system 10 determines that the pickup head 20 is at the pre - recorded region 32 . the system 10 confirms that the pickup head 20 is at the pre - recorded region 32 by using specified criteria . for example , w 1 should be larger than w 0 . if not , there may be an error , and the process 140 jumps to step 144 and starts over . in yet another example , the pickup head 20 is initially moved to near the center 14 , then moved radially outwards of about 22 mm , which places the pickup head 20 at the pre - recorded region 32 . to reduce errors due to tolerances in the disc 12 and the sled motor 18 , the frequencies of the pulse signal 102 are compared with pre - stored values to determine whether the pickup head 20 is actually positioned at the pre - recorded region 32 . in process 140 , the average frequency of the pulse signal 102 is compared with pre - stored values to determine whether the pickup head 20 is located at the pre - recorded region 32 or the rewritable region 34 . other parameters , such as the longest half - period , the shortest half - period , the standard deviation of the period , the standard deviation of the pulse width , or any combination thereof , can also be used . these parameters can be determined based on measurements made over a predetermined time period or a predetermined track length . instead of using the pulse signal 102 , the wobble signal 98 can also be compared with pre - stored values to determine whether the pickup head 20 is located at the pre - recorded region 32 or the rewritable region 34 . other signals derived from the wobble signal 98 or pulse signal 102 can also be compared with pre - stored values to determine whether the pickup head 20 is located at the pre - recorded region 32 or the rewritable region 34 . referring to fig1 , in an alternative example , the recording system 10 uses a process 170 to move the optical pickup head 20 to a location in the pre - recorded region 32 by measuring the rotation speed of disc 12 ( which is the same as the rotation speed of the spindle motor 16 ), rather than measuring the wobble frequency . the power of the optical recording system 10 is turned on ( 142 ), and the pickup head 20 is moved ( 144 ) to a position that is near 24 mm from the center 44 . this position would place the pickup head 20 in the rewritable region 34 . the spindle motor 16 is turned on ( 172 ). the laser of the pickup head 20 is turned on ( 148 ). the pickup head 20 focuses the laser beam 22 and tracks ( 150 ) the servo track 30 . a pulse signal is generated from the reflected laser beam 22 using the wobble signal generator 80 and the comparator 100 ( fig8 ). a particular wobble frequency is selected ( 174 ), and the recording system 10 is set to the constant linear velocity mode . the spindle motor 16 rotates the disc 12 to maintain the wobble frequency at the specified value . in one example , when the recording system 10 is operating under constant linear velocity mode at 1 × speed , the channel bit frequency is 66 mhz , the average wobble period is 66 . 8 t , and the average wobble frequency is 988 khz . in step 174 , the wobble frequency can be set at 988 khz . the wobble signal is demodulated ( 176 ) to obtain the address information . the track number between the current position to the starting position of the rewritable region 34 is calculated . based on the calculated track number , the pickup head 20 is moved to a location near the starting position of the rewritable region 34 . the rotation frequency of the disc 12 , represented by an fg frequency value , f 0 , is detected and stored in the memory . in one example , when the pickup head 20 is near the beginning of the rewritable region 34 , the disc rotation speed is about 36 . 2 revolutions per second . thus , f 0 is approximately equal to 36 . 2 hz . the pickup head 20 is moved ( 180 ) inwards towards the center 44 a number of tracks . the recording system 10 adjusts the spindle motor 16 so that the wobble frequency is maintained at 988 khz . the recording system 10 waits until the spindle motor 16 stabilizes , then detects and stores ( 182 ) the current fg frequency value , f 1 . because the average wobble period of the hfm groove is about 48 . 5 t ( whereas the average period of the wobble signal in the rewritable region 34 is 66 . 8 t ), the spindle motor 16 would have to decrease the rotation speed , such that f 0 = f 1 × n , where n = 66 . 8 / 48 . 5 = 1 . 377 , in order to maintain the wobble frequency at 988 khz . the value f 0 is compared ( 244 ) with the value 1 . 2 × f 1 . if f 0 is not greater than 1 . 2 × f 1 , the system 10 determines ( 188 ) that the pickup head 20 is still at the rewritable region 34 , and jumps to step 176 . if f 0 is larger than 1 . 2 × f 1 , the system 10 determines ( 186 ) that the pickup head 20 is at the pre - recorded region 32 , and ends ( 164 ) the process 170 . after the system 10 determines that the pickup head 20 is at the pre - recorded region 32 , the system 10 demodulates the signal read from the pickup head 20 using the bi - phase demodulator 110 . an advantage of using the process 140 or 170 is that the recording system 10 can quickly position the pickup head 20 at the pre - recorded region 32 upon startup of the recording system 10 , and quickly read the permanent information and control data stored at the pre - recorded region 32 . an advantage of comparing characteristics of the signal 98 or pulse signal 102 with pre - stored values , such as those in the chart 130 , is that the system 10 can more accurately determine whether the pickup head 20 is at the pre - recorded region 32 or the rewritable region 34 . without using process 140 or 170 , the recording system 10 would have to initially determine whether the pickup head 20 is at the pre - recorded region 32 or rewritable region 34 based on the radial distance of the pickup head 20 from the center 44 , try to decode the data read by the pickup head 20 based on the initial determination , and if the system 10 cannot decode the data , switch to another decoding method to decode the data read by the pickup head 20 . such trial - and - error method requires a longer time than processes 140 and 170 . when the process 140 or 170 is used , the system 10 does not have to wait for the pickup head 20 to be stably locked on to a particular track ( which would be required to read data from the disc 12 ) to determine whether the pickup head is at the pre - recorded region 32 or the rewritable region 34 . although some examples have been discussed above , other implementations and applications are also within the scope of the following claims . for example , the optical disc 12 can be a write - once disc such that the servo track includes a writable region ( which allows the user to write data once ) instead of a rewritable region . the optical disc 12 can be compatible with various standards , and can have wobble frequencies , periods , pulse widths that are different from what was mentioned above . the disc drive controller 14 can be designed to process signals that are encoded differently . the characteristics of the pre - recorded region 32 and the rewritable region 34 may be different from what is shown in the chart 130 of fig1 . for example , the values for the longest half - period , the shortest half - period , the average period , the standard deviation of the periods , the standard deviation of the pulse widths , the distribution of periods , and the distribution of pulse widths can be different . the servo track 30 can have more than two regions having different types of track wobbles . each type of track wobble can have particular characteristics . each of the different regions can be distinguished based on the values of the longest half - period , the shortest half - period , the average period , the standard deviation of the periods , the standard deviation of the pulse widths , the distribution of periods , and the distribution of pulse widths , and so forth . the servo track 30 can include a land portion that has track wobbles , instead of a groove portion having track wobbles . the optical disc 12 can have two servo tracks , one servo tracking including a land portion , the other servo track including a groove portion . the servo track does not necessarily have to be a spiral on a circular disc . the servo track can be disposed on a long tape , and the pickup head scans the servo track as the tape moves forward or backward relative to the pickup head . the optical disc 12 can have more than one reflective layer . the disc can be designed so that the pickup head 20 can read and write information from the multiple layers from the same side of the disc . the disc can also be designed so that the at least one pickup head is located at each side of the disc . when there are two layers on a disc , a servo track on one layer may start at a position close to the inner portion of the disc and spiral outwards , and a servo track on the other layer may start at a position close to the outer portion of the disc and spiral inwards . using characteristics of the wobble signal to determine the location of the pickup head relative to a servo track is not limited to optical recording systems , and can be used in other systems , such as magneto - optic or magnetic recording systems . the hfm groove can be modulated using different methods . for example , a logical value 1 can be represented as a track deviation to the left , and a logical value 0 can be represented as a track deviation to the right ( relative to the scanning direction of the pickup head ). the wobble groove can be frequency modulated , such that logical values of 0 and 1 are represented by different frequencies . the wobble groove can store an encoded format of the address information , such as gray codes that represent address information . the wobble groove may store track number information in additional to the address information .	6
a first embodiment of the present invention will now be described with reference to the accompanying drawings . [ 0023 ] fig1 is a diagram illustrating a manufacturing apparatus 1 for manufacturing a disposable worn article according to the first embodiment . the manufacturing apparatus 1 includes an adhesive applicator 13 for applying an adhesive on a first sheet 10 , a guide 21 for guiding an elastic member 20 between the first sheet 10 and a second sheet 30 , press rolls 31 and 32 for pressing together the first sheet 10 and the second sheet 30 into a combined web 40 , and a processing section 2 for cutting off at least a part of , or reducing the shrinking force of , the elastic member 20 of the combined web 40 produced through the press rolls 31 and 32 . the adhesive may be applied on the second sheet 30 . the adhesive applicator 13 is capable of applying an adhesive on the first sheet 10 , which has a strip shape of a predetermined width and which is advanced in the x direction ( the direction of the production flow ), so that an adhesive portion 11 and a non - adhesive portion 12 are provided on the first sheet 10 . in terms of the air permeability of the combined web 40 , it is preferred that the adhesive applicator 13 is a spray coater , a curtain coater , a spiral coater , or the like . the amount of adhesive is preferably about 1 g / m 2 to about 20 g / m 2 . the adhesive may be a hot melt . a specific example of the adhesive applicator 13 will be described later . the elastic member 20 under a predetermined tension is supplied to the guide 21 . the elastic member 20 may be in the form of a plurality of lines , as illustrated in fig1 or a mesh ( e . g ., elastomeric netting such as rebound ( r ) of conwed plastics may be used ). the elastic member 20 may be a string rubber or a flat rubber . the guide 21 is capable of reciprocating transversely of the direction of the production flow . in such a case , the guide 21 is capable of guiding the elastic member 20 between the first sheet 10 and the second sheet 30 so that the elastic member 20 is drawn in a non - linear line . a predetermined tension is applied to the elastic member 20 supplied to the guide 21 by means of a tension roll ( not shown ). the processing section 2 includes an embossing roll 50 and a counter roll 60 facing the embossing roll 50 . the combined web 40 is inserted between the embossing roll 50 and the counter roll 60 , and the processing section 2 cuts off at least a part of , or reduces the shrinking force of , the elastic member 20 . the embossing roll 50 includes an embossing section 51 having a plurality of protrusions . the protrusions may generate heat as will be described later . in such a case , the amount of heat to be generated is determined by the distance between the embossing roll 50 and the counter roll 60 , the shape and / or the size of each protrusion , the material , the cross - sectional area and / or the shape of the elastic member 20 , and / or the speed at which the combined web 40 is advanced . [ 0028 ] fig2 a to fig2 c illustrate an exemplary disposable worn article made of the combined web 40 , which has been passed through the processing section 2 . the disposable worn article illustrated in fig2 a to fig2 c ( e . g ., disposable underpants or a disposable diaper ; hereinafter referred to simply as “ underpants ”) includes a design area 150 having a graphical design or characters printed thereon . if the shrinking force of a part of the elastic member 20 on the design area 150 is not reduced or eliminated , the design area 150 will be wrinkled by the force , thereby deteriorating the appearance of the article . also in cases where a label having a graphical design or characters printed thereon is attached to the combined web 40 , the label will have wrinkles due to the shrinkage of the elastic member 20 , thereby deteriorating the appearance of the article . besides , such wrinkles make it difficult to adhere , on the combined web 40 , a member such as a label , a tape used for fixing a diaper , a tape used when disposing of the article having the combined web 40 , etc . even if such a member is successfully adhered on the combined web 40 while the wrinkles are being smoothed out , it is difficult to keep the adhesion between the combined web 40 and the member for a long period of time due to the shrinkage of the elastic member 20 . underpants 130 include the adhesive portion 11 , the non - adhesive portion 12 which has substantially the same width as that of the design area 150 , and the part of the elastic member 20 on the design area 150 is cut off . the shrinkage of the cut elastic member 20 stops in the vicinity of the boundary between the adhesive portion 11 and the non - adhesive portion 12 . where the combined web 40 has the non - adhesive portion 12 , it is preferred that the embossing section 51 has at least two rows of protrusions such that a portion of a protrusion in the first row overlaps a portion of a protrusion in the second row in the direction of the rotation axis of the embossing roll 50 , in order to reduce or eliminate the shrinking force of the elastic member 20 on the design area 150 . this is because it is not possible , with a single row of protrusions , to cut off a portion of the elastic member 20 located between adjacent protrusions . even with a single row of protrusions , the elastic member 20 can be cut off if the protrusions are in a slant arrangement . alternatively , for example , cutting off , etc ., of a plurality of rubber strings can be achieved with a single protrusion . the length l 2 of the embossing section 51 may be slightly smaller than the length l 1 of the non - adhesive portion 12 . in underpants 140 , an adhesive is applied also in the design area 150 . in order to reduce or eliminate the shrinking force of the part of the elastic member 20 on the design area 150 , it is preferred that the protrusions in each row are arranged at a predetermined interval in the embossing section 51 across the entirety of the design area 150 . in other words , it is preferred that the protrusions have an overlap with one another as they are projected in the axial direction of the embossing roll 50 . while the elastic member 20 exists under the sheet , the processing section 2 may be used to reduce or eliminate the shrinking force of the elastic member 20 in advance in cases where an additional member ( e . g ., a tape used when disposing of the underpants or a tape to be attached to a diaper body or a label ) is adhered on the sheet . this is because it is difficult to fix such an additional member on the sheet while the elastic member 20 is shrunk . underpants 160 are made of a combined web having a meshed elastic member 170 sandwiched between the first and second sheets at a predetermined tension . in a waist area 161 , the vertical elastics are cut off while leaving the horizontal elastics ( the elastic around the waist ) so that the underpants 160 fit well to the body . note however that the vertical and horizontal elastics are both cut off in an area 162 where an additional member or a label is adhered . moreover , the vertical and horizontal elastics are both cut off in a predetermined area 163 . the predetermined area 163 is an area where it is preferred that the underpants 160 do not shrink . an absorber may be provided in the area . as described above , it is made possible to adhere a member on the combined web 40 by reducing the shrinking force of the elastic member 20 of the combined web 40 in areas where the member is to be adhered . possible methods for reducing or eliminating the shrinking force of the elastic member 20 include : cutting off the elastic member 20 ; reducing the shrinking force of the elastic member 20 ; altering the molecular structure of the elastic member 20 ( when the elastic member 20 is a rubber ), and melting a part of the combined web 40 and curing the melted part . the protrusions may generate heat in order to reduce or eliminate the shrinking force of the elastic member . in such a case , the elastic member 20 is cut off by the protrusions melting at least a part of the second sheet 30 and at least a part of the elastic member 20 . in this process , the first sheet and the second sheet are sealed together . for example , in the case of the underpants 130 , the first sheet and the second sheet are sealed together while the elastic member 20 is cut off . the wrinkling of the elastic member 20 is improved when the shrinking force of the elastic member 20 is reduced , even if the elastic member 20 is not cut off . moreover , even if the protrusions do not generate heat , it is possible to cut off the elastic member 20 via the second sheet 30 when the width of each protrusion is small ( e . g ., several microns to about 0 . 5 mm ). in this process , at least apart of the second sheet 30 is cut by the protrusions , thereby increasing the air permeability of the underpants 140 . in addition to the design area 150 , a part of the elastic member 20 corresponding to an upper waist area 151 and / or a leg area 152 of the underpants 140 may also be opened by the protrusions . the protrusions of the embossing section 51 will now be described . fig3 a illustrates an emboss pattern including a plurality of rectangular protrusions arranged in a staggered pattern . the embossing section 51 includes : an n − 1 th row of rectangular protrusions 53 , 53 each having a length s 1 and a width w 1 which are arranged in the axial direction of the embossing roll 50 ( indicated by a solid arrow ) at intervals of a distance d 1 ; an nth row of protrusions 54 , 54 each having the same length ( s 1 ) and width ( w 1 ) as those of the protrusions 53 which are arranged in the circumferential direction of the embossing roll 50 ( indicated by an outline arrow ) at a distance of m 1 from the protrusions 53 so that the longitudinal center line thereof passes through a point of d 1 / 2 ; and an n + 1 th row of protrusions 55 , 55 having the same shape as that of the protrusions 53 which are arranged in the same manner as the protrusions 53 . the number of protrusions in each row may be determined based on , for example , the number of elastic members to be cutoff . the number of rows of protrusions may be determined based on the length l 1 of the non - adhesive portion . herein , n is a natural number , and “ 0 row ” means there is no row of protrusions . in an alternative emboss pattern where n is a natural number equal to or greater than 2 , a protrusion in the n − 1 th row may overlap with the protrusion in the n + 1 th row in the row direction by at least 1 mm or more . in such a case , a protrusion in the n − 1 th row may not overlap with the protrusion in the nth row or may overlap with the protrusion in the nth row by about 0 . 5 mm to about 1 mm . in this way , the density of protrusions in each row may be reduced as compared to the emboss pattern illustrated in fig3 a , thereby facilitating the production of the emboss roll . with an emboss roll having such protrusions as described above , as compared to an emboss roll having a single line blade , the protrusions more easily cut into the combined web , whereby it is possible to easily cut off the elastic member . [ 0040 ] fig3 b shows a pattern in which diamond - shaped protrusions are arranged in a staggered pattern . the embossing section 51 includes : a row of diamond - shaped protrusions 56 , 56 each having a long axis s 2 and a short axis w 2 which are arranged in the axial direction of the embossing roll 50 ( indicated by a solid arrow ) at intervals of a distance d 2 ; another row of protrusions 57 , 57 each having the same diamond shape as the protrusions 56 which are arranged in the circumferential direction of the embossing roll 50 ( indicated by an outline arrow ) at a distance of m 2 from the protrusions 56 so that the short axis thereof is collinear with a point of d 2 / 2 ; and still another row of protrusions 58 , 58 each having the same shape as that of the protrusions 56 which are arranged in the same manner as the protrusions 56 . of course , also for this pattern , the number of protrusions in each row may be determined based on , for example , the number of elastic members to be cut off , and the number of rows of protrusions may be determined based on the length l 1 of the non - adhesive portion . the length s 1 of the rectangular protrusions and the length of the long axis s 2 of the diamond - shaped protrusions are both preferably in the range of 1 mm to 25 mm , and more preferably 2 mm to 25 mm . where the interval d 1 between adjacent protrusions is less than or equal to s 1 , the elastic member located between adjacent protrusions 53 can be reliably cut off by the protrusion 54 due to the staggered arrangement . similarly , d 2 and s 2 may be determined so that d 2 ≦ s 2 holds . when s 1 or s 2 is less than 1 mm , the embossing section 51 may fail to cut off the elastic member , and when it is greater than 25 mm , the feel / touch of the article may deteriorate due to the excessive total area of seal portions . d 1 and d 2 are also preferably in the range of 1 mm to 25 mm , and d 1 is more preferably 2 mm to 25 mm . where diamond - shaped protrusions are used , if a protrusion in a row has little overlap with the closest protrusion in an adjacent row in the row direction , the elastic member may fall between adjacent seal portions , and the embossing section 51 may thereby fail to cut off the elastic member , depending upon the arrangement of the protrusions . in view of this , d 2 is more preferably 3 mm to 10 mm . when a portion of the combined web is to be melted , the width w 1 of the rectangular protrusions and the length of the short axis w 2 of the diamond - shaped protrusions are preferably 0 . 5 mm to 15 mm . when the first sheet 10 and the elastic member are cut off , w 1 is preferably several microns to about 0 . 5 mm . when they are greater than 15 mm , the feel / touch of the manufactured article may deteriorate due to the excessive total area of seal portions . the lower limit of w 2 is preferably 1 mm or more . while the distance between adjacent rows of protrusions is not limited to any particular value , m 1 or m 2 is preferably 1 mm to 25 mm . the protrusions may have a shape other than a rectangular shape and a diamond shape as described above , including a slanted rectangular shape , a circular shape , a triangular shape , a star shape , a heart shape , a clover shape , a crescent shape , other polygons , etc . the shape of the protrusions maybe varied for different rows . [ 0044 ] fig4 schematically illustrates elastic members 22 and 23 having been cut off . it is assumed that the combined web is advanced downwardly in fig4 . the area 11 is the adhesive portion and the area 12 is the non - adhesive portion . the left - hand side elastic member 22 is cut off by a seal portion 70 ( corresponding to the protrusion 53 ). an end portion 22 a of the elastic member 22 is released from the tension and shrink toward the elastic member 22 bonded on the sheet . if the remaining part of the elastic member is caught by the protrusion 55 before completion of the cutting off by the protrusion 53 , an elastic member 22 b between the protrusion 53 and the protrusion 55 shrinks toward a seal portion 72 when the elastic member is cut off by the protrusion 53 . if the cutting off by the protrusion 53 is completed before the remaining part of the elastic member is caught by the protrusion 55 , the elastic member 22 b will shrink toward the elastic member existing in the downstream adhesive portion ( not shown ). the right - hand side elastic member 23 is cut off by a seal portion 71 ( corresponding to the protrusion 54 ), and an end portion 23 a thereof shrinks . with the arrangement described above , the elastic member is cut off and a large number of small seal portions are formed in the non - adhesive portion , whereby the upper and lower sheets are bonded together also in the non - adhesive portion . since the seal portions are separated from one another and each have a small size , they are less likely to give discomfort to the wearer than when they are provided as a continuous line even when they are heat - sealed into a film . [ 0047 ] fig7 a is a diagram illustrating an exemplary adhesive applicator 13 a . the adhesive applicator 13 a includes a gun member 100 for spraying an adhesive ( a hot melt in the following description ) while positively charging the hot melt , and a conductive member 101 which is located under the first sheet 10 and is grounded or negatively charged . generally , not all of the hot melt sprayed from the gun member 100 is attached to the sheet , but a portion thereof is left floating in the air . however , by charging the hot melt as described above , it is possible to efficiently attach the hot melt to the sheet , and to reduce the amount of hot melt to be scattered with respect to the width direction of the sheet , thereby improving the widthwise precision . a voltage of the same polarity as the hot melt may be applied to portions where it is not necessary to apply the hot melt . it is possible to improve the positional precision of the attachment of the hot melt in the flow direction , which is transverse to the width direction , by controlling the period in which the hot melt is output and the potential of the gun member 100 or the conductive member 101 . the polarities of the applied voltages may be reversed from that described above . the conductive member 101 may be provided in the form of a plurality of plates 101 a and 101 b as illustrated in fig7 b . for example , when the hot melt is applied on areas separated by a predetermined interval by using a plurality of gun members 100 , the hot melt application maybe performed with the interval between adjacent hot melt - applied areas being the interval between the plates 101 a and 101 b . alternatively , the conductive member 101 may be provided in the form of a roller 102 as illustrated in fig7 c . the roller 102 rotates in synchronism with the first sheet 10 . the roller 102 includes a conductive portion 103 and a non - conductive portion 104 . as described above , the hot melt is charged to a potential of the first polarity , and the conductive portion 103 is grounded or charged to a potential of the opposite polarity to the first polarity . the shape of the conductive portion 103 is determined based on the shape of the area of the first sheet 10 on which the hot melt is to be applied . the gun member 100 is controlled to output the hot melt a predetermined time before the leading edge of the area on which the hot melt is to be applied passes by the gun member 100 , and to stop outputting the hot melt a predetermined time before the trailing edge of the area on which the hot melt is to be applied passes by the gun member 100 . with such an arrangement , it is possible to attach the hot melt to an area substantially equal to the intended area on which the hot melt should be applied . the roller 102 may be positioned upstream of the gun member 100 . it is understood that the adhesive applicator as described above maybe used for manufacturing articles other than disposable worn articles . nothing may be sandwiched between the first sheet and second sheet after the application of the hot melt , or a member other than the web materials may be adhered by the hot melt after the application of the hot melt . the hot melt adhesive may be continuously applied without providing a non - adhesive portion . this may be a more preferred embodiment than when the adhesive portions and the non - adhesive portions are alternately provided , because it is possible , in the former embodiment , to further increase the production line speed . the elastic member may be sandwiched between sheets on which an adhesive has been continuously applied and then passed between the embossing roll and the counter roll , so as to cut off only the elastic member without cutting off the sheets . after the cutting process , each elastic member 24 is held by two ( or three or more ) seal portions 59 and 59 , as illustrated in fig5 while being relaxed . therefore , even when the coating of the hot melt adhesive is continuous , the seal portion can be made non - elastic by changing the type and / or amount of the hot melt adhesive and / or the spraying direction thereof . it is believed that where the elastic member is cut off by heat , the hot melt adhesive is re - melted and softened by the heat of the embossing roll , so that the anchoring force on the elastic member by the hot melt adhesive is reduced and the elastic recovering force of the elastic member overcomes the anchoring force , whereby the elastic member is bonded to the seal portion while being relaxed . next , a second embodiment of the present invention will be described . the second embodiment employs , instead of the embossing roll having protrusions spaced apart from one another , an embossing roll including depressions having a length of 1 mm to 25 mm and a width of 0 . 5 mm to 15 mm and a latticed protrusion ( ridges ) having a width of 0 . 5 mm to 5 mm . as illustrated in fig6 the latticed protrusion 63 includes a large number of ridges 61 , 61 , . . . , which are arranged in the form of parallel crosses , with each space 62 surrounded by the ridges 61 being a depression . w 3 denotes the width of each ridge , which is 0 . 5 mm to 5 mm . an excessively large width of the ridges may deteriorate the feel / touch of the manufactured article , while the ridges having a width smaller than 0 . 5 mm may possibly cut off the sheet . d 3 is the length of each depression , which is preferably 5 mm to 25 mm , and more preferably 5 mm to 10 mm . m 3 is the width of each depression , which is preferably 5 mm to 25 mm , and more preferably 5 mm to 10 mm . while fig6 shows a slanted lattice pattern , the pattern may alternatively be any other polygonal lattice pattern such as a square lattice pattern or a rectangular lattice pattern . in this embodiment , the seal portions are in a lattice pattern , whereby it is possible to reliably cut off the elastic member . moreover , since the latticed protrusion made up of narrow ridges extends across a sufficiently large area in a meshed pattern , the elastic member can be cut off by any of the seal portions . where the sealing is provided by using a single line blade , all the elastic members need to be cut off by the single line blade , whereby it is necessary to perform strong sealing so that no elastic member is left uncut . as a result , the sheet may possibly be cut off . with the above - described arrangement , the elastic member can be cut off by any of the seal portions . therefore , the sheet will not be cut off because it is not necessary to perform strong sealing and the contact surface between the sheet and the protrusion is increased . moreover , such a latticed seal portion gives the wearer a soft feel / touch , and also is aesthetically desirable . also in the second embodiment , the sheet may include hot melt adhesive portions and non - adhesive portions , or the hot melt adhesive may be continuously applied on the sheet without providing the non - adhesive portions . at least one of the embossing roll 50 and the counter roll 60 illustrated in fig1 may include a heating member . moreover , other heating members such as a rod - shaped sheathed heater , a high - frequency heating member , afar infrared heater , or an oil heater , maybe additionally provided in the vicinity of these rolls . in the arrangement of fig1 the positions of the embossing roll 50 and the counter roll 60 may be reversed . it is preferred that either the first sheet 10 or the second sheet 30 is heat sealable . applicable types of sheet include non - woven fabric , a plastic film , knit fabric , woven fabric , paper , etc . applicable sheet materials include known materials such as a polypropylene , a polyethylene , a polyester , a cellulose , a rayon , etc ., which can be used alone or in combination of two or more . each of the sheets 10 and 30 may be a multi - layer sheet including a number of sheets laminated together . in such a case , a heat sealable sheet should be provided on the uppermost surface of the first sheet 10 or on the lowermost surface of the second sheet 30 . the elastic member may be made of a material that can be cut off by heat ( e . g ., a thermoplastic polyurethane , an elastomer , a rubber , etc . ), and may be provided in the form of a ribbon or a string . a film - shaped elastic member ( e . g ., an elastomer film ) can also be used because it can be reliably cut off by seal portions arranged in a staggered pattern or a lattice pattern . it is preferred that the elastic member has a melting point that is lower than that of the heat sealable material of the second sheet so that the second sheet will not be cut off . the melting point of the second sheet may be higher than that of the first sheet . while fig1 illustrates an example where the elastic member is adhered in the widthwise central portion of the sheet , the elastic member may alternatively be adhered near the edge of the sheet . in such a case , the emboss pattern can be changed according to the position of the elastic member . according to the present invention , the seal portions can be made non - elastic after the heat seal process not only in the case where an adhesive is applied so as to provide non - adhesive portions and adhesive portions but also in the case where the adhesive application is continuous . therefore , an elastic sheet having alternating elastic and non - elastic portions can be continuously manufactured .	8
the fig1 - 3 show the profile of a compensator according to the invention , specifically with the right half of a second along the longitudinal axis . all the hatched surfaces designate a section through an annular portion in each case . all profiles are self - contained , that is to say encircle the longitudinal axis 31 to the extent of a full 360 degrees . in fig1 to 2 , this longitudinal axis 31 — also termed “ longitudinal direction 31 ”— is doubly inflected in its profile , as a result of which it is illustrated by what dimension the second pipe socket 2 — shown below in the figures — is offset with respect to the first pipe socket 1 — shown at the top in the drawings . in fig3 , the longitudinal axis 31 is drawn as a continuous line , because in the illustrated operating state of the third exemplary embodiment , the first pipe socket 1 is axially aligned with the second pipe socket 2 . in fig1 , in the drawing , the second pipe socket 2 is offset to the right and downward with respect to the first pipe socket 1 . the two exterior surfaces 11 and 21 of the first and second pipe sockets 1 , 2 are therefore not aligned with one another . in the axial direction , the maximum possible distance of the two pipe sockets has still not yet been reached , for which reason the profile of the textile fabric compensator 6 is still additionally wrinkled . in fig1 , the most general case of the invention is illustrated . here , on the outlet opening 12 of the first pipe socket 1 , the nozzle d is fastened . in fig1 , it very quickly becomes clear that , in nozzle d , the inner radius 13 of the first pipe socket 1 is reduced . as with a venturi nozzle , the flow velocity in this region is thereby increased and a subatmospheric pressure occurs between the nozzle d and the adjacent inlet guide plate 7 . this subatmospheric pressure prevents flue gas and solid bodies contained therein from penetrating into the hollow space between the inlet guide plate 7 and inlet pipe 4 as a result of the — unavoidable — gap between the inlet guide plate 7 and the nozzle d . the inlet guide plate is fastened on the inlet pipe 4 via a plurality of bridges 72 , which are in each case radially oriented . in fig1 , it can be easily understood that the inlet guide plate 7 can be displaced in a radial direction with respect to each bridge 72 . fig1 shows that each of the two pipe sockets 1 , 2 bears on its exterior surface 11 , 21 the inlet pipe 4 and the outlet pipe 5 that is adjacent thereto . the outer surface 11 of the first pipe socket 1 is aligned with the outer surface of the inlet pipe 4 and the outer surface 21 of the second pipe socket 2 is aligned with the outer surface of the outlet pipe 5 . approximately in the centre of the figure , it can be seen that the outer surface of the outlet pipe 5 is distanced from the outer surface of the inlet pipe 4 in a radial direction . this distance occurs as a result of the required movement of the pipe socket 2 with respect to the first pipe socket 1 . the joint formed thereby is covered by the permanently flexible fabric compensator 6 , which is fastened by means of a plurality of clamps on a surrounding , l - shaped flange on the inlet pipe 4 and on the outlet pipe 5 . the resistance to solid bodies that press directly on the flexible fabric compensator , however , is very limited . a permanent exposure to very high temperatures , such as those possessed by the through - flowing gas 3 , also takes its toll on the lifetime of the flexible fabric compensator . in fig1 , it is made clear that in the illustrated , simplest version , despite the shielding inlet guide plate 7 , solid bodies can nevertheless pass through the gap between the inlet guide plate 7 and the second pipe socket 2 and can settle in the fabric compensator through the gap between the inlet pipe 4 and the outlet pipe 5 . such contamination would be extremely disadvantageous for two reasons : first , the hard ash particles very rapidly damage the fabric compensator , second the ash components and other solid bodies within the fabric compensator very rapidly cool down , since the latter cannot provide extensive thermal protection . by means of this cooling , the ash components clump together and form even larger solid bodies , which can very probably damage the flexible fabric compensator . to avoid these disadvantages , the inventions propose additional embodiments , which are illustrated in fig2 and 3 . fig2 shows the same cross - section as in fig1 , but with additional fittings in in an operating state in which the second pipe socket 2 departs to the left with respect to the first pipe socket 1 , which is also made clear in fig1 by the altered “ bend ” of the longitudinal axis 31 . the altered operating state is also recognisable by the changed form of the fabric compensator 6 . in fig2 , the inlet ring 41 in the inlet pipe 4 is shown as an additional embodiment . it bridges the distance between the outer lying inlet pipe 4 and the inner lying inlet guide plate 7 and in this version further seals the inlet guide plate 7 . furthermore , the function of the inlet ring 41 consists in protecting the insulation and delimiting the dead space . it is not considered as an essential function of the inlet ring 41 to support the inlet guide plate 7 . in the inlet ring 41 , a protrusion 42 is introduced , which projects into a recess 52 on the outlet ring 51 , which recess is complementary to the protrusion but enlarged by a specific distance . in fig2 , it can be seen that this recess 52 is so much bigger than the silhouette of the protrusion 42 that the protrusion 42 is , in all movement states of the second pipe socket 2 , movable with respect to the first pipe socket 1 within the recess 52 . as a further embodiment , fig2 shows the outlet guide plate 8 between the inlet guide plate 7 and the second pipe socket 2 . in fig2 , it can be readily seen that the outlet guide plate 8 is multipart , since it consists of a plurality of segmented hollow cylinders , which always complement one another independently of their temperature and thereby independently of their expansion , to form a ring of constant radius . in the embodiment shown in fig2 , these segments are connected to the outlet ring 51 , which is fastened on the outlet pipe 5 . it thereby becomes possible to position the outlet guide plate 8 directly on the inner edge of the second pipe socket 2 . the embodiment in fig2 shows a conical tapering of the inlet opening 22 , which simultaneously merges into the outlet guide plate 8 . at the edge between the outlet guide plate 8 and the second pipe socket 2 , excessive turbulence is thereby avoided and the risk thereby reduced of a multiplicity of further solid particles being forced into the gap between the outlet guide plate 8 and inlet guide plate 7 . in fig3 , another development of the most general form shown in fig1 of a compensator according to the invention is shown . in this variant , the planes of the inlet ring 41 and of the outlet ring 51 are inclined with respect to the longitudinal axis 31 of the compensator . with a vertical design of the compensator , foreign bodies on the lower region of the outlet ring 51 can thereby fall back into the second pipe socket 2 by force of gravity . in fig3 , a barrier air system with double air chambers is shown . the inner air chamber forms in the dead space between the inlet guide plate 7 , the inlet ring 41 with the protrusion 42 disposed thereon and the outlet ring with the recess 52 disposed thereon . this inner air chamber , in the embodiment according to fig3 , is closed outwardly by means of a flexible sealing element 61 , which keeps pulsations in the inner air chamber away from the outer air chamber , the pressure chamber 62 , or at least strongly dampens them . the inner air chamber can be subject to barrier air by means of the barrier air connections s and s 1 , which prevents the foreign bodies and particles from penetrating . it also keeps back the flue gases from penetrating into the dead space , where they might cool and thereby form a crust . in fig3 , a second operating state of the barrier air concept in the inner air chamber is also illustrated . if , with a vertical arrangement of the compensator , foreign particles that have penetrated into the recess 52 of the outlet ring remain there and thereby restrict the mobility of the recess 52 with respect to the protrusion 42 , or block it , barrier air can be supplied via the upper barrier air connection s and air sucked out of the lower barrier air connection s 2 . in the process , foreign bodies that have settled in the protrusion 52 are entrained by the air stream and conveyed to the outside . in the embodiment according to fig3 , by means of the flexible sealing element , the inlet pipe , the outlet pipe and the fabric compensator , a further air chamber , the pressure chamber 62 , is created . it can be set under permanent superatmospheric pressure by virtue of the barrier - air connection s 1 . in fig3 , it is very readily understandable that the fabric compensator 6 is thereby decoupled from the pulsations in the adjacent dead space between the inlet ring 41 and the outlet ring 51 , and it is thus prevented that the pulsations act directly on the fabric compensator 6 , and set it into “ fluttering movement ”, which would result in rapid wear . instead , the pulsations remain restricted as a breathing on the inner dead space between the inlet ring 41 and outlet ring 51 . fig3 clearly shows the two barrier air circuits separated from one another by the flexible sealing element 61 , of which the inner one breathes between the inlet ring 41 and outlet ring 51 and the outer one , the pressure chamber 62 , is subject essentially to a constant pressure . 3 gas streams from the first pipe socket 1 through the inlet pipe 4 and the outlet pipe 5 into the second pipe socket 2 31 longitudinal direction of the compensator , corresponds to the longitudinal axis and the flow direction of the gas 3 4 inlet pipe between the first pipe socket 1 and the outlet pipe 5 5 outlet pipe , between the inlet pipe 4 and the second pipe socket 2 6 fabric compensator , connects inlet pipe 4 to the outlet pipe 5 61 flexible sealing element , between the inlet pipe 4 and the outlet pipe 5 62 pressure chamber , between the fabric compensator 6 and the flexible sealing element 61 7 inlet guide plate , within the inlet pipe 4 , connecting with the pipe socket 1 8 outlet guide plate , between the inlet guide plate 7 and the outlet ring 5 9 coupling guide plate , connects the inlet guide plate 7 and outlet guide plate 8 d nozzle in the outlet opening 12 of the first pipe socket 1 s 2 second connection for barrier air for pressurization or draining of the inner dead space between the inlet ring 41 and outlet ring 51	5
the inventive insulation material contains the following ingredients at the indicated weight percentage levels based upon the weight of the inventive material . ______________________________________ingredients broad preferred______________________________________inorganic fiber 35 - 75 60 - 70inorganic binder 15 - 35 18 - 21hydrophilic particulate inorganic 4 - 10 5 - 7materialpolymer 0 . 5 - 5 1 - 3setting agent 0 - 6 1 - 4opacifier 0 - 15 7 - 10______________________________________ the inorganic fiber can be a glass fiber , a mineral wool fiber , a ceramic fiber , a refractory fiber or the like . preferably , the fiber utilized will have a temperature resistance of at least about 1400 ° f ., most preferably at least about 2300 ° f . additionally , it is preferred that the inorganic fiber be a low shot content fiber as this will allow amounts of fiber to be utilized down toward the lower end of the weight percentage range . examples of inorganic binders which can be utilized include but are not limited to colloidal silica , ethyl silicate , ammonium phosphate , aluminum phosphate , colloidal alumina , zirconium acetate , and aluminum chloride . colloidal silica is preferred because of its availability ; its ability to adjust setting characteristics and / or control bond migration during product drying ; and its compatibility with other organic additives . the hydrophilic particulate inorganic material employed in the present invention acts as both a filler and a bulking agent ( to absorb and retain water ). as used herein , the term hydrophilic signifies the ability of the particulate material to do the latter . the surface area of the hydrophilic material will generally be greater than about 100 m 2 / g , preferably greater than about 150 m 2 / g . examples of hydrophilic particulate material which can be utilized in the present invention include but are not limited to fumed silica , precipitated silica , micron size synthetic amorphous silica , and other fumed oxides . at least one polymer selected from the group consisting of ( a ) polyalkylene oxides , ( b ) cellulose ethers , ( c ) polyalkylene glycols ; and ( d ) copolymers of vinyl amides and acrylic acids is employed in the present invention . examples of the foregoing polymers which can be utilized in the present invention include but are not limited to polymers of ethylene oxide ; propylene oxide ; hydroxyethyl cellulose ; hydroxymethyl cellulose ; polyethylene glycol ; acrylamide - acrylate copolymers ; methylacrylamide - acrylate copolymers ; and the like . the organic polymer helps to provide good extrusion and molding characteristics for the mixture . it is believed that the organic polymer assists in water retention during formation of the insulation product ; helps control drying shrinkage ; and assists in the bonding of the insulation to metal surfaces such as aluminum . it is preferred that the inorganic binder and polymer employed in the present invention have maximum compatibility with one another . thus , the binder employed for use should preferably have as minimum a tendency as possible to degrade the particular polymer employed . colloidal silica , the preferred binder of the present invention , has been found to be compatible with all three different types of polymers . it is preferable , though , to use colloidal silica with ethylene oxide . alkylene oxides have been found to be particularly compatible with ethyl silicate and colloidal aluminum . cellulose ethers have been found to be particularly compatible with aluminum phosphate , ammonium phosphate , zirconium acetate , and aluminum chloride . in a preferred embodiment , the inorganic binder may be set by any suitable method known to those skilled in the art . generally , the mechanism to set the binder will be by gelation using either an organic , e . g . cationic starch , or inorganic , e . g . setting agent . it may also be preferable to employ an opacifier in the present invention where enhanced thermal conductivity is desired . examples of suitable opacifying agents include silicon carbide , titania , and magnesium oxide . the inventive insulation material is made by first forming an aqueous slurry of the ingredients . the solids content of the aqueous mixture will preferably be from about 20 - 40 wt %, most preferably from about 27 - 37 wt %. water is employed to help control the density of the final insulation product and also to provide extrusion and molding characteristics without the compression and density increase of the insulation during its installation . the mixture is then formed into the desired shape . if it is desired to set the product as described herein earlier , the setting agent is then added . afterwards , the shaped mixture is dried into an insulation product . generally , the inventive insulation material will have a density in the range of from about 12 - 30 p . c . f ., preferably about 15 - 22 p . c . f . 18 - 26 pound per cubic foot density samples of the inventive insulation material were made from a mixture of the following ingredients : ______________________________________ weight %, dry wt . ______________________________________1 . refractory fiber ( chrome fiber ) 60 gms 61 . 22 . fumed silica 6 gms 6 . 13 . colloidal silica ( nyacol 215 ) 121 gms ( 18 gm dry ) 18 . 44 . cationic starch setting agent 2 gms 2 . 05 . polyethylene glycol polymer 1 gm 1 . 06 . acrylamide - acrylate copolymer 1 gm 1 . 0 ( nalco ® 2332 ) 7 . magnesium oxide opacifier 10 gm 10 . 28 . water 130 gm total weight wet 326 gm total weight dry 98 gm 99 . 9______________________________________ 60 gms of loose bulk refractory fiber along with 6 gms of fumed silica , 2 gms of starch , 1 gm of polyethylene glycol polymer ( ws - 301 , available from union carbide company , danbury , conn . ), and 10 gms of magnesium oxide was placed into a 3 liter capacity hobart mixer . one gm of nalco ® 2332 acrylate - acrylamide copolymer ( available from nalco chemical company of oak brook , ill .) polymer was placed on the lower portion of the mixing blade . the mixer was turned on at low speed and the 100 ml ( 100 gms ) of water was slowly added . the material was then allowed to mix for approximately 30 seconds . next the full 110 milliliters ( 121 gms ) of colloidal silica was added while the material continued to be mixed . the material was allowed to mix for an additional 15 to 30 seconds . the speed of the mixer was turned up to medium and the material was blended for an additional 15 to 30 seconds . the formed mixture was then molded or formed into place using hand lay up techniques . after the material was formed into place it was either air or oven dried . for oven drying the oven temperature was set between 220 ° to 230 ° f . to remove all of the water , and depending upon product thickness and air movement within the oven , the product was dried for approximately 8 hours . after the product was dried it was smoothed to final shape using sanding and grinding tools . various properties of the samples of the inventive insulation material were measured with the average results obtained as follows : ______________________________________ astmproperty measured average results test method______________________________________density , pcf 18 - 26 c303linear fired shrinkage (%) c356after 24 hr exposure at220 ° f . 0 . 5220 ° f . 0 . 31800 ° f . 1 . 0thermal conductivity c518btu / in / ft . sup . 2 /° f ./ hr . at550 ° f . 0 . 54800 ° f . 0 . 781000 ° f . 0 . 91thermal shock resistance , pass5 cycles 1800 ° f . 1 hr ./ quench in 70 ° f . wateradhesion on aluminum plateafter oven drying goodafter 4 hr . soaking goodexposure at 500 ° f . loi , wt % loss 1 - 4______________________________________ the foregoing data show that the inventive insulation material has a low density , low thermal conductivity , bonds well to metal surfaces , e . g . aluminum , and has good thermal shock resistance . reasonable modifications and variations are possible from the foregoing disclosure without departing from either the spirit or scope of the invention as defined in the claims .	2
the following detailed description is of the best presently contemplated modes of carrying out the invention . this description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating general principles of embodiments of the invention . the scope of the invention is best defined by the appended claims . fig1 illustrates a conventional hand gun 100 that can be used with the accessories of the present invention . the gun 100 has slide rails 121 and 122 provided on the opposite lower sides of the barrel 110 , and are parallel to the axis 111 of the barrel 110 . a locating groove 123 is provided at the bottom of the barrel 110 , and is transverse to the axis 111 of the barrel 110 . referring now to fig2 to 4 , a gun accessory 200 according to one embodiment of the present invention has a main body 210 , locating pins 221 and 222 , locating bars 230 and 240 , elastic elements 251 and 252 ( e . g ., spring plates ), a laser sight 260 , and a light source 270 ( e . g ., a flash light ). the laser sight 260 is disposed on the bottom of the main body 210 , and the light source 270 is screwed and secured to the front of the main body 210 . the light source 270 functions to assist users in aiming at targets , or to provide lighting under dim or dark surroundings . as shown in fig2 - 4 , each of the two opposite sides on the upper surface 213 of the main body 210 is provided with a respective side wall 215 and 216 that extends upwards to form a somewhat u - shaped structure . each side wall 215 and 216 is provided with a respective inwardly - facing slide groove 211 and 212 , respectively , that is adapted to correspond to the slide rails 121 and 122 , respectively , provided on opposite sides of the hand gun 100 shown in fig1 , such that the gun accessory 200 can be slidably connected with the gun 100 ( as shown in fig3 ). also , the size and shape of the slide grooves 211 and 212 are sized and configured to be complementary to those of the slide rails 121 and 122 , respectively , of the hand gun 100 . as an alternative , it is possible to provide slide rails ( not shown ) on the main body 210 that can be slidably received by corresponding slide grooves 131 and 132 provided on opposite sides of the gun 100 . in addition , the side walls 215 and 216 are provided with locating holes 217 and 218 , respectively . the locating hole 217 is adapted to receive a portion of the locating pin 221 , the locating bar 230 , and the spring plate 251 , and the locating hole 218 is adapted to receive a portion of the locating pin 222 , the locating bar 240 , and the spring plate 252 . the locating pins 221 and 222 extend through bores in the main body 210 and are secured inside the locating holes 217 and 218 , respectively , and each locating pin 221 and 222 provides a rotating axis that extends in the same direction as the slide grooves 211 or 212 , respectively . the locating bar 230 has a generally l - shaped configuration and includes a baffle 231 , a press plate 232 , and a through hole 233 . the locating pin 221 passes through the through hole 233 to secure the locating bar 230 in the locating hole 217 such that the locating bar 230 can utilize the locating pin 221 as a rotating axis and thereby pivotably connect the locating bar 230 to the main body 210 . the locating bar 240 also has a generally l - shaped configuration and includes a baffle 241 , a press plate 242 , and a through hole 243 . the locating pin 222 passes through the through hole 243 to secure the locating bar 240 in the locating hole 218 such that the locating bar 240 can utilize the locating pin 222 as a rotating axis and pivotably connect the locating bar 240 to the main body 210 . the spring plate 251 is disposed between the press plate 232 and the main body 210 , and the spring plate 252 is disposed between the press plate 242 and the main body 210 . to enable the gun accessory 200 to easily and conveniently slide into the hand gun 100 , the baffles 231 and 241 are provided with bevel planes 234 and 244 , respectively . when the slide grooves 211 and 212 of the gun accessory 200 are slid into the barrel of the hand gun 100 through the slide rails 121 and 122 , respectively , the bevel planes 234 and 244 of the baffles 231 and 241 contact against the barrel of the hand gun 100 . the barrel continues to slide upwardly along the bevel planes 234 , 244 , thereby biasing the baffles 231 and 241 downwardly against the normal bias of the spring plates 251 and 252 , respectively . from the orientation shown in fig4 , the locating bar 230 is pivoted in a counterclockwise direction about the pivot axis 221 , and the locating bar 240 is pivoted in a clockwise direction about the pivot axis 222 . the slide grooves 211 and 212 of the gun accessory 200 then continue to slide along the slide rails 121 and 122 until the locating bars 230 and 240 reach the locating groove 123 of the hand gun 100 , at which time the spring forces of the spring plates 251 and 252 will naturally bias or push the press plates 232 and 242 , respectively , away from the main body 210 ( i . e ., towards the locating groove 123 ) and in turn push the baffles 231 and 241 , respectively , such that the baffles 231 and 241 protrude above the plane of the upper surface 213 of the main body 210 to be locked into the locating groove 123 of the hand gun 100 . from the orientation shown in fig4 , the locating bar 230 now is pivoted in a clockwise direction about the pivot axis 221 , and the locating bar 240 is pivoted in a counterclockwise direction about the pivot axis 222 . thus , the accessory 200 can be easily and quickly secured to the hand gun 100 during operation of the hand gun 100 . to remove the gun accessory 200 from the hand gun 100 , a user can use his or her fingers to press the press plates 232 and 242 on the respective sides of the main body 210 to overcome the spring force of the spring plates 251 and 252 , such that the press plates 232 and 242 push the baffles 231 and 241 downward to disengage the locating groove 123 of the hand gun 100 . the gun accessory 200 can then be pushed away from the hand gun 100 along the slide rails 121 and 122 so as to remove the gun accessory 200 from the hand gun 100 . in addition , the press plates 232 and 242 are provided with respective slide - proof grooves 245 to prevent the user &# 39 ; s fingers from sliding away from the press plates 232 and 242 when the user presses the press plates 232 and 242 . fig5 - 7 illustrate a second embodiment of a gun accessory 500 which is similar to the accessory 200 in fig2 - 4 . as a result , the same numeral designations shall be used in both embodiments to designate the same element , except that the elements in fig2 - 4 shall begin with a “ 2 ” and the elements in fig5 - 7 shall begin with a “ 5 ”. the accessory 500 includes a main body 510 , locating pins 521 and 522 , locating bars 530 and 540 , elastic elements 551 and 552 ( e . g ., spring plates ), a laser sight 560 , and a light source 570 ( e . g ., a flash light ). when compared with the gun accessory 200 shown in fig2 - 4 , the accessory 500 is different in that the locating bars 530 and 540 , and the locations of the locating holes 517 and 518 of the main body 510 , are different . in the accessory 200 of fig2 - 4 , the through holes 233 and 243 are disposed at the end of the locating bars 230 and 240 away from the press plates 232 and 242 , the baffle 231 is disposed between the through hole 233 and the press plate 232 , and the baffle 241 is disposed between the through hole 243 and the press plate 242 . consequently , the protrusions of the baffles 231 and 241 , as well as the bevel planes 234 and 244 , are positioned on the exterior of the l - shape structure , such that each locating bar 230 and 240 is oriented in an inverted l shape ( when viewed from the front of the light source 270 in fig4 ) into the respective locating hole 217 and 218 of the main body 210 . in contrast , the through hole 533 of the locating bar 530 in fig5 - 7 is disposed between the baffle 531 and the press plate 532 , and similarly , the through hole 543 of the locating bar 540 is also disposed between the baffle 541 and the press plate 542 . in addition , the baffles 531 and 541 are disposed at the end of locating bars 530 and 540 away from the press plates 532 and 542 , respectively . consequently , the protrusions of the baffles 531 and 541 , as well as the bevel planes 534 and 544 , are positioned on the interior of the l - shape structure , such that the locating bars 530 and 540 are oriented in a normal l shape ( when viewed from the front of the light source 570 in fig7 ) into the respective locating hole 517 and 518 of the main body 510 . to enable the gun accessory 500 to easily and conveniently slide into the hand gun 100 , the baffles 531 and 541 are provided with bevel planes 534 and 544 , respectively . when the slide grooves 511 and 512 of the gun accessory 500 are slid into the hand gun 100 through the slide rails 121 and 122 , respectively , the bevel planes 534 and 544 of the baffles 531 and 541 contact against the barrel of the hand gun 100 . the barrel continues to slide upwardly along the bevel planes 534 , 544 , thereby biasing the baffles 531 and 541 downwardly against the normal bias of the spring plates 551 and 552 , respectively . from the orientation shown in fig7 , the locating bar 530 is pivoted in a clockwise direction about the pivot axis 521 , and the locating bar 540 is pivoted in a counterclockwise direction about the pivot axis 522 . the slide grooves 511 and 512 of the gun accessory 500 then continue to slide along the slide rails 121 and 122 until the locating bars 530 and 540 reach the locating groove 123 of the hand gun 100 , at which time the spring forces of the spring plates 551 and 552 will naturally bias or push the press plates 532 and 542 , respectively , away from the barrel of the gun 100 and in turn push the baffles 531 and 541 , respectively , such that the baffles 531 and 541 protrude above the plane of the upper surface 513 of the main body 510 to be locked into the locating groove 123 of the hand gun 100 . from the orientation shown in fig7 , the locating bar 530 now is pivoted in a counterclockwise direction about the pivot axis 521 , and the locating bar 540 is pivoted in a clockwise direction about the pivot axis 522 . to remove the gun accessory 500 from the hand gun 100 , a user can use his or her fingers to press the press plates 532 and 542 on the respective sides of the main body 510 to overcome the spring force of the spring plates 551 and 552 , such that the press plates 532 and 542 push the baffles 531 and 541 downward to disengage the locating groove 123 of the hand gun 100 . the gun accessory 500 can then be pushed away from the hand gun 100 along the slide rails 121 and 122 so as to remove the gun accessory 500 from the hand gun 100 . as a result , the gun accessories 200 and 500 can be conveniently installed by a simple sliding action , and conveniently removed by simply pressing the press plates 232 , 242 , 532 , 542 and then sliding the accessory 200 , 500 off the barrel 110 of the gun 100 . in addition , the mechanisms that secure the accessory 200 , 500 to the gun 100 provide for enhanced operating stability . while the description above refers to particular embodiments of the present invention , it will be understood that many modifications may be made without departing from the spirit thereof .	5
fig2 a - 2 f are sectional side views which show the system according to a preferred embodiment of the present invention and comprises a system to orient and precisely place a log on a carriage in a way to maintain the precise orientation . in accordance with the present invention fig2 a shows logs 50 being presented by a conveyor 52 one at a time in a controlled fashion via stop and loader arm 54 to a log presentation station 56 wherein each log 50 is rotated in a precision manner by log turners , which suitably comprise chain turners ( not shown ) which move upwardly and engage , for example , the underside of the log . the chain turners rotate , whereby the log is caused to rotate so that the log is rotationally oriented to a desired degree so that the desired cutting configuration is produced . the position to which the log is rotated is suitably determined based on scan data from an earlier scan of the log , and this data is used to determine an optimal rotational orientation of the log to provide a desired position for a best opening cut . what is considered “ best ” may depend on many factors and may change from moment to moment , depending on whether logs are to be cut for maximum yield of particular dimensions of wood , maximum profit , or any other decision base . the invention provides the device which rotates the log , using the prior scan data of the log , to the determined log orientation to then provide the desired rotational orientation of the log . the system thus rotates the log so that it is in the desired orientation . then , a pair of chargers each having a set of extendible arms 59 which include overhung v - shaped channels 60 into which the log is carried , move up into spaces between the individual rotation devices , whereby the log is lifted while maintaining its rotational orientation . a holding arm ( not shown in this embodiment ) can be advantageously employed . the extendible arms 59 pick the log up by bringing the v - shaped channels 60 up to take the log off the rotation device . fig2 b shows the log 50 being carried forward by the extendible arms 59 and being placed onto the carriage 62 in fig2 c maintaining a particular position and a particular rotational orientation of the log 50 . in this way , the log is now presented to the carriage in an orientation that is much more precise than in accordance with the prior art , where the initial orientation was based on chance as the log rolled onto the carriage , and the ability to rotate the log was very limited and imprecise . the carriage 62 has a number of spaced apart ways or bunks 64 ( as also shown in elevation fig3 ) which are arranged above a frame 66 . the log 50 contacts the carriage via the ways 64 on the bottom of the log and contacts horizontally adjustable headblocks 66 via knees 68 . the overhung v - shaped channels 60 of the extensible arms 59 reach over the frame 66 and enable the log 50 to make contact with the ways 64 while the log 50 is still precisely oriented in the charger . the carriage is then directed to clamp the log into place thereon , by use of tong dogs 70 , whereupon the forward edge of the v - channel moves downward enabling the extensible arms to retract away , as discussed below , leaving the log mounted on the carriage in a precision rotational orientation , ready for sawing . after the log 50 is secured onto the carriage 62 in the precise orientation as determined by the log scan analysis the extensible arms 59 of the charger 58 are able to free themselves from being pinned between the log 50 and the frame 66 by the following : the extensible arms move downwardly as shown in fig2 d transferring the weight of the log 50 to the ways 64 . then the v - shaped channels 60 are made to pivot ( fig2 e ) thereby lowering or minimizing the forward edge 72 of the charger 58 below the bottom surface of the log 50 . then the extensible arms 59 are free to be extracted from the carriage 62 ( fig2 f ). the v - channels are repositioned to pick up the next log as the charger 58 moves back to the log presentation station 56 . the system controls the operation of the carriage also , whereby it can cooperatively interact with the carriage . in order to precisely position the log , rotational scan information from a previously completed scan of the log is employed ( done to determine the size and shape and optimal cutting of the log ). presenting the log to the carriage by the system , in a precise orientation and location on the carriage . controlling the overall operation of the carriage in conjunction with operation of the log scanning and orienting system . the system provides an improvement in that the log is presented to a standard style head rig and carriage by use of the v - shaped arms , which pick the log and move it onto the carriage while maintaining the precise log orientation , and then move down and away from the log to release it . an alternative log carrying v - channel is shown in fig4 a and 4 b . extensible arms 78 include v - shaped channels 80 created by a distal movable arm 82 and a near fixed sloping surface 84 . the movable arm 82 pivotally connected at a fulcrum point 86 to each extensible arm 78 . the movable arm 82 includes a log holding side 86 and a lever arm side 88 , which form an angle with each other , with a fulcrum point 86 in the middle thereof . once the log 50 ′ is placed on a carriage ( not shown ) the lever arms 86 are raised by actuation means 89 thereby lowering the movable arm 82 enabling the extensible arms 78 to extract themselves from under the log 50 ′ in a fashion similar to that discussed and shown in fig2 d - 2 f . it should be understood the angle formed between , and the relative lengths of , the log holding side and the lever arm side can be any angle without departing from the invention . another embodiment of the invention shown in fig5 a and 5 b illustrates using a straight movable distal arm . in this version each extensible arm 90 has a v - channel 92 which includes a movable front or distal leg 94 having a log holding side 96 and a lever arm side 97 connected at a fulcrum point 98 to the extensible arms 90 . a hold down dog 100 , connected to at least one extensible arm by a suitable means , comes down on a top surface of the log to ensure the log 50 ″ stays in place . the distal arm 92 can be moved down , e . g . to a flat horizontal configuration , to “ get out of the way ” of the log when retracting away from the log after the log has been placed on the carriage . in any event , once the log is presented to the carriage , the carriage is directed to clamp the log , and then the v arms may be retracted . a flow chart of control steps is shown in fig6 . the system according to the invention suitable will control operation of the carriage and sawing . first , the log is received onto the presentation station 56 ( block 110 ), and using the data from a previously completed scan , the log is rotated to a specific orientation so that the log can be presented to the carriage in an optimal position ( step 112 ). next the system will direct the carriage to move to a position so as to be ready to receive the log thereon ( block 114 ), which may include setting the knees on the carriage so as to also configure the skew of the log when it is mounted on the carriage , whereupon the log is presented to the carriage ( step 116 ) in its optimal rotational position , in the manner discussed hereinabove . in block 118 , the system now directs the clamping system of the carriage to activate so as to secure the log in the proper position on the carriage . in block 120 , the arms are now retracted away from the carriage , and the sawing operation can now begin ( block 122 ). the advantage provided is that the log has been set and clamped to the carriage in a precise rotational orientation , so as to provide maximum control of the operation . thus , in accordance with the invention , a system of presenting a log in a precise orientation to a carriage is provided . the system enables use with a standard type carriage , such as the side loading type carriage of fig1 , enabling a precision log orientation to be provided with a standard carriage . the system can be advantageously employed with an existing log carriage of the side loading type , for example , enabling a retrofit operation to upgrade the capability and accuracy of an existing sawing operation . the system presents the log to the carriage in an accurate , precisely positioned orientation . scan information from a log scanning system is employed in the rotational determination , and the operation of the carriage ( for receiving , clamping , sawing the log ) is controllable by the system . while plural embodiments of the present invention have been shown and described , it will be apparent to those skilled in the art that many changes and modifications may be made without departing from the invention in its broader aspects . the appended claims are therefore intended to cover all such changes and modifications as fall within the true spirit and scope of the invention .	1
the detailed description of exemplary embodiments herein makes reference to the accompanying drawings , which show exemplary embodiments by way of illustration . while these exemplary embodiments are described in sufficient detail to enable those skilled in the art to practice the inventions , it should be understood that other embodiments may be realized and that logical changes and adaptations in design and construction may be made in accordance with this invention and the teachings herein . thus , the detailed description herein is presented for purposes of illustration only and not of limitation . the scope of the invention is defined by the appended claims . for example , the steps recited in any of the method or process descriptions may be executed in any order and are not necessarily limited to the order presented . furthermore , any reference to singular includes plural embodiments , and any reference to more than one component or step may include a singular embodiment or step . also , any reference to attached , fixed , connected or the like may include permanent , removable , temporary , partial , full and / or any other possible attachment option . additionally , any reference to without contact ( or similar phrases ) may also include reduced contact or minimal contact . different cross - hatching is used throughout the figures to denote different parts but not necessarily to denote the same or different materials . furthermore , any reference to singular includes plural embodiments , and any reference to more than one component or step may include a singular embodiment or step . surface shading lines may be used throughout the figures to denote different parts but not necessarily to denote the same or different materials . fig1 a illustrates a multi - layered acoustic insulation for use in aircraft compartments , in accordance with various embodiments . acoustic absorption material 100 may include an outer layer 102 . outer layer 102 may be a silicone - coated glass cloth or any other fabric resistant to high temperatures and chemicals . outer layer 102 may be temperature rated from − 65 ° f . (− 53 ° c .) to 220 ° f . ( 104 ° c .) continuously with a maximum of 550 ° f . ( 288 ° c .) for short periods of time without physical deformation or degradation . outer layer 102 may also be resistant to chemicals such as jet fuel , oils , and de - icing fluid without physical deformation or degradation . the fabric of outer layer 102 may be rated for an ambient temperature up to 500 ° f . ( 260 ° c .) while maintaining low temperature flexibility at temperatures down to − 65 ° f . outer layer 102 may have high abrasion resistance and be water , fungi , and chemical resistant . in various embodiments , acoustic absorption material 100 may include an acoustic absorption batting material 104 proximate to outer layer 102 . acoustic absorption batting material 104 may be a material with chemical and thermal resistance properties such as a flame - resistant , aramid fiber ( e . g ., nomex ®). acoustic absorption batting material 104 may be a felt material having a thickness of a quarter - inch ( 6 . 4 mm ) to an inch ( 25 . 4 mm ) or greater ( e . g ., half - inch thick nomex ® felt ). acoustic absorption batting material 104 may be affixed to outer layer 102 using adhesives , chemical and temperature resistant thread , rivets , screws , or other fasteners . acoustic absorption batting material 104 may be stitched into outer layer 102 using a chemical and heat resistant thread , for example a para - aramid thread ( e . g . kevlar ® thread ). acoustic absorption batting material 104 may have the chemical and heat resistant thread stitched around acoustic absorption batting material 104 to hold acoustic absorption batting material 104 floating in a fixed location between outer layers 102 . acoustic absorption batting material 104 may also be stitched directly to outer layer 102 with the chemical and heat resistant thread passing through acoustic absorption batting material 104 to fix acoustic absorption batting material 104 to outer layer 102 . in various embodiments , acoustic absorption material 100 may include a high - temperature , room temperature vulcanizing silicone rubber ( rtv ) 106 . rtv 106 may retain its elastomeric properties from − 65 ° f . (− 53 ° c .) to 500 ° f . ( 260 ° c .) continuously and up to 600 ° f . ( 316 ° c .) for short periods of time . rtv 106 may be coated with , or replaced by , a fluorosilicone material . acoustic absorption batting material 104 may also be dipped in rtv 106 and set in place over a surface so that acoustic absorption batting material 104 and rtv 106 are molded to a contour of the surface . rtv 106 may be stitched in place proximate to acoustic absorption batting material 104 using chemical and heat resistant thread . outer layer 102 , acoustic absorption batting material 104 , and rtv 106 may be in varying orders and varying thicknesses . the thickness of rtv 106 may be varied to adjust the weight of acoustic absorption material 100 . in various embodiments , acoustic absorption batting material 104 may absorb a portion of the acoustic energy directed towards acoustic absorption material 100 . rtv 106 acts as a barrier off which noise will reflect and allow the acoustic absorption material to absorb more acoustic energy . the rtv layers may also absorb acoustic energy with thicker rtv layers tending to being more effective absorbers of acoustic energy . acoustic absorption material 100 may provide acoustic damping in thermally and chemically demanding applications . fig1 b illustrates a multi - layered acoustic insulation for use in aircraft compartments , in accordance with various embodiments . acoustic absorption material 110 may include an outer layer 112 similar to outer layer 102 . acoustic absorption material 110 may further include an acoustic absorption batting material 118 similar to acoustic absorption batting material 104 . acoustic absorption material 110 may also include rtv 116 similar to rtv 106 . in various embodiments , acoustic absorption material 110 may include a thin fibrous layer 114 ( e . g ., fiber glass ) with outer layer 102 comprising a thin silicone layer over thin fibrous layer 114 . thin fibrous layer 114 may be affixed to outer layer 112 via adhesives , chemical and temperature resistant thread , rivets , screws , or other fasteners . fig1 c illustrates a multi - layered acoustic absorption material for use in aircraft compartments , in accordance with various embodiments . acoustic absorption material 120 may include an outer layer 122 similar to outer layer 102 . acoustic absorption material 120 may further include an acoustic absorption batting material 124 similar to acoustic absorption batting material 104 . more than one layer of acoustic absorption batting material 124 may be alternated with rtv 126 . rtv 126 of acoustic absorption material 120 may be similar to rtv 106 . fig2 illustrates a perspective view of a blanket comprising multi - layered acoustic absorption material configured for use over a cylindrical pump , in accordance with various embodiments . acoustic blanket 130 may be constructed of an acoustic absorption batting material , silicone layers , and silicone coated cloth , for example , acoustic absorption materials 100 , 110 , and 120 and arranged as described above with momentary reference to fig1 a - 1c . acoustic blanket 130 may be stitched together with kevlar thread . in various embodiments , acoustic blanket 130 may include a rear pad 132 and a front pad 134 with side pads 136 and 138 extending between front pad 134 and rear pad 132 . front pad 134 and rear pad 132 may have a height greater than side pads 136 and 138 . front pad 134 and rear pad 132 may approximate the height of the component the pads are covering . for example , the front pad and rear pad may have a height between 9 inches and 10 inches to cover a 9 - inch - tall pump . side pads 136 and 138 may be shorter to accommodate clearance of other parts . straps 140 may attach acoustic blanket 130 to pump 142 or any other component requiring noise damping . in various embodiments , acoustic blanket 130 may be designed in shape , thickness or other aspects to be compliant with aircraft conditions , including aircraft fluid resistance and thermal extremes . acoustic blanket 130 may also be designed to fit snug to the component being abated to optimize acoustic absorption . the attachment of acoustic blanket 130 may be intended to be both installable and removable without having to remove surrounding components . acoustic blanket 130 may be a stack up of acoustic absorption and dispersion materials . the core of the stack up is silicone or rtv ( e . g ., rtv 106 from fig1 a ), which is designed to disperse and absorb the bulk of airborne emissions . on either side of the silicone , there is a layer of acoustic absorption batting material ( e . g ., acoustic absorption batting material 104 from fig1 a ) designed to absorb scattered or dispersed airborne emissions that are not absorbed by the silicone . acoustic blanket 130 may include an outer layer on each side comprising silicone - coated fiberglass or silicone - coated cloth that protects the stack up from fluid and particulate contamination . the silicone in the outer layer may provide an additional ( although minor relative to other layers ) absorption capability . in various embodiments , quarter - inch - thick ( 6 . 4 mm ) silicone may be cast and cut to size to fit acoustic blanket 130 . on either side of the silicone core , a layer of acoustic absorption batting material ( e . g ., acoustic absorption batting material 104 from fig1 a ) may be affixed . the acoustic absorption batting material may have excellent thermal and chemical resistance properties . the acoustic absorption batting material may be a felt made from a flame - resistant , aramid fiber . the felt may be selected due to its acoustic absorptive properties . the batting layer may be quarter - inch thick felt ( 6 . 4 mm ), for example . in various embodiments , the silicone layer may provide significant acoustic absorption capability , depending on the thickness of the silicone layer and the angle of incidence . for example , in a pump application , acoustic blanket 130 may be fabricated with a quarter - inch thick ( 6 . 4 mm ) silicone layer will be attached around the reservoir , a reduction between 10 to 31 db is possible at a frequency of 500 hz and 16 to 37 db at a frequency of 1000 hz . in various embodiments , the fabric or outer layer of acoustic blanket 130 may be joined together using a para - aramid synthetic fiber ( e . g ., kevlar ®) thread . the thread may be sewn around the edges of acoustic blanket 130 and anywhere that access slots / flaps are required in acoustic blanket 130 . the thread may be used in high temperature applications and is chemical and fungus resistant . the blanket materials consisting of the absorption batting and the inner silicone core are then inserted into the joined case . the thread seam exposed to the blanket exterior may be treated with a seal coating of high temperature rtv that bonds well to a variety of surfaces without the need for primers . the rtv seal coat may provide a barrier preventing moisture , de - icing fluids , and fuel from entering the acoustic blanket at the thread seam holes . acoustic blanket 130 may be installed in the wheel well of an aircraft . acoustic blanket 130 may be attached , for example , to an integrated cooling system pump to abate pump noise . silicone in acoustic blanket 130 is generally solvent resistant . a fluorosilicone material may be substituted for rtv , or simply used to coat the base silicone material . in various embodiments , acoustic blanket 130 may be attached to the pump using straps 140 , which may comprise hook and loop fasteners ( e . g ., velcro ®) in conjunction with metal loops . straps 140 may be sewn onto the fabric of the outer layer using the kevlar thread and may be one inch ( 25 . 4 mm ) thick . various attachment designs may be implemented , including a metal band clamp with belt loops made from the silicone fabric material used in acoustic blanket 130 , metal bands around acoustic blanket 130 , clamps , molding , or other suitable means of attachment . fig3 illustrates a top view of a blanket comprising multi - layered acoustic insulation configured for use over a cylindrical pump , in accordance with various embodiments . acoustic blanket 130 may have a circular shape when viewed from above . front pad 134 and rear pad 132 have greater thickness than side pads 136 and 138 . front pad 134 and rear pad 132 may comprise a thicker noise absorption ( e . g ., acoustic absorption material 110 or 120 from fig1 b and 1c ) material including more layers or thicker layers than side pads 136 and 138 . side pads 136 and 138 may comprise a thinner material with fewer layers ( e . g ., acoustic absorption material 100 from fig1 a ). benefits , other advantages , and solutions to problems have been described herein with regard to specific embodiments . furthermore , the connecting lines shown in the various figures contained herein are intended to represent exemplary functional relationships and / or physical couplings between the various elements . it should be noted that many alternative or additional functional relationships or physical connections may be present in a practical system . however , the benefits , advantages , solutions to problems , and any elements that may cause any benefit , advantage , or solution to occur or become more pronounced are not to be construed as critical , required , or essential features or elements of the inventions . the scope of the inventions is accordingly to be limited by nothing other than the appended claims , in which reference to an element in the singular is not intended to mean “ one and only one ” unless explicitly so stated , but rather “ one or more .” moreover , where a phrase similar to “ at least one of a , b , or c ” is used in the claims , it is intended that the phrase be interpreted to mean that a alone may be present in an embodiment , b alone may be present in an embodiment , c alone may be present in an embodiment , or that any combination of the elements a , b and c may be present in a single embodiment ; for example , a and b , a and c , b and c , or a and b and c . systems , methods and apparatus are provided herein . in the detailed description herein , references to “ various embodiments ”, “ one embodiment ”, “ an embodiment ”, “ an example embodiment ”, etc ., indicate that the embodiment described may include a particular feature , structure , or characteristic , but every embodiment may not necessarily include the particular feature , structure , or characteristic . moreover , such phrases are not necessarily referring to the same embodiment . further , when a particular feature , structure , or characteristic is described in connection with an embodiment , it is submitted that it is within the knowledge of one skilled in the art to affect such feature , structure , or characteristic in connection with other embodiments whether or not explicitly described . after reading the description , it will be apparent to one skilled in the relevant art ( s ) how to implement the disclosure in alternative embodiments . furthermore , no element , component , or method step in the present disclosure is intended to be dedicated to the public regardless of whether the element , component , or method step is explicitly recited in the claims . no claim element herein is to be construed under the provisions of 35 u . s . c . 112 ( f ), unless the element is expressly recited using the phrase “ means for .” as used herein , the terms “ comprises ”, “ comprising ”, or any other variation thereof , are intended to cover a non - exclusive inclusion , such that a process , method , article , or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process , method , article , or apparatus .	1
the term “ comprising ” encompasses “ including ” as well as “ consisting ” e . g . a composition “ comprising ” x may consist exclusively of x or may include something additional e . g . x + y . the term “ about ” in relation to a numerical value x means , for example , x + 10 %. the word “ substantially ” does not exclude “ completely ” e . g . a composition which is “ substantially free ” from y may be completely free from y . where necessary , the word “ substantially ” may be omitted from the definition of the invention . as used herein , the term “ alkyl ” refers to a straight or branched saturated monovalent hydrocarbon radical , having the number of carbon atoms as indicated . by way of non limiting example , suitable alkyl groups include propyl , butyl , pentyl , hexyl , heptyl , octyl , nonyl , decyl , and the like . the following examples of the present invention are merely exemplary and should not be viewed as limiting the scope of the invention . an aerogel according to the invention is produced under the following conditions : within the scope of this specific example , multi - walled carbon nanotubes are used ( commercial arkema graphistrength ® multi - wall carbon nanotubes ). 14 ml of a 3 : 1 mixture of concentrated sulphuric ( 95 %, analar ) and nitric acid ( 65 % analar ) were added to 400 mg of these nanotubes . the mixture was stirred and refluxed for 30 min . after cooling , the nanotubes were recovered from the supernatant by filtration using 0 . 4 μm polycarbonate membranes ( http isopore membrane filter , millipore ) and washed with 500 ml of 0 . 01 m sodium hydroxide ( analar ). generally , this ‘ base - washing ’ may be an important step to remove oxidation ‘ debris ’ and to expose groups directly bound to the nanotubes . the solution was then washed with distilled water until the filtrate reached a neutral ph . in order to remove the water , the sample was suspended in dimethylformamide ( acs , sigma - aldrich ) and filtrated using 10 μm ptfe membranes ( lcw mitex membrane filter , millipore ). the dimethylformamide washing step was repeated up to 3 times . the resulting sample was placed under nitrogen in a rectangular 10 ml flask sealed with a septum . 1 ml of anhydrous dimethylformamide ( 99 . 8 % sigma - aldrich ) was injected using a syringe and the mixture was sonicated for 1 minute ( ultrasonic bath grant xub5 , 22 . 2 w / i ) in order to obtain a homogeneous dimethylformamide nanotube suspension . to this , 688 mg ( 10 % carbon mol ) of 1 , 3 - dicyclohexylcarbodiimide ( dcc , fluke ) was added to catalyse the esterification reaction between the alcohols and acid groups of the as - prepared oxidised nanotubes . after 12 hours the black phase — presumably composed by cross - linked nanotubes — was highly viscous and did not deform even when the flask was turned upside down . the volume fraction of the nanotubes in the gel is estimated to be 20 %. in order to avoid the collapse of the gel during the drying of the solvent , the contact angle between the solvent and the nanotubes was increased by introducing hydrophobic functional groups onto the nanotube surface . this hydrophobisation was achieved through an additional esterification with a fluorinated alcohol ; specifically , 0 . 8 ml ( 33 % carbon mol ) of 2 , 2 , 2 - trifluoroethanol ( reagentplus , ≧ 99 %, sigma - aldrich ) was added to the gel . after 12 hours the supernatant was set aside . in order to wash the sample , 2 ml of dimethylformamide were added to the gel and after 5 minutes the supernatant was set aside . the washing step was repeated up to 3 times . the objective in this case is to exchange the pore fluid with the more hydrophobic n - hexane to reduce the effective surface tension during the drying of the gel . since dimethylformamide and n - hexane are immiscible , acetone is used as an intermediate exchange agent as it is completely soluble in both liquids . solvent exchange of pore - filled dimethylformamide with acetone and subsequently , of acetone with hexane was carried out . for this purpose 2 ml of the solvent were added to the gel and after 5 minutes the supernatant was set aside . the same process was repeated 3 times with each solvent . the resulting nanotube - hexane gel was recovered with the aid of a spatula and immediately placed in a glass syringe ( 20 ml volume and 2 mm nozzle diameter ). extrusion of the gel from the syringe produced a long ( up to 10 cm ) cylindrical sample that supported its own weight in air and retained its shape in hexane ( see the images below ). after 15 minutes the resulting 2 mm diameter cylinders were separated with tweezers , taken out from hexane and dried at room temperature . no shrinkage was observed during the drying of these carbon nanotube based cylindrical aerogels which had a density of 0 . 3 g / cm 3 . the shape of the aerogel can be modulated by controlling the shape of the vessel during the gelation step . the density of the final aerogel can be modulated by varying the volume fraction of nanotubes within the gel . for example , between at least the 20 vol % value described in the specific example and the percolation threshold of these specific crosslinked nanotubes in dimethylformamide ( estimated to be around 1 vol %).	2
the functions described as being performed at various components can be performed at other components , and the various components can be combined and / or separated . other modifications can also be made . all numeric values are herein assumed to be modified by the term “ about ,” whether or not explicitly indicated . the term “ about ” generally refers to a range of numbers that one of skill in the art would consider equivalent to the recited value ( i . e ., having the same function or result ). in many instances , the term “ about ” may include numbers that are rounded to the nearest significant figure . numerical ranges include all values within the range . for example , a range of from 1 to 10 supports , discloses , and includes the range of from 5 to 9 . similarly , a range of at least 10 supports , discloses , and includes the range of at least 15 . thus , the following disclosure describes data processing systems , methods , and apparatus for multi - modality imaging , including a system , a method , and an apparatus for optimizing the signal to noise ratio from an apd based detector in the presence of the time - varying electromagnetic field originating from the mri modality . many other examples and other characteristics will become apparent from the following description . one embodiment relates to a signal processing system that can combine both analog and digital pole / zero circuits and processes for the pet electronics for a combined mr / pet modality . the system can be used in the field of nuclear medical imagining . the system can enable the signal processing hardware to achieve a higher count rate capability than systems employing either an analog circuit or a digital pole / zero filter algorithm employed individually . the lower gain of the apds requires the use of low noise electronics to be able to measure accurate timing of the annihilation photons for a pet modality . in the specific application where an analog charge sensitive amplifier ( csa ) is used to integrate the apd charge derived from crystal scintillation light , an analog continuous reset of the integrator can be achieved by a large effective impedance in parallel with the integrating feedback element , a capacitor . this integrator &# 39 ; s reset time can be set larger than the collection time both to measure the full photon yield and to minimize the current noise density due to the feedback impedance , rf . from a macroscopic signal view , the end result with an apd / crystal - based detector and csa is that an integral exponential rise is shorter than the reset time . this parallel resistor - capacitor ( rc ) results in an exponential signal tail necessarily much longer than that required to the measure the full light emission of the scintillation crystal . although a gated low impedance reset circuit , i . e ., a gated integrator , can be used to reduce the integrated charge signal , the gating logic contains higher frequency signal components that need to be shielded in this specialized application , since the pet detectors are in such close proximity to the receiving mr electronics and are a noise source for the mr modality that must be minimized . for low noise and simplicity for a large number of channels , the integration reset function for this application consists of an analog parallel rc . referring to fig1 , a block diagram of the electrical signal path of an avalanche photodiode based detector using an analog pole / zero circuit combined with a discrete infinite impulse response filter for tail subtraction to improve high count rate operation is depicted . scintillation detector 101 with bias 102 generates an electrical signal . the signal is transmitted to analog pole / zero circuit 103 , which comprises an operational amplifier with passive feedback and gain elements . the analog pole / zero circuit could be any of the recognized types that one of skill in the art could envision to effectively create a circuit with one dominant pole and one dominant zero . circuit 103 has pole / zero function 104 , which can be given according to equation 1 in its continuous laplace transform equivalent form . in equation 1 , s represents the continuous domain complex frequency variable σ + jω , τ i represents [ a single zero , pole cancellation constant , used to cancel the dominant signal tail from the csa reset circuit , and τ 2 represents the substituted circuit single pole time constant after the original pole from the reset circuit has been cancelled by zero , τ i . circuit 103 is connected to cable driver / buffer 105 . the analog pole / zero cancelled signal is discrete - time sampled by analog to digital convert ( adc ) 105 . digital iir filter 107 can be used to improve the count rate performance of the crystal localization / energy algorithm 108 and timing algorithm 109 at high count rates . the localization routine is used to determine which crystal absorbed the gamma photons from a weighted combination of all light sensors associated with the apd / scintillation crystal detector . the number of crystals to light sensors in the apd / scintillation crystal detector is much greater than 1 : 1 for reasons of economic necessity . at a high detector count rate , signal tails from previously detected gamma photons are the source of measurement errors for determining event position , total event evergy , and the gamma photon &# 39 ; s time - of arrival . the time - of - arrival circuit is used to determine if two detected gamma photons are in time coincidence of each other , on the order of 20 ns or less for modern pet scanners . in nuclear spectroscopy , the exponential signal tail caused by an ideal integrator analog reset circuit can be eliminated by applying what is known as a pole / zero circuit in a following gain stages , which is shown in block diagram form in the first half of fig1 . if it is assumed that the scintillation detector signal is of first - order modeled as a signal exponential or pole of value 1 / τ 1 , the long tail resulting from the detector preamplifier can be cancelled by the zero of the pole / zero circuit leaving a remnant pole time constant 1 / τ 2 of the pole / zero circuit . if the csa is implemented in discrete form , the time constant of the resetting pole may be measured and an accurate cancellation is possible for a large number of channels . if the csa is implemented in a custom application specific integrated circuit ( asic ), the reset time constant may be cancelled , not because the absolute time constants are known , but because the lithography and processing cause the component values of the capacitances and effective resistances of the integrator and pole / zero cancellation circuits to track within a small area even though the absolute values may deviate by as much as 50 %. according to one embodiment , discrete - time filters have been developed to emulate their analog continuous counterparts . the analog pole / zero filter described above may also be implemented as a discrete filter that is nearly equivalent to the time - sampled analog pole / zero impulse response given sufficient accuracy of the digital coefficients for the filter . the system can use a combination of analog and digital pole / zero processing to achieve the benefits of both methods when used in a distributed system for a combined mr / pet modality . an advantage of an analog pole / zero cancellation directly at the detector before the signal is transmitted over a transmission cable to the processing unit is that the peak activity level that can be linearly processed with a fixed adc analog input range is higher than if the detector signals are transmitted with slow exponential reset tails . if the long reset tail τ i remains , then the photopeak signal needs to be appropriately scaled so that multiple pileup events do not cause the analog input range of the adcs ( typically 1 vpp or 2 vpp for a typical embodiment ) to be exceeded . a pileup event is defined as a measured gamma photon event that contains at least some of the remnant energy of past scintillation events before previous scintillation events &# 39 ; signals have been reset to within 1 % of the reference signal baseline level . the significance of the pileup events on the time - of - arrival and event localization measurement is best understood by modeling the input signals from the detectors as a random poisson process in time . if only the digital pole / zero is implemented directly from the csa , the highest acceptable count rate is lower than if the digital pole / zero algorithm is combined with the analog pole / zero circuit . in practice , this may necessitate that the 511 kev photopeak signal be lowered up to 5 times compared to an analog pole / zero filter applied to the apd detector signal prior to signal transmission as shown in fig1 . for a large distributed system this may cause distorted signals in the pet electronic signals due to the unrelated modality rf signals from the mr . there can be a remnant signal tail remaining from the analog pole / zero cancellation due to the component tolerances both in the csa and in the analog pole / zero circuit . various embodiments of the system , method , and apparatus can use an analog pole / zero filter to allow an increased signal level at the interface between the pet detectors and processing unit in the pet modality of a combined mr / pet modality . various embodiments of the system , method , and apparatus can use a sum of exponentials approximation to model the remnant signal tail of the detector signal after the analog pole / zero cancellation . in the envisioned embodiment , the statistical mean or expected value of the single pole value of the application specific integrated circuit &# 39 ; s ( asic &# 39 ; s ) ( csa ) reset time constant is used as the expected value of the pole time constant . the remnant signal tail resulting from ac coupling time constants and mismatch of the analog circuits can remain . various embodiments of the system , method , and apparatus can use a digitial infinite impulse response ( iir ) filter implemented with fixed point arithmetic inside a field programmable gate array ( fpga ) to cancel many poles of the signal approximated as a sum of exponentials , which is used as an input to a digital timing algorithm , crystal localization algorithm , and total energy algorithm . the embodiment will reduce measurement errors at single photons count rates of greater than 50 kcps . the analog pole / zero cancelled signal is discrete - time sampled by an adc after appropriate nyquist bandwidth limiting . the digital iir filter is used to improve the count rate performance of the crystal localization and timing algorithms at greater than 50 kcps for the pet electronics in a dual mode mr / pet gantry . various embodiments can include a method that measures the remaining signal tail on a per signal basis during a routine gantry setup and use a least square error fit to tune the digital coefficients of the filter coefficients automatically during gantry setup to optimize the count rate capability of the pet signal path in the combined mr / pet gantry . the optimal coefficients can be determined at low system count rates , less than 20 kcps per signal , where the remnant signal tails can be minimized through an iterative process by acquiring a histogram of each signal tail , automatically readjusting the digital coefficients , followed by subsequent histogram periods . the coefficients are stored in nonvolatile memory for later pet data acquisitions scans at normal and high count rates . the system , according to certain embodiments , is of particular use in a combined mr / pet modality where the narrowband mr electronics generate wideband electromagnetic signal content that is potentially coupled into different signal path points in the pet architecture . the system improves signal quality at the long cable interface and in the alter amplification stages . the analog pole / zero filtered signals can have a higher bandwith due to the substituted pole than the unfiltered csa detector signals in order to improve the signal risetime and time resolution in the pet application . these higher frequency spectral components radiate more easily at the cable interface thus potentially impacting the mri unless effective shielding is implemented . referring to fig2 , a block diagram of the electrical signal path of an avalanche photodiode based detector using a discrete infinite impulse response filter for tail subtraction to improve accuracy at moderate and high count rates is depicted . scintillation detector 201 with bias 202 generates an electrical signal . the signal is transmitted to analog pole / zero circuit 203 , which comprises passive networks and an operational amplifier . circuit 203 is connected to cable driver / buffer 204 . the analog pole / zero cancelled signal is discrete - time sampled by analog to digital converter ( adc ) 205 . digital iir filter 206 can be used to improve the count rate performance of the crystal localization / energy algorithm 207 and timing algorithm 208 at moderate and high count rates . digital iir filter 206 can be a single pole / zero digital filter and can comprise a field programmable gate array ( fpga ) employing a z - transform filter described mathematically in the form of equation 2 , for an ideal single exponential defined signal originating from a csa / scintillation crystal detector combination . in equation 2 , z represents the complex frequency variable e st , k 1 represents a constant coefficient , k 2 represents a scaling coefficient , k 3 represents the scaling filter coefficient associated with the last discrete output value of the iir filter . in the embodiment shown in fig2 , the system count rate is low enough that the dynamic range of the adc is not approached at the scanner maximum count rate . the analog pole / zero circuit , at this point , becomes unnecessary , if the csa integrator is assumed linear . the digitally implemented pole / zero filter is used to effectively cancel both the integrator circuit reset time and the ac coupling time constants from the apd / scintillation crystal based detectors . fig3 depicts one possible embodiment of the iir filter . the magnitude of the fourier transform of the infinite impulse response filter , h ( z ), used to cancel the single pole exponential tail from an an ideal avalanche photodiode / charge sensitive amplifier based detector . fig4 depicts the phase response of the fourier transform of one embodiment of the infinite impulse response filter , h ( z ), used to cancel the single pole exponential tail from an ideal avalanche photodiode / charge sensitive amplifier based detector . a processor as used herein is a device for executing stored machine - readable instructions for performing tasks and may comprise any one or combination of hardware and firmware . a processor may also comprise memory storing machine - readable instructions executable for performing tasks . a processor acts upon information by manipulating , analyzing , modifying , converting or transmitting information for use by an executable procedure or an information device , and / or by routing the information to an output device . a processor may use or comprise the capabilities of a controller or microprocessor , for example . a processor may be electrically coupled with any other processor enabling interaction and / or communication there - between . a processor comprising executable instructions may be electrically coupled by being within stored executable instruction enabling interaction and / or communication with executable instructions comprising another processor . a user interface processor or generator is a known element comprising electronic circuitry or software or a combination of both for generating display images or portions thereof . a user interface comprises one or more display images enabling user interaction with a processor or other device . an executable application comprises code or machine readable instructions for conditioning the processor to implement predetermined functions , such as those of an operating system , a context data acquisition system or other information processing system , for example , in response to user command or input . an executable procedure is a segment of code or machine readable instruction , sub - routine , or other distinct section of code or portion of an executable application for performing one or more particular processes . these processes may include receiving input data and / or parameters , performing operations on received input data and / or performing functions in response to received input parameters , and providing resulting output data and / or parameters . a user interface ( ui ), as used herein , comprises one or more display images , generated by a user interface processor and enabling user interaction with a processor or other device and associated data acquisition and processing functions . the ui also includes an executable procedure or executable application . the executable procedure or executable application conditions the user interface processor to generate signals representing the ui display images . these signals are supplied to a display device which displays the image for viewing by the user . the executable procedure or executable application further receives signals from user input devices , such as a keyboard , mouse , light pen , touch screen or any other means allowing a user to provide data to a processor . the processor , under control of an executable procedure or executable application , manipulates the ui display images in response to signals received from the input devices . in this way , the user interacts with the display image using the input devices , enabling user interaction with the processor or other device . the functions and process steps herein may be performed automatically or wholly or partially in response to user command . an activity ( including a step ) performed automatically is performed in response to executable instruction or device operation without user direct initiation of the activity . an object or data object comprises a grouping of data , executable instructions or a combination of both or an executable procedure . the technology can take the form of an entirely hardware embodiment , an entirely software embodiment or an embodiment containing both hardware and software elements . in one embodiment , the invention is implemented in software , which includes but is not limited to firmware , resident software , microcode , etc . furthermore , the invention can take the form of a computer program product accessible from a computer - usable or computer - readable medium providing program code for use by or in connection with a computer or any instruction execution system . for the purposes of this description , a computer - usable or computer readable medium can be any apparatus that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . the medium can be an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system ( or apparatus or device ) or a propagation medium ( though propagation mediums in and of themselves as signal carriers are not included in the definition of physical computer - readable medium ). examples of a physical computer - readable medium include a semiconductor or solid - state memory , magnetic tape , a removable computer diskette , a random access memory ( ram ), a read - only memory ( rom ), a rigid magnetic disk and an optical disk . current examples of optical disks include compact disk - read only memory ( cd - rom ), compact disk - read / write ( cd - r / w ) and dvd . both processors and program code for implementing each as aspect of the technology can be centralized and / or distributed as known to those skilled in the art . the above disclosure provides examples and aspects relating to various embodiments within the scope of claims , appended hereto or later added in accordance with applicable law . however , these examples are not limiting as to how any disclosed aspect may be implemented , as those of ordinary skill can apply these disclosures to particular situations in a variety of ways . although the present invention has been described in considerable detail with reference to certain preferred versions thereof , other versions are possible . therefore , the spirit and scope of the appended claims should not be limited to the description of the preferred versions contained herein . the reader &# 39 ; s attention is directed to all papers and documents which are filed concurrently with this specification and which are open to public inspection with this specification , and the contents of all such papers and documents are incorporated herein by reference . all the features disclosed in this specification ( including any accompanying claims , abstract , and drawings ) may be replaced by alternative features serving the same , equivalent or similar purpose , unless expressly stated otherwise . thus , unless expressly stated otherwise , each feature disclosed is one example only of a generic series of equivalent or similar features . any element in a claim that does not explicitly state “ means for ” performing a specified function , or “ step for ” performing a specific function , is not to be interpreted as a “ means ” or “ step ” clause as specified in 35 u . s . c § 112 , sixth paragraph . in particular , the use of “ step of ” in the claims herein is not intended to invoke the provisions of 35 u . s . c § 112 , sixth paragraph .	0
referring now to fig1 - 2 , in a first embodiment large diameter , low pressure plug 100 comprises nose 113 configured to selectively be inserted into and fit within inner annulus 301 ( fig6 ) of tubular 300 ( fig6 ). in certain embodiments nose 113 comprises a convex leading face for which the convex portion will protrude in inner annulus 301 ( fig6 ) of tubular 300 ( fig6 ) when nose 113 is inserted into inner annulus 301 . in certain embodiments , nose 113 comprises a substantially round outer boundary and collar 114 comprises a substantially round outer boundary which is complementary to the substantially round outer boundary of nose 113 . collar 114 is connected to the nose 113 about an outer boundary of nose 113 , where collar 114 is configured to slidingly fit within tubular 300 . plate top 103 is connected to collar 114 opposite nose 113 . slip bowl 101 is disposed proximate nose 113 about an outer surface of collar 114 . large diameter , low pressure plug 100 may further comprise first spring 122 disposed about an outer surface of slip bowl 101 . one or more o - rings 123 is disposed proximate the outer surface of collar 114 intermediate nose 113 and slip bowl 101 . o - ring 123 , which may comprise a large cross section and / or a large diameter , typically comprises a soft elastomeric material . slip 104 is disposed about an outer surface of slip bowl 101 in sliding communication with slip bowl 101 . slip 104 may comprise teeth and / or a serrated outer surface . in contemplated embodiments , slip 104 comprises a tapered edge and slip bowl 101 comprises a complementarily tapered edge in sliding communication with the slip tapered edge . nose 113 , slip 104 , and slip bowl 101 are configured to selectively position one or more o - rings 123 to a first position which does not form a seal between large diameter , low pressure plug 100 and inner annulus 301 of tubular 300 into which large diameter , low pressure plug 100 is positioned and to a second position which does form a seal between large diameter , low pressure plug 100 and inner annulus 301 of tubular 300 into which large diameter , low pressure plug 100 is positioned . a set of counter - rotating rings 106 , 109 comprises bottom ramp 106 , disposed about the outer surface of collar 114 proximate plate top 103 , and top ramp 109 , disposed about the outer surface of collar 114 intermediate plate top 103 and bottom ramp 106 . top ramp 109 is in communication with bottom ramp 106 . in certain embodiments , bottom ramp 106 and top ramp 109 are arranged in a counter - rotating relationship relative to each other and are further configured to produce an axial force to compress o - ring 123 . an assembly comprising one or more screw cap socket heads 107 , square nuts 115 ( or the like ), screw tubes 116 ( or the like ), and springs 117 may be present and disposed proximate collar 114 . slip pusher 102 is disposed at least partially intermediate bottom ramp 106 and slip 104 about the outer surface of collar 114 and is in communication with slip 104 . slip pusher 102 may be configured to engage an end portion of tubular 300 ( fig6 ) and at least partially impede insertion of large diameter , low pressure plug 100 into annulus 301 ( fig6 ) of tubular 300 ( fig6 ). bolt setter 111 is in communication with the outer surface of slip bowl 101 and is configured to provide axial movement to at least one of bottom ramp 106 and top ramp 109 . bolt setter 111 can be hydraulically actuated , actuated mechanically via a wrench or remotely operated vehicle ( rov ), or the like , or a combination thereof . bolt setter 111 can comprise a hydraulic pump and / or cylinder and typically turns and moves top ramp 109 against bottom ramp 106 . in certain embodiments , bolt setter 111 comprises a plurality of bolt setters 111 disposed at least partially opposite each other . large diameter , low pressure plug 100 may further comprise rov handle 118 connected to plate top 103 . referring now to fig3 - 4 , in a further embodiment , large diameter , low pressure plug 200 comprises leading nose 201 configured to be insertable into inner annulus 301 ( fig6 ) of tubular 300 ( fig6 ), where leading nose 201 comprises substantially circular descending collar 201 b and substantially solid convex leading face 201 a , which can be convex . back plate 215 is connected to descending collar 201 b and disposed opposite solid leading face 201 a . a set of set of counter - rotating rings comprises one or more conical ramp rings 206 , connected to back plate 215 and disposed about an outer surface of descending collar 201 b , and counter - rotating ramp ring 207 , disposed about an outer surface of descending collar 201 b intermediate at least one conical ramp ring 206 and slip pusher 203 . counter - rotating ramp ring 207 is in communication with slip pusher 203 . conical ramp ring 206 may be configured to be stationary with respect to counter - rotating ramp ring 207 . slip pusher 203 is disposed about an outer surface of descending collar 201 b intermediate at least one conical ramp ring 206 and descending collar 201 b . slip pusher 203 is in communication with back plate 215 . first slip 204 comprises a tapered edge and is disposed about the outer surface of descending collar 201 b intermediate slip pusher 203 and leading nose 201 . first slip 204 is in communication with slip pusher 203 . in embodiments , first slip 204 comprises a serrated outer surface . sliding slip bowl 202 comprises a tapered edge which is complimentarily tapered with respect to and engaged with the tapered edge of first slip 204 and is disposed about the outer surface of descending collar 201 b intermediate first slip 204 and leading nose 201 . one or more large cross section , large diameter o - rings 213 are disposed intermediate sliding slip bowl 202 and substantially solid leading face 201 a . counter - rotating ramp ring 207 is configured to produce an axial force to compress o - ring 213 . o - ring 213 typically comprises a soft elastomeric material . setting screw 212 , which is operatively in communication with conical ramp ring 206 and counter - rotating ramp ring 207 , is configured to selectively rotate or counter - rotate at least one of conical ramp ring 206 and counter - rotating ramp ring 207 . referring now to fig5 , in either embodiment described above one or more ports 150 may be present and adapted to removably receive a hose ( not shown in the figures ) which may be attachable via a complimentary hot stab . ports 150 , e . g . 3 inch connections , may be configured to be opened or closed as needed and may be placed where and as needed , e . g . proximate nose 113 ( fig1 ) or nose 201 ( fig3 ). ports 150 may comprise a connector such as a hydraulic connector , a check valve , or the like , or a combination thereof . in the operation of exemplary embodiments , a pipe , e . g . tubular 300 , may be sealed subsea by maneuvering large diameter , low pressure plug 100 proximate an open end of tubular 300 . the operation described herein applies equally to large diameter , low pressure plug 200 . one or more rov handles 118 may be used to aid in positioning large diameter , low pressure plug 100 . referring to fig6 and additionally to fig1 and 2 , when positioned to its desired proximity of tubular 300 , large diameter , low pressure plug 100 is inserted into inner annulus 301 of tubular 300 , with nose 113 leading into inner annulus 301 . when inserted sufficiently , e . g . when a ledge such as slip pusher 102 or back plate 215 engages an open end portion of tubular 300 , axial compression is applied by rotating top ramp 109 against bottom ramp 106 . the rotational movement is translated to axial movement due to meshing angles in both top ramp 109 and bottom ramp 106 . a sealing action is created by rotating a set of counter - rotating rings , e . g . top ramp 109 against bottom ramp 106 or conical ramp ring 206 with respect to counter - rotating ramp ring 207 . this causes radial expansion in a seal , such as o - ring 123 or o - ring 213 , against inner annulus 301 of tubular 300 by the rotation of one ring of the set of counter - rotating rings with respect to the other ring or rings of the set of counter - rotating rings . in configurations , the leading portion of large diameter , low pressure plug 100 , i . e . nose 113 , is shaped to withstand internal pressure within inner annulus 301 , e . g . convexly , such that the internal pressure , e . g . from fluid present in inner annulus 301 , does not push large diameter , low pressure plug 100 out from inner annulus 301 once large diameter , low pressure plug 100 is secured within inner annulus 301 . conical ramp ring 206 may be configured with one or more protruding arms 112 and a corresponding set of springs 110 , each of which is connected to a corresponding protruding arm 112 . in such embodiments , each such protruding arm 112 is allowed to compress its spring 110 which operates to maintain tension of a preload and insure that protruding arm 112 does not come off . when started , this action keeps spring 110 and applied torque , e . g . with a wrench or the like , will overcome the force exerted by spring 110 . large diameter , low pressure plug 100 may be locked into place using hydraulic pressure and toothed slips 104 . in an embodiment , first slip 104 comprises a serrated edge which is used to bite axially into inner annulus 301 to prevent large diameter , low pressure plug 100 from being pushed out of inner annulus 301 . first slip 104 may be expanded by pushing slip bowl 101 underneath first slip 104 with the same axial force that compresses o - ring 113 . in other configurations , slip pusher 203 is pushed underneath first slip 204 to compress o - ring 113 . in embodiments , protruding arm 112 comprises a plurality of opposing protruding arms 112 which may be pulled toward each other . in other embodiments , setting screw 212 comprises a plurality of opposing setting screws 212 which may be pulled toward each other . a slight axial movement may be caused with pressure the large diameter , low pressure plug 100 is designed to hold and the slight axial movement used to relax the axial setting force of conical ramp rings 206 . moreover , an original setting force of conical ramp rings 206 may be restored by having conical ramp rings 206 brought even closer together using stored energy in one or more compressed springs 210 . if ports 150 are present , they may be used to help stabilize pressure within tubular 300 such as when retrieving or otherwise repositioning tubular 300 . the foregoing disclosure and description of the inventions are illustrative and explanatory . various changes in the size , shape , and materials , as well as in the details of the illustrative construction and / or an illustrative method may be made without departing from the spirit of the invention .	5
while illustrated in the context of using ozone to strip photoresist from a semiconductor wafer , the skilled artisan will find application for delivery of highly concentrated dissolved ozone in a wide variety of contexts . for example , the disclosed delivery of highly concentrated dissolved ozone has utility in many cleaning , etching , and stripping processes involved in the fabrication of a wide variety of workpieces . for example , the delivery of highly concentrated dissolved ozone has utility in pc board fabrication and the like . [ 0032 ] fig1 illustrates a flow diagram of a pulsing process 10 according to one embodiment of the invention . according to the pulsing process 10 , step s 1 introduces a reagent into an environment where the reagent can react . step s 2 activates a solution spray . step s 3 deactivates the solution spray . decision s 4 determines if enough time has elapsed to substantially complete a desired reaction . if enough time has elapsed , the pulsing process 10 ends . however , if more time is required , the pulsing process 10 returns to step s 2 , activates the solution spray , and repeats the steps disclosed above . according to one embodiment , the reagent is ozone being introduced into the environment for any of a wide variety of reasons . for example , in the semiconductor fabrication industry , the ozone could be used to clean or sterilize the workpiece . the ozone could also be used to etch a semiconductor layer on , or strip another layer from the workpiece . according to one embodiment , the ozone strips a photoresist layer from the semiconductor wafer . in addition , according to an embodiment of the invention , the solution includes deionized water . the deionized water acts both as a carrier of the ozone to the semiconductor wafer and as a cleaning solution for the byproducts of an ozone - photoresist reaction . thus , cycling through step s 2 ( activation ), step s 3 ( deactivation ), and decision s 4 , the water spray is pulsed over the photoresist . the pulsing of the water establishes at least the following advantageous characteristics . first , the pulsing of the water advantageously provides less overall water to the photoresist . less water creates a water boundary layer on the photoresist , thereby allowing the ozone to supersaturate the water above the water &# 39 ; s normal ozone concentration capacity . this supersaturation , or highly concentrated dissolved ozone , increases the amount of ozone reaching the photoresist , thereby dramatically decreasing the time needed for the ozone to react with substantially all of the photoresist . second , the pulsing of the water increases its ability to wash away or remove the leftover and interfering byproducts of the ozone - photoresist reaction . for example , the water boundary layer pulses from the activation and deactivation of the spray . the pulsing helps loosen and break “ chunks ” of photoresist from the semiconductor substrate . the water boundary layer then washes away the chunks from interfering with further ozone - photoresist reactions , thereby increasing the effectiveness of the already highly concentrated dissolved ozone reaching the semiconductor wafer . accordingly , the pulsing process 10 decreases the time needed to substantially strip photoresist from the semiconductor wafer . the decrease in time advantageously speeds overall semiconductor fabrication process flows , thereby decreasing the overall cost of fabrication . for example , according to one embodiment , the pulsing process 10 includes a duty cycle and a pulse rate . the duty cycle is the ratio between the time the water spray is activated , e . g ., steps 2 , and the cycle time , e . g ., steps 2 + steps 3 . on the other hand , the pulse rate is the inverse of the cycle time , i . e ., according to one embodiment , the pulsing process 10 employs a 20 % duty cycle . in this embodiment , approximately 5 seconds of water spray activation and is followed by approximately 20 seconds of water spray deactivation . therefore , the pulse rate is approximately one pulse every 25 seconds . by employing this pulse rate and duty cycle to the pulsing process 10 , the time needed to substantially strip photoresist from the semiconductor wafer is dramatically decreased . for example , using a conventional constant spray process , approximately 12 . 6 k å of hard baked ( 130 ° c . for 90 sec .) 10i photoresist can be substantially stripped from a selection of semiconductor wafers in 20 minutes . however , when the above - disclosed pulsing process 10 is employed , the same 12 . 6 k å of 10i photoresist is substantially stripped from the selection of semiconductor wafers in just 5 minutes . in other embodiments , the pulsing process 10 employs a 50 % duty cycle wherein one second of spray activation is followed by approximately one second of water spray deactivation . therefore , the pulse rate is approximately one pulse every 2 seconds . in yet other embodiments , the pulsing process 10 employs approximately an 8 % duty cycle wherein five seconds of spray activation is followed by approximately sixty seconds of water spray deactivation . therefore , the pulse rate is approximately one pulse every 60 seconds . the skilled artisan will recognize that pulse ranges can vary over a wide range including , but not limited to , approximately one pulse per minute to as many as 30 pulses per minute . in addition , the skilled artisan will recognize that the duty cycles can range from 3 percent up to 97 percent . in one embodiment , the temperature of the water is heated from approximately 60 ° c . to approximately 95 ° c . in other embodiments , the water is maintained at an ambient temperature of approximately 20 ° c . in yet other embodiments , the water is maintained at sub - ambient temperatures less than 20 ° c . thus , the temperature of the water can be calibrated to a wide range of temperatures including , but not limited to from less that 20 ° c . to more than 95 ° c . [ 0043 ] fig2 illustrates a schematic of an ozone shower system 15 in accordance with one embodiment of the invention . the ozone shower system 15 includes a process chamber 20 having a chamber lid 25 , a full chamber 30 , and a short chamber 35 . a pump 40 pumps water from the full chamber 30 to a heater 45 . as the water passes through the heater 45 , the heater 45 raises the water temperature to desired levels . the water then travels through a flush valve 50 . the flush valve 50 allows for the addition of water to the ozone shower system 15 . the water then flows through a filter 55 and on to a selector valve 60 . the selector valve 60 directs the water into one of two paths . the filtered heated water directed through the first path travels to the chamber lid 25 and eventually to the full chamber 30 . thus , the water in the first path completes a water cycle from the full chamber 30 , through the pump 40 , through a first path , and back to the full chamber 30 . on the other hand , the selector valve 60 could also direct the filtered heated water through a second path . the filtered heated water directed through the second path travels to a drain valve 65 . the drain valve 65 allows for excess water removal from the ozone shower system 15 . the filtered heated water in the second path then travels to the short chamber 35 . after the short chamber 35 fills with water , excess water spills over into the full chamber 30 . thus , the water in the second path also completes a water cycle from the full chamber 30 , through the pump 40 , through the second path , and back to the full chamber 30 . also illustrated in fig2 is an ozone source . the ozone source supplies ozone to the ambient in the full chamber 30 through the chamber lid 25 . thus , according to the embodiment illustrated in fig2 the ozone shower system 15 circulates water through the first or second path while an ozone rich environment exists in the full chamber 30 . in other embodiments , the ozone from the ozone source is injected into the fluid in the first path , the second path or both paths . the injected ozone creates an ozone rich fluid that is applied to a workpiece as described in further detail below . according to one embodiment of the invention , the pump 40 is a bellow pump commercially available from white knight fluid handling , inc . the heater 45 is an in - line heater commercially available from santa clara plastics . in addition , the flush valve 50 , the selector valve 60 and the drain valve 65 are three - way valves commercially available from fluoroware . the filter 55 is an inert particle filter commercially available from pall corporation . according to one embodiment , the ozone source is an astex 8200 ozone generator configured to peak performance recommendations by the manufacturer . for example , the oxygen and nitrogen supplies are set to supply approximately greater than 13 percent by weight ozone concentration to the ambient . however , it will be understood that a skilled artisan would recognize a wide variety of other types of ozone sources , filters , valves , heaters , and pumps could be advantageously employed in the ozone shower system 15 . for example , a skilled artisan would recognize that the pump 40 could be a centrifuge pump . moreover , the heater 45 could be a heat exchanger . in addition , the valves could be two - way valves . the filter 55 could be a charged particle filter . the ozone source could be an electrolytic type generator . [ 0049 ] fig3 illustrates one embodiment of the process chamber 20 . the process chamber 20 includes the chamber lid 25 covering the full chamber 30 and the short chamber 35 . as shown in fig3 the full chamber 30 and the short chamber 35 are separated by a wall 68 . the wall 68 has a height less than that of the full chamber 30 such that a space exists between the top of the wall 68 and the chamber lid 25 . moreover , according to this embodiment , the chamber lid 25 includes a water manifold 70 having an array of spray nozzles 75 . the spray nozzles 75 are configured such that when the chamber lid 25 covers the full chamber 30 and the short chamber 35 , the spray nozzles 75 extend above the full chamber 30 . the full chamber 30 holds wafers 80 in a cassette 85 . the cassette 85 rests on a stand 90 . the stand 90 , in turn rests on the bottom of the full chamber 30 . a pump pool 95 fills the bottom of the full chamber 30 to a height less than that of the stand 90 such that the pump pool 95 does not reach the cassette 85 or the wafers 80 . in addition , a diverted pool 98 fills the short chamber 35 . according to one embodiment , the spray nozzles 75 in the spray lid 25 are cone spray nozzles commercially available from santa clara plastics . however , it will be understood that a skilled artisan would recognize that a wide variety of the spray nozzles 75 could be used in the chamber lid 25 . for example , the chamber lid 25 could employ shower massage nozzles , knife - edge nozzles , or the like . moreover , according to one embodiment of the invention , the spray nozzles 75 attach to the water manifold 70 such that when activated , a substantially uniform water boundary layer forms on each of the wafers 80 . according to one embodiment , the cassette 85 holds 13 of the wafers 80 and is commercially available from santa clara plastics . however , it will be understood that a skilled artisan would recognize that a wide variety of cassettes or other devices could be used to hold a wide number of the wafers 80 . for example , the number of the wafers 80 for a given cassette is often simply vendor dependent . moreover , the cassette 85 may be altogether avoided and the process chamber 20 could employ robot arms or the like . a robot arm for holding and exchanging the wafers 80 is commercially available from submicron systems . [ 0054 ] fig4 illustrates an array of the spray nozzles 75 on the spray lid 25 , according to one embodiment of the invention . fig4 illustrates the array comprising six rows and four columns . the six rows and four columns are depicted from the perspective of the wafers 80 such that the wafers 80 align parallel to the rows . according to one embodiment , the spray nozzles 75 in the 6 rows are separated from each other by 1 . 75 inches and the spray nozzles 75 in the 4 columns are separated from each other by 2 . 5 inches . however , it will be understood that a wide variety of patterns and distances could be used arrange the spray nozzles 75 in order to provide the substantially uniform water boundary layer on the wafers 80 . according to this embodiment , the spray lid 25 further includes an ozone nozzle 100 . for convenience , the ozone nozzle 100 and the spray nozzles 75 are the same , outside of the fact that the ozone nozzle 100 does not connect to the water manifold 70 . rather , the ozone nozzle 100 connects to the ozone source such that the ozone nozzle 100 supplies ozone into the ambient in the full chamber 30 . again , it will be understood that a skilled artisan would recognize a wide variety of devices and input areas where the ozone source could supply ozone to the process chamber 20 . for example , the ozone nozzle 100 could be entirely different from the spray nozzles 75 and enter the process chamber 20 from a position other than the center of the array of the spray nozzles 75 . furthermore , the chamber lid 25 could comprise multiple ozone nozzles 100 creating multiple entry points for the ozone into the full chamber 30 . according to one embodiment , the ozone shower system 15 employs the pulsing process 10 in order to decrease the time needed to strip photoresist from the wafers 80 . in step s 1 , the ozone source of the ozone shower system 15 pumps ozone into the full chamber 30 through the ozone nozzle 100 . according to this embodiment , the ozone concentration is at least 13 weight percent . further , the pump 40 begins pumping water from the pump pool 95 through the heater 45 . according to this embodiment , the heater 45 heats the water to approximately 60 - 95 ° c . the pump 40 then pumps the water though the filter 55 to remove contaminates . in step s 2 , the selector valve 60 directs the now filtered heated water through the first path to the chamber lid 25 and the water manifold 70 . the water manifold 70 distributes the filtered heated water to the array of the spray nozzles 75 . the spray nozzles 75 spray the filtered heated water on the wafers 80 such that the water sheets over the photoresist , thereby forming the water boundary layer . as the filtered heated water sheets off the wafers 80 , it falls through or around the cassette 85 and the stand 90 such that the filtered heated water collects in the pump pool 95 . the selector valve 60 continues to direct the filtered heated water through the first path for approximately 5 seconds . in step s 3 , the selector valve 60 redirects the filtered heated water into the second path , thereby shutting off the supply of water to the spray nozzles 75 . this redirection effectively deactivates the spray nozzles 75 . the filtered heated water travels through the second path to the short chamber 35 where it flows into the diverted pool 98 . when the diverted pool 98 becomes deeper than the height of the wall 68 , the filtered heated water in the diverted pool 98 spills over the wall 68 and into the pump pool 95 in the full chamber 30 . the water spilling over the wall 68 does not touch or effect the wafers 80 , rather , it simply adds to the pump pool 95 . the selector valve 60 continues to direct the filtered heated water through the second path for 20 seconds . in decision s 4 , the ozone shower system 15 determines whether five minutes has elapsed since first activating the pump 40 . if so , the pump 40 shuts down . on the other hand , if 5 minutes has not elapsed , the selector valve 60 redirects the filtered heated water back through the first path and reactivates the spray nozzles 75 , thereby restarting step s 2 . using the selector valve 60 to redirect the filtered heated water advantageously makes continued starting and stopping the pump 40 unnecessary . by using redirection , the pump 40 continues to pump throughout the ozone - photoresist reaction time . furthermore , the employment of the pump pool 95 advantageously ensures the pump 40 will not run dry and allows for recycling of the filtered heated water . as mentioned above , employing the pulsing process 10 in the ozone shower system 15 advantageously reduces the time needed to strip substantially all the photoresist from the wafers 80 . in addition , as mentioned above , the pulsing process 10 accomplishes this reduction without rotating the wafers 80 at high velocities . in fact , according to one embodiment , the wafers 80 are held stationary . however , when the wafers 80 do not rotate , the water boundary layer should be as uniform as possible . thicker areas of the water boundary layer can effect the ability of the water to transport the highly concentrated dissolved ozone to the photoresist , thereby slowing the stripping process . typically , the water boundary layer may vary in thickness in at least two places . first , the cassette 85 typically uses two horizontal rods contacting the wafers 80 . the surface tension of the horizontal rods contacting the wafers 80 tends to thicken the water boundary layer in those areas . second , gravity can cause the water boundary layer to “ channel ” towards a point near the bottom of the wafers 80 , thereby thickening the water boundary layer in that area as well . therefore , according to one embodiment of the invention , the ozone shower system 15 slowly rotates the wafers 80 in order increase uniformity of the water boundary layer . for example , fig5 illustrates a side view of the wafer 80 and the cassette 85 . the cassette 85 includes a portion 87 that holds each wafer 80 . the portion 87 could be the above - mentioned horizontal rods , or as shown in fig5 the portion 87 could comprise a concave slot substantially matching the curvature of the bottom of the wafer 80 . each concave slot could correspond to each wafer 80 in the cassette . as illustrated in fig5 when the wafers 80 are to be rotated , two rotating axles 120 contact the wafers 80 . as shown , the two rotating axles 120 substantially support the wafers 80 allowing for a gap 125 to exist between the cassette 85 and the wafers 80 . according to one embodiment , the two rotating axles 120 rotate in the one direction such that the wafers 80 rotate in the other . for example , as shown in fig5 the two rotating axles 120 rotate to the left , thereby rotating the wafers 80 to the right . however , it will be understood that a wide variety of rotating mechanisms could be used to rotate the wafers 80 . for example , when the cassette 85 includes horizontal rods to support the wafers 80 , those horizontal rods themselves could be rotated . according to another embodiment , the two rotating axles 120 rotate the wafers 80 at velocities ranging from about 100 revolutions per minute ( rpm ) to stationary . according to one embodiment , the two rotating axles 120 rotate the wafers 80 at approximately 3 rpm . the slow rotation of the wafers 80 changes both the area where the cassette 85 contacts the wafers 80 , and which area of the wafers 80 comprises the bottom . therefore , by slowly rotating the wafers 80 , the ozone shower system 15 advantageously provides a more uniform water boundary layer . through the more uniform water boundary layer , the ozone shower system 15 provides efficient transport of highly concentrated dissolved ozone to the photoresist on the wafers 80 . the efficient transport dramatically reduces the processing time for the ozone - photoresist reaction , thereby increasing semiconductor process flow efficiency . also , slow rotation of the wafers 80 avoids the mechanical complexity and risk of damage associated with very high rotation velocities . although one embodiment of the ozone shower system 15 employs slow rotation of the wafers 80 , it will be understood that a skilled artisan would recognize a wide variety of other ways to create uniform water boundary layers . for example , the ozone shower system 15 could employ rotating spray nozzles 75 that correct for channeling and gravity problems . according to another embodiment , the ozone shower system 15 could aim the spray nozzles 75 such that the water spray contacts the wafers 80 in a manner that causes a slow rotation . for example , knife - edge spray nozzles could provide a spray that contacts only one side of the each wafer 80 , thereby slowly rotating the wafer inside the cassette 85 . such an embodiment avoids the use of the two rotating axles 120 . on the other hand , the ozone shower system 15 could employ tipping mechanism that tips the wafers 80 from side to side in order to create uniform water boundary layers . further , the ozone shower system 15 could employ non - mechanical means to combat non - uniformity . for example , surfactants , acid spiking , water vapor , heated workpiece , and very hot water could also be included to help improve the ozone - photoresist reactions . although the foregoing invention has been described in terms of certain preferred embodiments , other embodiments will be apparent to those of ordinary skill in the art . for example , the ozone could also be pulsed into the process chamber 20 and the ozone pulse could also have a limited duty cycle . additionally , other combinations , omissions , substitutions and modification will be apparent to the skilled artisan , in view of the disclosure herein . accordingly , the present invention is not intended to be limited by the recitation of the preferred embodiments , but is instead to be defined by reference to the appended claims .	7
fig1 is an exemplary mobile device 100 including a variety of optional hardware and software components , shown generally at 102 . any components 102 in the mobile device can communicate with any other component , although not all connections are shown , for ease of illustration . the mobile device can be any of a variety of computing devices ( e . g ., cell phone , handheld computer , personal digital assistant ( pda ), etc .) and can allow wireless two - way communications with one or more mobile communications networks 104 , such as a cellular or satellite network . the illustrated mobile device can include a controller or processor 110 ( e . g ., signal processor , microprocessor , asic , or other control and processing logic circuitry ) for performing such tasks as signal coding , data processing , input / output processing , power control , and / or other functions necessary for implementing the mobile device . an operating system 112 can control the allocation and usage of the components 102 and support for one or more application programs 114 . the application programs typically include email applications , calendars , contact managers , web browsers , text and media messaging applications . memory 120 can include non - removable memory 122 and / or removable memory 124 . the non - removable memory 122 can include ram , rom , flash memory , a hard disk , or other well - known memory storage technologies and can be used for storing data and / or code for running the operating system 112 and the applications 114 . example data can include web pages , text , images , sound files , video data , or other data sets to and from one or more network servers or other mobile devices via one or more wired or wireless networks . the removable memory 124 can include flash memory or a subscriber identity module ( sim ) card , which is well known in gsm communication systems , or other well - known memory storage technologies , such as “ smart cards .” the memory 120 can be used to store a subscriber identifier , such as an international mobile subscriber identity ( imsi ), and an equipment identifier , such as an international mobile equipment identifier ( imei ). such identifiers can be transmitted to a network server to identify users and equipment . the mobile device can support one or more input devices 130 , such as a touch screen 132 , microphone 134 , camera 136 , physical keyboard 138 and / or trackball 140 and one or more output devices 150 , such as a speaker 152 and a display 154 . the touch screen 132 can provide preview transitions as described herein . other possible output devices ( not shown ) can include piezoelectric or other haptic output devices . a wireless modem 160 can be coupled to an antenna ( not shown ) and can support two - way communications between the processor 110 and external devices , as is well understood in the art . the modem 160 is shown generically and can include a cellular modem for communicating with the mobile communication network 104 and / or other radio - based modems ( e . g ., bluetooth or wi - fi ). the wireless modem 160 is typically configured for communication with one or more cellular networks , such as a gsm network for data and voice communications within a single cellular network , between cellular networks , or between the mobile device and a public switched telephone network ( psstn ). the mobile device can further include at least one input / output port 180 , a power supply 182 , a satellite navigation system receiver 184 , such as a global positioning system ( gps ) receiver , an accelerometer 186 , a transceiver 188 ( for wirelessly transmitting analog or digital signals ) and / or a physical connector 190 , which can be a usb port , ieee 1394 ( firewall ) port , and rs - 232 port . the illustrated components 102 are not required or all - inclusive , as any components can deleted and other components can be added . as described above , the touch screen 132 allows for transitions between pages being displayed . the transitions allow a user to visualize which user interface features are available on a page and where they are located . such information is displayed to the user in an animated fashion while the page is opening . fig2 is a flowchart of a method for transitioning to a target page . in process block 200 , user input is received to open a target page . in process block 202 , a transition is animated to display the target page . the target page can be associated with an application that is starting up or the target page can be associated with a transition between pages within an application . in process block 204 , as the transition is occurring , user interface features of the target page are temporarily displayed to preview the features to the user . the user interface features can be any type of content including toolbars , check boxes , text , images , etc . in process block 206 , the user interface features are removed from the viewable area so as to complete the preview . in one embodiment , removing the features includes animating the features out of the viewable area in a direction so as to indicate a location of the features outside of the viewable area . fig3 is a flowchart of a method for a particular embodiment wherein a source application animates out of a user interface and a target application animates into a user interface . in process block 300 , a source application sends a navigate event together with a desired exit transition and information about the destination application . a transition coordinator can receive the navigation event and animate out the source application in the requested manner ( process block 302 ). if the source application does not provide a desired exit transition , then a system transition can be used . in process block 304 , the transition coordinator can query the destination application which transitions it supports and whether it wants to use the system transition . in process block 306 , the destination application can decide whether it will handle the transition or let the transition coordinator handle it . in particular , the destination application can respond to the query of the transition coordinator and either instruct the transition coordinator to handle the transition or decide to handle the transition itself . in process block 308 , if the transition is a common system transition , the page ( which is being opened ) associated with the destination application accesses an animation library , which has information to define the overall motion behavior of the entire page or full layout of the scene . in process block 310 , for custom transitions , the page being opened controls the animation including the temporary preview display of the user interface elements . for example , each page can contain child user interface elements ( e . g ., common controls , such as checkboxes or list view items ) and the child user interface elements can monitor for the type of transition that will occur for the page . if the child user interface element has specific behavior defined for a transition , they can animate this behavior asynchronously from the rest of the page &# 39 ; s contents . if they do not have specific behavior defined , they can allow the user interface elements to animate in with the rest of the page . fig4 shows an embodiment of the overall system structure 400 that can be used to implement the preview transitions . a foreground application is shown at 401 . in this particular embodiment , the foreground application is executing and receives user input to open a target application . in response , the foreground application fires a navigation event and sends transition data 402 to a transition coordinator 404 . the transition data can include the desired transition out of the foreground application and information relating to the target application to be opened . the transition coordinator 404 organizes the transition out of the foreground application and the transition in of the target application . the transition coordinator 404 communicates with the destination application 406 and queries whether the transition coordinator is handling the transitions or whether the application will animate at the page level . in any event , the transition coordinator can pass off the transition information to a first page 408 in the application . in the case of a common transition , the page 408 accesses an animation library 410 that has a plurality of motion behaviors that can be used for transitions . the page 408 is a base layout element that can host child elements , such as child elements 412 , 414 . although two child elements are shown , a page can include any desired number of child elements . example child elements include controls , such as checkboxes and list view items . fig5 shows an example of how a preview transition can occur . a page 500 is shown as having a portion 502 within a viewable area 504 of a graphical user interface and a portion 506 outside of the viewable area . generally , the page 500 is too large to fit within the viewable area 504 , so the user must navigate , such as through a flick operation , to view the other content . the flick operation is well - known in the industry and includes allowing the user to drag a finger across the viewable area 504 in order to move content from outside the viewable area 506 into the viewable area 504 . two user interface features 518 and 520 are shown as being animated in a transition phase of opening the page 500 . the user interface features 518 and 520 are shown in dashed lines to indicate that they are moving across the viewable area 504 in the direction of arrow 522 . as such , the transition temporarily shows the user interface features to preview the features to the user . additionally , as the features move off the viewable area of the page 504 , the user has an understanding what user interface features are available and their location when they reside outside of the viewable area . fig6 shows the page 500 after it has opened ( i . e ., transition completed ), with the user interface features 518 and 520 in a static , at - rest state . the exposed portion of the page 602 is visible to the user and the unexposed portion 604 is only available through additional user input . even with the user interface features 518 and 520 in the unexposed portion of the user interface , due to the preview transition of fig5 , the user can know which user interface features are available and the direction the page must be moved to access those user interface features . thus , the preview transition provided the user with what user interface features are available and where they are located . fig7 shows an example timeline 700 with a foreground application transitioning out and a target application transitioning into the user interface . at time t 1 , a request is received from the foreground application to transition out of the user interface . between time t 1 and t 2 , the foreground application transitions out as controlled by a transition coordinator . between times t 2 and t 3 , the target application transitions into the user interface . for a first part of this time period 710 , a user interface feature is animated into the viewable area and for a second part of this time period , the user interface feature animates out of the viewable area . such transitions can occur according to the particular application and can easily be modified . after a time period t 3 , the target application is in the opened state and the transition is completed . fig8 through 10 show a transition using an email application that opens an email from a list . first , in fig8 , an email list is displayed in the user interface 800 . a toolbar 802 is shown at the bottom of the list . a user selects the list member entitled “ alex freeman ,” which results in opening an email . when the email is opened , a transition is illustrated in fig9 , wherein the word “ reply ” is temporarily displayed at the bottom to show the user that if they want to reply , a command is available . additionally , the location of the reply command is below the toolbar 802 . in fig1 , the word “ reply ” scrolls off the bottom of the screen to indicate a direction for the user to navigate in order to view the “ reply ” command again . thus , the temporary preview can also be used for transitions within an application , such as when a user selection causes new content to be displayed . fig1 illustrates a generalized example of a suitable implementation environment 1100 in which described embodiments , techniques , and technologies may be implemented . in example environment 1100 , various types of services ( e . g ., computing services ) are provided by a cloud 1110 . for example , the cloud 1110 can comprise a collection of computing devices , which may be located centrally or distributed , that provide cloud - based services to various types of users and devices connected via a network such as the internet . in example environment 1100 , the cloud 1110 provides services for connected devices 1130 - 1132 with a variety of screen capabilities . connected device 1130 represents a device with a computer screen ( e . g ., a mid - size screen ). for example , connected device 1130 could be a personal computer such as desktop computer , laptop , notebook , netbook , or the like . connected device 1131 represents a device with a mobile device screen ( e . g ., a small size screen ). for example , connected device 1131 could be a mobile phone , smart phone , personal digital assistant , tablet computer , and the like . connected device 1132 represents a device with a large screen . for example , connected device 1132 could be a television screen ( e . g ., a smart television ) or another device connected to a television ( e . g ., a set - top box or gaming console ) or the like . one or more of the connected devices 1130 - 1132 can include touch screen capabilities . additionally , each of the devices can use the transitions described herein . services can be provided by the cloud 1110 through service providers 1120 , or through other providers of online services ( not depicted ). for example , cloud services can be customized to the screen size , display capability , and / or touch screen capability of a particular connected device ( e . g ., connected devices 1130 - 1132 ). in example environment 1100 , the cloud 1110 provides the technologies and solutions described herein to the various connected devices 1130 - 1132 using , at least in part , the service providers 1120 . for example , the service providers 1120 can provide a centralized solution for various cloud - based services ( e . g ., spelling data , grammar data , word frequency data , etc .). the service providers 1120 can manage service subscriptions for users and / or devices ( e . g ., for the connected devices 1130 - 1132 and / or their respective users ). although the operations of some of the disclosed methods are described in a particular , sequential order for convenient presentation , it should be understood that this manner of description encompasses rearrangement , unless a particular ordering is required by specific language set forth below . for example , operations described sequentially may in some cases be rearranged or performed concurrently . moreover , for the sake of simplicity , the attached figures may not show the various ways in which the disclosed methods can be used in conjunction with other methods . any of the disclosed methods can be implemented as computer - executable instructions stored on one or more computer - readable media ( e . g ., non - transitory computer - readable media , such as one or more optical media discs , volatile memory components ( such as dram or sram ), or nonvolatile memory components ( such as hard drives )) and executed on a computer ( e . g ., any commercially available computer , including smart phones or other mobile devices that include computing hardware ). any of the computer - executable instructions for implementing the disclosed techniques as well as any data created and used during implementation of the disclosed embodiments can be stored on one or more computer - readable media ( e . g ., non - transitory computer - readable media ). the computer - executable instructions can be part of , for example , a dedicated software application or a software application that is accessed or downloaded via a web browser or other software application ( such as a remote computing application ). such software can be executed , for example , on a single local computer ( e . g ., any suitable commercially available computer ) or in a network environment ( e . g ., via the internet , a wide - area network , a local - area network , a client - server network ( such as a cloud computing network ), or other such network ) using one or more network computers . for clarity , only certain selected aspects of the software - based implementations are described . other details that are well known in the art are omitted . for example , it should be understood that the disclosed technology is not limited to any specific computer language or program . for instance , the disclosed technology can be implemented by software written in c ++, java , perl , javascript , adobe flash , or any other suitable programming language . likewise , the disclosed technology is not limited to any particular computer or type of hardware . certain details of suitable computers and hardware are well known and need not be set forth in detail in this disclosure . furthermore , any of the software - based embodiments ( comprising , for example , computer - executable instructions for causing a computer to perform any of the disclosed methods ) can be uploaded , downloaded , or remotely accessed through a suitable communication means . such suitable communication means include , for example , the internet , the world wide web , an intranet , software applications , cable ( including fiber optic cable ), magnetic communications , electromagnetic communications ( including rf , microwave , and infrared communications ), electronic communications , or other such communication means . the disclosed methods , apparatus , and systems should not be construed as limiting in any way . instead , the present disclosure is directed toward all novel and nonobvious features and aspects of the various disclosed embodiments , alone and in various combinations and subcombinations with one another . the disclosed methods , apparatus , and systems are not limited to any specific aspect or feature or combination thereof , nor do the disclosed embodiments require that any one or more specific advantages be present or problems be solved . in view of the many possible embodiments to which the principles of the disclosed invention may be applied , it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention . rather , the scope of the invention is defined by the following claims . we therefore claim as our invention all that comes within the scope and spirit of these claims .	6
fig1 illustrates the present invention system for determining frequency tolerance . the system 100 comprises a beatnote regulator 102 having a first input on line 104 to accept a beatnote signal . the beatnote signal has a frequency equal to the difference between input frequencies . for example , between an oscillator signal frequency and a data signal rate . the beatnote regulator has an output on line 106 to provide a reset signal in response to the beatnote signal . a counter 108 has a first input to accept and count cycles of the oscillator signal on line 110 . the counter 108 has an output on line 112 to provide an overflow signal , or most significant bit ( msb ) in response to meeting a first count . the counter has a second input connected to the beatnote regulator output on line 106 to reinitialize the count . a lock analyzer 114 has a first input connected to the output of the beatnote regulator on line 106 and a second input connected to the output of the counter on line 112 . the lock analyzer 114 analyzes the reset and overflow signals to supply a lock signal at a first output on line 116 when the oscillator and data signal frequencies are within a sufficient tolerance . in normal operation , the lock analyzer 114 generates a lock signal in response to receiving a single overflow signal . the lock analyzer 114 ceases to generate the lock signal in response to receiving a predetermined number of reset signals , subsequent to the initial lock signal . the lock analyzer 114 also has a second output to supply an interrupt signal on line 118 in response to generating an initial lock signal . the beatnote regulator 102 has a second input connected to the second output of the lock analyzer on line 118 to accept the interrupt signal . the beatnote regulator 102 interrupts the supply of reset signals on line 106 that are generated in response to the beatnote signal , when the interrupt signal has been received . the lock analyzer 114 ceases to supply the interrupt signal on line 118 in response to receiving an overflow signal on line 112 , subsequent to the generation of the initial lock signal . thus , the system 100 ignores the reception of beatnotes in the time period between the generation of an initial lock signal and the subsequent lock signal . this feature is useful when the system 100 uses the lock signal to perform functions that may be momentarily unstable , or that temporarily generate beatnote signals . more specifically , the beatnote regulator 102 generates a single reset signal in response to receiving the interrupt signal , or the initiation of the interrupt signal . this reset signal is used to reinitialize the counter 108 . after generating the next overflow , which in turn causes the subsequent lock signal , the beatnote regulator 102 generates another reset signal in response to the cessation of the interrupt signal . the counter 114 is reinitialized for normal operation where beatnote generated reset signals are once more analyzed . that is , the counter 114 is reinitialized in response to the reset signals generated by the interrupt signal . fig2 is a more detailed depiction of the beatnote regulator 102 of fig1 . in some aspects of the invention , the beatnote signal on line 104 includes a first beatnote signal on line 104 a responsive to the oscillator signal frequency being higher than the data signal rate . a second beatnote signal on line 104 b is responsive to the oscillator signal frequency being lower than the data signal rate . a first and gate 200 has a first input on line 104 a to receive the first beatnote signal , and a second input on line 104 b to receive the second beatnote signal . the first and gate 200 has an output on line 202 that provides the anded function of the two input signals . typically , only one line will have beatnotes to communicate at any particular time , while the other line remains high . the anded beatnotes are passed on the line 202 . a rising edge one - shot 204 has an input on line 202 connected to the first and gate 200 output . the rising edge one - shot 204 creates a pulse supplied at an output on line 206 , in response to each received beatnote . a second and gate 208 has a first input connected to the second output of the lock analyzer to accept and invert the interrupt signal , a second input connected to the output of the rising edge one - shot 204 , and an output on line 210 to supply the reset signal . in some aspects of the invention ( not shown ) a degliching circuit may be used between the first and gate 200 and the rising edge one - shot 204 . an either edge one - shot 212 has an input connected to the second output of the lock analyzer to accept the interrupt signal on line 118 . the either edge one - shot 212 has an output on line 214 to supply a signal in response to the initiation of the interrupt signal and the cessation of the interrupt signal . an or gate 216 has a first input connected to the output of the either edge one - shot 212 on line 214 , a second input connected to the output of the second and gate on line 210 , and an output connected to the second input of the counter on line 106 . although the beatnote regulator 102 has been depicted as a specific combination of logic elements , the present invention is not limited to depicted combination of elements or signal polarities . an equivalent circuit could be easily designed to generate reset pulses in response to equivalent stimuli . fig3 is a more detailed depiction of the lock analyzer 114 of fig1 . the lock analyzer further comprises a first flip - flop 300 having a clock input connected to the counter output on line 112 . a reset input of the first flip - flop 300 is connected to the beatnote regulator output on line 106 . the first flip - flop 300 has an output on line 302 to supply a saved , or gated overflow signal . note that the data input is tied to a logic high signal and the output is derived from the “ q ” output of the first flip - flop in this particular configuration of the invention . a divider 304 has a clock input connected to the output of the beatnote regulator on line 106 and a reset input connected to the output of the first flip - flop on line 306 . the divider 304 has an output on line 308 to supply a divided reset signal . in some aspects of the invention , the divider 304 is a divide - by - four , and the reset signal on line 106 is divided by four . a second flip - flop 310 has a clock input connected to the divider output on line 308 , a reset input connected to the output of the first flip - flop on line 306 , and an output to supply the lock signal on line 116 . the data input of the second flip - flop 310 is tied to a logic high . the lock analyzer 114 includes further elements to enable the interrupt function . a third flip - flop 312 has a data input connected to the output of the second flip - flop on line 116 , a clock input connected to the output of the first flip - flop on line 302 , and a reset input . the third flip - flop 312 has an output on line 314 connected to the reset input , to supply an interrupt reset signal . a fourth flip - flop 316 has a clock input connected to the output of the second flip - flop on line 116 , a reset input connected to the output of the third flip - flop on line 314 , and an output connected to the second input of the beatnote regulator on line 118 to supply the interrupt signal . note that the data input is tied to a logic high . in some aspects of the invention , the second flip - flop 310 has a first propagation delay for supplying an output responsive to resetting the flip - flop . then , the lock analyzer 114 further comprises a delay element 318 , with a second propagation delay , and an input connected to the output of the first flip - flop on line 302 . the delay 318 has an output connected to the reset input of the divider 304 and the reset input of the second flip - flop 310 on line 306 . further , the third flip - flop 312 has a data input hold - time that is less than the combination of the first and second propagation delays . alternately , the delay element 318 can be eliminated if the propagation of the first flip - flop output signal is delayed sufficiently through second flip - flop 310 . that is , if the third flip - flop hold - time is less than the propagation delay through the second flip - flop . however achieved , the propagation delays are important to assure that the third flip - flop 312 is clocked with a “ 0 ”, to prevent the generation of an interrupt reset signal on line 314 . likewise , the first flip - flop 300 has a third propagation delay for supplying an output responsive to resetting the flip - flop in response to reset signals on line 106 . then , the divider 304 has a clock pulse processing delay that is less than the combination of the second and third propagation delays . alternately , the same effect is achieved if the circuit is designed so that the first flip - flop 300 has propagation delay that exceeds the divider clock processing delay . this timing concern insures that the reset signal on line 106 is ignored by the divider 304 ( if line 302 is high ), before the first flip - flop 300 is reset . returning to fig1 in some aspects of the invention , the counter 108 has a third input on line 350 to accept commands selecting the first count . then , the lock analyzer 114 supplies a lock signal with a relaxed tolerance of frequency differences between the oscillator and data signals in response to decreasing the value of the first count . alternately stated , if the first count is decreased , then it is more likely that an overflow signal will be generated , in turn generating a lock signal , before a reset signal is received . since it is easier to generate lock signals with a smaller first count , the system has a greater tolerance of beatnotes and , therefore , of frequency differences between the oscillator frequency and data signal rate . likewise , when the first count is increased , the frequency tolerance is tightened . fig4 is a schematic block diagram illustrating an exemplary use of the system 100 of fig1 . a first phase detector 400 has a first input on line 402 to accept the oscillator signal , a second input on line 404 to accept the data signal , a first output to supply the first beatnote signal on line 104 a , and a second output to supply the second beatnote signal on line 104 b . a second phase detector 406 also has inputs connected to receive the oscillator signal and data signal , and has differential outputs on lines 408 and 410 . a bang - bang frequency phase detector provides a beatnote signal that is responsive to the frequency of the inputs , and it can be used as the first phase detector 400 to lock a loop or control the frequency of an oscillator . the data signal does not have a frequency per se , however , the information is clocked at a rate which can be thought of as a frequency for the purpose of the present analysis . a switch 412 has a control input connected to the first output of the lock analyzer on line 116 to receive the lock signal . the switch 412 has data inputs connected to the first phase detector 400 on lines 104 a and 104 b , and to the second phase detector 406 on lines 408 and 410 . the switch 412 selects the second phase detector 406 for use in response to the lock signal on line 116 . the switch 412 selects the first phase detector 400 for use in response to the cessation of the lock signal . in some aspects , the second phase detector 406 is a hogge phase detector . then , the circuit of fig4 uses the bang - bang 400 and hogge 406 phase detectors to recover a clock signal from an input data signal . this recovery is accomplished without a reference frequency , and can be designed to meet sonet tolerance standards . the bang - bang frequency detector 400 is used in acquisition . when the oscillator 414 frequency is close enough ( in frequency ) to the data rate , control of the loop is passed from the bang - bang frequency detector 400 to the hogge detector 406 for improved frequency / phase tracking . additional details of this use of the system 100 for selecting a phase detector can be found in copending patent application ser . no . 09 / 667 , 264 , entitled dual - loop system and method for frequency acquisition and tracking , invented by bruce coy , filed on sep . 22 , 2000 , and assigned to the same assignee as the instant invention . however , the present invention is not limited to merely this specific implementation . a more functional explanation of system 100 follows that requires the simultaneous reference to fig1 through 4 . if the frequency difference between the oscillator signal and the date rate is large , resets occur before the counter 108 can overflow . likewise , if the frequency difference is within the tolerance of “ lock ”, the counter 108 overflows before a reset signal is generated . if the counter 108 overflows , an overflow state is triggered and lock is indicated . once lock is indicated , the lock signal on line 116 cannot change for a time period equal to one entire counter cycle ( the first count ). after this wait , “ lock ” can be lost only with four consecutive non - overflow resets ( assuming the divider is divide - by - four ). this event occurs when the oscillator frequency and the data rate difference are consistently outside of the “ lock ” tolerance . the lock analysis circuit 114 can start in any internal state and will work itself out within four rising beatnote edges . assuming the difference in frequency between the oscillator signal and the data rate is more than the “ lock ” tolerance , the lock signal on line 116 , the gated overflow signal on line 302 , and the interrupt signal on line 118 are low . the first and gate 200 monitors rising edges of the beatnote signals on lines 104 a and 104 b . since the interrupt signal is low , whenever a rising edge occurs a reset signal ( high ) is generated on line 106 . assuming that the reset signal is generated before the counter overflows , the gated overflow signal on line 302 is reset before clocking in a “ 1 ”, and lock signal on line 116 does not go high . the reset signal also reinitializes the counter 108 and increments the count at divider 304 . when the divider 304 reaches “ 4 ”, the second flip - flop 310 clocks in a “ 1 ”. as the frequency of the reset signal on line 106 decreases , such that the counter 108 can generate an overflow signal , the lock signal on line 116 goes high . when the gated overflow signal on line 302 pulses high , long enough to reset the second flip - flop 310 , the lock signal on line 116 goes high . at the same time , the divider 304 is reset . once the lock signal goes high , the interrupt signal on line 118 also goes high . this flag turns “ off ” the second and gate 208 , but the action of the either edge one - shot 212 , which generates a pulse in response to either a low or high signal , causes a reset signal , and the counter 108 is reset . the beatnote regulator 102 ignores beatnotes during the time the interrupt signal is high . in the context of fig4 this transition could occur as the switch 412 changes from the first phase detector 400 to the second 406 . the counter 108 is reset so that beatnotes are ignored for the entire 2048 count ( assuming the first count equals 2048 ). when the counter 108 overflows , with the lock signal already high , the third flip - flop 312 is clocked , the fourth flip - flop 316 is reset , and the interrupt signal goes low . the falling edge on the interrupt signal reactivates the second and gate 208 , and the either edge one - shot 212 causes the counter 108 to reset . thus , a full count ( 2048 ) will occur before the msb goes high . the divider is also reset , to ensure that four consecutive non - overflow counts are required to lose lock . in some aspects of the invention , the selectable phase detector circuit of fig4 has a 488 parts per million ( ppm ) tolerance specification . since any beatnote period over 2048 count indicates 488 ppm frequency difference , or less , between the data rate and the oscillator , it is not desirable to increment the divider 304 when a beatnote reset occurs , after the counter has overflowed . therefore , it is important that ( delayed ) gated overflow signal on line 306 is held high and the divider 304 is held in reset , once the counter 108 has reached 2048 . since there is no limit to the period of beatnotes on lines 104 a and 104 b , an overflow indicator must be used . also , since a beatnote occurring after a counter overflow should not result in a loss of lock , the divider 304 must be held in reset despite the occurrence of the reset signal on line 106 . an “ illegal ” initial condition logic circuit can be used to remove the system 100 from the state in which the interrupt signal on line 118 is high and the lock signal on line 116 is not high . in this situation the fourth flip - flop 316 will never be reset . when the counter 108 will overflows , the lock signal remains high , and stays high forever because the interrupt signal is high . in some aspects of the invention ( not shown ), a simple and gate has one input connected to accept the interrupt signal on line 118 , a second input to accept an inverted lock signal , and an output to feed an or gate . the other input of the or gate is connected to line 314 . the or output is connected to reset inputs ( line 314 ) of the third and fourth flip - flops 312 / 316 . if the system 100 starts up in the interrupt and not locked state , the circuit will go into the not interrupt and not locked state . the following is a case where four consecutive beatnotes , with a period less than 2048 oscillator cycles , cause the system 100 to lose lock . the first beatnote period is 2052 cycles long and all subsequent beatnote periods are 2045 cycles long . reset occurs and counter is set to 0 ( divider = 1 ) reset occurs and counter is set to 0 ( divider = 2 ) reset occurs and counter is set to 0 ( divider = 3 ) reset occurs and counter is set to 0 ( divider = 4 ) the system is out of lock after 4 beatnote periods that are less than 2048 oscillator cycles long . fig5 is a flowchart illustrating the present invention method for determining - frequency tolerance . although the method is depicted as a sequence of numbered steps for clarity , no order should be inferred from the numbering unless explicitly stated . the method begins at step 500 . step 502 measures the frequency of a first signal . step 504 accepts a measurement of the difference in frequency between the first signal and a second signal . step 506 reinitializes the measurement of the first signal frequency in response to the frequency difference between the first and second signals . step 508 determines a sufficient tolerance between the first and second signal frequencies in response to completing the measurement of the first signal frequency . measuring the frequency of the first signal in step 502 typically includes counting cycles of the first signal . then , determining a sufficient tolerance between the first and second signal frequencies in response to completing the measurement of the first signal frequency in step 508 includes counting a predetermined first number of cycles , or more than the first number of cycles , to obtain a first count . reinitializing the measurement of the first signal frequency in response to the frequency difference between the first and second signals in step 506 includes reinitializing the count of the first signal cycles . in some aspects of the invention , the second signal is a data signal with a data rate . then , accepting a measurement of the difference in frequency between the first signal and a second signal in step 504 includes generating a reset signal having a frequency that is the absolute difference in frequency between the first signal frequency and second signal data rate . reinitializing the count of the first signal cycles in step 506 includes restarting the count at zero in response to the reset signal . following the determination of a sufficient tolerance between the first and second signal frequencies in step 508 , step 510 interrupts the generation of the reset signal . following the interruption of the generation of the reset signal in step 510 , step 512 generates a single reset signal . step 514 reinitializes the count of the first signal cycles in response to the reset signal . step 516 counts a first number of first signal cycles . step 518 ceases the interruption of the reset signal in response counting the first number of cycles . following the cessation of the interruption of the reset signal in step 518 , step 520 generates a single reset signal . step 522 reinitializes the count of the first signal cycles in response to the reset signal . the method includes the further steps . step 524 counts at least a predetermined second number of reset signals without an intervening first count . step 526 determines an insufficient tolerance between the first and second signal frequencies in response to generating reset signals . more specifically , determining an insufficient tolerance between the first and second signal frequencies in response to generating reset signals in step 526 includes counting the second number of ( consecutive ) reset signals . reset signals are considered to be consecutively generated if they occur without an intervening first signal cycle first number count ( step 508 ). in some aspects of the invention , counting at least a second number of ( consecutive ) reset signals in step 526 includes disregarding an initial reset signal , subsequent to counting a first number of first signal cycles ( the first count ). in some aspects of the invention , an oscillator , data signal , and a first phase detector are supplied . then , measuring the frequency of a first signal in step 502 includes measuring the frequency of the oscillator signal . accepting the measurement of the difference in frequency between the first signal and a second signal in step 504 includes the first phase detector measuring the frequency difference between the oscillator signal frequency and the data signal rate . in other aspects of the invention , a system , using a selectable first and second phase detector , is supplied , as shown in fig4 . then , in response to determining a sufficient frequency tolerance in step 508 , step 509 selects the second phase detector for use in the system . in response to determining an insufficient frequency tolerance in step 524 , step 526 selects the first phase detector for use in the system . in some aspects of the invention a further step , step 501 selects the first number of cycles of first signals to be counted . then , determining a sufficient tolerance between the first and second signal frequencies in step 508 includes tightening the tolerance in response to selecting a larger first number of cycles . a system and method have been provided for determining a frequency tolerance between input frequencies without the use of a reference frequency . the invention compares externally generated beatnotes to an overflow count generated by the clock . although a specific example is given of using the invention to select between phase detectors , and the generation of a oscillator frequency , the invention is applicable to other types of frequency or loop analysis . other variations and embodiments of the invention will occur to those skilled in the art .	8
referring now to fig1 the apparatus shown is a prospective view . the frame 10 is generally linear at a proximal end . a pneumatic cylinder is pivotally attached to handle 40 by bolt 8 . a cutaway section shows the piston 52 to which rod 18 is attached . the pneumatically operated cylinder provides the actuating force for the apparatus in the preferred embodiment . the piston is actuated by directing air through either lines 14 or 16 . air directed through line 14 moves the rod 18 to extend outward and actuate the linkage ( described below ) to the pry blade 42 ( hereinafter called “ the pry ”) open away from the fixed wedges 48 a and 48 b . air directed through line 16 causes the pry 42 to close . the air is directed to the selected line by - manual operation of switch control 4 which is pivotally mounted on pin 6 in handle 2 of the frame and moves rod 50 in to direct from line 12 air to line 14 and on release the rod 40 is biased ( not shown ) within switch 30 to direct the air to line 16 and close the pry . thus , squeezing the switch control 4 causes the pry to open and release causes it to close . referring to fig2 the apparatus is shown with the pry 42 closed . in the pry it is cooperatively aligned with the fixed wedges 48 a and 48 b and rests between them . as shown in fig2 in this configuration these three components have a single profile of beveled surfaces 54 for insertion between conjoined material such as boards nailed together . the rod 18 is affixed to fitting 22 which pivotally attached to slot 24 to lever 28 by pin 26 . lever 28 is pivotally mounted to the member 46 a and 46 b which extends from the frame and form a bracket where the lever 28 is mounted on pin 32 . the pin 32 is the fulcrum of the lever . the long end 56 of the lever 28 is attached to the pry . referring to fig6 arm 44 is shown as pivotally attached by pin 36 to the extension 42 a of pry 42 . the short end 58 of the lever 28 is attached to arm 44 by pin 34 which links the level to pry . the pry 42 is pivotally mounted between the wedges 48 a and 48 b on pin 38 as shown in fig1 . in the preferred embodiment the various components of the linkage system is shown as joined by fingers on the cooperating components . fingers 44 a - c of arm 44 interlaced with fingers 41 ( only one of two fingers is visible ) of extension 42 a on the one end and with finger 28 a - b of lever 28 on the other end . also arm 40 is provided for controlling and placing the apparatus which is conveniently suspended on a balanced line ( now shown ) when in use .	4
one embodiment of the invention is presented in fig1 . a paraffin wax 10 is transferred to a wax storage tank 20 . paraffin wax 10 , for example , is a normal paraffin having a carbon number between 14 and 22 . for example , paraffin includes 60 - 100 wt % n - octadecane , and has a melting point between about 50 ° f . ( 10 ° c .) and about 122 ° f . ( 50 ° c . ), preferably between about 64 ° f . ( 18 ° c .) and about 82 ° f . ( 28 ° c .). the paraffin has a heat fusion between about 100 and 240 j / g . the paraffin wax may be obtained from a number of chemical and refining operations such as fischer - tropsch synthesis , ethylene oligomerization followed by hydrogenation of c 14 - c 22 linear olefins , or via mole sieve separation from petroleum fractions . a bio - based process for production of n - paraffins involves hydrodeoxygenation of lipids using a hydrogenation catalyst having hydrogenolysis and olefin saturation activity . the lipid fatty acid / ester oxygen atoms are removed and double - bonds therein saturated . in a preferred embodiment , the octadecane - rich wax composition is the product of hydrodeoxygenation of lipids such as canola oil . the paraffin wax 10 is transferred to a mix tank 30 where it is mixed with other ingredients for pelletizing . a level transmitter 40 and an automatically activated valve 50 are used to ensure the proper amount of paraffin wax is introduced to the mix tank 30 . paraffin wax storage tank 20 is typically located at a higher elevation than the mix tank 30 , thus allowing for gravity flow of the paraffin . in some embodiments , a pump is used to transfer the contents of the storage tank 20 to the mix tank 30 . the other mix components include a polymer 60 and an additive composition 70 . the polymer 60 is , for example , a high density polyethylene ( hdpe ) powder . the polymers have a molecular weight greater than 100 , 000 and are compatible with the paraffin wax , or have at least one wax - compatible phase . some polymers have flame retardant properties which is useful when the pcm is used in building and construction applications . examples of such polymers include halogenated or halogen - modified polymers , or those additized with flame - retardants . a preferred polymer is hdpe having melt flow index ( or melt flow rate ) less than 50 g per 10 minutes . melt flow index ( mfi ) is a measure of the polymer &# 39 ; s molecular weight and melt viscosity ; the higher the molecular weight and melt viscosity , the lower its mfi . the most preferred polymer is hdpe having mfi values between about 0 . 1 g / 10 min and about 20 g / 10 min . however , it should be understood by one of ordinary skill in the art that various polymers may be utilized so long as the polymer functions in accordance with the present invention as described herein . the polymer 60 is loaded into a hopper 80 , from where required amounts for pcm compounding are transferred to the mix tank 30 using a mass flow control loop 90 including a load cell 100 and solids flow valve 110 . typically , hopper 80 is at a higher elevation than the mix tank 30 , thus allowing for gravity flow of polymer 60 through conduit 170 . if hopper 80 is not at a higher elevation , pneumatic transport , screw conveyor , or bucket elevators may be used to transfer the contents to the mix tank 30 . the additive composition 70 is optionally added to the mix tank 30 to enhance the pcm pellet performance . the additive composition 70 is a solid ( powder or flake ) blend including a thermal conductivity improver , a nucleating agent , an anti - oxidant , and / or a flame retardant . thermal conductivity improvers are optionally added to increase the rate of heat transfer from the pcm pellet walls to the paraffin clusters trapped therein . prior art teaches use of expandable graphite , graphite microfiber pieces , or graphite powder for this purpose . it should be understood by one of ordinary skill in the art that any material having thermal conductivities higher than the polymer and the wax — for example , in microfiber form — may be used as the thermal conductivity improver . nucleating agents include organic and inorganic material that can form a site for crystal growth , thus preventing sub - cooling or reducing the extent of sub - cooling . sub - cooling is when a molten material does not freeze when cooled to its melting point , but several degrees lower . the nucleating agents suitable for use in pcm pellets include inorganic salts , such as sodium and calcium chloride , or organic compounds having a higher melting point than the paraffin , but with a similar alkyl group . a suitable organic nucleating agent for the present invention includes 1 - octadecanol . it should be noted that 1 - octadecanol is also a reaction intermediate during hydrodeoxygenation of vegetable oils to paraffins , and thus , may be present in n - octadecane produced via hydrodeoxygenation . antioxidants / stabilizers include hindered phenols , phosphites , and hydroxylamines . flame retardants include halogenated organic compounds , as well as organo - antimony and organo - phosphorus compounds . antioxidant / stabilizers are added mainly to protect the polymer and wax from degradation at high compounding temperatures ( e . g . in the mix tank 30 , or an extruder ). the additives that include the additive composition 70 may be in the form of a master - batch . as such , the additive composition 70 is placed in an additive holding and transfer vessel 120 . if the components that include additive composition 70 are not pre - blended as a master - batch , individual holding and transfer vessels for each component will be required such that they can be dosed individually to the mix tank 30 . the amount ( defined below ) of additive composition 70 is transferred to the mix tank 30 using a mass flow control loop 130 , including a load cell 140 and solids flow valve 150 . typically , vessel 120 is at a higher elevation than the mix tank 30 , thus allowing for gravity flow of solids additive composition 70 through conduit 180 . if vessel 120 is not at a higher elevation , pneumatic transport , screw conveyor , or bucket elevators may be used to transfer the contents to the mix tank 30 . the rate of transfer of solids through conduits 170 and 180 may need to be controlled ( through control loops 90 and 130 , respectively ) to ensure that the solids are well - dispersed and / or melted . the paraffin wax , the polymer , and the additives are then charged to the mix tank 30 through conduits 160 , 170 , and 180 , respectively . the order of addition depends on the type of equipment used as the mix tank 30 . the mix tank 30 may be a viscous melt batch mixer ( e . g . banbury or henschel mixers ) or a continuous extruder . the extruder may be a single - screw mixer , a twin screw co - rotating mixer , or a counter - rotating mixer . in the embodiment of fig1 , the mix tank 30 is shown as a heated vessel equipped with a mixing device appropriate for the relatively high viscosity polymer melt composition . for this system , the polymer and additive are added to the pool of molten wax . a mix tank agitator 190 , including a motor , shaft , and propeller blade , is kept on during addition of all ingredients . the paraffin wax 10 and polymer 60 are charged at a ratio ( paraffin : polymer ) of from about 50 : 50 to 90 : 10 , preferably from 60 : 40 to 80 : 20 . the additives 70 are then dosed through a conduit 180 . the additive composition 70 and dosing level are such that the amount of nucleating agent in pcm paraffin is from about 0 to about 10 wt %, the thermal conductivity improver is from about 0 to about 2 wt %, the flame retardant is from about 0 to about 10 wt %, and the anti - oxidant is from about 0 to about 0 . 1 wt %. in order to ensure a homogenous molten composition is achieved , the mix tank 30 is equipped with a jacket 200 wherein a heat transfer fluid 210 circulates . the mix tank 30 , agitator 190 , and baffles 220 assist with heat transfer from the mix tank 30 walls to its contents . the heat transfer fluid 210 is supplied from a hot oil system ( not shown ), including a storage and expansion tank system with electric or direct - fired heating , and with a recirculation pump . the hot oil system is designed to maintain the mix tank 30 temperature between about 250 ° f . and about 550 ° f . the homogeneous molten pcm composition prepared in the mix tank 30 is transferred to a pelletizer feed tank 230 . when a continuous mixer such as an extruder is used , the pelletizer feed tank 230 is not required . for the mix tank 30 , the transfer is achieved by opening the block valve 240 and turning on pump 260 and thus , the molten pcm composition flows through conduits 250 and 270 . any number of pump types known to those having ordinary skill in the art may be selected for use as pump 260 based on the transfer temperature and corresponding pcm compound melt properties such as density and viscosity . examples of pump types include positive displacement ( gear , lobe , screw , diaphragm ) and centrifugal . preferred pumps for the transfer of liquids have viscosities in the 10 , 000 to 300 , 000 cp include gear , screw , and lobe pumps . the pelletizer feed tank 230 includes many of the same features of the mix tank 30 such as an agitator system 290 , baffles 300 , and vessel jacket 280 . furthermore , as with the mix tank 30 , heat transfer fluid 310 ( as described previously herein ) is allowed to circulate through vessel jacket 280 to maintain the pcm molten composition at desired temperature of from about 250 ° f . to about 550 ° f . when the volume of pelletizer feed gets low , a new batch of molten pcm compound is prepared in the mix tank 200 and is transferred to the pelletizer feed tank 230 . the molten pelletizer feed tank pcm composition is transferred through conduit 320 to a gear pump 330 where it is pressurized and transferred to an optional melt cooler 350 through conduit 340 . conduit 340 pressure is in the 200 to 2 , 000 psig range , depending on the melt viscosity and flow restriction provided by the apparatuses downstream . the molten pcm is cooled in melt cooler 350 to cooled pcm melt 360 . the temperature of the cooled pcm melt 360 is from about 200 ° f . to about 400 ° f . the purpose of cooling the melt is to raise its viscosity to at least about 4 , 000 cp . this ensures that extrudates of this melt , formed by pressuring the melt through orifice holes , have sufficiently high melt strength to be cut . when the molten pcm compound 250 has a viscosity higher than 4 , 000 cp , preferably above 10 , 000 cp , the melt cooler 350 is not required . the melt cooler 350 is a shell and tube heat exchanger . the pcm melt flows through the tubes 345 while a heat transfer fluid ( htf ) 351 flows through the shell . static mixer elements are inserted in the tubes 345 thereby improving heat transfer . without static mixer elements , or similar tube internals , heat transfer coefficients would be low due to laminar flow of the pcm compound . as a result , a prohibitively large heat transfer surface would be required . lacking provisions for improving heat transfer coefficient with laminar flow through tubes 345 also necessitates lower shell side temperatures which , in turn , may cause pcm freeze - off on the tube 345 walls . the htf temperature is controlled in a heat transfer fluid unit 352 . the htf temperature is controlled to be higher than the melting point of the crystalline polymer in the pcm compound . for paraffin / hdpe pcm compounds , the hdpe polymer has a melting point of about 250 ° f . ( 120 ° c .). typical htf temperatures are in the 250 ° f . to 350 ° f . range , preferably between about 260 ° f . and about 300 ° f . the temperature of the htf is thus controlled to be higher than the melting point of the polymer to ensure that no pcm components freeze on the walls of tubes 345 as the pcm is being cooled . the htf temperature is controlled via circulation through a htf cooler 355 . the htf cooler 355 , in turn , uses cooling water for cooling the htf as needed for temperature control purposes . in this embodiment , cooling water is supplied through conduit 357 , removing some of the heat from the htf , and returning cooling water through conduit 356 . the htf unit 352 is also equipped with heating capability either through a gas or liquid fuel fired heater or an electric heating element ( not shown ). the pressurized and optionally cooled pcm stream 360 enters an underwater pelletizer assembly 400 including a die 370 , rotating knives 380 , and a water chamber 390 . the die 370 is circular in shape and includes a plurality of orifice holes , arranged in a circular pattern . depending on pcm throughput , the die 370 may have between 10 and 1000 holes . in some embodiments , the die 370 is heated ( e . g . by an electric band heater ) to prevent freeze - off of molten pcm in the holes . the rotating knives 380 are set flush against the face of the die 370 in the water chamber 390 . the rotating knives 380 are supported by a shaft and motor assembly 385 , with the motor outside the water chamber 390 . as the molten pcm extrudate exits the die 370 , it is cut by rotating knives 380 under water . the cut pieces of molten pcm extrudate form into pellets , which are rapidly cooled and carried by water through a pellet slurry pipe 410 ( wherein additional pellet cooling takes place in the 1 to 10 second residence time provided by the pipe 410 ) to a spin dryer 420 . therein , pcm pellets 430 are separated from water and air - dried while spin dryer water 440 enters a pelletizer water tank 450 . the pelletizer water tank 450 is equipped with makeup line 460 and purge line 470 , to maintain tank level and water quality . the purge water in line 470 contains pellet fines and components in the pcm compound which may have migrated into the water phase . as such , the purge water is directed to filtration and / or water treatment ( not shown ). in some embodiments , the pelletizer water tank 450 is equipped with coils ( not shown ) for controlling the water temperature . in general , pelletizer water temperature best suited for pelletizing pcm according to the present invention is between about 70 ° f . to about 200 ° f . the water temperature is at a temperature between the melting point of the paraffin and the melting point of the polymer . pelletizer water of fairly constant temperature and quality is thus circulated through the water chamber 390 through a pump 480 . pump 480 is preferably a centrifugal pump sized to provide turbulence in the water chamber 390 and the pellet slurry pipe 410 . although an underwater pelletizer is described in this embodiment of the invention , it should be recognized by those skilled in the art that other pelletizers may be used so long as the pelletizer functions in accordance with the present invention as described herein . for example , a strand pelletizer may be used , wherein the molten extrudates are pulled as strands through a water trough where they are partially or completely solidified before being chopped into pellets . whereas the pellets formed in an underwater pelletizer are typically spherical , those formed in a strand pelletizer are typically cylindrical . nevertheless , the size of both types of pellets may be given by an equivalent diameter . for non - spherical pellets , the equivalent diameter is defined as the diameter of a sphere having the same surface area as the non - spherical pellet . the dewatered and dried pcm pellets 430 are transferred to a bagging hopper 490 . depending on pelletizer die 370 orifice size , rotation rate of the cutter knives 380 , and pelletizer gear pump 330 flow rate , the typical size of pellets 430 may be between 0 . 1 mm and 5 mm in diameter . for most pcm applications , the preferred size is between about 0 . 5 mm and about 2 mm , where it is small enough for high heat transfer rate , but not too small to create handling problems . for example , this size range can easily be incorporated into the gypsum slurry used to make standard wallboards . the smaller the pellet , the higher the pcm surface area to volume ratio and the higher the rate of heat transfer . the pellets 430 from the bagging hopper 490 are transferred to bags , drums , or other containers . the empty containers 510 are moved on a conveyor belt 500 to under the bagging hopper 490 and filled via fill valve 495 . the filled containers 514 are then palletized ( not shown ) and moved to warehouse for distribution . the bagging or drumming operation may be automated or performed manually . the pcm compounding and the continuous pelletizing process of the present invention are well - suited for process automation . the pcm pellets produced in this low cost production process are useful in diverse passive energy storage applications . these applications include , but are not limited to , building energy efficiency products ( e . g . wallboards , attic insulation , and roof shingles ), clothing , footwear , and furniture . from the above description , it is clear that the present invention is well adapted to carry out the objects and to attain the advantages mentioned herein as well as those inherent in the invention . while a presently preferred embodiment of the invention has been described for purposes of this disclosure , it will be understood that numerous changes may be made which will readily suggest themselves to those skilled in the art and which are accomplished within the spirit of the invention disclosed and claimed herein .	2
the present invention uses shaped articles containing polybenzazole ( polybenzoxazole and polybenzothiazole ) polymers . polybenzoxazole , polybenzothiazole and random , sequential and block copolymers of polybenzoxazole and polybenzothiazole are described in references such as wolfe et al ., liquid crystalline polymer compositions , process and products , u . s . pat . no . 4 , 703 , 103 ( oct . 27 , 1987 ); wolfe et al ., liquid crystalline polymer compositions , process and products , u . s . pat . no . 4 , 533 , 692 ( aug . 6 , 1985 ); wolfe et al ., liquid crystalline poly ( 2 , 6 - benzothiazole ) compositions , process and products , u . s . pat . no . 4 , 533 , 724 ( aug . 6 , 1985 ); wolfe , liquid crystalline polymer compositions , process and products , u . s . pat . no . 4 , 533 , 693 ( aug . 6 , 1985 ); evers , thermooxidatively stable articulated p - benzobisoxazole and p - benzobisthiazole polymers , u . s . pat . no . 4 , 359 , 567 ( nov . 16 , 1982 ); tsai et al ., method for making heterocyclic block copolymer , u . s . pat . no . 4 , 578 , 432 ( mar . 25 , 1986 ); 11 ency . poly . sci . & amp ; eng ., polybenzothiazoles and polybenzoxazoles , 601 ( j . wiley & amp ; sons 1988 ) and w . w . adams et al ., the materials science and engineering of rigid - rod polymers ( materials research society 1989 ), which are incorporated herein by reference . the polymer may contain ab - mer units , as represented in formula 1 ( a ), and / or aa / bb - mer units , as represented in formula 1 ( b ) ## str1 ## wherein : each ar represents an aromatic group . the aromatic group may be heterocyclic , such as a pyridinylene group , but it is preferably carbocyclic . the aromatic group may be a fused or unfused polycyclic system , but is preferably a single six - membered ring . size is not critical , but the aromatic group preferably contains no more than about 18 carbon atoms , more preferably no more than about 12 carbon atoms and most preferably no more than about 6 carbon atoms . examples of suitable aromatic groups include phenylene moieties , tolylene moieties , biphenylene moieties and bisphenylene ether moieties . ar 1 in aa / bb - mer units is preferably a 1 , 2 , 4 , 5 - phenylene moiety or an analog thereof . ar in ab - mer units is preferably a 1 , 3 , 4 - phenylene moiety or an analog thereof . each dm is independently a bond or a divalent organic moiety that does not interfere with the synthesis , fabrication or use of the polymer . the divalent organic moiety may contain an aliphatic group , which preferably has no more than about 12 carbon atoms , but the divalent organic moiety is preferably an aromatic group ( ar ) as previously described . it is most preferably a 1 , 4 - phenylene moiety or an analog thereof . the nitrogen atom and the z moiety in each azole ring are bonded to adjacent carbon atoms in the aromatic group , such that a five - membered azole ring fused with the aromatic group is formed . the azole rings in aa / bb - mer units may be in cis - or transposition with respect to each other , as illustrated in 11 ency . poly . sci . & amp ; eng ., supra , at 602 , which is incorporated herein by reference . the polymer preferably consists essentially of either ab - polybenzazole mer units or aa / bb - polybenzazole mer units , and more preferably consists essentially of aa / bb - polybenzazole mer units . the molecular structure of the polybenzazole polymer may be rigid rod , semi - rigid rod or flexible coil . it is preferably rigid rod in the case of an aa / bb - polybenzazole polymer or semirigid in the case of an ab - polybenzazole polymer . azole rings within the polymer are preferably oxazole rings ( z = 0 ). units within the polybenzazole polymer are preferably chosen so that the polymer is lyotropic liquid - crystalline , which means it forms liquid - crystalline domains in solution when its concentration exceeds a &# 34 ; critical concentration point &# 34 ;. preferred mer units are illustrated in formulae 2 ( a )-( h ). the polymer more preferably consists essentially of mer units selected from those illustrated in 2 ( a )-( h ), and most preferably consists essentially of a number of identical units selected from those illustrated in 2 ( a )-( c ). ## str2 ## each polymer preferably contains on average at least about 25 mer units , more preferably at least about 50 mer units and most preferably at least about 100 mer units . the intrinsic viscosity of lyotropic liquid - crystalline aa / bb - polybenzazole polymers ( as estimated by a single - point method in methanesulfonic acid at 25 ° c .) is preferably at least about 10 decilters / gram (&# 34 ; dl / g &# 34 ;), more preferably at least about 15 dl / g , and most preferably at least about 20 dl / g . for some purposes , an intrinsic viscosity of at least about 25 dl / g or 30 dl / g may be best . intrinsic viscosity of 60 dl / g or higher is possible , but the intrinsic viscosity is preferably no more than about 45 dl / g . the intrinsic viscosity is most preferably about 33 dl / g . the intrinsic viscosity of lyotropic liquid - crystalline semi - rigid ab - polybenzazole polymers is preferably at least about 5 dl / g , more preferably at least about 10 dl / g and most preferably at least about 15 dl / g . the polymer is fabricated into fibers and films by spinning or extruding from a dope . a dope is a solution of polymer in a solvent . if freshly made polymer or copolymer is not available for spinning or extruding , then previously made polymer or copolymer can be dissolved in a solvent to form a solution or dope . some polybenzoxazole and polybenzothiazole polymers are soluble in cresol , but the solvent is preferably an acid capable of dissolving the polymer . the acid is preferably non - oxidizing . examples of suitable acids include polyphosphoric acid , methanesulfonic acid and sulfuric acid and mixtures of those acids . the acid is preferably polyphosphoric acid and / or methanesulfonic acid , and is more preferably polyphosphoric acid . the dope should contain a high enough concentration of polymer for the polymer to coagulate to form a solid article but not such a high concentration that the viscosity of the dope is unmanageable to handle . when the polymer is rigid or semi - rigid , then the concentration of polymer in the dope is preferably high enough to provide a liquid crystalline dope . the concentration of the polymer is preferably at least about 7 weight percent , more preferably at least about 10 weight percent and most preferably at least about 14 weight percent . the maximum concentration is limited primarily by practical factors , such as polymer solubility and , as already described , dope viscosity . because of these limiting factors , the concentration of polymer is seldom more than 30 weight percent , and usually no more than about 20 weight percent . suitable polymers or copolymers and dopes can be synthesized by known procedures , such as those described in wolfe et al ., u . s . pat . no . 4 , 533 , 693 ( aug . 6 , 1985 ); sybert et al ., u . s . pat . no . 4 , 772 , 678 ( september 20 , 1988 ); harris , u . s . pat . no . 4 , 847 , 350 ( jul . 11 , 1989 ); and ledbetter et al ., &# 34 ; an integrated laboratory process for preparing rigid rod fibers from the monomers ,&# 34 ; the materials science and engineering of rigid - rod polymers at 253 - 64 ( materials res . soc . 1989 ), which are incorporated herein by reference . in summary , suitable monomers ( aa - monomers and bb - monomers or ab - monomers ) are reacted in a solution of nonoxidizing and dehydrating acid under nonoxidizing atmosphere with vigorous mixing and high shear at a temperature that is increased in step - wise or ramped fashion from a starting temperature of no more than about 120 ° c . to a final temperature of at least about 190 ° c . examples of suitable aa - monomers include terephthalic acid and analogs thereof . examples of suitable bb - monomers include 4 , 6 - diaminoresorcinol , 2 , 5 - diaminohydroquinone , 2 , 5 - diamino - 1 , 4 - dithiobenzene and analogs thereof , typically stored as acid salts . examples of suitable ab - monomers include 3 - amino - 4 - hydroxybenzoic acid , 3 - hydroxy - 4 - aminobenzoic acid , 3 - amino - 4 - thiobenzoic acid , 3 - thio - 4 - aminobenzoic acid and analogs thereof , typically stored as acid salts . in order to make polybenzazole fibers , the polybenzazole dopes are spun through a spinneret into an air - gap to make dope fibers . the dope fibers are drawn across the air gap . the solvent is removed from the drawn fibers , preferably by contacting the drawn fibers with a fluid that is not a solvent for the polymer . if desired the as - spun fibers are then heat set to improve their tensile modulus . to optimize the tensile and compressive properties of the fibers , one and possible two ( for high modulus fibers ) conditions of clarity must be met . the first condition is that the extruded dope ( uncoagulated ) fiber must be optically clear when it is in the air gap . as defined herein , &# 34 ; clear &# 34 ; for an extruded dope fiber means that the edge of the capillary die behind the extruded dope fiber 13 readily observable through the actual dope fiber . a long distance microscope , such as a questar long distance microscope or its equivalent can be used to observe whether the extruded dope fiber is clear . in this desirable &# 34 ; clear &# 34 ; condition , the dope fiber has only an amber colored tint visible . a fiber with non - optimal tensile and / or compressive properties will have a characteristic &# 34 ; opaque &# 34 ; appearance when the fiber is in the extruded dope fiber stage . this undesirable &# 34 ; opaque &# 34 ; condition in an extruded dope fiber can be readily observed in that the dope fiber has a characteristic greenish - yellow color . this greenish - yellow color is easily seen with the naked eye . the opaque condition permits very little or no light transmission through the fiber when the fiber is viewed with a long distance microscope . if the modulus properties of the fiber are to be as high as possible , the fiber must be heat set . the second condition of clarity that must be met ( the first being clarity of the extruded dope fibers ) in order to produce a fiber with optimal modulus properties is that the fiber must be clear after it has been heat set . clarity of a heat - set fiber means that light transmission through the fiber is very easily perceived using a standard optical microscope . clear heat set fibers have been observed to have only a slight amber tint . opaque condition of a heat set fiber is apparent when the fiber has a mottled , blotchy dark brown appearance under an optical microscope . process conditions to meet these criteria of clarity for producing fibers with optimal tensile and compressive properties are discussed in greater detail hereinafter . the fiber may be spun from a monofilament or multifilament line . an example of a useful monofilament fiber spinning line is shown on page 625 of a review article by j . f . wolfe ( see &# 34 ; polybenzothiazoles and polybenzoxazoles ,&# 34 ; encyclopedia of polymer science and engineering , 2nd ed ., vol . 11 , pp 601 - 635 ), which is incorporated herein by reference . the spinning equipment preferably contains a spinneret having one or more orifices and a means to impel the dope through the orifices . when the spinneret contains multiple orifices , the equipment preferably further contains a spin die to bring the dope to each orifice with about the same pressure and flow rate . the means to impel the dope may be , for instance , a pump , a piston or a single or multiple - screw extruder . the orifice diameter is preferably between about 5 to 15 mils ( 0 . 005 - 0 . 015 inches ), more preferably between about 7 and 9 mils and the most preferred being 8 mils . the shear rate of the dope as it goes through the orifices is preferably between about 1500 to 5000 reciprocal seconds , with a more preferred range between about 1500 and 2000 reciprocal seconds and the most preferred range being about 1700 reciprocal seconds . in preparation for fiber spinning runs the barrel is preheated and allowed to equilibrate , preferably for at least one hour . fibers can be spun over a temperature range of between about 100 ° c . and about 220 ° c . with this range yielding fibers with a diameter variation of plus or minus 15 percent . the preferred temperature range is between about 110 ° c . and about 170 ° c . and the most preferred spinning temperature is about 110 ° c . a dope fiber is formed by forcing the polybenzazole dope through a spinneret . the extruded dope fiber is drawn across a space known as an &# 34 ; air gap .&# 34 ; the gas in the &# 34 ; air gap &# 34 ; may be air , but it may also be another gas such as nitrogen , carbon dioxide , helium or argon . the temperature in the air gap is preferably between about 0 ° c . and 100 &# 34 ; c . the spin draw ratio is the ratio of the take - up velocity of the fiber divided by the extrusion velocity of the dope . the spin draw ratio range is between about 10 and 60 . the preferred spin draw ratio range is between 15 and 50 and the most preferred spin draw ratio range is between 15 and 20 . coagulation is the broad term used to define the separation of the polymer from its solvent . once spun , the dope fiber must have the majority of its solvent removed either in a coagulation or washing bath or spray . any coagulation or washing bath / spray used can contain water or water / acid mixtures , with the preferred acid being phosphoric acid at a concentration of 30 percent or less . other coagulants / washing media for the fiber include organic solvents such as acetone , methanol or acetonitrile . after the fiber is washed it is dried . please see co - owned , copending u . s . patent application ser . no . 929 , 272 , which is incorporated by reference for details on drying conditions required in order to produce fiber with minimal damage . basically , a fiber should be dried to a residual moisture content of 3 % or less before undergoing heat treatment . if desired , the modulus of the fiber can be increased by heat treating the fiber . heat treating ( or heat setting as it is sometimes described ) takes place preferably through a furnace that contains an inert gas such as nitrogen . tension is placed on the fiber as it goes through the heat setting element . heat setting can take place at any temperature between 300 ° c . and 600 ° c . with a preferred temperature range of between 400 ° c . and 550 ° c . and the most preferred temperature being 450 ° c . the residence time for heat setting depends upon the temperature , with the hotter the temperature the less time required . the range for residence time is preferably from one to thirty seconds . fibers spun under these conditions range in final ( meaning after the fiber has been heat treated ) diameter from 12 microns to 35 microns . it was found that a combination of spin draw ratio and certain diameter of fiber created ( see table i in example i ) yielded extruded dope fibers that were either opaque or clear and that the higher the spin draw ratio the lower the diameter of the fiber and the more chance that the extruded dope fibers would be clear . as stated previously , clarity in the extruded dope fiber was found to be crucial in obtaining fibers with enhanced physical properties . clarity is believed to be an indication of &# 34 ; high &# 34 ; or &# 34 ; enhanced &# 34 ; molecular ordering . once the fiber has been heat set , it has its properties measured in the following manner : tensile properties are obtained for monofilament samples by first mounting the samples on cardboard tabs with a one inch sample ( gauge ) length . after the average diameter of the filament sample is determined , the sample is tensile tested using an instron model 4201 fitted with air actuated grips and a crosshead speed of approximately 0 . 02 inch / min . the average tensile strength of the fibers is preferably at least about 600 ksi ( 1 ksi = 1000 psi ( pounds per square inch )), highly preferably at least about 800 ksi , more highly preferably at least about 1000 ksi , most highly preferably at least about 1200 ksi and utmost highly preferably at least about 1600 ksi . the average tensile modulus of the fibers is preferably at least about 40 msi ( 1 msi = 1 , 000 , 000 psi ), more preferably at least about 50 msi and most preferably at least about 57 msi . it has been found that for a given final monofilament diameter , tensile properties increased with decreasing spinning temperature . this is related in part to the increasing melt tension experienced with decreasing temperature . sufficiently high melt tension is manifested by clarity in the extruded dope fiber appearance . the maximum tensile properties for fiber were obtained when the fiber is spun at a temperature of 110 ° c . compressive properties of monofilament can be evaluated by three techniques , 3 point compressive modulus measurements , recoil testing and single fiber composite compression testing . for this work , the 3 point compressive modulus test is used . the 3 point compressive modulus measurements reported in example 1 are performed on monofilaments as per the technique described by moalli ( j . e . moalli and f . j . mcgarry , mit report r90 - 4 sep . 1990 ). the average compressive strength is preferably at least about 25 ksi and more preferably at least about 55 ksi . the average compressive modulus is preferably at most about 6 , 000 , 000 psi and more preferably at most about 30 , 000 , 000 psi . the following examples are for illustrative purposes only . they should not be taken as limiting either the specification or the claims . unless stated otherwise , all parts and percentages are by weight . several fourteen weight percent dope samples containing cis - polybenzoxazole in polyphosphoric acid are obtained ( pbo / ppa dope ). these pbo / ppa dope samples have an intrinsic viscosity of between 22 dl / g to 44 dl / g with an intrinsic viscosity preferably of approximately 33 dl / g . once formed these pbo / ppa dope samples are stored in a nitrogen - purged glove box . in preparation for fiber spinning runs , a monofilament rheometer barrel is preheated to 150 ° c ., 110 ° c . or 100 ° c . and allowed to equilibrate for at least one hour . the 14 % pbo / ppa dopes are quickly inserted into the barrel . for the examples given here , pbo fiber is extruded at 150 ° c ., 110 ° c . or 100 ° c . through a 0 . 008 &# 34 ; die ( l / d = 2 ) with a shear rate of 1700 reciprocal seconds and spin - draw ratio range of 10 to 60 . the take - up speed is about 35 meters / minute . these processing parameters resulted in monofilaments ranging in diameter from 35 pm down to 12 pm . fiber is coagulated in approximately 1 . 5 liters of water , and transferred to a wash bath or subsequent staging baths . the fiber remained in the wash bath ( h 2 o ) for approximately 12 hours ( overnight ), it was then run through a nitrogen - purged tube furnace with a heating element set at 450 ° c . with a residence time of about 10 seconds . constant tension of 20 to 30 en was maintained on the fiber during heat setting . the resulting diameter as a function of spin draw ratio ( sdr ) is listed in table 1 ( the fibers described in this table were spun at 150 ° c .). it should be noted that under the conditions of the example , the extruded dope fiber was found to have an opaque to clear transition above a sdr of about 10 , and is completely clear at a sdr equal to 15 or higher . tensile and compressive properties are given for the monofilaments so created in this work in tables 2 - 4 . table 1______________________________________spin draw ratio ( sdr ) vs . average attainablemonofilament diameter ( dia ) at a spinningtemperature of 150 ° c . opaque ( o ), transition ( t ), diameter clear ( c ) appearancesdr in microns of fiber______________________________________ 1 0 . 4 38 . 5 o 2 1 . 1 49 . 0 o 3 2 . 2 40 . 6 o 4 3 . 7 44 . 4 o 5 4 . 3 32 . 7 o 6 4 . 6 29 . 3 o 7 5 . 0 20 . 0 o 8 6 . 9 23 . 6 o 9 8 . 4 25 . 6 o10 10 . 2 20 . 8 t11 10 . 5 21 . 4 t12 11 . 4 24 . 1 t13 11 . 6 21 . 3 t14 13 . 4 20 . 2 t15 15 . 4 19 . 0 c16 17 . 0 17 . 4 c17 18 . 7 18 . 3 c18 20 . 0 15 . 1 c19 20 . 0 16 . 8 c20 20 . 3 15 . 4 c21 20 . 6 16 . 3 c22 25 . 7 15 . 0 c23 38 . 9 13 . 9 c______________________________________ table 2______________________________________fiber diameter vs . monofilament tensile modulusat three different spinning temperatures opaque ( o ), transi - tion ( t ) fiber tensile tensile tensile or cleardiameter modulus modulus modulus ( c ) appear - in ( msi ) t = ( msi ) t = ( msi ) t = ancemicrons 100 ° c . * 110 ° c . 150 ° c . of fiber______________________________________ 1 29 . 16 33 . 0 o 2 31 . 36 31 . 5 o 3 38 . 44 20 . 0 o 4 40 . 96 17 . 5 o 5 43 . 56 15 . 8 o 6 49 . 0 12 . 9 o 7 50 . 41 11 . 9 o 8 16 . 0 55 . 7 c 9 16 . 81 47 . 4 c10 17 . 64 48 . 8 c11 20 . 25 38 . 7 c12 24 . 01 25 . 8 o13 25 . 0 24 . 0 o14 29 . 16 21 . 1 o15 31 . 36 16 . 7 o16 31 . 36 18 . 7 o17 12 . 96 32 . 0 c18 12 . 96 35 . 1 c19 13 . 69 31 . 7 c20 13 . 69 32 . 6 c21 14 . 44 28 . 4 c22 14 . 44 28 . 6 c23 15 . 21 27 . 6 c______________________________________ * at this low processing temperature , the very high viscosity of the dope fiber extrudate precluded orientating the dope fiber sufficiently to obtain clarity / optimal properties . table 3______________________________________fiber diametervs . monofilament tensile strengthat three different temperatures opaque ( o ), transition tensile tensile tensile ( t ), diameter strength strength strength clear ( c ) in ( ksi ) t = ( ksi ) t = ( ksi ) t = appearancemicrons 100 ° c . * 110 ° c . 150 ° c . of fiber______________________________________ 1 29 . 16 925 o 2 31 . 36 793 o 3 38 . 44 602 o 4 40 . 96 468 o 5 43 . 56 518 o 6 49 . 0 417 o 7 50 . 41 337 o 8 16 . 0 1563 c 9 16 . 81 1178 c10 17 . 64 1257 c11 20 . 25 1129 c12 24 . 01 736 c13 25 . 0 597 c14 29 . 16 533 o15 31 . 36 514 o16 31 . 36 472 o17 12 . 96 701 c18 12 . 96 709 c19 13 . 69 520 c20 13 . 69 527 c21 13 . 69 576 c22 14 . 44 407 c23 14 . 44 552 c24 15 . 21 434 c______________________________________ * at this low processing temperature , the very high viscosity of the dope fiber extrudate precluded orienting the dope fiber sufficiently to obtain clarity even though postextrusion drawing provides sufficient orientation to boost tensile properties slightly . table 4______________________________________diameter of fiber ( microns ) vs . compressive modulus ( msi ) clear ( c ), transition ( t ) or comp . opaque ( o ) diameter modulus appearance ( microns ) ( msi ) of fiber______________________________________ 1 11 . 000 33 . 000 c 2 12 . 000 12 . 000 c 3 12 . 000 35 . 000 c 4 13 . 000 10 . 000 c 5 13 . 000 11 . 000 t 6 13 . 000 23 . 000 c 7 14 . 000 3 . 000 t 8 14 . 000 16 . 000 c 9 14 . 000 18 . 000 c10 15 . 000 3 . 000 t11 15 . 000 4 . 000 t12 15 . 000 6 . 000 t13 16 . 000 3 . 000 o14 18 . 000 4 . 000 o15 21 . 000 9 . 000 t16 22 . 000 1 . 000 o17 22 . 000 2 . 000 o18 22 . 000 3 . 000 o19 22 . 000 9 . 000 t20 23 . 000 4 . 000 o21 23 . 000 8 . 000 o22 24 . 000 5 . 000 o23 25 . 000 5 . 000 o24 25 . 000 1 . 000 o25 26 . 000 5 . 000 o26 26 . 000 5 . 000 o27 27 . 000 5 . 000 o28 28 . 000 2 . 000 o29 28 . 000 4 . 000 o30 29 . 000 1 . 000 o31 33 . 000 4 . 000 o______________________________________	3
fig1 illustrates a functional block diagram of the aircraft lightning detection and display system 10 of the present invention . the system 10 includes a lightning detection system 12 , an aircraft heading system 14 , an aircraft navigation system 16 , a computer 18 , and a display 20 , each housed within aircraft 50 . the lightning detection system 12 is conventional and may operate on known principles such as disclosed in the prior art . see , for example , ryan , u . s . pat . no . 4 , 023 , 408 and markson et al , u . s . pat . no . 4 , 972 , 195 , which patents are incorporated herein by reference . the lightning detection system 12 supplies the distance and bearing ( in relation to the aircraft ) of lightning strikes detected on a real - time basis to computer 18 via line 22 . concurrently , aircraft headingsystem 14 supplies computer 18 with the aircraft &# 39 ; s present heading via line24 . the aircraft heading system is conventional and can comprise a slaved compass or a directional gyro that drives a heading indicator or horizontal situation indicator ( hsi ). also operating concurrently , aircraft navigation system 16 provides the aircraft &# 39 ; s current location relative to the earth , i . e . latitude and longitude . for the purposes of this discussion , the location of the aircraft or lightning strike relative to the earth will be called the &# 34 ; fixed - reference &# 34 ; locations since the position of the earth , for the time durations of interest in this application , is fixed . the location of the lightning strikes relative to the aircraft will be called &# 34 ; moving - reference &# 34 ; locations since the advantages of the present inventionare most often realized when the aircraft is in flight . the aircraft &# 39 ; s latitude and longitude are provided on a real - time basis to computer 10 via line 26 . navigation system 16 is conventional and may be , for example , a long range navigation system ( i . e . loran c ) or global positioning system ( gps ). the lightning strike data is transferred on line 48 to display 20 , which may be a conventional cockpit display unit ( cdu ) on an aircraft control panel . as mentioned above , all inputs from systems 12 , 14 and 16 are input to computer 18 on a real - time basis . fig2 illustrates the basic components of computer 18 and fig3 illustrates the general program flow of computer18 . computer 18 may be any conventional programmable computer . software techniques for programming computer 18 are well known in the art and need not be discussed in detail herein . referring to fig2 inputs on lines 22 , 24 and 26 and 48 are received by computer 18 on input / output ( i / o ) bus 30 . lines 22 , 24 , and 26 are bidirectional to carry control and timing signals from computer 18 to systems 12 , 14 and 16 . data , control and timing signals are transferred between computer 18 and display 20 on line 48 . lines 22 , 24 , 26 and 48 , inpractice , may actually each comprise one or more multi - wire cables . input / output ( i / o ) controller 32 provides the interface between computer 18 and external system components , central communications bus 34 is the main internal path for signal transfer between major components of computer 18 . these components include central processing unit ( cpu ) 36 that performs instruction execution and arithmetic / logic functions , central and real time clock 38 that provides synchronization and time - of - day signals , temporary storage registers 40 , data storage memory 42 , which may be a random - access memory ( ram ), and program storage memory 44 , which may be a read - only memory ( rom ). the system program , shown generally in flowchart form in fig3 will be stored in memory 44 . referring to fig3 at step 100 , computer 18 receives inputs from each of systems 12 , 14 and 16 . at step 102 , data representative of each of these inputs is stored in temporary storage registers 40 . fig4 shows one example of the memory storage utilization during the process shown in fig3 . all operations will be under control of the cpu 36 . for example , data representative of the lightning strike is stored in temporary register 401 . the data stored in register 401 represents the location of the lightning strike ( if one is detected ) relative to the aircraft . this will be referred to as the &# 34 ; lightning moving - reference location &# 34 ;. also stored in register 401 is the time ( time stamp ) that the lightning strike is detected . this information is provided by real - time clock 38 , which is conventional . the data stored in register 402 represents the current location of the aircraft ( i . e . its latitude and longitude ) and will be referred to as the &# 34 ; aircraft fixed - reference location &# 34 ;, the current aircraft heading is stored in register 403 . the aircraft heading and location will also be continually fed to the aircraft &# 39 ; s control , navigational and display systems , which are conventional and will not be discussed in detail herein . referring again to fig3 at step 104 , the system checks to see if a lightning strike was detected when the inputs were received at step 100 . if no lightning was detected then no data is stored in register 401 duringthe current processing cycle and the program loops back to receive inputs during the next cycle . cycle times will depend on the particular computer selected and its processing speed capabilities . if lightning was detected , then at step 106 , the lightning location with reference to earth is calculated . at step 108 , this lightning &# 34 ; fixed - reference &# 34 ; location is stored in register 404 , along with a &# 34 ; time - stamp &# 34 ; that identifies the timeof day that the strike was detected . this time - stamp is provided by accessing real time - of - day clock 38 in synchronization with the lightning detection system . with reference to fig4 the lightning fixed - reference ( i . e . relative to the earth ) location is calculated by &# 34 ; adding &# 34 ; the data stored in register 401 to the data stored in register 402 . in actual practice , several steps will be required to &# 34 ; add &# 34 ; the data representing the aircraft &# 39 ; s longitude and latitude to the data representing the lightning &# 39 ; s distance and bearingto the aircraft . however , the principles of linear algebra for computing a vector sum are well known , as are the software techniques for programming such computation , and do not require any detailed discussion . once computed , the lightning fixed - reference location is stored in temporary register 404 . again , fig4 is simply a representation and in practice , register 404 may be an accumulator or the like in cpu 36 where the computation will be performed . the &# 34 ; time stamp &# 34 ; data will be transferred directly from register 401 to register 404 , without modification . at step 110 ( fig3 ), the data representing the lightning strike fixed - reference location and the time stamp data will be transferred to data storage 42 . at step 112 , the data is displayed . this display sequenceand format will be discussed in greater detail hereinafter . fig4 illustrates an example memory structure and allocation for data storage 42 . this structure is related to the lightning display modes provided by the present invention . the data from register 404 can be placed in two separate sections of data storage 42 . in the example embodiment shown , a current memory section 421 and a historical memory section 422 are provided . current memory 421 is the storage section that will be accessed during a primary display mode and historical memory 422 will be accessed during a secondary display mode . in a primary display mode , a geographic area is defined around the aircraft &# 39 ; s current latitude and longitude . a symbol representing the aircraft is then displayed at its current position within the geographicalarea . each lightning strike stored in memory section 421 is also displayed at its recorded fixed - reference location ( i . e . latitude and longitude ) within the geographic area . thus , the strikes will always appear in their correct relative position to the aircraft at its current location . the geographic area is rotated about the aircraft position so that the up direction corresponds to the current aircraft heading . alternatively , the aircraft symbol can be rotated on a north - up display . however , this form of presentation is more difficult for the operator to interpret . techniques for displaying information on a crt and the like are well knownand a detailed discussion is not required herein . in the primary display mode , a maximum number of lightning strikes will be displayed to reduce clutter and aid interpretation . for example , the capacity of memory section 421 can be limited to 500 entries . therefore , when the display 20 is refreshed by the data in section 421 a maximum of 500 lightning strikes will be shown . section 421 is structured as a circular buffer or push - down stack . once the buffer or stack is filled with 500 entries , the next newest lightning data ( entering top of stack ) will replace the oldest data ( leaving bottom of stack ). since each entry also includes a time stamp , . current memory section 421 can be periodically purged of entries that are obsolete . for example , entries that are over four minutes old are deleted so that only current or very recent conditions are displayed . techniques for purging memories based upon age are well known in the art . as mentioned previously , historical memory 422 ( fig4 ) is used in a seconddisplay mode . this mode permits the operator to view the history of the thunderstorm and thus observe its trend in movement and intensity . a largenumber of lightning data entries , e . g . 5 , 000 , are stored in section 422 . section 422 is also designed as a push down stack but with 5 , 000 availablememory locations rather than the 500 available in section 421 . once the data representing 5 , 000 lightning strikes is stored , the next newest strike will replace the oldest . in this second display mode , data entries in memory section 422 are displayed in chronological order ( i . e . by their position on the stack ) at high speed , e . g . 5 , 000 strikes per minute . in this mode , a fixed number , e . g . 100 , of the oldest strikes are displayed in chronological order , i . e . oldest strike first , then the next , and so on . once the fixed number ( e . g . 100 ) of strikes is displayed , the oldest strike is removed from the display and replaced by the next strike on the stack ( e . g . strike 101 replaces strike 1 , then strike 102 replaces strike 2 , and so on ). this continues until all 5 , 000 strikes have been displayed . the screen is then blanked , if desired , and the display cycles through the historical memory again , starting with the oldest entry . the operator can observe the recent history of the thunderstorm in this &# 34 ; time lapse &# 34 ; mode , and can detect the general movement of the storm and whether it is increasing or decreasing in intensity . since the lightning data in memory section 422 is also provided with a time stamp , these entries can also be purged of old data , e . g . any lightning strike data more than 4 minutes old . memory sections 421 and 422 are shown in fig4 as being physically separate . in practice , however , they may be the same physical memory whichis accessed and addressed differently for each display mode . a memory controller 52 is provided to supply the necessary read / write , address and timing signals necessary for the storage and retrieval of data to and frommemory 42 . as is conventional , the data retrieved from memory 42 to refreshdisplay 20 will determine the display format and sequence . from the foregoing detailed description , it will be appreciated that the advantageous features of the present invention overcome certain deficiencies in the prior art and provide more accurate and useful information regarding thunderstorms . adaptations of the present invention , which will be apparent to those having skill in the art , are intended to bewithin the scope of the present invention as defined by the following claims .	6
fig2 is a view showing an embodiment of the present invention , in which the same reference designations as those appearing in fig1 represent the same constituents . in fig2 a reference numeral 61 designates a light emitting element for emitting a controlling beam ; 62 , a light receiving element for receiving the said beam ; 1a , the mean reflection or front surface the reflective layer of a mirror 1 ; and 1b , the surface of the reverse side of the reflective layer of the thick mirror 1 . the light receiving element 62 is a two - piece photodiode or a like element , and as shown in fig3 a to 3c , the receiving part thereof is divided into two parts 62a and 62b , thereby enabling the difference in the luminous energies of these parts to be measured . the light ray ( main beam ) 8 from an optical head is reflected by the mirror 1 . the mirror 1 is rotatably supported by a supporting member ( not shown ) together with a mirror holder 2 and a coil 3 to be rotated about a point c as its center in the plane of the drawing . the coil 3 is arranged in a magnetic circuit comprising a magnet 4 and a yoke 5 to enable the mirror 1 , mirror holder 2 , and coil 3 itself to be rotated by an electric current being applied to the coil 3 . the irradiation light for the controlling beam ( detection beam ) from the light emitting element 61 is transmitted through the transmitting surface 1b of the mirror 1 and reflected by the reverse side of the reflective layer of the mirror 1 . thus , the irradiation light is received by the light receiving element 62 . the reflective layer is obtained by bonding a substance for enhancing the reflecting power firmly to the surface of the base material of the mirror 1 . however , since the thickness of such substance for enhancing the reflecting power is generally approximately 0 . 1 mm or less , the reflection surface 1a and the surface of the reverse side of the reflective layer are substantially coplanar . thus , the center c of the rotation is substantially positioned on the reverse side surface . the outputs of the light receiving part 62a and light receiving part 62b of the light receiving 62 are inputted into an angle detection circuit 7 . the beam on the light receiving element 62 is moved in accordance with the angles of the mirror 1 which vary by the rotation of the mirror 1 . therefore , the rotation angle signals of the mirror 1 are output by obtaining the differential between the outputs of the light receiving part 62a and light receiving part 62b of the two - piece photodiode in the angle detection circuit 7 . fig3 a to 3c are views illustrating the operation of the present embodiment , in which the same reference numbers appearing in fig2 represent the same constituents . fig3 a illustrates the case where the light receiving part 62a and light receiving part 62b of the two - piece photodiode of the light receiving element 62 are in contact at an interface in the direction perpendicular to the plane of the page . fig3 b illustrates the case where the light receiving part 62a and light receiving part 62b of the two - piece photodiode of the light receiving element 62 are in contact at an interface within the plane of the page . fig3 c illustrates the case represented in fig3 a , but shows a state where the mirror 1 has a translational motion in the direction a . in the case of fig3 a where the rotation is within the plane of the page with the point c as its center , the luminous energies of the light receiving part 62a and light receiving part 62b vary by the rotation , thus making it possible to measure the rotation when the rotational vibration mode is being generated with the line b perpendicular to the reflection surface of the mirror 1 as its center , the reflected light from the mirror 1 is vibrated on the boundary of the light receiving part 62a and light receiving part 62b . as a result , there is no effect on the output . however , if the vibration mode is being generated , which may result in the translational motion in the directions a , there is a effect on the output because the vibration occurs in the direction which generates a differential between the light receiving part 62a and light receiving part 62b as shown in fig3 c . however , this effect can be made negligible if the distance between the light emitting element 61 and the light receiving element 62 is made sufficiently close . in the case of fig3 b , the luminous energies of the light receiving part 62a and light receiving part 62b do not vary with rotation in the plane of the page with the point c as its center . fig4 is a view showing another embodiment of the present invention , and the same reference designations appearing in fig1 represent the same constituents . here , a reference numeral 9 designates a condenser lens . through the condenser lens 9 , the irradiation light from the light emitting element 61 becomes a parallel luminous flux which is transmitted through the other surface 1b and reflected at the point c on the reverse side of the reflective layer of the mirror 1 . then , the reflected parallel luminous flux is converged into the light receiving element through the condenser lens 9 . the two outputs respectively from the two - piece light receiving part 62a and light receiving part 62b of the light receiving element 62 are inputted into the angle detection circuit 7 . the beam on the light receiving element 62 is moved according to the rotation angles of the mirror in the plane of the drawing with the point c of the mirror 1 as a center , and the arrangement of the light receiving element is in such a form that the light receiving part 62a and light receiving part 62b of the two - piece photodiode of the light receiving element 62 are , as shown in fig3 a , in contact at the interface in the direction perpendicular to the plane of the drawing . consequently , the rotation angle signal is output by obtaining a differential between the outputs of the two - piece photodiode in the rotation angle detection circuit 7 . at the time of the rotational vibration mode with the line b perpendicular to the reflection surface of the mirror 1 as its center , the reflected light from the mirror 1 is vibrated along the boundary line of the light receiving part 62a and light receiving part 62b . as a result , the output caused by the rotation in the plane of the drawing with the point c as its center is not influenced at all . nor does the vibration mode which may result in the translational motion in the direction a affect the output caused by the rotation within the plane of the drawing with the point c as its center , in particular because the light is maintained as parallel luminous flux between the condenser lens 9 and the mirror 1 . fig5 is a view illustrating the operation of a mirror rotation actuator including the present invention and schematically shows the state where a mirror rotation angle detection mechanism according to the present invention is incorporated in an optical information recording and reproducing apparatus . here , the same reference designations appearing in fig2 represent the same constituents . in fig5 a reference numeral 11 designates a light source for laser , etc . ; 8 , a beam generated by the light source 11 ; 12 , an intermediate lens to converge the beam 8 ; 13 , a poralized beam splitter ; 14 , a phase plate ; 1 , a mirror in a mirror rotation actuator ; 16 , an objective lens to converge the reflected beam 8 from the mirror 1 ; and 17 , an information disc . the reference numeral 18 designates a light receiving element which receives the reflected light from the information disc 17 . also , a reference numeral 8a designates the controlling beam from the mirror rotation actuator shown in the first - embodiment already described , and a reference number 62 designates the light receiving element which receives the reflected light from the mirror of the mirror rotation actuator for the controlling beam 8a shown in the first embodiment . the beam generated by the light source 11 is converged by the intermediate lens 12 and reflected by mirror 1 of the mirror rotation actuator after being transmitted through the polarized beam splitter 13 and the phase plate 14 , and is converged by the objective lens 16 to irradiate the information disc 17 . the beam 8 reflected by the information disc 17 is returned on the same path , reflected by the polarized beam splitter 13 , and converted into an electrical signal by the light receiving element 18 . the mirror 1 of the mirror rotation actuator is controlled to rotate by the system structured as in the first embodiment or the second embodiment , so that the beam spot of the beam 8 can accurately follow the information track of the information disc 17 . in other words , if the mirror 1 is controlled to enable the controlling beam 8a to be irradiated always evenly onto the two light receiving parts 62a and 62b of the light receiving element 62 , the mirror 1 is maintained at a given position irrespective of existing wind pressure and mechanical vibration . hence , the recording can reliably be reproduced accurately . the objective lens 16 is vertically movable by known technique to correct the focusing of the beam spot on the information disc 17 . in the present embodiment , while the light emitting element 61 and the light receiving element 62 are arranged on the reverse side of the reflective layer of the mirror 1 as shown in fig2 and fig4 the arrangement is not limited thereto according to the present invention . fig6 illustrates the case where the light emitting element 61 and the light receiving element 62 are arranged at the front side of the mirror 1 in the present embodiment . in fig6 the same reference designations appearing in fig1 represent the same constituents . in this case , the irradiation light from the light emitting element 61 for the controlling beam is reflected on the same surface as the light ray 8 from an optical head .	6
referring first to fig1 one end of an engine crankshaft 10 is driveably connected through the transmission to the power output tail shaft 12 , which is adapted to be connected to the vehicle traction wheels through differential , driveline , and axle assemblies . the main transmission housing 22 encloses simple planetary gear units 16 , 18 , 20 . transmission housing 22 is bolted at its left - hand periphery to the cylinder block of an internal combustion engine and , at its right - hand end , to the left - hand end of tail shaft extension housing 24 , which surrounds output shaft 12 . transmission housing 22 encloses a hydrokinetic torque converter 26 , which includes a bladed impeller 28 , a bladed turbine 30 and a bladed stator 32 . the impeller , the turbine and the stator are arranged in fluid flow relationship in a common toroidal circuit . the impeller includes a housing connected driveably to drive plate 34 , which is bolted to the end of crankshaft 10 . turbine 30 includes a turbine hub 36 splined to turbine shaft 38 . impeller 28 is connected to impeller housing 40 , which is journalled for rotation on a portion 42 of a pump housing , which closes converter housing 22 . pump housing 44 is bolted to housing 22 and encloses gear elements of a positive fixed displacement pump 46 , which serves as a pressure source for the control valve system to be described with reference to fig5 a - 5e . a stator sleeve shaft 48 extends from the pump housing 44 and supports the inner race 50 of a one - way clutch 52 whose outer race supports stator 32 . a torque converter lockup clutch 54 is splined at 56 to the turbine hub 36 and carries a friction surface 58 , located at its radially outer end , to driveably engage the torque converter cover 61 , welded to the impeller housing . lockup clutch 54 is closed , locked , applied or engaged to complete a mechanical connection between the impeller and turbine when pressurized hydraulic fluid , contained in the torque converter casing , forces friction surface 58 against the housing . the torque converter is opened , unlocked , released or disengaged so that a hydrodynamic driving connection exists between the impeller and turbine when pressurized hydraulic fluid is supplied through passage 63 between converter cover 61 and friction surface 58 of the lockup clutch to disengage these surfaces . turbine shaft 38 is splined to the carrier 60 of the first planetary gearset 16 , which includes sun gear 62 , a set of planetary pinions 64 rotatably supported on carrier 60 and ring gear 66 . sun gear 62 is driveably connected to a member 70 that is common to a coast clutch 72 and an overdrive brake 74 . ring gear 66 is driveably fixed to a drum portion 68 connected to intermediate shaft 76 . overdrive brake 74 includes a set of clutch discs fixed to housing 22 , a load block 78 fixed to housing 22 , a set of clutch discs driveably connected to the outer surface of clutch member 70 and interposed between the discs affixed to the housing , a clutch piston 80 displaceable hydraulically against the clutch disc assembly and hydraulic cylinder 82 containing piston 80 , and a belleville spring 84 for returning piston 80 to the inactive position when hydraulic pressure is removed from cylinder 82 . coast clutch 72 includes a set of clutch discs driveably connected to the inner surfaces of clutch - member 70 , a load block connected to the inner surface of clutch member 70 , a second set of clutch discs driveably fixed to ring gear 66 , piston 86 actuated hydraulically to engage the coast clutch disc sets , a hydraulic cylinder 88 within which piston 86 moves , and a belleville spring 90 to return piston 86 to the disengaged position when hydraulic pressure is removed from cylinder 88 . a first one - way clutch 92 has its outer race driveably connected to ring gear 66 , its inner race driveably connected by a spline to cylinder 88 and to sun gear 62 and a driving member located in the annulus between the inner and outer races for producing a one - way driving connection therebetween . a second one - way clutch 94 is located between intermediate brake 96 and direct clutch 98 . one - way clutch 94 includes an outer race that carries a set of brake discs for the intermediate brake 96 , an inner race driveably fixed to drum 100 , and a driving member located in the annular region between the inner and outer races for producing a one - way drive connection therebetween . intermediate brake 96 includes a second set of brake discs fixed to housing 22 , a load block fixed to the housing , a piston 101 actuated hydraulically to force the brake disc sets into drivable relationship against the load block , hydraulic cylinder 83 within which piston 101 moves and a belleville spring . drum 100 is stopped and held against the transmission casing through the action of an intermediate brake band 102 actuated by a hydraulic intermediate servo . direct clutch 98 operates to produce a drive connection between drum 100 and clutch member 104 . the direct clutch includes a first set of clutch discs splined to the inner surface of drum 100 and a second set of clutch discs connected to clutch member 104 and interposed between successive members of the first clutch disc set . a piston 106 moves within a hydraulic cylinder to force the clutch disc sets into drivable connection against the load block that is carried on the inner surface of the drum 100 . piston 106 moves within the hydraulic cylinder defined by drum 100 and is restored to its disengaged position through operation of a coil compression spring 108 . forward clutch 110 operates to produce a driving connection between clutch member 104 and the ring gear 112 of the second planetary gearset 18 . this gearset includes a sun gear 114 , a set of planetary pinions 116 in continual meshing engagement with sun gear 114 and ring gear 112 , rotatably supported on a carrier 118 which is driveably connected by spline 120 to the tail shaft 12 . forward clutch 110 includes a first set of clutch discs driveably connected to the inner surface of clutch member 104 and a second set of clutch discs , each interposed with discs of the first set , driveably connected to the outer surface of ring gear 112 . piston 122 is hydraulically actuated for movement within the cylinder defined by clutch member 104 to force the clutch discs into a drivable connection . belleville spring 124 returns piston 122 to the disengaged position when hydraulic pressure is removed from the clutch cylinder . the third planetary gearset 20 includes sun gear 126 formed integrally with sun gear 114 , ring gear 128 connected by spline 130 to tail shaft 12 , a set of planet pinions 132 rotatably supported on carrier 134 , which is driveably connected to a first set of brake discs of the low - and - reverse brake 136 . a second set of brake discs of brake 136 is fixed to transmission casing 22 ; each disc of the second set is interposed between successive discs of the first disc set of brake 136 . brake piston 138 is actuated hydraulically when cylinder 140 is pressurized to force the piston against the first and second brake disc sets and to produce a drivable connection therebetween against the effect of the return spring 142 , which forces piston 138 to the brake disengaged position when cylinder 140 is vented . load block 144 , fixed to the transmission casing reacts the force applied by piston 138 to the disc brake sets . a one - way brake 146 includes an outer race pinned to carrier 134 , an inner race 150 bolted to the transmission casing 22 , and a driving member located in the annular region between the inner and outer races to produce a one - way drive connection between carrier 134 and the casing . the transmission produces four forward gear ratios and a reverse gear . the three lowest of the forward gear ratios are produced both automatically and by manual operation of the gear selector lever by the vehicle operator . the third forward gear ratio directly connects the engine crankshaft 10 to tail shaft 12 , and the fourth forward ratio is an overdrive ratio . when the gear selection is made manually by the vehicle operator , the three lowest forward gear ratios and the reverse drive involve the engagement of coast clutch 72 , and through its operation , the engine braking effect is transmitted through the transmission to the tail shaft 12 . fig3 shows engaged and release conditions of the clutches and brakes and driving and overrunning conditions of the one - way clutches for each of the gears and ranges of the transmission . the gear selector lever includes a prnd21 switch , which produces an electrical signal , preferably a voltage , whose magnitudes represent each of the prnd21 positions . the gear selector and the manual valve it controls can be moved among the following alphanumeric positions from leftmost to rightmost : p for park , r for reverse , n for neutral , d for overdrive , 2 for manually selected second gear , and 1 for manually selected first gear . when the gear selector is in the d position and an overdrive cancel button is depressed , a mechanically selected condition called &# 34 ; drive &# 34 ; range , the transmission will produce only the three lowest gears . when the button is released , and the selector is in the od position , a condition called &# 34 ; overdrive &# 34 ; range , the transmission can produce four forward gears . when the gear selector is moved to the manual 1 or 2 positions , the transmission produces only the first or second gear ratios , respectively . coast clutch 72 produces engine braking in third gear when the gear selector is in &# 34 ; drive &# 34 ;. otherwise , the transmission would freewheel in third gear while the vehicle is coasting . when overdrive range is selected , coast clutch 72 is disengaged hydraulically but engine braking results in fourth gear through operation of overdrive brake 74 . when manual 2 and manual 1 are selected , the coast clutch is applied hydraulically through operation of a coast clutch shift valve 302 ; whereas , when drive is selected , the coast clutch shift valve is actuated through operation of a solenoid - actuated coast clutch valve controlled by programmed logic . a manually initiated shift from fourth gear to third gear or second gear causes a short delay to allow overdrive clutch 74 to release fully before coast clutch 72 engages . to prevent intermediate band 102 from absorbing excessive driveline energy in the manual 2 and manual 1 ranges , application of band 102 is delayed until the coast clutch engagement is inferred by expiration of a shift - in - progress timer . the torque flow in each gear and range is described next with reference to fig2 a - 2h . low speed forward drive acceleration in the automatic mode is obtained by engaging forward clutch 110 . torque then is delivered from turbine shaft 38 to carrier 60 of the first gearset 16 . one - way clutch 92 driveably connects ring gear 66 and sun gear 62 so that the entire gearset 16 turns as a unit and drives intermediate shaft 76 . torque is then delivered from intermediate shaft 76 to the ring gear 112 through engaged forward clutch 110 , thus imparting a driving torque to carrier 118 and the power output shaft 12 . the reaction torque on sun gears 114 , 126 is in a reverse direction . this causes a forward driving torque on ring gear 128 , which is transferred to the output shaft 12 because carrier 134 acts as a reaction member . carrier 134 is held against rotation in this instance by overrunning brake 146 . in coasting operation , i . e . when torque flow is from output shaft 12 toward shaft 38 , owb 146 overruns so that there is no torque path to the torque converter . the vehicle operator selects low speed operation manually by moving the gear selector lever to the 1 position . in this range , forward clutch 110 , reverse - low brake 136 and coast clutch 72 are engaged , but converter lockup clutch 54 is always disengaged . clutch 72 connects ring gear 66 and sun gear 62 , so gearset 16 again turns as a unit and drives shaft 76 . shaft 76 drives clutch 110 , which drives ring gear 112 and carrier 118 . brake 136 provides the reaction by holding carrier 134 against rotation . in coasting operation , the torque flow is from shaft 12 to shaft 76 . a drive connection to engine shaft 10 for engine braking effect is completed from shaft 76 by coast clutch 72 and torque converter 26 . clutch 72 is applied with the logic of the hydraulic circuit of fig5 a - 5e . second speed ratio acceleration is achieved automatically by maintaining the first gear status of the friction elements and by engaging intermediate brake 96 . this holds sun gears 114 , 126 against rotation because overrunning clutch 94 driveably connects brake 96 to drum 100 . power flow from the engine to ring gear 112 is the same as that for the first speed overdrive and drive ranges . planet pinions 116 are driven by ring gear 112 and rotate with carrier 118 about sun gear 114 . ring gear 112 continues to act as a power input element and carrier 118 continues to drive the output shaft 12 . overrunning brake 146 free wheels so that all of the torque multiplication is accomplished by gearset 18 . during coasting , shaft 12 drives carrier 118 and pinion 116 . ring gear 112 and clutch 110 rotating at engine speed cause owc 94 to free wheel in the coast direction , so the torque path ends there . in the manually selected second speed , the following friction elements are engaged : coast clutch 72 , intermediate brake 96 , forward clutch 110 and intermediate band 102 . in drive operation , clutch 72 connects ring gear 66 and sun gear 62 , so gearset 16 turns as a unit and drives shaft 76 . shaft 76 drives ring gear 112 through clutch . overrunning clutch 94 driveably connects sun gears 114 , 126 to intermediate brake 96 , which holds sun gear 114 ; therefore , pinions 116 are driven by ring gear 112 and rotate with carrier 118 about sun gear 114 . brake 96 is engaged before band 102 is applied , as will be explained below , so full engine torque is not carried solely by band 102 but is stored with brake 96 . in coasting operation , clutch 94 overruns and shaft 12 drives carrier 118 and pinions 116 about sun gear 114 , which is held by band 102 . ring gear 112 drives shaft 76 and ring gear 66 through forward clutch 110 . gearset 16 turns as a unit because coast clutch 72 connects ring gear 66 to sun gear 62 . therefore , pinions 64 and carrier 60 drive shaft 38 , which is connected by the converter 26 , or by converter clutch 54 , to engine shaft 10 . while accelerating in the overdrive range , third gear ratio results by maintaining forward clutch 110 and intermediate brake 96 engaged and by engaging direct clutch 98 . when the engine drives output shaft 12 , overrunning brake 146 and overrunning clutch 94 freewheel , but one - way clutch 92 drives . shaft 76 and input shaft 38 turn at the same speed . one - way clutch 92 driveably connects ring gear 66 and sun gear 62 so that turbine shaft 38 is driveably connected by the first gearset 16 to intermediate shaft 76 . direct clutch 98 and forward clutch 110 driveably connect ring gear 112 , sun gears 114 , 126 and intermediate shaft 76 , which rotate as a unit . planet pinion set 116 , carrier 118 and output shaft 12 are driven at the speed of the turbine shaft because of the connection between ring gear 112 and sun gear 114 . overrunning brake 146 free wheels . when the vehicle coasts , owc 92 freewheels ; therefore , ring gear 66 and sun gear 62 are disconnected and no engine braking effect occurs . when the overdrive cancel switch is closed on the gear selector to place the transmission in the drive range , the friction elements operate as they do to produce third gear in the overdrive range except that coast clutch 72 is engaged . the transmission produces a direct connection between input shaft 38 and output shaft 12 , as in third gear overdrive , except that clutch 72 connects ring gear 66 and sun gear 62 instead of owc 92 . when the vehicle coasts , clutch 72 remains engaged , gearset 16 driveably connects shafts 76 and 38 , and the torque converter connects shaft 38 to engine shaft 10 . the fourth gear ratio is achieved by maintaining forward clutch 110 , direct clutch 98 and intermediate brake 96 engaged and by engaging overdrive brake 74 . sun gear 62 of gearset 16 is held against rotation by brake 74 and one - way clutch 92 freewheels due to the engagement of overdrive brake . in this instance , ring gear 66 and intermediate shaft 76 are driven at a higher speed than turbine shaft 38 and carrier 60 . gearsets 18 and 20 are disposed in the same condition as they were for the third gear ratio in the automatic mode ; therefore , the speed of the output shaft 12 is the same as the speed of the intermediate shaft 76 . in coasting operation , overdrive brake 74 remains engaged and the torque path from output shaft 12 to engine shaft 10 is completed by gearset 16 and the torque converter . engine braking is therefore operative . reverse drive is achieved by releasing intermediate brake 96 , forward clutch 110 and overdrive brake 74 and by applying low and reverse brake 136 , direct clutch 98 , and coast clutch 72 . with the friction elements so disposed , one - way clutch 94 free wheels , one - way clutch 92 is inactive and one - way brake 146 is inactive . coast clutch 72 driveably connects sun gear 62 and ring gear 66 of the first gearset 16 so that turbine torque is delivered from shaft 38 directly to sun gears 114 , 126 . with carrier 134 acting as a reaction point , ring gear 128 and power output shaft 12 are driven in a reverse direction . the transmission will produce upshifts and downshifts among the three lowest gear ratios in the drive range , and among all four gear ratios in the overdrive range . engine braking occurs in the highest gear available in each range , i . e ., 1 , 2 , drive and overdrive . the schedule of fig4 shows the status of the coast clutch solenoid in each gear of each range and the availability of engine braking . fig5 a through 5e show the hydraulic control valve system that controls application and release of the hydraulic clutches and brakes of the change - speed gear box of fig1 and 2 . the various passages are pressurized in accordance with selected positions of a manual valve 160 , moved manually by the vehicle operator among six positions p , r , n , od , 2 and 1 , and states of certain solenoid - operated valves as determined by microprocessor execution of control algorithms . fluid required for the operation of the hydraulic control valve system is supplied at the output of a hydraulic pump , which is supplied from the sump or reservoir of the transmission through a filter or from a return line connected to the inlet of the pump . the pump may be a fixed displacement pump that produces a flow rate proportional to its speed . line pressure magnitude is controlled by main regulator valve 162 shown in fig5 a . this valve operates in response to a second control pressure carried in line 164 from tv pressure valve 166 . valve 166 is connected by passages 168 and 170 from regulated line pressure produced by main regulator valve 162 . a variable force solenoid 172 regulates tv pressure in accordance with commanded torque output by the engine by having applied across its winding an electrical voltage duty cycle in accordance with the control of the microprocessor output . hydraulic pressure having a magnitude between 5 psi and 85 psi produced by valve 166 is applied to the end of line regulator valve 162 . when there is demand for a high volume of fluid at line pressure , spool 173 moves downward due to tv pressure operating against the effect of a set of coil springs 174 , closes the return line to the suction side 45 of the pump 46 and closes torque converter charge line 176 . then substantially the entire volumetric flow from the discharge side 47 of the pump is carried in passage 170 . the magnitude of pressure in line 170 is a result of upwardly directed differential pressure on the lower end of spool 173 acting against the spring forces and a tv pressure force directed downward on the spool . when line pressure is high in relation to tv pressure , spool 173 moves upward and opens the feedback line to the suction side of the pump . before this occurs , however , line 176 to converter regulator valve 178 is opened . thus , line pressure is regulated by balancing the spring forces and tv pressure against line pressure in passage 170 . when manual valve 160 is moved to the 1 and r positions , line pressure is carried in passages 180 , 182 to a differential pressure area of the main regulator valve . the pressure developed on the differential area operates to force spool 173 downward so that line pressure is higher when the reverse and 1 ranges are selected than for any of the other settings of the gear selector and manual valve . higher line pressure in these ranges increases the torque capacity of the clutches and brakes engaged to produce the first gear and reverse drive while engine torque is near its peak magnitude . passage 170 carries line pressure to solenoid regulator valve 184 , which produces a regulated solenoid feed pressure carried in passage 186 to first and second solenoid - operated shift valves 188 , 190 , a converter clutch solenoid - operated valve or first control means 192 , and coast clutch solenoid - operated feed valve 194 . regulator valve 184 maintains the output in line 186 at approximately 50 psi by balancing spring force applied to the spool against an opposing line pressure force on the spool end resulting from feedback output . valves 188 , 190 , 192 and 194 are on - off valves that alternately connect and disconnect line 186 and output lines 196 , 198 , 200 and 202 , respectively . the solenoids that operate these valves are controlled by the output of the microprocessor , which selectively energizes and deenergizes the solenoids in accordance with the result of executing electronically stored control algorithms accessible to the microprocessor . for example , when the solenoid of valve 188 is deenergized , line 196 is vented by being connected to the low pressure sump . but when the solenoid is energized , solenoid feedline 186 is connected to line 196 . similarly , valves 190 , 192 and 194 either connect solenoid feedline 186 to lines 198 , 200 , 202 or vent these lines in accordance with the state of the corresponding solenoids . converter clutch 54 is engaged to lock torque converter 26 by pressurizing line 204 and venting line 206 . the converter clutch is disengaged and the torque converter opened when line 206 is pressurized and line 204 is vented . converter clutch solenoid control valve 208 moves upward within the valve body due to a force on spool 210 resulting from converter clutch pressure carried in line 200 , the source of first control pressure . valve 208 is forced downward by the helical spring 211 and a pressure force resulting from 1 - r pressure carried in line 180 to the upper end of spool 210 . also , control valve 208 is supplied through line 212 with regulated converter feed pressure from converter regulator valve 178 , which regulates converter feed pressure in line 212 by sensing the pressure in line 212 and throttling converter charge pressure in line 176 . when converter clutch solenoid valve 192 , is energized , line 200 and first control port 213 are pressurized , and spool 210 moves upward against the force of the spring 211 to connect lines 212 and 204 . when this occurs , line 206 is connected by valve 208 to vent port 214 and converter clutch 54 is engaged . when solenoid valve 192 is deenergized , line 200 is vented causing spool 210 to move downward , closing the connection between lines 212 and 204 , closing the connection of line 206 to vent 214 , and opening a connection between lines 212 and 206 . this vents line 204 through valve 208 and a hydraulic fluid cooler to the sump of the transmission . this action opens the torque converter by disengaging the mechanical connection of impeller 28 and turbine 30 made through clutch 54 . the 1 - r pressure , in addition to increasing line pressure for a given tv pressure , as described with respect to the operation of valve 162 , also operates to open the torque converter if solenoid valve 192 remains open while the gear selector is moved to the 1 or r positions , perhaps due to failure of the solenoid that operates valve 192 , a short circuit or other electrical fault . this 1 - r pressure assures the torque converter will be open if the gear selector is located in the r and 1 positions so that the torque multiplication effect of the converter is available to maximize torque to output shaft 12 . converter regulator valve 178 limits torque converter feed pressure to approximately 110 psi . line modulator valve 220 is connected to regulated line pressure by passages 170 , 168 and 222 , and to tv pressure by passages 164 and 224 . regardless of whether the od cancel button is depressed on the gear selector mechanism , whenever manual valve 160 is moved to the od position , the position shown in fig5 d , regulated line pressure in passage 168 is connected through valve 160 to passage 226 . forward clutch 110 is continually connected to regulated line pressure through passage 226 , orifice 342 and passage 242 ; provided the manual valve is in a forward drive position . first gear results for automatic shifting when the forward clutch alone is engaged in this way . in the od range and with the transmission operating in first gear , first solenoid shift valve 188 directs sol1 pressure to 1 - 2 shift valve 228 through passage 196 and to 2 - 3 shift valve 232 through passage 244 , but second solenoid shift valve 190 is exhausted . therefore , shift valves 228 and 232 are moved by sol1 pressure to the rightward extremity , closing line pressure passages 227 and 230 , respectively . in this way only forward clutch 110 is pressurized and first gear operation results . an upshift to second gear occurs while first solenoid shift valve 188 remains open and after second solenoid shift valve 190 is opened . valve 190 directs sol2 pressure through passage 198 to the end of 3 - 4 shift valve 236 and to manual timing valve 306 . passage 198 also directs sol2 pressure to shuttle valve 246 . if passage 372 is not pressurized , valve 246 directs sol2 pressure to manual transition valve 250 . if l / r clutch pressure passage , 320 is not pressurized , transition valve 250 directs sol2 pressure to the spring end of 1 - 2 shift valve 228 . the 1 - 2 shift valve is moved leftward by sol2 pressure , thereby opening the connection between passages 227 and 254 , through which regulated line pressure is carried to intermediate brake accumulator 256 . line modulator valve 220 and accumulator 256 work cooperatively to supply pressurized fluid to intermediate brake 96 thereby engaging second gear . line modulator valve 220 supplies tvlm pressure to intermediate brake accumulator 256 , overdrive brake accumulator 260 , and direct clutch accumulator 262 . each accumulator is shown with its plunger located as it is prior to an upshift and filled with hydraulic fluid supplied from valve 220 . valve 258 , located immediately above accumulator 256 , balances the spring force against intermediate brake pressure and moves upward to connect passages 254 and 261 . the upper end of accumulator 256 is filled through orifice 264 . the orifice establishes a constant pressure drop and flow rate into the upper end of the accumulator cylinder and moves the plunger downward at a rate consistent with the flow rate through orifice 264 against the force of the springs within the accumulator and tvlm pressure within the accumulator below the plunger . in this way , the pressure in passage 261 rises linearly and rapidly when valve 258 first opens ; thereafter , pressure in brake 96 increases linearly as time increases at a lower rate determined by the flow rate through orifice 264 and the spring constant of the springs within the accumulator . also , pressure in brake 96 has a magnitude for each unit of elapsed time that varies with tv pressure , as is explained below . the output of valve 220 is tvlm pressure supplied to the space within each of the accumulators below the plungers . valve 266 , located at the top of the bore of line modulator valve 220 , regulates by balancing tvlm pressure against the force of the inner isolator spring 268 , a short spring having a relatively high spring rate that prevents contact between spools 270 and 266 when spring 268 is fully closed . when tv pressure , carried in passages 164 , 224 from vfs valve 166 , is approximately 6 psi or lower , spool 270 is held by the outer spring at the lower end of the valve bore , and spring 268 does not touch spool 266 . in this range of tv pressure , passage 272 is vented through port 269 because feedback tvlm pressure will have forced spool 266 downward closing communication between passages 222 and 272 . when tv pressure rises above 6 psi , valve 270 rises off its seat against the effect of the outer spring . spring 268 causes valve 266 to regulate because it moves valve 266 upward causing tvlm pressure to rise by one unit for each two unit increase of tv pressure above 6 psi . in this way , line pressure is modulated according to the magnitude of tv pressure produced by vfs valve 166 in accordance with the control of the microprocessor . accordingly , the pressures produced by accumulators 256 , 260 , 262 increase linearly with time after the initial rapid rise in their output pressures following their being pressurized from passages 254 , 278 and 280 , respectively . the pressures produced by the accumulators are higher at a given time after their linear increase begins if tv pressure is high , and lower at that time if tv pressure is low , because tvlm pressure varies linearly with tv pressure above 6 psi . during the upshift , tvlm pressure in line 272 remains substantially constant because fluid forced from below the accumulator plunger briefly and slightly raises the pressure force at the head of valve 266 , and opens the connection between line 272 and the vent 269 in modulator valve 220 . then the pressure in line 272 falls and the opening to vent 269 closes . this lost fluid is returned to the accumulator through line 222 while the accumulator is being recharged . when the intermediate brake is to be disengaged , for example , during a 2 - 1 downshift , the process for activating the accumulator is substantially reversed from that of the upshift . the 2 - 1 downshift occurs when line 254 is vented at 384 through 1 - 2 shift valve 228 due to the presence of sol1 pressure and the absence of sol2 pressure at that shift valve . flow from the space above the plunger of accumulator 256 through orifice 275 and the constant spring rate of the accumulator springs again controls the rate at which the plunger rises within its chamber and the rate at which the accumulator cylinder below the plunger is filled with fluid from line 222 and line modulator valve 220 . as the accumulator is being recharged , fluid within the accumulator cylinder above the plunger flows through one - way check valve 274 , and passages 263 , 254 . check valve 277 directs fluid through 2 - 1 downshift orifice , and the fluid is vented through 1 - 2 shift valve 228 . likewise , intermediate brake 96 is vented through passages 261 , 254 , the 2 - 1 downshift orifice , and shift valve 228 . intermediate brake 96 remains engaged for third gear and fourth gear during automatic operation because 1 - 2 shift valve 228 connects passages 227 and 254 for any combination of states of solenoid valves 188 , 190 except the first gear states . overdrive clutch brake accumulator 260 works , as accumulator 256 does , to pressurize and vent overdrive clutch 74 through passage 276 during a 3 - 4 upshift and 4 - 3 downshift . these upshifts and downshifts are initiated by selectively pressurizing and venting passage 278 through 3 - 4 shift valve 236 , as described below . an automatic upshift from second gear to third gear occurs after first solenoid shift valve 188 is closed by deenergizing its solenoid , and maintaining second solenoid valve 190 open , according to the schedule of fig4 . line pressure continues to be directed by manual valve 160 through passages 226 , 230 to 2 - 3 shift valve 232 . because of the absence of sol1 pressure , valve 232 moves to the position of fig5 e . this opens line pressure to passage 280 through which control valve 282 at the end of direct clutch accumulator 262 is pressurized . direct clutch 98 is thereby pressurized rapidly over a first , short portion of its engagement period , during which the clearances among the various components of the clutch are taken up . thereafter , clutch 98 is pressurized at a linearly increasing pressure controlled by the magnitude of tvlm , the rate of flow through orifice 284 , and the spring constant of accumulator 262 , as has been previously described with respect to accumulator 256 , until the clutch is fully engaged . clutch 98 remains engaged during third gear and fourth gear operation because sol1 pressure is absent ; therefore , 2 - 3 shift valve 232 maintains open the connection between line pressure and accumulator valve 282 . an automatic 3 - 2 downshift occurs when solenoid valves 188 and 190 are both on . then sol1 pressure forces 2 - 3 shift valve rightward so that direct clutch 98 is drained through passages 286 , valves 282 , passage 280 , orifice 283 , shift valve 232 , passage 290 , 3 - 4 shift valve 236 , and passage 292 to sump through manual valve 160 . this path to sump from the direct clutch is continually open through the 3 - 4 shift valve 236 regardless of the presence or absence of sol2 pressure at valve 236 . an automatic upshift from third gear to fourth gear results when solenoid valves 188 and 190 are both closed , whereby overdrive brake 74 is engaged . when this occurs , 3 - 4 shift valve 236 is moved by its spring to the position shown in fig5 d , whereby line pressure from the manual valve is directed by passage 234 through the shift valve to passage 278 . control valve 286 at the end of overdrive accumulator 260 is moved by its spring downward so that brake 74 is pressurized through passage 276 rapidly during the first , short phase of engagement of the brake during which clearances among the components of a brake are taken up . thereafter , pressure in brake 74 rises linearly with time according to the control of tvlm pressure , the flow rate of fluid through orifice 288 and the spring constant of the accumulator , as has been described with respect to accumulator 256 . an automatic downshift from fourth gear to third gear occurs when sol 2 pressure is applied to shift valve 236 . this action moves the valve rightward opening a connection through passage 278 , valve 286 , passage 276 and brake 74 to the vent port at shift valve 236 . when manual valve 160 is moved to the r position , line pressure in passage 168 is directed to passages 180 , through bypass loops 294 , 295 to passage 292 , and passage 226 is closed to the source of line pressure . thus , forward clutch 110 is disengaged . solenoid valve 188 is opened to connect srv passage 186 to sol1 passage 196 , but solenoid shift valve 190 is closed . sol1 pressure is carried in passage 244 to the end of 2 - 3 shift valve 232 , and to the sol1 port of 1 - 2 shift valve 228 . passage 180 is connected to line pressure both when the manual valve is moved to the r position and to the 1 position . 1 - r pressure forces spool 210 of the converter clutch control valve 208 downward , thereby directing regulated converter pressure through valve 208 and passage 206 to open converter clutch 54 . this action assures that , if sol3 pressure , which is limited to 50 psi , remains on while the gear selector or manual valve is in the 1 or r position , there is sufficient pressure to push spool 210 downward and open the torque converter . in this way , the torque converter is opened when 1 or r positions are selected to that the torque multiplication capacity of the torque converter is available during these high torque conditions . passage 182 carries line pressure from valve 208 to the main regulator valve 162 when the gear selector is in the 1 and r positions . this forces spool 173 downward , closes return to the pump inlet , and directs more pump output to passage 170 . passage 300 and one - way check valves 299 , 301 direct 1 - r pressure also to the end of coast clutch shift valve 302 . check valve 299 and passage 304 carry 1 - r pressure from the manual valve to manual timing valve 306 . because sol2 pressure is absent , 3 - 4 shift valve 236 is in the position shown in fig5 d . therefore , when the manual valve is moved to the r position , shift valve 236 connects line pressure in passage 292 to passages 290 , 310 and 318 . check valve 312 directs r pressure through orifice 314 to the end of low / reverse modular valve 316 , where a pressure force acting on the valve in opposition to its spring , opens r pressure in passage 318 to low / reverse brake passage 320 . low / reverse brake 136 is the first friction element to become engaged in the process of producing reverse drive . the 3 - 4 shift valve 236 also connects r pressure in passage 318 to coast clutch shift valve 302 through passage 322 . control pressure to coast clutch shift valve 302 is directed from passage 300 through the check valve 301 to passage 324 . valve 302 moves leftward against the effect of its spring due to 1 - r control pressure and completes the connection from passage 322 to passage 326 and passage 331 to coast clutch 72 , which is the second friction element applied during reverse drive engagement . when the manual valve is in the r position , 1 - 2 shift valve 228 connects passages 310 and 332 through check valve 369 . manual timing valve 306 includes a piston 361 , which is forced into contact with retaining plate 363 by srv pressure forwarded from solenoid regulator valve 184 and maintained at a constant pressure by that valve . a second piston 330 is biased by a spring into contact also with retainer plate 363 . first and second inlet passages 360 , 362 supply 1 - r / man2 pressure to timer valve 306 from passage 304 . an orifice 364 , located in passage 362 , controls the flow rate through that passage and through valve 306 during a portion of its operation . thereafter , when the valve opens , the higher pressure in passage 360 is directed to outlet passage 366 . in operation , first piston 361 is forced by srv pressure into contact with plate 363 . second piston 330 is forced by the spring into contact with the plate against feedback pressure in passages 366 , 368 tending to more spool 330 rightward . this closes passage 360 but permits continual flow through orifice 364 and passage 366 to feedback passage 368 because piston 330 does not close communication between passages 364 and 366 . ball check valve 369 and passage 332 carry r pressure from 1 - 2 shift valve 228 to timing valve 306 , but check valve 369 closes passage 332 when it is at a higher pressure than passage 310 . therefore , r pressure in passage 332 is directed by valve 306 immediately without delay to passage 334 because r pressure forces valve spool 330 rightward and opens this connection . the space immediately adjacent both sides of the retainer plate is pressurized through feedback passage 368 or through an aperture in plate 363 . because of the differential pressure across its ends , piston 361 immediately moves for a short period away from the plate against srv pressure until piston 361 seats on the valve body at the left - hand extremity . after this occurs , pressure rises quickly in the annulus , within which the retainer plate is located , and piston 330 moves rightward , subject to the flow rate across orifice 364 , against the spring force until it becomes seated at the right - hand end of the valve chamber . in this position , feedback passage 368 is open to passage 334 , through valve 306 and passage 360 is open also to passage 334 through passages 366 and 368 . the operation of the manual timing valve , therefore , delays the occurrence of delayed 1 - r / man2 pressure at 2 - 3 shift valve 232 by the period while piston 361 moves from the right - hand end of its chamber to the left - hand end plus the period while spool 330 moves rightward from plate 363 until valve 306 opens . valve 306 assures that whenever the vehicle operator moves manual valve 160 to the 1 or 2 positions , a delay occurs before pressure from the manual valve is present at 2 - 3 shift valve 232 . this produces a short delay , one or two seconds , before a downshift from third or fourth gear can be made into second gear . for example , when a 4 - 2 downshift is commanded by the vehicle operator by a manual shift to the 2 position at high speed , the transmission will dwell for a period , the period required for the manual timing valve to produce man2 pressure in third gear , before the downshift to the second gear is completed . in third gear drive range , coast clutch engagement produces the engine braking effect , whereas in second gear manual operation , intermediate band 102 and servo 96 produce the engine braking effect . torque capacity of the band and servo are much lower than torque capacity of the coast clutch . by avoiding an immediate high speed 4 - 2 downshift , torque loads eventually placed on band 102 are lower than otherwise they would be . similarly , high speed downshifts into first gear are delayed to avoid the sensation of an abrupt downshift . however , sol2 pressure at the end of timing valve 306 increases the delay or the absence of sol2 pressure prevents entirely any delay in pressure being output from valve 306 , depending on the magnitude of 1 - r / man2 pressure compared to sol2 pressure , the force developed on the spring of valve 306 , and the occurrence of sol2 pressure . when manual timing valve 330 is positioned at the right - hand end , pressure in passage 332 is directed as pressure to passages 334 , 336 to ports of the 2 - 3 shift valve 232 . also , r pressure is present at 2 - 3 shift valve 232 at the end of passage 290 . as a result of pressure in passage 334 , a differential pressure is developed on the spool of shift valve 232 , which , regardless of the effect of sol1 pressure at the end of the spool , forces the spool rightward against the effect of the spring to connect passage 290 to passage 280 . control valve 282 at the end of the direct clutch accumulator 262 is pressurized through passage 280 and check valve 338 . in this way , application of direct clutch 98 is both controlled to rise linearly with time through operation of accumulator 262 and delayed with respect to engagement of low reverse brake 136 and coast clutch 72 . when the direct clutch is fully engaged , reverse drive is completed . r pressure from manual valve 160 is directed by passages 292 , 310 also to the reverse port of the forward clutch valve 240 . tv pressure also is directed through passage 340 form variable force solenoid valve 166 to valve 240 . when tv pressure is high , as when transmission fluid is cold or the accelerator pedal is depressed substantially , valve 240 connects passages 310 and 344 . this action adds flow of hydraulic fluid through valve 240 to flow from accumulator 262 . if the manual valve is in the od or d position , and throttle pressure is high , valve 240 moves leftward against the force of its spring and opens a connection between passage 238 , which contains fluid at line pressure whenever the manual valve is in the od position , and passage 242 to the forward clutch . this action adds the flow of hydraulic fluid through valve 240 to the volume supplied through passage 226 and orifice 342 during automatic operation in forward drive . therefore , when ambient temperature is low and the viscosity of the hydraulic fluid is relatively high , tv pressure increases the flow to the forward clutch and to the direct clutch to produce forward drive and reverse drive operation , respectively . when first gear is produced manually by moving manual valve 160 to the 1 position , the transmission operates in the first gear by engaging forward clutch 110 , low - reverse brake 136 and coast clutch 72 , opening first solenoid shift valve 188 , and closing second solenoid shift valve 190 . in this position , the manual valve connects passages 168 and 180 through bypass loops 294 and 295 , outlets of manual valve 160 , but passages 292 , 226 and 318 are disconnected from line pressure passage 168 . converter lockup clutch 54 is disengaged and the torque converter opens through operation of the converter clutch control valve 208 , main regulator valve 162 and converter regulator valve 178 , as was previously described with reference to reverse drive operation . when manual timing valve 306 times out , passage 334 communicates delayed 1 - r pressure to two ports of the 2 - 3 shift valve 232 , which is moved rightward by the presence of sol1 pressure at the lefthand end of the valve . this action opens communication between passages 336 , 350 to a port of the 1 - 2 shift valve 228 . sol1 pressure in passage 196 moves shift valve 228 rightward , thereby connecting passages 350 and 352 . low - reverse modulator valve 316 supplied with r / manual 1 pressure in passage 352 , is moved leftward by its spring connecting passage 352 to passage 320 , through which low reverse brake 136 is engaged . when the manual valve 160 is in the 1 position , it directs line pressure from passage 168 through passage 226 , orifice 342 , and passage 242 to the forward clutch 110 . the coast clutch is energized through the manual valve 160 , which directs line pressure through passage 180 , check valves 299 , 301 and passage 324 to coast clutch shift valve 302 . line pressure directed by manual valve 160 through passages 226 , 230 is present at a port of the 2 - 3 shift valve 232 . the presence of sol1 pressure or delayed 1 - r pressure will have moved shift valve 232 rightward , thereby closing vent line 356 and connecting lines 230 and 358 . the differential pressure on the spool of 3 - 4 shift valve 236 produced by pressure in passage 358 opens a connection between line passage 234 and coast clutch passage 322 . coast clutch shift valve 302 moves leftward due to the presence of 1 - r pressure at its righthand end , and connects passages 322 and 326 to coast clutch 72 through orifice 374 and passage 331 . delayed 1 - r pressure transmitted in passage 334 to 2 - 3 shift valve 232 is also passed through valve 232 , passage 350 , 1 - 2 shift valve 228 and passage 352 to low - reverse modulator 316 . low - reverse brake 136 is pressurized from valve 316 , as is described above . a manual shift to second gear results when the gear selector manual valve 160 is moved to the 2 position and both shift solenoid valves 188 and 190 are turned on . in this position , the manual valve connects pressure in passage 168 to passages 226 , 372 and disconnects passages 180 , 292 , 318 from line pressure . forward clutch 110 is pressurized as it is for each of the four forward gears , directly from the manual valve through passages 226 , 242 and orifice 342 . the presence of sol2 pressure at the end of 3 - 4 shift valve 236 moves the valve rightward to open the connection between passage 234 , which receives line pressure through passage 226 , and passage 322 , which transmits line pressure from shift valve 236 to coast clutch valve 302 . manual valve 160 directs man2 pressure through passages 372 , direction valve 299 , passage 300 , direction valve 301 and passage 324 to the control end of the coast clutch valve . the presence of the control pressure at valve 302 opens a connection between passages 322 , 326 and directs coast clutch pressure through orifice 374 , a direction valve 328 and passage 330 to coast clutch 72 . whenever coast clutch solenoid valve 194 is on , srv pressure is connected through valve 194 to passage 202 and direction valve 301 is pressurized , thereby closing passage 300 and pressurizing the control port of coast clutch valve 302 through passage 324 . this action , therefore , engages the coast clutch by completing a connection between passages 322 and 326 regardless of the state of the manual valve . man2 pressure is directed from manual valve 160 through passage 372 , direction valve 299 and passage 304 to passages 360 and 362 , which lead to manual timing valve 306 . when the delay period of the valve expires , man2 pressure is connected through the valve and passages 334 , 336 to the 2 - 3 shift valve 232 . man2 pressure develops a differential pressure present at that shift valve , opens passage 230 to passage 358 , which is closed at 3 - 4 shift valve 236 , and directs man2 pressure through line 350 to 1 - 2 shift valve 228 . the 1 - 2 manual transition valve 250 , biased upward by its spring because of the absence of low - reverse brake pressure in passage 371 and at its control port , directs man2 pressure to passage 252 . man2 pressure added to the effect of the spring shift valve 228 and works in opposition to sol1 pressure to move shift valve 228 leftward , thereby closing the connection between passages 350 , 352 and opening a connection between passages 350 , 380 . man2 pressure is directed through orifices 382 , 383 to the intermediate servo 96 . orifices 382 , 383 delay engagement of servo 97 so that intermediate brake - 96 is engaged shortly before servo 97 , actuates band 102 and holds drum 100 against rotation . with the 1 - 2 shift valve so disposed , line pressure carried in passages 226 , 227 to shift valve 228 is connected by passage 254 to the control valve at the end of intermediate clutch accumulator 256 , by means of which passage 261 and intermediate brake 96 are pressurized in accordance with the technique described above . the delay in applying servo 97 and band 102 until after brake 96 is applied assures that engine torque is not carried by band 100 . a manual downshift to first gear from second gear occurs after man2 pressure is removed from the control end of the 1 - 2 shift valve . this causes shift valve 228 to move rightward thereby closing the connection between passages 350 and 380 to the intermediate servo 96 connecting passages 350 and 352 to low - reverse brake 136 through the low reverse modulator valve 316 , disconnecting passage 226 and 254 , and connecting passage 254 to vent port 384 . in this way , intermediate brake 96 is vented and drained through accumulator control valve 258 . the fluid above the plunger of accumulator 256 passes through the 2 - 1 downshift orifice near ball check valve 277 in passage 254 and eventually to vent 384 . when the manual valve is moved to the od position and the drive button is depressed , the transmission will produce automatic shifts among the first three gears in the manner previously described with respect to automatic operation . however , in this case , unlike overdrive operation , third gear has engine braking effect due to engagement of the coast clutch . intermediate brake 96 , direct clutch 98 , and forward clutch 110 are applied as described above with respect to overdrive operation . to produce third gear , second solenoid shift valve 190 is on and first solenoid shift valve 188 is off . the 3 - 4 shift valve 236 , moved rightward by sol2 pressure , opens a connection between passage 234 and coast clutch pressure in passage 322 . when a command is made for third gear operation and the manual valve is in the overdrive position with the drive range button depressed , coast clutch solenoid valve 194 is on and it directs sol4 pressure through passage 202 . check valve 301 pressurizes the control port of coast clutch shift valve 302 . this moves shift valve 302 leftward and connects coast clutch pressure in passage 322 to passage 326 , through which cost clutch 72 is engaged , whereby the transmission is disposed for operation in third gear with engine braking . to upshift from manual third gear to fourth gear coast clutch 72 is disengaged and overdrive clutch 74 is engaged . to disengage the cost clutch , 3 - 4 shift valve 236 moves leftward when sol2 pressure is removed , thereby closing the connection between line pressure in line 234 and passage 322 and connecting passages 234 and 278 . overdrive brake 74 is engaged through operation of accumulator 260 . in this way , coast clutch shift valve 302 will not supply pressure to the coast clutch even if sol4 pressure is available at the control port of coast clutch passage 326 . in making the upshift from third gear manual to fourth gear , sol4 pressure is removed permitting the valve 390 to close passage 322 and to connect coast clutch 22 to vent port 390 .	5
the present invention is a new and distinct variety of actinidia deliciosa plants having the several characteristics that distinguish the variety from other kiwi plants , particularly the ‘ hayward ’ variety . the new variety ‘ tsechelidis ’ was discovered in episkopi , imathia , greece , when the inventor planted seeds from selected hayward plants with the purpose of obtaining a group of male plants . from this original group of twenty plants , a single plant was identified as female . during its first harvest in 1994 , the female plant bore unusually large fruit as compared to plants of the ‘ hayward ’ variety . the female plant was monitored for the next two harvests and consistently bore the unusually large fruit , as well as other features which distinguished it from ‘ hayward ’. the female plant was then used to propagate the ‘ tsechelidis ’ variety by asexual reproduction beginning in 1996 . the ‘ tsechelidis ’ variety has been continuously asexually reproduced by cuttings from 1996 through 2007 . the distinguishing characteristics of the variety continue to run true in the propagated plants , as shown by about 1000 plants covering ½ hectare . furthermore , no changes have appeared in the new variety when grafted on ‘ hayward ’. in addition to cuttings , the new variety can be asexually reproduced by grafting to rootstocks of a . deliciosa . male pollenizers suitable for ‘ tsechelidis ’ may include , but are not limited to , ‘ matua ’. at this time the ‘ tsechelidis ’ variety is being tested for self - pollenization by the university of volvos , greece . according to preliminary results , ‘ tsechelidis ’ is characterized by up to 75 % self - pollenization as compared to 2 % for ‘ hayward ’. ‘ tsechelidis ’ should be cultivated in areas that are not affected by spring frost . temperatures of less than − 2 ° c . will damage the tender shoots of the plant and suspending growth or reduce the setting process . also , frost in early autumn to late october may damage fruit situated on the vine . the presence of strong wind , particularly in may , may result in considerable decrease of flowers borne by the plant . the following is a comparison of the fruit production an orchard of ‘ tsechelidis ’ as compared with cultivated ‘ hayward ’ situated in the area of episkopi - anthemion in the prefecture of imathia , greece . at the time of this study ( 2006 ) the ‘ tsechelidis ’ orchard was five years old . the listed observations , measurements and assessments were made in the following categories : 2 . quantitative production data ( yield , number of fruits / plants and average fruit weight ). 4 . qualitative fruit characteristics ( resistance to pressure , ph , soluble solids (° brix ), vitamin c , acids , sugars , thiault index and dry matter ). the chart below describes the physical differences between ‘ tsechelidis ’ and the known ‘ hayward ’ variety . the horticultural terminology applied below is used in accordance with revised upov guidelines for kiwi ( test guidelines — tg / 98 / 6 — actinidia 2001 - 04 - 04 , available at http :// www . upov . int / en / publications / tg - rom / tg098 / tg — 98 — 6 . pdf ). the shoots of ‘ tsechelidis ’ grow more vigorously than ‘ hayward ’, though there is no difference with respect to resilience against pest and diseases . the fruits of ‘ tsechelidis ’ are more oblong than ‘ hayward ’ ( the ratio of fruit length / width is 1 . 41 and 1 . 24 respectively ). furthermore , the fruits of ‘ tsechelidis ’ are larger and more uniform in size . ‘ tsechelidis ’ do no require thinning absent defective fruit , unlike ‘ hayward ’. additionally , due to the larger fruit size , any decrease that may be caused by low temperatures during the flowering season or poor pollination of the fruits will not affect the marketability of the fruits , in contrast with ‘ hayward ’. significance parameter ‘ tsechelidis ’ ‘ hayward ’ level ( p ) total number of 250 279 p & gt ; 0 . 05 fruits / plant number of 249 222 p & gt ; 0 . 05 marketable fruits rate of 99 . 6 79 . 6 — marketable fruits (%) total yield ( kg / 41 . 9 29 . 9 p & gt ; 0 . 05 plant ) yield of 41 . 6 25 . 1 0 . 001 & lt ; p & lt ; 0 . 01 marketable fruits ( kg / plant ) yield of 99 . 3 83 . 9 — marketable fruits (%) average weight 167 . 0 114 . 5 p & lt ; 0 . 001 of marketable fruits ( g ) average weight 237 . 0 88 . 8 p & lt ; 0 . 001 of non - marketable fruits ( g ) p & gt ; 0 . 05 signifies a statistically insignificant difference . ‘ tsechelidis ’ has a greater density of buds in each stem than ‘ hayward ’, whereby each stem , which has 13 buds , produces about 10 kg of fruit . therefore , each ‘ tsechelidis ’ tree , having about 15 - 18 stems , yields about 140 - 150 kg of fruit . the high yield , and large size and uniformity of the fruit of ‘ tsechelidis ’, as compared to the ‘ hayward ’, are significant advantages , particularly with regard to reducing production costs . this data was taken during a harvest affected by adverse weather during the growing season in imathia , greece . the following is table that shows the statistically significant differences in nutritional elements between ‘ tsechelidis ’ and ‘ hayward ’. the following tables show specific qualitative fruit characteristics between ‘ tsechelidis ’ and ‘ hayward ’. the first table lists measurements of fruit immediately after harvest . the second table lists measurements taken of fruit held in refrigerated storage for two months after harvest . measurements taken two ( 2 ) months after harvest significance parameter ‘ tsechelidis ’ ‘ hayward ’ level ( p ) resistance to 10 . 10 . 9 p & gt ; 0 . 05 pressure ( lb / in 2 ) flesh ph 3 . 32 3 . 41 p & lt ; 0 . 001 soluble solids 13 . 6 13 . 0 p & gt ; 0 . 05 (° brix ) (%) vitamin c ( mg / 100 80 . 2 38 . 3 p & lt ; 0 . 001 g fresh weight ) malic acid ( g / l ) 4 . 8 4 . 5 p & gt ; 0 . 05 sugars ( g / l ) 84 . 4 80 . 0 p & gt ; 0 . 05 thiault index 132 . 4 125 . 0 p & gt ; 0 . 05 based on the above information , the following distinctions may be drawn between ‘ tsechelidis ’ and ‘ hayward ’. the fruit of ‘ tsechelidis ’ ripen 7 - 10 days earlier than ‘ hayward ’, which is shown by the fruit &# 39 ; s lower resistance to pressure and their slight superiority in soluble solids (° brix ) during harvest . despite the earlier ripening , the resistance to pressure of ‘ tsechelidis ’ after two months of refrigerated storage was the same as ‘ hayward ’. a molecular genetic analysis was conducted by dr . athanasios mavromatis , professor of genetics & amp ; plant breeding ( university of thessaly , school of agricultural services ) comparing ‘ tsechelidis ’ with ‘ hayward ’ based on known microsatellite dna markers using pcr . the method is recognized as an accurate and repeatable molecular analysis for actinidia . huang , w . g ., cipriani , g ., morgante , m ., testolin , r . ( 1998 ) microsatellite dna in actinidia chinensis : isolation , characterization , and homology in related species . theor . appl . genet . 97 ( 8 ): 1269 - 1278 . repeatable samples of four genotypes were used ( commercial clones of ‘ hayward ’ ( one female , one male ) and ‘ tsechelidis ’ ( one female , one male )). leaf samples of 0 . 3 g per genotype was used for dna extraction process according to a modified cetyltrimethylammonium bromide ( ctab ) method . the extract dna was quantified on agarose gel by comparison with report samples ( dna marker ). the dna quality and quantity was tested to ensure accuracy of the molecular genetic analysis . thirteen known primer pairs were used for amplifying dinucleotide tandems ag / ct and ac / gt . the primer pairs used were : udk 96 - 022 , udk 97 - 402 , udk 99 - 152 , udk 96 - 053 , udk 97 - 411 , udk 96 - 030 , udk 96 - 001 , udk 96 - 037 , udk 96 - 034 , udk 99 - 168 , udk 96 - 092 , udk 97 - 406 and udk 97 - 407 . the primers were developed in a bilateral european union international cooperation with developing countries ( inco - dc ) project performed by university of udine , italy ; chinese agricultural university , beijing china ; inra , france ; and university of thessaly , greece . the pcr products were separated in 6 % polyacrylamide gels 1 . 5 mm thick . band visualization was made with silver nitrate . the results of the study indicated that at least seven out of 13 primer pairs were polymorphic . therefore , the study provides grounds for distinguishing between genetic material from ‘ tsechelidis ’ as compared to ‘ hayward ’. the polymorphic primer pairs are described in the table below according to the presence and absence of alleles of the same molecular weight . the genetic difference confirmed through diverse binding patterns indicate that the ‘ tsechelidis ’ variety is genetically distinct from ‘ hayward ’.	0
as one skilled in the art will fully appreciate , the hereinafter description of welding devices not only includes welders but also includes any system that requires high power outputs , such as heating and cutting systems , that require regulated flows of a shielding gas . description of a welding - type apparatus illustrates just one embodiment in which the present invention may be implemented . referring now to fig1 , a perspective view of a welding device incorporating the present invention is shown . welding device 10 includes a housing 12 enclosing the internal components of the welding device under a cover 14 . optionally , the welding device 10 includes a handle 16 for transporting the welding system from one location to another . to effectuate the welding process , such as tig or mig welding , the welding device includes a torch 18 as well as a work clamp 20 . the work clamp 20 is configured to ground a workpiece 22 to be welded . as is known , when the torch 18 is in relative proximity to workpiece 22 , a welding arc or cutting arc results , depending upon the particular welding desired . a pair of cables 24 and 26 connects the torch 18 and work clamp 20 to the housing 12 , respectively . as shown in fig1 , cover 14 has a door 28 located therein which allows access to an interior of welding device 10 . door 28 covers an opening 30 in housing 12 and has a hinge 32 connecting door 28 thereto . opening 30 is configured to allow for the passage of an internal shielding gas cylinder 34 ( shown in phantom under cover 14 ) therethrough . hinge 32 of door 28 allows door 28 to be pivotally opened and closed over opening 30 . the hinge may also be placed on a bottom side 36 of door 28 . a control panel 38 is located in an upper portion 40 of a front panel 42 of housing 12 . an on / off switch 44 and an output power control 46 are also located in control panel 38 of front panel 42 . it is understood that output control 46 , although shown as a single variable control , could be configured as several independent controls to control variable parameters of the power source such as wire feed speed , voltage , or current . a pressure gauge 48 and a valve 50 are located in control panel 38 of front panel 42 and provide an operator with a means of readily determining and controlling shielding gas flow to torch 18 . fig2 shows an alternate embodiment of the opening for the internal shielding gas cylinder 34 . preferably , a cover 52 threadingly engages a rear panel 54 of housing 12 . cover 52 is removable to allow for placement of internal shielding gas cylinder 34 into a gas cylinder chamber 56 . cover 52 can be constructed to retain a base 58 of internal shielding gas cylinder 34 . in this manner , a support 60 is provided at a front end 62 of gas cylinder chamber 56 and internal shielding gas cylinder 34 is effectively retained between support 60 and cover 52 . although shown as positioned in a rear or a side panel of the housing , such openings are only by way of example and do not limit the scope of the claims presented herein . fig2 also shows a first embodiment of a means of retaining the gas cylinder in welder 10 . cover 52 extends into an interior of welding device 10 by extending past rear panel 54 . cover 52 is constructed to engage base 58 of internal shielding gas cylinder 34 and thereby creates a compressive force generally indicated by arrow 64 between support 60 and rear panel 54 of housing 12 with internal shielding gas cylinder 34 disposed therebetween . the construction of support 60 and cover 52 secure internal shielding gas cylinder 34 relative to a power source within housing 12 of welder 10 . although not shown in fig2 , it is understood that the control panel 40 of this embodiment is similar to the control area shown in fig1 . that is , regardless of the means for providing shielding gas to the torch , by positioning the valve and gauge of a shielding gas regulator in the general vicinity of the control panel of the welding - type device , an operator has ready access to the control and operation of the shielding gas from a convenient location . fig3 shows a detailed view of the embodiment of fig1 with cover 14 removed to expose an interior 66 of welding device 10 and having connected thereto an optional secondary source of welding gas 92 . a wire feeder 68 is disposed in interior 66 of welding device 10 and in electrical communication with a power source 70 , also located therein and attached to a base 72 of housing 12 . wire feeder 68 provides a consumable material , such as wire 74 , to torch 18 during the welding process . shielding gas is provided to torch 18 during the welding process from internal shielding gas cylinder 34 . an operator can monitor and control the flow of shielding gas delivered to torch 18 by adjusting valve 50 and monitoring gauge 48 located in control panel 38 of front panel 42 . internal shielding gas cylinder 34 is located within housing 12 of welding device 10 and held in place by a means for retaining the gas cylinder , in this embodiment , a restraint 76 . restraint 76 maintains the position of internal shielding gas cylinder 34 relative to power source 70 . a body 78 of internal shielding gas cylinder 34 extends between base 58 and an outlet end 80 . outlet end 80 of internal shielding gas cylinder 34 is constructed to engage a first adapter 82 of an internal regulator 84 . the means for retaining 76 can be of many different configurations such as that shown with reference to fig2 , as discussed above , or , as that shown in fig3 , a pair of straps 86 , 88 that hold body 78 of internal shielding gas cylinder 34 and prevent movement of internal shielding gas cylinder 34 relative to power source 70 and internal regulator 84 . such a construction prevents the inadvertent disengagement of internal shielding gas cylinder 34 from first adapter 82 of internal regulator 84 . also shown in fig3 , first adapter 82 of internal regulator 84 is constructed to engage outlet end 80 of internal shielding gas cylinder 34 inside housing 12 and still allow a user control over the function of internal regulator 84 . gauge 48 and valve 50 extend from internal regulator 84 through front panel 42 of housing 12 . valve 50 and gauge 48 allow a user to adjust and determine the delivery pressure of shielding gas to torch 18 from internal shielding gas cylinder 34 and are positioned in control panel 38 of front panel 42 so that a majority of the controls of the welding - type device , including the control of the delivery pressure of the shielding gas , are adjustable from the control panel 38 of device 10 . in addition to first adapter 82 , internal regulator 84 is also connected to a housing adapter 90 , which is discussed below . housing adapter 90 extends from internal regulator 84 through rear panel 54 of housing 12 and is constructed to engage optional secondary source of welding gas 92 . optional secondary source of welding gas 92 also has a regulator 94 attached thereto . a connection means 100 extends from regulator 94 to housing adapter 90 of welding device 10 . this construction provides for the connection of a second shielding gas cylinder to the welding device when desired , such as when the welder is located at a primary operating position such as a shop or a garage . additionally , this construction provides that the shielding gas cylinder located within the welding device is reserved for remote operations away from the bulk shielding gas cylinder . the construction also prevents excessive changing of gas cylinders when a bulk shielding gas cylinder is available . additionally , the user is not required to transport a heavy and awkward bulk cylinder , but can simply disconnect the bulk cylinder at housing adapter 90 and move the welding - type device to a desired position with internal shielding gas cylinder 34 located securely within housing 12 . fig4 shows a schematic representation of a shielding gas system 102 of the welding device 10 in accordance with one embodiment of the invention . outlet end 80 of internal shielding gas cylinder 34 engages first adapter 82 of internal regulator 84 . pressure gauge 48 and control valve 50 of internal regulator 84 pass through housing 12 and indicate conditions of a shielding gas path 104 . shielding gas path 104 passes through a first inlet 106 of a t - connector 108 and into a valve 110 . t - connector 106 has a second inlet 112 that is connected by a second gas path 114 to a nipple 116 of housing adapter 90 . valve 110 has an outlet 118 that is connected by a gas path 120 to a drive roll assembly 122 . drive roll assembly 122 is electronically connected 124 to control the on / off actuation of valve 110 such that shielding gas is provided when a trigger of torch 18 is activated . as such , valve 110 controls the flow of shielding gas to torch 18 from internal shielding gas cylinder 34 and optional secondary source of welding gas 92 . housing adapter 90 extends through housing 12 and is rigidly mounted to housing 12 . housing adapter 90 also acts as a check valve and prevents the passage of shielding gas therethrough when a first end 126 of connector means 100 is not connected thereto . the engagement between housing adapter 90 and first end 126 of connection means 100 is such that the two components can be fluidly connected without needing additional tools . such a connection is commonly referred to as a quick connection or a quick coupler . connection means 100 has a second end 128 connected to secondary regulator 94 of optional secondary source of welding gas 92 . this construction allows for quickly connecting and disconnecting optional secondary source of welding gas 92 from welding device 10 . as such , when it is desired to utilize the welding device in a remote location away from such an auxiliary bulk shielding gas cylinder , connection means 100 and housing adapter 90 are disconnected at either of first or second ends 126 , 128 . the welding device can then be operated remotely with internal regulator 84 and internal shielding gas cylinder 34 to provide regulated shielding gas for welding . this construction provides that the gas cylinder located within the welding device is reserved for remote operations away from the bulk tank . by using the bulk shielding gas cylinder whenever available , replacing or refilling of the internal gas cylinder is minimized . the invention can be used in any welding - type apparatus , and is especially applicable to tig and / or mig welding processes . it is also noted that the regulator may be used to control a flow of inert or another suitable gas / mixture suitable for such uses . in general then , the invention is applicable to any of the aforementioned welding - type applications that would benefit from an internally regulated shielding gas flow . therefore , in accordance with one embodiment of the present invention , a welding - type apparatus includes a power source constructed to output an electrical signal suitable to welding and a shielding gas regulator disposed within an enclosure . in accordance with another embodiment of the present invention , a welding - type device has a housing having a base and a cover . a welding power source is disposed in the housing and is constructed to generate a signal suitable to welding . a first gas path originates at a regulator located in the housing and is constructed to provide shielding gas to a weld . the welding device has a second gas path that is also constructed to provide shielding gas to a weld . in accordance with a further embodiment of the present invention , a method of constructing a welding - type apparatus is disclosed that includes providing a power source constructed to provide a signal suitable to welding , providing a regulator constructed to engage a welding gas cylinder , and enclosing the power source and the regulator in an enclosure . the present invention has been described in terms of the preferred embodiment , and it is recognized that equivalents , alternatives , and modifications , aside from those expressly stated , are possible and within the scope of the appending claims .	1
aspects of the present invention relate to locating a misplaced mobile phone . reference is now made to fig1 , which is a simplified flowchart of a method for locating a misplace phone , in accordance with an embodiment of the present invention . the method of fig1 is performed by a mobile phone . at step 110 the mobile phone receives a transmitted message . at step 120 the mobile phone parses the transmitted message and identifies the message as being an alert request . generally , an alert request includes a recognizable header and one or more parameter values . a user , at step 10 , sets the parameter values by means of a message editor , such as message editor 201 ( fig2 ), to specify how the mobile phone responds to an alert request . a sample alert request is “ locatemyphone & lt ; personal identification #& gt ;& lt ; time & gt ;& lt ; volume & gt ;& lt ; alert type & gt ;”, the personal identification # parameter is a unique id for the user , the volume parameter designates a sound volume for an audible alert , and the alert type parameter designates a sound pattern for an audible alert . a sound pattern may be , for example , a repetitive “ 3 beeps + silence ” pattern , or a rising volume alert that starts with an initial volume and increases the volume over time . if the time parameter is not set , then the audible alert may be sounded for a default amount of time , or alternatively may be sounded until manually stopped . if the volume parameter is not set , then the audible alert may be sounded at a default sound volume . if the alert type parameter is not set , then the alert may be sounded according to a default sound pattern . if the transmitted message is identified at step 120 as being an alert request , then at step 130 the mobile phone sounds an audible alert . the time , volume and alert type parameters described above govern the audible alert sounded at step 130 . in addition , at step 140 the mobile phone displays a visible pre - designated message , such as “ please contact john at 123 - 456 - 7890 ” so that whoever finds the phone knows how to contact its owner . the pre - designated message displayed at step 140 may also be set using a parameter value . optionally , at step 150 the mobile phone may play a pre - designated audio / video recording , in addition to or instead of displaying the pre - designated message at step 140 . as above , the pre - designated audio / video recording may be set using a parameter value . the pre - designated audio / video recording may indicate that the phone is lost , and describe how to contact the phone &# 39 ; s owner . optionally , the mobile phone may vibrate , so as to assist people in finding it . according to various embodiments of the present invention , the transmitted message received at step 110 may be transmitted at step 20 , by means of a transmitter such as transmitter 202 ( fig2 ), in a number of different ways . the transmitted message may be transmitted inter alia as an sms message , or as an mms message . use of an mms message facilitates transmission of a pre - designated audio / video recording . the transmitted message may be transmitted via wireless application protocol ( wap ) from a mobile phone or from a pda . the transmitted message may be transmitted over a bluetooth ® connection , or over a wi - fi connection . for bluetooth ® transmission , the transmitted message may be sent as a vcard , which generally includes a message in the name field , from a bluetooth ® transmitter to the mobile phone using the object exchange ( obex ) protocol . bluetooth ® generally has a limited range of approximately 10 meters , for transmissions made by a mobile phone , and has a larger range of up to 200 meters for transmissions made by computers with class 1 transmitters . for wi - fi transmission , the transmitted message may be included in a data section of an element of an 802 . 11 ieee standard beacon . beacon element id 221 in the 802 . 11 standard is a vendor - specific element and , as such , can be used for adding data to the wi - fi protocol . in accordance with an embodiment of the present invention , the alert request message may be embedded in the data section of element id 221 , as follows . element id 221 in 802 . 11 beacon field value element id 221 length oui hex vendor code data alert request message the field oui represents a three - octet organizationally unique identifier . for example , the oui for microsoft corporation is 00 : 50 : f2 . the oui is unique for each vendor . it will thus be appreciated by those skilled in the art that for wi - fi transmission , step 120 may be performed using an 802 . 11 protocol sniffer that captures a beacon from a wireless access point , searches for element id 221 , and determines whether or not the data field contains an alert request message . reference is now made to fig2 , which is a simplified block diagram of a mobile phone 200 with circuitry for generating an alert that aids in locating the phone , in accordance with an embodiment of the present invention . as shown in fig2 , mobile phone 200 includes a receiver 210 , a message parser 220 , at least one speaker 230 , a display 240 and an optional audio / video player 250 . receiver 210 receives a transmitted message and forwards the message to message parser 220 . receiver 210 may be inter alia an sms message receiver or an mms message receiver . receiver 210 may be inter alia a bluetooth ® receiver or a wi - fi receiver . message parser 220 receives a message as input , parses the message to determine whether or not the message is an alert request , and generates as output an indicator if the message is an alert request . speaker ( s ) 230 receives as input the indicator from message parser 220 and generates as output an audible alert . as indicated hereinabove , the alert request may include parameter values that govern the time duration , sound volume and sound pattern of the audible alert . display 240 receives as input the indicator from message parser 220 , and generates as output a pre - designated display message . as indicated hereinabove , the pre - designated display message may be a parameter value in the alert request . audio / video player 250 receives as input the indicator from message parser 220 , and generates as output a pre - designated audio / video recording . in reading the above description , persons skilled in the art will realize that there are many apparent variations that can be applied to the methods and systems described . thus it may be appreciated from fig1 and 2 that embodiments of the present invention are not limited to mobile phones , and apply generally to electronic devices that have communication capability , such as portable digital assistants ( pdas ) and pagers . in the foregoing specification , the invention has been described with reference to specific exemplary embodiments thereof . it will , however , be evident that various modifications and changes may be made to the specific exemplary embodiments without departing from the broader spirit and scope of the invention as set forth in the appended claims . accordingly , the specification and drawings are to be regarded in an illustrative rather than a restrictive sense .	7
the invention will now be described in detail with reference to the foregoing figures where like numerals are used to identify like parts . in the foregoing discussion , and elsewhere in the specification and appended claims , the terms &# 34 ; lower &# 34 ; and &# 34 ; downward &# 34 ; are intended to make reference to the needle end of the syringe holder and associated parts , and conversely the terms &# 34 ; upper &# 34 ; and &# 34 ; upward &# 34 ; are intended to make reference to the head end thereof . referring to fig1 and 2 , the syringe holders of the invention , represented by general reference numeral 10 , are intended for use in combination with conventional medicament - containing ampoules which are closed at the upper end with a flexible piston slidable within the bore of the ampoule and closed at the lower necked - down end by a rubber diaphragm secured to the ampoule by a crimped - on metal collar . the necked - down end is conventionally fitted with a needle / needle hub unit and a needle sheath . a typical such ampoule / needle assembly is sold commercially as carpuject ®. the syringe holder comprises a total of five elements , which are best seen with reference to fig2 namely a generally semi - cylindrical body portion 11 ; a clamping element 12 ; a plunger element 13 ; associated piston engaging means 14 ; and boss 15 . with reference to fig2 a , 3b , 4a , 4b and 4c , the body portion comprises a generally semi - cylindrical unit which is adapted for side - loading of an ampoule through the open side wall . for this purpose the lower end has a circular hole 16 sized to fit around the needle hub of an ampoule / needle / needle hub / needle sheath unit used in combination with the holder . the upper end of the body portion has a short cylindrical section having a bore 17 therethrough for receiving the clamping element 12 which will be described shortly . finger gripping means 18 are provided for ease of manipulation of the syringe holder in use . the body portion also has a flattened area 19 having a keyhole opening 20 therethrough , the purpose of which will also be described shortly . the holder may also optionally have a viewing window 21 , which is desirable when the syringe holder is used as an aspirating syringe . the body portion may also be optionally equipped with raised ribs 22 or 22 &# 39 ;, located near the upper or lower end , respectively , of the body portion as shown in fig2 a and 3b , which serve to align an ampoule within the body of the syringe holder with the tip of the piston engagement means 14 . the ampoule clamping element 12 , shown in fig5 a and 5b , consists of a pair of handles 23 and a barrel 24 having a relatively small diameter bore 25 sized to slidably receive the shaft of plunger rod 13 shown in fig6 . the barrel of clamping element 12 has a slightly expanded bore section 25 &# 39 ; which is sized to accept the piston engaging means 14 , also shown in fig6 and which has a slightly larger diameter than the shaft portion of the plumger . extending partially around the outer surface of the barrel of clamping element 12 is a helical groove 26 . the helical groove is semi - circular in cross section and is of such width and depth that it will slidably receive a hemispherical lug 27 on the bottom surface of boss 5 . the construction of boss 15 and its relationship to clamping element 12 are best seen with reference to fig7 , 9a , 9b and 9c from which it will be seen that boss 15 is generally square in top view and is sized to occupy the generally flattened area 19 located on the cylindrical portion of body portion 11 . the hemi - spherical lug on the bottom of the boss has a tear drop shaped section 28 extending laterally from the hemispherical lug and oriented generally towards a corner of the boss . the hemi - spherical lug 27 and unitary tear drop shaped section are of such shape and size that they fit within the keyhole 20 located on the flattened area 19 of the body portion , and , as seen in fig8 the hemi - spherical lug fits within the helical groove 26 on the barrel of clamping element 12 . with reference to fig2 to assemble the various parts of the syringe holder as described above , the plunger rod 13 is first inserted through the bore 25 of clamping element 12 , and the piston engaging means 14 is affixed to the tip of the plunger rod by press fit of a knurled post on the piston engaging means with a mating hole in the tip of the plunger . the resulting clamping means / plunger / piston engaging means sub - assembly is then inserted through the bore 17 of body portion 11 , and the clamping element is rotated within the bore so as to expose the helical groove 26 to view through keyhole 20 . the hemispherical / tear drop lug section of boss 15 is then aligned with keyhole 20 , the hemispherical section is engaged with the helical groove 26 , and the boss is affixed in place on the syringe holder by any appropriate means . one means of affixing the boss to the holder when the parts are made of plastic is to provide a pair of beads 29 , shown in fig9 c , which serve as a means of sonic welding the boss to the syringe holder . all the elements of the syringe holder are thereby joined together in cooperative relationship with one another . an alternative means of affixing the boss to the holder is shown in fig1 , 11 , 12a , 12b and 12c . in that alternative embodiment , the flattened area 19 on the head of the body portion is provided with a slot 30 and a pair of ramped cavities 31 arranged on either side thereof . the boss 15 &# 39 ; is molded with hemispherical lug 27 &# 39 ; which is located atop and on the inner end of an integral base portion 30 &# 39 ; which extends to one edge of the boss and which is sized to fit within slot 30 . a pair of ramps 31 &# 39 ; is sized and located on the boss to fit within the ramp cavities 31 . thus to assemble the syringe holder in the configuration just described , the plunger rod / piston engaging means / clamping means / body portion sub - assembly discussed peviously is first made . after alignment of the helical groove 26 with slot 30 , the end of base portion 30 &# 39 ; on the bottom of the boss is aligned with the open end of slot 30 , and the boss is forced inward until the hemispherical lug engages helical groove 26 , and ramps 31 &# 39 ; engage ramp cavities 31 . this alternative embodiment is also particularly adaptable to assembly using plastic molded parts . it will be seen from the above description that , by rotating the clamping means approximately one half revolution in one direction or the other , the clamping means will move either forward to a fully engaged position or backward to a fully retracted position . thus in use the clamping means is first fully retracted by one half turn in one direction , counterclockwise as illustrated in the drawings , an ampoule / needle / needle hub / needle sheath unit is inserted through the side opening of the syringe holder , and the clamping means is given one half turn in the opposite direction to cause the shoulder 32 of clamping element 12 , shown in fig5 b , to bear against the rim of the ampoule thus securing it firmly in place within the holder . the plunger is then engaged with the piston of the ampoule , one means of achieving such engagement illustrated here being to turn the plunger rod so as to engage a screw - threaded hole in the end of the piston engaging means 14 with a screw - threaded post on the piston . the clamping element may optionally be equipped with a pair of raised ribs 33 , shown in fig5 a , located near both ends of helical groove 26 which serve to lock the clamping means either in the fully engaged or the fully retracted positions . it will be appreciated that minor modifications in the various elements of the invention may be made without departing from the spirit of the invention . for example , the means for accommodating the hub of the ampoule / needle / needle hub / needle sheath unit to the syringe holder has been described herein as a circular hole 16 . however , a side opening slot would obviously serve the same purpose , and such means is considered to be within the ambit of the inventive concept here described . moreover , the piston engaging means is described herein as being a screw - threaded element which mates with a screw - threaded post on the ampoule piston . such means of engaging the plunger with the piston , however , is only a preferred means , and other piston engaging means well known in the art will serve the purpose as well . such other engaging means include , for example , multiple retractable claws or hooks , such as shown in u . s . pat . no . 2 , 693 , 804 ; a screw - threaded engagement into threads molded into the plunger , such as disclosed in u . s . pat . no . 2 , 706 , 984 ; fixed claws such as described in u . s . pat . no . 2 , 789 , 559 ; an expandable chuck , such as disclosed in u . s . pat . no . 2 , 869 , 542 ; resilient gripping fingers , such as disclosed in u . s . pat . no . 2 , 895 , 473 ; a barbed point or &# 34 ; harpoon &# 34 ;, such as disclosed in u . s . pat . no . 2 , 904 , 044 ; or a bayonet connection , such as disclosed in u . s . pat . no . 2 , 986 , 141 . although the various elements of the syringe holders described herein may be made of any suitable material , including metals or plastics , they are well adapted to fabrication of plastic , particularly body portion 11 , clamping element 12 , plunger element 13 and boss 15 , and such method of fabrication of those parts is particularly preferred . although the piston engaging means 14 can also be made of plastic , it is preferably made of metal , for example brass . when the various elements are constructed of plastic , suitable plastics are high density polypropylene , polystyrene , abs ( clear or opaque ), nylon , delrin ® or polyethylene . a particularly preferred plastic is high density polypropylene . the boss 15 , which serves to hold all the elements of the syringe holders together , may in addition to the means specifically illustrated herein , be affixed to the body portion by any other suitable means appropriate to the materials used to construct the holders . when they are constructed of certain plastics , the boss may be affixed to the body portion by , for example , thermal , sonic or solvent welding , gluing and the like . other plastic materials , not adaptable to joining by such means , may require use of the ramp and ramp cavities method described above . when constructed of metal , they may be affixed by screws through the boss into the head portion , by welding , brazing , gluing or the like . having thus described the invention and the advantages thereof , it is considered that the invention is to be broadly construed and limited only by the character of the following claims .	0
referring to fig1 the general operation and structure of the system of the present invention will be described , it being understood that the operation of the system will be described in greater detail with reference to fig2 a - 2g , 3 and 4 . when a consumer calls into the telepay system 10 using a telephone 12 , the consumer is prompted by an interactive voice response unit within the system 10 to input certain necessary information , to wit , payee access code , debit card number , account number , and amount . the telepay system 10 then checks all of its internal files , including an account number velocity file 14 , a debit card velocity file 16 and a negative file 18 , to validate the access code entered , the card number presented , the validity of the account number , and if that card number and / or account number has ever processed a fraudulent transaction . if any of these internal checks into the telepay system 10 process indicate fraud , then the transaction is denied . if all of the checks are passed , then the telepay system 10 assembles the data into an authorization request message , which is electronically sent to a debit card network 20 for transmission to a financial institution 22 that issued the card for verification of balance on deposit . the debit card network 20 receives a response as to whether or not the there are sufficient funds on deposit to process the transaction requested by the consumer . the debit card network 20 prepares an appropriate deduction from the consumers account and prepares an appropriate deposit to the payee &# 39 ; s account to be processed later . in addition any fees that are due from the payor are also preprocessed at this time . the debit card network then sends a message to the telepay system 10 while the consumer is still on the telephone 12 line . the telepay system 10 will then translate the numeric data received into an audible verbal response transmitted to the consumer via the telephone 12 . settlement , as described in greater detail with reference to fig3 is defined herein as the methodology of debiting and crediting the appropriate accounts affected by the above - described transaction . these accounts would affect the payor , the payee , and the telepay system 10 for any transaction fee . the debit card network 20 will initiate this process . the debit card network 20 , however will only deposit a total of the days transactions into the payee &# 39 ; s account . the network has no capability to discern which consumer paid how much . it then becomes the responsibility of the telepay system 10 to detail the specific account numbers and amount of payments that were made that day . this is accomplished by a computer dial - up link ( rje ) 24 from the telepay system 10 to the payee &# 39 ; s billing system 26 . the telepay system 10 will also bill the payee on a monthly basis for 800 telephone line usage ( if any ). the accounts receivable department of the payee is also provided with the capability to call into the telepay system 10 to inquire as to if and when a consumer initiated a payment . a single 800 number is used by the telepay system 10 . technology allows for a virtually unlimited number of telephone lines to terminate on the same number , limited only by the compliment of computer hardware and it &# 39 ; s capabilities that are running the system . the caller will be asked to enter the access code of the bill to be paid . this access code typically will be printed on the bottom of the statement in an obvious manner and is a requirement of all payees utilizing the service . the code will identify the payee within the telepay system 10 and will activate the telepay software to verbalize the customer &# 39 ; s selection in order to give positive re - enforcement as is the case with all customer input ( i . e . &# 34 ; you have elected to pay florida power and light in miami , fla .&# 34 ; press 1 if this is correct and you wish to continue , or press 2 if incorrect &# 34 ;). if incorrect , the customer will be asked to input another access code , or to terminate the call . assuming the proper access code is confirmed , the next step will be the entering of the account number of the bill to be paid , as this number also appears on the monthly statement . all selections will be verbally re - enforced . the next step will be the entering of the debit ( atm ) card number . various telepay system 10 checks will be done on this entry . verbal re - enforcement of the numbers entered is again given to the user (&# 34 ; you have entered 5419 23485 4657 . please press 1 if correct or 2 if incorrect &# 34 ;). the telepay system 10 will then instruct the user to enter the amount of the payment and verbal positive re - enforcement will be given . if all has been acknowledged positively up to this point , then the system will give a verbal summary of the transaction and give the customer a final opportunity to validate the entries (&# 34 ; press 1 if correct , or press 2 if incorrect &# 34 ;). when the transaction has been positively re - enforced by the user , the telepay system will then build an authorization request that will be sent out to the existing debit ( electronic funds transfer ) networks . when the transaction has been authorized , the system will once again give positive re - enforcement to the user (&# 34 ; your payment to dallas gas and electric in the amount or $ 124 . 56 has been paid from your atm card account number 5419 23485 4657 . your authorization number for this transaction is xxxxxxx . please make a note of this authorization code for future reference . if you would like to hear the authorization code for this transaction again , press 1 . if you would like to pay another bill press 2 . if you are finished press 3 &# 34 ;). if the user elects to pay another bill during the same session , then the system will retain the previously entered card number and ask the caller if the next bill being paid is to be paid with the same card , or allow the opportunity to enter a new card number . all of the debit ( electronic funds transfer ) networks are accustomed to the assessment , debiting and crediting of fees to the issuers and acquirers of debit ( atm ) and credit transactions . in many cases , a 75 ¢ fee for a customer to use an atm card at an atm that is not owned by the card issuing bank involves the dividing of that fee into increments as small as 5 ¢. in this manner all networks that are accessed are compensated to assist in the authorization and routing of the transaction . all of these fees are electronically credited to the entity that earned the revenue as a result of a contractual relationship with that particular network . this process happens every working day at a predetermined &# 34 ; cut off &# 34 ; period that separates business days and is refereed to in the industry as &# 34 ; settlement &# 34 ;. never before , however , has a transaction been presented to the debit networks for a real - time authorized bill payment initiated by the consumer from a touch tone telephone with the - debit card used as the transaction vehicle . additionally , it has never been done without the requirement of a pin ( personal identification number ) and still maintain transaction security . in the telepay system 10 , when a transaction is entered by a consumer , and subsequently passed on to an outside debit card network for authorization , a number of things happen . assuming that the transaction is authorized , then any fee that the customer is paying , in addition to the actual bill payment , is automatically deducted from the payor &# 39 ; s account immediately and added to the amount that the debit card network will owe telepay and the payee at settlement . the amount of the bill that was paid is automatically added to the amount that will be credited to the payee at the end of the business day ( every payee is required to provide a bank account number that will be used to electronically credit the days receipts ). telepay &# 39 ; s bank account will , in a like manner , be automatically credited for the transaction fee . any network usage fees that have to be paid to process the transaction by the use of an debit card network will be electronically paid by the telepay system 10 to the appropriate service provider . once a day at telepay &# 39 ; s settlement time , each payee participating in the system will receive the electronic on - line detail summary of the days individual transactions for posting to the consumer &# 39 ; s account . a flowchart illustrating the operation of a bill payment transaction process of the telepay system 10 is shown in fig2 a - 2g . the process is initiated by a user &# 39 ; s calling into the system 10 . in step 200 , a general purpose welcome message that announces and instructs the caller in the manner with which the system can be used is transmitted to the user via the telephone 12 ( fig1 ). in step 202 , the user is prompted to enter a payee access code , which is assigned by the embodiment of the invention in the form of a service and the user is made aware of this code due to its printed presence on the monthly customer statement , statement stuffers or other printed handouts . this code is what distinguishes one payee from the other , and is the identifier that causes the system 10 ( fig1 ) to record the transaction in the appropriate payee record file . after the caller enters the access code , it is electronically checked against the list of authorized payees participating in the system 10 in step 204 . in step 206 , a determination is made whether the entered access code is valid . if the access code is invalid , in step 208 , the system 10 checks to determine whether this is the third incorrect entry of an access code . if this is not the third incorrect entry of the access code , in step 210 , the system 10 instructs the caller that the access code is invalid , and offers the caller to opportunity to re - enter the access code in step 202 . if this is the third incorrect entry of an access code , in step 212 , the system 10 instructs the caller to check the access code information and call again . if the access code is entered properly within three attempts , in step 214 , the caller is prompted to enter the account number of the bill that they are paying . in step 216 , the system 10 checks the account number for validity . the validity check is based on the methodology that the payee uses to verify account numbers and will vary according to payee . the system 10 will have all of the participating payees verification methodologies . this methodology could be a mod 10 or mod 11 check digit routine with or without a check digit in it &# 39 ; s most basic implementation . in a more sophisticated environment , the system would have in it &# 39 ; s database , a list of all the valid account numbers for that particular payee , commonly known to those skilled in the art as a &# 34 ; shadow file .&# 34 ; in step 218 ( fig2 b ), a determination is made as to the validity of the account number entered . if the entered account number is not valid , in step 220 , a determination is made as to whether this is the third incorrect entry . if it is not the third incorrect entry , in step 221 ( fig2 a ), the caller is informed that the entry is invalid and is given an opportunity to reenter the account number . if the entry attempt is the third invalid attempt , in step 222 , the caller is instructed to check their information and call again . if a valid account number is entered within three attempts , in step 224 , the system 10 requests the caller to enter the debit card number . in step 226 , the debit card number is checked for validity . this validity check is done via the mod 10 algorithm that is the basis for debit card issuance used by financial institutions . using this method that is commonly used , and familiar to those skilled in the art , gives a great level of assurance that the number that was entered by the caller was entered properly . in step 228 , a determination is made whether the entered debit card number is valid . if the entered debit card number is not valid , in step 230 , a determination is made whether this is the third invalid entry if this is not the third invalid entry , in step 232 , the caller is instructed of the invalid entry and then , in step 224 , is requested to enter a debit card number . if this is the third invalid entry , in step 234 , the system 10 requests the caller to check their information and call again . once a valid debit card number is entered within three attempts , in step 236 ( fig2 c ), the caller is requested to enter the dollar amount ( without a decimal ) of the bill to be paid . in step 238 , the system 10 repeats the entered amount to the caller and , in step 240 , asks the caller to indicate whether the entry is correct by depressing a key on the keypad of the telephone 12 . in step 242 , a determination is made whether the caller responded that the entry is correct . if the entry is not correct , in step 244 , a determination is made whether this is the third incorrect entry . if this is not the third incorrect entry , in step 236 , the caller is requested to enter a new dollar amount . if this is the third incorrect entry , in step 246 , the caller is requested to check their information and call again . if the caller enters a correct amount within three attempts , in step 248 ( fig2 d ), the system 10 initiates a velocity file 14 check . the velocity file 14 is an internal file to this invention that restricts the number of times that a payor account number can be paid electronically using the system 10 over a 30 day period . the numerical value of the velocity file is individually selectable by each payee participating in the system 10 , and will prevent excessive payments from their customers that have the potential for fraud . in step 250 , if payments are located in the velocity file 14 that indicate to the system 10 a violation of the number of transactions permitted over a 30 day period by the payee , in step 252 , the caller is notified that their transaction cannot be processed , due to the excessive frequency of usage . if the transaction is within the number allowed by the payee over a thirty day period , in step 254 , the system 10 performs the velocity file check on the debit card number that the caller entered . the numerical value of the debit card velocity file 16 is determined by the system 10 based on , but not limited to , historical usage data of all payees and payors over a given period of time . this value is variable and is achieved generally by multiplying the total number of payees participating in the system times the total number of payments allowed by each payee over a 30 day period . if the system 10 determines that the transaction by the payor exceeds the debit card velocity file criteria , in step 256 , the caller is notified that the transaction cannot be processed due to the frequency of the number of uses of the debit card used to process transactions over a thirty day period . if the transaction by the payor does not exceed the debit card velocity file criteria , in step 258 ( fig2 e ), the system 10 determines whether either the payor account number or the debit card number is contained in the negative file 18 comprising a database of negative accounts stored on the system 10 . the purpose of the negative file 18 maintained by the system 10 is to prevent debit card numbers and account numbers that have been involved in fraudulent transactions from initiating another transaction . this file is updated by payees participating in the system by written notification to the service . an employee of the service would then update the system . if the system 10 determines that a match on either payor account number or debit card number has been found , in step 260 , the caller is informed that the transaction cannot be processed . if there is not a match found on the negative file 16 , then the details of the transaction are summarized to the caller verbally on the interactive voice response system in step 262 . in step 264 , the caller is prompted to begin the processing of the transaction by pressing one ( 1 ) on the telephone keypad , or by pressing two ( 2 ) on the telephone keypad to abort the transaction . in step 266 , the system 10 checks the caller &# 39 ; s response . if two has been depressed by the caller , in step 268 , the system 10 thanks the caller and terminates the call . if one has been depressed by the caller , in step 270 ( fig2 f ), the system 10 outdials via a normal telephone line to an appropriate debit card network , such as the network 20 for processing . a debit card network is a third party processor that will process the transaction for a fee , providing connectivity to either the financial institution that issued the debit card number , or another debit card network that has the capability to connect with the financial institution that issued the debit card number . those skilled in the art are aware that a debit card network , i . e . pulse in houston , tex ., most in washington , d . c ., honor in maitland , fla ., etc ., process primarily atm ( automated teller machine ) transactions , and do not rely on the automated clearing house ( ach ) to process individual transactions . in addition to the face value of the bill to be paid , the system adds a service charge that the caller will electronically pay for use of the convenience of the system . through the use of the debit card network , rather than the ach , the transaction is positively verified against funds on deposit prior to the processing of the transaction . in step 272 , while the system 10 is outdialing to the debit card network 20 , the system 20 plays a customized individually recorded marketing message for each payee utilizing the system 10 , that will promote a service of the payee while the caller is awaiting approval . if the debit card network and the subsequent transmission to other debit card networks ( if required ) make the determination that funds are not available in the caller &# 39 ; s account selected by the debit card number , then the transaction will be declined . in step 274 , the system 10 awaits a reply from the debit card network 20 . in step 276 , the system 10 then makes a determination on the disposition of the transaction based on the response received back form the debit card network 20 . if the response from the debit card network 20 indicates to the system 10 a declination , with which those skilled in the art are familiar , in step 278 , the system 10 informs the caller that the transaction was declined by the financial institution that issued their debit card number . if the response from the debit card network 20 indicates an approval , the caller will be verbally informed of the approval code in step 280 . in step 282 , the approved transaction is updated in a system transaction log file that will later become the basis for the transmission for payment data to each individual payee . the transaction log file contains the debit card number , payor account number of the bill paid , amount of the bill paid , time / date , and approval code . the log file is individually kept for each payee participating in the system for later electronic transmission for billing system update . in step 284 ( fig2 g ), when a transaction is successfully completed , the aforementioned debit card number velocity file that was checked as part of the pre - processing procedures is updated to reflect the transaction . in step 286 , the velocity file for the account number of the bill that was paid is updated to reflect the transaction . in step 288 , the system 10 asks the caller if he or she would like to pay another bill by requesting the caller to press one ( 1 ) to pay another bill , or two ( 2 ) to terminate the call . in step 290 , the system 10 makes a determination as to whether the caller would like to make another payment , based on the response indicated by the caller . if a one was pressed , the system 10 prompts the caller for another access code in step 202 ( fig2 a ). if a two is pressed , the system 10 terminates the call in step 292 . fig3 is a flowchart of the settlement process of the present invention . after close of the business day , by the debit card network 20 , the debit card network 20 begins to move the funds electronically ; a process with which those skilled in the art are familiar . at that point the system 10 is in a position to transmit the detail of the days transactions to the individual payees that will be receiving electronic credits from the debit card network 20 . the debit card networks transmit only the gross dollar amount of funds for crediting to each payee . the system 10 performs the actual detail of the electronic transmission of individually paid accounts . the system 10 will recognize the time of day by the internal clock common to most computer systems , and select the first payee in the aforementioned transaction log file . in step 300 , the system 10 will outdial using an ordinary telephone line into the first payee on the system in an effort to connect to the computer billing system 26 ( fig1 ). once a telephonic connection is established , in step 302 , the system 10 begins the process of transmitting the payor account numbers and amounts of the bills that were paid since the last settlement period using the system 10 . this process is known to those skilled in the art as remote job entry ( rje ). in step 314 , the system 10 determines whether there are other files to be transmitted . in step 306 , the system 10 outdials the appropriate telephone number established in advance to establish a telephonic rje link with the next payee in step 302 , in a manner similar to the aforementioned , the transactions that the system 10 performed in favor of that particular payee will be transmitted to that payee &# 39 ; s computer billing system 10 . once all the files have been transmitted , the settlement process is terminated in step 308 . fig4 is a flowchart of a payee inquiry process of the present invention , which provides a payee with the ability to initiate a telephone call into the present invention operating as a third party to the transaction , in order that payment information can be discerned in conjunction with a touch tone telephone . the process is initiated by a payee calling into the system 10 . in step 400 , the system 400 will ask the caller to input a security code , which is assigned to each payee and is different for each payee . the input of a proper code will indicate to the system which payee payments are to be inquired upon . without a proper code , no inquiry access is permitted . it is important to recognize that this system capability is for the payee , and not for the actual payor of the bill . this system capability assists in past due collection activity . in step 402 , the system 10 checks its internal data files to ascertain the validity of the code entered . if an improper code is entered , in step 404 , the system 10 informs the caller that the code is invalid . if the entered code matches one that was contained in the system database , in step 406 , the system 10 requests the caller to enter the account number of the customer whose bill is being inquired upon . after the caller enters the account number , in step 408 , the system attempts to locate it on the system database . if the system 10 cannot locate the account number , in step 410 , the caller is informed that no payment exists for the entered account number and is given an opportunity to enter another account number in step 406 . if the entered account number is located , in step 412 , the system 10 informs the caller of the details of the transaction , to wit , time , date , amount , and authorization number of the payment . in step 414 , upon completion of the audio text information , the caller is asked whether he or she has another inquiry to perform . if so , in step 406 , the system 10 prompts the caller to enter the account number ; otherwise , the system 10 terminates the call in step 416 . the crux of this invention is that bill payment transactions have never been presented to the debit networks for a real - time authorization initiated by the consumer from a touch tone telephone with the debit card number used as the transaction vehicle . additionally , this process has never been done without the requirement of a pin ( personal identification number ) and still maintain an assemblage of transaction security . in the telepay system , when a transaction is entered by a consumer , and subsequently passed on to an outside debit card network for authorization , a number of things happen . assuming that the transaction is authorized , then any fee that the customer is paying , in addition to the actual bill payment , is automatically deducted from the payor &# 39 ; s account immediately and added to the amount that the debit card network will distribute between telepay and the payee at settlement . the amount of the bill that was paid is automatically added to the amount that will be credited to the payee at the end of the business day ( every payee is required to provide a bank account number that will be used to electronically credit the days receipts ). telepay &# 39 ; s bank account will , in a like manner , be automatically credited for the transaction fee . any network usage fees that have to be paid to process the transaction by the use of an debit card network will be electronically paid by telepay to the appropriate service provider . once a day at telepay &# 39 ; s settlement time , each payee participating in the system will receive the electronic on - line detail summary of the days individual transactions for posting to the consumer &# 39 ; s account . the following criteria and conditions are part of the telepay method and unique process prior to the acceptance of a debit card number into the system in order to ensure a proper transaction has been presented and to add a level of usage security . first , a service address ( telephone number or residential electricity site , etc .) or payee account number can only be the recipient of a specific limited number of payments within 30 days that is selectable by the funds recipient and a velocity file by account number is kept at the telepay system tracking this limitation . in addition , a debit card number can only be used in the telepay system a specific limited number of times based on a recipient of funds selectable parameter and current recipient of funds ( payee ) negative files due to adverse experience are added to the telepay system prior to implementation . still further , any consumer chargebacks will prevent that customer &# 39 ; s telephone number / electricity service address number and that credit / debit card number to have system access . appropriate additions will be made to the negative file unless specific overrides are requested by the funds recipient . also , all transactions will be routed electronically to the card issuing entity / network by the telepay system for positive authorization as to card acceptability , credit limit guidelines , payment status , balance availability , and any and all criteria that the issuer deems appropriate . additionally , the telepay system will provide records of all declinations by card number and by telephone number , electric service account number , or payor account number , whichever is appropriate and a check will be done on all debit card numbers entered into the telepay system to ensure that the input number is an assigned number within the criteria of the issuing entities , as well as on service address account numbers to insure that the proper number and sequence of digits have been entered to add an additional level of accuracy to the numeric entry process . moreover , the customer will always be given positive audio reinforcement at critical steps during the data entry process to assist in the entry of accurate information and transaction declinations due to non - sufficient funds will be audio referred for the consumer to contact their card issuing institution . accordingly , it is clear that the telepay system is a technologically advanced and consumer convenient process . the consumer may use the telepay system to pay bills at will , spontaneously , without any personal investment in equipment , and any requirement of pre - registration . the use of the telepay system is not tied to a specific locations , as any touch tone telephone will suffice . use of this unique process will eliminate the use of stamps , envelopes , the u . s . postal service , and the necessity of going to a mailbox . personal computers and the lack of realistic portability are problems that do not exist in the present invention . receipt of payment is also assured and issues of &# 34 ; lost in the mail &# 34 ; or mail delays will no longer exist . debit cards will now have true utility as transaction vehicles in order to electronically present payment as opposed to paper checks . older technology of pre - registration and direct debit registration systems will become obsolete . it is understood that the present invention can take many forms and embodiments . the embodiments shown herein are intended to illustrate rather than to limit the invention , it being appreciated that variations may be made without departing from the spirit of the scope of the invention . for example , it is anticipated that the payor may be an individual or an institution , such as a corporation or association . although illustrative embodiments of the invention have been shown and described , a wide range of modification , change and substitution is intended in the foregoing disclosure and in some instances some features of the present invention may be employed without a corresponding use of the other features . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention .	6
in fig1 is illustrated a cabinet generally designated 10 on which is mounted a support assembly 11 serving as a cell and motor support . mounted on the support assembly 11 is a motor 12 . mounted beneath the support assembly 11 is an electrode 13 held in an electrode head 14 . the electrode 13 is adapted to fit within a sample holder ( not shown ). the sample holder in practice is a plastic or glass member shape essentially like a test tube and characterized by being made of a material which is free from detectable quantities of any metal for which testing is to be performed . one principal intended use of the apparatus , according to this invention , is testing for trace quantities of lead and accordingly , the sample holder is made of lead - free glass or plastic which has been additionally treated to eliminate detectable trace quantites of lead . desirably the support assembly 11 is pivotally mounted in the cabinet by means of mounting pins 16 whereby the entire assembly may be rotated in our out of position for easy insertion or removal of a sample holder from the head 14 on which it is held by a snug fit between the head and the sample holder . on the cabinet is positioned in a convenient location , an off / on switch 17 , an off / on motor switch 18 , and desirably , a reset switch 19 . also , on the front of the cabinet is a meter 20 for visual read out of voltage or current a recorder off / on switch 21 , a sweep offset 22 , and a recorder offset button 23 . desirably , there is also on the cabinet face a current range indicator 24 . in fig2 is illustrated further detail of the cell and motor assembly . mounted on support assembly 11 is motor 12 having a shaft 26 extending therefrom . by means of a coupling 27 the shaft 26 is connected to a propeller shaft 28 which terminates in a propeller blade 29 positioned within and near the bottom of electrode shield 14 . mounted at the bottom of support assembly 11 is an electrode holder 13 which is adapted and positioned to hold the electrode shield 14 . mounted within the electrode shield 14 is a stop 32 receiving and bearing against the electrode shield 14 . the electrode 33 is in turn positioned within the stop 32 and is held in its proper position thereby . mounted within the electrode are dividers 35 forming internal electrode compartments through which extends propeller shaft 28 and which , among other thing , serves as a guide for the propeller shaft . in practice three dividers are employed to form compartments . a bearing 36 at the bottom of the electrode compartment rotatably holds and guides the propeller . optionally , a fine tube 37 or nitrogen line is positioned extending through the electrode shield and electrode with its nozzle positioned within the electrode compartment to assure a neutral atmosphere . the electrode 33 is constructed and adapted to anodic stripping voltammetry or other electrode chemical operation . the electrode 33 consists of a hollow cylindrical electrode 40 desirably having one or more openings 41 in its side . the electrode body 40 according to one form of this invention is a hollow cylinder of graphite impregnated with a film forming material such as paraffin wax or the like and having on its surface a deposit of an electrode surface layer such as , for example , a layer of mercury . the electrode surface layer is present in the form of a multiplicity of dots or islands of mercury , each deposited on a graphite point and surrounded by a portion of impregnated wax surface . the electrode can be produced by impregnating a graphite rod with wax , scraping the wax from the graphite surface to lay bare a multiplicity of graphite points and coating mercury thereon by electrode chemical disposition using the graphite body as an electrode chemical cathode . the preparation of mercury coated graphite electrode described in co - pending application ser . no . 168 , 161 , filed aug . 2 , 1971 . in at least exposed active areas of the electrode area 33 according to one embodiment of the invention , both the outer surface 42 and the inner surface 43 of the electrode body 40 are coated with the electrode metal as described . when the apparatus of the present invention is employed for testing for trace elements of lead , the electrode metal preferably is mercury . in this manner a mercury electrode surface is positioned vertically within the sample holder and has an extremely high ratio of surface area in relation to sample volume . the area / volume relationship should be at least 3 cm 2 electrode area per milliliter sample volume , and preferably 4 : 1 or greater . at present , an electrode to sample ratio is 20 cm 2 per 3 . 6 milliliter sample . the propeller shaft 28 passes through the center of the electrode 33 and propeller blade 29 is positioned near the base of the electrode and is adapted to cause circulation of the sample liquid both inside and outside the electrode body 40 . apparatus of the type herein disclosed can be employed by means of manual switching and manual controls in anodic stripping voltammetry . in such manual operation a sample holder containing a liquid for test is placed in position with the electrode assembly immersed therein . the electrode is connected in cathode mode to a suitable power source and ionic components are deposited on the electrode surface . in particular , if the apparatus is employed to test for the presence of lead , then lead is electrolytically deposited on the mercury electrode surface and is alloyed therein . after cathodic deposition on the electrode surface , the electrode is placed in anodic mode and the voltage applied thereto is gradually raised , and the electrolytic current is monitored . metallic elements are identified by the potential or voltage of which the flow of current indicates that a trace of metal is being anodically stripped from the electrode and the quantity of the trace element is measured by the quantity of anodic current . in fig3 is illustrated a modified electrode assembly in which the electrode 13 is mounted on a support or holder 31 and adapted to fit within a suitable sample holder ( not shown ) in much same manner as with the assembly in fig2 . a coupling 27 connects the motor 12 ( see fig1 ) with a propeller shaft 28 extending axially through holder 31 and to a point approximately level with the electrode 13 . the electrode 13 is hollow , as with the electrode shown in fig2 and within the hollow electrode the propeller shaft 28 is of significantly bigger radius leaving only a relatively small space between shaft 28 and inner surface of electrode 13 . at the bottom of this shaft , once again , is a propeller blade 29 . a counter electrode 30 extends through the electrode holder 31 and is positioned to be immersed in the sample within the sample holder . a reference electrode 34 also extends through the holder 31 to a position within the sample . desirably , the counter electrode 30 is a platinum wire which may directly contact the solution or , as presently preferred , is a platinum electrode contained in a porus glass compartment or shell . the reference electrode desirably is a silver or silver cloride wire immersed in a saturated sodium chloride solution . desirably the propeller shaft 28 may extend through one or several bearings 21 . in the preferred form of the structure , the electrode holder 31 is adapted to fit snuggly with in a sample holder so that during operation a sample holder is retained firmly but releasably in a position into which it can be manually fitted . in one form of the invention , as illustrated in fig3 the electrode 13 has a coating 15 on its outer or exposed surface . this coating is a plastic tubing shrunk around the outside of the active electrode . when the coating is employed , the electrode is generally protected from accidential damage and can , in fact , be handled carefully when the electrode is removed from a sample . there is relatively small clearance between the electrode and the sample holder when in position , and again is there relatively small clearance between the electrode and the lower end of stirrer 28 . moreover , the stirrer 28 is slightly tapered , being slightly larger at its lower end than it is at the upper end , so that the space between this stirrer 28 and the inner electrode surface also is tapered , being narrower at the bottom than at the top . as the stirrer rotates within the electrode , this tapering causes not only localized currents of the test liquid , but also causes a general flow of the liquid downwards in the space between stirrer and electrode . in high speed sample testing it is important that the sample liquid should circulate well , but it is also desired that the relatively still layer adjacent to the electrode be as thin as practical . this layer , known as the nernst layer , appears to be about 1 - 2 micron in the apparatus of fig3 . in fig4 is illustrated , in the form a block diagram , the electrical controls for automation of the equipment according to one embodiment of the invention . a clock generator and timer controlled sequence serves as a control mechanism for all functions . a plate and strip control 51 serves to apply a plating potential to the electrode and under the control of the timer 50 applies such control for a perios of 1 minute or selectively for some other period of time such as 3 minutes or 5 minutes . a motor 52 energizes the stirring mechanism ( propeller shaft 28 and 29 ) and under the control of timer 50 , causes stirring of the sample while the plating potential is applied . a sweep generator 53 is adapted to supply a stripping voltage to electrode 32 and under the control of timer 50 , supplies this voltage 10 seconds after the plate and strip control 51 and motor 52 and turned off by the timer 50 . the sweep generator 53 is essentially a staircase generator and steps down in 10 millivolt steps at 100 milliseconds per step . when the apparatus is used for detection and measurement of lead , the plating voltage is - 1 . 0 volts and the sweep generator steps down from - 1 . 0 volts to 0 . 1 volts in 90 steps in an elapsed time of about nine seconds . the sweep generator operates through an electrode supply 54 . adapted to read out from the electrode during stripping , and optionally during plating , is an i / e converter which serves to convert current to voltage to supply a signal more suitable for being amplified . the i / e converter 55 feeds to an optional strip chart recorder 56 . as will be seen hereinafter , the apparatus under the control of the elements in fig4 produces a direct digital readout but a chart readout may be desired and is illustrated in fig4 . this readout , when employed , is a conventional charting device to chart current flow vs . time ; the current flow being expressed in terms of voltage output from the i / e converter 55 . the time vector , is relation to the output of sweep generator 53 , identified and stripping voltage . the chart represents , therefore , the readout from the electrode and is shown in the figure as an analog selector 57 . as s & amp ; h i / e zeroing unit 59 ( sample and hold ) delays for a selected time which , in operation , may be 20 milliseconds , before counting the electrode output . in order to eliminate initial noise upon each change in step as the stripping potential is stepped down , an i / e zero selector 60 is set for a zero point at 100 ± 50 millivots before the integration zone . a connection to a power supply or voltage source 61 operates through switch 62 energize the various electrical components , energizes the timer 50 and the other power units previously and hereinafter described . for digital readout , which is a presently preferred embodiment of the invention , a dual slope integrator 64 integrates the output signal and converts the analog signal to a digital representation . an s & amp ; h integrator 65 operates from the dual slope integrator 64 to identify and isolate the zone of the stripping potential in which the current signal occurs . an s & amp ; h delayed analog 66 optionally permits a variation in sample and hold time . this adjustability is not required if the apparatus is employed for a single use and the application , as is now the case where the apparatus is employed for the detection of lead which has a single deplating or stripping potential . an integration set point and logic circuit 68 is adapted to receive the readout signal and to discard as noise an initial signal less than a pre - determined value . this integration setpoint and logic 68 then , together with an output from the dual slope integrator 64 , feeds to an up / down count control logic 69 . this up / down count control logic 69 , for its first count , counts down six times and next , for twelve counts , counts up followed by a fourteenth count which , once again , counts down six times thus making a count equivalent to a digital output from the output signal . the up / down count control logic 69 in turn feeds to an up / down counter 70 and to a data latch 71 which finally feeds to a digital readout 72 . the up / down counter 70 merely counts the signal received from the up / down counter control logic 69 in the number and direction designated by such logic . the data latch 71 brings the process to a halt after the signal in the desired zone has been completed . the digital signal received from the total count from up / down counter 70 and is converted into a digital reading thus corresponding to a digital representation of quantity of metal or other ion detection and measurement . in practice , this readout is set to present digitally a direct reading of micrograms of lead per 100 cc of blood sample . the digital readout 72 can , accordingly , be set to translate a signal to correspond to any desired digital measure . in fig5 is shown the panel of apparatus which may operate in accordance with the diagram of feg . 4 . the upper part of the panel is normally visible ; the lower portion may be covered after the appropriate settings and calibration are made . a digital display 80 reads out and displays the digital record of a test while a meter 81 may indicate the current flow or voltage during a run . an indicator lamp panel has lights for &# 34 ; ready &# 34 ; 83 , &# 34 ; plate &# 34 ; 84 and &# 34 ; strip &# 34 ; 85 indicating the phase of the operation . a push button 86 labelled &# 34 ; cancel analysis &# 34 ; operates to interupt and return the analysis to zero . at the upper right hand corner a push button 87 labelled &# 34 ; start analysis &# 34 ; is adopted to start timer 50 , and pushing this button is the only act required of the operator once the sample is in place . a motor light 88 indicates when motor 52 is operating . adapted for preliminary set up and calibration is a lower panel . a potentometer 90 is adjustable , being adapted to control the digital readout 72 of fig4 desirably so that the readout is directly in the correct digital units . when blood is tested for lead , this readout is set against a known standard sample so that the readout is the number of micrograms of lead per 100 milliliters of blood . a rotary switch 91 selects a desired scale expansion if needed , and a blank correction potentiometer 92 is adjustable to set a desired zero point . in the lower left corner of the panel is a run indicator 93 , with screw potentometers 94 , 95 , 96 , 97 and 98 for indicated settings for initial potential , sweep rate , recorder set point and recorder integration . finally , in the lower right is a slope correction setting 99 , a rotary switch 100 selecting one of several automatic time controls for timer 50 ( or selecting a manual control ) and a &# 34 ; function test &# 34 ; switch 101 for selecting a dummy cell or analysis cell for calibration or other purposes . the panel of fig5 serves the purpose that in part illustrates the instrument and in part illustrates the ease of operation . a skilled operator can first set and calibrate the instrument for a specific test condition , after which an operator who may be unskilled measures a predetermined quantity of sample into a prepackaged sample holder , places the sample holder on the machine , pushes the &# 34 ; start analysis &# 34 ; button 87 and a minute later reads the result in digital display 80 . the apparatus discussed , herein in accordance with the present invention is intended to be employed for detection and measurement of trace quantities of certain heavy metals including zinc , cadmium , lead , copper , busmuth , silver , gold and thallium . analysis can be made of nanogram quantities of these trace metals in periods of time of a few seconds up to one or occasionally several minutes . in particular , it is possible to detect and measure quantities of certain of these trace elements in the human blood stream . one of the very important social purpose of this invention is the detection and measurement of small quantities of lead in the human blood stream and in particular , in the blood stream of children residing in city slum areas . for such lead detection and measurement , the desired sample holder is a test tube shaped plastic or glass vessel made of lead - free glass or lead - free plastic or other convenient container . desirably , the sample holder is preconditioned by electro - chemical treatment to electrolyze out of the glass any trace quantities of lead which may originally have been present . a reagent solution is prepared in advance containing a dissolved chromium or calcium ionic material cr + 3 or ca + 2 . a measured sample of blood is taken from a human blood stream . a small quantity of the chromium or calcium reagent is added , and as presently preferred , a mixed calcium - chromium reagent is employed . the precise amounts and concentrations can be adjusted for convenience , provided a standard procedure is adopted and suitable calibration made . it has been found satisfactory to employ crcl 3 prepared with 0 . 03 to 0 . 04 molar cr + 3 in 0 . 001 to 0 . 02 molar hcl ; this chromium ion solution may be employed in the amount of 3 . 6 cc to exchange the lead in 100 microliters of blood sample . in one embodiment there is used a dilute solution of calcium chloride , chromium trichloride , hydrogen ion , perchlorate ion and a dispersing agent ( surfynol 104 is the agent currently employed , and is believed to be a non - ionic higher alcohol wetting agent ). one formula which has been used with biological samples such as blood , foods , is : ______________________________________cacl . sub . 2 0 . 08fcrcl . sub . 3 0 . 04fhgcl . sub . 2 0 . 000225fh . sub . 2 nnh . sub . 2 --( hcl ). sub . 2 ( hydrazine ) 0 . 019fsurfynol 104 0 . 001 weight percentclo . sub . 4 -- 0 . 0458fh + 0 . 0398 ( to bring to ph 1 . 4 ) ______________________________________ another formula which is now presently preferred is different in some details of composition and is now thought to be more reliable for use with fresh human blood samples , and comprises : ______________________________________calcium acetate 0 . 08fcrcl . sub . 3 0 . 04fhgcl . sub . 2 0 . 000225fh . sub . 2 nnh . sub . 2 --( hcl ). sub . 2 ( hydrazine ) 0 . 019fsurfynol 104 0 . 001 weight percenth . sub . 3 po . sub . 4 0 . 01fh + to bring to ph 1 . 0______________________________________ the mixture of calcium ion and / or chromium ion cause release of complexed lead in the blood so that the total concentration of lead in blood can be effectively measured when one of the reagents just described is employed in the equipment and method of the invention . heavy metals which are complexed or bound in other sample materials can also be released . for example , a mix of 0 . 01 molar bromide ions ; 0 . 1 molar nacl ; 0 . 01 molar hno 3 ; and 0 . 01 % triton x - 100 ( a polyalcohol ) is suitable for releasing lead in gasoline . the same and other releasing components can be used to release the various heavy metals from a wide variety of organic samples . what is used is a metal ion or mixture of metal ions which will displace the test metal and which will not plate out or strip out at the plating or stripping potentials used in detection and measurement of the metal being tested . after the test material is treated with a release agent , or after other sample preparation as may be necessary such as digestion , or other treatment and dilution or concentration as needed , the sample in the sample holer is placed in position on the apparatus and the apparatus is turned on . the chromic ion in the solution acts to displace lead from any complexes which it may have formed with components of the blood sample , and the chromium does not plate out at the operating potentials used for lead analysis . within a 60 second operating time , the apparatus will cause any lead to be largely deposited on or in the mercury electrode coating and thereafter anodically stripped from the electrode with both identification and quantitative measurement . an important value of the invention is that the detection and measurement can be carried out in a time of mo more than a minute or two after extraction of the blood sample from the blood stream so that the person himself can be advised as to the test results without being required to return on a subsequent occasion or even being required to wait for a significant period of time for such test results . a presently preferred sample holder is a self - contained unit which is factory preconditioned . it comprises a plastic sample holder cylindrical in shape having a volume of 5 cc . and containing 3 . 6 millimeters of a liquid sample which contains chromic ion , mercury , hydrogen and hydrochloric acid . it is sterilized , purified to remove lead , or to remove other metallic ion being tested and measured and sealed .	6
as mentioned above , a rope cleat can be used to facilitate the securing of a rope to or around an object . one type of cleat , the double horned cleat , can often be found on boat docks . in many cases , the cleat is bolted or screwed to a wooden dock and made available to docking boats . in such a circumstance , the docking boat may have a rope tied to some portion of the boat . the end of the rope that is not tied to the boat may be used to tether the boat to the dock by wrapping the rope around the double horned cleat . as shown in fig3 a and 3b , there can be significant differences in the type of knot used to tie off to the cleat . fig3 a illustrates a traditional double horned cleat with a rope secured using a cleat hitch knot . the knot depicted in fig3 a is an effective knot and should keep a tethered boat securely connected to the dock . fig3 b illustrates a traditional double horned cleat with a rope secured using an arbitrary knot that will not remain secure . many boaters lack the knot tying expertise necessary to safely secure a boat to an available double horned cleat . the cleating systems depicted in fig1 and 2 , in addition to other potential benefits , could help these boaters to safely secure their boats to available docks . as mentioned above , fig1 illustrates an exploded view of a rope cleating system 100 that incorporates teachings of the present disclosure for improved performance . as shown , system 100 includes a cleating sleeve 102 , an anchoring sleeve 104 , and a floating shell 106 . though system 100 is depicted in an exploded manner , one skilled in the art will recognize how system 100 may be connected into a unit . moreover , one skilled in the art will recognize that the three - piece system could also be manufactured as a one - piece or a two - piece system . similarly , a designer may elect to utilize a system with more than three pieces . as shown , cleating sleeve 102 defines a generally elliptical opening 108 through which a rope may be doubled back upon itself . cleating sleeve 102 also includes a member 109 and an end cap 110 that defines a shoulder 112 that may serve to help keep floating shell 106 in position when cleating sleeve 102 and anchoring sleeve 104 are connected . cleating sleeve also includes a cleat opening 114 that defines three cleating locations indicated generally at 116 . in practice , a rope may pass through elliptical opening 108 ( along the bottom of the opening ), around anchoring sleeve 104 ( as defined more fully below ) and back through elliptical opening 108 ( this time above the earlier passed rope ). the tag end of the rope routed in such a way may then be pulled into cleat opening 114 and removably locked in place . cleating sleeve 102 also includes locking port 116 , which may interact with locking node 118 to help secure cleating sleeve 102 to anchoring sleeve 104 . in some instances , locking port 116 and locking node 118 may releasably connect sleeves 102 and 104 . for example , a designer may offer system 100 as a kit with more than one anchoring sleeves like sleeve 104 . each of the sleeves included in such a kit may be sized for use with different diameters of rope . if a boater is using ⅜ inch rope , the boater may use an anchoring sleeve designed for ⅜ to ½ inch rope ( for example ). if the boater is using ⅝ inch rope , the boater may upsize to an anchoring sleeve designed for ropes larger than ½ inch . as shown , anchoring sleeve 104 includes a dual port system 120 , which may allow for a separation of the rope as it passes into and out of anchoring sleeve 104 . dual port system 120 ( as depicted ) extends through member 121 and includes deflection slits 122 , which facilitate the sliding of anchoring sleeve 104 or at least a portion of sleeve 104 into cleating sleeve 102 . in addition , deflection slits 122 may create a spring force that helps lock depicted locking node 118 into locking port 116 . anchoring sleeve 104 may also include an end cap 124 that acts in a manner similar to end cap 110 . as shown , dual port system 120 may include two holes that remain independent from one another and are formed all the way through anchoring sleeve 104 . such a design may keep a rope passed through the bottom hole and then routed back through the top hole from being “ pulled through ” and accidently removed from system 100 . as shown , the holes of anchoring sleeve 104 may be specifically designed for a given diameter of rope . the holes may also be designed with some “ slop ” to allow for some flexibility in the diameter of rope used . for example , the holes may allow for the sliding through of a rope having a ⅜ inch diameter , a ½ inch diameter , or both . system 100 , as depicted , also includes floating shell 106 , which surrounds cleating sleeve 102 and anchoring sleeve 104 when system 100 is snapped together . though floating shell 106 , as depicted , is intended to provide buoyancy and to help system 100 float when in use , a given designer may choose to create floating shell 106 from a material that does not float . as shown , floating shell 106 is intended to float and to provide some give or impact resistance . as such , floating shell 106 may be formed from several different materials . for example , floating shell 106 may be formed from neoprene , sponge , foam , rubber , plastic , some other lightweight material , and / or a combination of materials . similarly , cleating sleeve 102 and anchoring sleeve 104 may be formed from the same or different materials . in one example version of system 100 , cleating sleeve 102 and anchoring sleeve 104 may be formed from an extruded plastic material while floating shell 106 may be formed from a scuba foam , a fabric , a foam , a neoprene , or other high buoyancy material that facilitates screen printing on its exterior surface . as depicted , floating shell 106 is sized to fit snugly around cleating sleeve 102 and anchoring sleeve 104 and to be held in place by end caps 110 and 124 when cleating sleeve 102 and anchoring sleeve 104 are connected to one another . in addition , floating shell 106 includes cut out 126 , which may help a user to pull the tag end of a rope into cleat opening 114 without undue interference from floating shell 106 . as shown , the generally elliptical cross section of cleating sleeve 102 , anchoring sleeve 104 , and the hole 128 formed through floating shell 106 may help to keep cut out 126 in position relative to cleat opening 114 . in addition , a designer may elect to include a printable location 130 on shell 106 to facilitate the inclusion of marketing , branding , and / or contact information , some or all of which may be printed and / or reproduced on shell 106 . as indicated above , system 100 incorporates teachings of the present disclosure and represents one way a designer may choose to implement some teachings . many things could be altered if a designer so chooses without departing from the present teachings . as mentioned above , the number of component parts within system 100 may be changed . similarly , different materials may be chosen . components of a system like system 100 may include , for example , one or more of a plastic material , a rubber material , a spandex material , a leather material , a neoprene material , a metal material , a wooden material , a woven material , and / or some other material that is suitable for performing the objectives of system 100 . as indicated above , fig2 depicts a photographic style image of a rope cleating solution 200 that incorporates teachings of the present disclosure . as shown , a system 202 , which may be like system 100 , is shown in an assembled state . in addition , a rope 204 is shown as passing through system 202 around double homed cleat 206 and back through system 202 . rope 204 , as depicted , has been seated into a cleating mechanism 208 , which may be similar to cleat opening 114 . the tag end 210 of rope 204 is shown as resting on a wooden dock 212 to which double homed cleat 206 is attached . system 202 also depicts an outer shell 214 , which may be similar to floating shell 106 . as shown , outer shell 214 presents a printable surface 216 onto which the words “ searay ” and “ www . searay . com ” are printed . the printing technique may include , for example , silk screen printing , embossing , branding , labeling , stamping , embroidering , etc ., and / or some combination of these or other techniques . as shown , printable surface 216 may made from a material and offered in a size and shape that facilitates the inclusion of branding , marketing , and / or contact information , among other things . in one offering , a system , like system 202 , may work with various standard rope diameters , may be made of some combination of soft , durable , and / or floating materials , and may provide a surface to add marketing and contact information . such a system may , for example , help boaters who tie knots like the one depicted in fig3 b to safely and securely tether their boats to docks with double horned cleats . a system incorporating teachings of the present disclosure may replace , add , or delete many of the above - described features and components without departing from the scope of the disclosure . one skilled in the art will recognize that the many of the above - described components could be combined or broken out into other combinations . although the present invention has been described in detail , it should be understood that various changes , substitutions and alterations to the devices , methods , and other aspects and techniques of the present invention can be made without departing from the spirit and scope of the invention as defined by the appended claims . while the present invention has been described with respect to a limited number of embodiments , those skilled in the art will appreciate numerous modifications and variations therefrom . it is intended that the appended claims cover all such modifications and variations as fall within the true spirit and scope of this present invention .	1
illustrated in fig1 is a perspective view of the basic layout of the parts that make up the engine . the present invention comprises a closed loop steam engine that is made up of the following parts . a boiler / steam generator 10 to create steam , a steam injector 11 that uses the steam from the boiler to propel a flow of water that then drives a turbine 12 . a heat exchanger 13 that receives the warm water that exits the turbine in order to extract the excess heat and then feed it back into the water inlet of the steam injector . part of the water flow is diverted from the steam injector outlet or the turbine outlet or the heat exchanger outlet to feed back into the steam boiler . the heat exchanger can be of any type that exchanges heat with a liquid , for instance liquid / gas or liquid / liquid heat exchangers such as convectors or plate heat exchangers . there can be a pump 14 and / or a control valve attached to assist the flow into the boiler if necessary . this pump can be separate or connected directly to the turbine shaft in order to minimize the number of moving parts or even another steam injector . fig2 shows a cross section of the steam injector and the pipe 16 transporting the feed water back to the boiler . the feed - water pipe can be joined to a hole in the pipe coming out of the injector or as shown in fig2 suspended in the water flow so as to have part of the water forced into it . the flow rate is dependent upon the cross section of the pipe as well as the current pressure and velocity of the water . if the pressure after the injector is lower than the back pressure of the boiler , the pressure can be further enhanced by means of a venturi diffuser 15 . if the engine is only used in a steady state application ( one operating point ), the system can be designed to run without a pump 14 , although start - up may be difficult . the turbine ideally should be enclosed with no voids or pockets of air or other gasses , so that no momentum is lost . ideally this would be a francis , kaplan , tesla or even a simple fixed propeller turbine . research has shown , that the efficiency of a steam injector increases as the difference in velocity of the steam and water decreases . thus it is important to maximize the speed of the water entering the steam injector . in order to do this it is either necessary to not extract all the momentum from the water when flowing through the turbine , or to create a bypass 17 for part of the water coming out of the steam injector to be re - injected into the water of the inlet of said steam injector . a regulator valve can be added for more precise control over the amount of feedback of the bypass . also additional cooling via a second heat exchanger can be provided for this bypass or the bypass can lead to the inlet of the main heat exchanger instead of the steam injector . fig3 . shows where the bypass 17 would be placed . the bypass can be connected in the same way the feed - water pipe is shown to be connected in fig2 or simply connected to a hole in the pipe coming from the injector . the boiler 10 can be of any type , however a water - tube boiler of compact design that can safely deliver high temperature superheated steam is preferred . as the water is in a closed system there should be no problems with scale and other impurities . the connections between the individual parts of the engine as well as the bypasses can be made with hoses , pipes , carved pathways or any other conceivable way to keep water enclosed and flowing from one part to the next . the engine can use not just water but also any other suitable liquid , the proper vapor thereof being used to drive the injector , the injector then being a gas - into - liquid injector compatible with that fluid . in cold climates for instance it is a good idea to use a water / ethanol mix as the working fluid in order to guard against freezing . in the preferred embodiment of the invention the steam boiler is of the monotube design , more specifically a flash boiler . this is mainly for safety reasons , as a monotube / flash boiler , even if failure should occur will not create a deadly explosion . the turbine is a tesla turbine , as these are very easy and cheap to manufacture , tolerate accidentally non condensed steam quite well and have low maintenance requirements . there is a bypass from the outlet of the steam injector through a low friction heat exchanger to cool the water and then leading back into the inlet of said steam injector . a valve regulates the amount of water in the bypass so as to keep the velocity of the water going into the steam injector in the optimal range . the main heat exchanger is a liquid / liquid heat exchanger that uses the waste heat in a combined heat and power application . the water is injected back into the steam boiler via a pipe / connection that diverts part of the flow of water from the steam injector outlet . this is assisted by an electrical pump to ensure reliable start up . the pump only assists when not enough pressure is available from the steam injector flow . a valve regulates the amount of admitted water into the boiler according to the water level in the coils .	5
this invention comprises of a hydraulically activated swivel 100 useful in a running assembly to expand an expandable liner downhole . generally , the expandable liner is a tubular or tailpipe that is anchored or suspended at the bottom of the previous tubular string . typically , the expandable liner is anchored or suspended by expanding an upper portion of the expandable liner into frictional contact with a lower portion of the tubular string . the expandable liner may be constructed and arranged to apply to various downhole applications . in one application , the expandable liner may be constructed to include an integral packer arrangement to seal and hang the expandable liner from the previous tubular string . in the integral packing arrangement , the body of the expandable liner is modified by machining grooves into the surface . thereafter , the grooves are typically filled with a pliable material , such as an elastomer , forming a packer , thereby increasing the sealing capability of the expandable liner to the previous tubular string . the integral packer arrangement also includes hardened inserts disposed between the grooves , such as carbide buttons , for gripping the surrounding tubular string upon contact . the gripping mechanism increases the capacity of the expandable liner to support its weight and to serve as a hanger . the expandable liner may also include a non - integral packer arrangement where the packer and the hanger are formed on different portions of expandable liner . additional applications for expandable liners include the use of an expandable sand screen , employment of an expandable seat for seating a diverter tool , and the use of an expandable seat for setting a packer . therefore , the invention is not limited to expanding a tubular string , but is equally applicable to various downhole applications . thus , throughout this disclosure , the term “ liner ” shall refer to various downhole applications . [ 0025 ] fig1 a and 1b illustrate a cross - sectional view of one embodiment of the hydraulically activated swivel 100 in accordance with the present invention . the swivel 100 is generally disposed between an expander tool 90 and a running tool 80 . the swivel 100 may be attached to the expander tool 90 using a top connection 105 , while a bottom connection 260 may be used to connect running tool 80 to a lower end of the swivel 100 . as illustrated , fig1 a and 1b show the swivel 100 in the run - in position . in this position , the swivel 100 acts a one complete unit . in other words , the expander tool 90 , the swivel 100 and the running tool 80 are rotationally locked with respect to one another , thereby allowing the rotation of the liner ( not shown ) by the drill string ( not shown ). as shown in fig1 a , an upper mandrel 110 of the swivel 100 is connected to the top connection 105 using a thread , and is torsionally locked by at least one upper torque pin 115 . the upper mandrel 110 is tubular body that contains an upper mandrel passageway 112 to direct fluid through the swivel 100 . an upper spline assembly 120 connects the upper mandrel 110 to a housing 125 . as used herein , a spline assembly means a mechanical torque connection between a first and second member . typically , the first member includes a plurality of keys and the second member includes a plurality of keyways . when rotational torque is applied to the first member , the keys act on the keyways to transmit the torque to the second member . additionally , the spline assembly may be disengaged by axial movement of one member relative to the other member , thereby permitting rotational freedom of each member . in this respect , a rotational force applied to the upper mandrel 110 will be transmitted through the engaged upper spline assembly 120 , thereby causing the housing 125 to rotate . in the embodiment shown on fig1 a , biasing members 130 are disposed at the lower end of the upper mandrel 110 to function as a shock absorber between the upper mandrel 110 and a lower mandrel 135 . during operation of the swivel 100 , the biasing members 130 permit the upper mandrel 110 to axially move a predetermined distance . the predetermined distance is illustrated on fig1 a as gap 134 . in the preferred embodiment , the biasing members 130 are bellville washers . however , other forms of biasing members 130 may be employed such as elasterometric material , springs or combinations thereof , so long as they permit substantial axial movement of the upper mandrel 110 . as illustrated in fig1 a and 1b , the lower mandrel 135 is tubular body having a lower mandrel passageway 132 through the center of the mandrel 135 . in this respect , the lower mandrel passageway 132 is fluidly connected to the upper mandrel passageway 112 , thereby forming a fluid conduit through the length of this swivel 100 . the lower mandrel 135 further includes an aperture 205 in a wall thereof in fluid communication with the lower mandrel passageway 132 . load members 140 are disposed between the lower mandrel 135 and the housing 125 . the load members 140 permit rotational movement of the housing 125 relative to the lower mandrel 135 . additionally , the load members 140 are capable of supporting the entire weight of the liner during the expansion operation by the expander tool 90 . in the preferred embodiment , the load members 140 are a plurality of stacked thrust bearings 215 . however , other forms of load members 140 may be employed , so long as they are capable of supporting the weight of the liner and allow rotational movement between the housing 125 and the lower mandrel 135 . each thrust bearing 145 comprises at least one wire carrier 165 , a lower member 160 , a ball 155 , an upper member 150 and a shoulder member 145 . the wire carrier 165 connects the housing 125 to the lower member 160 . the lower member 160 is rotationally connected to the upper member 150 through the ball 155 . the upper member 150 is connected to the lower mandrel 135 through the shoulder member 145 . in this manner , the housing 125 is rotationally connected to the lower mandrel 135 . [ 0030 ] fig1 b shows a seal spacer 170 and a seal adapter 185 disposed at the lower end of the load members 140 . the upper end of the seal adapter 185 is secured to the housing 125 by a locking pin 175 while the lower end is supported by a lockring 195 disposed around the lower mandrel 135 . further , a first seal member 270 , such as an o - ring , is disposed at the lower end of the seal adapter 185 , thereby allowing the seal adapter 185 to provide a sealing means between the lower mandrel 135 and the shiftable sleeve 225 . [ 0031 ] fig1 b further depicts a shiftable sleeve 225 in a first position . the sleeve 225 is movable between the first and a second position using hydraulic force . as illustrated , the sleeve 225 is partially disposed between the housing 125 , the lower mandrel 135 and the bottom connection 260 . at least one shearable connection 180 connects the sleeve 225 to the housing 125 . in one embodiment , the shearable connection 180 is a shear pin . however , other forms of shearable connections may be employed , so long as they are capable of failing at a predetermined force , thereby allowing the sleeve 225 to move axially downward relative to the housing 125 . in addition to the shearable connection 180 , a middle spline assembly 190 also mechanically connects the sleeve 225 to the housing 125 . in fig1 b , the middle spline assembly 190 is fully engaged , thereby capable of transmitting the full rotational force from the housing 125 to the sleeve 225 . further , a first sleeve shoulder 275 is formed on the inner portion of the sleeve 225 . the first sleeve shoulder 275 is located near the aperture 205 in the lower mandrel 135 and later provides a hydraulic area to shift the sleeve 225 axially downward . a second sleeve shoulder 220 is also formed at the lower portion of the sleeve 225 . the second sleeve shoulder 220 is used as a stop to limit the downward axial movement of the sleeve 225 . a second sealing member 210 , such as an o - ring , is disposed between the sleeve 225 and the lower mandrel 135 . in this respect , both the first and second sealing members 210 , 270 act as a fluid tight seal as the sleeve 225 is hydraulically urged downward . as further shown on fig1 b , the lower end of the sleeve 225 is mechanically connected to the bottom connection 260 by a lower spline assembly 240 . while the sleeve 225 is in the first position , the lower spline assembly 240 is capable of transmitting the rotational force from the sleeve 225 to the bottom connection 260 . below the lower spline assembly 240 , a spline assembly relief 245 is formed to house a portion of the lower spline assembly 240 after the sleeve 225 has shifted to the second position . also illustrated in fig1 b , a spring clip 265 is disposed on the outer portion of the sleeve 225 . the spring clip 265 is used to mate with at least one relief groove 250 formed on an outer portion of the bottom connection 260 after the sleeve 225 is moved to the second position . [ 0033 ] fig1 b further depicts the bottom connection 260 at the lower end of the swivel 100 . the primary function of the bottom connection 260 is to act as a connection means between the swivel 100 and the running tool 80 . the bottom connection 260 is secured to the lower mandrel 135 by a thread , and is torsionally locked by at least one lower torque pin 255 . an upper portion of the bottom connection 260 is partially disposed between the sleeve 225 and the lower mandrel 135 . as shown , a plurality of washers 280 are disposed on an upper end of the bottom connection 260 to reduce friction between the bottom connection 260 and the sleeve 225 after the sleeve 225 is moved to the second position . [ 0034 ] fig1 a and 1b illustrate the swivel 100 in the run - in position . in this position , the swivel 100 acts as one complete unit . in other words , the expander tool 90 , the swivel 100 and the running tool 80 are rotationally locked with respect to one another , thereby allowing the rotation of the liner by the drill string . in this respect , a rotational force applied from the drill string to the expander tool 90 may be transmitted to the top connection 105 . in turn , the top connection 105 transmits the rotational force through the upper torque pin 115 to the upper mandrel 110 . the upper mandrel 110 transmits the rotational force through the upper spline assembly 120 to the housing 125 . the housing 125 transmits the rotational force through the middle spline assembly 190 to the sleeve 225 . the sleeve 225 transmits the rotational force through the lower spline assembly 240 to the bottom connection 260 . the bottom connection 260 transmits the rotational force to the running tool 80 that is holding the liner . in this manner , the swivel 100 acts as a conduit for rotational force from the drill string to the liner . [ 0035 ] fig2 a and 2b are a cross - sectional view of the swivel 100 after the sleeve 225 is shifted axially to the second position . the axial movement of the sleeve 225 may be accomplished using a hydraulic isolation device ( not shown ), such as a ball or a dart , that is circulated down into a seat ( not shown ) below the running tool 80 . dropping the ball onto the seat allows fluid pressure to build up in the running tool 80 and the lower mandrel passageway 132 until the fluid level reaches aperture 205 . at that point , pressurized fluid enters aperture 205 creating hydraulic force that acts against the first sleeve shoulder 275 of the sleeve 225 . at a predetermined hydraulic force , the shearable connection 180 fails and the sleeve 225 is urged axially downward toward the second position . the sleeve 225 reaches the second position when the second sleeve shoulder 220 contacts the plurality of washers 280 disposed on the bottom connection 260 . the movement of the sleeve 225 from the first to the second position also disengages the spline assembly 245 , thereby removing the mechanical connection between the sleeve 225 and the bottom connection 260 . thereafter , the upper portion that includes connection 105 , upper mandrel 110 , housing 125 , and sleeve 225 , is rotationally separate from the lower portion that includes mandrel 135 and connection 260 . in other words , the swivel 100 is capable of exclusively rotating the upper portion in a first direction while allowing the bottom portion to remain stationary . on the other hand , the swivel 100 may rotate as a rotationally locked unit in a second direction . the movement of the sleeve 225 to the second position aligns the spring clip 265 on the sleeve 225 with the relief groove 250 formed on an outer portion of the bottom connection 260 . the spring clip 265 is constructed and arranged to mate with the relief groove 250 when the upper portion of the swivel 100 rotates in the second direction . in this respect , the spring clip 265 acts upon the relief groove 250 causing the lower portion to rotate with the upper portion of the swivel 100 . conversely , the spring clip 265 will not mate with the relief groove 250 when the upper portion of the swivel 100 rotates in the first direction , thereby allowing the upper portion to rotate freely in respect to the lower portion . in this manner , the spring clip 265 and the relief groove 250 act as a clutch system allowing the rotation of the upper and lower portion as a rotationally locked unit in the second direction while permitting the upper portion to rotate free of the lower portion in the first direction . [ 0037 ] fig3 is an enlarged cross - sectional view of the swivel 100 as illustrated in fig2 b . in this view , the sleeve 225 is in the second position in contact with the plurality of washers 280 . further , the middle spline assembly 190 is partially engaged , thereby permitting transfer of rotational force between the housing 125 and the sleeve 225 . however , the lower spline assembly 240 is completely disengaged . the portion of the spline assembly 240 attached to the bottom connection 260 did not move while the portion of spline assembly 240 attached to the sleeve 225 moved axially downward into the spline assembly relief 245 . therefore , the lower portion of the swivel 100 is no longer mechanically connected to the upper portion through the spline assembly 240 . as further illustrated , the spring clip 265 is in line with the clip groove 250 . while the swivel 100 in the preferred embodiment uses the sleeve 225 and spline assemblies 120 , 190 , 240 to connect the upper and lower mandrel 110 , 135 , it would be understood by one skilled in the art that a variety of different methods may be employed , which allow the swivel 100 to function in the manner described in previous paragraphs . [ 0038 ] fig4 a and 4b are a cross - sectional view illustrating the hydraulically activated swivel 100 in compression . the swivel 100 may need to compress during the expansion operation of the liner to permit the running tool 80 to operate properly . this present invention includes a function that allows the swivel 100 to compress a predetermined distance , thereby protecting components in the running tool 80 from impact loading during operation . in other words , the lower mandrel 135 and the bottom connection 260 move axially upward closing off the gap 134 , thereby compressing the biasing members 130 between the lower mandrel 135 and the upper mandrel 110 . in this manner , the swivel 100 permits the running tool 80 to function properly . in operation , the liner ( not shown ), expander tool 90 , swivel 100 and the running tool 80 are run - in the wellbore on a drill string ( not shown ). the swivel 100 is in the run - in position as illustrated in fig1 a and 1b . if any obstruction is encountered during the run - in operation , the liner is “ drilled ” into the wellbore by applying a rotational force from the drill string to the liner through the expander tool 90 , swivel 100 and running tool 80 . in this respect , the swivel 100 acts as a complete unit as discussed in fig1 a and 1b . the liner is run - in to a predetermined point near the end of an existing casing string ( not shown ). subsequently , fluid is pumped from the surface of the wellbore down the drill string through the expander tool 90 and the upper and lower mandrel passageways 112 , 132 to the running tool 80 . thereafter , a hydraulic isolation device ( not shown ) is circulated down into a seat ( not shown ) below the running tool 80 . the fluid pressure builds up in the running tool 80 and the lower mandrel passageway 132 until the fluid level reaches aperture 205 . as pressurized fluid enters aperture 205 , a hydraulic force is created acting against the first sleeve shoulder 275 on the sleeve 225 . at a predetermined hydraulic force , the shearable connection 180 fails and the sleeve 225 is urged axially downward toward the second position , thereby contacting the plurality of washers 280 disposed on the bottom connection 260 . the movement of the sleeve 225 from the first to the second position disengages spline assembly 240 , thereby removing the mechanical connection between the sleeve 225 and the bottom connection 260 . thereafter , the upper portion that includes connection 105 , upper mandrel 110 , housing 125 , and sleeve 225 is rotationally separate from the lower portion that includes mandrel 135 and connection 260 . in other words , the swivel 100 is capable of exclusively rotating the upper portion in a first direction while allowing the bottom portion to remain stationary . subsequently , the expander tool 90 is activated and the expansion operation begins . a rotational force by the drill string in the first direction causes the expander tool 90 and the upper portion of the swivel 100 to rotate while the lower portion and the running tool 80 remain stationary . during the expansion operation , the load members 140 carry the entire weight of the liner and permit a rotational connection between the housing 125 and the lower mandrel 135 . additionally , the movement of the sleeve 225 to the second position aligns the spring clip 265 on the sleeve 225 with the relief groove 250 formed on an outer portion of the bottom connection 260 . the spring clip 265 is constructed and arranged to mate and act upon the relief groove 250 when the upper portion of the swivel 100 rotates in the second direction but not in the first direction . in this manner , the spring clip 265 and the relief groove 250 act - as a clutch system allowing the rotation of the upper and lower portion as a rotationally locked unit in the second direction while permitting the upper portion to rotate free of the lower portion in the first direction . after the expansion operation is complete , the running tool 80 is deactivated , thereby allowing the liner to hang exclusively from the casing string . the running tool 80 is released from the liner through hydraulic means . in the event of a hydraulic failure , the running tool 80 may be released by mechanical means by rotating the swivel 100 in the second direction . in this respect , a rotational force from the drill string is transmitted in the second direction through the expander tool 90 to the top connection 105 of the swivel 100 . the top connection 105 transmits the rotational force through the upper torque pin 115 to the upper mandrel 110 . the upper mandrel 110 transmits the rotational force through the upper spline assembly 120 to the housing 125 . the housing 125 transmits the rotational force through the middle spline assembly 190 to the sleeve 225 . the sleeve 225 transmits the rotational force to the bottom connection 260 by allowing the spring clip 265 to contact and act against the clip groove 250 , thereby causing the bottom connection 260 to rotate in the second direction . the bottom connection 260 transmits the rotational force in the second direction to the running tool 80 , thereby releasing the running tool from the liner . while the foregoing is directed to embodiments of the present invention , other and further embodiments of the invention may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims that follow .	4
fig1 is a high level block diagram illustrating the components of an exemplary system 10 for providing prepaid account replenishment . system 101 provides the replenishment capability by serving as an interface between with bank 102 and prepaid engine 103 . it will be understood that in the present invention the term “ bank ” can mean a banking institution or any system that supports a point of sale network . for example , bank 102 is not necessarily a true bank , but it 102 can be credit card transaction processor . bank 102 maintains a number of accounts for handling the funds involved in the replenishment transactions . a number of geographically diverse terminals , such as pos 104 and atm 105 , provide consumers and prepaid account users with locations for completing prepaid account replenishment transactions . point of sale ( pos ) terminal 104 and automated teller machine ( atm ) 105 are linked to bank 102 and exchange financial transaction data with bank 102 . in other embodiments , users can perform replenishment transactions via internet 106 and personal computer ( pc ) 107 or via the user &# 39 ; s mobile phone 108 . replenishment system 101 may be coupled to database 109 , which is used to store information about users , banks , points of sale , prepaid accounts and the like . prepaid engine 103 , which is known in the art and will not be described in detail herein , monitors and verifies current prepaid account balances . wireless service providers are in communication with prepaid engine 103 to ensure that users have sufficient funds to pay for calls . wireless telephone 108 is in communication with a wireless network . for example , wireless device 108 communicates with wireless network 110 via mobile switching center ( msc ) 111 . users may also communicate via a wireline network , such as network 112 , using wireline telephone 113 . other well known wireless or wireline infrastructure and equipment , such as base stations , switching offices and signaling nodes , are not shown in fig1 to simplify the diagram . in one exemplary embodiment , a consumer will desire to use a prepaid account to pay for wireless telephone service . in this example , the user will be issued a permanent account card , similar to a credit card , which uniquely identifies the user &# 39 ; s prepaid account . the user may receive the account card upon purchasing a wireless telephone . alternatively , the user may already have a wireless telephone and therefore be or she only needs to receive an account card to use the prepaid service . in either case , the user is issued the permanent account card and the card is activated for use . as part of the activation process the card is uniquely associated with the consumer &# 39 ; s wireless telephone or telephones . more than one card may be associated with a particular wireless telephone . the permanent account card has no value in and of itself and serves only as a means of transmitting a prepaid account number to facilitate replenishment transactions . however , the account card is associated with a prepaid account at replenishment system 103 , wireless device 108 is also associated with the prepaid account at prepaid engine 103 and with prepaid account number in replenishment system 103 during the account card activation process . upon activation of the permanent account card , an initial sum of money is deposited into the prepaid account . the user is then able to make and receive calls via wireless telephone 108 . the cost of calls to and from wireless telephone 108 are charged to the prepaid account at a previously agreed to rate . systems and methods for completing wireless or wireline telephone calls using a prepaid account are known in the telecommunications industry and , therefore , will not be further discussed herein . as the user makes and receives calls via prepaid wireless telephone 108 , the prepaid account balance is reduced and eventually the user will have to make a deposit to the depleted account in order to make additional tails . the permanent account card preferably has an account number that indicates an issuing bank or other institution operating the replenishment system 101 , and the specific prepaid account . in addition , the card may comprise other features that facilitate replenishment transactions , such as a magnetic stripe that duplicates the account number and that can be read by swiping the card through a card reader . the account card may also comprise a universal product code ( upc ) or machine readable bar code that identifies the card as a prepaid account card . as discussed above , the account card may be issued with a new wireless telephone or the account card may be issued separately . the account card can be activated by the user in person at a retail location when the user receives the card or the user may activate the card by calling a customer service representative ( csr ) or an interactive voice response ( ivr ) system . information , such as the wireless telephone number , the mobile identification number ( min ), the wireless carrier identity , the prepaid account card number and the like is provided to replenishment system 101 to activate the card . in the preferred embodiment , the user will be able to replenish the prepaid account at any location that is capable of conducting credit card transactions . the replenishment transaction may be performed by following the steps illustrated in the flowchart of fig2 . in step 201 , the user presents the permanent prepaid account card to a clerk at point of sale location 104 . the user also provides cash or the equivalent for the amount of money that is to be added to the prepaid account in step 202 . it will be understood that the user can provide replenishment funds in any form that is acceptable to the retail location , such cash , check , money order , credit card and the like . the clerk rings up the prepaid replenishment transaction or sale in step 203 for the amount of the transaction . to facilitate the transaction , the clerk may scan a upc code on the permanent account card . in step 204 , the clerk swipes the permanent prepaid account card through an authorization terminal in the same manner that a credit card or debit card is swiped in known systems . the authorization terminal is preferably the same terminal that is used for performing credit card and / or debit card transactions . however , the authorization terminal may be a separate device that is specifically used for the prepaid replenishment transactions described herein . the authorization terminal at point of sale location 104 is coupled to bank 102 . in step 205 , transaction information , such as an account number and an amount of funds to be credited to the prepaid account , is sent to bank 102 , which recognizes the transaction as a prepaid account replenishment transaction . bank 102 then confirms the transaction in step 206 by sending a transaction identification number or confirmation number to the user at pos location 104 after bank 102 has received confirmation from the replenishment system 101 . the transaction number will be unique such that it will not be reused for a specified period of time , such as no repeated numbers for 24 months . the transaction number may include checksum digits that can be used to verify the validity of the number . the user may receive a receipt that indicates the transaction amount and the transaction identification number . the transaction identification number can be used later to identify a specific transaction in order to correct any errors that occurred during the transaction , such as a failure to properly credit the designated prepaid account . preferably , once the transaction is complete and the user is issued a transaction number , the user can immediately use wireless telephone 108 to make calls that are charged against the prepaid account . alternatively , there may be a delay before the prepaid engine is updated while bank 102 , replenishment system 101 and prepaid engine 103 process the transaction . the transaction funds remain in pending or revenue accounts at bank 102 and they are not actually transferred to replenishment system 101 or prepaid engine 103 . instead , bank 102 will notify replenishment system 101 that the user has deposited a certain amount of funds that are to be credited to a particular prepaid account for the wireless carrier . replenishment system 101 acts as an interface between bank 102 and prepaid engine 103 . bank 102 formats transactions into separate transaction records and sends them to replenishment system 101 in real time . preferably there is a dedicated link between bank 102 and replenishment system 101 . the transaction records include information such as a transaction number or confirmation number provided to the user , a transaction record identification number , date of purchase , time of purchase , location of purchase , amount of transaction , and the like . each transaction will be processed by replenishment system 101 and the transactions are acknowledged after the information is stored in a non - volatile memory , such as database 109 . replenishment system 101 will authorize prepaid transactions only after verifying certain information in the transaction record . for example , the transaction will be authorized only if the permanent account card number has been activated and only if the location identification is correlated to a list of authorized replenishment locations . replenishment system 101 will also verify that the transaction identification number is not a duplicate of a previously used number . replenishment system 101 sends a transaction message to prepaid engine 103 for each prepaid replenishment transaction . the transaction message includes information such as the transaction identification number , the transaction amount , and the mobile identification number ( min ) or other identification for wireless telephone 108 . the replenishment system 101 supports multiple prepaid engines 103 each of which may be associated with different wireless operators . a replenishment system 101 database will route replenishment transaction information to the correct prepaid engine based on the association established during the activation process . each transaction message that is sent to prepaid engine 103 is logged . preferably , the transaction messages to prepaid engine 103 are sent immediately following the receipt of a corresponding transaction record from bank 102 in order to minimize the time between the prepaid transaction and the availability of funds for prepaid calls . once every day , bank 102 will transfer a reconciliation file to replenishment system 101 . the reconciliation file will comprise the information for every transaction record that was sent in the previous 24 hours . this allows replenishment system 101 to compare the bank &# 39 ; s transaction records with the transaction records that are sent in real - time . any records that do not match between the reconciliation file and the individual transaction records will be logged to an exception file . a replenishment service provider can access the exception file to resolve any unreconciled transactions . after processing the reconciliation file , replenishment system 101 calculates the disbursement of funds and executes an online banking transaction to move funds into the correct accounts . funds deposited by users will be allocated to the replenishment service provider , the wireless carrier , the retailer at point of sale locations , the bank and other entities involved in the replenishment transactions . it is expected that the retailer , the bank and the replenishment service provider would each receive a predetermined percentage of each transaction or a preselected fee for each transaction . the wireless service provider will typically receive the remaining funds , which will be used to pay for prepaid calls . replenishment system 101 will provide other features related to the replenishment transactions , such as the capability to reverse transactions , to correct transactions or to force transactions . under certain conditions bank 102 may desire to cancel or reverse a transaction . in such a situation , bank 102 will send a reversing transaction , which identifies the initial transaction . replenishment system 101 will search for the transaction number of the original transaction and then verify that the account number and transaction amount of the original transaction match the reversing transaction . if the original and reversing transactions match , replenishment system 101 verifies the reverse transaction with bank 102 and sends a reversing entry to prepaid engine 103 . if the original transaction has not yet been sent from replenishing system 101 to prepaid engine 103 , then upon receipt of a reversing transaction replenishment system 101 can delete the original transaction from a queue of messages to be sent to prepaid engine 103 . if the transaction number for an original transaction cannot be matched to the reversing transaction , then replenishment system 101 will assume that the original transaction was not completed and no changes will be made . bank 102 may need to make corrections to the transaction records , for example if a clerk entered the wrong transaction amount . in such situations , bank 102 may manually correct the transaction records by sending a reversing transaction for the original transaction and a new transaction for the correct amount . the reversing transaction and the correction entry shall contain the same transaction identification code . in the preferred embodiment , prepaid replenishment transactions will not be allowed when the link between bank 102 and replenishment system 101 is down . however , in alternative embodiments , bank 102 may accept prepaid transactions even when replenishment system 101 is offline . thereafter , when the link between bank 102 and replenishment system 101 is reestablished , bank 102 will provide transaction records for all transactions made while replenishment system 101 was offline . all connections between bank 102 , replenishment system 101 , and prepaid engine 103 are dual so that no single point of failure exists in the prepaid replenishment system . all transactions between and among bank 102 , replenishment system 101 , and prepaid engine 103 will be acknowledged within a preset time limit . failures during a transaction will be detected when an acknowledgment is not received within the preset time limit . during such as failure , the transmitting device will time out awaiting acknowledgment and either cancel the transaction or resend the information . any resent information , such as a transaction record or message , will include the same transaction identifier as the original information so that duplicates can be identified if both sets of information are received . customer service representatives ( csrs ) for the wireless carrier and / or the replenishment system provider will have access to replenishment system 101 and database 109 to allow verification and correction of individual transactions and customer records . read / write access to individual records and record entries shall be selectable depending upon the querying party &# 39 ; s authorization to access the record . for example , a wireless carrier may be allowed to access transactions involving only their customers regardless of which bank or point of sale is involved in the transactions . csrs shall have the capability to update and correct accounts , including updating or correcting the m n , carrier , or account number . csrs may also search for and correct prepaid transactions . fig3 is a flowchart illustrating one embodiment of the operation of replenishment system 101 . in step 301 , replenishment system 101 receives real time replenishment transaction data from bank 102 . this data is then parsed into its component elements in step 302 . replenishment system 101 verifies the account number in step 303 . the account number verification step may involve a number of substeps , such as using checksum digits , checking that the account is not expired , verifying that the account number is within a valid range and / or that a valid min is assigned to the account - if the account number fails in step 303 , then the transaction is logged to an exception file in step 304 . the exception file may be used by a csr or by bank 102 in step 305 to manually correct any incorrect or missing account information . once the information has been corrected , the transaction may be resubmitted for processing in step 301 . preferably , replenishment system 101 includes fraud prevention and control checks in step 305 to identify and prevent fraudulent attempts to credit prepaid accounts . valid account transactions are further processed in step 306 , wherein a transaction message is formulated for prepaid engine 103 . this transaction message is sent to prepaid engine 103 to update the user &# 39 ; s prepaid account balance for future calls . replenishment system 101 logs the nun , transaction amount , account number and other information in step 307 . this transaction information is then used to track the replenishment transactions or to generate reports , such as monthly revenue reports in step 308 . revenue reports may be generated for each carrier or for each bank . the transaction information is stored in a database in step 309 . at preset intervals , such as every 24 hours , in step 310 , bank 102 sends a reconciliation file summarizing all transactions during the period . in step 311 , replenishment system 101 compares the reconciliation file to the log of individual transactions to verify that all transactions have been recorded correctly . an email message is generated in step 312 identifying any exception cases that do not match between the reconciliation file and the transaction log . these records are then analyzed to resolve any discrepancies . in step 313 , replenishment system 101 sends a message to bank 102 containing instructions on how the funds are to be distributed among the bank , retailer , and wireless service providers &# 39 ; accounts . fig3 also illustrates series of exemplary steps to be performed when activating prepaid account cards using an ivr system . in step 315 replenishment system 101 receives data from an ivr system . this information is parsed into its component parts in step 316 and the account number is verified in step 317 . the account number can be verified on activation by using a checksum , verifying that it is not expired and that the account number is within a valid range . if the account number fails step 317 , then the information is logged to an exception file in step 304 and the user can be connected to a csr or customer care facility in step 305 to resolve the errors . once the account number problems have been corrected , the activation process is restarted in step 316 . activation information including valid account numbers is then checked in step 318 to verify that the min is valid . if the min is not valid , then a message is sent to the ivr to prompt the user to reenter the min information in step 319 . alternatively , the user may be connected to a csr to resolve the min errors . if the account number and the min are both valid , then the min is assigned to the prepaid replenishment account in step 320 and a confirmation message is sent to the ivr in step 321 . the ivr then informs the customer that the account is active and the prepaid replenishment card can be used . replenishment system 101 monitors all transactions for fraud attempts and logs all fraud attempts to a fraud file . specialized reports are then generated from the fraud file to aid in fraud detection . system 101 also provides bank 102 and the prepaid service provider an audit trail for accounting of all funds involved in the replenishment transactions . in addition to using a point of sale location to replenish the prepaid accounts , in other embodiments users may use an atm to add funds to a prepaid account . for example , bank 102 may provide replenishment services such as processing of transactions from pos 104 . bank 102 may also provide a replenishment transaction via its atms 105 . upon swiping or inserting their debit or bank card , users may be offered the typical options of withdrawing , depositing or transferring funds into or among accounts at bank 102 . atm 105 may be configured to also offer the option to transfer money from the user &# 39 ; s checking or savings account to the user &# 39 ; s prepaid account . the user then selects the transaction amount and confirms the transaction . bank 102 then notifies replenishment system 101 of the transaction and the user &# 39 ; s account balance in prepaid engine 103 is updated . alternatively , atm 105 may be configured so that the user can swipe more than one card during a transaction . for example , the user would first swipe a debit or bank card to identify the account to remove funds from and then swipe a permanent prepaid account card to identify the prepaid account to which funds are to be deposited , bank 102 would then inform replenishment system 101 that the user &# 39 ; s prepaid account should be credited a certain amount . in another embodiment , the user may access replenishment system 101 via pc 107 to transfer funds to a prepaid account . for example , the user may access replenishment system 101 through a web site via internet 106 or the user may access replenishment system 101 directly through a proprietary computer interface or network . replenishment system 101 would prompt the user for an identification code and a personal identification number ( pin ) or password before conducting the prepaid transactions . when activating the prepaid account , the user may identify a specific bank account to be debited for replenishment transactions . thereafter , whenever the user desires to replenish the prepaid account , he or she can access replenishment system 101 via pc 107 and , after entering an identification code , pin or password , the user can transfer funds from the preselected debit account to the prepaid account . replenishment system 101 will then send a message to bank 102 to verify that the funds are available in the debit account and , if they are available , to transfer the replenishment amount to the appropriate pending account . replenishment engine 101 will send a confirmation message to the user at pc 107 . the confirmation message may include the prepaid account number , a transaction or confirmation number and the amount transferred . replenishment system 101 also sends a message to prepaid engine 103 to update the prepaid account balance for the user . fig4 is a flowchart illustrating the steps involved in another embodiment of the replenishment system in which the user adds value to a prepaid account via wireless telephone 108 . in step 401 , the user preauthorizes a specific account that will provide funds to replenish the prepaid account . this debit account may be predesignated by the user during activation of the replenishment account . to replenish the prepaid account , the user enters the appropriate dialed digits in step 402 . the dialed digits can be any length and may include a feature code , telephone number , transaction amount , pin or other information . certain feature codes may be correlated to specific replenishment amounts . for example , “* 25 ” may correspond to a $ 25 replenishment transaction . accordingly , when the user enters the feature code plus a pin , wireless network 110 converts the dialed digits in step 403 to a message to replenishment system 101 . continuing the example , the user may send the dialed digits “* 25123456 ”, wherein “* 25 ” is a feature code and “ 123456 ” is the pin . this information is converted to a message to be sent to replenishment system 101 . using the “* 25 ” feature code , the system knows that the transaction amount is to be $ 25 . signals from wireless telephone 108 include the min assigned to the device and this information can be used to uniquely identify a specific wireless telephone and an assigned prepaid account . the wireless network further confirms the validity of the phone through existing authentication methods . in one embodiment , wireless network 110 converts the dialed digits and min to an origination request message that is used to initiate the transaction . wireless network 110 interfaces with replenishment system 101 and then , in step 404 , sends a confirmation tone or announcement to the user to indicate that the replenishment transaction is being performed . no call is actually completed to the replenishment system 101 . alternatively , if the transaction cannot be sent to replenishment system 101 , then a deny announcement or tone will be sent to the user . after sending the appropriate tone , the call connection between wireless telephone 108 and network 110 can be broken while replenishment system 101 attempts to complete the transaction . in step 405 , replenishment system 101 attempts an electronic banking transaction with the user &# 39 ; s bank . if replenishment system 101 is unable to contact bank 102 or if the banking transaction fails , then replenishment system 101 initiates an email or short message service ( sms ) message to wireless telephone 108 in step 406 to notify the user that the transaction failed . if the transaction is successfully processed by bank 102 , then in step 407 replenishment system 101 initiates an sms message to wireless telephone 108 indicating that the replenishment transaction was completed . the sms message may comprise a transaction number , the amount transferred or other such information . in step 408 , replenishment system 101 sends a message to prepaid engine 103 to update the prepaid account balance for the user . in step 409 , bank 102 transfers funds from the user &# 39 ; s predesignated account to the appropriate account for prepaid transactions . it will be understood that , although the exemplary system described above was directed to the replenishment of a prepaid wireless telephone services account , the present invention can be used to replenish prepaid accounts for wireline telephone service . for example , a prepaid account that is used for wireline telephone services may also be replenished in the manner described above . a user may desire to make calls from wireline telephone 113 using a prepaid account . whenever the account for prepaid wireline services needs to be replenished , the user may add funds to the account via a point of sale location 104 , atm 105 , or pc 107 . alternatively , the user may perform replenishment transactions from telephone 113 by dialing a predetermined replenishment telephone number . the user may then be connected to an ivr system that prompts the caller for account number information and a transaction amount . such an ivr system may be incorporated with replenishment system . if the user predesignated a prepaid account that is to be associated with telephone 113 , then the caller identification ( caller id ) functions , such as calling number delivery or automatic number identification ( ant ), can be used to identify the appropriate prepaid account . also , specific replenishment telephone numbers may be predesignated for selected replenishment amounts , such as “ 1 - 800 - 555 - 2525 ” for a $ 25 replenishment transaction or “ 1 - 800 - 555 - 5050 ” for a $ 50 replenishment . accordingly , the user could dial “ 1 - 800 - 555 - 2525 from telephone 113 and the answering replenishment ivr system would know that the user desired a $ 25 replenishment . the answering ivr system would also identify telephone 113 , the associated prepaid account and the preselected debit account information based upon the caller id from telephone 113 . as a result to complete the transaction , the ivr system would only need to prompt the user for a password or pin to complete the transaction . the replenishment ivr system would then provide the user with a transaction number or confirmation number . a receipt including the transaction number and the transaction amount may also be sent to the user via electronic , sms , or regular mail . replenishment system 101 updates the prepaid account balance in prepaid engine 103 and performs an electronic banking transaction with bank 102 to move the funds among the appropriate accounts . it will be further understood that the present invention may be used to replenish any prepaid accounts without regard to how the prepaid account is used . funds may be added to any prepaid account using the systems and methods described herein . funds may also be used to pay existing post paid or credit accounts , such as normal phone bills or utility bills including cable or telephone bills . many people use prepaid credit cards that can be used to make purchases at any location that accepts regular credit cards . these prepaid credit cards may be replenished in the manner described above . for example , the user could present the prepaid credit card at a point of sale location 104 along with a cash amount to be added to the account balance . a clerk at the retail location would then ring up the replenishment transaction for the appropriate amount and swipe the prepaid credit card in an authorization terminal the transaction would be confirmed by bank 102 . in such a transaction , replenishment system 101 may be a dedicated system that is used by bank 102 to perform credit card replenishment transactions . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps .	6
the present systems and methods will now be described with reference to the figures . it should be understood , however , that numerous variations from the depicted arrangements and functions are possible while remaining within the scope and spirit of the claims . for instance , one or more elements may be added , removed , combined , distributed , substituted , re - positioned , re - ordered , and / or otherwise changed . further , where this description refers to one or more functions being implemented on and / or by one or more devices , one or more machines , and / or one or more networks , it should be understood that one or more of such entities may carry out one or more of such functions by themselves or in cooperation , and may do so by application of any suitable combination of hardware , firmware , and / or software . for instance , one or more processors may execute one or more sets of programming instructions as at least part of carrying out of one or more of the functions described herein . fig1 depicts a communication system , in accordance with at least one embodiment . as shown , a communication system 100 includes a communication device 102 , a local endpoint 104 , and a remote endpoint 106 . communication device 102 may take the form of , for example , a personal computer , a desktop computer , a laptop computer , a notebook computer , a tablet computer , a handheld computer , a wearable computer , a personal digital assistant ( pda ), a feature phone , an optical head - mounted display ( ohmd ), and / or a smart watch , among numerous other possibilities that will be known to those of skill in the art . in the embodiment illustrated in fig1 , communication device 102 takes the form of a smartphone . in some embodiments , communication device 102 may be integrated into a vehicle , such as a bluetooth supported automobile , aircraft , watercraft , local endpoint 104 may take the form of a headset ( such as a bluetooth headset ), a communication - device - mounted accessory ( such as a case or sleeve ), and / or any other entity capable of carrying out the local - endpoint functions described herein . as shown in fig1 , communication device 102 is communicatively connected to local endpoint 104 via a local communication link 110 in an embodiment , the local communication link takes the form of a bluetooth communication link , though the link may take other forms as well . remote endpoint 106 may be any suitable device ( or combination of devices ) configured to perform the remote - endpoint functions described herein . in the embodiment illustrated in fig1 , remote endpoint 106 takes the form of a remote - endpoint communication device 118 and a remote - endpoint accessory 116 that are communicatively connected via a communication link 120 . accessory 116 , device 118 , and communication link 120 may be similar in function and / or structure to local endpoint 104 , communication device 102 , and local communication link 110 ( respectively ), as examples . in other configurations , remote endpoint 106 may take the form of a cryptographic phone , a private branch exchange ( pbx ), an internet protocol pbx ( ip - pbx ), and / or any other entity capable of carrying out the described remote - endpoint functions . communication device 102 may provide local - endpoint media - session control data to local endpoint 104 via the local communication link . the local - endpoint media - session control may be based on the media - session control data , for example , and may include a cryptographic key ( e . g ., a public key ), a digital signature ( e . g ., of a cryptographic key and / or of media - session payload data ), media - session metadata , and / or payload - data metadata , among other possibilities . such local - endpoint media - session control data may be used to by local endpoint 104 for encrypting and / or decrypting media - session payload data for example . in an embodiment , local communication link 110 takes the form of a bluetooth communication link and providing local - endpoint media - session control data to local endpoint 104 via the local communication link takes the form of providing the local - endpoint media - session control data via the bluetooth communication link . providing the local - endpoint media - session control data via the bluetooth communication link may include providing the local - endpoint media - session control data according to a second bluetooth profile that is different from the first bluetooth profile . the second bluetooth profile may take the form of ( or include ) a serial port profile ( spp ) and / or a non - audio bluetooth profile , as examples . fig2 depicts a block diagram of a communication device , in accordance with at least one embodiment . as shown , communication device 102 includes a processor 202 , data storage 204 , a communication interface 206 , and a user interface 208 , each of which is interconnected via a system bus 210 . in the embodiment illustrated in fig1 , remote endpoint 106 takes the form of a cryptographic desk phone . those having skill in the relevant art will appreciate that communication device 102 may have additional and / or different components , and perhaps a different arrangement of components , among many other possible variations that may be listed here . processor 202 may include one or more processors of any type deemed suitable by those of skill in the relevant art , some examples including a microprocessor , an application - specific integrated circuit ( asic ), and a digital signal processor ( dsp ). data storage 204 may take the form of any non - transitory computer - readable medium or combination of such media , some examples including flash memory , read - only memory ( rom ), and random - access memory ( ram ) to name but a few , as any one or more types of non - transitory data - storage technology deemed suitable by those of skill in the relevant art may be used . as depicted in fig2 , data storage 204 contains program instructions 212 which are executable by processor 202 for carrying out various functions , though data storage 204 may contain different and / or additional data . in an embodiment in which communication device 102 is configured to carry out one or more processes and / or functions ( such as the processes and functions described with reference to fig1 ), program instructions 212 are executable by processor 202 for carrying out those functions . in instances where other entities described herein have a structure similar to that of communication device 102 as described in connection with at least fig3 , the respective program instructions 212 stored by the respective data storages 204 of those respective devices are executable by their respective processors 202 to carry out functions performed by those devices . communication interface 206 may include any necessary hardware ( e . g ., chipsets , antennas , ethernet cards , etc .) and / or software for conducting one or more forms of communication with one or more other components and / or entities ( such as local endpoint 104 and remote endpoint 106 , as examples ). communication interface 206 may be configured to communicate according to one or more protocols such as bluetooth , nfc , infrared data association ( irda ), zigbee , wi - fi , universal serial bus ( usb ), ieee 1394 ( firewire ), and / or ieee 802 . 3 ( ethernet )), as examples . user interface 208 may include one or more displays , touchscreens , loudspeakers , microphones , dial keys , buttons , switches , light emitting diodes ( leds ), and the like . one or more user - interface components ( e . g ., an interactive touchscreen - and - display component ) may provide both user - input and user - output functionality . and other user - interface components may be implemented in a given context , as known to those of skill in the art . fig3 depicts a block diagram of a local endpoint , in accordance with at least one embodiment . as shown , local endpoint 104 includes a processor 302 , data storage 304 , a local communication interface 306 , a user interface 308 , and a cryptographic module 310 , each of which is interconnected via a system bus 312 . those having skill in the relevant art will appreciate that local endpoint 104 may have additional and / or different components , and perhaps a different arrangement of components , among many other possible variations that may be listed here . processor 302 , data storage 304 , local communication interface 306 , and / or user interface 308 may function in a manner similar to the similarly - named entities of communication device 102 , as described ( for example ) with respect to fig2 above . cryptographic module 310 may include hardware and / or software for performing cryptographic functions or processes — e . g ., encryption , decryption , signature generation , signature verification , and / or key generation . in an embodiment , cryptographic module 310 is contained within an explicitly defined perimeter that establishes the physical bounds of the cryptographic module and that contains any processors and / or other hardware components that store and protect any software and firmware components of the cryptographic module . cryptographic module 310 may take the form of ( or include ) a secure crypto - processor , a smart card , a secure digital ( sd ) card , a micro sd card , a subscriber identity module ( sim ) card , and / or any other cryptographic module , as known to one of skill in the art . in at least one embodiment , local endpoint 104 communicates with communication device 102 using a bluetooth hands - free profile ( hfp ). in some embodiments , the hfp uses a protocol known to those of skill in the art as continuously variable slope delta ( cvsd ) modulation , which is utilized to communicate audio data from the bluetooth device to the communication device ( or vice versa ). embodiments herein describe use of a cvsd modulation protocol , however it is known to those of skill in the art that minor modifications can be made to provide embodiments for other audio - based codecs . fig4 a depicts an example block diagram of a known cvsd encoder 400 . as shown multi - bit data byte input x ( k ) enters combination unit 402 along with the multi - bit data byte reference sample stored within accumulator 404 { circumflex over ( x )}( k − 1 ). b ( k ) corresponds to a bit representing the sliced output of the comparison ( i . e . b ( k )= sgn ( x ( k )−{ circumflex over ( x )}( k − 1 ), where sgn ( x ) corresponds to the sign function e . g . sgn ( x )= 1 for x ≧ 0 , otherwise sgn ( x )=− 1 ). the accumulator 404 then reads in the value b ( k ) and a step size control signal δ ( k ), which adds or subtracts δ ( k ) from the current reference sample of the accumulator 404 if b ( k ) is + 1 or − 1 , respectively , thus updating the reference sample within the encoder . step - size control unit 406 monitors b ( k ) ( e . g . for consecutive ‘ 1 ’ or ‘ 0 ’ outputs ) and adjusts the magnitude of δ ( k ) accordingly . a new input x ( k ) is read in and the process repeats . in a standard cvsd system , input x ( k ) can be a multi - bit byte read in at 64 khz , while b ( k ) is a single bit stream output at a rate of 64 khz . fig4 b depicts an example block diagram of a known cvsd decoder 407 . the decoder receives the single bit stream b ( k ) at a rate of 64 khz . the decoder also includes an accumulator 408 , which is initialized to be equal to the accumulator 404 in the encoder . in some embodiments , the accumulator is shared between the encoder and decoder for a single codec . in some embodiments , out of sync references may converge over time due to a decay factor associated with the accumulators . the reference sample within accumulator 408 is incremented / decremented based on the step size δ ( k ) and the input bit b ( k ). the step - size control unit 410 of the decoder is synchronized to the step - size control unit 406 of the encoder . similar to the accumulator , a single cvsd codec may share a step - size control unit . in some embodiments of cvsd , a multi - bit data byte stream may be output from accumulator 408 at a rate of 64 khz . in other embodiments ( such as in some bluetooth profiles ), the multi - bit data bytes are output at a rate of 8 khz . in at least one embodiment , it is desired to transmit binary data , or perhaps encrypted binary data , rather than raw audio data . as is known to one of skill in the art , the method of cvsd described above may provide an output that is an approximated multi - bit byte data stream , however the output of the cvsd decoder will not be exactly the same as the data input to the cvsd encoder . thus , if one attempts to send data over such a link , this would cause data errors . therefore , modifications must be made in order to achieve perfect reconstruction of the sent data . fig5 depicts an apparatus in accordance with at least one embodiment . as shown , fig5 includes a communication device 102 and a local endpoint 104 . as shown , communication device 102 includes byte sequencer 510 , cvsd encoder 515 , and bluetooth transceiver 520 . local endpoint 104 includes byte sequencer 540 , cvsd decoder 535 , and bluetooth transceiver 530 . fig5 depicts data being sent from communication device 102 to local endpoint 104 for clarity , however it is understood that the embodiments include bi - directional communication . as shown , communication device 102 provides a binary data sequence 505 to byte sequencer 510 . in at least one embodiment , binary data sequence 505 is a single bit - wide serial stream . in at least one embodiment , binary data sequence 505 represents encrypted data . in a further embodiment , the encrypted data represents encrypted audio . byte sequencer 510 is configured to receive binary data 505 , and responsively generate a multi - bit byte sequence . the cvsd encoder 515 receives the multi - bit byte sequence and responsively generates a one - bit per - sample binary sequence 525 representing the binary data sequence . each bit in the one - bit per - sample binary sequence 525 indicates whether a received multi - bit data byte is larger or smaller than a prior output reference byte . the one - bit per - sample binary sequence 525 is transmitted via bluetooth transceiver 520 to bluetooth transceiver 530 at local endpoint 104 . cvsd decoder 535 receives the one - bit per - sample binary sequence and responsively generates a multi - bit data byte sequence . the multi - bit data byte sequence is received by byte sequencer 540 , which responsively generates a binary data sequence 545 , which is a replicated version of binary data sequence 505 . fig6 depicts byte sequencer 510 , in accordance with at least one embodiment . as shown , byte sequencer 510 includes a byte generator 605 and a bit generator 610 . it should be noted that byte sequencer 510 might include any combination of components shown , as well as additional components as known to one of skill in the art . in at least one embodiment , byte generator 605 is configured to receive a bit of a binary data sequence and responsively generate a multi - bit data byte of a multi - bit data byte sequence to be sent to a cvsd encoder . in at least one embodiment , bit generator 610 is configured to receive a multi - bit data byte of a multi - bit data byte sequence from a cvsd decoder and responsively generate a bit of a binary data sequence . in some embodiments , byte generator 605 may receive step size information in order to account for a step / increment size used by the cvsd codecs due to repeated bits when generating multi - bit data bytes . in some embodiments , byte generator 605 may receive the value of the current reference sample within the cvsd codec as a reference ( or feedback ) when generating the next multi - bit data byte . fig7 depicts byte generator 605 , in accordance with at least one embodiment . as shown , byte generator 605 includes pattern - setting module 702 and generator 706 . it should be noted that byte generator 605 might include the combination of components shown , as well as any additional components as known to one of skill in the art . generator 706 receives at least one input and responsively generates a multi - bit data byte . in at least one embodiment , pattern - setting module 702 receives a single bit of a binary data sequence and generates a bit sequence pattern representing the single bit of received binary data sequence 505 to be used by generator 706 when forming multi - bit data bytes . in some embodiments , the bit sequence pattern is output from pattern - setting module 702 at a faster rate than the rate at which pattern - setting module 702 receives each bit of the binary data sequence ( e . g . if each single bit is received at 32 khz , then pattern - setting module may generate pairs of bits , each bit of the pair of bit at a rate of 64 khz to maintain the same throughput ). in at least one embodiment , each bit of the one - bit per - sample binary sequence is represented by a sequence pattern of two or more bits . depending on how many bits in the sequence pattern of two or more bits , as well as what the sequence pattern is ( e . g . 111 , 000 , 101 , 010 ), generator 706 may need to generate multi - bit data bytes that have a larger / smaller difference between them . examples of different binary data sequence patterns are given in paragraphs below . in at least one embodiment , pattern - setting module 702 provides a single binary bit to generator 706 to indicate whether the next multi - bit data byte needs to be larger or smaller than the previously transmitted data byte . in at least one embodiment , generator 706 receives the value of the current reference sample of the cvsd encoder in order to generate the next multi - bit data byte . in some embodiments , the byte generator may include a reference register configured to store a previously generated multi - bit data byte in order to generate the next multi - bit data byte . in at least one embodiment , generator 706 may also receive an input indicating a current step size used by the cvsd codecs to ensure a sufficient magnitude is used in generating multi - bit data bytes . fig8 depicts bit generator 610 , in accordance with at least one embodiment . as shown , bit generator 610 includes current reference sample 805 , previous reference sample 810 , and compare unit 815 . current reference sample 805 and previous reference sample 810 may be stored within registers , as electrical charges on capacitors , or any other way known to one of skill in the art . compare unit accepts the current reference sample 805 from the cvsd decoder and compares it to the previous reference sample 810 using compare unit 815 and outputs a single bit based on the result . in at least one embodiment , the comparator unit 815 outputs a binary ‘ 1 ’ if the current data byte is larger than the previous data byte , and outputs a binary ‘ 0 ’ if the previous data byte is larger than the current data byte . the current reference sample 805 is then stored as the previous reference sample 810 before a new multi - bit data byte is read in from the cvsd decoder . in some embodiments , bit generator 610 includes a pattern - setting module 820 which may be similar in architecture to pattern - setting module 702 within byte generator 605 . in the following embodiments , it is assumed that the one - bit per - sample binary sequence transmitted between bluetooth receivers is transmitted at a rate of 64 khz . however , the rate at which the cvsd codecs sample / output multi - bit data bytes may vary , thus limiting the overall throughput . in at least one embodiment , each bit of the one - bit per - sample binary sequence is represented by a sequence pattern of one or more bits output from the cvsd encoder during one sample period . the following paragraphs give embodiments utilizing different codec receive / output rates . in a first embodiment , the cvsd codecs are configured to sample / output a multi - bit data byte sequence at a rate of 64 khz . referring to fig5 , byte sequencer 510 receives binary data sequence 505 at a throughput of 64 , 000 bits per second ( bps ) ( which also may be denoted as 64 kbps herein ) and outputs multi - bit data bytes at 64 khz . in some embodiments , the multi - bit data bytes include 8 - 16 bit bytes , however other size bytes are possible . cvsd encoder 515 samples each multi - bit data byte at 64 khz and outputs a one - bit per - sample binary sequence 525 at 64 khz , which is transmitted to local endpoint bluetooth transceiver 530 via communication device bluetooth transceiver 520 . in this embodiment , each bit of the one - bit per - sample binary sequence corresponds to a respective bit output by cvsd encoder 515 . cvsd decoder 535 receives bits of the one - bit per - sample binary sequence at a rate of 64 khz , increments / decrements a stored reference multi - bit data byte based on each received bit , and outputs the stored multi - bit data byte at a rate of 64 khz . byte sequencer 540 receives each stored multi - bit data byte at a rate of 64 khz and responsively generates a binary data sequence 545 at a rate of 64 khz . fig9 a depicts an example of a one - bit per - sample binary sequence 525 in accordance with at least one embodiment , wherein each bit of the one - bit per - sample binary sequence 535 is represented by a single bit output from the cvsd encoder 515 . in some embodiments , binary data sequence 505 is provided at a rate of 32 khz to byte sequencer 510 . byte sequencer 510 may then form a sequence pattern of a pair of bits at a rate of 64 khz ( e . g . using pattern - setting module 702 described above ), where each pair of bits represents a single bit of binary data sequence 505 . the transmission process remains the same , except byte sequencer 540 may output bits at a rate of 32 khz , using a pattern - setting module similar to that used by byte - sequencer 510 . other embodiments may further reduce the throughput of binary data sequence 505 and encode each bit in three , four , or more bit sequence patterns , at the benefit of improved accuracy of the data at the receiving end . example pattern sequences that may be used are given in examples below . in a second embodiment , at least one of the cvsd codecs is configured to sample / output a multi - bit data byte sequence at a rate of 32 khz while maintaining transmission of the one - bit per - sample binary sequence at a rate of 64 khz . in a first case , both the cvsd encoder 515 and cvsd decoder 535 operate at 32 khz . this will limit the overall throughput to 32 , 000 bps , since cvsd decoder 535 can only output multi - bit data bytes to byte sequencer 540 at a rate of 32 khz , and therefore the byte sequencer 540 can only output bits at an effective rate of 32 kbps . binary data sequence 505 may be provided to the byte sequencer 510 at a rate of 32 khz ( for a throughput of 32 kbps ), while byte sequencer 510 is configured to output multi - bit data bytes at a rate of 32 khz . in this embodiment , the cvsd encoder samples each byte at a rate of 32 khz and outputs a binary sequence pattern represented as a pair of bits per multi - bit data byte at a rate of 64 khz . in at least one embodiment , each bit of the one - bit per - sample binary sequence is represented by a pair of bits , ( i . e . each pair of bits representing a binary ‘ 0 ’ or ‘ 1 ’), resulting in the expected throughput of 32 kbps . cvsd decoder 535 is configured to receive the pairs of bits of the one - bit per - sample binary sequence 525 at a rate of 64 khz , analyze each pair of bits in the sequence , and output a multi - bit data byte sequence at a rate of 32 khz . fig9 b depicts an example one - bit per - sample binary sequence in accordance with one embodiment , wherein each bit of the one - bit per - sample binary sequence is represented as a sequence pattern of a pair of bits . in this embodiment , a binary ‘ 1 ’ is represented by a sequence pattern of a pair of bits ‘ 11 ’ whereas a binary ‘ 0 ’ is represented by a sequence pattern of a pair of bits ‘ 00 ’. in at least one embodiment , if a phase of the cvsd decoder is off , then byte sequencer 510 can be configured to insert a dummy bit into the one - bit per - sample binary sequence to realign the phase . in at least one embodiment , if the cvsd decoder 535 is configured to detect sequence of ‘ 00 ’ and ‘ 11 ’, but receives a sequence ‘ 10 ’ or ‘ 01 ’, then the byte sequencer 510 can be configured to hold a received binary data bit of binary data sequence 505 for a half a sample ( 1 / 64 k ) before outputting the multi - bit data byte corresponding to the held sample , thus inserting a dummy bit in so that the cvsd decoder 535 is realigned and receiving exclusively ‘ 11 ’ and ‘ 00 ’ sequences again . other methods of inserting dummy bits may also be used that would be known to one of skill in the art . table 1 shows possible binary sequence patterns of pairs of bits that may be used for binary values of ‘ 1 ’ and ‘ 0 ’ in accordance with at least one embodiment : in a second case , the cvsd encoder 515 is configured to receive multi - bit data bytes at a rate of 32 khz , while the cvsd decoder 535 is configured to output multi - bit data bytes at a rate of 64 khz . in this case , the binary data stream 505 entering byte sequencer 510 may have a maximum throughput of 32 , 000 bps ( e . g . single bits at 32 khz or a pattern sequence of pairs of bits at 64 khz wherein one pair of bits represents a single information bit ). the byte sequencer 510 receives the binary data stream 505 and outputs a multi - bit data byte sequence at a rate of 32 khz , which is received by cvsd encoder 515 . the cvsd encoder then outputs a sequence pattern of a pair of bits ( as described above ) based on each received multi - bit data byte and the current value of the reference sample within the cvsd encoder 515 at a rate of 64 khz . the 64 khz one - bit per sample binary sequence 525 produced by cvsd encoder 515 is transmitted via bluetooth transceiver 520 to bluetooth transceiver 530 . cvsd decoder 535 receives the 64 khz one - bit per sample binary sequence 525 and outputs multi - bit data byte sequence at a rate of 64 khz . the byte sequencer 540 receives the multi - bit data byte sequence and outputs binary data stream 545 at an effective throughput of 32 , 000 bps . in one embodiment , byte sequencer 545 is configured to analyze two consecutive multi - bit data bytes and output binary data stream 545 as a 32 khz stream of bits . in another embodiment , byte sequencer 540 outputs binary data stream 545 as a 64 khz stream of sequence patterns of pairs of bits , each pair of bits corresponding to one bit within binary data stream 505 ( in the case of a single bit stream at 32 khz ), and further pattern identification is done by a processor , for example . in a third case , the cvsd 515 encoder is configured to receive multi - bit data bytes at a rate of 64 khz , while the cvsd decoder 535 is configured to output multi - bit data bytes at a rate of 32 khz . in this case , binary data sequence 505 is again transmitted at an effective throughput of 32 , 000 bps . binary data sequence 505 is received by byte sequencer 510 , which in turn outputs a multi - bit data byte sequence at a rate of 64 khz ( e . g ., a pair of consecutive multi - bit data bytes represents a single bit of binary data sequence , or each bit of binary data sequence 505 is transmitted as a sequence pattern of a pair of bits ). cvsd encoder 515 receives the multi - bit data byte sequence and outputs the one - bit per sample binary sequence 525 at a rate of 64 khz , which is transmitted via bluetooth transceiver 520 to bluetooth transceiver 530 . cvsd decoder 535 receives the one - bit per sample binary sequence 525 and outputs a multi - bit data byte sequence at a rate of 32 khz , after which byte sequencer 540 converts the 32 khz multi - bit data byte sequence into a 32 khz single bit stream . many other transmission rate configurations ( as well as combinations between transmitter / receiver ) for cvsd codecs may be available , in which case each bit of binary data sequence 505 may be represented by various different bit sequence patterns . for example , in some embodiments , the overall throughput may be limited to 21 , 333 bps , in which case each bit of binary data sequence 505 may need to be represented as a sequence pattern of 3 bits . table 2 below shows possible sequence patterns that may be used for binary values of ‘ 1 ’ and ‘ 0 ’, in accordance with some embodiments . note that table 2 does not provide an exhaustive list of options , and other sequence patterns may be used as known to one of skill in the art : another embodiment may utilize an overall throughput of 16 , 000 bps , in which case each binary data sequence 505 may be represented as a sequence pattern of 4 bits . table 3 below shows possible sequence patterns that may be used for binary values of ‘ 1 ’ and ‘ 0 ’, in accordance with some embodiments . note that table 3 does not provide an exhaustive list of options , and other sequence patterns may be used as known to one of skill in the art : in at least one embodiment , local endpoint 104 may not include any sort of audio - codec , and may be configured to generate / receive the one - bit per - sample binary sequence directly . fig1 depicts a system in accordance with at least one embodiment . as shown , fig1 includes local endpoint 104 , which includes cvsd data 1005 and bluetooth transceiver 1010 . fig1 also depicts communication device 102 , which includes bluetooth transceiver 1015 , cvsd decoder 1020 , byte sequencer 1025 , and binary data sequence 1030 . local endpoint 104 is configured to generate cvsd data 1005 representing encrypted data directly , and transmit the cvsd data over a bluetooth data link via bluetooth transceiver 1010 . communication device 102 receives the cvsd data 1005 via bluetooth transceiver 1015 , and decodes the data into a multi - data byte sequence , which is provided to byte sequencer 1025 and converted into binary data sequence 1030 , wherein binary data sequence 1030 is a replicated version of cvsd data 1005 . in many embodiments , arbitrary data is not represented as a constant bit stream , but is usually broken up into 8 bit bytes ( or more ) of data . thus in some embodiments , a byte framing scheme is proposed to help the receiver determine which bits of the stream belong to an individual byte and to help with resynchronization in the event of data loss or corruption . in one embodiment , the proposed scheme comprises a mechanism based on the rs - 232 serial data specification . the transmitter emits one start bit , followed by the 8 ( or more ) data bits belonging to a single multi - bit byte , optionally followed by a parity bit which could be used to determine corruption , and then followed by a stop bit . an example of such a coding scheme is depicted in fig5 . this means that each multi - bit data byte would take either 10 or 11 bits to transmit further reducing the throughput by 8 / 10ths or 8 / 11ths . a more advanced coding scheme may be used if better error resiliency , lower overhead , or forward error correction is desired . a simple improvement would be to match the framing used by the link level in order to improve performance when frames are dropped . although features and elements are described above in particular combinations , those having ordinary skill in the art will appreciate that each feature or element can be used alone or in any combination with the other features and elements without departing from the scope and spirit of the present disclosure .	7
reference is now made to fig1 which schematically represents an operator 10 operating a string trimmer - type cutting device 12 . as typical for such devices , a motor 14 drives a driveline 16 extended from the motor to a trimmer head 18 . a cutting line , cord or string 20 protrudes from the head 18 and is rotated at a high rpm for cutting grass 22 , e . g ., as may be located next to a wall 24 . the string 20 , being flexible , will simply bend upon impacting the wall whereas the grass will be severed . [ 0017 ] fig2 a and 2b illustrate in cross section a trimmer head of a preferred embodiment of the present invention . the driveline 16 rotatably drives a collar 23 . attached to the collar is a core member 25 which is configured to have a manual turning knob 26 , a bearing portion 28 and a securement head 30 . the securement head 30 is cylindrical and has opposing configured slots 32 . a housing 34 includes an upper cover 36 mounted to the bearing portion 28 of the core member 25 and is slideable rotatably and axially on said bearing portion as permitted by knob 26 and shoulders 40 . a spool 42 ( see also fig3 and 5 ) is mounted to the securement head 30 . the spool includes upper and lower flanges 44 , 46 and a center or dividing flange 48 , all radiating from a cylinder 50 . the spool 42 has a tubular post 52 spanning the center of the cylinder 50 and as will be explained in a later section , is extended along the dividing flange 48 as indicated in fig2 b . the post 52 ( in assembled relation ) extends through the securement head 30 as permitted by the configured slots 32 and accordingly , as the securement head is rotated by driveline 16 , that rotation is transmitted to spool 42 via the post 52 . a bottom portion 54 of the housing 34 is releasably locked to the upper cover 36 via lock elements or latches 76 . it will be appreciated from the disclosure at this point that drive line 16 is rigidly connected to the core member 25 and rotatably drives the core member . the core member 25 includes a knob 26 , bearing portion 28 and securement head 30 . because spool 42 has its post 52 extended through the securement head 30 , the spool 30 is rotatably driven when driveline 16 is rotated . housing cover 36 , as explained , is confined on the bearing portion 28 between the knob 28 and shoulder 40 . this confinement enables limited axial sliding of the cover 36 and thus the housing 34 relative to the core member 25 . a boss 59 of the bottom portion 54 extends into the securement head 30 to facilitate stabilization of the housing 34 . the housing 34 is selectively rotated relative to the core member 30 as will now be explained . extended between the bottom portion 54 of housing 34 and the bottom of securement head 30 ( of core member 25 ) is a coil or compression spring 58 seated on boss 59 . spring 58 urges the housing 34 downwardly relative to securement head 30 and thus urges the cover 36 toward and against the shoulder 40 of bearing portion 28 . the spool 42 has its upper surface of upper flange 44 positioned relative to shoulder 40 so that the cover 36 is urged into engagement with said upper surface of the spool 42 . reference is now made to fig5 which is a perspective view of the spool 42 . as will be noted , the upper surface of flange 44 is provided with ramp detents 60 . now refer to fig7 and it will be noted that the bottom or inside surface of cover 36 is provided with ribs 62 . thus as the spring 58 urges the housing downward the ribs 62 are urged into engagement with the ramps 60 of the spool ( see fig4 ). the ramps 60 are arranged so that under the influence of the driveline 16 , the ribs 62 of cover 36 engage the vertical face 64 of ramp 60 to rotatably drive the cover 36 and thus the housing 34 . with reference to the figures and particularly fig2 a and 2b , it will be understood that the driveline 16 rotatably drives collar 23 and thus the core member 25 and its various portions and particularly having reference to securement head 30 . because post 52 of spool 42 extends through securement head 30 ( fig2 b ), the spool 42 is also caused to rotate . because spring 58 forces the cover 36 into engagement with the upper side of flange 44 , the ribs 62 of the cover 36 engage the vertical faces 64 of ramp 60 ( fig4 ) and thus generates rotation of the housing 34 . wound onto the spool 42 is a trimmer line 66 which has an upper winding 66 a between the upper flange 44 and divider flange 48 . a grommet or eyelet 68 ( fig2 b ) in the wall of the housing 34 allows the line 66 a to extend through the housing and extends from the housing for cutting of grass 22 as illustrated in fig1 . lower line 66 b is wound onto the spool between the lower flange 46 and the divider flange 48 . the end of line 66 b extends from the housing through opposing eyelet 69 . thus as explained , the trimmer head is operated to cut grass as long as the desired lengths of line 66 a and 66 b are extended from the housing 34 . as the line 66 a and 66 b as projected through the eyelets 68 , 69 are worn or broken off , it is necessary to provide for additional lengths to be unwound or fed off of the spool 42 . this can be accomplished in either of two ways as shown in fig2 a and 2b . automatic feeding of the line can be accomplished by simply bumping the bottom of the housing 34 against the ground . such bumping produces relative axial movement of the housing and core member 25 as permitted by the tolerance between the knob 26 and shoulder 40 and compression of spring 58 . the ribs 62 on the cover 36 separate from the ramp detents 60 and the friction producing ground engagement of the housing and centrifugal force of the line projected from the spool produces rotative movement of the housing relative to the spool which in turn produces unwinding of the line segments 66 a and 66 b . as the detents 60 and ribs 62 become disengaged , detents 61 at the bottom of the flange 46 line up with ribs 63 ( which are offset from ribs 62 ) and thus allow limited relative rotation before the detents 61 contact ribs 63 . as bumping is but a brief engagement of the housing contacting the ground , the spring 58 effects return axial movement and re - engagement of the ribs 62 and ramp detents 60 following a similar limited relative rotation upon release of ribs 62 from detents 61 . manual unwinding is accomplished only when the tool is shut down . the operator can unwind the string from the spool by pressing the housing upwardly against the knob 26 , turning the knob 26 , and then pulling on the trimmer lines 66 a and 66 b . once the line 66 has been completely used up , it is necessary to obtain a new length of line to assemble onto the spool 42 . this is accomplished for the present device ( preferred embodiment ) with use of the tubular post 52 . with reference to fig3 and 9 , it will be noted that the post 52 is fully enclosed as it spans the opening of cylinder 50 of the spool . the tube is provided with an open side 72 at the bottom of the post in one direction ( see fig9 ) and an open side 74 at the top of the post in the opposite direction ( see fig8 ). the operator first aligns the tube 52 with the eyelets 68 , 69 to establish a straight through opening for the string . the string is then threaded through the opening until substantially half of the length of the line is at either side of the housing . the operator then simply turns the knob 26 which is opposite the feed out direction and what is permitted by the ramp detents 60 and the string simply winds onto the spool , one side winding onto the upper portion of the spool and the other to the lower portion of the spool as permitted by the open sides 72 , 74 of the post 52 . ( note that the spool has been rotated a half turn in fig3 .) as indicated in the summary of the invention , there are occasions where it is preferable that the line is fed out of the eyelets 68 , 69 only manually . for the preferred embodiment , a conversion to the non - automatic feeding ( non - bump feeding ) of the line is accomplished by repositioning the spring 58 . the repositioned state is illustrated in fig1 . the housing 34 is disassembled by unlatching latches 76 to separate the bottom portion 54 from the cover 36 . the core member 25 , which is screwed into the collar 23 , is unscrewed and thereby separated from the collar 23 . the spring 58 is then placed onto the bearing portion 28 and under the cover 36 as shown in fig1 and the core member 25 is screwed back into engagement with collar 23 . the spool is then assembled back onto the securement head 30 and the bottom portion 54 reattached ( latched ) to the cover 36 . with the bottom portion 54 attached to the cover and the cover urged to its uppermost position , the ribs 63 on the lower portion 54 are in close adjacency to the lower flange 46 . the ribs 63 engage the vertical faces of the ramp detents 61 to prevent turning of the spool relative to the housing in the same manner as fig2 . however , now the housing is in the upper position relative to the core member and bumping no longer will release the engagement between the housing and the spool . yet with the rotation drive stopped , the housing can be manually urged downwardly against the spring 58 to unwind string from the spool . ( the movement is permitted as the engagement by the detents 60 , 61 are transferred between the sets of ribs 62 and 63 .) the configured slots 32 are shown as having a t shape which produces nesting of the post 52 in the cross bar of the t to prevent relative axial sliding of spool and core member . this can be accomplished in other ways , e . g ., with a straight slot and a locking member , e . g ., locking tabs . it is submitted that there are a number of unique features in the single embodiment disclosed above and these features may be arranged in a variety of configurations and combinations that will be apparent to those skilled in the art . accordingly , it is intended that the invention is not limited to any specific configuration or arrangement and instead encompasses the full range of devices as defined by the appended claims .	0
referring now to fig1 there is shown a schematic block diagram 110 illustrating information flow from a code provider 112 to multiple nodes 114 and 116 for a computer system utilizing the present invention . there is further depicted exemplary modes of code corruption 118 , 120 , 122 and 124 . nodes 114 and 116 preferably comprise at least a processor unit that may be coupled to a storage unit . it is contemplated that the multiple nodes may be configured in any know topological architecture , for example the mesh , ring , torus , star or the hypercube architectures . it should be further understood that the multiple nodes may be configured in any know scalable processing environment , such as the shared memory , cluster - type , shared device , or a system area network ( san ) environment . when multiple nodes are connected in a network , one or more of the nodes will generally be endowed with &# 34 ; network - aware &# 34 ; or &# 34 ; cluster - aware &# 34 ; capability . such nodes are often referred to as administrator nodes . for example , in a san environment , and administrator node is typically provided with a san manager , a software structure that initializes the system and resource configuration of the network upon power - up . continuing to refer to fig1 when code information is transmitted from the code provider 112 to one or more of the nodes , which may be arranged in a network configuration , the information is typically received first by the administrator node 114 via data path 126 . it is contemplated that data path 126 may represent either manual transfer of code information stored on medium such as floppy disks , cds , or the like ; or automatic transfer thereof by means of data communication from a remote site owned or controlled by the code provider 112 . the automatic transfer of code information may , for example , comprise a file transfer protocol ( ftp ) down - load from the code provider 112 , such as over the internet . still referring to fig1 the data or code information transmitted from the code provider 112 preferably comprises update information for updating at least a portion of the basic input / output system ( bios ) image associated with one or more of nodes 114 and 116 . the bios update information is commonly referred to as bios flash information . as this information is used to overwrite at least a portion of the existing bios , the integrity of the bios flash information transmitted from the code provider 112 is very critical . the bios flash information could be compromised from tamper sources 118 and 120 , or from code infection sources 122 and 124 such as with &# 34 ; software viruses &# 34 ;. it is because of these potential problems that the present invention is so paramount . referring now to fig2 there is shown a block flow diagram 210 illustrating a method of the present invention for the secure remote flashing of a bios in a computer system such as illustrated in fig1 . first as indicated by start block 212 , the procedure begins with the code provider / sending computer transmitting the flash bios information to a receiving computer . thereafter , as indicated by block 214 the receiving computer receives the flash information and stores the flash information such as onto a fixed disk partition or in nvram . then , as indicated by block 216 , the flash information received in the receiving computer is subjected to a validation process , an example of which is described in more detail below . if the determination is made that the flash information is not valid , i . e . the flash information has been tampered with or modified , then the &# 34 ; no &# 34 ; branch is followed and the bios flashing is not carried out and the procedure terminated . if , however , the determination is made that the flash information is good or valid , the &# 34 ; yes &# 34 ; branch is followed . then as indicated by block 218 , the receiving computer is placed in a predetermined operating state , such as by going through a cold boot power cycle . as described above , the flash information is stored in the receiving computer in a manner such that it is not lost or deleted during the power cycle . then as indicated by block 220 , the bios flash is carried out . subsequently , as indicated by block 222 , the receiving computer is re - booted , such a by going through another power cycle , and the bios information is enabled . referring now to fig3 there is illustrated a block flow diagram 310 illustrating an exemplary method for validating of the flash code and for signaling that a flash is desired in accordance with the principles of the present invention . as indicated by block 312 , the flash bios information received from the sending computer is loaded into the receiving computer . then as indicated by block 314 , the receiving computer enters a secure mode of operation . this can be accomplished by any of a number of procedures , such as described below in reference to fig4 or by generating a system management interrupt ( smi ) or by those described in u . s . pat . no . 5 , 421 , 006 , entitled &# 34 ; method and apparatus for assessing integrity of computer system software &# 34 ;. still referring to fig3 after the receiving computer has entered the secured mode , a hash value is calculated from the flash information , as indicated by block 316 . then , as indicated by block 318 , a hash value that has been encrypted in the flash information prior to the information being transferred from the sending computer , is decrypted and compared with the calculated hash value ( block 320 ). if the calculated hash value and the decrypted hash value do not match , the &# 34 ; no &# 34 ; branch is followed , wherein the status of the flash information is determined to be &# 34 ; bad &# 34 ; or invalid ( block 322 ). if the calculated hash value and the decrypted hash value do match , the &# 34 ; yes &# 34 ; branch is followed to bock 324 , where the files of the flash information are then copied to a system partition . then as indicated by block 326 , an indication is established that a flash is desired , such as by setting a bit in the nvram to signal a flash , or by setting a bit in the system partition or bootstrap to signal a flash . then , as indicated by block 328 , the flash information is validated and can be used to flash the bios . good results have also been achieved in the step of block 312 by also checking the validation of the sending computer for authorization of being able to send the flash information to the receiving computer . if the sending computer is not authenticated , the procedure is terminated . one method of validating the sending computer utilizes a method for digitally signing code information . prior to sending the information , the sender generates an information - integrity - code (&# 34 ; iic &# 34 ;) associated with the coded information to be transmitted , such as a checksum . the iic is then encrypted using a encryption scheme , such as a public key / private key encryption . the encrypted iic is then attached to the coded information and is transmitted to the receiver . the receiver generates a second iic associated with the coded information . then , the received iic in the encrypted form is decrypted by the receiver . the generated second iic is then compared to the decrypted iic . if the two match , the validation is successful . referring now to fig4 there is illustrated a block flow diagram 410 for entering a secure mode in the receiving computer to receive a remote flashing of the bios in accordance with the principles of the present invention . good results have been achieved for performing the steps of block flow diagram 410 during a power cycle of the computer . as depicted in block 412 , the computer cycles through an initialize system standard process , where the video and keyboard are activated and the memory is checked . then , as indicated by block 414 , the computer checks to determine if the flash bit is set . if the flash bit is not set , the &# 34 ; no &# 34 ; branch is followed and the procedure terminated . if the flash bit is set , the &# 34 ; yes &# 34 ; branch is followed and a hash value is calculated for the bootstrap of the receiving computer as indicated in block 416 . then , as indicated in block 418 , the validity of the bootstrap is checked , by comparing the calculated hash value with the known value . if the bootstrap is not valid , the no branch is followed and the procedure is terminated . if the bootstrap is valid , the yes branch is followed , and , as indicated by block 420 the bootstrap is loaded . next , as indicated by blocks 422 and 424 , hash values for system partition files are calculated and compared with known values , so that the system partition files can be validated . if the system partition files are not validated , the &# 34 ; no &# 34 ; branch is followed and the procedure terminated . if validated , the receiving computer is placed is in a secure mode . good results have also been achieved by further performing the steps of locating and validating both the system partitions and the flash application subsequent to block 414 . referring now to fig5 there is illustrated a block flow diagram 510 for loading , checking , and flashing a bios flash code in the receiving computer in accordance with the principles of the present invention . as indicated by blocks 512 and 514 , when the receiving computer has received the flash program , the program is checked , such as with a cyclic redundancy check ( crc ), a secure hash algorithm ( sha ), or a cryptographic checksum , and then validated , such as described above . if the flash program is not valid , the &# 34 ; no &# 34 ; branch from block 514 if followed and the procedure terminated . it the flash program is valid , the &# 34 ; yes &# 34 ; branch from block 514 is followed , and as indicated by block 516 , the flash program is loaded by the receiving computer , such as into nvram or on a disk partition . then , as indicated by blocks 518 and 520 , the flash code is checked and validated . if the flash code is not valid , the &# 34 ; no &# 34 ; branch from block 520 is followed and the procedure is terminated . if the flash code is valid , the &# 34 ; yes &# 34 ; branch from block 520 is followed . subsequently , as indicated by . block 522 , the current flash is read and saved . the current flash is re - read , and used to verify the saved current flash . thereafter , as indicated by block 524 , the new flash is flashed . referring now to fig6 there is illustrated a block flow diagram 610 for the flashing of the newly loaded bios flash in the receiving computer . as depicted by block 612 , the &# 34 ; power switch &# 34 ; is disabled , preventing the receiving computer from acting upon any power - on - reset signals received or generated therein . this prevents the receiving computer from power cycling in the middle of flashing . block 614 indicates the number permitted attempts for performing the flash . block 616 determines if the permitted number of attempts has been exceeded . if the maximum number of attempts has been exceeded , the success of the flashing is determined to be bad , and the procedure proceeds to block 626 . if the maximum number of attempts has not been exceeded , the flash is loaded , read and checked as indicated by blocks 618 , 620 and 622 . if the status of the new flash has been determined to be successful , the &# 34 ; success &# 34 ; branch is followed from block 622 , proceeding to block 626 . if the status of the new flash has been determined not be successful , the number of attempts is incremented by one ( block 624 ), and the procedure returns back to block 616 . subsequently , when block 626 has been reached , the &# 34 ; power switch &# 34 ; is enabled and the procedure terminated ( block 628 ). those skilled in the art can realize that the teachings of the present invention as described hereinabove provide and effective method for the secure remote flashing of the bios of a computer . it can be further appreciated that the present invention provides a method for transmitting flash information from a transmitting computer to a receiving computer , such as in a network configuration , and for guaranteeing the integrity of the flash information , such that if any viruses are introduced into the flash , the virus infected flash will not be used in updating a computers bios . although a preferred embodiment of the method of the present invention has been illustrated in the accompanying drawings and described in the foregoing detailed description , it will be understood that the invention is not limited to the embodiment disclosed , but is capable of numerous rearrangements , modifications and substitutions without departing form the spirit of the invention as set forth and defined by the following claims .	6
specific embodiments of the present invention are hereafter described in detail with reference to the accompanying figures . like elements in the various figures are identified by like reference numerals for consistency . although the invention has been described and illustrated with a certain degree of particularity , it is understood that the present disclosure has been made only by way of example and that numerous changes in the combination and arrangement of parts can be resorted to by those skilled in the art without departing from the spirit and scope of the invention . referring now to fig4 , a mechanical drawing including a side 402 and top view 422 of a removable pv module - mounted power element according to a one embodiment of the present invention is shown . according to one embodiment of the present invention the power element 422 can be an inverter capable of converting dc power to ac power . in another embodiment of the present invention the power module is a dc conditioner capable of modifying the dc characteristics including , but not limited to voltage . while the present invention is hereafter described in terms of an inverter , one skilled in the art will recognize that the power element 422 can possess multiple functionalities without departing from the spirit of the invention . referring again to fig4 , a potted assembly inverter 422 in a non - conductive enclosure is shown with metallic blade connectors 404 , 405 , 406 , 407 , 408 , 409 , 410 to bring ac and dc wiring connections out of the enclosure 402 . the blade connectors 404 , 405 , 406 , 407 , 408 , 409 , 410 are designed to support high voltage and high current operation consistent with a single pv module output power . recessed mounting holes 403 , 420 , 421 are used in conjunction with a mounting clip to secure the inverter in the mounting bracket using a single installation motion . the dimensions and aspect ratio of the inverter 422 may be adjusted to support differing power requirements based on pv module design . the inverter is lightweight — generally less than 16 ounces — and does not significantly load the pv module to which it is attached . fig5 shows , according to another embodiment of the present invention , a mechanical drawing of a side 505 and top view 510 of an inverter mounting bracket mounted on the back of a pv module 502 . the bracket is attached to the back of a pv module 502 by an adhesive 509 that is placed between bracket 505 and pv module 502 prior to assembly . the bracket 505 is molded from a non - conductive material , such as a composite plastic or the like , to minimize cost . mounting clips 503 , 511 , 512 are used to lock the inverter in place once the inverter is inserted into the electrical high - voltage receptacles 520 , 521 , 522 , 523 , 524 , 525 of the bracket 505 . dc wiring connections 507 from the inverter receptacles to the pv module are made by wire or bus - bar means . connectors 504 , 530 , 531 are used to make all ac connections to the inverter via wires 506 to the inverter receptacles . the connectors 504 can be discrete or can be molded into the body of bracket 505 . inverter receptacles 520 , 521 , 522 , 523 , 524 , 525 may be recessed into the bracket to improve protection against weather , sunlight , ultraviolet radiation and other environmental features . fig6 shows a side and top view of an inverter 602 inserted into an inverter mounting bracket 604 according to an embodiment of the present invention . the high voltage pins 620 , 621 , 622 , 623 , 624 , 625 of the inverter are inserted into the bracket 604 receptacles . the inverter is locked into place to eliminate disengagement via vibration or accidental means via locking clips 612 , 615 that engage inverter mounting holes 613 , 614 . the design of the inverter 602 and inverter mounting bracket 604 results in spacing 603 of the inverter 602 from the back surface of pv module 605 thereby reducing heating of pv module 605 by heat generated in the inverter 602 . it is well known that the conversion of dc power to ac power by an inverter produces as a by product , heat . in a centralized type of system configuration in which dc power transported away from the pv modules for conversion , heat production by the inverter is of little concern . however in system in which an inverter is coupled to each pv module the generation of heat can significantly reduce the efficiency of each photovoltaic cell . to better understand the implications of heat generated by an inverter consider how a pv module operates . pv modules operate as current sources derived from a photoexcited semiconductor junction . the maximum available power from the pv cell is defined by the product of its output voltage and current . the current is due to generated photocarriers and , at low output voltages , will be proportional to the incident illumination on the pv cell and is termed the photocurrent . the pv cell behaves as if it has a photocurrent source in parallel with a non - illuminated junction diode . the output voltage is defined by the diode circuit effects implicit in the semiconductor junction and ultimately limits the maximum useful output voltage to a point where the diode current begins to increase significantly . diode current is a strong function of operating temperature and results in a reduced pv cell voltage for a given output current as temperature rises . pv module output power therefore decreases with temperature . this effect requires that the pv module temperature be kept as low as possible by mitigating any related heat sources as much as possible . previous designs neglect to consider this important aspect of power production . according to one embodiment of the present invention , a replaceable inverter 602 is mounted physically apart from the pv module . by maximizing surface area of the inverter open to surrounding air currents the heat produced by each inverter can be dissipated away from the inverter by way of convection to the atmosphere and not to the pv module . no tools are required to insert the inverter and only a simple blade screwdriver is required to release the clips for removal and replacement . shown in fig7 is a mechanical drawing , according to another embodiment of the present invention , of a side 703 and top view 710 of an inverter mounting bracket capable of being mounted on the back of a pv module 702 . the bracket is identical in design to the embodiment shown in fig5 with the exception of the method of ac connections . ac connections shown in fig7 are made using multi - conductor cables 704 , 730 , 731 that are affixed to mounting bracket 710 . the cables 704 , 730 , 731 are directly connected via internal wires 706 to bracket inverter receptacles 720 , 721 , 722 , 723 , 724 , 725 . fig8 shows another embodiment of an inverter mounting bracket that can be mounted on the back of a pv module 802 . the first ac connection shown in fig8 is made using multi - conductor cable , 804 or 831 , that is affixed to the mounting bracket 810 . a cable 831 is directly connected via internal wires 806 to bracket inverter receptacles 820 , 821 , 822 , 823 , 824 , 825 . the second ac connection is made via the bracket 810 mounted connector 830 and is connected to the inverter receptacles 820 , 821 , 822 , 823 , 824 , 825 via additional wiring 806 . the connector 830 may be discrete or molded into the body of bracket 810 . fig9 is a layout drawing , according to one embodiment of the present invention , showing the backside of an array 901 of pv modules 902 , 912 , 922 with inverter mounting brackets 904 , 914 , 924 attached at the dc connection location of each module . inverters 903 , 913 , 923 are inserted into inverter mounting brackets 904 , 914 , 924 , respectively . multi - wire ac connecting cables 915 , 925 are shown connecting the inverters . a multi - wire ac connecting cable 905 is shown connecting the inverters on the pv modules in the drawing and the ac grid ( not shown ). fig1 is also a layout drawing , according to another embodiment of the present invention , showing the backside of an array 1001 of pv modules 1002 , 1012 , 1022 with inverter mounting brackets 1004 , 1014 , 1024 attached at the dc connection location on pv modules 1002 , 1012 , 1022 . the inverters 1003 , 1013 , 1023 , according to the embodiment shown in fig7 , are inserted into inverter mounting brackets 1004 , 1014 , 1024 , respectively . multi - wire ac connecting cables 1006 , 1015 are connected together via connectors at the end of each bracket affixed cable . additional multi - wire ac connecting cables 1016 , 1025 , 1026 , 1035 are connected together via connectors at the end of each bracket affixed cable . the assembly is thereafter connected to the ac grid . fig1 shows a mechanical drawing of a top view of an inverter mounting bracket 1110 capable of being mounted on the back of a pv module . bracket 1110 is similar in design to the embodiment shown in fig7 with the exception of the design of the dc connections . in this embodiment , the dc connections are made using single - wire cables 1111 , 1112 that are affixed to mounting bracket 1110 . cables 1111 , 1112 are directly connected via their internal wires to bracket inverter receptacles 1120 , 1121 , 1122 , 1123 , 1124 , 1125 . the dc cables 1111 , 1112 may be placed in other locations than those shown in fig1 . likewise , fig1 presents a layout drawing showing the backside 1214 of a pv module 1212 with inverter mounting bracket 1203 attached according to one embodiment of the present invention . an inverter 1202 is shown inserted into the top of inverter mounting bracket 1203 . ac cables 1210 , 1211 are shown leaving the bottom of bracket 1203 . single - wire dc cables 1206 , 1207 connect the junction box 1205 to the inverter mounting bracket 1203 . this allows the inverter to be used with existing manufactured pv modules 1212 that have junction boxes 1205 pre - assembled without any modifications to pv modules 1212 . according to another embodiment of the present invention and as shown in fig1 , a bracket 1302 is attached to the back of pv module 1303 by an adhesive 1308 that is placed between bracket 1302 and pv module 1303 . the bracket 1302 is molded from a non - conductive material , such as a composite plastic or the like , to minimize cost . the inverter 1304 is completely enclosed within bracket 1302 . inverter connections 1320 , 1321 , 1322 , 1323 , 1324 , 1325 are connected to ac connectors 1306 , 1330 , 1331 and the pv module by internal wiring . cables 730 , 731 of the inverter mounting bracket 710 shown in fig7 may be substituted for the connectors 1306 , 1330 , 1331 shown in fig1 . likewise , the cable of the inverter mounting bracket 810 shown in fig8 may be substituted for the connector 1331 shown in fig1 . fig1 is a mechanical drawing according to another embodiment of the present invention showing a top view of an inverter mounting bracket 1410 mounted on the back of a pv module . the bracket 1410 is identical in design to the embodiment of fig5 with the exception of the method of placement of the inverter connection receptacles . an inverter connection receptacle 1425 is shown partially recessed into the bracket . when the inverter is removed from the bracket 1410 , the associated connector pin on the inverter is disconnected from receptacle 1410 prior to the inverter pins connected to receptacles 1420 , 1421 , 1422 , 1423 , 1424 being disengaged . a detection circuit is implemented in the inverter to determine that the connection to the receptacle 1410 has been broken and thereby disables all power currents into and out of the inverter . as a result , no arc is formed at the receptacles 1420 , 1421 , 1422 , 1423 , 1424 when the inverter is removed . similarly , power current flow into and out of the inverter is not enabled until after a complete connection has been made on the receptacle 1425 after the power connections have been established on receiving receptacles 1420 , 1421 , 1422 , 1423 , 1424 . since the connections have been established prior to the enabling of current , no arc can occur at the connection 1420 , 1421 , 1422 , 1423 , 1424 . the recessed receptacle 1410 and associated detection circuitry implements a hot - swap function in which the inverter can be removed and replaced while voltages remain active on all the ac and dc connections to the inverter without creating a potentially hazardous arc . similarly the connector pin 425 upon replacement of the inverter prevents operations of the inverter prior to the connection of the receptacles 1420 , 1421 , 1422 , 1423 , 1424 . as the inverter is mated with the inverter bracket , each receptacle of the inverter mates with a corresponding connection of the inverter bracket . subsequent to the connections being made the connection pin 1425 establishes contact with a corresponding component of the inverter bracket signifying that operation of the inverter can safely begin . in one embodiment the connection pin is a recessed pin / receptacle combination over which a simple continuity circuit can be attached while in another the pin is a telescoping pin coupled to a switch that signifies whether a complete connection or extraction of the inverter . fig1 is a flowchart illustrating methods of implementing an exemplary process for replacing a pv inverter associated with a pv module . in the following description , it will be understood that some blocks of the flowchart illustration , and combinations of blocks in the flowchart illustrations , can be implemented by computer program instructions while other blocks represent physical methodology . when implemented by a computer , these computer program instructions may be loaded onto a computer or other programmable apparatus to produce a machine such that the instructions that execute on the computer or other programmable apparatus create means for implementing the functions specified in the flowchart block or blocks . these computer program instructions may also be stored in a computer - readable memory that can direct a computer or other programmable apparatus to function in a particular manner such that the instructions stored in the computer - readable memory produce an article of manufacture including instruction means that implement the function specified in the flowchart block or blocks . the computer program instructions may also be loaded onto a computer or other programmable apparatus to cause a series of operational steps to be performed in the computer or on the other programmable apparatus to produce a computer implemented process such that the instructions that execute on the computer or other programmable apparatus provide steps for implementing the functions specified in the flowchart block or blocks . accordingly , blocks of the flowchart illustrations support combinations of means for performing the specified functions and combinations of steps for performing the specified functions . it will also be understood that each block of the flowchart illustrations , and combinations of blocks in the flowchart illustrations , can be implemented by various means including a computer , robotics , or via human implementation . indeed many of the steps illustrated in fig1 can comprise multiple steps that are not listed herein as they would be well known to one skilled in the art . furthermore the steps listed and discussed below are one example of a process for replacing a pv inverter associated with a pv module according to the present invention . fig1 begins 1505 with the identification 1510 of a pv inverter in need of replacement . the identification of an inverter can be due to failure of the inverter , periodic or preventive maintenance or for other reasons known to one skilled in the art . the determination of what pv inverter in a pv system needs to be replaced is not trivial and is not the subject of this invention . upon identification 1510 the pv inverter is released 1520 from its mounting bracket . upon release of any physical restraints holding the pv to the inverter bracket the pv inverter can be extracted 1530 from the bracket . note that during this process , and according to one embodiment of the present invention , the pv system remains operational and indeed the pv module to which the pv inverter is associated continues to provide dc power to the pv inverter . as the pv inverter is removed from the inverter bracket but prior to the connectors mating the pv module to the pv inverter from breaking contact , a connector pin indicates 1540 to the inverter that a secure connection between the inverter bracket and the pv inverter has been compromised . responsive to the connector pin breaking contact , the pv inverter ceases operation 1550 . as one skilled in art will recognize the termination of operation of the pv inverter can be accomplished by a number of methodologies . according to one embodiment a detection circuit is included in the pv inverter to ensure that a positive connection exists between the pv module ( inverter bracket ) and the pv inverter prior to converting the dc power to ac power . the process ends 1595 with the inverter being safely removed 1560 from an operation pv module without any electrical arc or danger to the technician . while there have been described above the principles of the present invention in conjunction with a pv module ac inverter mount and interconnect , it is to be clearly understood that the foregoing description is made only by way of example and not as a limitation to the scope of the invention . particularly , it is recognized that the teachings of the foregoing disclosure will suggest other modifications to those persons skilled in the relevant art . such modifications may involve other features that are already known per se and which may be used instead of or in addition to features already described herein . although claims have been formulated in this application to particular combinations of features , it should be understood that the scope of the disclosure herein also includes any novel feature or any novel combination of features disclosed either explicitly or implicitly or any generalization or modification thereof which would be apparent to persons skilled in the relevant art , whether or not such relates to the same invention as presently claimed in any claim and whether or not it mitigates any or all of the same technical problems as confronted by the present invention . the applicant hereby reserves the right to formulate new claims to such features and / or combinations of such features during the prosecution of the present application or of any further application derived therefrom .	7
referring to the figures , in which like reference numerals refer to like elements thereof , fig1 shows the left arm of a patient provided with a fistula suitable for hemodialysis . a fistula has shown itself to be the most effective , durable , permanent blood vessel access for extracorporeal blood treatment . a fistula is created by surgical intervention , whereby a connection is formed between an artery and a proximate vein , for example in the lower arm . the fistula is formed either by an opening being formed from the sidewall of the artery to the sidewall of the vein as shown in fig1 or by an opening in the sidewall of the artery being connected with the end of a vein . by means of the fistula , the blood flow in the artery is short - circuited to the vein , which leads to an arterializing of the vein and an increased bloodflow in the vein which allows taking out of bloodflows up to 500 ml / minute or more . as is clear from fig1 the arterial needle which leads to the extracorporeal circuit is always placed in the part of the arterialized vein which faces the hand , but at least three centimeters downstream of the connection between the artery and the vein . the arterial needle can either point towards the hand as shown in fig1 or in the other direction . the venous needle is to be inserted directed towards the heart , approximately five centimeters from the arterial needle . the expression &# 34 ; fistula &# 34 ; will be used below for the part of the arterialized vein where the needles are inserted . other types of blood vessel access can be used , such as a scribner - shunt or one or more catheters . fig2 shows an extracorporeal circuit of the type which is used in a dialysis machine . the circuit comprises an arterial needle 1 and an arterial tube 2 which connects the arterial needle 1 to a blood pump 3 which is normally of the peristaltic type , such as indicated in fig2 . at the inlet of the pump there is an arterial sensor 4 which measures the pressure immediately before the pump in the arterial tube 2 . the blood pump 3 leads the blood further , through tube 5 , to a dialyser 6 . the tube 5 can comprise an inlet 7 for heparin connected to a heparin pump 8 . many dialysis machines are additionally provided with a pressure sensor 9 which measures the pressure between the blood pump 3 and the dialyser 6 , i . e ., the so - called system pressure . the blood is lead through tube 10 from the dialyser 6 to a venous drip chamber 11 and from there back to the patient through a venous tube 12 and a venous needle 14 . the venous tube 12 is provided with a clamp device 13 which stops the blood flow upon the occurrence of a malfunction . the venous drip chamber 11 is provided with a venous sensor 15 which measures the pressure in the venous drip chamber . the arterial tube 2 can also be provided with a clamp device similar to the clamp device 13 . both the arterial needle 1 and the venous needle 14 are inserted into the fistula . when the blood passes the arterial needle 1 , which has as small a cross - sectional area as possible so as not to damage the fistula , the pressure sinks to between about - 20 to - 80 mm hg , which is measured by the arterial sensor 4 . the pressure rises in the pump 3 , said pressure being measured by the system sensor 9 . in the dialyser 6 , the pressure falls due to the flow resistance therein and the pressure downstream of the dialyser is measured with the venous sensor 15 , normally in the venous drip chamber . the pressure in the venous drip chamber is normally between about + 50 to + 150 mm hg . finally the blood is released to the fistula through the venous needle 14 , whereby a pressure drop occurs in the needle due to the flow through its small cross - section . the aforementioned pressure conditions vary considerably from patient to patient and can even vary for one and the same patient between different treatment sessions . it is therefore difficult to set up limit values for the pressure sensors which indicate different error conditions . it is particularly difficult to indicate whether the venous needle 14 is coming out of the fistula , particularly if the venous tube 12 is hanging over a position so that the venous needle is moved upwardly a long way when it comes out . in many dialysis machines one or more of said pressure detectors are not present . normally however there will be at least one veneous pressure sensor . fig3 shows a pressure curve which is obtained from the arterial sensor 4 in fig2 . this pressure curve corresponds to the pressure curve of the blood pump 3 on its suction side . the pressure pulses emanate from the periods of time when one pressure roller takes over from the other pressure roller , i . e . showing the pump stroke . the pressure curve in fig3 corresponds to the blood pump &# 39 ; s suction stroke , but also has a superimposed pulse signal obtained from the pulse in the fistula . this pulse signal is , however , very insignificant and cannot be observed with the naked eye in fig3 . in fig4 the pressure curve in fig3 has been resolved in the frequency plane ( fourier - transformation ). it can be seen that the signal consists of a base frequency , fo , at about 52 strokes per minute , as well as a large number of harmonics , of which only three can be identified in fig4 . by eliminating the frequency fo and its harmonics , the effect of the blood pump &# 39 ; s pressure pulses on the pressure in the arterial sensor 4 can be eliminated . such elimination can be done with the aid of notch filters . if the frequency and phase of the interference are known , notch - equivalent filters can advantageously be used . one example is the generation of sinus signals at the known frequency together with its harmonics and the subtraction of these from the signal at suitable phase . with an adaptive filter , the amplitude and the phase of the generated signals can be determined . this filter technique is known . the calculations and the subtraction suitably occur in a signal processor . the signal processor and its analogue / digital converter must however have high resolution since the pulse signal is very weak . fig5 shows the signal in fig3 in the frequency plane after subtraction of the interference due to the blood pump &# 39 ; s pressure waves , i . e . subtraction of the base frequency fo and its harmonics . from fig5 it can be seen that a half base frequency , i . e . 0 . 5 fo , is also represented in the frequency plane together with the corresponding harmonics 1 . 5 fo , 2 . 5 fo , 3 . 5 fo etc . ( fo , 2fo , 3fo etc . have already been eliminated ). this half base frequency is due to the fact that the blood pump used is of the peristaltic type , with two rollers which act on the tube segment in the blood pump . the rollers are probably not entirely symmetrical , which gives rise to the half base frequency ( 0 . 5 fo ). half the base frequency is also the same as the motor &# 39 ; s rotational speed . this rotational speed is known since it is generated by the dialysis machine . the motor which drives the blood pump can be constituted by a stepping motor which is driven at predetermined frequency . by using this known frequency signal or the known rotational speed of the blood pump , the frequency fo can be determined very accurately , which results in an accurate removal of these frequency components . fig6 shows the signal which is obtained after the above - mentioned adaptive filtering and elimination of the pump frequency and its harmonics . moreover , the pulse signal has passed a band - pass filter which lets through the frequencies 30 - 180 strokes / minute ( 0 . 5 - 3 hz ). as is clear from fig6 the amplitude of the pulse signal is dependent on many factors , such as damping in the tubes , etc . other factors can be changes in the height position of the arm , or that the needle has temporarily come closer to the wall of the fistula . even though fig3 - 6 relate to the pressure conditions of the arterial needle , the conditions are similar with a venous needle . an indication that the needle has fallen out is that the amplitude of the pulse signal sinks to zero . in practice , an alarm signal can be emitted if the amplitude sinks below 20 % of an earlier determined normal amplitude . this normal amplitude can be determined during the first stage of the treatment when the dialyser is being observed by a nurse , for example during the first half hour of the treatment . the pulse signal can disappear temporarily for other reasons than the needle having fallen out , such as the patient moving . the adaptive signal processing then re - adjusts the settings to the new situation , after which the pulse signal can be recovered and separated . such an adaptive adjustment to normal , but changed situations , takes a certain amount of time . it is therefore suitable if the emitting of an alarm signal is delayed by a short period of time on the order of a number seconds . another way of determining when an alarm signal is to be emitted is to determine the relationship between the amplitude of the pulse signals from the venous sensor 15 and the pulse signal from the arterial sensor 4 . due to the different damping in , for instance , the blood tube 2 and the blood tube 12 , respectively , as well as the venous drip chamber 11 , the amplitude from these sensors is different , whereby the venous sensor 15 generally has a lower amplitude . if the pulse signal from the venous sensor 15 disappears more or less completely at the same time as the pulse signal from the arterial sensor 4 is still present and substantially unchanged , this is a certain sign of a problem with the venous needle 14 ; either that it has come too close to the blood vessel wall or fallen out completely . according to the present invention it is proposed that the alarm signal is emitted when the relationship between the amplitudes for the pulse signals from the venous sensor 15 and the arterial sensor 4 , respectively , are changed substantially , such as the relationship between the amplitudes sinking below a limit value which is 50 % of the original value . if it is desired to obtain greater accuracy for the detection , said limit value can instead be set at 30 %. if there is a patient who has weak blood vessels , whereby it can easily happen that the venous needle 14 comes too close to the blood vessel wall , or if problems arise in another way which can be acceptable and would not lead to an alarm , the limit value should be set even lower , such as at 20 %. if the amplitude of the pulse signal from the arterial sensor 4 reduces greatly , this is probably an indication of a problem with the arterial needle 1 which can also give rise to an alarm signal . from fig5 it can be seen that if the frequency of the pulse lies close to the half base frequency ( 0 . 5 fo ) of the blood pump or multiples thereof , difficulties will occur in separating the pulse signal from the blood pump signal . in particular , there will be difficulties in such a separation if the difference between the pulse and any of the blood pump &# 39 ; s frequencies is less than about 5 - 10 %. in accordance with the present invention , it is suggested that the blood pump is adapted so that the pulse always lies at at least about 10 % from any of the blood pump &# 39 ; s frequency components . this can be done by making the blood pump increase or decrease its speed by about ± 10 % when the pulse detection system according to the invention senses that there is a risk of collision . such a change of the blood pump &# 39 ; s speed will hardly be noticed by the patient . in order to reduce the risk of exceeding any maximum possible bloodflow speed , said regulation can be - 15 % to 5 % or - 20 % to 0 %, or something similar . the frequency of the pulse signal can be used for other purposes such as are known per se . thus , a great rise in the pulse implies that there is a risk for shock , etc . since the pressure pulses of the blood pump 3 are strong , these pressure pulses can be transmitted to the venous sensor 15 through a path which comprises the tube 2 , the arterial needle 1 , the fistula , the venous needle 14 and the tube 12 to the venous sensor 15 . if the arterial needle 1 and / or the venous needle 14 comes out , said path for the pressure pulses will be broken and thus will cease . this characteristic can be used in order to detect the integrity of both the arterial needle and the venous needle simultaneously . fig2 shows a pressure sensor 9 for the system pressure . the pressure wave from the blood pump 3 passes through the system sensor 9 and the dialyser 6 to the venous sensor 15 . in this way there is both a time delay from the system sensor 9 to the venous sensor 15 and a damping . the system sensor 9 is positioned so that the pulse signal is very small or completely absent . by comparing the signals from the arterial sensor 4 , the venous sensor 15 and the system sensor 9 , suitable conditions for emitting an alarm signal can be determined . fig7 shows a schematic circuit similar to fig2 for single - needle dialysis , whereby the same reference numerals have been used for the same components as in fig2 . the difference compared to two - needle dialysis is merely that one needle is used . furthermore , expansion vessels 21 and 22 are required and often a second pump 23 . the system pressure sensor 9 is often placed after the dialyser 6 . apart from this , the function is basically the same as described above , in as far as concerns the present invention . frequencies between about 0 . 2 - 20 hz have been quoted above . the reason for the use of these frequencies is that they are in the infrasound range and do not give rise to audible sound . it is useful to use frequencies of about 1 hz since many patients find this frequency calming , presumably due to the fact that it is close to the frequency of the heart . normally , however , it is preferable to use frequencies for the blood pump which differ from the heart frequency if the pulse is to be used as an indication , for example 1 . 5 hz and upwards or below about 0 . 8 hz . an ultrasound generator can also be used as the pressure wave generator , it being coupled to the blood vessel by an arm band as described above , or to the extracorporeal blood circuit for transmission through the blood vessel access as described above . a suitable ultrasound frequency ought to lie at just above 20 khz , for instance 20 - 40 khz . in principle , it is possible to use frequencies within the range of 20 - 20 , 000 hz , but this is not preferred since it has apparently been found to be disturbing to the patients and personnel . the principles of the present invention can also be applied for detecting the condition of another component in the extracorporeal circuit , such as the dialyser , by letting a pressure wave pass through that component , and detecting the changed condition with a pressure sensor . the invention can also be used for other applications than those described in detail above , such as those mentioned in the introduction , like hemofiltration etc . the various electronic means for obtaining the desired function have not been described above although a skilled man will realise various possibilities and can practice the invention without a detailed account of any embodiments .	0
turning now to the drawings , fig1 is a schematic illustration of a sheet - fed rotary press . two printing units 1 are interconnected by impression cylinders 2 and 3 and sheet transport drums 4 and 5 . the printing units are driven by way of gearwheels disposed parallel to the impression cylinders 2 and 3 and sheet transport drums 4 and 5 . if sheet turnover is to be carried out between the two printing units , then the relative position of the two printing units must be changed by an amount corresponding to the length of the sheet for printing . for this purpose , at the transfer point between the impression cylinder 2 and the sheet transport drum 5 , there must be a relative displacement between the two printing units 1 in the transmission as well , since the sheet transport drum 5 now takes over not only the start of the sheet but also the end of the sheet from the impression cylinder 2 . a double gearwheel 6 is therefore flanged on the journal of the impression cylinder 2 . in this double gearwheel , a gearwheel ring is clamped to or released from a main gearwheel by means of a clutch 7 . the arrangement of a clutch 7 of this kind is shown in fig2 which is a section through half a double gearwheel 6 . the double gearwheel 6 consists of a main gearwheel 8 and a gearwheel ring 9 . the main gearwheel 8 is connected to a cylinder journal 10 . a clamping connection is made between the gearwheel ring 9 and the main gearwheel 8 by way of an annular clamp ring 11 . to this end , clamping elements 12 bear between the gearwheel ring 9 and the clamp ring 11 fixed to the main gearwheel 8 and force is applied by spring assemblies 13 . if there is no external load applied to the spring assemblies 13 , they urge the clamping element 12 against the clamping ring 11 and hence the gearwheel ring 9 against the main gearwheel 8 . the resulting frictional forces produce a reliable transmission of the drive forces . the drive forces are transmitted via a gearwheel 14 to the gearwheel ring 9 and hence also to the main gearwheel 8 and from the latter to the following drive elements . for the relative displacement when the machine is set to sheet turnover between the sheet transport elements in the sheet - fed rotary press , the clamping of the gearwheel ring 9 must be released . to this end , the clamping force of the clamping elements 12 between the clamp ring 11 and the gearwheel ring 9 must be cancelled or reduced . in accordance with the invention , an actuator is provided for the clutch mechanism 7 for releasing the frictional engagement of the clamping ring 12 . as shown in fig2 it consists of an inner ring 15 and an outer ring 16 . the two rings 15 , 16 are part of a hydraulic or pneumatic system . this system is mounted on the inner ring 15 on retaining bolts 17 , loading being applied by springs 18 . the outer ring 16 is urged to the left by compression springs 19 . the position of rest of the system is defined by abutment of the inner ring 15 against a carrier or subframe 20 fixed to the press frame 26 . an abutment surface 21 facing the inner ring 15 is provided on one side of the outer ring 16 . to release the clamping , the outer end face 22 of the inner ring and a crank ring surface 23 of the outer ring 16 are used as operative surfaces of the system . the clamping elements 12 receive the force application from the end face 22 of the inner ring 15 and a release element 24 with an inwardly directed lip connected to the gearwheel ring 9 acts as the force application for the ring surface 23 of the outer ring 16 . the position of the complete clutch 7 is defined by the carrier 20 which is rigidly connected to part of the press frame 26 . in detail , the operation of the clutch 7 will be further described in connection with fig3 and 4 , as follows . fig3 is a detail of fig2 in which the individual parts of the clutch have been enlarged somewhat . fig3 shows the clutch in the position of rest , in which it will be clear that there is a clearance a between the outer ring 16 and the release element 24 . a clearance b is also present between the inner ring 15 and the clamping element 12 . fig3 also shows the abutment surface 21 bearing against an inner ring surface 27 of the inner ring 15 . finally , a mounting 28 of the inner ring 15 bears against the carrier 20 . the spring 18 is provided for this purpose and bears against the retaining bolt 17 and urges the mounting 28 towards the carrier 20 . abutment of the outer ring 16 against the inner ring 15 is produced by the compression spring 19 which bears between the carrier 20 and the outer ring 16 . from the foregoing , it will be understood that the entire system , which is pressureless in this condition , is secured on an element fixed to the frame , namely the subframe or carrier 20 , and at no point touches the double gearwheel 6 or any of its elements . in this position the sheet - fed rotary press is operated normally . to release the clamping between the gear ring 9 and the main gearwheel 8 , a pressure medium is introduced via a pressure medium connection 29 into a pressure chamber 30 between the inner ring 15 and the outer ring 16 . the pressure chamber 30 is sealed off by high - grade seals 25 between the outer ring 16 and the inner ring 15 . pressurization of the chamber 30 results in the following events , which are shown in fig4 . the outer ring 16 and the inner ring 15 move apart against the force applied by the springs 18 , 19 . depending on the force applied by the springs 18 , 19 , for example , the outer ring 16 is first moved to the right until its lip or crank surface 23 abuts against the flanged application surface 31 on the release element 24 . since it cannot now move any further , the pressure medium which continues to be supplied causes the inner ring 15 to be moved to the left . in so doing , it lifts away from its abutment against the carrier 20 against the force of the spring 18 , until its end face 22 bears against the clamping element 12 . in this condition the unlocking system is free of any mountings fixed to the frame , except for minor spring forces . the release forces which are applied by way of the end face 22 and the ring surface 23 , bear against parts which are inside the gearwheel . the flow of force to release the clamping extends via the release element 24 and via the clamping element 12 to the gearwheel ring 9 . as the supply of pressure medium continues , the clamping is released without axial forces being transmitted to the main gearwheel 8 or its bearings . the main gearwheel 8 can be rotated relative to the gearwheel ring 9 , while the latter and the transmission parts coupled thereto are held fast . an additional effect in the construction is obtained by the fact that in the region of the abutment surface 21 a pressure chamber enlargement and an enlargement of the piston surface of at least 25 % are produced on the lifting of the inner ring 15 from the outer ring 16 , so that there is a corresponding enlargement of the force for releasing the clamping . on completion of the relative rotation between the transmission parts , the pressure medium system simply has to be rendered pressureless and the system returns to its original position ( as shown in fig3 ) automatically by the force of the springs 18 , 19 . all parts of the gearwheel are then out of contact and accordingly need not be accelerated during machine operation . consequently , there is no need , for example , for rotary feeds for the pressure medium . an alternative embodiment of the invention is shown in fig5 which basically uses mechanical elements . as shown here , a gearwheel ring 41 is mounted on a main gearwheel 40 and is clamped by means of a clamp ring 42 by way of tie rods 43 and spring assemblies 44 . the tie rods 43 are supported in a tension element 45 . the clamping force is applied by introducing a tensile force from the spring assemblies 44 into the main gearwheel 40 and , on the other hand , by way of the tensioning element 45 , tie rod 43 and clamp ring 42 to the gearwheel ring 41 . to cancel out or reduce the clamping force between the gearwheel ring 41 and the main gearwheel 40 a clutch is provided after the style of a recirculating ball spindle . it consists of an inner ring 46 and an outer ring 47 . the inner ring 46 is guided in the outer ring 47 by means of bearing balls 48 which run in screwthread - shaped bearing grooves 49 in the inner ring 46 and in the outer ring 47 . the inner ring 46 is mounted on the machine frame 26 by means of retaining bolts 111 and is loaded by compression springs 112 to the left away from the machine frame 26 . in addition , facing the main gearwheel 40 a support ring 113 mounted rotatably and axially is provided on the outer ring 47 , the necessary clearance a being provided between the support ring 113 and the tensioning element 45 . to release the clamping , the outer ring 47 is rotated , for example by means of a pneumatic piston 114 . in these conditions the bearing balls 48 roll in the bearing grooves 49 and shift the outer ring 47 away from the machine frame 26 and towards the tension element 45 . since the pivot angle required is relatively small , the row of bearing balls 48 can be secured against unintentional displacement at both ends by means of compression springs fixed in the bearing grooves 49 . no ball return system is therefore necessary . when the clearance a is overcome , the inner ring 46 is pulled towards the machine frame 26 against the force of the compression spring 112 and in these conditions overcomes a clearance b relative to the release element 115 . the clutch is then again free of the machine frame 26 and is supported solely between elements inside the gearwheel . in this case the flow of force is between the outer ring 47 , by way of the tensioning element 45 and the tie rod 43 to the clamp ring 42 , and between the inner ring 46 and the release element 115 and the main gearwheel 40 . it is possible for the outer ring to turn relative to the fixed main gearwheel 40 , because the support ring 113 is mounted for rotation relative to the abutment surface on the outer ring 47 . to re - clamp the gearwheel ring 41 on the main gearwheel 40 , the outer ring 47 is turned back by means of the pneumatic piston 114 and returned to its starting position by the force of the compression spring 112 . it is then again free of any contact with any gearwheel elements . here again , the release element 115 is the only required additional means mounted directly on the double gearwheel 40 , 41 . another embodiment of the release mechanism of the present invention is shown in fig6 . here , instead of a recirculating ball spindle , a cam drive is used to produce the operative movement . similar to the illustration in fig5 a release element 51 is fixed on the main gearwheel 50 . the clamping is transmitted by tie rod 52 and a tensioning element 53 to the clamp ring and the gearwheel ring ( neither of which is shown here ). in the embodiment illustrated in fig6 the clutch is constructed from three rings , the outer ring of the other embodiments hereinbefore being divided into two rings . an inner ring 54 is again fixed on the machine frame 26 so as to be displaceable and has a flat contact surface 56 . the outer ring 55 , disposed opposite the flat contact surface 56 , is carried on the inner ring 54 by tension springs , and has cams 63 in its surface . a number of such cams 63 are disposed similarly at the periphery of the outer ring 55 . an adjusting ring 57 is provided as the third ring between the inner ring 54 and the outer ring 55 . cam followers 58 , 59 are disposed at the inner periphery of adjusting ring 57 so that the cam followers 58 run on the cams 63 of the outer ring 55 and the cam followers 59 run on the flat contact surface 56 of the inner ring 54 . the number of cam rollers 58 , 59 provided corresponds to the number of cams 63 in the outer ring . in the position of rest , the inner ring 54 , which is guided for axial displacement on retaining bolts 60 , is held out of contact with the machine frame 26 by compression springs 61 and the distance between the outer ring 55 and the inner ring 54 being minimal , since the cam followers 58 are on the low point of the cams 63 . the unit consisting of the outer ring 55 , adjusting ring 57 and inner ring 54 is held together by the above - mentioned tension springs ( which are shown only in fig6 a ), so that the cam followers 58 , 59 are always in contact with their co - acting surfaces 56 , 63 . fig6 a shows the relative arrangement of the cams 63 , flat contact surface 56 and cam followers 58 , 59 on the adjusting ring 57 . on turning of the latter at its pivot arm 62 , the cam followers 58 , 59 run on the flat contact surface or the cams 63 opposite the same and , in so doing first shifts the outer ring 55 outward until it comes into abutment with the tensioning element 53 . the inner ring 54 is then moved inward against the force of the compression spring 61 until it abuts the release element 51 . only then is the force operative to reduce the clamping between the clamping element and the gearwheel ring and the main gearwheel 50 . in these conditions no movement is required at the outer ring since the adjustment movement is fully taken by the adjusting ring 57 which , of course , has bearing elements in the form of the cam followers 58 , 59 relatively to the two rings 54 , 55 . fig6 b shows a simplified version of the embodiment of fig6 . instead of the arrangement of cam followers , guide slots 64 are formed in the adjusting ring 57 and pairs of support rollers 65 are inserted in them . the rollers 65 are disposed one above the other , one resting on the flat contact surface 56 and the other on a cam 63 and both being in contact in the center . here again the two rings 54 , 55 are pulled towards one another by springs 69 , so that the support rollers 65 are held in their guide slots 64 . in this way the arrangement can be made even more compact and , in particular , very much simpler , while a larger number of support points is also possible at the periphery of the clutch . fig6 c shows another simplified version of the embodiment according to fig6 . instead of two cam followers , only one cam follower 66 is now provided for each support point on the adjusting ring 57 . the originally resiliently connected rings 54 , 55 are combined to form a rigid ring 67 . the cam is now in the form of a groove 68 in the ring 67 . in this case , a mounting may be necessary between the moving adjusting ring 57 and its abutment surface on part of the main gearwheel 50 , as shown in fig5 between the outer ring 47 and the tensioning element 45 . another embodiment of the invention is shown in fig7 . here the gearwheel ring 71 is disposed directly on the main gearwheel 70 . clamping is by way of a conical tensioning element 72 . the outside of the latter has a peripheral grip edge 74 and is clamped against the main gearwheel 70 by tensioning screws 73 at its conically extending hub . the outer ring 75 and the inner ring 76 of the actuator are each part of a pneumatic piston . for release purposes , the pressure chamber 77 is subjected to compressed air as a result of which the two rings 75 , 76 are pushed apart against the force of compression springs 78 . in these conditions the inner ring 76 is supported on the hub of the main gearwheel 70 and the outer ring 75 engages the grip edge 74 by a grip ring 79 and in so doing pulls the clamp element 72 out somewhat so that the clamping between the main gearwheel 70 and the gearwheel ring 71 is released . again , a large number of parts can be dispensed with this version of the invention . in addition , an effect becomes apparent here which can also be observed in the other versions . when the clamping is released , the main gearwheel 70 is automatically secured against turning by the fact that the coupling mechanism is supported between the gearwheel hub and the tensioning element 72 . thus no brake is now required and the sheet - fed press can also be turned by the drive motor on the side towards the feed unit , since the motor brake is no longer required to block one of the machine sections . fig8 shows another embodiment of the invention wherein clamping is achieved by means of conical tensioning elements . a gearwheel ring 81 is fitted to a main gearwheel 80 . a conically shaped annular tensioning element 84 is disposed between a collar 82 on the main gearwheel 80 and a collar 83 on the gearwheel ring 81 . the tensioning element 84 acts like a double belleville washer . tie rods 85 extend through the central circle of the tensioning element and are supported on the opposite side on a spring assembly 87 at the main gearwheel 80 via a retaining element 86 . the tie rods 85 are in turn held in a bearing plate 88 and are supported via the latter on the annular rise of the tensioning element 84 . as a result of the tensioning force of the spring assembly 87 , by way of the bearing plate 88 , the tensioning element 84 is forced apart or radially expanded by pressure on its center - line . in these conditions it is supported on the one hand via its inner surface 89 and its outer surface 90 on the collar 82 of the main gearwheel 80 and on the collar 83 of the gearwheel ring 81 , while on the other hand it is pressed axially with its end face 91 against the surface at right angles to the collar 83 . as a result of the foregoing , the friction surface for generating high clamping force between the gearwheel ring 81 and the main gearwheel 80 is considerably increased . in this way , the retaining force of the entire system is also improved , so that reduced spring forces can be used . in this case , it is also possible to release the coupling system in a different way , by using an electromagnet 92 which acts on the bearing plate 88 and hence on the tie rods 85 . the operating principle is equivalent to the versions already described . the electromagnet 92 is disposed in a ring 93 and has a concentric annular projection 94 . it is also axially displaceable at the machine frame 26 by way of retaining bolts 95 with loading being provided by a compression spring 96 . when the electromagnet 92 is switched on , it will first move against the force of the compression spring 96 until its projection 94 abuts the hub of the main gearwheel 80 . it then pulls up the bearing plate 88 and hence , by way of the tie rods 85 , the retaining element 86 , so that the spring force acting on the tensioning element 84 is reduced . as a result , the tensioning element 84 will on the one hand contract radially so that the clamping forces on the outer and inner surfaces 90 and 89 respectively are reduced . on the other hand , as a result of the force of the spring assembly 87 being relieved , the axially acting clamping force on the end faces 91 is also reduced . the gearwheel ring 81 is thus released to such an extent that it is possible for relative movement in relation to the main gearwheel 80 . normally , the arrangement of the double gearwheel or of its clamping elements is free of the electromagnet 92 . moreover , no additional mechanical elements are required for operating the release mechanism . a detent bolt 97 may be provided between the gearwheel ring 81 and the main gearwheel 80 for positional indexing . it is mounted resiliently in a bore 98 on the main gearwheel 80 . an index bore 99 is provided in the gearwheel ring 81 for matching purposes for the single - sided printing position . to change over to perfecting the detent bolt 97 has to be pulled . it engages automatically on resetting . the operation can be automated in respect of actuation and monitoring . in fig9 the clamping embodiment described above in connection with fig8 is constructed in accordance with the operation of original embodiments ( fig2 to 4 ), release being effected by means of an annular hydraulic or pneumatic actuator . at the main gearwheel 100 the gearwheel ring 101 is fitted on an outer collar 100a , the gearwheel ring 101 additionally having a collar 102 and the main gearwheel 100 an inner collar 103 . an annular tensioning element 104 with a conical annular wall is fitted so as to bear against the collars 102 , 103 . the tensioning element 104 is tensioned by spring assemblies 105 , tie rods 106 and a retaining element 107 so that it bears by its inner and outer surfaces against the collars 102 , 103 and by its inner end face against the surfaces of the gearwheel 100 and gearwheel ring 101 at right angles thereto and thus clamps the gearwheel ring 101 . release is effected by the supply of pressure medium to a pressure chamber bounded by an inner ring 108 and an outer ring 109 . in these conditions the outer ring 109 bears by its crank end on a flanged release element 110 fixed on the main gearwheel 100 and the inner ring 108 bears on the retaining element 107 so that the prestressing of the spring assembly on the tensioning element 104 is reduced and the gearwheel ring 101 can be turned . given a relatively constant ring piston area , less pressure energy is required than previously as a result of the force - intensifying effect of the enlarged friction surface at the tensioning element 104 . in fig1 the arrangement of a complete clutch is shown as a front attachment to the double gearwheel 6 . for this purpose , an inner ring 32 and an outer ring 33 are mounted on a subframe crossmember 34 which is held on the machine frame 26 on two or more supports 35 . in this way the clutch can be actuated and serviced at all times from the outside c of the machine . in fig1 , the entire arrangement is disposed directly on the machine frame 26 behind the double gearwheel . the inner ring 36 and the outer ring 37 directly enclose the journal bearing 38 of an impression cylinder . a release element 39 is fixed on the hub of the double gearwheel 6 . thus a very space - saving construction is obtained from the outside c . admittedly this renders operation and access difficult for any maintenance work , but in view of the simplicity of the mechanism no particular problems are to be expected during operation . there are also a number of possibilities for adapting the energy supply to the optimum energy in the press . for example , the pneumatic energy normally available at the press , which is at a relatively low pressure level , can be utilized by force boosting means , e . g . pressure boosters . this has already been indicated in the version with the conical tensioning elements . finally , the arrangement of release elements , retaining elements , clamp rings and spring assemblies is open to such a wide variety of options that they cannot all be shown here , although the variants illustrated are indicative of such further possibilities .	1
the general principle of the invention is based upon the implementation of an activity status management apparatus , capable of determining whether the terminals of a radio communications network are active or inactive , and to which a service provider external to the network can have access . with regard to fig1 an embodiment of the invention is presented , in which the activity status management apparatus 1 , independent of the network provider in question , manages activity status information of a radio communications terminal 2 , and makes this data available to service or content providers 3 external to the network . in order to simplify matters , a single radio communications terminal 2 has been shown in fig1 . the invention also applies of course to cases where the activity status management apparatus 1 manages activity status information from several radio communications terminals and , more preferably , to the case where the activity status of all the terminals on the network are managed by one or several activity status management apparatuses 1 . in the example illustrated in fig1 the terminal 2 belongs to a radio communications network 4 using the standard umts , also called 3g network ( for third generation radio communications network ). the invention also applies of course to all other types of radio communications networks , particularly to networks using the standard gprs ( also called 2 . 5g network ) or gsm , notably if taken in combination with a protocol of the wap (“ wireless application protocol ”) type . the service providers 3 are , in the example in fig1 linked to an activity status management apparatus 1 by a network 5 of the internet type , such as for example the world wide web . it should be noted that the network 5 can also be of any other type , and can notably be a radio communications network using the standards umts , gprs or gsm . service provider 3 here means any server on the radio communications network 5 for which knowing the waking status of the terminal 2 is useful . such a service provider can be , for example , a content provider , a localisation server of the terminal 2 , or an information broadcast server . the service provider 3 can notably be internal or external to the network 4 and , in a particular embodiment of the invention , the service provider 3 can be included in the architecture of the network 4 , or be the operator of the network 4 himself . the activity status management apparatus 1 comprises , following the example of fig1 an activity status server 11 , which analyses the activity of the terminal 2 in order to deduce information as to its activity status , and an activity status database 12 , which stores the information deduced by the server 11 . the server 11 and the database 12 can be integrated into a single management apparatus 1 , or be distant . in the latter case , it can be envisaged , for example , that the server 11 be connected to another communications network , of the internet type for example . the server 11 and the database 12 comprise in this way the specific means which enable them to exchange data and notably the activity status information of the terminal 2 . according to a first embodiment illustrated in fig1 the terminal 2 disposes of an activity status client which sends a datagram indicating that it is active to the activity status server 11 at regular intervals . when a long period of time goes by without the activity status server 11 receiving a datagram , it deduces that the terminal 2 has turned inactive . it then transmits this information to the database 12 , which updates the status information register so that the activity status information associated with the terminal 2 takes on the value of “ inactive ”, indicating that the terminal is on standby . it should be clear that in the particular embodiment where the database 12 and the server 11 are integrated into a single activity status management apparatus 1 , the apparatus deduces the terminal 2 &# 39 ; s activity status information and stores it directly in a status information register . according to a second embodiment not shown in fig1 a connection of the type tcp is maintained open between the terminal 2 &# 39 ; s activity status client and the activity status server 11 . maintaining this connection presents the advantage of being very inexpensive and of giving the activity status server 11 an indication of the terminal 2 &# 39 ; s unavailability when the tcp connection is broken . the activity status database 12 ( or the activity status management apparatus 1 in the case where the database 12 and the server 11 are integrated into a single apparatus ) can then update the status information register , as described above . such an embodiment can present certain difficulties , notably that too many tcp connections must be maintained open simultaneously . an alternative embodiment can therefore be envisaged , corresponding to a dual mode of operation in which a tcp connection is maintained open between the terminal 2 and the activity status server 11 for a predetermined maximum length of time , for example depending on the operational restrictions of the network 4 , and can then be reallocated later on . it can be envisaged to implement a mode of operation corresponding to a combination of different embodiments presented above . a tcp connection is maintained open between the activity status server 11 and the terminal 2 , which periodically transmits ip packets ( for “ internet protocol ”) to the server 11 to inform it , amongst others , of its activity status . thus , to determine whether the terminal 2 is active or inactive , the server 11 can analyse the status of the tcp connection ( open or broken ), then refine the status information , estimating the length of time passed since the last ip packet was received ( inferior or superior to a predetermined threshold ). the server 11 can also refine the waking status information associated with the terminal 2 by analysing the contents of the ip packet received . in fact , according to the invention , the terminal 2 &# 39 ; s activity status client can insert information relating to the waking status it wishes to indicate to the server 11 into the ip packet transmitted to the server 11 . thus , the terminal 2 can be on , but its user can indicate to the server 11 that he does not wish to be considered active , except in the case of an emergency , for example . by way of example , the case of a temporary connection can be described , established upon the terminal 2 &# 39 ; s request . for example , the terminal 2 sends a request of the type http , which entails a request to establish a tcp connection . a client of the terminal 2 can request that the communications network 4 , of the type gprs for example , establish a pdp context (“ packet description protocol ”). this then entails the reservation of an ip address allocated to the terminal 2 , which can then send packets through the gprs network 4 . this context implies that the radio resources are allocated to the terminal 2 when , for example , it sends or receives data . such an external ip address is established by the network 4 of the operator for a predetermined time that corresponds to the duration of the establishment of the pdp context . such a period of time is superior to the duration of a connection tcp . in addition , the network 4 associates a timer to each pdp context , which is deactivated when the maximum predetermined duration expires . such a characteristic is necessary for the establishment of a web session by the terminal 2 because such a session comprises many tcp connections that must however have the same ip address . in addition , it must be noted that a pdp context is costly in terms of network resources . such a pdp context thus makes it possible to maintain contact between a public address and a private address on the level of a router ( gateway gprs signalling node ) which connects the gprs network to the worldwide internet . if the terminal 2 disconnects this can be detected by the tcp protocol status machines . the activity status server 11 considers , by default , that the terminal 2 &# 39 ; s status does not change during the period separating two successive connections . in other words , the activity status server 11 exploits the last status information received from the terminal 2 to determine whether it is active or inactive . in the case where the status information of the terminal 2 has not been updated for a long period of time ( and therefore for example if the “ pdp context ” has expired ), the activity status server 11 can modify the status of the terminal 2 which it has stored ( and therefore deduce from the expiration of the context that the terminal can no longer be contacted ). for example the activity status server 11 can consider the terminal 2 to be unavailable , or inactive if no new status information is transmitted to it for a period of time superior to the predetermined threshold , about 10 minutes for example . in the example in fig1 the activity status server 11 manages the terminal 2 &# 39 ; s activity status information , but can also manage data relating to the terminal 2 &# 39 ; s user subscriber &# 39 ; s profile . this data can be stored in the activity status database 12 . the user of the terminal 2 subscribes , implicitly or explicitly , to an activity protocol with the server 11 , determining notably the structure of the datagram or the ip packet transmitted to the server 11 . in one embodiment of the invention , the activity protocol ensures that the message sent from the terminal 2 to the server 11 comprises a certain number of bits and that each bit is associated with a particular mode of transmission , associated with a class of services offered to the terminal 2 . one service can of course belong to several distinct classes of services if the service provider implements several distinct modes of transmission in order to offer this service to the user . for example , a content provider can choose to transmit contents to the terminal 2 by data transmission of the wap type and by notification of the sms type . thus , the activity status management apparatus 1 or the activity status database 12 can keep an activity status register up to date , grouping together waking status information of the following structure : bit 1 notification bit 2 normal voice bit 3 urgent voice bit 4 normal wap push bit 5 urgent wap push bit 6 filtered voice each bit 1 to 6 is associated with a mode of transmission used preferably for a class of services to which the terminal 2 has access via the communications network 4 . for example , bit 1 corresponds to the emission and / or reception by the terminal 2 of notifications , for example of the sms type . bits 2 and 3 correspond to the possibility of receiving calls of the types normal or urgent . the bits 4 and 5 are associated to data transmission within the framework of wap protocol . by way of example , services of the type “ alert ” linked to the security of goods or of people and services of the type “ stock market info ,” which typically use a mode of the type wap push . if the user of the terminal 2 sends an ip packet to the server 11 in which all the bits of the above structure are positioned at 1 , the server 11 can deduce that the terminal 2 must be considered as active for all mode of transmission mentioned above . inversely , if all the bits are positioned at 0 , the user wishes his terminal 2 to be considered on standby with regard to all the modes of transmission , and therefore does not wish to be disturbed . if the activity status server 11 receives an ip packet from the terminal 2 in which the bits 1 and 3 of the above structure have the value of 1 , and all the other bits have the value of 0 , the server 11 can therefore deduce that the user accepts to receive notifications ( for example short messages ) and urgent calls , but wishes to be considered inactive , and therefore unavailable , for all other modes of transmission implemented in the network 4 . identification data , called userid , is in addition associated to the terminal 2 &# 39 ; s user and is transmitted in the datagram to the activity status server 11 . the server 11 can then interpret the protocol used in the ip packet received depending on the identification data . it can in fact store in memory a table associating an activity protocol with each userid of the radio communications network 4 . for example , the msisdn of the terminal 2 &# 39 ; s user can be used as identification data . the use of any other type of identification data can of course be envisaged to enable server 11 to identify the originating point of a datagram or ip packet received . in addition , if the terminal 2 wishes to access a service offered by a service provider 3 disposing of a particular apn (“ access point name ”) for its service , the terminal 2 &# 39 ; s activity status client attaches the public ip address at which the terminal 2 &# 39 ; s user can be contacted to the datagram transmitted to the server 11 in the ip packet . in the same manner , if the service provider 3 is connected to the activity status management apparatus 1 or to the activity status database 12 through the worldwide internet , a tcp connection can be established between the terminal 2 and the apparatus 1 ( or the database 12 ), and authentication data can be added to the ip packet passing between the terminal 2 and the apparatus 1 when the session is established . the status information relating to the terminal 2 , updated by the activity status server 11 , can then be made available to service providers 3 over the network 5 . several mechanisms can be envisaged within the framework of the invention to this effect . thus , it can be envisaged that the database 12 ( or the apparatus 1 ) stores the addresses of a large number of service providers 3 , and that it sends notification to all these service providers 3 each time the activity status information associated with terminal 2 changes in value . it can also be envisaged that a service provider 3 regularly or upon need carries out a polling of the activity status management apparatus 1 or of the activity status database 12 in order to determine the activity status of terminal 2 . it can also be envisaged , in the framework of the invention , that any other technique enabling a service provider 3 who wishes to determine the waking status relative to a given terminal 2 be implemented . the invention as illustrated in fig1 also enables the activity status server 11 to send notification to terminal 2 &# 39 ; s user . in other words , the activity status server 11 can transmit a particular piece of information to the terminal 2 , or a notification instructing the user to pick up some particular data . for example , the server 11 can invite terminal 2 &# 39 ; s user to go to a wap page containing notification information intended for terminal 2 . [ 0120 ] fig2 presents an example of embodiment of the invention in which a tcp connection remains open between the terminal 2 and the activity status server 1 . according to the tcp protocol , the terminal 2 regularly sends ( 21 ) a synchronisation message , called syn , to the activity status server 11 . for example , a syn is sent every 14 seconds . the server 11 acknowledges ( 22 ) the syn received , and the terminal 2 acknowledges ( 23 ) in turn the acknowledgement received by the server 1 . an initial piece of data is sent ( 24 ) by the terminal 2 &# 39 ; s activity status client to server 11 when the tcp connection is initialised . such an initial piece of data comprises for example the userid identification data of the terminal 2 &# 39 ; s user , the public ip address at which he can be contacted , authentication data and the waking status information which the user wishes to signal to the server 11 . afterwards , only the syn relating to the maintenance of the connection and the states of readiness , containing data on the terminal 2 &# 39 ; s activity status , are sent to the server 1 . according to this embodiment , beyond the establishment of the connection , at which time a large quantity of data is exchanged between the terminal 2 &# 39 ; s activity status client and the server 1 , it should be noted that the volume of user data transmitted by the terminal 2 is advantageously small . in fig3 an example of the implementation of the invention similar to that described in fig2 is shown , but in which the protocol used is the udp protocol . in the example in fig3 the terminal 2 belongs to a radio communications network 4 using the standard gprs . it should be noted that the udp protocol is the protocol used by the wap protocol for transmission between the mobile terminal and the wap gateway . when a message is sent , a bearer connection is established in the gprs network 4 between the mobile terminal 2 and the gprs gateway service node , called ggsn . this bearer connection will be maintained in the network for a configurable time , independent of the service running over the udp . it should be noted that a bearer connection is a low - level connection that makes it possible to transport ip packets between two points . by way of example , the pdp protocol (“ packet description protocol ”) can be considered , as used in a modem connection . the ggsn gateway then maintains a correspondence between the ip address allocated dynamically to terminal 2 during the establishment of the bearing connection , and the identification data of terminal 2 . a notion of session over the udp protocol must be reconstituted , associating the identification data of terminal 2 &# 39 ; s user ( that is to say his userid , for example his msisdn ) and a changing ip address . as illustrated in fig3 the activity status client implemented by the terminal 2 therefore sends ( 31 ) initialisation data to server 11 , comprising notably its userid , authentication information , the public ip address at which it can be contacted and data concerning its status . a session is then established , and the server 1 sends ( 32 ) data called sessionid to terminal 2 , making it possible to identify the session . a first ip address , shown as @ ip 1 in fig3 is associated with terminal 2 . in the examples presented in relation to the fig2 and 3 , the data packets sent by the terminal 2 to server 11 contain little information . it can therefore be envisaged in the framework of the invention that the server 11 sends a response to terminal 2 upon reception of the data packets . such a response , or return data , can for example be data of the push type , that is to say a notification . more generally , the structure of the return data can use the principles of e - mail , of the web and of the sip protocol , and for example be constituted of data blocks of the mime type . it can for example be envisaged that such return data present the following structure : thus , the field “ voice notification ” makes it possible to indicate to the user that he should consult his voice mailbox , and the fields “ normal wap push ” and “ urgent wap push ” make it possible to indicate to the user that he can consult a wap page ( of the type push ). [ 0142 ] fig4 shows the manner in which the invention is implemented when a service provider 3 wishes to send a notification to terminal 2 &# 39 ; s user . during the step numbered 41 , the service provider 3 sends contents xyz to the activity status management apparatus 1 , intended for terminal 2 &# 39 ; s user . the apparatus 1 ( for example through the database 12 illustrated in fig1 ) sends back ( 42 ) data indicating that the terminal 2 is on standby with regard to this type of service . during the step numbered 43 , the service provider 3 sends a new contents xyz ′ to the apparatus 1 , destined to replace the contents xyz previously transmitted . the apparatus , having received ( 44 ) from the terminal 2 data indicating that it is active , transmits the contents xyz ′ to terminal 2 during the step numbered 45 . for example , in a particular embodiment where the apparatus 1 comprises an activity status server 11 and a distant activity status database 12 , server 11 transmits the contents xyz ′ to terminal 2 , upon validation by the database 12 of the active status of terminal 2 . the terminal 2 can then acknowledge ( 46 ) reception of the contents . the activity status management apparatus 1 acknowledges ( 47 ) in turn the transmission of the message with the contents xyz ′ to the terminal 2 , with the service provider 3 . it should be noted that , in the example in fig4 the activity status management apparatus 1 plays a role close to that of systems which transmit short messages of the type sms of the prior art , without however being connected to the hlr implemented in classic radio communications networks .	7
the various embodiments will be described in detail with reference to the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . references made to particular examples and implementations are for illustrative purposes , and are not intended to limit the scope of the invention or the claims . an aeroponic growth system will be referred to as an “ atrium ” 190 , which includes the electronics and various mechanical systems embodied in an enclosure including a water reservoir and a top , wherein the plants being grown generally are kept in a basket - type device with the roots extending down towards the bottom of the reservoir . in some systems there is little water ; the box is to provide a volume for the roots to occupy . the systems providing the present invention may comprise a portable , wireless sensor system 160 and a collar 170 affixed to a container for the water , nutrients , and various pumps and other equipment 180 for growing plants according to the aeroponic methodology 190 . a system referred to as a “ lef ” 110 , or lights , exhaust gas temperature , and fan control includes lighting equipment , a wireless communications device , temperature sensor , fire detector , fan , and input terminals for mains power . some number of access points 102 are connected to a router 101 connected to a lan / wan 103 and may also connect to a local console 104 and another router providing firewall protection 015 and eventually connection to the internet 107 . a link server 150 may include wireless capability , and be in communication with all other appliances on the network , whether via wi - fi or wired via a wireless node . in some embodiments there is optional equipment , some , all or none of which may be utilized at a given installation . examples include a smart tablet or phone 120 , a camera 130 , and a roving sensor 140 . the atrium 190 may be contained in a single enclosure , which may include some overhead support structures . the system 190 may include a qr code conveniently placed where the tablet or smart phone 120 or camera 130 may read the qr code and report it to the link server 150 , thereby making an association of a specific system 190 . an electronic serial number (“ esn ”) in the collar 170 makes a logical association between the system 190 and the instant wand 170 . a qr code emblem in the lef 110 may be used in the same manner . a system referred to as a “ wand ” 160 , an acronym for water , air , network device , may be provisioned with a variety of sensors according to the system designer &# 39 ; s need . in some embodiments of the instant disclosure the wand 160 comprises air sensors for co2 , co , and o2 , and a sensor for ambient light . the wand 160 may also comprise water sensors , for sensing ph , temperature , tds ( total dissolved solids ) or resistivity . the wand 160 may be completely devoid of internal power , instead be inserted into a collar 170 wherein the collar induces power into the wand 160 via proximate coils . such an arrangement enables a system to be built and used wherein the wand 160 is easily removable for a variety of reasons . examples include replacement due to failure or changing the sensor complement of a given wand 160 , therefore growth system 190 . wands 160 may be configured with wireless communications capability , thereby acting as a gateway . wired communications are sometimes provided by inductively communicating between the wand and the collar 170 , the collar 170 in turn connected to other devices within the growth system 190 by any means . the collar 170 includes an esn , which may then be used to identify a given growth system 190 to the link server 150 . further details regarding the wand 160 and the collar 170 may be found in the ‘ 774 disclosure . looking to fig2 , detailing the subsystems 180 associated with the atrium 190 , an rs - 485 bus 205 provides for communication between the atrium electronics 181 and the collar 170 . looking to fig3 , the ace ( atrium chamber electronics ) 181 comprises a mister system 235 ; a pump for mixing and siphon priming 240 ; a valve to a water source 245 ; two pumps to water misters , one for a first bank 255 and one for a second bank 260 ; and five canister dispensing pumps with check valves . the canisters may be for the following nutrients ( fig2 ): phosphate 265 ; nitrogen 270 ; potassium 275 ; acid for ph decreasing 280 ; and a base for increasing ph 285 . the ace 181 also includes a status / warning light 350 . an mcu 310 manages the various sensors and drivers in order to control the hardware systems within the atrium 190 . mains power 302 is provided to the system from the facility in which it is operated . the mains 302 provide high voltage , for example 120 vac to a 24 vdc converter 303 . the 24 vdc converter 303 provides operating power to the downstream pumps . a ups 345 senses the output of the mains 302 , and under certain conditions , for example power failure , takes over and provides 120 vac to the 24 vdc supply , which continues to operate until either power is restored to the mains 302 or the ups 345 unit &# 39 ; s battery fails , and which time the entire atrium 190 fails . the ups 345 system provides a unique safety backup similar to how data centers are configured to be failure resistant . the ups 345 may communicate with the mcu 310 via a usb line 330 , providing data as to the condition of the mains 302 level and the state of the ups 345 backup battery . consider an atrium 190 comprising nine plant locations in nine plant baskets . each plant is provided with two transducers to generate mist for the roots from two small reservoirs holding the water or water enriched with nutrients . in one embodiment eighteen mister drivers 315 provide control signals to the eighteen transducers . signals from the mister drivers are provided to an analog front end 305 , wherein the signals are converted to digital versions of the analog signals and provided to the mcu on a bus 306 . the data is used by the mcu to determine if a transducer has gone bad or a reservoir gone dry , causing the transducer to shut down . a motor driver 325 includes seven outputs for driving pumps , for example peristaltic pumps . for backup , the nine misters comprising two small water reservoirs per plant are refilled by two different pumps 255 , 260 such that if one side fails to all nine mister reservoirs the other pump will likely still be operable . the other five motor driver 325 output signals control individual canister pumps wherein each canister contains a liquid or gel nutrient . for example , in one embodiment the five canister pumps are assigned to canisters holding phosphate 265 ; nitrogen 270 ; potassium 275 , an acid to decrease ph 280 ; and a base to raise the ph . a water level sensor 320 , for example an etape water level sensor , provides a signal voltage that varies with how much water the sensor 320 is covered by . the water level sensed is the main water reservoir of the atrium 190 . the status light system 350 provides different color lights which may be turned on by the system to identify status or problems . an example component is a qlight st56ecf - bz - 1 , available from qlight , 185 - 25 , mukbang - ro , sangdong - myeon , gimhae - si , gyeongsangnam - do 621 - 812 korea . the light 350 may signal such conditions as good , a warning that the water level is low but useable , or an out of service condition such as failure of the mister pumps ( 255 , 260 ). a solenoid controller 335 controls a valve for adding water 245 and another valve for priming the draining tube 240 . there is also a pump control for operating a circulation / draining pump 250 . fig4 is an example of a system referred to as a lights , egt , and fan system or “ lef ” 110 . the lef 110 performs several functions wirelessly other than the mains power 405 provided by the facility in which it is installed . ac power is delivered 405 to a relay 440 for turning on lights 470 . the lights 470 maybe be any suitable lighting technology . a controller system 415 includes components for rectification and voltage reduction as needed . the controller 415 may comprise an mcu for controlling the system 110 and an analog front end or other adc functionality . a contactless ad voltage and current sensor 410 provides signals to the adc within the controller 415 . ac mains power 405 may also be provided to a fan 450 , enabled or disabled by a relay 430 under the control of the controller 415 . a temperature sensor 460 for sensing the local temperature provides its signal to the adc of the controller 415 . a two - way wireless device 420 , for example a wi - fi transceiver , may be connected to the controller 415 , thereby enabling the controller 415 to report the lef 110 status to the link server 150 or to receive a recipe or commands from the link server 150 . a qr sticker 480 may be viewed by the smart device 120 or camera 130 to associate the instant lef with a particular atrium 190 or position in the facility . the controller may perform several functions beyond energizing and de - energizing relays . for example , the controller 415 may read the temperature from sensor 460 and if the temperature is above a predetermined value turn on the fan 450 until the temperature returns to a desirable value . the controller may also have a predetermined cycle of turning the lights 470 on and off per instructions from the link server 150 . in some embodiments other sensors may be provided , for example a co detector or fire detector for protection of the atrium , facility , or human staff . the system of fig1 may be related to just one atrium in service . however it may be deployed in a large plant growing facility , thereby providing efficiency by amortizing the cost of some components over a larger number of atriums 190 . the key component in the system 100 is a link server 150 . the link server may support any wireless technology , such as wi - fi or a proprietary technology . in some embodiments all of the communication equipment is off the shelf components , configured as a unique command and control system . a key component of the system 100 is a link server 150 . the link server may be designed in a variety of ways , for example a programmed raspberry pi . strictly for the purpose of illustration , a wi - fi based system has been arbitrarily selected to be an example for the instant disclosure . the link server performs a variety of functions . in some embodiments the link server 150 collects data from other wireless components of the system , connecting via one or more access points 102 , wherein the access points 102 are deployed throughout the growth facility so that there are no “ blind spots ” for data and control . for example the link server may receive requested air or water sensor data from the wand 160 . the wand 160 is coupled to the collar 170 for data from ace 181 on an rs - 485 bus 205 ( fig2 ) enabling data , status and such related to the entire atrium 190 via the wand wi - fi link . when a wand 160 is installed in a collar 170 a pairing procedure may command the wand 160 to interrogate an esn in the collar , thereby matching the wand 160 with the collar 170 , thereby the atrium 190 for which the wand 160 provides data . in some embodiments a controller in the wand 160 has been set up by the link server 150 to report various sensor data per a schedule . in other embodiments the link server 150 requests sensor data when it wants it , which may be in place of or in addition to the schedule in place in the wand . in a similar fashion , the link server 150 may provide on / off pattern data to the controller 310 in the ace 181 for scheduling the operation of the water pumps 255 , 260 , 240 , 245 , 250 or the on / off times for the mister transducers . as with the wand , the ace 181 controller 310 functions may be per patterns and schedules commanded by the link server , or a local function , or a combination of the two . data from the link server , for example the status and other information of a given atrium 190 may be provided to a wireless tablet or smart phone 120 . the tablet or smart phone 120 may be used the other way as well . that is , to send commands to the link server . for example , the link server 150 could be commanded to turn all lights on or off . a camera 130 , either dedicated or a camera that may be included in a smart tablet or phone 120 may interrogate a qr code sticker on an atrium 190 or a lef 110 , thereby to cause an association with an atrium 190 and a newly installed wand 160 . in some embodiments qr stickers are placed on various known positions in a facility and , again , making the location of the qr code known . for example , the camera 130 may be used to report the position of a portable sensor , such as a system for determining ambient temperature , by scanning the qr code sticker on a nearby atrium 190 . the access points 102 may connect to a router 101 , which would take care of such network duties as assignment of dnss to all devices in the lan . a factory console 104 may connect to the link server 150 through the router for the purpose of getting data , status , downloading recipes , and even insuring that the link server 150 is healthy . in some embodiments atriums 190 are installed adjacent to each other , for example nine in a row . this configuration is referred to as a “ master / slave ” arrangement . this may provide for several advantages . for example , each atrium may include a siphon tube between each atrium in line . installation may be accomplished by filling two adjacent atrium units 190 with the desired amount of water , then priming the siphon tube with a mechanical priming tool . this would be done in sequence until the end of a row , for example nine atriums 190 , then the tube exiting the last atrium 190 may be returned to the water siphon input of the first atrium 190 , thereby completing a water circuit . a pump 245 may keep the water flowing between units , thereby keeping water from becoming stagnant or gross variations between atriums 190 . in some embodiments only one wand 160 has water and air sensors , the other atriums 190 being equipped with wand 160 units which are only for communication . fig5 provides details of the master / slave configuration . fig6 is a table of the meaning of various symbols used by fig5 when water from the pump 245 is to be directed to mix in nutrients and / or stir the tank 505 for measurements , the mixing / siphon break valve 240 is opened and the pump 245 is switched on . since the siphon drain line 510 requires a higher water head than the mixing / siphon break line 515 and the check valve will prevent back flow , water flows through the open valve through the eddy jet and back into the tank 505 . when a water drain process is initiated , the mixing / siphon break valve 240 is closed and the pump 245 is switched on . a check valve will prevent back flow while the siphon primes . falling water levels inside the tank , as measured by the water level sensor 320 , will confirm that the siphon drain 510 is primed and running . at this point the check valve will have opened and draining will continue with the pump switched off . if a drain operation is to be partial , the siphon may be interrupted by opening the mixing / siphon break valve 240 . since the eddy jet 520 is always above the water line , the open valve will introduce air to the siphon , terminating the drain operation . in some embodiments the inlet filter and measurement channel and pump are inside a “ pump bag ” inside the main mixing tank . a pump bag is commonly used in swimming pools as a pre - filter for a pump . it is simply a bag made out of filter material . in one embodiment it is just a bag which is open at the top , above the water line that provides a filtered area of water within the main tank 505 . the siphon input picks up inside the tank 505 and the check valve is close to the pickup end of the siphon input line . the siphon drain ( top end of the siphon ) rises over the edge of the tank 505 . note that the siphon input is not inside the pump bag so that the tank can drain at max rate , even if the pump bag is fouled . the pump is inside the pump bag to protect the pump . the pump input and the siphon input are not the same line and the check valve is not in the pump input . since the siphon input tube is inside the tank , the mixing / siphon break valve is also inside the tank above the water line but below the edge of the tank and importantly below the peak of the siphon drain tube . this is also true for the mixing / siphon break line 515 , the venturi and eddy jet 520 . the preceding description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention . various modifications to these embodiments will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention . thus , the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the following claims and the principles and novel features disclosed herein .	7
the present disclosure proposes a technique in which a membrane distillation process is combined with a bio - reactor . the membrane distillation process induces evaporation of water by endowing a temperature difference to both sides of the membrane and condenses and extracts the evaporated vapor , which gives great improvement of treated water quality . in the present disclosure , the membrane modules are immersed in a bio - reactor , and detailed configurations of the membrane modules and the channel for an optimal membrane distillation process are proposed . in addition , the present disclosure proposes a technique for generating bio - gas by operating the bio - reactor in an anaerobic condition , and also proposes a technique for minimizing adhesion of contaminants to a surface of the membrane by providing rotary disks at both sides of the membrane module and also providing a fluidizable media in the bio - reactor to contact the surface of the membrane . hereinafter , an apparatus and method for anaerobic wastewater treatment with membrane distillation according to an embodiment of the present disclosure will be described in detail with reference to the drawings . referring to fig1 to 3 , the apparatus for anaerobic wastewater treatment with membrane distillation according to an embodiment of the present disclosure comprises a bio - reactor 100 . the bio - reactor 100 performs anaerobic treatment to wastewater to induce generation of bio - gas and also gives a space for mounting submerged membrane modules 10 . in order to maintain the anaerobic state , the bio - reactor 100 is isolated from an external environment , and an air supply device such as an air diffuser provided at an existing mbr is excluded . the submerged membrane modules 10 provided in the bio - reactor 100 play a role of filtering off contaminants in the wastewater through a membrane distillation process . the membrane distillation process basically gives a temperature difference at both sides of the membrane to filter contaminated water by evaporating moisture from the contaminated water and retrieving the clean water by condensing evaporating moisture . in the present disclosure , in order to implement the membrane distillation process , the submerged membrane module 10 is configured as follows in detail . the submerged membrane module 10 comprises a channel - formed plate 110 and a unit membrane 120 ( see fig4 ). channels are provided at both surfaces of the channel - formed plate 110 , and the unit membranes 120 are provided on both surfaces of the channel - formed plate 110 . here , the ‘ channel ’ means a moving passage of cooling water , and the cooling water includes treated water condensed by means of membrane distillation . the channel - formed plate 110 comprises a master plate 111 , a rectangular frame 112 and a central frame 113 in detail . the master plate 111 is a flat plate with a predetermined area , and the rectangular frame 112 is provided on a circumference of the master plate 111 to be perpendicular to the master plate 111 . accordingly , an inner space of the master plate 111 and an outer space of the master plate 111 are divided by the rectangular frame 112 , and a space corresponding to the height of the rectangular frame 112 is formed in the master plate 111 . the central frame 113 is a straight frame having a predetermined height and a predetermined length , and the central frame 113 is disposed at a center portion of the master plate 111 in parallel to both sides of the rectangular frame 112 . the central frame 113 is shorter than the length of the rectangular frame 112 disposed in parallel , and accordingly one end of the central frame 113 is connected to the rectangular frame 112 and the other end of the central frame 113 does not extend to one end of the master plate 111 . in this configuration , the inner space of the master plate 111 forms a ‘ u ’ shape by the rectangular frame 112 and the central frame 113 , and the ‘ u ’- shaped space means a channel . as described above , the rectangular frame 112 and the central frame 113 forming a u ′- shaped channel are provided on one surface of the master plate 111 . in addition , on the other surface of the master plate 111 , a rectangular frame 112 and a central frame 113 having the same shape as above are provided to form a channel . in other words , ‘ u ’- shaped channels are provided at both surfaces based on the master plate 111 . in other words , based on the master plate 111 , a first channel is provided at a front surface of the channel - formed plate 110 and a second channel is provided at a rear surface thereof . in addition , the rectangular frames 112 at the front and rear surfaces of the master plate 111 may be integrally formed , and the rectangular frame 112 may have various shapes , without being limited to a rectangular shape , as long as it may divide the inner space of the master plate 111 and the outer space thereof . meanwhile , a cooling water inlet 114 and a cooling water outlet 115 are provided at an upper side of the rectangular frame 112 . cooling water is introduced through the cooling water inlet 114 , and the introduced cooling water passes through the u - shaped channel and discharges through the cooling water outlet 115 . at this time , the cooling water inlet 114 and the cooling water outlet 115 are spatially connected to both the first channel and the second channel of the channel - formed plate 110 , respectively . in other words , the cooling water introduced through the cooling water inlet 114 is distributed to the first channel and the second channel , and both the cooling waters of the first channel and the second channel discharge through the single cooling water outlet 115 . the channel - formed plate 110 has been described above . here , the unit membranes 120 are provided on the rectangular frames 112 at the front and rear surfaces of the channel - formed plate 110 . the unit membrane 120 is closely adhered to the rectangular frame 112 , and accordingly the channels ( the first channel and the second channel ) of the channel - formed plate 110 are isolated from the external environment . the unit membrane 120 is made of a porous hydrophobic membrane , so that water does not directly pass through the unit membrane 120 but only vapor passes through pores of the unit membrane 120 . in a state where the submerged membrane module 10 of the present disclosure is configured as above , a membrane distillation process using the submerged membrane module 10 will be described below ( see fig5 ). in a state where wastewater of 35 to 55 ° c . is provided in the bio - reactor 100 , the cooling water of the cooling tank 40 is supplied through the cooling water inlet 114 of the channel - formed plate 110 to the first channel and the second channel . the cooling water supplied to the first channel and the second channel passes through the u - shaped channel and discharges through the cooling water outlet 115 , and the discharged cooling water is returned to the cooling tank 40 . the cooling water repeatedly circulates in the order of the cooling tank 40 , the cooling water inlet 114 , the first channel and second channel , the cooling water outlet 115 and the cooling tank 40 . in the above circulation of cooling water , the first surface 121 of the unit membrane 120 comes into contact with the wastewater , and the second surface 122 of the unit membrane 120 comes into contact with the cooling water which moves along the first channel and the second channel . at this time , since the temperature of the cooling water is lower than the temperature of the wastewater , a temperature difference is generated between the first surface 121 and the second surface 122 of the unit membrane 120 . due to the temperature difference between the first surface 121 and the second surface 122 of the unit membrane 120 , moisture contacting the first surface 121 having a relatively high temperature is evaporated into vapor , and the corresponding vapor passes through the unit membrane 120 to the second surface 122 , and finally to the first channel and the second channel in contact with the second surface 122 to join the cooling water . in other words , contaminants in the wastewater are filtered off on the first surface 121 of the unit membrane 120 , and only moisture is evaporated to move through the pores of the unit membrane 120 and condensed at the second surface 122 of the unit membrane 120 to join the cooling water which moves along the first channel and the second channel . the wastewater is filtered by means of generation of vapor due to the temperature difference , movement of the vapor through the unit membrane 120 , and join to the cooling water , as described above , and this means the membrane distillation process using the submerged membrane module 10 of the present disclosure . heretofore , the submerged membrane module 10 of the present disclosure and the membrane distillation process using the same have been explained . a plurality of submerged membrane modules 10 may be provided , and a cooling water pipe 41 may be provided for a connection between the cooling tank 40 and the cooling water inlet 114 and between the cooling tank 40 and the cooling water outlet 115 . in addition , since the cooling water discharges while containing a condensed vapor , the temperature of the cooling water may rise . this , in order to maintain the temperature of the cooling water constantly , the cooling tank 40 may be controlled by a separate cooling device . along with it , a treated water tank 50 for storing a predetermined amount of treated water may be provided at one side of the cooling tank 40 . meanwhile , as the membrane distillation process using the submerged membrane module 10 is performed , the surface of the submerged membrane module 10 , namely the first surface 121 , may be clogged by filtered contaminants . in order to prevent this , a rotary disk 20 and a fluidizable media 30 are provided in the bio - reactor 100 . in detail , rotary disks 20 are provided at both sides of the submerged membrane module 10 . the rotary disk 20 rotates by a motor 22 connected to one side thereof . the rotation of the rotary disk 20 induces turbulence of the wastewater , which ultimately detaches contaminants adhered to the surface of the membrane module 10 or restrains adhesion of contaminants to the surface of the membrane module 10 . the rotary disk 20 and the surface of the membrane module 10 are spaced apart from each other by a predetermined distance , and two rotary disks 20 provided at both sides of the membrane module 10 are connected to the motor 22 by means of a shaft 21 so that both rotary disks 20 rotate simultaneously by the motor 22 . in another embodiment , it is also possible to connect each rotary disk 20 to a motor 22 separately so that the rotary disk 20 operates independently . meanwhile , the rotary disks 20 may be installed successively at the shaft 21 depending on the number of installed membrane modules 10 so that each membrane module 10 is interposed between the rotary disks 20 . in other words , a plurality of rotary disks 20 may be provided at intervals , and the membrane module 10 may be provided in each space between the rotary disks 20 . by means of the rotation of the rotary disk 20 , contamination of the membrane module 10 may be restrained . here , the contamination restraining effect of the membrane module 10 may be further improved by adding the fluidizable media 30 . in detail , in a state where a plurality of fluidizable media 30 having a predetermined unit size are provided in the bio - reactor 100 , the fluidizable media 30 may be allowed to fluctuate due to the turbulence caused by the rotation of the rotary disk 20 so that contaminants may be detached due to the fluctuation of the fluidizable media 30 as well as the contact between the fluidizable media 30 and the membrane surface . in addition , the fluidizable media 30 is made of porous material , and anaerobes may be attached to and grow at the surface of the fluidizable media 30 and in the pores thereof so as to treat contaminants in the bio - reactor 100 and generate bio - gas such as methane gas . in particular , since anaerobes attached on the surface of the fluidizable media 30 may treat contaminants and the attached anaerobes may be present at a high concentration and take the place of suspended anaerobes to treat contaminants , the concentration of suspended anaerobes could be reduced . therefore the concentration of floating substances which should be rejected by the submerged membrane module 10 is lowered greatly , and thus the contamination of the submerged membrane module 10 may be greatly reduced in comparison to an existing membrane separation bio - reactor 100 in which suspended microorganisms are used for treatment . along with it , the fluidizable media 30 has a porous form to serve as a habitat of anaerobes and is made of organic polymer material such as polyurethane , polypropylene , polyethylene or the like , which are so soft not to damage the membrane when producing friction with the surface of the membrane . in addition , the media has a hexahedral or spherical shape with a diameter of 1 to 20 mm or a spherical shape in which yarns made of the above materials are bundled . a baffle ( not shown ) is provided at a top portion of the bio - reactor 100 to prevent the fluidizable media 30 from rising over the top of the membrane module 10 . in addition , at one side of the top portion of the bio - reactor 100 , a bio - gas pipe ( not shown ) for extracting bio - gas such as methane gas generated through anaerobic treatment in the bio - reactor 100 is provided , and the extracted bio - gas passes through the bio - gas pipe and is stored in a bio - gas storage tank 60 . along with it , a water level sensor for detecting a water level of the bio - reactor 100 is provided at one side of the bio - reactor 100 . heretofore , the configuration of the apparatus for anaerobic wastewater treatment according to an embodiment of the present disclosure has been described . next , operations of the apparatus for anaerobic wastewater treatment will be described . if wastewater is introduced into the bio - reactor 100 , anaerobic treatment is performed to the wastewater by means of anaerobes flowing in the bio - reactor 100 and anaerobes present in the bio - film formed at the surface of the fluidizable media 30 and in the pores thereof . since the bio - reactor 100 comes to an anaerobic state in which air supply is blocked as described above , if the wastewater stays in the bio - reactor 100 for a predetermined time , an anaerobic digestion process is performed . bio - gas such as methane gas is generated due to the anaerobic digestion of the wastewater , and the generated bio - gas is carried to the bio - gas storage tank 60 . meanwhile , along with the anaerobic treatment process , a membrane distillation process is performed by the submerged membrane module 10 , and contaminants in the wastewater are filtered off by the submerged membrane module 10 during the membrane distillation process . in detail , if a cooling water having a lower temperature than the wastewater is supplied to the channels ( the first channel and the second channel ) in the submerged membrane module 10 , a temperature difference is generated between the first surface 121 of the unit membrane 120 in contact with the wastewater and the second surface 122 of the unit membrane 120 in contact with the cooling water , moisture in contact with the first surface 121 having a relatively higher temperature due to the temperature difference between the first surface 121 and the second surface 122 of the unit membranes 120 is evaporated into vapor , and the corresponding vapor passes through the unit membrane 120 and moves to the second surface 122 , finally to the first channel and the second channel in contact with the second surface 122 to join the cooling water . moisture of the wastewater is evaporated into vapor , finally condensed to join the cooling water , and then discharges to the cooling tank 40 . also , contaminants in the wastewater are filtered off by the unit membrane 120 . meanwhile , along with the anaerobic treatment process and the membrane distillation process , contaminants at the surface of the submerged membrane module 10 are removed . in a state where the fluidizable media 30 fills the bio - reactor 100 , the rotary disks 20 provided at both sides of the membrane module 10 are rotated to remove contaminants at the surface of the membrane module 10 by means of turbulence of the wastewater , and simultaneously contaminants at the surface of the membrane module 10 are removed by means of the fluidizable media 30 . the rotary disks 20 are rotated while the filtering process is in operation , and the rotary disks 20 may also be operated intermittently .	8
this specification discloses various catheter - based systems and methods for treating dysfunction in various locations in an animal body . for example , the various aspects of the invention have application in procedures requiring treatment of sphincters and adjoining tissue regions in the body , or hemorrhoids , or incontinence , or restoring compliance to or otherwise tightening interior tissue or muscle regions . the systems and methods that embody features of the invention are also adaptable for use with systems and surgical techniques that are not necessarily catheter - based . the systems and methods are particularly well suited for treating dysfunctions in the upper gastrointestinal tract , e . g ., in the lower esophageal sphincter and adjacent cardia of the stomach . for this reason , the systems and methods will be described in this context . still , it should be appreciated that the disclosed systems and methods are applicable for use in treating other dysfunctions elsewhere in the body , which are not necessarily sphincter - related . a tissue treatment device 26 is shown in fig1 . the device 26 includes a handle 28 made , e . g ., from molded plastic . the handle 28 carries a flexible catheter tube 30 . the catheter tube 30 can be constructed , for example , using standard flexible , medical grade plastic materials , like vinyl , nylon , poly ( ethylene ), ionomer , poly ( urethane ), poly ( amide ), and poly ( ethylene terephthalate ). the handle 28 is sized to be conveniently held by a physician , to introduce the catheter tube 30 into the tissue region targeted for treatment . the catheter tube 30 may be deployed with or without the use of a guide wire ( not shown ). the catheter tube 30 carries on its distal end an operative element 36 . the operative element 36 can take different forms and can be used for either therapeutic purposes , or diagnostic purposes , or both . the operative element 36 can support , for example , a device for imaging body tissue , such as an endoscope , or an ultrasound transducer . the operative element 36 can also support a device to deliver a drug or therapeutic material to body tissue . the operative element 36 can also support a device for sensing a physiological characteristic in tissue , such as electrical activity , or for transmitting energy to stimulate tissue or to form lesions in tissue . in the illustrated embodiment ( shown in greater detail in fig2 , 3 , and 4 ), one function that the operative element 36 performs is to apply energy in a selective fashion to a targeted tissue region . for the purpose of illustration , the targeted tissue region can comprise , for example , the lower esophageal sphincter , or cardia of the stomach , or both . the applied energy creates one or more lesions , or a prescribed pattern of lesions , below the mucosal surface of the esophagus or cardia . the subsurface lesions are formed in a manner that preserves and protects the mucosal surface against thermal damage . the natural healing of the subsurface lesions leads to a physical tightening of the sphincter and / or adjoining cardia . the subsurface lesions can also result in the interruption of aberrant electrical pathways that may cause spontaneous sphincter relaxation . in any event , the treatment can restore normal closure function to the sphincter . in this arrangement ( as fig1 shows ), the treatment device 26 can operate as part of a system 24 . the system 24 includes a generator 38 to supply the treatment energy to the operative element 36 . a cable 40 is coupled to the handle 28 . the cable 40 is electrically coupled to the operative element 36 by wires that extend through the catheter tube 30 . the cable 40 is also electrically coupled to the generator 38 , to convey the generated energy to the operative element 36 . in the illustrated embodiment , the generator 38 supplies radio frequency energy , e . g ., having a frequency in the range of about 400 khz to about 10 mhz . of course , other forms of energy can be applied , e . g ., coherent or incoherent light ; heated or cooled fluid ; resistive heating ; microwave ; ultrasound ; a tissue ablation fluid ; or cryogenic fluid . the system 24 can also include certain auxiliary processing equipment . in the illustrated embodiment , the processing equipment comprises an external fluid delivery or irrigation apparatus 44 . a luer fitting 48 on the handle 28 couples to tubing 34 to connect the treatment device 26 to the fluid delivery apparatus 44 , to convey processing fluid for discharge by or near the operative element 36 . the system 24 also desirably includes a controller 52 . the controller 52 is linked to the generator 38 and the fluid delivery apparatus 44 . the controller 52 , which preferably includes an onboard central processing unit , governs the power levels , cycles , and duration that the radio frequency energy is distributed to the operative element 36 , to achieve and maintain power levels appropriate to achieve the desired treatment objectives . in tandem , the controller 52 also desirably governs the delivery of processing fluid . the controller 52 desirably includes an input / output ( i / o ) device 54 . the i / o device 54 allows the physician to input control and processing variables , to enable the controller to generate appropriate command signals . in the embodiment shown in fig2 to 4 , the operative element 36 comprises a three - dimensional basket 56 . the basket 56 includes one or more spines 58 , and typically includes from four to eight spines 58 , which are assembled together by a distal hub 60 and a proximal base 62 . in fig2 to 4 , four spines 58 are shown , which are equally circumferentially spaced apart . each spine 58 preferably comprises a flexible body made , e . g . from molded plastic , stainless steel , or nickel titanium alloy . candidate plastic materials for the spine 58 include peek , ultem , polyimide , pebax , hytrel polyester , pet , and polyurethane . the cross sectional shape of the spine body 58 can vary , possessing , e . g ., a circular , elliptical , square , or rectilinear shape . in the illustrated embodiment , the spine bodies 58 each possess a rectilinear shape to resist twisting . in the illustrated embodiment ( see fig5 ), each spine body 58 defines two or more interior lumens or passages . as fig5 shows , in the illustrated embodiment , three lumens or passages , designated l 1 , l 2 , and l 3 , are present . for each spine 58 , each passage l 1 , l 2 , and l 3 is dedicated to accommodate a different functional element . in the illustrated embodiment ( see fig6 and 7 ), a first or center passage l 1 carries a movable , elongated electrode element 66 . a second passage l 2 along one side the first passage l 1 carries a temperature sensing element 80 . a third passage l 3 along the opposite side of first passage l 1 is coupled to tubing 82 that carries processing fluid from the fluid delivery device 44 . each electrode 66 is carried within the first passage l 1 for sliding movement . each electrode 66 slides from a retracted position , withdrawn in the spine 58 ( as shown in fig3 ), and an extended position , extending outward from the spine 58 through an opening 84 in the spine 58 ( as shown in fig4 and 8 ). as fig7 best shows , a push - pull lever 68 on the handle 28 ( as fig2 to 4 also show ) is coupled by a stylet 86 to a carrier 88 located within the catheter tube 30 . the electrodes 66 are secured to the carrier 88 , extending from the carrier 88 into the lumens l 1 of the respective spine 58 . the lever 68 controls the sliding movement of the electrodes with the spines 58 between the retracted position ( by pulling rearward on the lever 68 , arrow 90 in fig7 ) and the extended position ( by pushing forward on the lever 68 , arrow 92 in fig7 ). as fig2 to 4 show , the lever 68 is exposed on the handle 28 for manipulation by the thumb of an operator . a suitable rachet assembly 118 ( see fig2 ) may be provided to advance the sliding movement of the lever 68 in a controlled , stepwise fashion . a slot 119 on the handle 28 stops advancement of the lever 68 beyond a predetermined distance . in the illustrated arrangement , the electrodes 66 are intended for monopolar operation . each electrode 66 serves as a transmitter of energy , and an indifferent patch electrode on the patient = s skin ( not shown ) serves as a common return for all electrodes 66 . it should be appreciated , however , the operative element 36 could include bipolar pairs of electrodes 66 , if desired . in the embodiment shown in fig2 to 4 , an expandable structure 72 comprising , e . g ., a balloon , is located within the basket 56 . the balloon structure 72 can be made , e . g ., from a polyethylene terephthalate ( pet ) material , or a polyamide ( non - compliant ) material , or a radiation cross - linked polyethylene ( semi - compliant ) material , or a latex material , or a silicone material , or a c - flex ( highly compliant ) material . non - compliant materials offer the advantages of a predictable size and pressure feedback when inflated in - contact with tissue . compliant materials offer the advantages of variable sizes and shape conformance to adjacent tissue geometries . the balloon structure 72 presents a normally , generally collapsed condition , as fig2 shows . in this condition , the basket 56 is also normally collapsed about the balloon structure 72 , presenting a low profile for deployment into the targeted tissue region . the catheter tube 30 includes an interior lumen 94 ( see fig3 ), which communicates with the interior of the balloon structure 72 . a fitting 76 ( e . g ., a syringe - activated check valve ) is carried by the handle 28 . the fitting 76 communicates with the lumen . the fitting 76 couples the lumen 94 to a syringe 78 ( see fig3 ), which injects fluid under pressure through the lumen 94 into the balloon structure 72 , causing its expansion , as fig3 shows . expansion of the balloon structure 72 urges the spines 58 of the basket 56 to open and expand ( as fig3 shows ). the force exerted by the balloon structure 72 upon the spines 58 , when expanded , is sufficient to exert an opening force upon the tissue surrounding the basket 56 . when moved to their extended positions , the electrode 66 penetrate tissue contacted by the spines 58 . the electrodes 66 can be formed from various energy transmitting materials . for deployment in the esophagus or cardia of the stomach , the electrodes 66 are formed , e . g ., from nickel titanium . the electrodes 66 can also be formed from stainless steel , e . g ., 304 stainless steel , or , as will be described later , a combination of nickel titanium and stainless steel . the electrodes 66 have sufficient distal sharpness and strength to penetrate a desired depth into the smooth muscle of the esophageal or cardia wall . the desired depth can range from about 4 mm to about 5 mm . to further facilitate penetration and anchoring in the targeted tissue region , each electrode 66 is preferably biased with a bend ( as fig4 and 8 show ). movement of the electrode 66 into the spine 58 overcomes the bias and straightens the electrode 66 for passage through the lumen l 1 . in the illustrated embodiment ( see fig4 and 8 ), each electrode 66 is normally biased with an antegrade bend ( i . e ., bending toward the proximal base 62 of the basket 56 ). alternatively , each electrode 66 can be normally biased toward an opposite retrograde bend ( i . e ., bending toward the distal hub 60 of the basket 58 ). an electrical insulating material 70 ( see fig9 ) is desirably coated about the distal end of each electrode 66 , a distance below the distal tip . for deployment in the esophagus or cardia , the length of the insulating material 70 ranges from about 80 to about 120 mm . the insulating material can comprise , e . g ., a polyethylene terephthalate ( pet ) material , or a polyimide or polyamide material . for deployment in the esophagus or cardia , each electrode 66 preferably presents an exposed , non - insulated conductive length of about 8 mm . when the distal end of the electrode 66 that penetrates the targeted tissue region transmits radio frequency energy , the material 70 insulates the surface of the tissue region from direct exposure to the radio frequency energy . desirably ( see fig1 ), the electrode 66 slides within an insert 96 positioned within the first passage l 1 . the insert 96 guides the electrode 66 to the electrode opening 84 and protects the spine 58 from inadvertent puncture or apoke - through @ by the electrode 66 . the insert 96 is preferably made of a relatively hard ( i . e ., high durometer ) and tough plastic material , e . g ., peek plastic . this plastic material has a durometer in excess of 75 shore d . the hardness provides lubricity for easy electrode movement within the insert 96 , and the toughness makes the insert 96 resistant to puncture by the electrode 66 . the insert material desirably is also adhesively bondable , which peek plastic is . desirably , the insert is also reformable with heat , which peek plastic is , so that its outer diameter can be readily altered in desired ways during manufacture , as will be described in greater detail below . other candidate materials for the insert 96 include ultem , polyimide , pebax , hytrel polyester , pet , and polyurethane . a main advantage of the insert 96 is absolute guidance of the electrode 66 through the spine opening 84 . the flexibility to provide an insert 96 of a different material and possessing different mechanical properties than a spine 58 is another advantage . the insert 96 can also have a different wall thickness than the spine body 58 , so that the dimensions of each of these components can be made appropriate to the function they perform . as fig1 shows , the insert 96 includes a first body portion 98 and a second body portion 100 . the first body portion 96 has an outside diameter smaller than the inner diameter of the passage l 1 , to accommodate insertion of the first body portion 98 into the passage l 1 . the second body portion 100 has an outside diameter that is larger than the inner diameter of the passage l 1 , to prevent its insertion into the passage . the transition between the first and second body portions 98 and 100 forms a notch 102 that abuts against the proximal end 116 of the spine 58 . this abutment forms a mechanical stop , to prevent movement of the first body portion 98 within the passage l 1 beyond a prescribed distance . in this arrangement ( see fig9 ), the electrode 66 may comprise a hybrid of materials comprising stainless steel for the proximal portion 104 and nickel titanium alloy for the distal portion 106 . the nickel titanium alloy performs best in the curved distal portion 106 of the electrode 66 , due to its super - elastic properties . the use of stainless steel in the proximal portion 104 can reduce cost , by minimizing the amount of nickel titanium alloy required . the different materials may be joined , e . g ., by crimping , swaging , soldering , welding , or adhesive bonding , which provide electrical continuity between or among the various materials . the distal portion 106 of the electrode 66 possesses an outside diameter less than the inner diameter of the insert 96 . this allows the distal portion 106 of the electrode 66 to freely slide within the insert 96 . the proximal portion 104 of the electrode has an outside diameter that is larger than the inner diameter of the insert 96 . the transition between the distal and proximal portions 106 and 104 of the electrode 66 forms a notch 108 that abuts against the notch 102 formed at the transition between the first and second body portions 98 and 100 of the insert 96 . in assembly ( see fig1 ), the electrode opening 84 is formed in the spine 58 by a heat gun 112 or the like in the desired located on the exterior of the passage l 1 . as fig1 shows , a segment 110 of the spine wall is displaced into the passage l 1 as the opening 84 is created . this wall segment 110 is deflected into the passage l 1 , to form an interior ramp appended to the opening 84 . as fig1 shows , the first body portion 98 of the insert 96 is inserted through the proximal end 116 of the spine 58 into the passage l 1 . the first body portion 98 is advanced through the formed opening 84 to the fullest extent permitted , i . e ., until the notch 102 between the first and second body portions 98 and 100 abuts against the proximal end 116 of the spine 58 . as fig1 shows , the first body portion 98 that projects from the opening 84 is cut to form a terminus 112 that is flush with the opening 84 . the insert 96 is then pulled back a small distance ( see fig1 ), so that the terminus 112 rests within the passage l 1 against the ramp wall segment 110 , a small distance below the plane of the opening 84 . adhesive 114 is applied in the space between the notch 102 and the proximal end 116 of the spine 58 , to thereby secure the insert 96 to the body of the spine 58 . as fig1 shows , the distal portion 106 of the electrode 66 freely slides through the insert 96 in response to operation of the push - pull lever 68 previously described . the insert terminus 112 faces toward the opening 84 , and serves to reliably guide the distal portion 106 of the electrode 66 toward and away from the opening 84 . the eventual abutment between the lever 68 and the slot 119 on the handle 28 ( see fig2 ) will mechanically stop further passage of the distal portion 106 of the electrode 66 through the opening 84 . the depth of electrode penetration into tissue is thus mechanically controlled , to prevent puncture through the targeted tissue region . should the adhesive 114 fail , the eventual abutment of the notch 102 ( between the first and second body portions 98 and 100 of the insert 96 ) against the proximal end 116 of the spine 58 will mechanically limit the extent to which the insert terminus 112 can advance through the opening 84 . the mechanically limited displacement of the insert terminus 112 through the opening 84 serves to prevent exposure of the cut insert terminus 112 beyond the plane of the electrode opening and into contact with tissue . the electrodes 66 can be formed in various sizes and shapes . the electrodes 66 can possess a circular cross sectional shape . however , the electrodes 66 preferably possess a cross section that provides increased resistance to twisting or bending as the electrodes penetrate tissue . for example , the electrodes 66 can possess a rectangular cross section . alternatively , the electrodes 66 can possess an elliptical cross section . other cross sections , e . g ., conical or pyramidal , can also be used to resist twisting . the surface of the electrode 66 can , e . g ., be smooth , or textured , or concave , or convex . the preceding description describes electrodes 66 bent in either an antegrade or retrograde direction over an arc of ninety degrees or less . the bend provides a secure anchorage in tissue . retraction of the electrodes 66 into the insert overcomes the bias and straightens the electrode 66 when not in use . in the illustrated embodiment ( see fig6 ), the fluid delivery apparatus 44 conveys processing fluid through the third passage l 3 in the spine 58 for discharge at the treatment site . the processing fluid f can comprise , e . g ., saline or sterile water , to cool surface tissue while energy is being applied by the electrode 66 to ohmically heat muscle or tissue beneath the surface , to thereby protect the surface tissue from thermal damage . the third passage l 3 conveys liquid from the irrigation apparatus through an opening 120 formed in the spine 58 . the irrigation opening 120 in each spine 58 is generally aligned with the needle opening 84 in the spine 58 , so that ablation and cooling occur in the same general tissue region . in the illustrated embodiment ( see fig7 ), the individual lengths of tubing 82 that convey irrigation fluid to each passage l 3 of the spines 58 are coupled to an irrigation manifold 122 within the catheter tube 30 . the irrigation manifold 122 is , in turn , coupled by a single tube 124 to the luer fitting 48 on the handle 28 , previously described ( see fig1 ). the irrigation manifold 122 simplifies connection of the multiple tubing 82 to the single tube 124 within the confined space of the catheter tube 30 ( as fig2 shows ), as well as efficiently routes cooling fluid to the appropriate openings 120 . the irrigation manifold 122 can be constructed in various ways , e . g ., from molded or machined plastic such as polycarbonate or ultem . in the illustrated embodiment ( see fig1 to 20 ), the manifold 122 is formed from plastic to form a compact body 134 sized to fit within the catheter tube . the manifold body including a single main fluid junction or inlet port 130 , multiple branch fluid junctions or apertures 128 , and a fluid circuit 126 formed within the manifold body 134 to channel fluid flow between the single main fluid junction 130 and the multiple branch fluid junctions 128 . the single tube 124 is secured to the main fluid junction 130 ( see fig2 ), e . g ., by an adhesive bond . the multiple branch fluid junctions or apertures 128 , which are sized and arranged side - by - side to receive individual ends of the tubings 82 ( see fig2 ), e . g ., by adhesive bonds . the apertures 128 desirably include internal tubing stops to facilitate accurate adhesive bonding . the manifold 122 is also desirably made from a clear or transparent plastic , to further facilitate the process of adhesive bonding the tubings 82 within the apertures 128 . the tubings 82 extend from the manifold 122 and are routed to the designated passages l 3 in the spines 58 . the cavity 126 distributes irrigation fluid conveyed through the single tube 124 to the individual tubings 82 serving the spines 58 . in a representative embodiment , the manifold body 134 can measure about 0 . 74 inch in overall maximum length ( from apertures 128 to the end of the inlet port 130 ) and about 0 . 274 inch in maximum width . it should be appreciated that the manifold 122 can serve to handle fluid flow either to ( i . e , fluid irrigation ) or from ( i . e ., fluid aspiration ) an operative element carried by a catheter tube . the manifold body for carrying out either function is sized to fit within the catheter tube . the manifold body is machined or molded as a single unit to including a single main fluid junction ( inlet 130 ), multiple branch fluid junctions ( apertures 128 ), and a fluid circuit ( circuit 126 ) to channel fluid flow between the single main fluid junction and the multiple branch fluid junctions . the single main fluid junction can be coupled either to a fluid source or a fluid destination external to the catheter tube . likewise , each of the multiple branch fluid junctions can be individually coupled to a fluid - conveying port on the operative element . in the illustrated embodiment ( see fig6 and 7 ), the second passage l 2 in each spine 58 carries a temperature sensing element 80 . in the illustrated embodiment , the temperature sensing element 80 comprises a thermocouple assembly . the temperature sensor is exposed through an opening 140 in the spine body 38 . the temperature sensor rests against surface tissue when the basket structure is deployed for use . desirably ( as fig6 shows ), the temperature sensor opening 140 is generally aligned with the electrode and cooling fluid openings 84 and 120 , so that ablation , temperature sensing , and cooling occur generally in the same localized tissue region . as fig7 shows , the individual thermocouple wires 80 extend from the respective passages l 2 . the thermocouple wires 80 are desirably wound to form a composite thermocouple cable 142 . the thermocouple cable 142 extends through the catheter tube 30 into the handle 28 . the thermocouple cable 142 is electrically coupled ( via the cable 40 ) to temperature sensing and processing elements of the controller 52 . the i / o device 54 of the controller 52 receives real time processing feedback information from the temperature sensors 80 , for processing by the controller 52 , e . g ., to govern the application of energy and the delivery of processing fluid . the i / o device 54 can also include a graphical user interface ( gui ), to graphically present processing information to the physician for viewing or analysis . various features of the invention are set forth in the following claim .	0
this disclosure relates to a chromatographic process to synthesize cyclic esters of 5 and 6 carbon sugar alcohols and their monanhdydro and dianhydro derivatives in accordance with the following reaction scheme : where r and r ′ are independently hydrogen , alkyl , aryl , vinyl , alkenylallyl . isosorbide , which is the starting material depicted above is an end product of the progresseive acid catalyzed dehydration of sorbitol to first the monoanhdyo then the dianhydro sugar alcohol according to the reaction scheme below : because acid catalyzes the dehydration as well as the ultimate esterification with the added organic acid , the starting materials useful in the present teaching can be any polyol that undergoes acid catalyzed dehydration . typical polyol starting materials include sugar alcohols , monoanhydrosugar and dianhydrosugar alcohols , dianhydrosugar monoesters or a mixture of such alcohols . accordingly , the term “ polyol ” is used generically herein to be inclusive of the aforementioned sub genus of compounds . generally , the preferred starting materials include arabinitol , ribitol , sorbitol , mannitol , isosorbide , sorbitan , isoiodide , isomannide , galactitol and iditol . pentitols such as xylitol can also be used . isosorbide , which is the dianhydro sugar alcohol derivative of sorbitol , is depicted in the reaction above and is a particularly preferred starting material because it is readily available or easily made from the dehydration of sorbitol . sorbitan which is the monanhydro sugar alcohol derivative of sorbitol is also a desirable starting material , but the reaction works with sorbitol and other polyols as well . the starting materials may be “ crude ”, i . e ., contained in an impure state as mixtures with one another or with minor non - reactive impurities . in a typical practice , the reaction is carried out on a solid acid catalyst . examples of such solid acids include acidic resins such as amberlyst 35 , amberlyst 15 , amberlyst 36 , amberlyst 70 , and amberlyst 131 from rohm and haas ; purolite ct - 145 , lewatit s2328 , lewatit k2431 , lewatit s2568 , lewatit k2629 from bayer company ; and dianion sk104 , pk228 , rcp160 and relite rad / f from mitsubishi chemical america , inc . in differing embodiments , the solid acid catalyst may be a weak or a strong acid catalyst . in other practices , the solid acid catalyst can be acid groups associated with non - resin substrates such as clays , zeolites , alumina , etc . examples of such solid acids include zeolites such as cbv 3024 , 5534g , t - 2665 , t - 4480 , and cs331 - 3 . the solid acid catalyst may be a calcined zeolite . one process involves exposure of a mono or dianhydrosugar alcohol or sugar alcohol to an acid catalyst in the presence of an organic acid rcooh , at a temperature and pressure for a period of time ( dependent on reaction conditions ) sufficient to provide mono and dianhydrosugar esters , which are mono cyclic or dicyclic respectively . another independent but related process involves microwave irradiation of the polyol in the presence of the organic acid including but not limited to a sugar alcohol and an anhydrosugar alcohol to provide cyclic esters . the reactions conditions are preferably relatively mild . the reaction is carried out at a temperature from about 70 ° c . to about 100 ° c . at ambient pressure . more typically the reaction temperature is about 80 ° c . to 100 ° c . and in exemplary practices the reaction temperature is about 85 ° c . when the acid catalyst is in the form of a column bed , the column can be equilibrated with the desired organic acid ( rcooh ) and the reaction commenced by heating the bed to the desired temperature and loading the sugar alcohol or anhydro sugar alcohol to one end of the column . the column may be eluted using the same organic acid as the eluent . the passage of the reactants over the column bed affects a simultaneous synthesis of the polyol esters and chromatographic separation of the esters from unreacted sugar alcohol or anhydrosugar alcohol as shown in fig1 , unreacted sorbitol tends to elute after the peak of isosorbide esters . as shown best in fig2 , unreacted isorobide tends to elute just before the peak of isosorbide esters following separation of the product from the reaction mixture , further purification of the different esters can be done using procedures such as recrystallization or distillation or other chemical purification techniques well known in the art . the use of a column ( s ) in the synthetic and purification processes enables a continuous flow of a heated anhydrosugar alcohol or sugar alcohol solution , thereby decreasing the amount of by - product formation , polymerization , and resin deactivation . the use of solid phase catalysts to chromatographically synthesize and separate isosorbide esters and cyclic esters of polyols is novel . when the starting source is a sugar alcohol material , the intermediate compounds of monoanhydrosugar alcohol and dianhydrosugar alcohol may be obtained and recycled to give the desired ester products . another unique aspect of this teaching is that any fraction containing unreacted sugar alcohol or anhydrosugar alcohol can be allowed to react again by recycling onto the column . mixed fractions can be rechromatographed . this process differs from prior art in that sorbitol containing fractions may be recycled until pure isosorbide esters are obtained . as opposed to the process of the present teaching , recycling of starting material heretofore has not been an option and longer reaction times have led to polymerization and tar formation . in the present teaching , the recycling of sugar alcohol and anhydrosugar alcohol containing mixtures ( fractions ) through a solid phase catalyst to generate and separate cyclic esters of polyols and anhydro derivatives thereof does not produce the polymerization and tar formation as in the prior art . the experimental design and set up of this process is not limited . multiple chromatographic columns may be used when the feeding amount for the chromatography is especially high . this aspect of this disclosure is advantageous for industrial scale development . the material may flow through all of the resin columns or an elution stream may be inserted such that only a remainder of the stream passes through the complete system . for example , several columns may be used specifically for synthesis and a few columns used for separation and purification . alternatively , the system may be but not limited to a jacketed glass column , a falling film evaporator , a simulated moving bed , continuous setup ( csep ), or a continuous flow pipe system . a continuous chromatographic separation process using a simulating moving bed chromatographic device such as a csep system 100 is schematically illustrated in fig4 . the csep system 100 includes a continuous stationary phase column bed 132 separated into a plurality ( 1 - 10 ) of segmented beds 32 on a carousel 132 . the liquid moving phase , is loaded from one end of a first bed segment 32 ( 1 ) and is passed from the opposite end of the first bed segment 32 ( 1 ) to the top of the next adjacent bed segment in the carousel 13 ( 2 ) in fluid flow direction 115 . at the same time the plurality of column bed segments 32 are rotated in carousel 132 in bed movement direction 135 that is counter current to the fluid direction 115 . reactants are fed into segments of the column at a first zone ( depicted at segment 32 ( 1 )) for organic acids 110 and at second zone ( depicted at segment 32 ( 6 ) for sugar alcohols 120 , each in the fluid flow direction 115 . it is understood in this depiction that sugar alcohols 120 may include or be replaced by mono and / or anhydro derivatives thereof . the sugar alcohols 120 and organic acids 110 contact each other over the catalytic bed 132 maximally in reaction zones of the carousel bed depicted as column segments 32 ( 6 ) through 32 ( 9 ). the ester products 140 preferentially partition with the stationary phase of the column beds 32 relative to the sugar alcohols 120 , therefore , as the bed segments are rotated in bed flow direction 135 the ester products 140 preferentially move with the bed segments and are eluted in a product elution zone depicted as segment 32 ( 4 ). in contrast , the sugar alcohols 120 relative to the esters 140 preferentially partition with the liquid phase of organic acid 110 and therefore flow toward an opposing portion of bed 132 and can be withdrawn from an elution zone that is enriched with unreacted sugar alcohols 150 depicted at segment 32 ( 10 ) of column bed 132 . in an optional embodiment , the eluted sugar alcohols 150 can be combined with the input sugar alcohols 120 to maximize reactant utilization . optionally , a wash elution zone may be introduced between the elution zone at column segment 32 ( 1 ) and the reload zone at column segment 32 ( 1 ) to regenerate the column bed , in which case an additional wash elution port would be configured to collect the waste product in any case , when hen the overall fluid flow between input organic acid 110 and sugar alcohols is properly balanced with the removal of product esters 140 and unreacted sugar alcohols 150 product and elution the effect is to establish continuous formation of product and continuous chromatographic separation that can be conducted indefinitely , subject only to the life of the column bed . the process of described herein may also be applied to crude isosorbide reaction mixtures containing unreacted sorbitol . also , the present teaching does not involve the use of toxic chemicals , and does not require expensive enzymes . also , a variety of isosorbide esters can be prepared using this process by modifying the choice of organic acid solvent . for example , a continuous flow of an acetic acid solution of sorbitol , sorbitan , isosorbide , or a mixture thereof through a solid phase catalyst can result in the formation of mono - and / or di - acetylated isosorbide . while exemplified herein with acetic acid , the organic acids useful for forming cyclic esters may be any branched or straight chain alkanoic acids , substituted and unsubstituted aryl carboxylic acids , alkenoic acids , dicarboxylic acids , fatty acids or mixtures thereof . typical organic acids of interest include formic acid , acetic , propionic , and butyric acid . also useful are compound with multiple acid groups such as diacids like succinic acid , tartaric acid , or fumaric acid and tri - acids like citric acid . in addition to the above in an entirely different embodiment it has been discovered that , exposure of anhydrosugar alcohols to microwave radiation in the presence of an organic acid and an inorganic acid catalyst in the liquid phase also provides a method for forming cyclic esters from sugar alcohols and anhydro derivatives thereof . optionally an organic solvent that is inert to the reaction conditions may be included . in an exemplary embodiment , dioxane is used . additional solvents may include but are not limited to ; methyltetrahydrofuran , cyclopentylmethyl ether , alkylated polyether solvents , ketones solvents such as methyl ethyl ketone , methyl isobutyl ketone and amide solvents such as dimethyformamide ( dmf ), dimethylacetamide ( dmac ) and n - methyl pyrrolidinone ( nmp ). the inorganic acid catalyst can be for example , hydrochloric acid , sulfuric acid , phosphoric acid , or hydrofluoric acid . while oxygenated acids such as sulfuric acid , phosphoric acid are useful for catalyzing the reaction they may also form cyclic sulfoesters or phosphoesters of the sugar alcohol or anhydro derivative thereof as unwanted byproducts . microwave assisted synthesis of isosorbide esters allows for the enhancement of reaction rates , ease of manipulation , and precise control over reaction conditions ( see example 3 below ). the reaction temperature for microwave assisted synthesis of the cyclic esters is typically between 120 ° c . and 200 ° c ., more typically between 140 ° c . and 180 ° c ., and in an exemplary embodiments is about 160 ° c . these temperatures are higher than required for synthesis using a solid phase acid catalyst and the process does not result in a separation of the unreacted products from the diesters . however , the microwave facilitated reaction is less costly , faster , and easier to execute . sugar alcohols , crude mixtures of sugar alcohols , crude mixtures of anhydrosugar alcohols , including monoanhydrosugar and dianhydro derivatives thereof or mixtures thereof may also be used as a starting source . the process may be performed in batch or continuously using a pipe , tubing , or similarly constructed flow - through reactor system . the following examples illustrate specific embodiments of the present teaching , but is not to be considered as limiting the invention in any manner . amberlyst 35 resin ( 50 g ) soaked in acetic acid is added to a column heated to 85 ° c . the temperature of the column was maintained at 85 ° c . and a solution of sorbitol ( 5 . 00 g ) in acetic acid ( 10 ml ) was added . the solution was eluted through the column at a flow rate of 1 . 2 ml / min . the major product was isosorbide diacetate with the monoacetates also present . the products eluted from the column are summarized in table 1 and depicted in fig1 . amberlyst 35 resin ( 50 g ) soaked in acetic acid is added to a column heated to 85 ° c . the temperature of the column was maintained at 85 ° c . and a solution of isosorbide ( 5 . 01 g ) in acetic acid ( 10 ml ) was added . the solution was eluted through the column at a flow rate of 1 . 2 ml / min . the major product was isosorbide diacetate with the monoacetates also present . table 2 below summarizes the products eluded from the column which are also depicted in fig2 . a sample of isosorbide ( 3 g ), acetic acid ( 30 ml ), and 4m hcl in dioxane ( 1 ml ) were placed in a teflon - lined reaction vessel inside a high density rotor for treatment in a microsynth microwave labstation . the sample was heated from room temperature to 160 ° c . in 2 min , and kept at 160 ° c . for 20 min using an irradiation power of 1000 watt . the vessel was cooled . the final product was composed of 18 . 9 % isosorbide , 14 . 7 % monoester 1 , 18 . 8 % monoester 2 , and 12 . 5 % diester , which are illustrated in hplc chromatogram depicted in fig3 . the yields disclosed herein are exemplary only and do not necessarily reflect the optimal yields possible when reaction conditions are optimized . while this invention has been described with reference to several preferred embodiments , it is contemplated that various alterations and modifications thereof will become apparent to those skilled in the art upon a reading of the preceding detailed description . it is therefore intended that the following appended claims be interpreted as including all such alterations and modifications as fall within the true spirit and scope of this invention .	8
referring to the drawings , fig1 a through 1 h , 2 a through 2 f , 3 a through 3 e , 4 a through 4 h , 5 a through 5 h and 6 a through 6 l show different examples of surfactants according to the present invention , which may be contained in the additive . the additive is contained in an electrolyte 30 . the electrolyte 30 is contained in one embodiment variant , as can be seen in fig8 a and 9 b , in a gas sensor 10 according to the present invention . it is seen in fig1 a through 1 h , 2 a through 2 f , 3 a through 3 e , 4 a through 4 h and 6 a through 6 l that the surfactant is an anionic surfactant . corresponding to the exemplary embodiments shown in fig1 a , 1 c , 1 e , 1 g , 2 a , 2 b and 3 a , the surfactants are sulfonic acids . the surfactants corresponding to the exemplary embodiments shown in fig1 b , 1 d , 1 f , 1 h , 2 c through 2 f , 3 b through 3 e , 4 a through 4 h as well as 6 a through 6 d are sulfonates , i . e ., salts of sulfonic acid . the surfactants corresponding to the exemplary embodiments shown in fig6 e through 6 l are sulfates , i . e ., salts of sulfuric acid esters . it is further seen that the surfactants corresponding to the embodiments shown in fig1 a through 1 d , 2 a through 2 f and 3 a through 3 e are all halogenated surfactants , i . e ., surfactants that have at least one fluorine atom on a carbon chain . the surfactants shown in fig1 a , 1 b and 2 a through 2 f are perfluorinated surfactants , i . e ., surfactants with an alkyl chain , in which all hydrogen atoms are replaced by fluorine atoms . the surfactants shown in fig1 c , 1 d and 3 a through 3 e are polyfluorinated surfactants , i . e ., surfactants with an alkyl chain in which some but not all hydrogen atoms are replaced by fluorine atoms . the surfactants in the embodiments shown in fig1 e through 1 h and 4 a through 4 h as well as 6 a through 6 l are halogen - free . it is seen in fig1 a through 1 h that the length of the alkyl chain of the surfactants according to the present invention is variable . here , n is always selected from among 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 or 12 . in the exemplary embodiment according to fig1 a , the surfactant according to the present invention is a perfluorinated alkylsulfonic acid . here , n is selected from among 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 or 12 . it is thus seen that the surfactant according to fig1 a is selected from the group comprising perfluorobutylsulfonic acid , perfluoropentylsulfonic acid , perfluorohexylsulfonic acid , perfluorooctylsulfonic acid , perfluorononylsulfonic acid , perfluorodecylsulfonic acid , perfluoroundecylsulfonic acid , and perfluorododecylsulfonic acid . in the exemplary embodiment according to fig1 b , the surfactant according to the present invention is a perfluorinated alkyl sulfonate . here , n is selected from the group containing heterocyclic cations , quaternary ammonium ions , alkali or alkaline earth ions . in one embodiment variant , the counterion r1 is a heterocyclic cation , namely , a pyridinium , ion . in another embodiment variant , the counterion r1 is an ammonium compound , namely , an ammonium ion . in another embodiment variant , the counterion r1 is a quaternary ammonium ion , namely , tetramethyl ammonium . in yet another embodiment variant , the counterion r1 is an alkali ion , namely , na + , k + or li + . it is thus seen that the surfactant according to fig1 b is selected from the group containing sodium perfluorobutyl sulfonate , sodium perfluoropentyl sulfonate , sodium perfluorohexyl sulfonate , sodium perfluorooctyl sulfonate , sodium perfluorononyl sulfonate , sodium perfluorodecyl sulfonate , sodium perfluoroundecyl sulfonate , sodium perfluorododecyl sulfonate ,′ potassium perfluorobutyl sulfonate , potassium perfluoropentyl sulfonate , potassium perfluorohexyl sulfonate , potassium perfluorooctyl sulfonate , potassium perfluorononyl sulfonate , potassium perfluorodecyl sulfonate , potassium perfluoroundecyl sulfonate , potassium perfluorododecyl sulfonate , tetraethylammonium perfluorobutyl sulfonate , tetraethylammonium perfluoropentyl sulfonate , tetraethylammonium perfluorohexyl sulfonate , tetraethylammonium perfluorooctyl sulfonate , tetraethylammonium perfluorononyl sulfonate , tetraethylammonium perfluorodecyl sulfonate , tetraethylammonium perfluoroundecyl sulfonate , tetraethylammonium perfluorododecyl sulfonate , tetraethylammonium perfluorobutyl sulfonate , tetraethylammonium perfluoropentyl sulfonate , tetraethylammonium perfluorohexyl sulfonate , tetraethylammonium perfluorooctyl sulfonate , tetraethylammonium perfluorononyl sulfonate , tetraethylammonium perfluorodecyl sulfonate , tetraethylammonium perfluoroundecyl sulfonate , tetraethylammonium perfluorododecyl sulfonate , ammonium perfluorobutyl sulfonate , ammonium perfluoropentyl sulfonate , ammonium perfluorohexyl sulfonate , ammonium perfluorooctyl sulfonate , ammonium perfluorononyl sulfonate , ammonium perfluorodecyl sulfonate , ammonium perfluoundecyl sulfonate , ammonium perfluorododecyl sulfonate , ammonium perfluorobutyl sulfonate , ammonium perfluoropentyl sulfonate , ammonium perfluorohexyl sulfonate , ammonium perfluorooctyl sulfonate , ammonium perfluorononyl sulfonate , ammonium perfluorodecyl sulfonate , ammonium perfluoundecyl sulfonate , ammonium perfluorododecyl sulfonate , dimethylammonium perfluorobutyl sulfonate , dimethylammonium perfluoropentyl sulfonate , dimethylammonium perfluorohexyl sulfonate , dimethylammonium perfluorooctyl sulfonate , dimethylammonium perfluorononyl sulfonate , dimethylammonium perfluorodecyl sulfonate , dimethylammonium perfluoundecyl sulfonate , dimethylammonium perfluorododecyl sulfonate , dimethylammonium perfluorobutyl sulfonate , dimethylammonium perfluoropentyl sulfonate , dimethylammonium perfluorohexyl sulfonate , dimethylammonium perfluorooctyl sulfonate , dimethylammonium perfluorononyl sulfonate , dimethylammonium perfluorodecyl sulfonate , dimethylammonium perfluoundecyl sulfonate , dimethylammonium perfluorododecyl sulfonate , pyridinium perfluorobutyl sulfonate , pyridinium perfluoropentyl sulfonate , pyridinium perfluorohexyl sulfonate , pyridinium perfluorooctyl sulfonate , pyridinium perfluorononyl sulfonate , pyridinium perfluorodecyl sulfonate , pyridinium perfluoundecyl sulfonate , and pyridinium perfluorododecyl sulfonate . fig2 a through 2 f show especially preferred embodiment variants of the perfluorinated alkylsulfonic acids according to fig1 a and of the perfluorinated alkyl sulfonates according to fig1 b . fig2 a shows perfluorooctylsulfonic acid and fig2 b shows perfluorobutylsulfonic acid as preferred variants of the exemplary embodiments shown in fig1 a . fig2 c , 2 d , 2 e and 2 f show as preferred variants of the exemplary embodiments from fig1 b sodium perfluorooctyl sulfonate ( fig2 c ), lithium perfluorooctyl sulfonate ( fig2 d ), potassium perfluorooctyl sulfonate ( fig2 e ) and tetraethylammonium perfluorooctyl sulfonate ( fig2 . the surfactant according to the present invention is a mono - or polyfluorinated alkylsulfonic acid in the exemplary embodiment according to fig1 c . here , n is selected from among 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 or 12 . it is thus seen that the surfactant is selected from the group containing monofluorobutylsulfonic acid , difluorobutylsulfonic acid , trifluorobutylsulfonic acid , tetrafluorobutylsulfonic acid , pentafluorobutylsulfonic acid , hexafluorobutylsulfonic acid , heptafluorobutylsulfonic acid , octafluorobutylsulfonic acid , nonafluorobutylsulfonic acid , monofluoropoentylsulfonic acid , difluoropentylsulfonic acid , trifluoropentylsulfonic acid , tetrafluoropentylsulfonic acid , pentafluoropentylsulfonic acid , hexafluoropentylsulfonic acid , heptafluoropentylsulfonic acid , octafluoropentylsulfonic acid , nonafluoropentylsulfonic acid , decafluoropentylsulfonic acid , undecafluoropentylsulfonic acid , monofluorohexylsulfonic acid , difluorohexylsulfonic acid , trifluorohexylsulfonic acid , tetrafluorohexylsulfonic acid , pentafluorohexylsulfonic acid , hexafluorohexylsulfonic acid , heptafluorohexylsulfonic acid , octafluorohexylsulfonic acid , nonafluorohexylsulfonic acid , decafluorohexylsulfonic acid , undecafluorohexylsulfonic acid , dodecafluorohexylsulfonic acid , tridecafluorohexylsulfonic acid , monofluoroheptylsulfonic acid , difluoroheptylsulfonic acid , trifluoroheptypsulfonic acid , tetrafluoroheptylsulfonic acid , pentafluoroheptylsulfonic acid , hexafluoroheptylsulfonic acid , heptafluoroheptylsulfonic acid , octafluoroheptylsulfonic acid , nonafluoroheptylsulfonic acid , decafluoroheptylsulfonic acid , undecafluoroheptylsulfonic acid , dodecafluoroheptylsulfonic acid , tricedafluoroheptylsulfonic acid , tetradecafluoroheptylsulfonic acid , pentadecafluoroheptylsulfonic acid , monofluorooctylsulfonic acid , difluorooctylsulfonic acid , trifluorooctgylsulfonic acid , tetrafluorooctylsulfonic acid , pentafluorooctylsulfonic acid , hexafluorooctylsulfonic acid , heptafluorooctylsulfonic acid , octafluorooctylsulfonic acid , nonafluorooctylsulfonic acid , decafluorooctylsulfonic acid , undecafluorooctylsulfonic acid , dodecafluorooctylsulfonic acid , tridecafluorooctylsulfonic acid , tetradecafluorooctylsulfonic acid , pentadecafluorooctylsulfonic acid , hexadecafluorooctylsulfonic acid , heptadecafluorooctylsulfonic acid , monofluorononylsulfonic acid , difluorononylsulfonic acid , trifluorononylsulfonic acid , tetrafluorononylsulfonic acid , pentafluorononylsulfonic acid , hexafluorononylsulfonic acid , heptafluorononylsulfonic acid , octafluorononylsulfonic acid , nonafluorononylsulfonic acid , decafluorononylsulfonic acid , undecafluorononylsulfonic acid , dodecafluorononylsulfonic acid , tridecafluorononylsulfonic acid , tetradecafluorononylsulfonic acid , pentadecafluorononylsulfonic acid , hexadecafluorononylsulfonic acid , heptadecafluorononylsulfonic acid , octadecafluorononylsulfonic acid , nonadecafluorononylsulfonic acid , monofluorodecylsulfonic acid , difluorodecylsulfonic acid , trifluorodecylsulfonic acid , tetrafluorodecylsulfonic acid , pentafluorodecylsulfonic acid , hexafluorodecylsulfonic acid , heptafluorodecylsulfonic acid , octafluorodecylsulfonic acid , nonafluorodecylsulfonic acid , decafluorodecyllsulfonic acid , undecafluor5odecylsulfonic acid , dodecafluorodecylsulfonic acid , tridecafluorodecylsulfonic acid , tetradecafluorodecylsulfonic acid , pentadecafluooorodecylsulfonic acid , hexadecafluorodecylsulfonic acid , heptadecafluorodecylsulfonic acid , octadecaflorodecylsulfonic acid , nonadecafluorodecylsulfonic acid , eicosafluorodecylsulfonic acid , hjeneicosafluorodecylsulfonic acid , monofluoroundecylsulfonic acid , difluoroundecylsulfonic acid , trifluoroundecylsulfonic acid , tetrafluoroundecylsulfonic acid , pentafluoroundecylsulfonic acid , hexafluoroundecylsulfonic acid , heptafluoroundecylsulfonic acid , octafluoroundecylsulfonic acid , nonafluoroundecylsulfonic acid , decafluoroundecylsulfonic acid , undecafluoroundecylsulfonic acid , dodecafluoroundecylsulfonic acid , tridecafluoroundecylsulfonic acid , tetradecafluoroundecylsulfonic acid , pentadecafluoroundecylsulfonic acid , hexsadecafluoroundecylsulfonic acid , heptadecafluoroundecylsulfonic acid , octadecafluoroundecylsulfonic acid , nonadecafluoroundecylsulfonic acid , eicosafluoroundecylsulfonic acid , heneicosafluoroundecylsulfonic acid , docosafluoroundecylsulfonic acid , tricosafluoroundecylsulfonic acid , monofluorododecylsulfonic acid , difluorododecylsulfonic acid , trifluorododecylsulfonic acid , tetrafluorododecylsulfonic acid , pentafluorododecylsulfonic acid , hexafluorododecylsulfonic acid , heptafluorododecylsulfonic acid , octafluorododecylsulfonic acid , nonafluorododecylsulfonic acid , decafluorododecylsulfonic acid , undecafluorododecylsulfonic acid , dodecafluorododecylsulfonic acid , tridecafluorododecylsulfonic acid , tetradecafluorododecylsulfonic acid , pentadecafluorododecylsulfonic acid , hexadecafluorododecylsulfonic acid , heptadecafluorododecylsulfonic acid , octadecafluorododecylsulfonic acid , nonadecafluorododecylsulfonic acid , eicosafluorododecylsulfonic acid , heneicosafluorododecylsulfonic acid , docosafluorododecylsulfonic acid , tricosafluorododecylsulfonic acid , tetracosafluorododecylsulfonic acid , and pentacosafluorododecylsulfonic acid . the surfactant according to the present invention is a mono - or polyfluorinated alkyl sulfonate in the exemplary embodiment according to fig1 d . here , n is selected from among 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 or 12 . r1 is the positively charged counterion and is selected from the group containing heterocyclic cations , quaternary ammonium ions , alkali or alkaline earth ions . in one embodiment variant , the counterion r1 is a heterocyclic cation , namely , a pyridinium ion . in another embodiment variant , the counterion r1 is a quaternary ammonium ion , namely , tetraethylammonium . it yet another embodiment variant , the counterion r1 is an alkali ion , namely , na + , k + or li + . it is thus seen that the surfactant according to fig1 d is selected from the group containing sodium monofluorobutyl sulfonate , sodium difluorobutyl sulfonate , sodium trifluorobutyl sulfonate , sodium tetrafluorobutyl sulfonate , sodium pentafluorobutyl sulfonate , sodium hexafluorobutyl sulfonate , sodium heptafluorobutyl sulfonate , sodium octafluorobutyl sulfonate , sodium nonafluorobutyl sulfonate , sodium monofluoropentyl sulfonate , sodium difluoropentyl sulfonate , sodium trifluoropentyl sulfonate , sodium tetrafluoropentyl sulfonate , sodium pentafluoropentyl sulfonate , sodium hexafluoropentyl sulfonate , sodium heptafluoropentyl sulfonate , sodium octafluoropentyl sulfonate , sodium nonafluoropentyl sulfonate , sodium decafluoropentyl sulfonate , sodium undecafluoropentyl sulfonate , sodium monofluorohexyl sulfonate , sodium difluorohexyl sulfonate , sodium trifluorohexyl sulfonate , sodium tetrafluorohexyl sulfonate , sodium pentafluorohexyl sulfonate , sodium hexafluorohexyl sulfonate , sodium heptafluorohexyl sulfonate , sodium octafluorohexyl sulfonate , sodium nonafluorohexyl sulfonate , sodium decafluorohexyl sulfonate , sodium undecafluorohexyl sulfonate , sodium dodecafluorohexyl sulfonate , sodium tridecafluorohexyl sulfonate , sodium monofluoroheptyl sulfonate , sodium difluoroheptyl sulfonate , sodium trifluoroheptyl sulfonate , sodium tetrafluoroheptyl sulfonate , sodium pentafluoroheptyl sulfonate , sodium hexafluoroheptyl sulfonate , sodium heptafluoroheptyl sulfonate , sodium octafluoroheptyl sulfonate , sodium nonafluoroheptyl sulfonate , sodium decafluoroheptyl sulfonate , sodium undecafluoroheptyl sulfonate , sodium dodecafluoroheptyl sulfonate , sodium tridecafluoroheptyl sulfonate , sodium tetradecafluoroheptyl sulfonate , sodium pentadecafluoroheptyl sulfonate , sodium monofluorooctyl sulfonate , sodium difluorooctyl sulfonate , sodium trifluorooctyl sulfonate , sodium tetrafluorooctyl sulfonate , sodium pentafluorooctyl sulfonate , sodium hexafluorooctyl sulfonate , sodium heptafluorooctyl sulfonate , sodium octafluorooctyl sulfonate , sodium nonafluorooctyl sulfonate , sodium decafluorooctyl sulfonate , sodium undecafluorooctyl sulfonate , sodium dodecafluorooctyl sulfonate , sodium tridecafluorooctyl sulfonate , sodium tetradecafluorooctyl sulfonate , sodium pentadecafluorooctyl sulfonate , sodium hexadecafluorooctyl sulfonate , sodium heptadecafluorooctyl sulfonate , sodium monofluorononyl sulfonate , sodium difluorononyl sulfonate , sodium trifluorononyl sulfonate , sodium tetrafluorononyl sulfonate , sodium pentafluorononyl sulfonate , sodium hexafluorononyl sulfonate , sodium heptafluorononyl sulfonate , sodium octafluorononyl sulfonate , sodium nonafluorononyl sulfonate , sodium decafluorononyl sulfonate , sodium undecafluorononyl sulfonate , sodium dodecafluorononyl sulfonate , sodium tridecafluorononyl sulfonate , sodium tetradecafluorononyl sulfonate , sodium pentadecafluorononyl sulfonate , sodium hexadecafluorononyl sulfonate , sodium heptadecafluorononyl sulfonate , sodium octadecafluorononyl sulfonate , sodium nonadecafluorononyl sulfonate , sodium monofluorodecyl sulfonate , sodium difluorodecyl sulfonate , sodium trifluorodecyl sulfonate , sodium tetrafluorodecyl sulfonate , sodium pentafluorodecyl sulfonate , sodium hexafluorodecyl sulfonate , sodium heptafluorodecyl sulfonate , sodium octafluorodecyl sulfonate , sodium nonafluorodecyl sulfonate , sodium decafluorodecyl sulfonate , sodium undecafluorodecyl sulfonate , sodium dodecafluorodecyl sulfonate , sodium tridecafluorodecyl sulfonate , sodium tetradecafluorodecyl sulfonate , sodium pentadecafluorodecyl sulfonate , sodium hexadecafluorodecyl sulfonate , sodium heptadecafluorodecyl sulfonate , sodium octadecafluorodecyl sulfonate , sodium nonadecafluorodecyl sulfonate , sodium eicosafluorodecyl sulfonate , sodium heneicosafluorodecyl sulfonate , sodium monofluoroundecyl sulfonate , sodium difluoroundecyl sulfonate , sodium trifluoroundecyl sulfonate , sodium tetrafluoroundecyl sulfonate , sodium pentafluoroundecyl sulfonate , sodium hexafluoroundecyl sulfonate , sodium heptafluoroundecyl sulfonate , sodium octafluoroundecyl sulfonate , sodium nonafluoroundecyl sulfonate , sodium decafluoroundecyl sulfonate , sodium undecafluoroundecyl sulfonate , sodium dodecafluoroundecyl sulfonate , sodium tridecafluoroundecyl sulfonate , sodium tetradecafluoroundecyl sulfonate , sodium pentadecafluoroundecyl sulfonate , sodium hexadecafluoroundecyl sulfonate , sodium heptadecafluoroundecyl sulfonate , sodium octadecafluoroundecyl sulfonate , sodium nonadecafluoroundecyl sulfonate , sodium eicosafluoroundecyl sulfonate , sodium heneicosafluoroundecyl sulfonate , sodium docosafluoroundecyl sulfonate , sodium tricosafluoroundecyl sulfonate , sodium monofluorododecyl sulfonate , sodium difluorododecyl sulfonate , sodium trifluorododecyl sulfonate , sodium tetrafluorododecyl sulfonate , sodium pentafluorododecyl sulfonate , sodium hexafluorododecyl sulfonate , sodium heptafluorododecyl sulfonate , sodium octafluorododecyl sulfonate , sodium nonafluorododecyl sulfonate , sodium decafluorododecyl sulfonate , sodium undecafluorododecyl sulfonate , sodium dodecafluorododecyl sulfonate , sodium tridecafluorododecyl sulfonate , sodium tetradecafluorododecyl sulfonate , sodium pentadecafluorododecyl sulfonate , sodium hexadecafluorododecyl sulfonate , sodium heptadecafluorododecyl sulfonate , sodium octadecafluorododecyl sulfonate , sodium nonadecafluorododecyl sulfonate , sodium eicosafluorododecyl sulfonate , sodium heneicosafluorododecyl sulfonate , sodium docosafluorododecyl sulfonate , sodium tricosafluorododecyl sulfonate , sodium tetracosafluorododecyl sulfonate , sodium pentacosafluorododecyl sulfonate , potassium monofluorobutyl sulfonate , potassium difluorobutyl sulfonate , potassium trifluorobutyl sulfonate , potassium tetrafluorobutyl sulfonate , potassium pentafluorobutyl sulfonate , potassium hexafluorobutyl sulfonate , potassium heptafluorobutyl sulfonate , potassium octafluorobutyl sulfonate , potassium nonafluorobutyl sulfonate , potassium monofluoropentyl sulfonate , potassium difluoropentyl sulfonate , potassium trifluoropentyl sulfonate , potassium tetrafluoropentyl sulfonate , potassium pentafluoropentyl sulfonate , potassium hexafluoropentyl sulfonate , potassium heptafluoropentyl sulfonate , potassium octafluoropentyl sulfonate , potassium nonafluoropentyl sulfonate , potassium decafluoropentyl sulfonate , potassium undecafluoropentyl sulfonate , potassium monofluorohexyl sulfonate , potassium difluorohexyl sulfonate , potassium trifluorohexyl sulfonate , potassium tetrafluorohexyl sulfonate , potassium pentafluorohexyl sulfonate , potassium hexafluorohexyl sulfonate , potassium heptafluorohexyl sulfonate , potassium octafluorohexyl sulfonate , potassium nonafluorohexyl sulfonate , potassium decafluorohexyl sulfonate , potassium undecafluorohexyl sulfonate , potassium dodecafluorohexyl sulfonate , potassium tridecafluorohexyl sulfonate , potassium monofluoroheptyl sulfonate , potassium difluoroheptyl sulfonate , potassium trifluoroheptyl sulfonate , potassium tetrafluoroheptyl sulfonate , potassium pentafluoroheptyl sulfonate , potassium hexafluoroheptyl sulfonate , potassium heptafluoroheptyl sulfonate , potassium octafluoroheptyl sulfonate , potassium nonafluoroheptyl sulfonate , potassium decafluoroheptyl sulfonate , potassium undecafluoroheptyl sulfonate , potassium dodecafluoroheptyl sulfonate , potassium tridecafluoroheptyl sulfonate , potassium tetradecafluoroheptyl sulfonate , potassium pentadecafluoroheptyl sulfonate , potassium monofluorooctyl sulfonate , potassium difluorooctyl sulfonate , potassium trifluorooctyl sulfonate , potassium tetrafluorooctyl sulfonate , potassium pentafluorooctyl sulfonate , potassium hexafluorooctyl sulfonate , potassium heptafluorooctyl sulfonate , potassium octafluorooctyl sulfonate , potassium nonafluorooctyl sulfonate , potassium decafluorooctyl sulfonate , potassium undecafluorooctyl sulfonate , potassium dodecafluorooctyl sulfonate , potassium tridecafluorooctyl sulfonate , potassium tetradecafluorooctyl sulfonate , potassium pentadecafluorooctyl sulfonate , potassium hexadecafluorooctyl sulfonate , potassium heptadecafluorooctyl sulfonate , potassium monofluorononyl sulfonate , potassium difluorononyl sulfonate , potassium trifluorononyl sulfonate , potassium tetrafluorononyl sulfonate , potassium pentafluorononyl sulfonate , potassium hexafluorononyl sulfonate , potassium heptafluorononyl sulfonate , potassium octafluorononyl sulfonate , potassium nonafluorononyl sulfonate , potassium decafluorononyl sulfonate , potassium undecafluorononyl sulfonate , potassium dodecafluorononyl sulfonate , potassium tridecafluorononyl sulfonate , potassium tetradecafluorononyl sulfonate , potassium pentadecafluorononyl sulfonate , potassium hexadecafluorononyl sulfonate , potassium heptadecafluorononyl sulfonate , potassium octadecafluorononyl sulfonate , potassium nonadecafluorononyl sulfonate , potassium monofluorodecyl sulfonate , potassium difluorodecyl sulfonate , potassium trifluorodecyl sulfonate , potassium tetrafluorodecyl sulfonate , potassium pentafluorodecyl sulfonate , potassium hexafluorodecyl sulfonate , potassium heptafluorodecyl sulfonate , potassium octafluorodecyl sulfonate , potassium nonafluorodecyl sulfonate , potassium decafluorodecyl sulfonate , potassium undecafluorodecyl sulfonate , potassium dodecafluorodecyl sulfonate , potassium tridecafluorodecyl sulfonate , potassium tetradecafluorodecyl sulfonate , potassium pentadecafluorodecyl sulfonate , potassium hexadecafluorodecyl sulfonate , potassium heptadecafluorodecyl sulfonate , potassium octadecafluorodecyl sulfonate , potassium nonadecafluorodecyl sulfonate , potassium eicosafluorodecyl sulfonate , potassium heneicosafluorodecyl sulfonate , potassium monofluoroundecyl sulfonate , potassium difluoroundecyl sulfonate , potassium trifluoroundecyl sulfonate , potassium tetrafluoroundecyl sulfonate , potassium pentafluoroundecyl sulfonate , potassium hexafluoroundecyl sulfonate , potassium heptafluoroundecyl sulfonate , potassium octafluoroundecyl sulfonate , potassium nonafluoroundecyl sulfonate , potassium decafluoroundecyl sulfonate , potassium undecafluoroundecyl sulfonate , potassium dodecafluoroundecyl sulfonate , potassium tridecafluoroundecyl sulfonate , potassium tetradecafluoroundecyl sulfonate , potassium pentadecafluoroundecyl sulfonate , potassium hexadecafluoroundecyl sulfonate , potassium heptadecafluoroundecyl sulfonate , potassium octadecafluoroundecyl sulfonate , potassium nonadecafluoroundecyl sulfonate , potassium eicosafluoroundecyl sulfonate , potassium heneicosafluoroundecyl sulfonate , potassium docosafluoroundecyl sulfonate , potassium tricosafluoroundecyl sulfonate , potassium monofluorododecyl sulfonate , potassium difluorododecyl sulfonate , potassium trifluorododecyl sulfonate , potassium tetrafluorododecyl sulfonate , potassium pentafluorododecyl sulfonate , potassium hexafluorododecyl sulfonate , potassium heptafluorododecyl sulfonate , potassium octafluorododecyl sulfonate , potassium nonafluorododecyl sulfonate , potassium decafluorododecyl sulfonate , potassium undecafluorododecyl sulfonate , potassium dodecafluorododecyl sulfonate , potassium tridecafluorododecyl sulfonate , potassium tetradecafluorododecyl sulfonate , potassium pentadecafluorododecyl sulfonate , potassium hexadecafluorododecyl sulfonate , potassium heptadecafluorododecyl sulfonate , potassium octadecafluorododecyl sulfonate , potassium nonadecafluorododecyl sulfonate , potassium eicosafluorododecyl sulfonate , potassium heneicosafluorododecyl sulfonate , potassium docosafluorododecyl sulfonate , potassium tricosafluorododecyl sulfonate , potassium tetracosafluorododecyl sulfonate , potassium pentacosafluorododecyl sulfonate , tetraethylammonium monofluorobutyl sulfonate , tetraethylammonium difluorobutyl sulfonate , tetraethylammonium trifluorobutyl sulfonate , tetraethylammonium tetrafluorobutyl sulfonate , tetraethylammonium pentafluorobutyl sulfonate , tetraethylammonium hexafluorobutyl sulfonate , tetraethylammonium heptafluorobutyl sulfonate , tetraethylammonium octafluorobutyl sulfonate , tetraethylammonium nonafluorobutyl sulfonate , tetraethylammonium monofluoropentyl sulfonate , tetraethylammonium difluoropentyl sulfonate , tetraethylammonium trifluoropentyl sulfonate , tetraethylammonium tetrafluoropentyl sulfonate , tetraethylammonium pentafluoropentyl sulfonate , tetraethylammonium hexafluoropentyl sulfonate , tetraethylammonium heptafluoropentyl sulfonate , tetraethylammonium octafluoropentyl sulfonate , tetraethylammonium nonafluoropentyl sulfonate , tetraethylammonium decafluoropentyl sulfonate , tetraethylammonium undecafluoropentyl sulfonate , tetraethylammonium monofluorohexyl sulfonate , tetraethylammonium difluorohexyl sulfonate , tetraethylammonium trifluorohexyl sulfonate , tetraethylammonium tetrafluorohexyl sulfonate , tetraethylammonium pentafluorohexyl sulfonate , tetraethylammonium hexafluorohexyl sulfonate , tetraethylammonium heptafluorohexyl sulfonate , tetraethylammonium octafluorohexyl sulfonate , tetraethylammonium nonafluorohexyl sulfonate , tetraethylammonium decafluorohexyl sulfonate , tetraethylammonium undecafluorohexyl sulfonate , tetraethylammonium dodecafluorohexyl sulfonate , tetraethylammonium tridecafluorohexyl sulfonate , tetraethylammonium monofluoroheptyl sulfonate , tetraethylammonium difluoroheptyl sulfonate , tetraethylammonium trifluoroheptyl sulfonate , tetraethylammonium tetrafluoroheptyl sulfonate , tetraethylammonium pentafluoroheptyl sulfonate , tetraethylammonium hexafluoroheptyl sulfonate , tetraethylammonium heptafluoroheptyl sulfonate , tetraethylammonium octafluoroheptyl sulfonate , tetraethylammonium nonafluoroheptyl sulfonate , tetraethylammonium decafluoroheptyl sulfonate , tetraethylammonium undecafluoroheptyl sulfonate , tetraethylammonium dodecafluoroheptyl sulfonate , tetraethylammonium tridecafluoroheptyl sulfonate , tetraethylammonium tetradecafluoroheptyl sulfonate , tetraethylammonium pentadecafluoroheptyl sulfonate , tetraethylammonium monofluorooctyl sulfonate , tetraethylammonium difluorooctyl sulfonate , tetraethylammonium trifluorooctyl sulfonate , tetraethylammonium tetrafluorooctyl sulfonate , tetraethylammonium pentafluorooctyl sulfonate , tetraethylammonium hexafluorooctyl sulfonate , tetraethylammonium heptafluorooctyl sulfonate , tetraethylammonium octafluorooctyl sulfonate , tetraethylammonium nonafluorooctyl sulfonate , tetraethylammonium decafluorooctyl sulfonate , tetraethylammonium undecafluorooctyl sulfonate , tetraethylammonium dodecafluorooctyl sulfonate , tetraethylammonium tridecafluorooctyl sulfonate , tetraethylammonium tetradecafluorooctyl sulfonate , tetraethylammonium pentadecafluorooctyl sulfonate , tetraethylammonium hexadecafluorooctyl sulfonate , tetraethylammonium heptadecafluorooctyl sulfonate , tetraethylammonium monofluorononyl sulfonate , tetraethylammonium difluorononyl sulfonate , tetraethylammonium trifluorononyl sulfonate , tetraethylammonium tetrafluorononyl sulfonate , tetraethylammonium pentafluorononyl sulfonate , tetraethylammonium hexafluorononyl sulfonate , tetraethylammonium heptafluorononyl sulfonate , tetraethylammonium octafluorononyl sulfonate , tetraethylammonium nonafluorononyl sulfonate , tetraethylammonium decafluorononyl sulfonate , tetraethylammonium undecafluorononyl sulfonate , tetraethylammonium dodecafluorononyl sulfonate , tetraethylammonium tridecafluorononyl sulfonate , tetraethylammonium tetradecafluorononyl sulfonate , tetraethylammonium pentadecafluorononyl sulfonate , tetraethylammonium hexadecafluorononyl sulfonate , tetraethylammonium heptadecafluorononyl sulfonate , tetraethylammonium octadecafluorononyl sulfonate , tetraethylammonium nonadecafluorononyl sulfonate , tetraethylammonium monofluorodecyl sulfonate , tetraethylammonium difluorodecyl sulfonate , tetraethylammonium trifluorodecyl sulfonate , tetraethylammonium tetrafluorodecyl sulfonate , tetraethylammonium pentafluorodecyl sulfonate , tetraethylammonium hexafluorodecyl sulfonate , tetraethylammonium heptafluorodecyl sulfonate , tetraethylammonium octafluorodecyl sulfonate , tetraethylammonium nonafluorodecyl sulfonate , tetraethylammonium decafluorodecyl sulfonate , tetraethylammonium undecafluorodecyl sulfonate , tetraethylammonium dodecafluorodecyl sulfonate , tetraethylammonium tridecafluorodecyl sulfonate , tetraethylammonium tetradecafluorodecyl sulfonate , tetraethylammonium pentadecafluorodecyl sulfonate , tetraethylammonium hexadecafluorodecyl sulfonate , tetraethylammonium heptadecafluorodecyl sulfonate , tetraethylammonium octadecafluorodecyl sulfonate , tetraethylammonium nonadecafluorodecyl sulfonate , tetraethylammonium eicosafluorodecyl sulfonate , tetraethylammonium heneicosafluorodecyl sulfonate , tetraethylammonium monofluoroundecyl sulfonate , tetraethylammonium difluoroundecyl sulfonate , tetraethylammonium trifluoroundecyl sulfonate , tetraethylammonium tetrafluoroundecyl sulfonate , tetraethylammonium pentafluoroundecyl sulfonate , tetraethylammonium hexafluoroundecyl sulfonate , tetraethylammonium heptafluoroundecyl sulfonate , tetraethylammonium octafluoroundecyl sulfonate , tetraethylammonium nonafluoroundecyl sulfonate , tetraethylammonium decafluoroundecyl sulfonate , tetraethylammonium undecafluoroundecyl sulfonate , tetraethylammonium dodecafluoroundecyl sulfonate , tetraethylammonium tridecafluoroundecyl sulfonate , tetraethylammonium tetradecafluoroundecyl sulfonate , tetraethylammonium pentadecafluoroundecyl sulfonate , tetraethylammonium hexadecafluoroundecyl sulfonate , tetraethylammonium heptadecafluoroundecyl sulfonate , tetraethylammonium octadecafluoroundecyl sulfonate , tetraethylammonium nonadecafluoroundecyl sulfonate , tetraethylammonium eicosafluoroundecyl sulfonate , tetraethylammonium heneicosafluoroundecyl sulfonate , tetraethylammonium docosafluoroundecyl sulfonate , tetraethylammonium tricosafluoroundecyl sulfonate , tetraethylammonium monofluorododecyl sulfonate , tetraethylammonium difluorododecyl sulfonate , tetraethylammonium trifluorododecyl sulfonate , tetraethylammonium tetrafluorododecyl sulfonate , tetraethylammonium pentafluorododecyl sulfonate , tetraethylammonium hexafluorododecyl sulfonate , tetraethylammonium heptafluorododecyl sulfonate , tetraethylammonium octafluorododecyl sulfonate , tetraethylammonium nonafluorododecyl sulfonate , tetraethylammonium decafluorododecyl sulfonate , tetraethylammonium undecafluorododecyl sulfonate , tetraethylammonium dodecafluorododecyl sulfonate , tetraethylammonium tridecafluorododecyl sulfonate , tetraethylammonium tetradecafluorododecyl sulfonate , tetraethylammonium pentadecafluorododecyl sulfonate , tetraethylammonium hexadecafluorododecyl sulfonate , tetraethylammonium heptadecafluorododecyl sulfonate , tetraethylammonium octadecafluorododecyl sulfonate , tetraethylammonium nonadecafluorododecyl sulfonate , tetraethylammonium eicosafluorododecyl sulfonate , tetraethylammonium heneicosafluorododecyl sulfonate , tetraethylammonium docosafluorododecyl sulfonate , tetraethylammonium tricosafluorododecyl sulfonate , tetraethylammonium tetracosafluorododecyl sulfonate , tetraethylammonium pentacosafluorododecyl sulfonate , tetraethylammonium monofluorobutyl sulfonate , tetraethylammonium difluorobutyl sulfonate , tetraethylammonium trifluorobutyl sulfonate , tetraethylammonium tetrafluorobutyl sulfonate , tetraethylammonium pentafluorobutyl sulfonate , tetraethylammonium hexafluorobutyl sulfonate , tetraethylammonium heptafluorobutyl sulfonate , tetraethylammonium octafluorobutyl sulfonate , tetraethylammonium nonafluorobutyl sulfonate , tetraethylammonium monofluoropentyl sulfonate , tetraethylammonium difluoropentyl sulfonate , tetraethylammonium trifluoropentyl sulfonate , tetraethylammonium tetrafluoropentyl sulfonate , tetraethylammonium pentafluoropentyl sulfonate , tetraethylammonium hexafluoropentyl sulfonate , tetraethylammonium heptafluoropentyl sulfonate , tetraethylammonium octafluoropentyl sulfonate , tetraethylammonium nonafluoropentyl sulfonate , tetraethylammonium decafluoropentyl sulfonate , tetraethylammonium undecafluoropentyl sulfonate , tetraethylammonium monofluorohexyl sulfonate , tetraethylammonium difluorohexyl sulfonate , tetraethylammonium trifluorohexyl sulfonate , tetraethylammonium tetrafluorohexyl sulfonate , tetraethylammonium pentafluorohexyl sulfonate , tetraethylammonium hexafluorohexyl sulfonate , tetraethylammonium heptafluorohexyl sulfonate , tetraethylammonium octafluorohexyl sulfonate , tetraethylammonium nonafluorohexyl sulfonate , tetraethylammonium decafluorohexyl sulfonate , tetraethylammonium undecafluorohexyl sulfonate , tetraethylammonium dodecafluorohexyl sulfonate , tetraethylammonium tridecafluorohexyl sulfonate , tetraethylammonium monofluoroheptyl sulfonate , tetraethylammonium difluoroheptyl sulfonate , tetraethylammonium trifluoroheptyl sulfonate , tetraethylammonium tetrafluoroheptyl sulfonate , tetraethylammonium pentafluoroheptyl sulfonate , tetraethylammonium hexafluoroheptyl sulfonate , tetraethylammonium heptafluoroheptyl sulfonate , tetraethylammonium octafluoroheptyl sulfonate , tetraethylammonium nonafluoroheptyl sulfonate , tetraethylammonium decafluoroheptyl sulfonate , tetraethylammonium undecafluoroheptyl sulfonate , tetraethylammonium dodecafluoroheptyl sulfonate , tetraethylammonium tridecafluoroheptyl sulfonate , tetraethylammonium tetradecafluoroheptyl sulfonate , tetraethylammonium pentadecafluoroheptyl sulfonate , tetraethylammonium monofluorooctyl sulfonate , tetraethylammonium difluorooctyl sulfonate , tetraethylammonium trifluorooctyl sulfonate , tetraethylammonium tetrafluorooctyl sulfonate , tetraethylammonium pentafluorooctyl sulfonate , tetraethylammonium hexafluorooctyl sulfonate , tetraethylammonium heptafluorooctyl sulfonate , tetraethylammonium octafluorooctyl sulfonate , tetraethylammonium nonafluorooctyl sulfonate , tetraethylammonium decafluorooctyl sulfonate , tetraethylammonium undecafluorooctyl sulfonate , tetraethylammonium dodecafluorooctyl sulfonate , tetraethylammonium tridecafluorooctyl sulfonate , tetraethylammonium tetradecafluorooctyl sulfonate , tetraethylammonium pentadecafluorooctyl sulfonate , tetraethylammonium hexadecafluorooctyl sulfonate , tetraethylammonium heptadecafluorooctyl sulfonate , tetraethylammonium monofluorononyl sulfonate , tetraethylammonium difluorononyl sulfonate , tetraethylammonium trifluorononyl sulfonate , tetraethylammonium tetrafluorononyl sulfonate , tetraethylammonium pentafluorononyl sulfonate , tetraethylammonium hexafluorononyl sulfonate , tetraethylammonium heptafluorononyl sulfonate , tetraethylammonium octafluorononyl sulfonate , tetraethylammonium nonafluorononyl sulfonate , tetraethylammonium decafluorononyl sulfonate , tetraethylammonium undecafluorononyl sulfonate , tetraethylammonium dodecafluorononyl sulfonate , tetraethylammonium tridecafluorononyl sulfonate , tetraethylammonium tetradecafluorononyl sulfonate , tetraethylammonium pentadecafluorononyl sulfonate , tetraethylammonium hexadecafluorononyl sulfonate , tetraethylammonium heptadecafluorononyl sulfonate , tetraethylammonium octadecafluorononyl sulfonate , tetraethylammonium nonadecafluorononyl sulfonate , tetraethylammonium monofluorodecyl sulfonate , tetraethylammonium difluorodecyl sulfonate , tetraethylammonium trifluorodecyl sulfonate , tetraethylammonium tetrafluorodecyl sulfonate , tetraethylammonium pentafluorodecyl sulfonate , tetraethylammonium hexafluorodecyl sulfonate , tetraethylammonium heptafluorodecyl sulfonate , tetraethylammonium octafluorodecyl sulfonate , tetraethylammonium nonafluorodecyl sulfonate , tetraethylammonium decafluorodecyl sulfonate , tetraethylammonium undecafluorodecyl sulfonate , tetraethylammonium dodecafluorodecyl sulfonate , tetraethylammonium tridecafluorodecyl sulfonate , tetraethylammonium tetradecafluorodecyl sulfonate , tetraethylammonium pentadecafluorodecyl sulfonate , tetraethylammonium hexadecafluorodecyl sulfonate , tetraethylammonium heptadecafluorodecyl sulfonate , tetraethylammonium octadecafluorodecyl sulfonate , tetraethylammonium nonadecafluorodecyl sulfonate , tetraethylammonium eicosafluorodecyl sulfonate , tetraethylammonium heneicosafluorodecyl sulfonate , tetraethylammonium monofluoroundecyl sulfonate , tetraethylammonium difluoroundecyl sulfonate , tetraethylammonium trifluoroundecyl sulfonate , tetraethylammonium tetrafluoroundecyl sulfonate , tetraethylammonium pentafluoroundecyl sulfonate , tetraethylammonium hexafluoroundecyl sulfonate , tetraethylammonium heptafluoroundecyl sulfonate , tetraethylammonium octafluoroundecyl sulfonate , tetraethylammonium nonafluoroundecyl sulfonate , tetraethylammonium decafluoroundecyl sulfonate , tetraethylammonium undecafluoroundecyl sulfonate , tetraethylammonium dodecafluoroundecyl sulfonate , tetraethylammonium tridecafluoroundecyl sulfonate , tetraethylammonium tetradecafluoroundecyl sulfonate , tetraethylammonium pentadecafluoroundecyl sulfonate , tetraethylammonium hexadecafluoroundecyl sulfonate , tetraethylammonium heptadecafluoroundecyl sulfonate , tetraethylammonium octadecafluoroundecyl sulfonate , tetraethylammonium nonadecafluoroundecyl sulfonate , tetraethylammonium eicosafluoroundecyl sulfonate , tetraethylammonium heneicosafluoroundecyl sulfonate , tetraethylammonium docosafluoroundecyl sulfonate , tetraethylammonium tricosafluoroundecyl sulfonate , tetraethylammonium monofluorododecyl sulfonate , tetraethylammonium difluorododecyl sulfonate , tetraethylammonium trifluorododecyl sulfonate , tetraethylammonium tetrafluorododecyl sulfonate , tetraethylammonium pentafluorododecyl sulfonate , tetraethylammonium hexafluorododecyl sulfonate , tetraethylammonium heptafluorododecyl sulfonate , tetraethylammonium octafluorododecyl sulfonate , tetraethylammonium nonafluorododecyl sulfonate , tetraethylammonium decafluorododecyl sulfonate , tetraethylammonium undecafluorododecyl sulfonate , tetraethylammonium dodecafluorododecyl sulfonate , tetraethylammonium tridecafluorododecyl sulfonate , tetraethylammonium tetradecafluorododecyl sulfonate , tetraethylammonium pentadecafluorododecyl sulfonate , tetraethylammonium hexadecafluorododecyl sulfonate , tetraethylammonium heptadecafluorododecyl sulfonate , tetraethylammonium octadecafluorododecyl sulfonate , tetraethylammonium nonadecafluorododecyl sulfonate , tetraethylammonium eicosafluorododecyl sulfonate , tetraethylammonium heneicosafluorododecyl sulfonate , tetraethylammonium docosafluorododecyl sulfonate , tetraethylammonium tricosafluorododecyl sulfonate , tetraethylammonium tetracosafluorododecyl sulfonate , tetraethylammonium pentacosafluorododecyl sulfonate , pyridinium monofluorobutyl sulfonate , pyridinium difluorobutyl sulfonate , pyridinium trifluorobutyl sulfonate , pyridinium tetrafluorobutyl sulfonate , pyridinium pentafluorobutyl sulfonate , pyridinium hexafluorobutyl sulfonate , pyridinium heptafluorobutyl sulfonate , pyridinium octafluorobutyl sulfonate , pyridinium nonafluorobutyl sulfonate , pyridinium monofluoropentyl sulfonate , pyridinium difluoropentyl sulfonate , pyridinium trifluoropentyl sulfonate , pyridinium tetrafluoropentyl sulfonate , pyridinium pentafluoropentyl sulfonate , pyridinium hexafluoropentyl sulfonate , pyridinium heptafluoropentyl sulfonate , pyridinium octafluoropentyl sulfonate , pyridinium nonafluoropentyl sulfonate , pyridinium decafluoropentyl sulfonate , pyridinium undecafluoropentyl sulfonate , pyridinium monofluorohexyl sulfonate , pyridinium difluorohexyl sulfonate , pyridinium trifluorohexyl sulfonate , pyridinium tetrafluorohexyl sulfonate , pyridinium pentafluorohexyl sulfonate , pyridinium hexafluorohexyl sulfonate , pyridinium heptafluorohexyl sulfonate , pyridinium octafluorohexyl sulfonate , pyridinium nonafluorohexyl sulfonate , pyridinium decafluorohexyl sulfonate , pyridinium undecafluorohexyl sulfonate , pyridinium dodecafluorohexyl sulfonate , pyridinium tridecafluorohexyl sulfonate , pyridinium monofluoroheptyl sulfonate , pyridinium difluoroheptyl sulfonate , pyridinium trifluoroheptyl sulfonate , pyridinium tetrafluoroheptyl sulfonate , pyridinium pentafluoroheptyl sulfonate , pyridinium hexafluoroheptyl sulfonate , pyridinium heptafluoroheptyl sulfonate , pyridinium octafluoroheptyl sulfonate , pyridinium nonafluoroheptyl sulfonate , pyridinium decafluoroheptyl sulfonate , pyridinium undecafluoroheptyl sulfonate , pyridinium dodecafluoroheptyl sulfonate , pyridinium tridecafluoroheptyl sulfonate , pyridinium tetradecafluoroheptyl sulfonate , pyridinium pentadecafluoroheptyl sulfonate , pyridinium monofluorooctyl sulfonate , pyridinium difluorooctyl sulfonate , pyridinium trifluorooctyl sulfonate , pyridinium tetrafluorooctyl sulfonate , pyridinium pentafluorooctyl sulfonate , pyridinium hexafluorooctyl sulfonate , pyridinium heptafluorooctyl sulfonate , pyridinium octafluorooctyl sulfonate , pyridinium nonafluorooctyl sulfonate , pyridinium decafluorooctyl sulfonate , pyridinium undecafluorooctyl sulfonate , pyridinium dodecafluorooctyl sulfonate , pyridinium tridecafluorooctyl sulfonate , pyridinium tetradecafluorooctyl sulfonate , pyridinium pentadecafluorooctyl sulfonate , pyridinium hexadecafluorooctyl sulfonate , pyridinium heptadecafluorooctyl sulfonate , pyridinium monofluorononyl sulfonate , pyridinium difluorononyl sulfonate , pyridinium trifluorononyl sulfonate , pyridinium tetrafluorononyl sulfonate , pyridinium pentafluorononyl sulfonate , pyridinium hexafluorononyl sulfonate , pyridinium heptafluorononyl sulfonate , pyridinium octafluorononyl sulfonate , pyridinium nonafluorononyl sulfonate , pyridinium decafluorononyl sulfonate , pyridinium undecafluorononyl sulfonate , pyridinium dodecafluorononyl sulfonate , pyridinium tridecafluorononyl sulfonate , pyridinium tetradecafluorononyl sulfonate , pyridinium pentadecafluorononyl sulfonate , pyridinium hexadecafluorononyl sulfonate , pyridinium heptadecafluorononyl sulfonate , pyridinium octadecafluorononyl sulfonate , pyridinium nonadecafluorononyl sulfonate , pyridinium monofluorodecyl sulfonate , pyridinium difluorodecyl sulfonate , pyridinium trifluorodecyl sulfonate , pyridinium tetrafluorodecyl sulfonate , pyridinium pentafluorodecyl sulfonate , pyridinium hexafluorodecyl sulfonate , pyridinium heptafluorodecyl sulfonate , pyridinium octafluorodecyl sulfonate , pyridinium nonafluorodecyl sulfonate , pyridinium decafluorodecyl sulfonate , pyridinium undecafluorodecyl sulfonate , pyridinium dodecafluorodecyl sulfonate , pyridinium tridecafluorodecyl sulfonate , pyridinium tetradecafluorodecyl sulfonate , pyridinium pentadecafluorodecyl sulfonate , pyridinium hexadecafluorodecyl sulfonate , pyridinium heptadecafluorodecyl sulfonate , pyridinium octadecafluorodecyl sulfonate , pyridinium nonadecafluorodecyl sulfonate , pyridinium eicosafluorodecyl sulfonate , pyridinium heneicosafluorodecyl sulfonate , pyridinium monofluoroundecyl sulfonate , pyridinium difluoroundecyl sulfonate , pyridinium trifluoroundecyl sulfonate , pyridinium tetrafluoroundecyl sulfonate , pyridinium pentafluoroundecyl sulfonate , pyridinium hexafluoroundecyl sulfonate , pyridinium heptafluoroundecyl sulfonate , pyridinium octafluoroundecyl sulfonate , pyridinium nonafluoroundecyl sulfonate , pyridinium decafluoroundecyl sulfonate , pyridinium undecafluoroundecyl sulfonate , pyridinium dodecafluoroundecyl sulfonate , pyridinium tridecafluoroundecyl sulfonate , pyridinium tetradecafluoroundecyl sulfonate , pyridinium pentadecafluoroundecyl sulfonate , pyridinium hexadecafluoroundecyl sulfonate , pyridinium heptadecafluoroundecyl sulfonate , pyridinium octadecafluoroundecyl sulfonate , pyridinium nonadecafluoroundecyl sulfonate , pyridinium eicosafluoroundecyl sulfonate , pyridinium heneicosafluoroundecyl sulfonate , pyridinium docosafluoroundecyl sulfonate , pyridinium tricosafluoroundecyl sulfonate , pyridinium monofluorododecyl sulfonate , pyridinium difluorododecyl sulfonate , pyridinium trifluorododecyl sulfonate , pyridinium tetrafluorododecyl sulfonate , pyridinium pentafluorododecyl sulfonate , pyridinium hexafluorododecyl sulfonate , pyridinium heptafluorododecyl sulfonate , pyridinium octafluorododecyl sulfonate , pyridinium nonafluorododecyl sulfonate , pyridinium decafluorododecyl sulfonate , pyridinium undecafluorododecyl sulfonate , pyridinium dodecafluorododecyl sulfonate , pyridinium tridecafluorododecyl sulfonate , pyridinium tetradecafluorododecyl sulfonate , pyridinium pentadecafluorododecyl sulfonate , pyridinium hexadecafluorododecyl sulfonate , pyridinium heptadecafluorododecyl sulfonate , pyridinium octadecafluorododecyl sulfonate , pyridinium nonadecafluorododecyl sulfonate , pyridinium eicosafluorododecyl sulfonate , pyridinium heneicosafluorododecyl sulfonate , pyridinium docosafluorododecyl sulfonate , pyridinium tricosafluorododecyl sulfonate , pyridinium tetracosafluorododecyl sulfonate , and pyridinium pentacosafluorododecyl sulfonate . fig3 a through 3 e show especially preferred embodiment variants of the polyfluorinated alkylsulfonic acids according to fig1 c and of the polyfluorinated alkyl sulfonates according to fig1 d . fig3 a shows a polyfluorooctylsulfonic acid , namely , tridecafluorooctylsulfonic acid as preferred variants of the exemplary embodiment from fig1 c . fig3 b , 3 c , 3 d and 3 e show as preferred variants of the exemplary embodiments from fig1 d sodium tridecafluorooctyl sulfonate ( fig3 b ), potassium tridecafluorooctyl sulfonate ( fig3 c ), lithium tridecafluorooctyl sulfonate ( fig3 d ) and tetraethylammonium tridecafluorooctyl sulfonate ( fig3 e ). the embodiment variants shown in fig1 a , 1 b , 1 c and 1 d as well as 2 a through 2 f and 3 a through 3 e are all compounds corresponding to the following formula : ( c n f ( 2n + 1 )- m h m — so 3 − ) r1 formula i , in which n ={ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 }, m ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 }, r1 is selected from the group comprising h + , na + , k + , li + , as well as (( c s h 2s + 1 )( c p h 2p + 1 )( c q h 2q + 1 )( c r h 2r + 1 )) n + , in which s ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 }, p ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 }, q ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 }, and r ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 }. here , m = 0 and n ={ 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 } applies to the compounds corresponding to fig1 a , 1 b and 2 a through 2 f . now , m ={ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 } and ( 2n + 1 - m )={ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 }, in which n ={ 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 }, apply to the compounds corresponding to fig1 c , 1 d and 3 a through 3 e . in the exemplary embodiment according to fig1 e , the surfactant according to the present invention is an n - alkylsulfonic acid . here , n is selected from among 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 or 12 . it is thus seen that a compound according to fig1 a is selected from the group comprising n - butylsulfonic acid , n - pentylsulfonic acid , n - hexylsulfonic acid , n - octylsulfonic acid , n - nonylsulfonic acid , n - decylsulfonic acid , n - undecylsulfonic acid , and n - dodecylsulfonic acid . in the exemplary embodiment according to fig1 f , the surfactant according to the present invention is an n - alkyl sulfonate . here , n is selected from among 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 or 12 . r1 is the positively charged counterion and is selected from the group containing heterocyclic cations , quaternary ammonium ions , and alkali or alkaline earth ions . in one embodiment variant , the counterion r1 is a heterocyclic cation , namely , a pyridinium ion . in another embodiment variant , the counterion r1 is a quaternary ammonium ion , namely , tetraethylammonium . it yet another embodiment variant , the counterion r1 is an alkali ion , namely , na + , k + , li + . it is thus seen that the surfactant according to figure if is selected from the group containing sodium - n - butyl sulfonate , sodium n - pentyl sulfonate , sodium n - hexyl sulfonate , sodium n - octyl sulfonate , sodium n - nonyl sulfonate , sodium n - decyl sulfonate , sodium n - undecyl sulfonate , sodium n - dodecyl sulfonate , potassium n - butyl sulfonate , potassium n - pentyl sulfonate , potassium n - hexyl sulfonate , potassium n - octyl sulfonate , potassium n - nonyl sulfonate , potassium n - decyl sulfonate , potassium n - undecyl sulfonate , potassium n - dodecyl sulfonate , lithium n - butyl sulfonate , lithium n - pentyl sulfonate , lithium n - hexyl sulfonate , lithium n - octyl sulfonate , lithium n - nonyl sulfonate , lithium n - decyl sulfonate , lithium n - undecyl sulfonate , lithium n - dodecyl sulfonate , tetraethylammonium n - butyl sulfonate , tetraethylammonium n - pentyl sulfonate , tetraethylammonium n - hexyl sulfonate , tetraethylammonium n - octyl sulfonate , tetraethylammonium n - nonyl sulfonate , tetraethylammonium n - decyl sulfonate , tetraethylammonium n - undecyl sulfonate , tetraethylammonium n - dodecyl sulfonate , pyridinium n - butyl sulfonate , pyridinium n - pentyl sulfonate , pyridinium n - hexyl sulfonate , pyridinium n - octyl sulfonate , pyridinium n - nonyl sulfonate , pyridinium n - decyl sulfonate , pyridinium n - undecyl sulfonate , and pyridinium n - dodecyl sulfonate . the surfactant according to the present invention is an iso - alkylsulfonic acid in the exemplary embodiment according to fig1 g . here , n is selected from among 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 or 12 . it is thus seen that a compound according to fig1 a is selected from the group comprising isobutylsulfonic acid , isopentylsulfonic acid , isohexylsulfonic acid , isooctylsulfonic acid , isononylsulfonic acid , isodecylsulfonic acid , isoundecylsulfonic acid , and isododecylsulfonic acid . in the exemplary embodiment according to fig1 h , the surfactant according to the present invention is an iso - alkyl sulfonate . here , n is selected from among 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 or 12 . r1 is the positively charged counterion and is selected from the group containing heterocyclic cations , quaternary ammonium ions , alkali or alkaline earth ions . in one embodiment variant , the counterion r1 is a heterocyclic cation , namely , a pyridinium ion . in another embodiment variant , the counterion r1 is a quaternary ammonium ion , namely , tetraethylammonium . in yet another embodiment variant , the counterion r1 is an alkali ion , namely , na + , k + or li + . it is thus seen that the surfactant according to figure if is selected from the group containing sodium isobutyl sulfonate , sodium isopentyl sulfonate , sodium isohexyl sulfonate , sodium isooctyl sulfonate , sodium isononyl sulfonate , sodium isodecyl sulfonate , sodium isoundecyl sulfonate , sodium isododecyl sulfonate , potassium isobutyl sulfonate , potassium isopentyl sulfonate , potassium isohexyl sulfonate , potassium isooctyl sulfonate , potassium isononyl sulfonate , potassium isodecyl sulfonate , potassium isoundecyl sulfonate , potassium dodecyl sulfonate , lithium isobutyl sulfonate , lithium isopentyl sulfonate , lithium isohexyl sulfonate , lithium isooctyl sulfonate , lithium isononyl sulfonate , lithium isodecyl sulfonate , lithium isoundecyl sulfonate , lithium isododecyl sulfonate , tetraethylammonium isobutyl sulfonate , tetraethylammonium isopentyl sulfonate , tetraethylammonium isohexyl sulfonate , tetraethylammonium isooctyl sulfonate , tetraethylammonium isononyl sulfonate , tetraethylammonium isodecyl sulfonate , tetraethylammonium isoundecyl sulfonate , tetraethylammonium isododecyl sulfonate , pyridinium isobutyl sulfonate , pyridinium isopentyl sulfonate , pyridinium isohexyl sulfonate , pyridinium isooctyl sulfonate , pyridinium isononyl sulfonate , pyridinium isodecyl sulfonate , pyridinium isoundecyl sulfonate , and pyridinium isododecyl sulfonate . fig4 a through 4 h show especially preferred embodiment variants of the halogen - free alkyl sulfonates according to fig1 f and 1 h . fig4 a through 4 d show a preferred butyl sulfonate each , namely , sodium butyl sulfonate ( fig4 a ), potassium butyl sulfonate ( fig4 b ), lithium butyl sulfonate ( fig4 c ), and tetraethylammonium butyl sulfonate ( fig4 d ). fig4 e through 4 h show each a preferred dodecyl sulfonate , namely , sodium dodecyl sulfonate ( fig4 e ), potassium dodecyl sulfonate ( fig4 f ), lithium dodecyl sulfonate ( fig4 g ), and tetraethylammonium dodecyl sulfonate ( fig4 h ). the embodiment variants shown in fig1 e , if as well as 4 a through 4 f are also all compounds corresponding to the following formula : ( c n f ( 2n + 1 )- m h m — so 3 − ) r1 formula i in which n ={ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 }, m ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 }, r1 is selected from the group h + , na + , k + , li + , as well as (( c s h 2s + 1 )( c p h 2p + 1 )(( c q h 2q + 1 )( c r h 2r + 1 )) n + , in which s ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 }, p ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 }, q ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 }, and r ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 }. here , ( 2n + 1 )= m , in which n ={ 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 ), for the compounds corresponding to fig1 e , if as well as 4 a through 4 f . it is thus seen that the embodiment variants shown in fig1 e , if as well as 4 a through 4 f are halogen - free anionic surfactants corresponding to the following formula : in which n ={ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 }, r1 is selected from the group h + , na + , k + , li + or (( c s h 2s + 1 )( c p h 2p + 1 )(( c q h 2q + 1 )( c r h 2r + 1 )) n + , in which s ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 }, p ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 }, q ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 }, and r ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 }. other embodiment variants of anionic , halogen - free surfactants are shown in fig6 a through 6 l . fig6 a through 6 d show each exemplary embodiments for iso - or n - alkylbenzene sulfonate compounds , namely , sodium alkylbenzene sulfonate ( fig6 a ), potassium alkylbenzene sulfonate ( fig6 b ), lithium alkylbenzene sulfonate ( fig6 c ), and tetraethylammonium alkylbenzene sulfonate ( fig6 d ). it is seen that the alkylbenzene sulfonates corresponding to fig6 a through 6 d may have a variable length of the alkyl chain . here , n is always selected from among 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 12 . the variants shown in fig6 a through 6 d are a para - alkylbenzene sulfonate compound each . it is obvious that the corresponding meta - alkylbenzene sulfonate and ortho - alkylbenzene sulfonate compounds are also embodiment variants of the present invention in other variants , not shown in the figures . fig6 e through 6 h show each exemplary embodiments for iso - or n - alkyl sulfate compounds , namely , sodium alkyl sulfate ( fig6 e ), potassium alkyl sulfate ( fig6 , lithium alkyl sulfate ( fig6 g ), and tetraethylammonium alkyl sulfate ( fig6 h ). it is seen that the alkyl sulfates corresponding to fig6 e through 6 h may have a variable length of the alkyl chain . here , n is always selected from among 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 12 . fig6 i and 6 l show exemplary embodiments each for alkyl ether sulfate compounds , namely , sodium alkyl ether sulfate ( fig6 i ), potassium alkyl ether sulfate ( fig6 j ), lithium alkyl ether sulfate ( fig6 k ), and tetraethylammonium alkyl ether sulfate ( fig6 l ). it is seen that the terminal alkyl chain of the alkyl ether sulfates corresponding to fig6 i through 6 l may have a variable length . here , n is always selected from among 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 12 , and t is an integer between and including 1 and including 20 . it is thus seen . on the whole , that the exemplary embodiments corresponding to fig1 b , 1 d , 1 f , 1 h , 2 c , 3 b , 4 a , 4 e , 6 a , 6 e and 6 i are sodium salts . it is also seen that the exemplary embodiments corresponding to fig1 b , 1 d , 1 f , 1 h , 2 e , 3 c , 4 b , 4 f , 6 b , 6 f , and 6 j are potassium salts . in addition , it is seen that the exemplary embodiments corresponding to fig1 b , 1 d , 1 f , 1 h , 2 d , 3 d , 4 c , 4 g , 6 c , 6 g and 6 k are lithium salts . it is further seen that the exemplary embodiments corresponding to fig1 b , 1 d , 1 f , 1 h , 2 f , 3 e , 4 d , 4 h , 6 d , 6 h and 6 l are tetraethylammonium salts . in another embodiment variant , the surfactant is a cationic surfactant , as can be seen in fig5 a through 5 h . it is seen , in particular , that the compounds shown in fig5 a through 5 h are quaternary ammonium compounds . a hydrogen sulfate ion ( hso 4 − ) acts as a counterion in the compounds corresponding to fig5 a through 5 d . a dihydrogen phosphate ion ( h 2 po 4 − ) acts as a counterion in the compounds corresponding to fig5 e through 5 h . it is further seen that the exemplary embodiments shown in fig5 a through 5 h are each tetraalkylammonium compounds . the tetraalkylammonium compounds are each halogen - free compounds . in particular , the compounds are surfactants corresponding to the following formula [(( c s h 2s + 1 )( c p h 2p + 1 )( c q h 2q + 1 )( c r h 2r + 1 )) n + ] r2 ( formula iii ) s ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 }, p ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 }, q ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 }, r ={ 0 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 }, wherein r2 is selected from the group containing hso 4 − , h 2 po 4 − , cf 3 — co 3 − , c 2 f 4 hso 3 − , cf 3 − coo − , ( cf 3 — so 2 ) 2 n − . the embodiment variants shown in fig5 b and 5 f are each dimethyldialkylammonium compounds . the two alkyl groups of the respective compound have at least a length of two carbon atoms . in other words , the embodiment variants corresponding to fig5 b and 5 f have at least two methyl groups each and correspond to one of the following two formulas : [(( c s h 2s + 1 )( c p h 2p + 1 )( c q h 2q + 1 )( c r h 2r + 1 )) n + ] hso 4 − ( formula iiid ), in which s ={ 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 }, p ={ 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 }, q ={ 1 }, and r ={ 1 }, or [(( c s h 2s + 1 )( c p h 2p + 1 )( c q h 2q + 1 )( c r h 2r + 1 )) n + ] h 2 po 4 − ( formula iiie ), in which s ={ 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 }, p ={ 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 }, q ={ 1 }, and r ={ 1 }. it is seen that the embodiment variants corresponding to fig5 b are selected from the group containing diethyldimethylammonium hydrogen sulfate , butylethyldimethylammonium hydrogen sulfate , pentylethyldimethylammonium hydrogen sulfate , hexylethyldimethylammonium hydrogen sulfate , heptylethyldimethylammonium hydrogen sulfate , octylethyldimethylammonium hydrogen sulfate , nonylethyldimethylammonium hydrogen sulfate , decylethyldimethylammonium hydrogen sulfate , undecylethyldimethylammonium hydrogen sulfate , dodecylethyldimethylammonium hydrogen sulfate , dibutyldimethylammonium hydrogen sulfate , pentylbutyldimethylammonium hydrogen sulfate , hexylbutyldimethylammonium hydrogen sulfate , heptylbutyldimethylammonium hydrogen sulfate , octylbutyldimethylammonium hydrogen sulfate , nonylbutyldimethylammonium hydrogen sulfate , decylbutyldimethylammonium hydrogen sulfate , undecylbutyldimethylammonium hydrogen sulfate , dodecylbutyldimethylammonium hydrogen sulfate , dipentyldimethylammonium hydrogen sulfate , hexylpentyldimethylammonium hydrogen sulfate , heptylpentyldimethylammonium hydrogen sulfate , octylpentyldimethylammonium hydrogen sulfate , nonylpentyldimethylammonium hydrogen sulfate , decylpentyldimethylammonium hydrogen sulfate , undecylpentyldimethylammonium hydrogen sulfate , dodecylpentyldimethylammonium hydrogen sulfate , dihexyldimethylammonium hydrogen sulfate , heptylhexyldimethylammonium hydrogen sulfate , octylhexyldimethylammonium hydrogen sulfate , nonylhexyldimethylammonium hydrogen sulfate , decylhexyldimethylammonium hydrogen sulfate , undecylhexyldimethylammonium hydrogen sulfate , dodecylhexyldimethylammonium hydrogen sulfate , diheptyldimethylammonium hydrogen sulfate , octylheptyldimethylammonium hydrogen sulfate , nonylheptyldimethylammonium hydrogen sulfate , decylheptyldimethylammonium hydrogen sulfate , undecylheptyldimethylammonium hydrogen sulfate , dodecylheptyldimethylammonium hydrogen sulfate , dioctyldimethylammonium hydrogen sulfate , nonyloctyldimethylammonium hydrogen sulfate , decyloctyldimethylammonium hydrogen sulfate , undecyloctyldimethylammonium hydrogen sulfate , dodecyloctyldimethylammonium hydrogen sulfate , dinonyldimethylammonium hydrogen sulfate , decylnonyldimethylammonium hydrogen sulfate , undecylnonyldimethylammonium hydrogen sulfate , dodecylnonyldimethylammonium hydrogen sulfate , didecyldimethylammonium hydrogen sulfate , undecyldecyldimethylammonium hydrogen sulfate , dodecyldecyldimethylammonium hydrogen sulfate , diundecyldimethylammonium hydrogen sulfate , dodecylundecyldimethylammonium hydrogen sulfate , didodecyldimethylammonium hydrogen sulfate . the embodiment variants shown in fig5 c , 5 d , 5 g and 5 h are trimethylalkylammonium compounds . it is thus seen that the embodiment variants corresponding to fig5 c are selected from the group containing ethyltrimethylammonium hydrogen sulfate , butyltrimethylammonium hydrogen sulfate , pentyltrimethylammonium hydrogen sulfate , hexyltrimethylammonium hydrogen sulfate , heptyltrimethylammonium hydrogen sulfate , octyltrimethylammonium hydrogen sulfate , nonyltrimethylammonium hydrogen sulfate , decyltrimethylammonium hydrogen sulfate , undecyltrimethylammonium hydrogen sulfate , dodecyltrimethylammonium hydrogen sulfate . the especially preferred embodiment variant corresponding to fig5 d is dodecyltrimethylammonium hydrogen sulfate . it is further seen that the embodiment variants corresponding to fig5 f are selected from the group containing diethyldimethylammonium dihydrogen phosphate , butylethyldimethylammonium dihydrogen phosphate , pentylethyldimethylammonium dihydrogen phosphate , hexylethyldimethylammonium dihydrogen phosphate , heptylethyldimethylammonium dihydrogen phosphate , octylethyldimethylammonium dihydrogen phosphate , nonylethyldimethylammonium dihydrogen phosphate , decylethyldimethylammonium dihydrogen phosphate , undecylethyldimethylammonium dihydrogen phosphate , dodecylethyldimethylammonium dihydrogen phosphate , dibutyldimethylammonium dihydrogen phosphate , pentylbutyldimethylammonium dihydrogen phosphate , hexylbutyldimethylammonium dihydrogen phosphate , heptylbutyldimethylammonium dihydrogen phosphate , octylbutyldimethylammonium dihydrogen phosphate , nonylbutyldimethylammonium dihydrogen phosphate , decylbutyldimethylammonium dihydrogen phosphate , undecylbutyldimethylammonium dihydrogen phosphate , dodecylbutyldimethylammonium dihydrogen phosphate , dipentyldimethylammonium dihydrogen phosphate , hexylpentyldimethylammonium dihydrogen phosphate , heptylpentyldimethylammonium dihydrogen phosphate , octylpentyldimethylammonium dihydrogen phosphate , nonylpentyldimethylammonium dihydrogen phosphate , decylpentyldimethylammonium dihydrogen phosphate , undecylpentyldimethylammonium dihydrogen phosphate , dodecylpentyldimethylammonium dihydrogen phosphate , dihexyldimethylammonium dihydrogen phosphate , heptylhexyldimethylammonium dihydrogen phosphate , octylhexyldimethylammonium dihydrogen phosphate , nonylhexyldimethylammonium dihydrogen phosphate , decylhexyldimethylammonium dihydrogen phosphate , undecylhexyldimethylammonium dihydrogen phosphate , dodecylhexyldimethylammonium dihydrogen phosphate , diheptyldimethylammonium dihydrogen phosphate , octylheptyldimethylammonium dihydrogen phosphate , nonylheptyldimethylammonium dihydrogen phosphate , decylheptyldimethylammonium dihydrogen phosphate , undecylheptyldimethylammonium dihydrogen phosphate , dodecylheptyldimethylammonium dihydrogen phosphate , dioctyldimethylammonium dihydrogen phosphate , nonyloctyldimethylammonium dihydrogen phosphate , decyloctyldimethylammonium dihydrogen phosphate , undecyloctyldimethylammonium dihydrogen phosphate , dodecyloctyldimethylammonium dihydrogen phosphate , dinonyldimethylammonium dihydrogen phosphate , decylnonyldimethylammonium dihydrogen phosphate , undecylnonyldimethylammonium dihydrogen phosphate , dodecylnonyldimethylammonium dihydrogen phosphate , didecyldimethylammonium dihydrogen phosphate , undecyldecyldimethylammonium dihydrogen phosphate , dodecyldecyldimethylammonium dihydrogen phosphate , diundecyldimethylammonium dihydrogen phosphate , dodecylundecyldimethylammonium dihydrogen phosphate , didodecyldimethylammonium dihydrogen phosphate . the embodiment variants shown in fig5 c , 5 d , 5 g and 5 h are trimethylalkylammonium compounds . it is thus seen that the embodiment variants corresponding to fig5 g are selected from the group containing ethyltrimethylammonium dihydrogen phosphate , butyltrimethylammonium dihydrogen phosphate , pentyltrimethylammonium dihydrogen phosphate , hexyltrimethylammonium dihydrogen phosphate , heptyltrimethylammonium dihydrogen phosphate , octyltrimethylammonium dihydrogen phosphate , nonyltrimethylammonium dihydrogen phosphate , decyltrimethylammonium dihydrogen phosphate , undecyltrimethylammonium dihydrogen phosphate , dodecyltrimethylammonium dihydrogen phosphate . the especially preferred embodiment variant corresponding to fig5 h is dodecyltrimethylammonium dihydrogen phosphate . in other words , the embodiment variants corresponding to fig5 c , 5 d , 5 g and 5 h have three methyl groups each and correspond to one of the following two formulas : [(( c s h 2s + 1 )( c p h 2p + 1 )( c q h 2q + 1 )( c r h 2r + )) n + ] hso 4 − ( formula iiid ), in which s ={ 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 }, p ={ 1 }, q ={ 1 }, and r ={ 1 }, or [(( c s h 2s + 1 )( c p h 2p + 1 )( c q h 2q + 1 )( c r h 2r + 1 )) n + ] h 2 po 4 − ( formula iiie ), in which s ={ 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 }, p ={ 1 }, q ={ 1 }, and r ={ 1 }. each of the exemplary embodiments shown in fig1 a through 1 h , 2 a through 2 f , 3 a through 3 e , 4 a through 4 h , 5 a through 5 h and 6 a through 6 l for a surfactant according to the present invention may be contained in or form the additive according to the present invention alone or in combination with one or more other of the surfactants according to the present invention . it is thus seen that an electrolyte according to the present invention contains an additive , wherein the additive has at least one surfactant corresponding to one of the exemplary embodiments shown in fig1 a through 1 h , 2 a through 2 f , 3 a through 3 e , 4 a through 4 h , 5 a through 5 h and 6 a through 6 l . it is further seen that the additive consists entirely of one surfactant in one embodiment variant and is a mixture of a plurality of components in another embodiment variant , one component being a surfactant . in any case , at least one surfactant has , in at least one embodiment variant , a counterion , which is selected from among heterocyclic cations , ammonium ions , h ± ions , alkali or alkaline earth ions , hso 4 − ions or h 2 po 4 − ions , cf 3 — so 3 − ions , c 2 f 4 hso 3 − ions , cf 3 — coo − ions , and ( cf 3 — so 2 ) 2 n − ions . all surfactants may have the same counterion , or the surfactants may have different counterions . if the additive is a mixture of a plurality of components , it has , in one embodiment variant , both halogenated surfactants corresponding to the exemplary embodiments according to fig1 a through 1 d , 2 a through 2 f and 3 a through 3 e and halogen - free surfactants corresponding to the exemplary embodiments according to fig1 e through 1 h , 4 a through 4 h , 5 f through 5 h and 6 a through 6 l . fig7 shows a first , very simple and schematic exemplary embodiment of an electrochemical gas sensor 10 , which has an electrolyte 30 with an additive . the gas sensor 10 is an electrochemical cell . it has a housing 10 with a gas inlet 23 . two electrodes 21 , 22 , namely , a working electrode 21 and a counterelectrode 22 , are arranged in the housing . the electrodes 21 , 22 are coupled with one another via an electrically conductive analysis unit 24 . the analysis unit is , e . g ., an amperometer . the electrolyte 30 is arranged in the housing 10 . the electrodes 21 , 22 partly dip into the electrolyte 30 . the electrolyte 30 therefore partly wets the electrodes 21 , 22 . a gas mixture 40 to be analyzed can enter and , if necessary , also leave the housing 10 through a gas inlet 23 . it is seen that the gaseous phase , which is formed by the gas mixture 40 , the liquid phase , which is formed by the electrolyte 30 , and the solid phase , which is formed by the respective electrodes 21 , 22 , form a three - phase boundary . the desired reaction of the gas to be detected with the electrode material and with the electrolyte takes place at this three - phase boundary . the additive of the electrolyte 30 contains a surfactant corresponding to one of the above - described exemplary embodiments shown in fig1 a through 1 e , 2 a through 2 f , 3 a through 3 e , 4 a through 4 h , 5 f through 5 h and 6 a through 6 l . in one embodiment variant , the additive of the electrolyte 30 contains a plurality of these surfactants . in yet another embodiment variant , the additive additionally contains additional components . fig8 a schematically shows another embodiment variant for an electrochemical gas sensor 10 . this gas sensor 10 also has a housing 20 , in which a working electrode 21 and a counterelectrode 22 are arranged . the electrodes 21 , 22 are also coupled here with one another via an analysis unit 24 . the housing 20 has , in addition , a gas inlet 23 and a gas outlet 25 . a gas mixture 40 to be analyzed can enter the housing 10 through the gas inlet 23 and form a gaseous phase there . the electrolyte 30 is arranged in the interior of a porous wick system ( wick ) 50 . the wick system 50 is in contact with the electrodes 21 , 22 such that a layer of the electrolyte ( electrolyte layer ) is formed between the wick system 50 and the surface of the electrodes 21 , 22 . this electrolyte layer wets the surface of the electrodes 21 , 22 on the side of the electrodes 21 , 22 facing the wick system 50 . the electrodes 21 , 22 consist of a porous material . the pores of the material enlarge the surface of the electrodes 21 , 22 . it is seen in the enlarged detail of area a , which is shown in fig8 b , that the electrolyte 30 enters the pores of the electron material . a three - phase boundary is formed from the electrode material 21 , the gas mixture 40 and the electrolyte 30 within the respective pore . the wick system 50 ensures that a sufficient quantity of but not too much electrolyte 30 is always present in the pores of the electrodes 21 , 22 . this process is supported especially by the surfactant , which is present in the additive of the electrolyte 30 . in an exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . perfluorosulfonic acid (= heptadecafluorooctylsulfonic acid ) is present as an additive at a concentration of 20 mmol / l in this liquid medium . in another exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . perfluorooctylsulfonic acid is present as an additive at a concentration of 2 mmol / l in this liquid medium . in another exemplary embodiment of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . perfluorooctylsulfonic acid is present as an additive at a concentration of 500 mmol / l in this liquid medium . in another exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . perfluorooctylsulfonic acid is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . perfluorooctylsulfonic acid is present as an additive at a concentration of 20 mmol / l in this liquid medium . in another exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium 1 - perfluorooctyl sulfonate is present as an additive at a concentration of 2 mmol / l in this liquid medium . in another exemplary example of an electrolyte a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium 1 - perfluorooctyl sulfonate is present as an additive at a concentration of 500 mmol / l in this liquid medium . in another exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium 1 - perfluorooctyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium 1 - perfluorooctyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in another exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - perfluorooctyl sulfonate is present as an additive at a concentration of 2 mmol / l in this liquid medium . in another exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - perfluorooctyl sulfonate is present as an additive at a concentration of 500 mmol / l in this liquid medium . in another exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - perfluorooctyl sulfonate is present as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - perfluorooctyl sulfonate is present as an additive at a concentration of 20 mmol / l in this liquid medium . in another exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium 1 - perfluorooctyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in another exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium 1 - perfluorooctyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in another exemplary example of an electrolyte with a perfluorinated , an ionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium 1 - perfluorooctyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium 1 - perfluorooctyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in another exemplary examples of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium 1 - perfluorooctyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in another exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium 1 - pefluorooctyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in another exemplary example of an electrolyte with a perfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium 1 - perfluorooctyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tridecafluorooctylsulfonic acid is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tridecafluorooctylsulfonic acid is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tridecafluorooctylsulfonic acid is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tridecafluorooctylsulfonic acid is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a polyfluorinated , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium tridecafluorooctyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium 1 - butyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium 1 - butyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium 1 - butyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium 1 - butyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium isobutyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium isobutyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium isobutyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium isobutyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - butyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - butyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - butyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - butyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - butyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - butyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - butyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - butyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium 1 - butyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium 1 - butyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium 1 - butyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium 1 - butyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium isobutyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium isobutyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium isobutyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium isobutyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium 1 - butyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium 1 - butyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium 1 - butyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium 1 - butyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium isobutyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium isobutyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium isobutyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium isobutyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium 1 - dodecyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium 1 - dodecyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium 1 - dodecyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium 1 - dodecyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium isododecyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium isododecyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium isododecyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . sodium isododecyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - dodecyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - dodecyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - dodecyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium 1 - dodecyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium isododecyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium isododecyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium isododecyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . potassium isododecyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium 1 - dodecyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium 1 - dodecyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium 1 - dodecyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium 1 - dodecyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium isododecyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium isododecyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium isododecyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . lithium isododecyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium 1 - dodecyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium 1 - dodecyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium 1 - dodecyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium 1 - dodecyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium isododecyl sulfonate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium isododecyl sulfonate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium isododecyl sulfonate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a halogen - free , anionic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . tetraethylammonium isododecyl sulfonate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a cationic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . dodecyltrimethylammonium hydrogen sulfate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a cationic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . dodecyltrimethylammonium hydrogen sulfate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a cationic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . dodecyltrimethylammonium hydrogen sulfate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a cationic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . dodecyltrimethylammonium hydrogen sulfate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with a cationic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . dodecyltrimethylammonium dihydrogen phosphate is contained as an additive at a concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a cationic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . dodecyltrimethylammonium dihydrogen phosphate is contained as an additive at a concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a cationic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . dodecyltrimethylammonium dihydrogen phosphate is contained as an additive at a concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with a cationic surfactant , the electrolyte consists of a liquid medium in the form of sulfuric acid . dodecyltrimethylammonium dihydrogen phosphate is contained as an additive at a concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of dodecyltrimethylammonium hydrogen sulfate and polyethylene glycol is present as an additive at a total concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of dodecyltrimethylammonium hydrogen sulfate and polyethylene glycol is present as an additive at a total concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of dodecyltrimethylammonium hydrogen sulfate and polyethylene glycol is present as an additive at a total concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of dodecyltrimethylammonium hydrogen sulfate and polyethylene glycol is present as an additive at a total concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of dodecyltrimethylammonium hydrogen sulfate and polyethylene glycol is present as an additive at a total concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of dodecyltrimethylammonium hydrogen sulfate and polyethylene glycol is present as an additive at a total concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of dodecyltrimethylammonium hydrogen sulfate and polyethylene glycol is present as an additive at a total concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of dodecyltrimethylammonium hydrogen sulfate and glycol is present as an additive at a total concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of dodecyltrimethylammonium hydrogen sulfate and glycol is present as an additive at a total concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of dodecyltrimethylammonium hydrogen sulfate and glycol is present as an additive at a total concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - dodecyl sulfonate and polyethylene glycol is present as an additive at a total concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - dodecyl sulfonate and polyethylene glycol is present as an additive at a total concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - dodecyl sulfonate and polyethylene glycol is present as an additive at a total concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - dodecyl sulfonate and polyethylene glycol is present as an additive at a total concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - dodecyl sulfonate and polypropylene glycol is present as an additive at a total concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - dodecyl sulfonate and polypropylene glycol is present as an additive at a total concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - dodecyl sulfonate and polypropylene glycol is present as an additive at a total concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - dodecyl sulfonate and glycol is present as an additive at a total concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - dodecyl sulfonate and glycol is present as an additive at a total concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - dodecyl sulfonate and glycol is present as an additive at a total concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - butane sulfonate and polyethylene glycol is present as an additive at a total concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - butane sulfonate and polyethylene glycol is present as an additive at a total concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - butane sulfonate and polyethylene glycol is present as an additive at a total concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - butane sulfonate and polyethylene glycol is present as an additive at a total concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - butane sulfonate and polypropylene glycol is present as an additive at a total concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - butane sulfonate and polypropylene glycol is present as an additive at a total concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - butane sulfonate and polypropylene glycol is present as an additive at a total concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - butane sulfonate and glycol is present as an additive at a total concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - butane sulfonate and glycol is present as an additive at a total concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of sodium 1 - butane sulfonate and glycol is present as an additive at a total concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of tridecafluorooctylsulfonic acid and polyethylene glycol is present as an additive at a total concentration of 2 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of tridecafluorooctylsulfonic acid and polyethylene glycol is present as an additive at a total concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of tridecafluorooctylsulfonic acid and polyethylene glycol is present as an additive at a total concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of tridecafluorooctylsulfonic acid and polyethylene glycol is present as an additive at a total concentration of 1 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of tridecafluorooctylsulfonic acid and polypropylene glycol is present as an additive at a total concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of tridecafluorooctylsulfonic acid and polypropylene glycol is present as an additive at a total concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of tridecafluorooctylsulfonic acid and polypropylene glycol is present as an additive at a total concentration of 1 mol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of tridecafluorooctylsulfonic acid and glycol is present as an additive at a total concentration of 20 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of tridecafluorooctylsulfonic acid and glycol is present as an additive at a total concentration of 500 mmol / l in this liquid medium . in an exemplary example of an electrolyte with an additive , which has a mixture of a plurality of surfactants , the electrolyte consists of a liquid medium in the form of sulfuric acid . a mixture of tridecafluorooctylsulfonic acid and glycol is present as an additive at a total concentration of 1 mol / l in this liquid medium . the present invention is not limited to one of the above - described embodiments but can be modified in many different ways . thus , the electrochemical gas sensor 10 has more than two electrodes 21 , 22 in another embodiment variant ( not shown ). just as the gas outlet 25 , the gas inlet 23 may be covered by a membrane in order to prevent dust and other foreign particles from entering the gas sensor 10 . all the features and advantages appearing from the claims , the description and the drawings , including design details , spatial arrangements and method steps , may be essential for the present invention both in themselves and in the many different combinations . while specific embodiments of the invention have been shown and described in detail to illustrate the application of the principles of the invention , it will be understood that the invention may be embodied otherwise without departing from such principles .	6
the advantages achieved by means of the various embodiments consist in particular in that pressure changes acting on the stop valve are taken into consideration and this therefore enables an improved control quality of the injection system to be set . the volume flow is determined for different pressures acting on the stop valve adjusted depending on the fuel supplied and recorded in a characteristic field . fig1 shows a block diagram of an injection system for controlling the fuel injection quantity . here , the injection system consists of a low pressure pump 2 which pumps out fuel , a volume flow control valve 3 with recirculating pipe 5 to the fuel tank 1 , a high - pressure pump 4 which feeds fuel to a high pressure storage unit 6 , a measuring unit 8 which determines the pressure upstream of the volume flow control valve 3 and injectors 7 , 7 ′ and 7 ″ for injecting fuel into a combustion chamber of the internal combustion engine ( not shown in the drawing ). it has proved to be advantageous to use a seat valve for the volume flow control valve 3 . by means of a low pressure pump 2 , fuel is encouraged out of the fuel tank 1 and fed to a high pressure pump 4 via a volume flow control valve 3 . the high pressure pump 4 then feeds a high pressure storage unit 6 with the fuel fed from the low pressure pump 2 . in this way , pressures of up to 1800 bar can build up in the high pressure storage unit 6 . fuel is finally injected from the high pressure storage unit 6 into a combustion chamber via injectors 7 , 7 ′, and 7 ″. the volume flow control valve 3 provided between the low pressure pump 2 and the high pressure pump 4 , e . g . a seat valve serves to control the pressure inside the high pressure storage unit 6 , with a recirculating pipe 5 to the fuel tank . here , the control of the volume flow control valve 3 takes place by means of a supply of electric current to an actuator of the volume flow control valve 3 , depending on the pressure measured in the measuring unit 8 . with the aid of the volume flow control valve 3 , the intake volume of the low pressure pump 2 is controlled and thus the pressure in the high pressure storage unit 6 is determined . fig2 shows a cross - sectional view of a seat valve . a ball element 1 provided in this exemplary embodiment ensures that a volume flow through - flow between the inlet chamber 12 and the outflow chamber 13 is prevented . fuel is fed to the intake chamber 12 from the low pressure pump 2 . the fuel travels by means of the outflow chamber 13 to the fuel tank via a recirculation pipe . the ball element 1 is held in the closed position in the outgoing situation by a spring 11 so that a volume flow from the intake chamber 12 into the outflow chamber 13 is prevented . the ball element 1 can be pushed into the outflow chamber 12 by means of an actuator 10 . in this way , the ball element 1 is pushed further into the intake chamber 12 the more the actuator 10 is supplied with fuel . based on the pressure difference between the pressure p 1 in the intake chamber 12 and the pressure p 2 in the outflow chamber 13 , the volume flow can be controlled . the volume flow is therefore greater , the further the ball element is pushed into the intake chamber 12 and / or the greater the pressure difference between the intake chamber 12 and the outflow chamber 13 . if the pressure p 1 in the intake chamber 12 increases , the actuator 10 must be supplied by higher electric current in order to push the ball element 1 against the adjusting flow direction into the same position as would be the case if the pressure were not increased . in the event ( not shown ) that the ball element 11 is opened in the flow direction , when the pressure is increased in the intake chamber a reduced supply of electric current to the actuator will be necessary in order to push the ball element into the same position as would be the case if the pressure were not increased . fig3 shows how a valve characteristic diagram shifts depending on the pressure acting on the stop valve . the volume flow trend q is shown in relation to the supply of electric current i to the actuator . the volume flow trend v 1 then corresponds to the trend in a discharge pressure p 1 in the intake chamber . as soon as the pressure p 1 in the intake chamber increases , higher current i has to be supplied to the actuator , so that the same volume flow q can flow via the seat valve . in this way , a new volume flow trend v 1 ′ is adjusted for a higher pressure p 1 in the intake chamber .	5
the instant invention relates to improving , for example , an industrial process ( e . g ., a rectisol process ) wherein sulfur species ( e . g ., h 2 s , cos , among other compounds ), are removed from an industrial gas feed stream by methanol absorption , and then concentrated for sulfur recovery or disposal in another unit , typically in a claus plant wherein the sulfur species are recovered as liquid sulfur ( for purposes of this invention the “ claus process ”). the concentrated sulfur stream is normally generated in a steam - heated desorption column within equipment designed to conduct the rectisol process . this concentrated stream can be cooled to condense excess methanol vapor before being sent to disposal or sulfur recovery , otherwise methanol losses from the system can be relatively large . the concentrated sulfur stream typically also contains relatively large amounts of carbon dioxide , often about 50 % or more on a molar basis . the cooling and methanol condensation of the rectisol process are typically done in a cooling loop using some source of relatively cold temperatures , typically below zero degrees f , such as a cold vent gas or a refrigerant . the temperatures required to condense methanol from the concentrated sulfur stream can also condense ammonia , hydrogen cyanide , among other compounds or components . these trace components are typically present at relatively low concentrations in the feed gas to the rectisol unit ( e . g ., effluent from a gasifier ). typically the rectisol process is operated in a manner to route all ammonia and hydrogen cyanide into the concentrated sulfur stream . however , condensation of ammonia and hydrogen cyanide in connection with the methanol condensation can result in a build - up of these species . if the ammonia reaches a critical concentration , which may vary depending upon the temperatures and other species present , ammonia can react with carbon dioxide to form solid ammonium carbamate in the following reaction : the solid ammonium carbamate can foul cold heat transfer surfaces and cause excessive pressure drop in the cooling exchanger of the rectisol process . typically , the only practical solution once the pressure drop becomes too high is to shut down the heat exchanger ( and necessarily the entire rectisol process ) and warm up the fouled surfaces . at temperatures above 130 - 140 f the ammonium carbamate sublimates from the surfaces and can be purged . whether or not fouling occurs , depends upon the mass balance of the ammonia in the system and on the temperatures employed during cooling . if all ammonia absorbed from the rectisol feed stream is disposed in the concentrated sulfur stream so that the resulting ammonia concentration in the cooling loop remains below the critical concentration , no significant fouling occurs . if the ammonia in the feed stream rises , or other process changes occur such that the critical ammonia concentration is reached , then fouling occurs and the plant must be shut down ( with the attendant loss of production and revenue ). while hydrogen cyanide does not cause fouling , it can build up in a similar way and potentially cause corrosion within the system . fouling and / or corrosion are difficult to predict since prior to starting the rectisol process , the ammonia and hydrogen cyanide levels in the rectisol feed stream may be unknown or vary during operation of the recitsol process . in one aspect of the instant invention , a sidestream comprising methanol , ammonia and / or hydrogen cyanide is removed from the cooling train for the concentrated sulfur stream in the rectisol system . for example , this stream can be taken from the process location where ammonia and / or hydrogen cyanide are at their maximum concentrations . this sidestream is fed to a stripping column ( e . g ., the top of a stripping column ), which may use random or structured packing or trays , depending upon the design and size and other known variables . desirable results have been obtained by using random packing . a gas ( also known as a stripping gas ) is fed to the bottom of the column and flows counter - current upward to the down - flowing methanol . this gas can be nitrogen or any other gas stream that is compatible with the species present and with the utility of the column &# 39 ; s overhead vapor . in one aspect of the invention , the overhead vapor containing ammonia and / or hydrogen cyanide and the stripping gas are combined with the previously described concentrated sulfur stream ( produced by the rectisol process ) and further processed ( e . g ., in a claus process ). while any suitable gas can be employed in the inventive process , examples of suitable gases comprises at least one member from the group consisting of nitrogen , argon , hydrogen , methane or natural gas are suitable . desirable results have been obtained by using nitrogen . the methanol containing stream exiting the bottom of the column , with reduced concentrations of ammonia and / or hydrogen cyanide , is typically returned to the rectisol process . it should be noted that complete removal of ammonia and / or hydrogen cyanide may not be required or practical in the stripping column ; it is only necessary to remove sufficient amounts to eliminate or substantially reduce fouling or corrosion . in general the methanol flow to the stripping device should be as low as practical , as this minimizes the stripping gas employed . the relative flows of liquid and stripping as to the column can be optimized depending upon the desired amount of ammonia to be removed . in some cases it will be useful to provide relatively large amounts of methanol to the stripping column and remove a lower percentage of ammonia and / or hydrogen cyanide ; this may allow lower flows of stripping gas to be used . the amount of stripping gas supplied to the column may vary depending upon the intended usage of the overhead vapor from the column . if the overhead vapor is provided to a claus process , there may be a concentration limits on stripping gas , methanol or other components in the overhead vapor . the overall system can be optimized to meet all concentration parameters on streams exiting the stripping column ( including , for example , the elimination of ammonia and / or hydrogen cyanide ) while minimizing the required flows of stripping gas and methanol fed to the column . referring now to fig1 , fig1 is a schematic illustration of one aspect of the instant invention . a sulfur - rich gas stream ( source not shown ) is introduced into the rectisol system , and three streams exit the system . one exiting stream comprises a sulfur - rich stream that is typically further processed by a claus process ( not shown ) in order to dispose or recover sulfur . a second exiting stream comprises methanol that is recycled to the rectisol process . the third exiting stream comprising ammonia and methanol can be treated in accordance with the instant invention . the concentrations of methanol , ammonia and other components in the third stream can vary depending upon the feed stream introduced to the rectisol process , effectiveness of the rectisol process , operating conditions , among other parameters . the third stream is introduced into a stripping column or other device capable of causing an interaction between a stripping gas ( e . g ., an inert gas such as nitrogen ), and the compound to be removed ( e . g ., ammonia ). a suitable gas is introduced into the column and a stream containing ammonia and the stripping gas is released overhead , and a methanol stream having a reduced amount of ammonia ( or stripped stream ) is released from the bottom of the column . the stripped methanol can be reintroduced into the rectisol process . the concentration of ammonia and stripping gas in the overhead stream can vary depending upon temperature , pressure , composition of feed stream to the rectisol process , among other variables . the concentration of methanol ( and other compounds ) in the stream exiting the column can vary depending upon the previously identified variables but is typically greater than about 80 % on a molar basis . while any suitable temperature can be employed for operating the column , the temperature will normally range from about 40 to about 110 f . the process pressure will normally range from 50 to about 100 psig . while this description emphasizes a process for treating a methanol stream , the instant invention can be used to remove a wide range of compounds from a wide range of organic streams . similarly , the instant invention can be used to treat a wide range of process streams other than those produced by a rectisol process . the following examples are provided to illustrate certain aspects of the invention and do not limit the scope of the claims appended hereto . the following example is based upon a gas stream that was produced in a commercial industrial process and which was modeled in aspen using a proprietary thermodynamics package in accordance with conventional methods . the ammonia removal rate was adequate to reduce fouling of the rectisol process equipment . the following example represents the same ammonia mass removal rate as in example 1 : 0 . 28 lbmoles / hr . but in this example the liquid methanol feed rate to the stripper is doubled , and the nitrogen stripping gas flow is adjusted to maintain that same mass removal rate . while the liquid feed rate doubles , the required n 2 stripping flow declines by 27 %. the per cent ammonia removal ( as opposed to the mass removal ) drops from 40 . 4 % in example 1 , to 20 . 8 % in example 2 . this example illustrates that it is possible to optimize the stripping column in different ways to achieve a predetermined removal rate , depending on which variables are most important in a given facility . the present invention is not limited in scope by the specific aspects disclosed in the examples which are intended as illustrations of a few aspects of the invention and any embodiments that are functionally equivalent are within the scope of this invention . indeed , various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art and are intended to fall within the scope of the appended claims .	1
referring now to fig1 , a three - dimensional spectrally encoded imaging system 10 includes a source 12 coupled to a beam splitter 14 at first port 14 a . it should be appreciated that beam splitter 14 may be implement using any techniques now known or later discovered . for example , splitter 14 may be provided as a fiber optic beam splitter , a free space splitter or a glass plate splitter . the system 10 includes a reference path 16 coupled to a second port 14 b of the beam splitter 14 and a sample path 18 coupled to a third port 14 c of the beam splitter 14 . the reference path 16 includes a path - length change device 17 . path - length change device 17 is adapted to change a propagation path length of light propagating in the reference path 16 . the device 17 allows the optical path length of the reference arm 17 to be changed in a controlled and known manner . in some embodiments , device 17 may be provided such that it can introduce a change in the group delay of optical signals propagating in path 16 . such a change in group delay may or may not be accompanied by a physical change in the optical path length of the reference arm . changes in group delay in optical signals may be desired to reduce speckle artifacts and possibly result in increased system sensitivity . it should be appreciated that in embodiments in which the reference arm does not include a path - length change device 17 , then the depth at a single spot along a scan line of a sample may be computed . the sample path 18 has disposed therein a sample 19 ( also referred to herein as a specimen 19 ). the sample path 18 may optionally include one or more of a dispersive elements 18 a , a beam focusing device 18 b and a scanning element ( or more simply , a scanner ) 18 c as described in co - pending application ser . no . 09 / 709 , 162 . the dispersive element may be provided , for example , as a diffraction grating and in response to a signal fed thereto from the beam splitter , the dispersive element disperses the signal into a spectrum in an image plane . the dispersive element may also be provided as a dispersive prism , a fiber grating , a blazed grating , a grism , a holographic lens grating or any other element which provides angular separation of light signals propagating at different wavelengths . that is , in response to light signals incident thereon , the dispersive element directs different wavelengths in different directions or , stated differently , the dispersive element disperses the spectrum of the light signal provided thereto to provide a spectrally encoded focal plane . the beam focusing device 18 b focuses individual spectrally - encoded points toward the sample 19 disposed in the sample path 18 . the beam focusing device may be provided , for example , from an optical system such as a lens system . the scanning element 18 c , scans the spectrally - encoded beam across the specimen 19 to produce a two - dimensional image . it should be understood that the positions of the dispersive device 18 a and beam focusing device 18 b are selected in accordance with the requirements and needs of the particular application . it should be appreciated that in some embodiments , it may be desirable to provide the dispersive element 18 a the scanner 18 c and the beam focusing device 18 b as separate elements . for example , the dispersive element 18 a may be provided as a diffraction grating , the beam focusing device 18 b may be provided as a lens disposed to focus the beam on the specimen and the scanner 18 c may be provided as a galvanometric scanner disposed to direct light to and from the diffraction grating . the dispersive element 18 a , scanner 18 c and lens system 18 b may be combined in a single housing . in other embodiments , however , it may be desirable to provide the dispersive element 18 a , the scanner 18 c and the lens system 18 b as a single integrated element . alternatively still , the functions performed by the dispersive element 18 a , scanner 18 c and lens system 18 b may be provided from a single device . in order to obtain a surface profile of the specimen 19 , the propagation path length of the reference path 16 is changed . in one embodiment , the path length of the reference path 16 is changed by providing the device 17 as a movable reflective device disposed at the end of the reference arm . movement of the reflective device changes the path length of the reference arm 16 . in one embodiment , the movable reflective device can be provided as a mirror disposed on a movable platform at the end of the reference arm 16 . movement of the platform ( and thus the mirror ) changes the optical path length of the reference arm 16 . other techniques for changing the path length of the reference path , may of course , also be used . the source 12 emits a light signal to the beam splitter 14 which splits the light and provides a first portion of the light signal to the reference arm 16 and a second portion of the signal to the sample arm 18 . the light impinges upon device 17 and sample 19 in the reference and sample paths 16 , 18 respectively and is reflected back toward ports 14 b , 14 c of splitter / combiner 14 . ideally , the splitting ratio of the splitter / combiner 14 is selected such that an equal amount of reflected power is received at each of the splitter ports 14 b , 14 c . the reference line can also include an optical attenuator ( not shown in fig1 ) having an attenuation setting selected to adjust the strength of a reference beam reflected from a reflective device to increase ( and in some cases maximize ) the contrast of an interference pattern generated from the reflected reference beam and the reflected beam from the sample arm . signals reflected from the reference and sample arms 16 , 18 are coupled to a detector arm 20 via splitter / combiner circuit 14 . the detector arm 20 receives signals fed thereto and detects depth . as mentioned above , it is possible for detector arm 20 to analyze a pattern provided thereto without scanning the reference arm . detector 21 b can thus determine depth information at a single point in an image , along a line in an image or in an entire two - dimensional image ( i . e . to provide a three - dimensional image ). in one embodiment , the detector receives time - domain measurements and provides depth information by using a fourier transform ( e . g . an fft ). in another embodiment , detector arm 20 includes a dispersive device 21 a and a detector 21 b . in this case , the dispersive element disperses the wavelengths of an optical signal provided thereto and the dispersed spectrum is detected by the detector 21 b . the dispersive device 21 a may be provided from a number of devices including but not limited to a grating or a dispersive prism . similarly , the detector 21 b may be provided from a number of devices including but not limited to a charge coupled device ( cdd ) camera . referring now to fig2 , a system 30 for performing three - dimensional spectrally encoded imaging includes a source 32 having a relatively broad bandwidth coupled to a single mode fiberoptic interferometer 34 at first port 34 a . a reference path 36 is coupled to a second port 34 b of the interferometer 34 , a sample path 42 is coupled to a third port 34 c of the interferometer 34 and a detection path 52 is coupled to a fourth port 34 d of the interferometer 34 . in one embodiment , the source 32 is provided as abroad - bandwidth titanium - sapphire source having a center wavelength of 860 nanometers ( nm ) and an fwhm bandwidth of 200 nm while the interferometer 34 is provided as a 50 / 50 michelson interferometer and the sample arm 42 includes a diffraction grating ( 600 lines / mm ) to disperse the spectrum in the horizontal image plane ( x - axis ). a lens 48 ( f = 75 mm , beam diameter = 1 mm ) focuses the individual spectrally - encoded points onto a specimen 50 . the beam was scanned in the vertical dimension ( y - axis ) by a galvanometric scanner ( 60 hz ) 44 to create a two - dimensional image . these parameters resulted in a spatial transverse resolution of approximately 40 μm . the image was comprised of approximately 585 × 585 resolvable points ; each transverse spot contained a bandwidth of 0 . 34 nm . the overall power on the sample was 10 mw . in order to obtain surface profiles , the path length of the reference arm 36 was controlled by moving a mirror 40 mounted on a translation stage . the power of the reference beam was attenuated using a neutral density ( nd ) filter 308 to maximize the contrast of the interference pattern . referring now to fig2 and 2a , by placing the mirror in a first location 41 a , the reference arm is provided having a first path length . this path length results in a first coherence length ( cl ) 41 a . reflections from the surface of the sample 50 at this coherence length represent a first depth . when the mirror is moved to a second location 41 b , the reference arm is provided having a second path length in this example , the second reference arm path length is longer than the first reference arm path length . this path length results in a second coherence length ( cl ) 41 b . reflections from the surface of the sample 50 at this second coherence length represent a second depth . similarly , when the mirror is moved to a third location 41 c , the reference arm is provided having a third path length in this example , the third reference arm path length is longer than the first and second reference arm path lengths . the third path length results in a third coherence length ( cl ) 41 c . reflections from the surface of the sample 50 at this second coherence length represent a third depth . in this manner , the depth information of the surface sample is provided . although this example utilizes only three coherence lengths , it should be appreciated that the any desired number of coherence lengths can be used . the particular number of coherence lengths to use will depend upon the particular application . its should also be appreciated that while the coherence lengths are changed by moving a mirror to adjust a phase length of the reference path , any technique which effectively changes the coherence length such that phase can be used to determine surface depth of a sample can also be used . referring again to fig2 , at the detection path 52 , the signals from the sample and reference arms are combined and detection is performed . in one embodiment , the fields from the sample and reference arms 36 , 42 were combined and spatially dispersed by a diffraction grating 56 ( 600 lines / mm ) and a lens 58 ( f = 60 mm ) onto a charge - coupled device ( ccd ) array 60 . it should be appreciated that the focusing function provided by lens 58 could also be provided at the output of the combiner ( i . e . output 34 d ) or at the input to the detector arm . for example , if a fiber optic cable were used to couple interferometer 34 to detector 52 , then the focusing function could be accomplished at the detector end the of fiber optic cable . vertical scanning was performed by another galvanometric scanner 54 which was synchronized with the sample arm y - axis scanner . the resulting interference pattern was viewed on a display 62 ( e . g . a monitor ) in real time , digitized , and stored . at each horizontal line on the ccd , the intensity is given by : i ( ω )=\| e ( ω )+ e 0 ( ω )\| 2 = 2 \| a 0 ( ω )\| 2 ·{ 1 − cos [ φ ( ω )− φ 0 ( ω )]}, ( 1 ) where e ( ω )= a ( ω ) exp ( iφ 0 ( ω )) and e 0 ( ω )= a 0 ( ω ) exp ( iφ ( ω ) are the spectra reflected from the sample and the reference arms , respectively . for simplicity , it is assumed that the spectral amplitudes from the sample and reference arms are real and equal , a ( ω )= a 0 ( ω ). algorithms for extracting phase difference from a spectral interference signal between two waves with continuous and smooth phases are well known . spectral phase measurements were performed mainly for dispersion measurements using broadband sources and white light . using a fourier - limited reference field ( φ 0 ( ω )= 0 ) with a given delay τ between the reference and the signal fields , the interference term in eq . ( 1 ) is simply cos [ φ ( ω )− ωτ ]. with a straight forward algorithm , the spectral phase can be unambiguously extracted from the interference pattern i ( ω ). in one configuration , the depth or surface height h at each point is given by h = c · φ ( ω )/( 2ω ), where c is the speed of light . to demonstrate the ability of this scheme to probe optically smooth surfaces , a plano - convex lens ( melles - griot , f = 1 m , bk7 glass ) was placed in the sample arm ( e . g . lens 48 was provided as a plano - convex lens ), with its convex surface facing toward the grating . in order to match the optical path length over the entire field of view , an additional two lenses , in a confocal configuration , were placed at the sample arm between the scanner and the diffraction grating . a delay of 2 . 18 ps ( 654 μm ) was introduced between the sample and the reference arms . the interference pattern for this setup is shown in fig2 b . the surface profile was obtained using the algorithm described in “ linear techniques of phase measurement by femtosecond spectral interferometry for applications in spectroscopy ,” j . opt . soc . am . b 12 , 2467 ( 1995 ) l . lepetit , g . chériaux , and m . joffre . fig2 a is a two - dimensional spectrally - encoded interferogram provided from the curved surface of a lens ( f = 1 m ). referring now to fig2 c , a measured surface profile along a horizontal line is plotted as a solid line 66 in fig2 c . for comparison , the spherical curve of the lens &# 39 ; s radius , calculated according to r = f ·( n − 1 ), ( n = 1 . 5187 ), is plotted as a dashed line 68 ( fig2 c ). fig2 c thus illustrates that the profile of the lens ( solid line 66 ) measured using the described system agrees with a calculated profile ( dashed line 68 ). the differences between the measured and the calculated profiles can be attributed to the loss of fringe contrast on the right side of the frame and due to low fringe density on the left side . when the sample contains steep local slopes , the fringe pattern became too dense to be resolved by the imaging system . this limitation prevented the system from measuring optically smooth surfaces with slopes greater than λ / d , where λ is the wavelength and d is the transverse spot size . in most industrial and medical applications , the specimen surface is not optically smooth , but contains many surface irregularities . when the surface is rough and the diffraction - limited point - spread function of the imaging system is broad in comparison to the microscopic surface variations , the interference between the sample and the reference is manifested by a granular speckle pattern . this pattern has a characteristic speckle size that matches the system &# 39 ; s point - spread function . the depth of the speckle pattern along the z axis is defined by the coherence length , where n is the number of resolvable points along the x - axis ( wavelength ) and δω is the total source bandwidth . unlike white - light interferometry , where the coherence length is given by cl = c / δω and can be as short as a few microns , here the coherence length is n times larger , since it is determined only by the spectral width of each spectrally encoded spot . throughout this work , the coherence length ( 310 μm ) was smaller than the confocal parameter ( 2 . 7 mm ) and therefore determined the axial resolution . the large depth of focus allowed imaging over a range equivalent to the confocal parameter by scanning only the optical path length of the reference arm . to demonstrate the ability of a 3 - d spectrally - encoded imaging apparatus to measure the profile of rough surfaces , the face of a small plastic doll was imaged . the doll &# 39 ; s face is shown in fig3 a . the image of the doll &# 39 ; s face in fig3 a was obtained using white light illumination and a standard ccd camera . it should be noted that the scale bar in fig3 a represents 4 mm while the scale bars in fig3 b - 3d represent 1 mm . in fig3 b , the standard spectrally encoded - two - dimensional image is shown . the surface height , measured by 3d spectrally encoded imaging , is represented as a gray scale image , where z values closer to the probe have a higher pixel intensity . this image is obtained by blocking a reference arm in the system of fig2 . when the light returned from the reference arm was allowed to interfere with that of the sample arm , a speckle pattern was observed in portions of the image . a full three - dimensional data set was acquired by capturing 45 frames as the reference arm path length was scanned in steps of 100 μm . the natural logarithm of the absolute value of the difference between consecutive frames was calculated , followed by moderate volumetric smoothing ( kernel = 3 × 3 × 3 pixels ). the surface height was obtained by determining the location of the maximum speckle intensity difference along the axial ( z ) axis ( displayed as a gray scale image in fig3 c ). fig3 d corresponds to a surface rendering of the dolls face using the data shown in fig3 c . referring now to fig4 a and 4b , for estimating the experimental depth resolution a sagital ( y - z ) section was plotted ( fig4 a ) from the data . the sagital section was placed next to the actual doll &# 39 ; s profile ( fig4 b ). the measurement revealed an axial resolution of approximately 330 μm ( fwhm of the coherence envelope ), which is in reasonable agreement with the predicted axial resolution of 310 μm . the scale bar ( visible in fig4 b ) is 1 mm . three dimensional ( 3 - d ) spectrally - encoded imaging can be used in many configurations to suit specific applications . for example , this method is capable of measuring a surface within a volume of 50 × 50 × 30 millimeters ( x , y , z respectively ) with , typically , 200 × 200 × 280 resolution points ( 250 μm transverse spot - size and 107 μm axial resolution ). using a ccd camera ( 10 , 000 frames per second ) and a rapidly scanning optical delay line in the reference arm the three - dimensional data set could be captured and displayed in real time ( 30 frames per second ). referring now to fig5 , a technique for producing a three - dimensional image begins by illuminating a line on a sample and then scanning a reference line as shown in processing blocks 70 , 72 . next , the depth information is determined as shown in block 74 . in one embodiment , this is achieved by measuring the number of fringes within a spot on the sample ( e . g . analyzing the number of fringes using a fast fourier transform ( fft ) or other technique ) and translating this information to depth information . as shown in decision block 76 , if there are no more lines on the sample to detect , then processing ends . otherwise a next line on the sample is selected and illuminated as shown in blocks 78 , 80 and blocks 72 - 78 are repeated until the imaging process is complete . in summary the techniques and apparatus described above can be used to provide three - dimensional macroscopic images using a phase - sensitive spectrally encoded imaging technique . using the techniques of the present invention , volume data can be acquired through a single optical fiber without any additional modifications to the spectrally - encoded imaging device . these features make three - dimensional imaging within the confines of a miniature , flexible probe possible . although only a few exemplary embodiments of this invention have been described in detail above , those skilled in the art will readily appreciate that many modifications are possible in the exemplary embodiments without materially departing from the novel teachings and advantages of this invention . accordingly , all such modifications are intended to be included within the scope of this invention as defined in the following claims . it should further be noted that any patents , patent applications and publications referred to herein are incorporated by reference in their entirety .	6
it is to be appreciated that the dimensions , materials , finishes , etc ., called out within the drawings are for specific species of the device , and are provided by way of example only . embodiments of the invention are not limited to the dimensions , materials , finishes or other detail set forth within the drawings . referring now to the figures , fig1 shows an isometric view of embodiment of the disclosed anchor device 10 in an uninstalled condition . it is to be appreciated that the disclosed anchor device 10 may be manufactured from carbon steel and various alloys in a cold - headed extrusion process , with no machining required . anchor device 10 comprises a double sectioned head member 12 and a sleeve section 14 . double - sectioned head member 12 distinguishes the present invention from other anchor devices in that double - sectioned head member 12 comprises a lower head member 16 which depends from upper head member 18 . this configuration allows upper head member 18 to extend sufficiently above work piece w to allow a wall of a structure , such as a roof rack , to be contained between the bottom of upper head member 18 and the top surface of work piece w . fig6 shows how upper head member 18 extends away from work piece w after the anchor device 10 ′ has been installed . head member 12 comprises a circular opening 20 which has a center axis l which coincides with the center axis of the anchor device 10 . circular opening 20 extends through much of the entire length of the anchor device 10 , and may either terminate at a closed end 22 , or continue throughout the entire length of the device such that the device is open - ended . head member 12 transitions into sleeve section 14 at shoulder 24 . sleeve section 14 comprises a mostly hollow body having a first section 26 and an axially adjacent second section 28 . first section 26 comprises a proximal end 30 , which transitions into head member 12 . first section 26 further comprises a distal end 32 wherein the first section 26 transitions into second section 28 , which is indicated by an increasing wall thickness of the sleeve section 14 . first section 26 comprises a collapsible counter - bore area 60 between proximal end 30 and distal end 32 . sleeve section 14 will typically have a non - circular exterior shape to prevent the anchor device from rotating within the opening 34 of work piece w . for example , sleeve section 14 may have a hexagonal profile to correspond with the hexagonal opening 34 in work piece w indicated in fig5 . however , it is to be appreciated that other non - round exterior shapes will also work to prevent the sleeve section from rotating within the opening 34 . second section 28 comprises a hollow cylinder which may have a closed end 22 . as shown best in fig3 , the thickness of wall 36 in the second section 28 is greater than the thickness of wall 38 of first section 26 , thereby allowing the first section to preferentially collapse as shown in fig6 when the anchor device 10 is installed by application of a linear force . second section 28 may comprise threads 62 . in the utilization of the present device for attaching a roof rack to the top of a vehicle , an acceptable thread is an m6 thread . an installed anchor device 10 ′ is shown in fig6 . the anchor device is typically installed in a opening 34 in a work piece w , where the work piece has a visible side 40 and a blind side 42 . as depicted in fig6 , when the anchor device 10 ′ has been installed in work piece w , the installed anchor device is retained within the opening 34 of the work piece by the shoulder 24 of double - sectioned head member 12 on the visible side 40 , and bubble 44 which is formed on the blind side 42 by the collapse of first section 26 . bubble 44 prevents the withdrawal of anchor device 10 ′ from the work piece w . anchor device 10 may further comprise a seal member 46 which is attached to or adjacent to shoulder 24 of head member 12 . as depicted in fig6 , when anchor device 10 ′ is installed in work piece w , seal member 46 ′ plastically deforms between shoulder 24 and the surface of work piece w , creating a seal which restricts liquid flow into opening 34 to assist in avoiding corrosion in the work piece . seal member 46 may comprise various elastomeric materials which have appropriate mechanical properties for plastically deforming and flowing upon being subjected to the compression applied between the shoulder 24 and the work piece w when the anchor device is installed by application of linear force . the anchor device 10 is fabricated from metal and metal alloy materials which have mechanical properties suitable for plastic deformation , such that the first section will collapse yet the second section retains its integrity . appropriate materials are various carbon steels and alloys . fig7 schematically shows a portion of a structure 50 which may be attached to work piece w with embodiments of the presently disclosed anchor device . the structure 50 has a top side , shown in fig7 , and a bottom side , which facially engages work piece w upon installation , and a slot 52 . slot 52 comprises a first aperture 54 having a width larger than the diameter of upper head member 18 . slot 52 has a second aperture 56 , which is connected to first aperture 54 by transition section 58 . the first aperture 54 , the second aperture 56 and the transition section 58 all extend from the top side through to the bottom side of structure 50 . second aperture 56 is large enough to receive lower head member 16 , but smaller than the diameter of upper head member 18 , thus preventing the withdrawal of upper head member 18 from structure 50 . once upper head member 18 has been inserted through first aperture 54 , the structure 50 being attached to the work piece w is thereafter slid along the surface of the work piece such that the integral head engages the portion of slot having the second ( i . e ., narrower ) width . the top surface of structure 50 may comprise a ramp which , as the position of upper head member 18 changes from adjacent to first aperture 54 to second aperture 56 , applies stress to the installed anchor device 10 ′, thus further securing structure 50 to work piece w . a structure 50 , such as a roof rack , may be attached to a work piece , such as the roof of a vehicle , by the following procedure . the anchor device 10 is placed within an opening 34 in the workpiece w . axial force is applied by an installation tool to the anchor device 10 thereby deforming the first section 28 . the anchor device 10 may be installed with an installation tool which comprises a threaded stud , where the threaded stud is either rotated , thereby tightening into threads 62 located in the second section 28 of the anchor device , and thus imposing a linear force to the anchor device , causing the first section 28 to collapse as the rotation of the stud pulls the second section 28 toward the blind side 42 of the work piece . alternatively , the linear force may be applied by reciprocation of the installation tool , such that the threaded stud is pulled toward the tool . as yet another alternative , the installation tool may be attached to a breakstem which is attached to the anchor device 10 , where the installation tool applies a longitudinal load to a breakstem attached within the anchor device , thereby causing the anchor device to deform until the breakstem shears upon application of sufficient applied axial force . in this embodiment , the anchor device 10 need not comprise threads for attaching a threaded stud . following installation of the anchor device 10 ′ in a work piece w as described above , upper head member 18 extends a sufficient distance from the work piece w so the upper head may engage slot 52 of the structure 50 . as can be appreciated , the thickness of structure 50 should be sized such that there is sufficient space for upper head member 18 to be received through first aperture 54 such that the bottom of upper head member 18 clears the top of structure 50 , and allowing the structure and / or the work piece to be moved with respect to the other such that upper head member 18 is adjacent to second aperture 56 , and most of lower head member 16 is disposed within section aperture 56 , with shoulder 24 engaging the work piece w . structure 50 may comprise , among other things , a rail member of a roof rack for automobile or other vehicle . as can be appreciated , a rail member may have a plurality of slots , each slot corresponding to a upwardly protruding upper head member 18 of a species of the device . the rail member may be slid such that the smaller opening , second aperture 56 , is locked from upward movement and sideways movement by the upper head member 18 . if anchor device 10 comprises threads , threaded fasteners may be made up into the threads for securing additional structures as desired . as an alternative method of installation , an embodiment of the anchor device 10 may be simultaneously placed within an aperture 56 ′ of structure 50 and the opening 34 in the work piece w , such that head member 12 of the anchor device , which has a larger diameter than the aperture 56 ′, abuts the top surface of the structure , with the sleeve section 14 of the anchor device extending through the aperture of the structure , with sufficient length left for insertion into the opening 34 of the work piece , and disposition of the first section 26 and the second section 28 on the blind side 42 of the work piece w . once sleeve section 14 is within the opening 34 of the work piece , the anchor device 10 may be installed by activation of an installation tool , as described above . thus , once a portion of the anchor device is deformed on the blind side of the work piece , the anchor device attaches the structure to the work piece at the same time the anchor device is installed within the work piece . while the above is a description of various embodiments of the present invention , further modifications may be employed without departing from the spirit and scope of the present invention . for example , the size , shape , and / or material of the various components may be changed as desired . thus the scope of the invention should not be limited by the specific structures disclosed . instead the true scope of the invention should be determined by the following claims .	5
the invention provides process for forming a printed circuit board having integral inductor cores . an electrically conductive structure is provided which comprises a copper foil having a layer of nickel deposited thereon . according to the invention , the term “ copper foil ” preferably comprises copper or copper alloys , but may also include copper foils containing zinc , brass , chrome , nickel , aluminum , stainless steel , iron , gold , silver , titanium and combinations and alloys thereof . the thickness of the copper foil may vary according to each particular application . in a preferred embodiment , the copper foil has a thickness of from about 5 μm to about 50 μm . copper foils are typically manufactured by well known electrodeposition processes . one preferred process includes electrodepositing copper from a solution of a copper salt onto a rotating metal drum . the side of the foil next to the drum is typically the smooth or shiny side , while the other side has a relatively rough surface , also known as the matte side . this drum is usually made of stainless steel or titanium which acts as a cathode and receives the copper as it is deposited from solution . an anode is generally constructed from a lead alloy . a cell voltage of about 5 to 10 volts is typically applied between the anode and the cathode to cause the copper to be deposited , while oxygen is evolved at the anode . this copper foil is then removed from the drum . the foil &# 39 ; s shiny side , matte side , or both , may optionally be pre - treated with a bond enhancing treatment known in the art , which may serve as an adhesion promoter for the copper foil . the layer of nickel is applied onto one side of the copper foil to thereby form an electrically conductive structure . the nickel layer preferably includes nickel or a nickel alloy , but may also comprise other metals such as zinc , brass , chrome , nickel , aluminum , stainless steel , iron , gold , silver , titanium , and combinations and alloys thereof . the nickel layer may be applied to the copper foil by any conventional method such as by electrodeposition , sputtering or electroless plating . in a preferred embodiment , the nickel layer is deposited by electrodeposition . the thickness of the nickel layer may vary according to each particular application . in a preferred embodiment , the nickel layer has a thickness of from about 0 . 1 μm to about 5 μm . once formed , the electrically conductive structure is preferably laminated onto a first surface of an electrically non - conductive substrate having first and second opposite surfaces . the substrate preferably comprises an electrically non - conductive material . suitable materials for the substrate nonexclusively include epoxies , polyimides , teflon , and polyesters . preferably , the substrate comprises an epoxy . laminating is preferably done using conventional lamination techniques known to those skilled in the art . the electrically conductive structure is preferably laminated onto the first surface of the substrate such that the nickel layer is in contact with the first surface of the substrate . after lamination , the copper foil of the electrically conductive structure is preferably removed , thereby leaving the nickel layer on the first surface of the substrate . the copper foil may be removed using any conventional method which remove the copper foil but not the nickel layer . one preferred method of removing the copper foil is by etching . in a most preferred embodiment , the copper foil is etched away using an ammoniacal etchant . once the copper foil has been removed , any oxide formed on the nickel layer is removed . this may be done using any suitable conditioning step . preferably , this is done by the cathodization process described in u . s . pat . no . 6 , 117 , 300 which is incorporated herein by reference . next , integral inductor cores are formed on the first surface of the substrate . this may be done in any order and by any method known to those skilled in the art . according to a preferred embodiment of the present invention , integral inductor cores are formed on the first surface of the substrate by performing either step ( i ) or step ( ii ) as described below . step ( i ) includes applying a photoresist onto the nickel layer ; imagewise exposing the photoresist to actinic radiation ; developing the resist to thereby remove non - imaged areas while retaining imaged areas ; depositing a layer of nife onto the nickel layer portions underlying the removed non - imaged areas of the photoresist ; removing the balance of the photoresist ; and optionally removing at least a portion of the nickel layer ; thereby forming integral inductor cores on the first surface of the substrate . step ( ii ) includes depositing a layer of nife onto the nickel layer ; applying a photoresist onto the nife layer ; imagewise exposing the photoresist to actinic radiation ; developing the resist to thereby remove non - imaged areas while retaining imaged areas ; removing the nife layer portions underlying the removed non - imaged areas of the photoresist from the nickel layer ; removing the balance of the photoresist ; and optionally removing at least a portion of the nickel layer , thereby forming integral inductor cores on the first surface of the substrate . in either of these steps , the photoresist may be positive working or negative working and is generally commercially available . positive working photoresists are more preferred in the practice of the present invention . suitable positive working photoresist materials are well known in the art and may comprise an o - quinone diazide radiation sensitizer . the o - quinone diazide sensitizers include the o - quinone - 4 - or - 5 - sulfonyl - diazides disclosed in u . s . pat . nos . 2 , 797 , 213 ; 3 , 106 , 465 ; 3 , 148 , 983 ; 3 , 130 , 047 ; 3 , 201 , 329 ; 3 , 785 , 825 ; and 3 , 802 , 885 . suitable positive working photoresists may be obtained commercially , for example , under the trade name of az - p4620 from clariant corporation of somerville , n . j . the photoresist may be applied by conventional means such as depositing by spin coating . the thickness of the photoresist may vary depending on the deposition procedure and parameter setup . the photoresist is preferably imagewise exposed by conventional methods to thereby form both imaged and non - imaged areas . it is preferred that the photoresist is imagewise exposed using actinic radiation such as light in the visible , ultraviolet or infrared regions of the spectrum through a mask , or scanned by an electron beam , ion or neutron beam or x - ray radiation . actinic radiation may be in the form of incoherent light or coherent light , for example , light from a laser . the photoresist is then preferably imagewise developed by conventional methods to thereby remove the non - imaged areas while retaining the imaged areas . it is preferred that the photoresist is imagewise developed using a suitable solvent such as an aqueous alkaline solution . one preferred solvent developer comprises sodium carbonate . the balance of the photoresist may be subsequently removed by conventional methods known in the art such as stripping . in both steps , a layer of nife is deposited onto the nickel layer . the nife layer preferably includes a nickel and iron alloy , but may also comprise other metals such as chrome , cobalt and combinations and alloys thereof . the nife layer may be deposited by any conventional methods such as electrodeposition , sputtering or electroless plating . in a preferred embodiment , the nife layer is deposited by electrodeposition . the thickness of the nife layer may vary according to each particular application . in a preferred embodiment , the nife layer has a thickness of from about 0 . 1 μm to about 25 μm . portions of the nife layer may subsequently be removed using any conventional method which removes the nife but not the nickel layer . one preferred method of removing the nife layer is by etching . in a most preferred embodiment , the nife is etched away using an ammonium hydroxide complex with copper . optionally but preferably , at least a portion of the nickel layer may subsequently be removed . the nickel layer may be removed using any conventional method such as etching . in a preferred embodiment , the nickel layer is removed by acid etching . suitable acid etching materials nonexclusively include ferric chloride , cupric chloride , and combinations thereof . the completion of either step ( i ) or step ( ii ) results in the formation of integral inductor cores on the first surface of the substrate . optionally but preferably , once the integral inductor cores are formed on the first surface of the substrate , one or more inductors may be formed onto an opposite second surface of the substrate . the inductors may be formed by the method described previously . in a preferred embodiment , each inductor formed on the second surface of the substrate is preferably in substantial alignment with an inductor core on the first surface of the substrate . optionally but preferably , a first electrically non - conductive support having first and second opposite surfaces may be attached onto the integral inductor cores on the first surface of the substrate . in a preferred embodiment , the first surface of the first electrically non - conductive support is attached to the first surface of the substrate . suitable materials for the first electrically non - conductive support nonexclusively include fiberglass , epoxies , polyimides , polyesters , thermoplastics , and combinations thereof . optionally , another electrically conductive structure according to the invention may be laminated onto the second surface of the first electrically non - conductive support . additional integral inductor cores may optionally be formed according to the invention on the second surface of the first electrically non - conductive support . optionally but preferably , a second electrically non - conductive support having first and second opposite surfaces may be attached onto the one or more inductors on the second surface of the substrate . in a preferred embodiment , the first surface of the second electrically non - conductive support is attached to the second surface of the substrate . suitable materials and thicknesses for the second electrically non - conductive support nonexclusively include those materials and thicknesses described above for the first electrically non - conductive support . optionally , another electrically conductive structure according to the invention may be laminated onto the second surface of the second electrically non - conductive support . additional integral inductor cores may optionally be formed according to the invention on the second surface of the second electrically non - conductive support . optionally but preferably , circuit elements may be formed on the first surface of the substrate at locations surrounding the integral inductor cores formed on the first surface of the substrate . examples of circuit elements nonexclusively include electrically conductive lines and the like . such circuit elements may be formed by well known lithographic techniques . suitable materials for the circuit elements nonexclusively include aluminum , aluminum alloys , copper , copper alloys , titanium , tantalum , tungsten , and combinations thereof . these circuit elements typically form the conductors of an integrated circuit . such circuit elements are typically closely separated from one another at distances preferably of from about 20 micrometers or less , more preferably from about 1 micrometer or less , and most preferably of from about 0 . 05 to about 1 micrometer . in a most preferred embodiment , integral inductor cores are formed onto a first surface of a substrate according to the invention . circuit elements are formed on the first surface of the substrate at locations surrounding the integral inductor cores . one or more inductors are formed onto the second surface of the substrate , each inductor being in substantial alignment with a core on the first surface of the substrate . a first surface of a first electrically non - conductive support is attached onto the integral inductor cores on the first surface of the substrate . another electrically conductive structure according to the invention is formed and laminated onto a second surface of the first electrically nonconductive support . additional integral inductor cores surrounded by additional circuit elements are then formed according to the invention on the second surface of the first electrically nonconductive support . a first surface of a second electrically non - conductive support is attached onto the one or more inductors on the second surface of the substrate . another electrically conductive structure according to the invention is formed and laminated onto a second surface of the second electrically nonconductive support . additional integral inductor cores surrounded by additional circuit elements are then formed according to the invention on the second surface of the second electrically nonconductive support . any number of additional electrically non - conductive supports having additional integral inductor cores or inductors formed thereon may be produced according to the invention . the process of the present invention results in the formation of printed circuit boards having integral inductor cores . the following non - limiting examples serve to illustrate the invention . it will be appreciated that variations in proportions and alternatives in elements of the components of the invention will be apparent to those skilled in the art and are within the scope of the present invention . an electrically conductive structure , consisting of a copper foil having a nickel layer deposited thereon , is applied to a first surface of an epoxy substrate such that the nickel layer is in contact with the first surface of the substrate . this is then laminated under heat and pressure sufficient to flow and cure the epoxy , forming a laminate . the copper foil is etched away with an ammoniacal etchant , leaving the nickel layer on the first surface of the substrate . any oxide formed on the nickel layer is then removed using the cathodization process described in u . s . pat . no . 6 , 117 , 300 . integral inductor cores are then formed on the first surface of the substrate . this is done by first applying a layer of az - p4620 , a positive working photoresist material available commercially from clariant corporation of somerville , n . j ., onto the nickel layer to protect the nickel layer in areas where cores are not to be formed . the photoresist is imagewise exposed to actinic radiation using a laser , and developed with sodium carbonate to thereby remove non - imaged areas while retaining imaged areas . the non - imaged areas will be the sites of inductor core formation . a layer of nife plating solution is then electrodeposited onto the nickel layer portions underlying the removed non - imaged areas of the photoresist . the nife plating solution comprises : nicl 2 * 6h 2 o 109 grams per liter fecl 2 * 4h 2 o 1 . 85 grams per liter h 3 bo 3 12 . 5 grams per liter na sacccharin 0 . 4 grams per liter na lauryl sulfate 0 . 4 grams per liter h 2 o to make up one liter plating current density 18 . 5 asf ph = 2 . 5 the balance of the photoresist is removed by stripping . a portion of the nickel layer is then removed by etching with cupric chloride . the result is the formation of integral inductor cores on the first surface of the epoxy substrate . an electrically conductive structure , consisting of a copper foil having a nickel layer deposited thereon , is applied to a first surface of an epoxy substrate such that the nickel layer is in contact with the first surface of the substrate . this is then laminated under heat and pressure sufficient to flow and cure the epoxy , forming a laminate . the copper foil is etched away with an ammoniacal etchant , leaving the nickel layer on the first surface of the substrate . any oxide formed on the nickel layer is then removed using the cathodization process described in u . s . pat . no . 6 , 117 , 300 . integral inductor cores are then formed on the first surface of the substrate . this is done by first depositing a layer of nife plating solution onto the nickel layer . the nife plating solution comprises : nicl 2 * 6h 2 o 109 grams per liter fecl 2 * 4h 2 o 1 . 85 grams per liter h 3 bo 3 12 . 5 grams per liter na sacccharin 0 . 4 grams per liter na lauryl sulfate 0 . 4 grams per liter h 2 o to make up one liter plating current density 18 . 5 asf ph = 2 . 5 next , a layer of az - p4620 , a positive working photoresist material available commercially from clariant corporation of somerville , n . j ., is deposited onto the nife layer . the photoresist is imagewise exposed to actinic radiation using a laser , and developed with sodium carbonate to thereby remove non - imaged areas while retaining imaged areas . portions are then removed of the nife layer underlying the removed non - imaged areas of the photoresist . this is done by etching away the desired areas of nife using an ammonium hydroxide complex with copper . the balance of the photoresist is removed by stripping . a portion of the nickel layer is then removed by etching with cupric chloride . the result is the formation of integral inductor cores on the first surface of the epoxy substrate . integral inductor cores are formed on the first surface of an epoxy substrate as described in example 1 . integral inductor cores are then subsequently formed in the same manner on the second surface of the epoxy substrate such that each inductor core on the second surface is in substantial alignment with an inductor core on the first surface . integral inductor cores are formed on the first surface of an epoxy substrate as described in example 2 . integral inductor cores are then subsequently formed in the same manner on the second surface of the epoxy substrate such that each inductor core on the second surface is in substantial alignment with an inductor core on the first surface . integral inductor cores are formed on the first surface of an epoxy substrate as described in example 1 . a first fiberglass support , having first and second opposite surfaces , is attached onto the integral inductor cores on the first surface of the substrate such that the first surface of the first fiberglass support is attached to the first surface of the substrate . another electrically conductive structure , consisting of a copper foil having a nickel layer deposited thereon , is laminated onto the second surface of the first fiberglass support . additional integral inductor cores are formed according to example 1 on the second surface of the first fiberglass support . integral inductor cores are formed on the first surface of an epoxy substrate as described in example 2 . a first fiberglass support , having first and second opposite surfaces , is attached onto the integral inductor cores on the first surface of the substrate such that the first surface of the first fiberglass support is attached to the first surface of the substrate . another electrically conductive structure , consisting of a copper foil having a nickel layer deposited thereon , is laminated onto the second surface of the first fiberglass support . additional integral inductor cores are formed according to example 2 on the second surface of the first fiberglass support . integral inductor cores are formed on the first surface of an epoxy substrate as described in example 1 . a first fiberglass support , having first and second opposite surfaces , is attached onto the integral inductor cores on the first surface of the substrate such that the first surface of the first fiberglass support is attached to the first surface of the substrate . a second fiberglass support , having first and second opposite surfaces , is attached onto the integral inductor cores on the second surface of the substrate such that the first surface of the second fiberglass support is attached to the second surface of the substrate . another electrically conductive structure , consisting of a copper foil having a nickel layer deposited thereon , is laminated onto each of the second surface of the first fiberglass support and the second surface of the second fiberglass support . additional integral inductor cores are formed according to example 1 on the second surface of the first fiberglass support and on the second surface of the second fiberglass support . integral inductor cores are formed on the first surface of an epoxy substrate as described in example 2 . a first fiberglass support , having first and second opposite surfaces , is attached onto the integral inductor cores on the first surface of the substrate such that the first surface of the first fiberglass support is attached to the first surface of the substrate . a second fiberglass support , having first and second opposite surfaces , is attached onto the integral inductor cores on the second surface of the substrate such that the first surface of the second fiberglass support is attached to the second surface of the substrate . another electrically conductive structure , consisting of a copper foil having a nickel layer deposited thereon , is laminated onto each of the second surface of the first fiberglass support and the second surface of the second fiberglass support . additional integral inductor cores are formed according to example 2 on the second surface of the first fiberglass support and on the second surface of the second fiberglass support . while the present invention has been particularly shown and described with reference to preferred embodiments , it will be readily appreciated by those of ordinary skill in the art that various changes and modifications may be made without departing from the spirit and scope of the invention . it is intended that the claims be interpreted to cover the disclosed embodiment , those alternatives which have been discussed above and all equivalents thereto .	7
the present invention addresses the problems with the varian 350 d implanter and any similar processing system that displays similar problems by checking for misalignment of wafers and including an interlock circuit that stops the platen from closing when a misalignment is detected . referring again to fig1 , which shows the prior art platen faceplate 1502 . chuck vacuum channels 1508 are shown extending from the chuck orifice 1512 . the channels 1508 serve to secure a wafer to the faceplate of the platen once the chuck has been retracted to bring the wafer flush with the faceplate 1502 . also , the channels 1508 serve , to some extent , to detect when a wafer is misaligned by monitoring a chuck vacuum drop ( since the chuck orifice 1512 is in flow communication with the channels 1508 ). however , it will be appreciated that since the channels 1508 extend outwardly only up to a 100 mm diameter , a chuck vacuum drop will not be detected unless there is a misalignment of more than 50 mm . this amount of misalignment would cause wafer breakage when the platen closes on the vacuum chamber . furthermore , the varian endstation does not even check the chuck vacuum after the chuck retracts , thus rendering the vacuum channels 1508 useless for purposes of monitoring misalignment of wafers . the present invention proposes retrofitting the platen to provide for chuck vacuum channels that extend to a diameter that is not much smaller than the diameter of the wafer to be held by the platen faceplate . for instance , for a 150 mm diameter wafer , the chuck vacuum channels , in one embodiment , were made to extend from the chuck orifice outwardly to a diameter of 148 mm as shown in fig1 . in fig1 the chuck vacuum channels 1600 are shown extending outwardly from a chuck orifice 1602 to a diameter of 148 mm to define a 148 mm detection diameter as indicated by doted line 1620 . the platen faceplate 1606 in this case has an inner or smaller tier 1622 of diameter 152 mm . in the embodiment of fig1 , a 150 mm wafer that is misaligned by more than 2 mm will therefore allow air to leak into the vacuum channels 1600 , thereby reducing the vacuum in the channels 1600 and also the chuck vacuum since the channels 1600 are in flow communication with the chuck orifice 1600 . the rest of the platen 1610 remains essentially unchanged . it includes peripheral holes 1612 for securing the faceplate 1606 , and an o - ring 1614 ( which was depicted by reference numeral 142 in fig8 ). by monitoring the drop in vacuum , i . e , by monitoring the drop in air pressure in the chuck orifice 1602 or channels 1600 , a misalignment of as little as 2 mm can therefore be detected . this can be used by an interlock circuit such as the interlock circuit shown in fig1 . the circuit 1700 includes an opto - isolator that includes a transistor 1702 and a light emitting diode ( led ) 1704 . the diode 1704 is connected to two inputs 1706 , 1708 , that sink current from a sv source 1710 through a resistor 1712 . input 1706 sinks current when the platen orient is in the home position . this occurs when processing is complete , the wafer is removed , and the platen wishes to close . input 1708 sinks current when no wafer misalignment is detected due to a pressure drop in the chuck orifice of the platen . since inputs 1706 , 1708 are connected in parallel , current flows through the diode 1704 when either the platen orient is in the home position or when the wafer is correctly positioned on the platen . this turns on the transistor 1702 to close the drive signal circuit and allow the platen to close . when either of these conditions is not present , the transistor 1702 is turned off and the drive signal is not sent to the drive circuit . the inputs 1706 , 1708 further include light emitting diodes 1720 , 1722 , respectively , to indicated when current is flowing to the particular input . the input signals 1706 , 1708 can best be understood with reference to fig1 , which shows a representation of an orient switch assembly 1800 , which is also shown in fig8 . as shown in fig8 , the assembly 1800 is connected to the chuck 108 by means of a belt 1802 . the assembly controls the rotational orientation of the wafer on the chuck 108 , by having an actuator 1804 which engages either a home switch 1806 or a orient position switch 1808 , to provide the input signals 1706 , 1708 , respectively . this ensures that the wafer flat 1402 ( fig1 ) is in the home position for loading and unloading of the wafer onto or from the platen , and is rotated to its preset angle prior to the chuck being retracted . the preset angle is process dependent and serves to avoid channeling by the ions when the wafer is subjected to the ion beam in the chamber . while a specific embodiment has been described , it will be appreciated that the present invention is applicable to any wafer handlers that have similar chuck vacuum channel issues and an inability to properly monitor wafer alignment on the platen . the monitoring of the wafer position may even be performed using techniques other than monitoring air pressure in the vacuum channels . for instance , in another embodiment , light sensors were used to monitor the position of the wafer . similarly , imaging techniques could be used to identify the position of the wafer , and have this relayed to an interlock circuit . also , it will be appreciated that the circuit described in fig1 is only one example of an interlock circuit and that other circuits could be substituted to take a misalignment signal and use it to stop the platen from closing .	7
a mechanism for cutting a thread reserve of spindles in a continuous spinning machine has a cylinder - shaped element 1 which is either composed of steel 9 , or coated with a slightly abrasive material , or is composed of metal with a final superficial treatment , or of some non - metallic material depending on its construction . depending on the kind of thread 14 ( cotton , etc . ), the above mentioned element can adapt one or another shape and one or another superficial finish . it can freely rotate , or can be driven or fixed . this element is a part of the mechanism which is suitably adjusted without contacting the area 2 of the spindle 9 , where the thread 3 to be removed , called reserve , exists . the adjustment is regulated by a spring or an element for providing pressure 8 , a second element roller or guiding bearing 4 depending on the construction , the parts 5 for fastening them , and the support 16 attached to the frame 21 of the cleaning element which in turn is fixed on the dragging element 6 or 15 . a guiding part for such as a roller or a rotating bearing or a flat part , etc . is provided . in the event that the element 1 and the guiding element 4 are cylinder - shaped , both elements can have a common axis or not , according to the construction and the type of the continuous machine . the spindles 9 of the machine can be slightly out of alignment with each other . the guideways 10 and 10 ′ which support the clearing mechanism called also mouse , can be also out of alignment . therefore the cutting elements for the reserve developed up to now can not secure a correct and suitable adjustment between the element 1 and each of the spindles 9 , remaining too seperated from some of the spindles which thus are not cleaned , or too close to other spindles so as to come in contact with the risk of damaging the mechanism or the spindle . the guiding element comes to directly and tangentially contact a copying part of the outline of the lower area 11 of the spindle 9 at its front or rear end . this part is generally cylindrical and forms a continuation with a similar cylindrical part 2 where the thread 3 to be cleaned is fixed . the spindle 9 or the guiding element 4 comes to contact with an equivalent element 12 , by means of which it can copy and know the accurate position of the spindle and which can be fixed for example in the spindlehead or bed , which has movement or not . the roller 4 then accurately copies the position of each spindle 9 , locating itself at the position which always secures the correct adjustment between the element 1 and the area 2 of the spindle 9 where the thread to be cleaned or the reserve 3 is located . thus , for copying of each spindle , the roller 4 can contact the cylindrical lower part 11 of the spindle 9 itself , or an equivalent element 12 as shown in fig2 which allows to carry out the same “ position copying ” functions . applying the roller 4 in the lower part of the spindle or on the equivalent wrapping element 12 does not limit the object of the present invention . a spring or a similar pressing element 8 allows that the cleaning assembly and copier proper recovers the position . in addition , it allows the movement between the assembly support 16 and the frame 21 . the spring allows to accurately copy the position of each spindle 9 . finally , a cutting element or blade is provided for the thread 3 . fig5 schematically illustrates the way the spindles 9 or equivalent element 12 copies by means of the roller or guiding bearing 4 . the above disclosed mechanism allows to copy the spindle accurate position . in the event that the mechanism loses its vertical position shown in fig3 and 4 , with the sham axis 19 it would not recover it . the vertical position can be lost , depending on the guiding system for the cleaning mechanism which can be installed in each kind of continuous machine , so that a mechanism for recovering the vertical position has been provided . this mechanism is optional and can be used or not . the mechanism for recovering the vertical position is located close arranged to the cleaning mechanism . to the already known cleaning mechanism , a rotating movement with respect to the location point 11 and the spring or pressing element 18 are added as shown in fig3 and 4 . when the spring 18 applies pressure and the cleaning mechanism is not located in front of any spindle , the axis 20 which is common to the cleaning mechanism and the guiding rollers 4 remains inclined with respect to the sham axis 19 as shown in more detail in fig4 . then , when the roller or guiding bearing 4 contacts a spindle 9 or equivalent element 12 by the spring or pressing element 11 and the relation of movement between the different elements of the system , such as the actual axis 20 and the sham axis 19 coincides again , the mechanism remains fully parallel to the axis of the spindle as shown in fig3 . as explained herein above , the main feature of the present invention is that the mechanism for cutting and cleaning the reserve copies the accurate position of the spindle either by directly contacting the spindle or by contacting another part or element which has a concrete accurate position with respect to the spindle . the present invention is not limited to any of corresponding mechanisms , but instead deals with the idea of copying the position of the spindle by means of the mechanism or similar one . in connection with this , some modifications of the inventive mechanism within the spirit of the present invention are possible . a triangle - shaped mechanism can be utilized , with the sides which are slightly curved to take the exact shape of the spindle or the element used for being positioned with respect to the spindle , so as to carry the same function as the above mentioned element with the roller or guiding bearing 4 . together with the triangle - shaped element , a second element for protrusion of the triangle will carry out the same functions as the above mentioned element 1 . the triangle - shaped element will rotate in that case on a point located over the part and at the same time it will move forward along the continuous machine for cleaning the reserve of the spindle , as shown in fig6 and 7 . a mechanism for simultaneously cleaning several spindles can be provided in accordance with another embodiment . for each spindle to be simultaneously cleaned , an approximately half - arched - shaped part is made , which is formed of two parts . one part is used for cleaning the spindle and is equivalent to the element 1 and the other part is equivalent to the roller or guiding bearing 4 for copying the position of the spindle or the element which is equivalent to the element 12 to allow to position the mechanism with respect to the spindle taking the shape thereof . each of the half - arched part are attached to a common frame , and then the whole assembly can be moved toward the spindle for copying the position of the spindle , by matching different moves pressing elements if required . also , the spindle can be taken apart from the spindle by a small move of a few millimeters , for escaping from the spindle , which allows to move a step forward and to clean the following group of spindles . this embodiment is illustrated in fig8 and 9 . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of constructions differing from the types described above . while the invention has been illustrated and described as embodied in a mechanism for cutting a thread reserve of spindles in continuous spinning machines , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention .	3
reference will now be made in detail to the embodiments of the present invention , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to the like elements throughout . the embodiments are described below to explain the present invention by referring to the figures . the matters defined in the description such as a detailed construction and elements are provided to assist in a comprehensive understanding of the invention . thus , it is apparent that the present invention may be carried out without those defined matters . also , well - known functions or constructions are not described in detail since they would obscure the invention in unnecessary detail . fig2 is a block diagram of an optical recording apparatus according to a preferred embodiment of the present invention . the optical recording apparatus 200 is a device to record data in a recording medium , being connectable to a variety of image sources like computers , broadcast receiving antennas , tvs , and hard disk drives . an example of the optical recording apparatus 200 is a dvd recorder . as for the recording medium , a one - time recordable medium such as cd ± r and dvd ± r , as well as a rewritable recording medium such as cd ± rw , dvd ± rw and dvd − ram ( rewritable ), may be used . additionally , while described as a recording apparatus 200 , it is understood that the apparatus 200 may further reproduce data according to an aspect of the invention . as illustrated in fig2 , the optical recording apparatus 200 of the invention includes a pickup 210 , a radio frequency ( rf ) signal processor 220 , a codec 230 , a digital signal processor ( dsp ) 240 , a controller 250 , a servo driver 260 , a spindle motor 270 , and a user interface 280 . the dsp 240 converts data input to the optical recording apparatus 200 into digital data , and performs on the converted data a signal processing operation such as error correction to convert the data into a recording format . the codec 230 encodes the data converted into the recording format by the dsp 240 , and decodes the encoded data . the spindle motor 270 rotates a loaded optical disk 200 a . the pickup 210 records a signal in the optical disk 200 a , or reads a recorded signal therefrom . the rf signal processor 220 filters and shapes the signal detected by the pickup 210 into a binary signal , and outputs it . the servo driver 250 controls the operations of the pickup 210 and the spindle motor 270 . the user interface 280 applies to the controller 250 a key operation signal applied by the user through the key input unit 110 . as for the key input unit , the key input unit 110 of fig1 , which is formed on the front panel 100 of the optical recording apparatus 100 , or a remote controller ( not shown ) sending an infrared signal in correspondence to each request signal may be used . however , it is understood that the input may be otherwise received , such as across network connections or the like . there are certain types of key operation signals applied to the controller 250 through function keys shown in fig1 . for example , the play key 100 a is assigned to output a play request signal , the stop key 110 c a stop request signal , the pause key 110 d a pause request signal , the open / close key 110 e a tray open / close request signal , the rewind key 110 f a rewind request signal , and the fast forward key 110 f a fast forward request signal . if a record resume time is input after the pause request signal is applied from the key input unit 110 through the user interface 280 , the controller 250 controls the servo driver 250 and stops the pickup 210 temporarily . as a result , the data recording operation currently underway stops temporarily . when the record resume time is provided from the user interface 280 and the time is reached , the controller 250 controls the servo driver 250 to drive the pickup 210 again . in this manner , the temporarily stopped data recording operation is resumed . if the pause request signal is applied , but the record resume time is not input from the user interface 280 , the controller 250 controls the servo driver 260 and ensures that the pickup 210 is maintained in pause state until the record request signal is applied from the user interface 280 . fig3 is a flow chart illustrating a controlling method of an optical recording apparatus according to an embodiment of the present invention . here , the controlling method of the optical recording apparatus will be explained with reference to fig1 to 3 . while not required , it is understood that the method illustrated in fig2 may be implemented as computer software encoded on a computer readable medium and implemented using a general or special purpose computer . using a generally known method , the user loads the optical disk 200 a to the optical recording apparatus 200 connected to a designated image source , and operates the record key 110 b . then , the record request signal is transferred to the controller 250 from the user interface 280 , and the controller 250 controls the servo driver 260 to drive the spindle motor 270 . in this way , a recording data provided from the image source is recorded in the optical disk 200 a ( s 200 ). while the optical disk 200 a is recording the data , if the user operates the pause key 110 d , the pause request signal is applied from the user interface 280 , and the controller 250 displays on the display 120 a message asking the user whether to set the record resume time ( s 210 , s 220 ). if the record resume time is input from the user interface 280 , the controller 250 controls the servo driver 260 to stop the spindle motor 270 ( s 230 , s 240 ) temporarily . the record resume time is recorded so as to allow the recording of the data to be resumed . if the record resume time input from the user interface 280 has occurred while the data recording operation is being temporarily stopped , the controller 250 controls the servo driver 260 to ensure that the spindle motor 270 starts driving again , and the temporarily stopped recording operation may be resumed ( s 250 , s 260 ). in operation 220 , in the case that the user declines to set the record resume time , that is , if the user gives ‘ no ’ for an answer to the message provided to the display 120 by the controller 250 , the message asking whether the user wants to set the record resume time , the controller 250 controls the servo driver 260 to stop the spindle motor 270 temporarily , thus temporarily stopping the data recording operation ( s 220 , s 240 ). if the recording operation is temporarily stopped without the record resume time being preset , the controller 250 is maintained in pause state until the record request signal is applied from the user interface 280 . after operation 250 and if no record resume time is recorded , if the user operates the record key 110 b , and therefore the record request signal is applied from the user interface 280 , the controller 250 controls the servo driver 260 to drive the spindle motor 270 , thus resuming the temporarily stopped recording operation ( s 280 ). as may be appreciated from the above description of the an optical recording apparatus and the method to control the same , according to an embodiment of the present invention , when a user wants to stop temporarily during the recording process , the record resume time may be selectively set by the user to resume the recording correctly at a desired time . while described as used with an optical recording apparatus , it is understood that the present invention may be used with magnetic and / or magneto - optical apparatuses . while described as a record resume time , it is understood that other , non - time based events may be used to resume , automatically , recording of the data . thus , accordingly to aspects of the invention , recording may be resumed if an eject button is pressed or if the power button is turned off to ensure that the recording is completed . accordingly , although the user may not return within time to resume the data recording operation after leaving the optical recording apparatus in a pause state , or the user forgets to resume the recording within the time to resume the data recording operation , loss of data for recording may be prevented . the present invention may also be embodied as computer readable instructions on a computer readable recording medium . the computer readable recording medium is any data storage device that may store data which may be thereafter read by a computer system . examples of the computer readable recording medium include read - only memory ( rom ), random - access memory ( ram ), cd - roms , magnetic tapes , floppy disks , optical data storage devices , and carrier waves ( such as data transmission through the internet ). the computer readable recording medium may also be distributed over network coupled computer systems so that the computer readable code is stored and executed in a distributed fashion . although a few embodiments of the present invention have been shown and described , it would be appreciated by those skilled in the art that changes may be made in these embodiments without departing from the principles and spirit of the invention , the scope of which is defined in the claims and their equivalents .	6
according to a preferred embodiment of the invention , a person wishing to participate in an affiliate program as an affiliate registers with the personal affiliate program and becomes an “ personal affiliate ”. then the personal affiliate must use a so - called client software to compose a signature file which contains information about the virtual stores or products or just web pages he would like to promote . the client software may be downloaded from the personal affiliate program web site ( papws ) or delivered to him , e . g ., as an attachment to an e - mail message . this software , which may be an executable object , a link to a web site or even a combination of both , is used for two purposes : to collect links / banners to web pages which the personal affiliate would like to promote , and to compose a signature file from those links / banners according to the instructions given by the personal affiliate program . the software then adds this file ( which may be an html file ) to the e - mail signature of the personal affiliate when a recipient receives an e - mail bearing such promotional information , he may click one of the links / banners and be taken to the relevant site . if a purchase is effected or any other commerce transaction , a reward is due from the seller , which has to be distributed between the affiliate and the papws . the affiliate to the various e - commerce programs is not the recipient , but rather the personal affiliate program ( pap ). therefore , any recipient reaching the virtual store by clicking on the e - mailed banner will do so through the personal affiliate program web site ( papws ). the virtual store will thus identify the papws as the referrer of the customer , and will pay the due remuneration to it , the papws , according to one preferred embodiment of the invention , keeps track of the transaction and is therefore capable to identify the personal affiliate which initiated the first e - mail , and therefore to remunerate him . according to another preferred embodiment of the invention , remuneration of the affiliate by the papws is not effected on a transaction basis , but rather on the basis of profit distribution schemes , such a scheme based on the number of entrances to given sites , the number of “ clicks ” by a referred surfer in a given site , or any other suitable scheme . thus , a client - server situation exists between the users and the personal affiliate program web site ( papws ), where the papws functions as the facade for a plurality of users , and provides the referral services as well as the distribution of the remuneration to the various users . thus every person and organization involved gains from this arrangement : the virtual stores increase the volume of traffic and the sales , but decrease the volume of administrative work involved in remunerating the various affiliates , since this is taken care of by the affiliation program , while the users may join in the e - commerce affiliate program and make a profit , without the need to have a web site . the personal affiliate program performs a registration procedure at virtual stores . the personal affiliates perform a registration procedure as well , during the registration procedure the details of the affiliate ( such as name , address , bank account etc .) are sent to the personal affiliate program ( pap ) and are registered in a suitable database . as a result of the registration procedure , the personal affiliate gets a unique id . the personal affiliate browses the internet . whenever he finds a web page that he would like to promote , he can drag its link / image and drop it in a “ drop - zone ” of the client software . this page may or may not belong to a virtual store / web page which participates in one of the personal affiliate programs . regarding the e - mail , “ signature ” is a file which is attached to an e - mail document , and usually is displayed by e - mail programs as an integral part of the document . the majority of e - mail programs support signature files . a signature file may be an html file , ms word document , text file , bmp file and so forth . according to a preferred embodiment of the invention , the signature file appears as follows : & lt ; html & gt ; & lt ; body & gt ; & lt ; div id = seasand_signature & gt ; & lt ; p & gt ;& lt ; div align =“ center ”& gt ; & lt ; table border =“ 1 ” width =“ 90 %”& gt ; & lt ; tr & gt ;& lt ; td & gt ;& lt ; table width =“ 90 %”& gt ; & lt ; tr align =“ center ” valign =“ top ”& gt ; & lt ; td & gt ; & lt ; a href =“ http :// www . pwp . com / redirector . dll ? url = www . website1 . com / index . html , usr = 1234 ”& gt ; & lt ; img vspace = 4 border = 0 src =“ product1 . jpg ” width =“ 68 ” height =“ 127 ” alt =“ ”& gt ; & lt ;/ a & gt ;& lt ; br & gt ; & lt ;/ td & gt ; & lt ; td & gt ; & lt ; a href =“ http :// www . pap . com / redirector . dll ? url = www . website2 . com / index . html , usr = 1234 ”& gt ; & lt ; img vspace = 4 border = 0 src =“ product2 . jpg ” width =“ 68 ” height =“ 127 ” alt =“ ”& gt ; & lt ;/ a & gt ;& lt ; br & gt ; & lt ;/ td & gt ; & lt ;/ div & gt ; & lt ;/ p & gt ; & lt ;/ div & gt ; & lt ;/ body & gt ; & lt ;/ html & gt ; clicking on the relevant banner activates the file redirectore . dll which resides in www . pap . com ( the personal affiliate program web site ). the parameter for this program is www . website1 . com / index . html , which is the url ( uniform resource location , i . e . a file accessible on the internet ) where the pap directs the browser upon click . the signature file contains also the id of the personal affiliate in the personal affiliate program , which in this example is 1234 . client software is a software by which the personal affiliate creates or edits signature files according to his preferences , such as format and selection of the affiliated virtual stores . the id received during the registration procedure is attached to the signature file . the software allows creation of several signature files , from which the personal affiliate can select his signature . another purpose of the software is to store the links / banners of web sites which may attached to the signature files he creates , as described in the collecting the links / banners section . there are two variations for e - commerce activity , according to whether the recipient participates in a personal affiliate program or not . if the recipient is a personal affiliate , then the scenario is as follows : personal affiliate : attaches the recently created signature file to e - mail message he sends . the id received in the registration procedure is embedded in the signature file . recipient : clicks on one or more of the web - links appearing on the e - mail , due to this clicking , the personal affiliate program ( pap ) receives ( via the internet ) a message which contains information such as the affiliate &# 39 ; s id and the utrl of the site to which he was directed . personal affiliate program software : redirects the recipient to the desired url (‘ uniform source locator ’, i . e . an address of a web site ). however , from now on , the affiliate is the personal affiliate program ( pap ) rather than the original personal affiliate . that is the pap &# 39 ; s id is considered rather then pa &# 39 ; s personal affiliate program software : credits the affiliate &# 39 ; s account , unless it operates according to a nonpersonal remuneration scheme , personal affiliate : receives report and a commission due to the purchase made by the recipient of his e - mail ( or according to other remuneration schemes ). if the recipient is not a personal affiliate , still the originator personal affiliate will be remunerated , but this remuneration will be shared between other personal affiliates . [ 0049 ] fig1 shows an e - mail sent by a personal affiliate , according to a preferred embodiment of the invention . the signature file in this example contains three affiliated sites marked as 101 , 102 and 103 . [ 0050 ] fig2 schematically illustrates the activities performed on an affiliate program , according to a preferred embodiment of the invention . the arrows have the following meanings : all the virtual stores represented in this figure are participants in the personal affiliate program . virtual store 211 registers to the affiliate program 200 ; affiliate 201 registers to the affiliate program 200 as well , affiliate 201 sends to recipient 221 an e - mail with the recently created signature file containing information and link of the affiliated virtual store 211 ; recipient 221 orders 242 , a service from virtual store 211 . the order details are registered in affiliate program 200 ; due to the purchase , virtual store 211 sends the commission 243 to the affiliate program , and then affiliate 201 gets the reward from the affiliate program 200 ( according to any remuneration scheme ). [ 0061 ] fig3 illustrates the process of constructing a signature file using the agent software , according to a preferred embodiment of the invention , in step 1 , which is illustrated in fig3 . a , the user is given the choice of selecting an existing signature file ( signature 1 or signature 2 ), renaming or deleting an existing signature file or creating a new signature file . in step 2 , illustrated in fig3 . b , the user is given the choice of selecting the virtual - stores / web - sites / products / web - pages to be included in the selected signature file . the user clicks on selection boxes 321 . for illustrative purposes of the program , the icons of the selected items are inserted into box 322 . in step 3 , illustrated in fig3 . c , the user is given the choice of selecting the style of the signature . at this stage , the user may view the signature by clicking the preview button 331 . there are a plurality of ways to remunerate the personal affiliate , such as commission , reduction on products purchased , participation in lottery with each purchase or even as a remuneration for browsing virtual stores , fixed fee , etc . while embodiments of the invention have been described by way of illustration , it will be understood that the invention can be carried out by persons skilled in the art with many modifications , variations and adaptations , without departing from its spirit or exceeding the scope of the claims .	6
referring first to fig1 a and 1b , examples of prior art cutting tools for cutting concentric casing strings upon downward movement are illustrated . fig1 a shows cutting tool t with blades b cutting an inner casing ic and a stabilizer s for centering tool t within inner casing ic during the cutting operation . an annulus a between inner casing ic and outer casing oc is normally filled with concrete . fig1 b shows blades b in cutting relation with outer casing oc in a separate cutting operation after removal of a section of inner casing ic . a tang or lug l on blades b is provided to ride along outer casing oc to center or stabilize tool t within outer casing oc . referring now to the drawings for a better understanding of this invention , and more particularly to fig2 - 4 , an inner casing or casing string for a well is shown at 10 and an outer concentric casing or casing string is shown at 11 . the annulus 12 between casings 10 , 11 is usually filled with concrete ( not shown ). a drill string is indicated generally at 14 having a central bore 16 to receive drilling fluid trough drill string 14 from a surface location . a lower threaded end 18 of a drill string 14 is received in threaded engagement within the upper end of a cutting tool generally indicated at 22 . cutting tool 22 has a tubular cutter body 24 forming a central bore 26 which houses a fluid pressure responsive means which will be described later . the fluid pressure responsive means is responsive to flowing drilling fluid from drill string 14 for hydraulic actuation as will be explained further . cutting tool 22 has a lower reduced diameter bore portion 30 with a lower end 32 for the discharge of drilling fluid . stabilizer fins 33 extending from body 24 engage the inner periphery of inner casing string 10 for centering tool 22 . longitudinally extending slots 34 are circumferentially spaced about the periphery of tubular cutter body 24 adjacent reduced diameter bore portion 30 and receive elongate cutter blades 36 of a generally rectangular configuration . each elongate cutter blade 36 has an upper end portion 37 pivotally mounted by a pin 38 to cutter body 24 and a lower downward extending end portion 40 . blades 36 are free for pivoting between a retracted position shown in broken lines in fig2 for lowering within casing 10 and a radially expanded or extended position as shown in fig3 and 4 in which lower end portions 40 of blades 36 are swung or moved radially outwardly first into cutting contact with the inner periphery of inner casing 10 as shown in fig2 for cutting through the wall of inner casing 10 , and then further extended or expanded radially into cutting contact with the inner periphery of outer casing 11 as shown in fig3 for cutting through the wall of outer casing 11 . cutting tool 22 is particularly adapted for cutting through both inner casing 10 and outer casing 11 and then removing a predetermined length of casings 10 , 11 in a simultaneous downward cutting action . the cutting operation is normally accomplished in a single trip within the well by directing drilling fluid under pressure from the surface through drill string 14 and by rotating drill string 14 and cutting tool 22 with blades 36 pivoted into a radially expanded position into cutting contact with the periphery of the casing to be cut . the pivotal connections 38 between blades 36 and cutter body 24 are designed so that the connections are sufficient to transmit the torque required to accomplish the cutting of casing strings 10 , 11 . for moving lower end portions 40 of cutter blades 36 radially outwardly into expanded cutting engagement with the adjacent casing , the aforementioned fluid pressure responsive means includes a piston 46 having a reduced diameter bore 47 and mounted within cutter body 24 . spring 48 urges piston 46 upwardly . a flow restriction 49 has a reduced diameter bore 50 and a plurality of spaced ports or orifices 52 . when a predetermined fluid pressure differential is reached , piston 46 moves downwardly contacting end portions 37 to pivot cutter arms 36 radially outwardly into cutting engagement with casings 10 and 11 . when cutter arms 36 are pivoted outwardly into contact with casing 10 or 11 , a decreased fluid pressure differential is indicated at the surface so that an operator is aware that cutter arms 36 are in expanded cutting engagement with the inner periphery of the casing to be cut . each blade as shown particularly in fig5 and 6 has a main body portion 54 with cutaway sections defining a leading recessed portion 56 and a trailing recessed portion 58 with respect to the direction of rotation . each recessed portion 56 , 58 extends continuously along three sides of blade 36 to define relative to the fully expanded cutting position of blade 36 an upper side 60 , a lower side 62 , and an outer extending side or end 64 extending between and connecting upper and lower sides 60 , 62 . sides 60 , 62 and connecting end 64 form a planar mounting surface for a plurality of cutting elements or inserts indicated at 66 . a single row of cutting elements 66 is mounted on sides 60 , 62 and a single row or column of cutting elements 66 are preferably formed of tungsten carbide and have leading cutting faces 68 and opposed parallel rear faces 70 . rear planar faces 70 may be secured by suitable brazing or the like to the planar mounting surfaces defining sides 60 , 62 , and 64 . the outer periphery of cutting face 68 defines a cutting edge 72 . a cutting element 66 which has been found to function in a satisfactory manner is a generally cylindrical tungsten carbide disc having a thickness of three - sixteenths ( 3 / 16 ) inch , a diameter of three - eights ( 3 / 8 ) inch , and sold under the name &# 34 ; sandvik s6 &# 34 ; by the sandvik company , located in houston , tex . the embodiment shown in fig2 - 6 includes only a single row of cutting elements 66 on the leading and trailing lower sides 62 of blade 36 . since the lower sides 62 of blade 36 are utilized exclusively during the cutting operation for removing a section of casing after the wall of the casing has been cut , the cutting elements on the lower side of the blade are subject to more wear and a longer cutting operation . for that reason it may be desirable to provide more than one row of cutting elements on the lower side of the blade . the blade embodiment shown in fig7 and 8 has two rows of cutting elements , arranged in a plurality of columns , shown generally at 74a and 76a on blade 36a . cutting elements 66a are mounted on three sides 60a , 62a , and 64a of blade 36a as in the embodiment of fig2 - 6 . cutting elements 66a in lower rows 74a and 76a of blade 36a are axially aligned and follow the same cutting path in the fully extended cutting position of fig4 . it may also be desirable for the cutting elements in row 74a to be horizontally staggered relative to the cutting elements in row 76a , so that the adjacent rows will follow different concentric cutting paths , as disclosed in the parent patent , u . s . pat . no . 4 , 796 , 709 . it may also be desirable for the cutting elements in the lower leading and trailing rows to be staggered horizontally when in the cutting position of fig4 so that different concentric cutting paths along the upper annular ends of the casing strings are provided by the corresponding trailing and leading rows . for that purpose , a further blade embodiment is shown in fig9 in a partial bottom plan view of blade 36b . blade 36b has a lower leading row 74b of cutting elements 66b in recessed portion 56b and a lower trailing row 74b of cutting elements 66b in recessed portion 58b . cutting elements 66b in trailing row 74b are staggered horizontally with respect to cutting elements 66b in leading row 74b in the full extended cutting position and thus follow different concentric cutting paths . in some instances , it may be desirable to stagger the cutting elements on adjacent blades so that different concentric cutting paths are provided by the corresponding cutting elements on adjacent blades . the cutting elements 66 shown in the embodiment of fig2 - 6 have leading cutting faces 68 forming a planar cutting surface extending in a generally vertical plane parallel to the longitudinal axis of rotation . it may be desirable under certain conditions to have the front face and peripheral cutting edge of each cutting element arranged and constructed in such a manner as to effect a &# 34 ; chip breaker &# 34 ; action to provide a metal turning or shaving from the upper annular end of the casing in a predetermined size range in order to minimize any interesting of metal turnings cut form the casing . for that purpose , a modified blade 36c is shown partially in the embodiment of fig1 having a leading mounting surface or side at 62c . for the purpose of illustration , only one cutting element 66c is illustrated as it is understood that the remaining cutting elements are similar to cutting element 66c . a recess 76 is provided in leading surface or face 62c of blade 36c to form a mounting surface for rear face 70c of cutting elements 66c inclined at a negative rake angle a of around fifteen degrees for example . since cutting face 68c is parallel to rear mounting face 70c , cutting face 68c is likewise provided with the negative rake angle of around fifteen degrees . a negative rake angle of between around two degrees and twenty - five degrees would provide a so - called &# 34 ; chip breaker &# 34 ; effect . the upper annular end e of a casing c is shown in fig1 and a metal turning t is shown being cut from end e by cutting element 66c . front face 68c has an annular groove or deformation 78c therein adjacent cutting edge 72c and receives metal turning t for bending turning t in an outward and downward direction to effect a breaking of turning t . thus , the length of turning t is minimized by the negative axial rake angle a and deformation 78c in the front cutting face 68c of cutting element 66c . when the cutting operation is commenced with an unused or new carbide disc , sharp edge 72c initially contacts the inner periphery of the casing to be cut . it is desirable to obtain a relatively short metal turning t which does not tend to intertwine with other metal turnings or shavings and provide an interesting mass which might restrict the removal of such metal scrap . the inclination of cutting face 68c in contact with the metal turnings t , particularly if formed with a deformation 78c therein , assists in the breaking of metal turnings t at a relatively short length of between one to four inches , for example , and since a substantial thickness of turnings t is provided , the curling or turning up of the ends of the turnings t is restricted . fig1 shows another alternative embodiment of a blade 36d , shown as it would extend horizontally in a cutting position . cutting element 66d , which covers the entire cutting face of blade 36d , has a leading surface 68d which comes into contact with the casing to be cut , as the tool is rotated . leading surface 68d has surface irregularities in the form of straight linear surface ridges 78d , arranged horizontally . the function of breaking the chips at a short length , performed by ridges 78d , could also be performed by linear surface depressions , rather than ridges , and the linear surface irregularities could be arranged vertically or at some other angle , rather than horizontally , depending upon the desired application . as explained earlier , the chip breaking feature prevents the formation of long chips or turnings , which would be difficult to remove from the well . also shown formed on leading surface 68d are grooves 80d which are stress relievers , functioning to prevent the propagation of a crack completely across the cutting element 36d . as previously explained , cutting element 36d is preferably made from a very hard material , such as tungsten carbide , which is likely to be very brittle . when such a material is used to make relatively large cutting elements such as 36d , downhole stresses can cause the formation of a crack in the cutting element 36d . grooves 80d will prevent any such cracks from propagating across the element and causing a major portion of cutting element 36d to break loose . grooves 80d are shown as linear grooves vertically arranged , but they could take other shapes and orientations . fig1 shows still another alternative embodiment of a blade 36e . cutting element 66e , which covers the entire cutting face of blade 36e , has a leading surface 68e which comes into contact with the casing to be cut , as the tool is rotated . leading surface 68e has surface irregularities in the form of circular surface ridges 78e , arranged in horizontal rows and vertical columns . the function of breaking the chips at a short length , performed by ridges 78e , could also be performed by circular surface depressions , rather than ridges , and the surface irregularities could be arranged in some other pattern , rather than in rows and columns , depending upon the desired application . also shown formed on leading surface 68e are grooves 80e which are stress relievers , as previously explained . grooves 80e are shown as linear grooves in a vertical and horizontal crossing pattern , but they could take other shapes and orientations . fig1 shows yet another alternative embodiment of a blade 36f . a plurality of cutting elements 66f , each of which extends the full horizontal width of the cutting face of blade 36f , are arranged in a vertical column on the leading face of blade 36f . each cutting element 66f has a leading surface 68f which comes into contact with the casing to be cut , as the tool is rotated . leading surface 68f has surface irregularities in the form of circular surface ridges 78f , arranged in horizontal rows . the function of breaking the chips at a short length , performed by ridges 78f , could also be performed by circular surface depressions , rather than ridges , and the surface irregularities could be arranged in some other pattern , rather than in horizontal rows , depending upon the desired application . as an example , the surface irregularity on each cutting element 66f could be a single horizontal linear ridge or depression , or there could be a vertical column of horizontal linear ridges or depressions on each element 66f . as discussed above , depending upon the size of cutting element 66f , leading surface 68f could have grooves for stress relievers . while inner and outer casings 10 and 11 are shown in the drawings as being in an exact concentric relation , it is to be understood that the present invention will function in a satisfactory manner with the inner and outer casings in an eccentric relation . similarly , the embodiments of the invention are shown as blades for a section milling tool , constructed to pivot outwardly into a cutting position , but the invention embodied in these blades could just as easily be practiced in stationary blades for a pilot mill or some other type of downhole milling tool . while the particular downhole milling tool as herein shown and disclosed in detail is fully capable of obtaining the objects and providing the advantages herein before stated , it is to be understood that it is merely illustrative of the presently preferred embodiments of the invention and that no limitations are intended to the details of construction or design herein shown other than as described in the appended claims .	4
the present invention will now be described in more detail . the present invention is processed by steps of acquisition and cloning of genes of a target fusion protein , construction of expression vectors of a target gene , transfection of animal cells and eatp expression , and purification of the expressed eatp and activity measurement . complementary dna ( cdna ) of epo can be acquired by employing a conventional reverse transcription - polymerase chain reaction ( rt - pcr ) technique using a rt - pct premix kit available from bioneer corp ., korea , in which primers ep1 and ec2 complementary to both terminals of epo cdna previously prepared from a cdna library of the human embryonic liver ( available from invitrogen corp .) are used . epo cdna is cloned into a cloning vector pgem - t ( promega corp . ), which is termed pgemt - epo , and its base sequence is identified for use as template in subsequent operations . ctp variant genes of a hcg β subunit used in the present invention are obtained by artificial synthesis and self - priming pcr . the synthesized gene fragments are ea1 , a2 , a3 and a4 : ( seq id no : 5 ) ea1 : aggggaggcctgcaggacaggggactcctcttccg ( seq id no : 6 ) a2 : ggaagg gc ggggggaggggcctt g g c ggaagagga ( seq id no : 7 ) a3 : cc gc ccttccaagccca g cccgactcccggggccg ( seq id no : 8 ) a4 : ttattgtgggaggatcggggtgtc g g c gggccccg each 1 μl of four genes is taken ( 50 pmole / μl ) to be subjected to pcr using a high fidelity taq system ( boehringer manheim corp .). gene fragments ( modified ctp genes ) of approximately 100 bps in size are identified in a 1 % agarose gel . these genes encode a peptide obtained by replacing 4 ser residues at positions 121 , 127 , 132 and 138 among 28 carboxy terminal amino acids at positions 118 - 145 of a hcg β subunit , with ala residues ( see fig1 ). pcr is performed using a pgemt - epo as template and ep1 and ec2 as primers , yielding only epo genes . then , pcr is further performed using both the epo genes and the modified ctp genes as templates and using ep11 and ep22 primers by means of the high fidelity taq system , thereby acquiring a desired fusion protein with gene fragments of approximately 630 bps ( to be termed eatp genes ). these genes are cloned into pgem - t cloning vectors and then base sequences are identified ( to be termed pgemt - eatp ) ( see fig3 ). pcdna3 . 1 vector ( invitrogen corp .) is used as an expression vector . both termini of the eatp gene in pgemt - eatp have hind iii and bamh i restriction enzyme sites derived from the primers ep11 and ep22 . pcdna3 . 1 and the obtained pgemt - eatp are treated with hind iii and bamh i . the linearized pcdna3 . 1 and eatp gene are obtained from an agarose gel using a qiagen elution kit , followed by ligation , thereby transforming e . coli nm522 . plasmids are isolated from colonies resulting after incubation overnight in an lb - ampicillin solid medium , and are treated with the restriction enzymes hind iii and bamh i . then , only colonies inserted eatp are selected by 1 % agarose gel electrophoresis . the resultant plasmids are termed pcdna3 . 1 - eatp ( see fig3 ). cho cells ( dg44 ) are grown in a 60 mm dish to prepare 40 - 80 % confluent cells ( 1 - 4 × 10 5 cells / 60 mm dish ). 3 μl of a superfection reagent ( boehringer manheim corp .) and 97 μl of media ( α - mem with media , serum free and non - antibiotic ) are mixed sufficiently , and approximately 2 μg of a plasmid pcdna3 . 1 - eatp dna ( more than 0 . 1 μg / μl ) and 0 . 2 μg of a dihydrofolate reductase ( dhfr ) gene containing vector pltrdhfr26 ( atcc37295 ) are added to the resultant mixture and reacted at room temperature for 5 - 10 minutes to then be added to the cells . after one day , the media are replaced with α - mem without media ( containing 500 μg / ml g418 ) with 10 % fbs . the cells are replenished with media with 500 μg / ml g418 and cultured for 7 - 10 days . then , cells without g418 - resistant genes and cells of negative control group all die . after cells selected from the g418 media are sufficiently cultured , an eatp protein expressed from the media is confirmed using an epo elisa kit ( boehringer manheim corp .). using an anti - epo monoclonal antibody ( r & amp ; d inc . ), affinity resins for purification are prepared as follows . 0 . 3 g of cnbr - activated sepharose 4b is swollen in 1 mm hcl for 20 minutes and loaded onto a column , followed by washing with 1 mm hcl . then , the resultant resin is further washed in 4 ml coupling buffer solution ( 0 . 1 m nahco 3 and 0 . 5 m nacl , ph 8 . 3 ) transferred to a tube and immediately mixed with anti - epo monoclonal antibody in the coupling buffer solution ( 500 μg / vial ), and then reacted at room temperature for 2 hours . at this time , the tube is sufficiently shaken . then , the resultant product is replaced with a blocking buffer ( 0 . 2 m glycine , ph 8 . 0 ) and reacted at room temperature for 2 hours with agitation . the resultant resin is washed sequentially with a 6 . 5 ml coupling buffer solution , a 6 . 5 ml acetate buffer solution ( 0 . 1 m acetic acid , 0 . 5 m nacl , ph 4 ) and a 6 . 5 ml coupling buffer solution . the prepared resin is packed into a column and then subjected to purification as follows . cells are grown in a serum - free medium for one day and then only the medium is concentrated approximately 5 times using a ultrafiltration filter , for example , centriprep ( having a nominal molecular weight cutoff of 10 , 000 ) ( millipore corp .). then , the concentrated solutions are loaded onto a column equilibrated with phosphate buffered saline ( pbs ) at a flow rate about 20 ml / hr and washed again with pbs . the target proteins are eluted in an elution buffer solution ( 0 . 1 m glycine , ph 2 . 8 ) and then immediately titrated with 1 m tris solution for adjustment to ph 7 . 5 . the purity of the purified eatp is 97 % or higher as verified by sds - page and silver staining ( see fig4 ). biological activities of the expressed and appropriately purified epo and eatp are measured by a bioassay using spleen cells of a mouse treated with phenylhydrazine . the result shows that the activity of eatp is higher than that of epo , suggesting that the presence of added carboxy terminals in eatp does not inhibit the activity of epo . in order to confirm whether the prepared candidate materials actually have a longer in vivo half - life , pharmacokinetic tests are performed on mice . here , the candidate materials are intravenously administered to four mice at dosages of 20 units for each mouse . to evaluate the concentration profile in blood , blood is gathered from the mice and the concentration in the gathered blood is measured using an eia kit ( boehringer manheim corp .). the pharmacokinetic test performed on mice shows that candidate material eatp has a much longer half - life than the control material epo ( see fig5 ). the present invention is further illustrated in the following examples , which should not be misconstrued as limiting the scope of the invention . cdna of epo was acquired by employing a conventional rt - pcr technique using a rt - pct premix kit ( bioneer corp ., korea ), in which primers ep1 and ec2 complementary to both terminals of epo cdna previously prepared from a cdna library of the human embryonic liver ( invitrogen corp .) were used . 30 cycles of pcr reactions were performed in the conditions of 35 seconds at 55 ° c . ( annealing ), 40 seconds at 72 ° c ., and 20 seconds at 94 ° c ., yielding epo cdna . the obtained epo cdna was cloned into a cloning vector pgem - t ( promega corp .). in other words , the product of pcr was eluted from 1 % agarose , ligated to pgem - t , followed by transformation of e . coli nm522 . after overnight incubation in an x - gal / iptg smeared lb - ampicillin solid medium , plasmid dna was isolated from white colonies and reacted with restriction enzymes sac i and sac ii to select colonies having epo cdna inserts therein . the obtained vector was termed pgemt - epo and its base sequence was identified for use as a template in subsequent processes . modified ctp genes of a hcg β subunit were obtained by artificial synthesis and self - priming pcr . the synthesized gene fragments were ea1 , a2 , a3 and a4 . each 1 μl of four genes was taken ( 50 pmole / μl ) to be subjected to 15 cycles of pcr using a high fidelity taq system ( boehringer manheim corp .) under conditions of 40 seconds at 55 ° c . ( annealing ), 40 seconds at 72 ° c . and 20 seconds at 94 ° c . gene fragments of approximately 100 bps in size were identified in a 1 % agarose gel ( modified ctp genes ). these genes encode a peptide obtained by replacing 4 ser residues at positions 121 , 127 , 132 and 138 among 28 carboxy terminal amino acids of a hcg β subunit , with ala residues ( fig1 ). pcr was performed using a pgemt - epo template and ep1 and ec2 primers , yielding only epo genes . then , 30 cycles of pcr were further performed using both the epo genes and the modified ctp genes obtained as templates and using ep11 and ep22 primers by means of the high fidelity taq system under conditions of 42 seconds at 57 ° c . ( annealing ), 60 seconds at 72 ° c ., and 20 seconds at 94 ° c . thus , approximately 630 bps of fused gene fragments were obtained ( to be termed eatp genes ). these genes were cloned into pgem - t using above mentioned method ( to be termed pgemt - eatp ), and its sequences were identified . pcdna3 . 1 vector ( invitrogen ) was used as expression vector . both terminus of the eatp gene in pgemt - eatp have hind iii and bamh i restriction sites derived from the primers ep11 and ep22 . pcdna3 . 1 and the obtained pgemt - eatp were treated with the restriction enzymes hind iii and bamh i . the linearized pcdna3 . 1 and eatp gene were obtained from an agarose gel using a qiagen elution kit , followed by ligation , thereby transforming e . coli nm522 . plasmids were isolated from colonies resulting after incubating overnight in an lb - ampicillin solid medium , and were treated with the restriction enzymes hind iii and bamh i . then , only colonies inserted eatp were selected by 1 % agarose gel electrophoresis . the resultant plasmids were termed pcdna3 . 1 - eatp ( see fig3 ). cho cells ( dg44 ) were grown in a 60 mm dish to prepare 40 - 80 % confluent cells ( 1 - 4 × 10 5 cells / 60 mm dish ). 3 μl of a superfection reagent ( boehringer manheim corp .) and 97 μl of media ( α - mem with media , serum - free and non - antibiotic ) were mixed sufficiently , and approximately 2 μg of a plasmid pcdna3 . 1 - eatp dna ( more than 0 . 1 μg / μl ) and 0 . 2 g of a dihydrofolate reductase ( dhfr ) gene containing vector pltrdhfr26 ( atcc37295 ) were added to the resultant mixture and reacted at room temperature for 5 - 10 minutes and then added to the cells . after one day elapsed , the media were replaced with α - mem without media ( containing 500 μg / ml g418 ) with 10 % fbs . the cells were replenished with media containing 500 μg / ml g418 , and cultured for 7 - 10 days . then , cells without g418 - resistant genes and cells of negative control group all died . after cells selected from the g418 media were sufficiently cultured , eatp protein expressed from the media was confirmed using an epo elisa kit ( boehringer manheim corp .). using an anti - epo monoclonal antibody ( r & amp ; d inc . ), affinity resins for purification were prepared as follows . 0 . 3 g of cnbr - activated sepharose 4b was swollen in 1 mm hcl for 20 minutes and loaded onto a column , followed by washing with 1 mm hcl . then , the resultant resin was further washed in 4 ml coupling buffer solution ( 0 . 1 m nahco 3 and 0 . 5 m nacl , ph 8 . 3 ), transferred to a tube and immediately mixed with anti - epo monoclonal antibody in the coupling buffer solution ( 500 μg / vial ), and then reacted at room temperature for 2 hours with agitation . at this time , the tube was sufficiently shaken . then , the resultant product was replaced with a blocking buffer ( 0 . 1 m glycine , ph 8 . 0 ) and reacted at room temperature for 2 hours . the resultant product was washed sequentially with a 6 . 5 ml coupling buffer solution , a 6 . 5 ml acetate buffer solution ( 0 . 1 m acetic acid , 0 . 5 m nacl , ph 4 ) and a 6 . 5 ml coupling buffer solution . the prepared resin was packed into a column and then subjected to purification as follows . cells were grown in a serum - free medium for one day and then only the medium was concentrated approximately 5 times using a ultrafiltration filter of centriprep ( having a nominal molecular weight cutoff of 10 , 000 ) ( millipore corp .). then , the concentrated solutions were loaded onto a column equilibrated with pbs at a flow rate about 20 ml / hr and washed again with pbs . the target proteins were eluted in an elution buffer solution ( 0 . 1 m glycine , ph 2 . 8 ) and then immediately titrated with 1 m tris solution for adjustment to ph 7 . 5 . the purity of the purified eatp was 97 % or higher as verified by sds - page and silver staining ( see fig4 ). phenylhydrazine was administered to a mouse once a day for 2 days at the dose of 60 mg / kg . after 3 days , an enlarged spleen was isolated from the mouse and pulverized with a homogenizer to gain spleen cells . the spleen cells were diluted to a concentration of 6 × 10 6 cells / ml and each 100 μl of the diluted sample was transferred to a 96 - well plate . standard epo ( 0 - 500 mu / ml ) and the expressed epo and eatp ( each 100 mu / ml ) were added to the respective wells . then , the plate was stored in a co 2 incubator maintained at 37 ° c . for 22 hours . 50 μl of dimethyl - 3 h - thymidine ( 20 μci / ml ) was added to each well . the resultant plate was further reacted for 2 hours , and then the sample solutions of each well were adsorbed to a glass filter ( nunc 1 - 73164 ). the filter was washed three times with saline and the radioactivity of the filter was measured using a beta ( β ) counter . the measurements showed that the activity of eatp was substantially equal to or slightly higher than that of epo , suggesting that the presence of added carboxy terminals in eatp does not inhibit the activity of epo . in order to confirm whether the prepared candidate materials actually have a longer in vivo half - life , pharmacokinetic tests were performed on mice . here , the fusion protein purified by the method described in example 5 was intravenously administered to four mice at dosages of 20 units for each mouse . to evaluate the concentration profile in blood , blood was gathered from the mice at regular time intervals , that is , every 30 minutes at the beginning and every 2 hours after 2 hours . and the concentration in the gathered blood was determined using an eia kit ( boehringer manheim .). the result of the pharmacokinetic test is shown in fig5 . as shown in fig5 the candidate material eatp had a much longer ( more than 2 . 5 times longer ) half - life than the control material epo . according to the present invention , the in vivo activity of epo can be enhanced by increasing the in vivo half - life while retaining the intrinsic activity of the epo with its own amino acid , i . e ., without increasing the sugar chain content of epo . met gly val his glu cys pro ala trp leu trp leu leu leu ser leu ile cys asp ser arg val leu glu arg tyr leu leu glu ala lys glu asn ile thr val pro asp thr lys val asn phe tyr ala trp lys arg gln pro trp glu pro leu gln leu his val asp lys ala val ser gly thr ala asp thr phe arg lys leu phe arg val tyr ser asn phe leu	0
fig1 - 3 relate to a first preferred embodiment of the invention . more particularly , fig1 shows a powder ejection apparatus 10 which includes a pump body 12 . the pump body 12 receives fluidized powder from a powder hopper 14 and pumps the powder through an ejection tube 17 connected to the pump body 12 . directional arrow 18 shows the direction of flow of the powder . the tube 17 may be of any desired length to facilitate directing the powder flow to a spray gun . to enter pump body 12 from the power hopper 14 , the powder enters a powder inlet 20 . this powder flow is caused by an ejector nozzle 22 mounted to pump body 12 and directed along the same axis as tube 17 . an air supply tube 24 is connected to ejector nozzle 22 , and as shown by directional arrow 25 , supplies air at a relatively high pressure to ejector nozzle 22 to pump the powder outwardly through tube 17 . as ejector nozzle 22 directs the high pressure air stream toward tube 17 , a low pressure is created at the powder inlet portion 20 , thereby causing the powder to move therethrough from the hopper 14 and into the pump body 12 to be pumped through tube 17 . because of the relatively small cross sectional dimension of inlet 20 relative to powder hopper 14 , powder has a tendency to adhere and accumulate within the inlet 20 enroute to pump body 12 , particularly if the powder has the property of high coherence , high adherence due to viscosity , low slipperiness , a tendency to agglomerate or low flow characteristics . if left unchecked , this powder accumulation will narrow the powder inlet 20 and reduce the total volume of powder supplied to the pump body 12 and to tube 17 per unit time , thereby adversely affecting the uniformity of the powder coating on the article being coated . this reduction in discharge quantity per unit time is shown in fig3 designated by reference numeral 32 . to solve this problem , a pulsing air flow is directed from a pulsing nozzle 28 through the inlet 20 in a direction counter to that of the normal powder flow inlet 20 . preferably , as shown in fig2 the nozzle 28 and the nozzle 22 are oriented such that their axes and flow paths do not intersect . also , it is preferred that this reverse flow be sprayed at a pressure lower than the pressure of the air sprayed from nozzle 22 . this pulsing air flow from nozzle 28 produces microvibrations in the powder within the inlet 20 , which prevents or reduces adherence and accumulation of the powder along the sidewalls thereof . as a result , the quantity of powder transferred from the hopper 14 through the pump body 12 and outwardly through tube 17 does not fluctuate with time during operation of the powder ejection apparatus 10 . therefore , the powder ejection apparatus 10 can be operated continuously to produce uniformity in the volume of powder ejected per unit time , thereby assuring consistent powder flow to a spray gun for spraying onto a surface to be coated and producing a higher quality coating . air pressure setting for the ejector nozzle 22 -- 4 kg / cm 2 ; air pressure setting for nozzle 28 -- 2 kg / cm 2 , and the air was continuously pulsed to spray for a duration of about 20 to 100 milliseconds and then to stop for a duration of about 40 to 200 milliseconds . under these conditions , the powder ejection apparatus 10 ejected the fluoride powder in a relatively uniform quantity over the entire period of operation , as shown in fig3 by reference numeral 34 , thereby improving the powder flow uniformity . while fig1 and 2 show nozzle 28 above and to the side of ejector nozzle 22 , it is to be understood that nozzle 28 could be located in any one of a number of different positions , so long as the oppositely directed pulsing air flows through inlet 20 and into powder hopper 14 . the primary consideration is that the two gas flows from nozzles 22 and 28 should not cross . also , the powder hopper 14 may be a fluidizing tank for supporting the powder in a fluidized state , i . e ., a fluidized bed . fig4 - 7 relate to a second preferred embodiment of the invention . more particularly , fig4 shows a powder ejection apparatus and powder coating system 110 which also provides uniformity in volume and consistency for a powder coating , but in a slightly different manner . the apparatus 110 receives fluidized powder from a powder hopper 114 and pumps the powder to a spray nozzle 116 located at the end of an outlet tube 117 . the powder storage chamber 114 includes a fluiding plate 115 located adjacent the bottom thereof through which air is directed upwardly , as shown by directional arrows 119 , to fluidize the powder within hopper 114 . similar to the first embodiment , pressurized air is sprayed from an ejector nozzle 122 aimed along the axis of the tube 117 . however , in this second embodiment , instead of a single pump body 12 , the powder ejection apparatus 110 has a pump body which includes a separate intake portion 112a and an ejector portion 112b in fluid communication via a connector 112c . the intake portion 112a is in fluid communication with the powder hopper 114 , thereby providing a flow path for fluidized powder from the powder hopper 114 to the ejector portion 112b . more particularly , intake portion 112a includes powder inlet portion 120 through which the powder must flow from powder hopper 114 enroute to the ejector portion 112b . a reverse flow nozzle 128 mounts to intake portion 112a , and is directed toward powder inlet 120 to spray air through the powder inlet 120 and into the powder hopper 114 , counter to the normal flow direction of the powder . ejector nozzle 122 and reverse flow nozzle 128 are operatively connected to a pressurized air source 125 , via fluid lines 124 and 130 , respectively . fluid lines 124 and 130 each include an in line gas regulator , designated by reference numerals 134 and 140 , respectively . additionally , fluid lines 124 and 130 include solenoid valves 135 and 138 , respectively , which are electrically connected with an electric controller 142 . the controller 142 controls the timing sequences of the operation for the ejector nozzle 122 and the reverse flow nozzle 128 to alternately actuate the solenoid valves 135 and 138 to spray air from nozzles 122 and 128 , thereby alternating between drawing powder into powder ejection apparatus 110 from hopper 114 and blowing powder away from apparatus 110 into hopper 114 . thus , compared to the first embodiment , which produced uniformity in powder quantity per unit time during ejection , this embodiment achieves uniformity in ejection quantity per on / off cycle . this is due to the uniformity in conditions during initiation of the &# 34 ; on &# 34 ; portion of the on / off cycle of operation . at initiation , no powder resides in the inlet portion 120 , unlike prior systems which relied upon pinch valves and were susceptible to deterioration with age and inadvertent powder flow . preferably , the controller 140 is programmable to select the desired operating sequence . during operation , when the ejector nozzle 122 sprays air through ejector portion 112b , reduced pressure at inlet 120 and in connector tube 112c causes the fluidized powder to flow from the powder hopper 114 through powder intake portion 120 and ejector portion 112b to nozzle 116 . this produces a spray pattern 118 of powder coating material from nozzle 116 . after the nozzle 122 turns off , reverse flow nozzle 128 is turned on to spray air toward hopper 114 , and in the opposite direction of the normal powder ejection flow path of the fluidized powder . this spray from nozzle 128 blows the powder out of the inlet portion 120 into the chamber 114 . when nozzle 128 is turned off and nozzle 122 is turned on , the powder must move entirely from the chamber 114 to inlet 120 , since no powder was already in the inlet 120 at the commencement of spraying by nozzle 122 . by cooperatively pulsing the ejector nozzle 122 and the reverse flow nozzle 128 , the same quantity of powder can be ejected during each cycle of &# 34 ; on / of &# 34 ; sequences , thereby assuring uniformity in powder ejection during coating operations which require switching and eliminating prior uniformity problems caused by inconsistent spray volumes especially during initiation of the &# 34 ; on &# 34 ; portion of the cycle . this second embodiment of the invention is particularly suitable for spray coating articles carried a conveyor , due to the need for on / off cycling at a coating station . fig5 shows the on / off times for ejector nozzle 122 and reverse flow nozzle 128 , as designated by reference numerals 143 and 144 , respectively . reference 146 shows the duration of &# 34 ; on &# 34 ; time for reverse flow air nozzle 128 and reference numeral 147 shows the duration of time thereafter until ejector nozzle 122 is turned back to &# 34 ; on &# 34 ; to commence powder pumping . thus , no powder is pumped during the time period represented by the sum of 146 and 147 . with the reverse flow of air sprayed by nozzle 128 through powder inlet portion 120 , this invention eliminates the need to insert a pinch valve , or possibly a mechanical type valve , between powder hopper 114 and the inlet of ejector portion 112b for the purpose of starting and stopping powder flow . fig6 shows a variation of the second preferred embodiment of the invention . according to this variation , the powder ejection apparatus 110 includes a single piece pump body 112 to which the ejector nozzle 122 and the reverse flow nozzle 128 are mounted . the ejector nozzle 122 is aimed to spray air outwardly through line 117 , and the reverse flow nozzle 128 is aimed to spray air opposite the normal flow of the fluidized powder , through powder inlet 120 and toward powder hopper 114 . fig7 shows timing control for switching the operation of ejector nozzle 122 and the reverse flow nozzle 128 for the apparatus 110 shown in fig6 . because of the proximity of the nozzles 122 and 128 , the switching spray pulses between on / off can be more closely timed to provide a shorter on / off cycle for the apparatus 110 . again , as with the apparatus shown in fig4 the apparatus of fig6 provides effective stopping and starting of each powder pumping cycle , thereby assuring uniformity in the volume of powder pumped per cycle . fig8 and 9 depict a third preferred embodiment of the invention which combines features from the first and the second embodiments . more specifically , fig8 shows a powder coating system 210 for applying electrostatically charged particles to an article 209 to be coated . the apparatus 210 conveys the particles through an outlet conduit 217 to a spray nozzle 216 which produces a spray pattern designated by reference numeral 218 . to electrostatically charge the particles , the apparatus 210 includes a corona electrode 208 mounted adjacent the outlet 216 . the corona electrode 208 is connected to a power supply ( now shown ) in electrical controller 248 via an electrical cable 206 . the system 210 further includes a pump body 212 which receives powder from a powder hopper 214 and then conveys the powder to outlet conduit 217 . the hopper 214 includes a fluidizing plate 215 , located at a bottom end thereof above a fluidizing air plenum 221 . an air inlet 250 supplies pressurized air to the plenum 221 , and a resulting upward flow of the pressurized air through the plate 215 causes the powder to be fluidized . a powder supply container 251 supplies powder to the hopper 214 in response to a level sensor ( now shown ) in a manner known in the industry . the hopper 214 also includes a rotatable stirring blade 254 which is driven by a motor 255 . the stirring blade 254 reduces channeling of the powder in the hopper 214 , as described above . air to the inlet nozzle 250 is supplied via a line 258 connected to a pressurized air supply source and controller , designated generally 240b , and the system 210 precisely controls the flow of air to inlet 250 via a solenoid valve 260 , which is electrically controlled by an electrical controller 240a . the electrical controller 240a and the air supply source and controller 240b cooperatively interact to control all operations of the powder system 210 . preferably , each of the controllers 240a and 240b includes a microprocessor to facilitate programmable control . the pump body 212 is connected to the bottom of the hopper 214 and includes a powder inlet 220 which communicates with the hopper 214 . a reverse flow nozzle 228 mounts to pump body 212 for directing a stream of air through the powder inlet 220 and toward the hopper 214 , opposite the normal flow direction of powder during pump operation . an ejector nozzle 222 also mounts to the pump body 212 , and ejector nozzle 222 delivers a high pressure air stream through the pump body 212 along the axis of outlet line 217 . additionally , pump body 212 includes a gas transport nozzle 270 which supplies pressurized gas to an annular region 271 within the pump body 212 and then toward outlet line 217 via channels 272 , which are also formed within the pump body 212 . thus , the transport nozzle 270 supplies pressurized transport air downstream of the ejector air supplied by the ejector nozzle 222 . as a result , powder pumped from pump body 212 and into line 217 is carried by an air stream consisting of the confluence of the ejector air and the transport air . air transport nozzle 270 is supplied with pressurized air via a fluid line 273 connected to the controller 240b , and air flow is controlled via a solenoid valve 274 , which is electrically connected to controller 240a . similarly , ejector nozzle 222 is connected to controller 240b via a fluid line 224 , and ejector air flow is controlled via a solenoid valve 235 which is electrically connected to electrical controller 240a . in this embodiment , the reverse flow nozzle 228 includes two separate fluid supply lines 230a and 230b connected to controller 240b , through which air flow is controlled by solenoid valves 238a and 238b , respectively . downstream of the solenoid valves 238a and 238b , the lines 230a and 230b merge to form a single air supply line 230 for nozzle 228 . the use of two separate supply lines 230a and 230b and two separate solenoid valves 238a and 238b allows the apparatus 210 to use a single nozzle 228 for providing reverse pulsing during powder pumping , as in the first embodiment , and reverse flow to stop powder from entering pump inlet 220 when the pump 15 is idle , as in the second embodiment . in operation , at start - up , solenoid valves 235 , 274 and 238b are closed . solenoid valves 260 and 238a are opened . this produces fluidizing air flow into fluidizing plenum 221 via hopper inlet 250 to fluidize particles in the hopper 214 . additionally , the reverse flow through nozzle 228 prevents powder from entering the powder inlet 220 . the pressure of the air supply sprayed from nozzle 228 may initially need to be adjusted to accomplish this objective by means of a regulator ( now shown ). additionally , the stirring blade 254 is rotated by means of motor 255 . solenoid valve 260 remains open so that powder is continuously fluidized during the operation of system 210 , and likewise blades 254 are at all time continuously rotating wherever the system 210 is in operation . to spray powder , valves 235 and 274 are opened , and solenoid valve 238a is closed . this causes nozzle 222 and nozzle 270 to spray ejector air and transport air , respectively , thereby causing powder to be pumped from hopper 214 through pump body 212 to outlet line 217 . at the same time , solenoid valve 238b is opened and closed intermittently ( pulsed ) based on an electrical signal from the controller 240a . preferably , during this intermittent opening and closing of valve 238b , the air sprayed into pump body 212 from nozzle 228 is adjusted to a pressure lower than the pressure of the pressurized air sprayed from the ejector nozzle 222 . valve 238b continues to cycle for so long as solenoid valves 235 and 274 are open . with the ejector nozzle 222 spraying air , due to opening of solenoid valve 235 , powder from the hopper 214 is drawn into pump body 212 through powder inlet 220 via venturi operation . additionally , due to the opening of solenoid valve 274 , transport nozzle 270 supplies pressurized transport air to the pump body 212 downstream of ejector nozzle 222 . as a result , powder particles are pumped through line 217 and are sprayed outwardly from nozzle 216 , whereupon corona electrode 208 , powdered by cable 206 via power supply and controller 204a , electrostatically charges the particles to render them electrostatically attracted to the article 209 to be coated . article 209 is typically electrically grounded by the conveyor . to temporarily stop the flow of powder from the nozzle 216 , valves , 235 , 274 and 238b are closed , and at the same time , valve 238a is opened . this causes air flow from nozzle 228 to go from the intermittent pulsing operation at relatively low pressure to reverse flow operation wherein an air stream is sprayed at sufficient pressure to force the powder particles in the powder inlet 220 back into the hopper 214 . this operation of the solenoid valves is shown more clearly in fig9 with reference numeral 280 indicating a temporary stoppage of powder flow . with this powder coating system 210 , a very consistent powder coating may be applied to an article 209 , with a uniformity of powder thickness and high quality assured , due to improved control of the volume of powder delivered per unit time during the &# 34 ; on &# 34 ; portion of the on / off cycle of operation and the ability to temporarily halt flow of the powder from the hopper 214 during switching between &# 34 ; on &# 34 ; and &# 34 ; off &# 34 ;. this assures uniformity in conditions each time the powder pump of system 210 is switched &# 34 ; on &# 34 ;. a high quality coating was achieved with powder coating system 210 using the following parameters : pulsed air flow for nozzle 228 / solenoid valve 238b -- 2 kg / cm 2 with pulsed &# 34 ; on &# 34 ; time of about 20 - 100 milliseconds and &# 34 ; off &# 34 ; time of about 40 - 200 milliseconds ; reverse flow air for nozzle 228 / solenoid valve 238a -- 3 kg / cm 2 ; fig1 - 12 relate to a fourth preferred embodiment of the invention , which varies somewhat from the third preferred embodiment , but still provides reverse pulsing during the pumping of powder and reverse flow when the pump is idle . fig1 shows a powder coating system 310 which sprays powder in a spray pattern 318 onto an article to be coated 309 . if desired , the article 309 may be carried on a conveyor 301 and / or coated within an environmentally controlled enclosure 302 wherein oversprayed powder would be collected and possibly returned to hopper 314 . the apparatus 310 conveys fluidized powder from hopper 314 , through a pump body 312 , through an outlet line 317 to an electrostatic spray gun 316 , such as a model npe - 4ah , available from nordson corporation , amherst , ohio , and shown in u . s . pat . no . 4 , 630 , 777 , which is hereby incorporated by reference in its entirety . the hopper 314 includes a fluidizing plate 315 above an air plenum 321 . air supplied into the plenum 321 via inlet 350 passes upwardly through the plate 315 to fluidize the powder particles within hopper 314 . a paddle 354 is mounted within hopper 314 and rotated via motor 355 to uniformly mix the powder particles . particles are drawn from the hopper 314 into the pump body 312 via venturi action caused by operation of an ejector nozzle 322 mounted to the pump body 312 and directed at outlet line 317 . to get to the pump body 312 , the particles move through a powder inlet 320 , which is preferably located directly below rotating paddle 354 . as shown in fig1 , pump body 312 further includes a pulse nozzle 328 directed at the hopper 314 and along powder inlet 320 , and a flow nozzle 329 which is also directed at the hopper 314 along the powder inlet 320 . thus , this fourth preferred embodiment of the invention differs from the third preferred embodiment in that separate nozzles , i . e ., nozzles 328 and 329 , are used for the separate functions of reverse pulsing inlet 320 during pumping , and reverse flow to prevent the particles from entering inlet 320 when the pump is idle , respectively . this is in contrast to the single nozzle 228 which was used with two separate solenoid valves 238a and 238b and fluid lines 230a and 230b in the third preferred embodiment for these same two functions . fig1 also clearly shows outlet line 317 extending horizontally from pump body 312 , without any horizontal or vertical bends , except for the downward bend before gun 316 , and is located either level with or entirely below the outlet of pump body 312 . also , spray gun 316 is oriented vertically and located below the outlet of pump body 312 . this structure eliminates the possibility of powder particles returning to the pump body 312 under gravitational forces when the ejector nozzle 322 is switched off . the gun 316 is also oriented vertically to further reduce the possibility of collisions and / or coherence of the powder particles during flow from pump body 312 to the spray nozzle of gun 316 . in total , the flow path makes only one turn between pump body 312 and the article 309 . fig1 shows the relative positions of the nozzles 328 and 329 with respect to nozzle 322 . use of the two separate nozzles , 328 and 329 , for the separate functions of pulsing and stoppage , respectively , produces more precision in these controls and further allows the flows emanating from these nozzles to be oriented in a manner which does not interfere with the spray from nozzle 322 . fig1 shows the on / off timing operation of the sprays from nozzles 322 , 328 and 329 . air flow from these nozzles is controlled in the same manner as described with respect to the third preferred embodiment . fig1 a shows the spray gun 316 in greater detail . spray gun 316 has a powder flow conduit 370 having an inlet 351 at one end and a spray nozzle 352 at the other end . preferably , spray nozzle 352 is a slot nozzle having a 0 . 12 inch wide slot available from nordson corporation , amherst , ohio as part number 117 , 158 . conduit 370 is completely unobstructed up to nozzle 352 which defines spray pattern 318 . this is facilitated by the use of a charging electrode 360 which is completely external to conduit 370 and nozzle 352 . with this spray gun design there are no places within the gun for the powder particles to agglomerate , and this facilitates the consistent , uniform application of powder to articles by means of the system 310 of this fourth embodiment . in view of the above detailed description of four preferred embodiments , it will be understood that variations will occur in employing the principles of this invention , depending upon materials and conditions , as will be understood to those of ordinary skill in the art .	8
the invention described herein is directed to dyes for use with commercially available ink - jet printers such as design jet ® liner printers , manufactured by hewlett - packard company , of palo alto , calif . more specifically , a specific dye for formulating the magenta is disclosed . the dye enables the production of high - quality print and excellent lightfastness . the inks formulated according to the invention produce images having color appearance that meets commercial requirements for color accuracy and durability . one of the most stable photographic systems on the market today is fuji film and print media , which is reported to have a display life of 60 years . a search of patents by fuji revealed that they have developed a novel class of dyes , which when used in photographic media , were very stable . structures 1 and 2 are examples of such dyes : recognizing that the environment around the dye plays a very large role in dye stability , hp isolated the magenta dye from developed fuji crystal archive photographic media and investigated its stability on a typical glossy ink jet medium . it was found not to be very stable toward light . further , it is known that these azopyrazolone dyes can be attacked by ozone at the imine carbon . thus , at first glance , this class of dye does not appear to be very interesting from an ink jet application standpoint . however , given that the chemistry of this class of dye is well known and it has a very good color , it is an excellent choice to pursue the concept of steric protection . if all of the large “ ballast ” groups are stripped away that are present in typical photographic dyes to leave the basic chromophore and attach groups to provide steric protection of the imine carbon , the dyes shown in structures 3 and 4 are produced in structure 3 , the phenyl group attached to the imino n at c - 4 has ortho - methyl groups , which will inhibit formation of tetrahedral n during ozonolysis . similarly , the c - 5 nitrogen has two phenyl groups with ortho chlorines attached to make approach to c - 5 more difficult . in an analogous manner , the azopyrasolotriazole dye ( structure 2 ) has been modified to produce structure 4 . in addition to the same ortho - methyl groups on the imino phenyl ring , oxygen at c - 8 has an isopropyl instead of an ethyl group . molecular modeling ( hyperchem ) of structure 3 shows that the approach to the imine carbon ( or to the entire pyrazolone ring ) is very hindered . structure 1 shows the energy minimized structure . a remaining challenge is to make these dyes water - soluble . two options appear likely . one is to sulfonate one or more of the aromatic rings . second is to change the acetamide groups to contain a water - solubilizing group , such as cooh , so 3 h , or polyether . further , it has been reported that spiroindane compounds when added to solutions of these dyes improve their lightfastness . it is speculated that the spiro materials act as singlet excited state quenchers . thus , similar type additives could be added to these dyes either in the ink or in the media itself . such work is the subject of a recent patent application by the same inventor , ser . no . 09 / 662 , 950 filed on sep . 15 , 2000 . another approach to providing steric protection of dyes is to encase them inside some structure . one method of doing this is to construct bridges that cross over above and below the imine or azo plane . however , synthetically , such structures are very challenging to make . an alternate method of doing this is to use the concept of “ self - assembly ”. in this approach , the dye is constructed so that it contains arms that spontaneously form bridge like structures . this area of chemistry is extensive and recently reviewed . the driving force to make the bridge structure is the formation of several hydrogen bonds , although other methods such as metal chelation are also possible . using a proto - typical acid azo dye , complementary arms can be attached so that they form hydrogen bonds with each other . this process forms the protecting bridge . such a structure is shown in structure 5 , where the cyanuric and melamine groups can form h - bonds to each other above and below the plane of the naphthalene ring . this effectively “ encapsulates ” the dye . space filling models ( hgs ) show that this arrangement is possible . wherein m and n are from 0 to 4 added carbons . an alternate approach to this methodology is to shorten the alkyl chains that attach the cyanuric acid groups . this precludes intra - molecular h - bonding to the melamine group , but allows inter - molecular h - bonding . a head to tail stacking of the dye molecules then results . this enforced aggregation of the dye protects the dye for obvious steric reasons . further , dye aggregation has been shown to improve light stability . this stacked structure is shown in structure 6 . the present magenta aqueous ink compositions each comprise in general from about 0 . 1 to about 6 wt % of at least one dye , and a vehicle comprising the following components ( in wt % of total ink composition ): from about 5 to about 30 wt % of at least one organic solvent ; 0 to about 2 . 0 wt % of at least one component independently selected from the group consisting of surfactants , buffers , biocides , and metal chelators ; and the balance water . all concentrations herein are in weight percent of total ink composition unless otherwise indicated . the purity of all components is that employed in normal commercial practice for ink - jet inks . the inks of the present invention comprise an aqueous vehicle comprising the following components ( in wt % of total ink composition ): from about 5 to about 30 wt % of at least one water soluble organic solvent ; 0 to about 2 . 0 wt % of at least one component independently selected from the group consisting of surfactants , buffers , biocides , and metal chelators ; and the balance water . the inks of the present invention comprise from about 5 to about 30 wt % organic solvent . more preferably , the inks comprise from about 8 to about 20 wt % organic solvent , with a concentration from about 9 to about 15 wt % being the most preferred . the water soluble organic solvents suitably employed in the present ink - jet ink compositions include any of , or a mixture of two or more , of such compounds as nitrogen - containing heterocyclic ketones , such as 2 - pyrrolidone , n - methyl - pyrrolid - 2 - one ( nmp ), 1 , 3 - dimethylimidazolid - 2 - one , and octyl - pyrrolidone ; diols such as ethanediols , ( e . g ., 1 , 2 - ethandiol ), propanediols ( e . g ., 1 , 2 - propanediol , 1 , 3 - propanediol , 2 - ethyl - 2 - hydroxy - methyl - 1 , 3 - propanediol , ethylhydroxy - propanediol ( ehpd ), butanediols ( e . g ., 1 , 2 - butanediol , 1 , 3 - butanediol , 1 , 4 - butanediol ), pentanediols ( e . g ., 1 , 2 - pentanediol , 1 , 5 - pentanediol ), hexanediols ( e . g ., 1 , 6 - hexanediol , 2 , 5 - hexanediol , 1 , 2 - hexanediol ), heptanediols ( e . g ., 1 , 2 - heptanediol , 1 , 7 - heptanediol ), octanediols ( e . g ., 1 , 2 - octanediol , 1 , 8 - octanediol ); glycols and thioglycols , commonly employed in ink - jet inks , such as polyalkylene glycols such as polyethylene glycols ( e . g ., diethylene glycol ( deg ), triethylene glycol , tetraethylene glycol ), polypropylene glycols ( e . g ., dipropylene glycol , tripropylene glycol , tetrapropylene glycol ), polymeric glycols ( e . g ., peg 200 , peg 300 , peg 400 , ppg 400 ), and thiodiglycol ; and glycol ethers such as dipropylene glycol monobutyl ether , propylene glycol monobutyl ether , and ethylene glycol monobutyl ether , diethylene glycol monohexyl ether . the inks of the present invention optionally comprise 0 to about 2 . 0 wt % surfactant . more preferably , the inks comprise from about 0 . 1 to about 1 . 8 wt % surfactant , with a concentration from about 0 . 8 to about 1 . 5 wt % being the most preferred . in the practice of the invention , one or more surfactants may optionally be used . non - ionic surfactants , such as secondary alcohol ethoxylates ( e . g ., tergitol series available from union carbide co . ), non - ionic fluoro surfactants ( e . g ., fc170c available from 3m , non - ionic fatty acid ethoxylate surfactants ( e . g ., alkamul psmo - 20 available from rhone - poulenc ), non - ionic silicone surfactants ( e . g ., silwetl7600 available from osi specialties , inc . danbury , conn . ), and fatty amide ethoxylate surfactants ( e . g ., aldamide l203 available from rhone - poulenc ) are preferred , with secondary alcohol ethoxylates being the most preferred . in the practice of the invention , the surfactant serves to prevent color to color bleed by increasing the penetration of the inks into the print medium , and to improve the spread of the ink on polymer coated media . secondary alcohol ethoxylates are nonionic surfactants and are commercially available , for example , from union carbide co . ( houston , tex .) as the tergitol series , such as tergitol 15 - s - 5 and tergitol 15 - s - 7 . the secondary alcohol ethoxylates contain ( a ) an aliphatic chain having a prescribed number of carbon atoms in the chain , and ( b ) a prescribed number of ethoxylated units . these ethoxylates are commercially available as mixtures of ethoxylates , and so are described in terms of the predominance of a given compound . secondary alcohol ethoxylates suitably employed in the practice of the invention predominantly have from about 12 to about 18 carbon atoms in the aliphatic chain , while the number of ethoxylated units is predominantly in the range of from about 4 to about 8 units . thus , “ tergitol 15 - s - 5 ” represents a secondary alcohol ethoxylate surfactant predominantly having about 15 carbons in its aliphatic chain and about 5 ethoxylated units . tergitol 15 - s - 5 and tergitol 15 - s - 7 are the preferred surfactants . the inks of the present invention optionally comprise 0 to about 1 . 5 wt % buffer . more preferably , the inks comprise from about 0 . 1 to about 0 . 5 wt % buffer , with a concentration from about 0 . 1 to about 0 . 3 wt % being the most preferred . buffers employed in the practice of the invention to modulate ph can be organic - based biological buffers or inorganic buffers , preferably , organic - based . further , the buffers employed should maintain a ph ranging from about 3 to about 9 in the practice of the invention , preferably about 6 . 5 to about 8 and most preferably from about 7 . 5 to 8 . 5 . examples of preferably - employed buffers include trizma base , available from companies such as aldrich chemical ( milwaukee , wis . ), 4 - morpholineethanesulfonic acid ( mes ), b - hydroxy4 - morpholinepropanesulfonic acid ( mopso ), and 4 - morpholinepropanesulfonic acid ( mops ). the inks of the present invention optionally comprise 0 to about 1 . 5 wt % metal chelator . more preferably , the inks comprise from about 0 . 1 to about 0 . 5 wt % metal chelator , with a concentration from about 0 . 1 to about 0 . 3 wt % being the most preferred . metal chelators employed in the practice of the invention are used to bind transition metal cations that may be present in the ink . examples of preferably - employed metal chelators include : ethylenediaminetetraacetic acid ( edta ), diethylenetriaminepentaacetic acid ( dtpa ), trans - 1 , 2 - diaminocyclohexanetetraacetic acid ( cdta ), ( ethylenedioxy ) diethylenedinitrilotetraacetic acid ( egta ), or other chelators that can bind transition metal actions . more preferably , edta , and dtpa ; and most preferably edta in its disodium salt form is employed in the practice of the invention . the inks of the present invention optionally comprise 0 to about 1 . 5 wt % biocide . more preferably , the inks comprise from about 0 . 1 to about 0 . 5 wt % biocide , with a concentration from about 0 . 1 to about 0 . 3 wt % being the most preferred . any of the biocides commonly employed in ink - jet inks may be employed in the practice of the invention , such as nuosept 95 , available from huls america ( piscataway , n . j . ); proxel gxl , available from zeneca ( wilmington , del . ); and glutaraldehyde , available from union carbide company ( bound brook , n . j .) under the trade designation ucarcide 250 . proxel gxl is the preferred biocide . the specific ink set disclosed herein is expected to find commercial use in ink - jet color printing . a pyrazolone azomethine dye dye of the present invention , is synthesized as shown below : the desired hindered phenylenediamine is made by treating 2 , 5 - dimethyl - 1 , 4 - phenylenediamine with methyl - 3 - chloropropanante and hydrolyzing the resulting ester to the acid . in the above formula , the pyrazolone azomethine dye [ 4 -( 3 - methyl - 4 -) 4 -( n , n - di -( ethylsulfonic acid ) amino )- 1 - phenylimino )- 5 - oxo - 2 - pyrazolin - yl )- benzoic acid ] was prepared by adding 0 . 6 grams of potassium persulfate to a stirred mixture of 4 -( 3 - methyl - 5 - oxo - 2 - pyrazolin - 1 - yl )- benzoic acid ( 1 mmol ), n , n - di - ethylsulfonic acid )- 1 , 4 - phenylenediamine ( 0 . 25 g ), methanol ( 10 ml ), and sodium carbonate in water ( 5 %; 20 ml ). the mixture was stirred for about 40 minutes and then additional water ( 70 ml ) was added . the pyrazolone azomethine dye was collected by filtration , dried and recrystallized with methanol or ethanol .	2

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.