Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
fig1 a and 1b are cross - sections of a setting tool 1 , a liner assembly 100 , and a wiper assembly 150 , according to one embodiment of the present invention . the setting tool 1 , liner assembly 100 , and wiper assembly 150 may be run into a wellbore using a run - in string 685 ( see fig6 ). the run - in string 685 may include a string of tubulars , such as drill pipe , longitudinally and rotationally coupled by threaded connections . the liner assembly 100 may include an expandable liner hanger 105 , a polished bore receptacle ( pbr ) 110 , one or more adapters 115 , and a liner string 125 . the setting tool 1 may be operable to radially and plastically expand the liner hanger 105 into engagement with a casing or liner string 305 ( see fig3 a ) previously installed in the wellbore . non - sealing members of the setting tool 1 and liner assembly 100 may be made from a metal or alloy , such as steel or stainless steel . alternatively , the pbr 110 may be disposed between the liner hanger and the run - in string . the setting tool 1 may include a connector sub 2 , a mandrel 3 , one or more piston assemblies 10 a , b , an expander assembly 25 , a latch assembly 50 , an isolation valve 200 , and a seal assembly 75 . the connector sub 2 may be a tubular member including a threaded coupling for connecting to the run - in string and a longitudinal bore therethrough . the connector sub 2 may also include a second threaded coupling engaged with a threaded coupling of the mandrel 3 . one or more fasteners , such as set screws may secure the threaded connection between the connector sub 2 and the mandrel 3 . the mandrel 3 may be a tubular member having a longitudinal bore therethrough and may include one or more segments connected by threaded couplings . the piston assemblies 10 a , b may include pistons 11 a , b , sleeves 12 - 14 , caps 15 a , b , inlets 16 a , b , outlets 17 a , b , and ratchet assembly 18 . the pistons 11 a , b may each be t - shaped annular members . an inner surface of each piston 11 a , b may engage an outer surface of the mandrel 3 and may include a recess having a seal , such as an o - ring disposed therein . the inlets 16 a , b may be formed radially through a wall of the mandrel 3 and provide fluid communication between a bore of the mandrel 3 and first sides of the pistons 11 a , b . the sleeves 12 , 13 may be longitudinally coupled to the pistons 11 a , b by threaded connections . seals , such as o - rings , may be disposed between the pistons 11 a , b and the sleeves 12 , 13 . each of the sleeves 12 - 14 may be a tubular member having a longitudinal bore formed therethrough and may be disposed around the mandrel , thereby forming an annulus therebetween . the caps 15 a , b may be annular members , disposed around the mandrel , and longitudinally coupled thereto by a threaded connection . the caps 15 a , b may also be disposed about a shoulder formed in or disposed on an outer surface of the mandrel 3 . seals , such as o - rings , may be disposed between the caps 15 a , b and the mandrel 3 and between the caps 15 a , b and the sleeves 12 , 13 . an end 12 a of the sleeve 12 may be exposed to an exterior of the setting tool 1 . the end 12 a of the sleeve 12 may further include a profile formed therein or fastened thereto by a threaded connection . the profile may mate with a corresponding profile formed on an outer surface of the ratchet assembly 18 , thereby longitudinally coupling the ratchet 18 and the sleeve 12 when the pistons are actuated . the sleeve profile may engage the ratchet profile by compressing a spring , such as a c - ring . the c - ring may then expand to lock in a groove of the sleeve profile . teeth formed on inner and outer surfaces of a lock ring of the ratchet assembly 18 respectively engage corresponding teeth formed on an outer surface of the mandrel 3 and an inner surface of a ring housing , thereby longitudinally locking the sleeve 12 and thus the expander assembly 25 once the sleeve 12 engages the ratchet assembly 18 . the outlet 17 a may be formed through an outer surface of the piston 11 a and may provide fluid communication between a second side of the piston 11 a and the exterior of the setting tool 1 . the sleeves 13 , 14 may be longitudinally coupled to the piston 11 b by a threaded connection . the outlet 17 b may be formed through a wall of the sleeve 14 and may provide fluid communication between a second side of the piston 11 b and the exterior of the setting tool 1 . an end 14 a of the sleeve 14 may be longitudinally coupled to an expander assembly 25 by a threaded connection and one or more set screws . the sleeve 14 may also be temporarily longitudinally coupled to the mandrel at 14 b by one or more frangible members , such as shear screws . the expander assembly 25 may include a body 26 , upper cone retainer 27 , a plurality of cones 28 a , b , cone base 29 , lower cone retainer 30 , sleeve 31 , and shoe 32 , pusher 33 , and one or more frangible members , such as shear screws 34 . the expander assembly 25 may be operable to radially and plastically expand the hanger 105 into engagement with a previously installed liner or casing . the expander assembly 25 may be driven through the expandable hanger 105 by the pistons 11 a , b . the pusher 33 may longitudinally coupled to the sleeve 14 by a threaded connection and one or more fasteners , such as set screws . the pusher 33 may be longitudinally coupled to the body 26 by the shear screws 34 . the cones 28 a , b may each include a lip at each end thereof in engagement with respective lips formed at a bottom of the upper retainer 27 and a top of the lower retainer 30 , thereby radially coupling the cones to the retainers . an inner surface of each cone may be inclined for mating with an inclined outer surface of the cone base 29 , thereby holding each cone radially outward into engagement with the retainers . the body 26 may be tubular , disposed along the mandrel 3 , and longitudinally movable relative to the mandrel . the upper retainer 27 may be longitudinally coupled to the body 26 by a threaded connection and one or more fasteners , such as set screws . the retainers , sleeve , and shoe may be disposed along the body . the upper retainer 27 may abut the cone base 29 and the cones 28 a , b . the cones may abut the lower retainer 30 . the lower retainer 30 may abut the sleeve 31 and the sleeve 31 may abut the shoe 32 . the shoe 32 may be longitudinally coupled to the body 26 by a threaded connection and one or more fasteners , such as set screws . in operation ( see fig3 c ), movement of the sleeve 14 longitudinally toward the upper retainer 27 may fracture the shear screws 34 since the body 26 may be retained by engagement of the cones 28 a , b with a top of the liner hanger 105 . failure of the shear screws 34 may free the pusher 33 for relative longitudinal movement toward the upper retainer until a bottom of the pusher abuts a top of the upper retainer . continued movement of the sleeve 14 may then push the cones 28 a , b through the liner hanger 105 , thereby expanding the liner hanger 105 into engagement with the previously installed casing / liner 305 . when removing the setting tool 1 ( fig3 d ), a top of the override 59 may engage a bottom of the body 26 , thereby carrying the expander assembly 25 with the mandrel 3 . the expandable liner hanger 105 may include a tubular body made from a ductile material , such as a metal or alloy , such as steel or stainless steel . the hanger may include one or more seals 105 a disposed around an outer surface of the body . the seals 105 a may be made from a soft material , such as lead or a polymer , such as an elastomer . the hanger may have teeth 105 b embedded in the one or more of the seals 105 a for engaging an inner surface of the previously installed casing / liner and / or supporting the seals 105 a . alternatively , a hard material 705 b ( see fig7 ) may be disposed along an outer surface of the hanger and / or the seals 105 a to penetrate an inner surface of the previously installed casing or liner , thereby securing the hanger 105 to the casing or liner . the hard material may be a ceramic , such as a carbide , such as tungsten carbide and disposed on the seals as dust and / or disposed on the hanger as teeth or blades . the liner assembly 100 may be longitudinally and rotationally coupled to the mandrel 3 by the latch assembly 50 . the latch assembly 50 may include a piston 51 , a stop 52 , a release 53 , a collet 54 , a cap 55 , a retainer 56 , a biasing member , such as a spring 57 , one or more frangible members , such as shear screws 58 , an override 59 , a body 60 , one or more fasteners 61 a , b , and a catch 62 . alternatively , the latch assembly 50 may include dogs ( see dogs 77 ) instead of a collet . the override 59 and the body 60 may each be tubular , have a bore therethrough , and include a threaded coupling at each end . the override 59 may be longitudinally and rotationally coupled to the mandrel 3 by one of the threaded couplings at a top thereof and one or more fasteners , such as set screws , and longitudinally and rotationally coupled to the body 60 by one of the threaded couplings and one or more fasteners , such as set screws 61 a . the body 60 may be longitudinally coupled to a seat 95 by one of the threaded couplings at a bottom thereof . seals , such as o - rings , may be disposed between the override 59 and the mandrel 3 , between the override and the body 60 , and between the body and the seat 95 . the release 53 may be longitudinally and rotationally coupled to the override 59 by a threaded connection and one or more frangible members ( not shown ), such as shear screws . the threaded connection may be oppositely oriented ( i . e . left - hand ) relative to other threaded connections of the setting tool 1 . the release 53 may be longitudinally biased away from the override 59 by engagement of the spring 57 with fasteners 61 b . the collet 54 may have a plurality of fingers each having a profile formed at a bottom thereof . the fingers 54 f may engage a corresponding profile formed in an inner surface of the adapter 115 . the collet 54 , case 56 , and cap 55 may be longitudinally movable relative to the body 60 between the stop 52 and a top of the piston 51 . when weight of the liner assembly 100 is applied to the collet 54 , the collet may move downward along the body 60 until the fingers seat against a profile 95 a formed in a top of the seat 95 , thereby longitudinally coupling the liner assembly 100 to the setting tool 1 . keys 53 k and keyways may be formed in an outer surface of the release 53 . the keys 53 k and keyways may engage respective keyways and keys 115 k formed in a top of the adapter 115 , thereby rotationally coupling the liner assembly 100 and the setting tool 1 . the piston 51 may be fluidly operable to release the fingers 54 f when actuated by a predetermined pressure . the piston 51 may be longitudinally coupled to the body 60 by the shear screws 58 . once the liner hanger 105 has been expanded into engagement with the casing / liner 305 ( see fig3 c ) and weight of the liner assembly is supported by the liner hanger 105 and / or setting the liner 125 onto a bottom of the wellbore 300 , fluid pressure may be increased . the fluid pressure may push the piston 51 and fracture the shear screws 58 , thereby releasing the piston 51 . the piston 51 may then move upward toward the collet 51 until the piston 51 abuts a bottom of the collet 54 . the piston 51 may continue upward movement while carrying the collet 54 ( and fingers 54 f ), case 56 , and cap 55 upward until a bottom of the release abuts the fingers 54 f , thereby pushing the fingers 54 f radially inward . the catch 62 may be a split ring biased radially inward and disposed between the collet 54 and the case 56 . the body 60 may include a recess formed in an outer surface thereof . during upward movement of the piston 51 and members 54 - 56 , the catch 62 may align and enter the recess , thereby forming a downward stop preventing reengagement of the fingers 54 f . movement of the piston and members 54 - 56 may continue until the cap 55 abuts the stop 52 , thereby ensuring complete disengagement of the fingers 54 f . in the event that the liner assembly 100 becomes stuck in the wellbore 300 during run - in , the override 59 may be operated to release the fingers 54 f from the liner assembly 100 . the override 59 may be operated by setting down weight of the run - in string 685 onto the liner assembly 100 , thereby moving the collet 54 upward along the body 60 and the fingers 54 f from engagement with the profile 95 a . the run - in string may then be rotated , thereby rotating the override , fracturing the shear screws , and freeing the release from the override . the spring 57 may then move the release 53 toward the fingers 54 f until the release 53 disengages the fingers 54 f from the adapter . the seal assembly 75 may include a lock 76 , a plurality of dogs 77 , dog retainer 78 , a cap 79 , fasteners , such as screws 80 , a catch 81 , a body 82 and one or more seal stacks 83 a , b . each of the seal stacks 83 a , b may include first and second end adapters ( not shown ), one or more first seals ( not shown ), a center adapter ( not shown ), and one or more second seals ( not shown ). the first seals may be directional ( i . e ., chevron rings ), and may be disposed between the first end adapter and the center adapter . the second seals may be directional and disposed between the center adapter and the second end adapter with an orientation opposing the first seals . the body 82 may be tubular , have a bore therethrough , and include a threaded coupling at each end . the body 82 may be longitudinally coupled to the housing 214 by one of the threaded couplings at a top thereof and longitudinally coupled to the catch 81 by one of the threaded couplings and one or more fasteners , such as set screws . a seal , such as an o - ring , may be disposed between the body 82 and the catch 81 . the dogs 77 may be radially movable between an extended position and a retracted position . the dogs 77 may be disposed in respective recesses formed in the dog retainer 78 and a lip of each dog may engage a respective lip of the retainer 78 in the extended position , thereby keeping the dogs 77 disposed in the recesses . the dogs 77 may be held in the extended position by abutment of protrusions of a profile formed in an inner surface of the dog with respective protrusions of a profile formed in an outer surface of the lock 76 . the dogs 77 may engage a groove formed in an inner surface of the adapter 115 in the extended position , thereby longitudinally coupling the dogs and the adapter . each screw 80 may be received by a threaded opening formed through the retainer 78 . an end of each screw 80 may extend into a respective slot formed through the lock 76 , thereby coupling the lock and the retainer while allowing limited longitudinal movement therebetween . the cap 79 may be longitudinally coupled to the block retainer 78 by a threaded connection . inner seal stack 83 a may be disposed radially between the dog retainer and the body and longitudinally between a lower surface of the cap and a shoulder formed in the dog retainer . outer seal stack 83 b may be disposed radially between the dog retainer and the adapter 115 and longitudinally between a bottom of the cap and a shoulder formed in the dog retainer . the seal stacks 83 a , b may fluidly isolate a bore of the liner 125 from an annulus formed between the setting tool 1 and the rest of the liner assembly 100 . to release the lock 76 ( see fig3 d ), the body 82 may be moved upward carrying the catch 81 toward the lock 76 until a top of the catch 81 abuts a bottom of the lock and pushes the lock 76 upward toward the dog retainer 78 until recesses in the lock profile align with protrusions in the dog profile . a lower portion of the body 82 may include one or more grooves formed in an outer surface thereof for pressure equalization as the catch moves toward the lock . alignment of the profiles allows the dogs to move from the extended position to the retracted position , thereby freeing the dogs from the adapter 115 . the setting tool 1 may further include the seat 95 . the seat 95 may have a tapered inner surface 95 s for receiving a ball or plug ( not shown ) and one or more ports 95 p formed radially therethrough . the ports 95 p may be isolated from the setting tool - adapter annulus by seals , such as o - rings , disposed between the seat and the adapter 115 and longitudinally straddling the ports 95 p . the ball or plug may be deployed as a safeguard or in response to failure of the isolation valve 200 . the ball may be released from the surface a predetermined distance behind the top plug ( se fig3 a ) so that the ball may be substantially pumped to the seat 95 by the displacement fluid ( the ball may have to free fall a small depth once the top plug has seated against the wiper ). alternatively , should the isolation valve 200 fail , a plug may be delivered to the seat via wireline ( not shown ) or the ball may be deployed after the top plug has seated by free - falling to the seat 95 . as with the isolation valve 200 , landing of the ball or plug may fluidly isolate the mandrel bore from the liner bore . when the setting tool is being removed from the liner assembly 100 and the seat is removed from the liner assembly , the port seals may no longer engage a sealing surface due to the larger inside diameter of the previously installed casing or liner , thereby opening the ports 95 p . the ports 95 p may then provide fluid communication between the setting tool bore and the wellbore , allowing drainage of the displacement fluid from the setting tool 1 and the run - in string 685 as the setting tool 1 travels to the surface . a bottom of the seat 95 may be longitudinally coupled to the housing 201 by a threaded connection . the wiper assembly 150 may include a body 151 , a wiper 152 , and one or more frangible members , such as shear screws 153 . the body 151 may be longitudinally coupled to the catch 81 by the shear screws 153 . the body 151 may be tubular and have a profile 151 p formed along an inner surface thereof for receiving a top plug 320 ( see fig3 a ). the top plug 320 may include a latch for engaging the profile 151 p . additionally , the wiper assembly 150 may be a top wiper assembly and the setting tool may further include a bottom wiper assembly ( not shown ). the bottom wiper assembly may be longitudinally coupled to the body 151 by shear screws and have an inner diameter less than an inner diameter of the top wiper assembly 150 . in this manner a bottom plug ( not shown ) may be deployed before the cement is pumped for isolating the cement from circulation fluid and may be pumped through the body 151 and seat in the bottom wiper assembly . the bottom plug may include a diaphragm or valve . fig2 is a cross - section of the isolation valve 200 . the isolation valve may be longitudinally coupled to the mandrel 3 by a threaded connection . the isolation valve may include one or more housings 201 , 208 , 211 , 214 , one or more seals , such as o - rings 202 , 204 , 207 , 212 , one or more frangible members , such as shear screws 203 and rupture disk 216 , a piston 205 , a retaining rod 206 , one or more nuts 209 , one or more locator rings 210 , a valve member such as a flapper 213 , and one or more biasing members , such as springs 215 , 218 , and one or pins 217 , 219 . alternatively , the valve member may be a ball ( not shown ). the piston 205 may be longitudinally coupled to the flapper 213 via the retaining rod 206 . the piston 205 may be longitudinally coupled to the retaining rod 206 via the pins 217 . the piston 205 may be biased away from the flapper 213 by spring 215 and longitudinally and rotationally coupled to the housing 208 by shear screws 213 . the retaining rod 206 may hold the flapper 213 in the open position . the flapper 213 may be biased towards the closed position by the spring 218 disposed on a mount , such as the pin 219 . a chamber housing the piston 205 and the spring 215 may be sealed at the surface with air at atmospheric pressure . in operation , when it is desired to close the flapper 213 , pressure may be increased in bores of the housings 201 , 208 , 211 , 214 until a predetermined pressure is reached . the rupture disk 216 may then fracture , thereby providing fluid communication between the housing bores and a bottom of the piston 205 . the resulting fluid force may fracture the shear screws 203 and ( along with the spring 215 ) move the piston 205 away from the flapper 213 , thereby allowing the flapper 213 to close . fig3 a - d illustrate installation of the liner assembly 100 . in operation , the setting tool 1 , liner assembly 100 , and wiper assembly 150 may be run into the wellbore 300 until the liner hanger 105 overlaps an end of the previously installed casing or liner 305 distal from the surface . a bottom of the liner 125 may or may not rest on a bottom of the wellbore . prior to run - in , fluid , such as drilling mud , may be circulated to ensure that all of the cuttings have been removed from the wellbore . a surge reduction valve ( not shown ), if used , may be closed . circulation may then be established by pumping fluid , such as drilling mud , down the run - in string and up the liner annulus . the liner assembly 100 may be reciprocated and / or rotated during circulation . if auto - fill equipment ( not shown ) is used , it may be released . if a bottom wiper assembly ( not shown ) is used , then the bottom plug may be launched . cement slurry 315 may then be pumped from the surface into the run - in string . the liner assembly 100 may be reciprocated and / or rotated during injection of the cement . a spacer fluid ( not shown ) may be pumped in ahead of the cement 315 . once a predetermined quantity of cement 315 has been pumped , a top plug 320 may be pumped down the run - in string using a displacement fluid 310 , such as drilling mud . the bottom plug may seat in the bottom wiper assembly , free the bottom wiper assembly from the setting tool , and land in the float collar / shoe . the diaphragm may then rupture or the valve may open due to a density differential between the cement and the circulation fluid and / or increased pressure from the surface . pumping of the displacement fluid 310 may continue and the top plug 320 may seat in the wiper body 151 , thereby closing the bore through the wiper body 151 ( fig3 a ). the displacement fluid 310 may have a density substantially less than the density of the cement , thereby placing the liner 125 in compression . a latch of the plug 320 may engage the profile 151 p and hydraulic pressure may fracture the shear screws 153 , thereby freeing the wiper assembly 150 and the plug 320 . the wiper / plug 150 , 320 may then be pumped down the liner 125 , thereby forcing the cement 315 through the liner and out into the liner annulus . pumping may continue until the wiper / plug 150 , 320 seat against a landing or float collar ( not shown ), thereby indicating that the cement 315 is in place in the liner annulus . the pressure may then be increased until the rupture disk 216 in the isolation valve 200 fractures , thereby moving the piston 205 and allowing the flapper 213 to close ( fig3 b ). the flapper 213 may isolate the mandrel bore from the liner bore . pressure may then be increased to fracture the shear screws 14 b and operate the pistons 11 a , b , thereby pushing the expander assembly 25 through the expandable liner hanger 105 ( fig3 c ). once the hanger 105 is expanded into engagement with the previously installed casing or liner 305 , the latch assembly 50 may be released from the liner assembly 105 and the setting tool 1 removed ( fig3 d ). before retrieval to the surface , the setting tool 1 may be raised and fluid , such as drilling mud , may be reverse circulated ( not shown ) to remove excess cement above the hanger before the cement sets . fig4 is a cross - section of an isolation valve 400 , according to another embodiment of the present invention . the isolation valve 400 may be used instead of the isolation valve 200 . the isolation valve 400 may include one or more housings 401 , 409 , 412 , 416 , 419 , 422 , one or more seals , such as o - rings 402 , 403 , 405 , 408 , 420 , one or more plugs 404 , one or more frangible members , such as shear screws 413 , one or more pistons 406 , 410 , an actuator 414 , a retaining rod 415 , a choke 407 , one or more nuts 417 , one or more locator rings 418 , a valve member , such as a flapper 421 , and one or more biasing members , such as springs 411 , 424 , and 218 ( see fig2 b ), one or more check valves 423 , and one or pins 217 , 219 ( see fig2 a and 2b ). a top of the piston 405 may be in fluid communication with a bore of the housings 401 , 416 via fluid path 430 defined between the housings 401 , 416 . a chamber housing spring 411 may be in fluid communication with the liner annulus via vent 432 . a hydraulic fluid , such as oil , may be disposed between a shoulder 406 s of the piston 406 and a top of the piston 410 . the housing 409 may include fluid ports 409 a , b longitudinally formed therethrough . the fluid ports 409 a , b may provide limited fluid communication between an upper hydraulic chamber formed between the shoulder 406 s and a top of the housing 409 and a lower hydraulic chamber formed between a bottom of the housing 409 and the top of the piston 410 . the check valve 423 may be disposed in the path 409 b and operable to prevent flow of the hydraulic fluid from the upper hydraulic chamber to the lower hydraulic chamber and allow flow from the lower hydraulic chamber to the upper hydraulic chamber . the choke 407 may be disposed in the path 409 a and operable to restrict hydraulic flow from the upper hydraulic chamber to the lower hydraulic chamber . the choke 407 may also restrict flow from the lower hydraulic chamber to the upper hydraulic chamber but this restriction may be negated by the open check valve 423 . the piston 410 may be longitudinally coupled to the piston 406 by incompressibility of the hydraulic fluid . a bottom of the piston 410 may be in fluid communication with the liner annulus via the vent 432 . the piston 410 may be biased toward the housing 409 by the spring 411 . the actuator 414 may be longitudinally coupled to the flapper 421 via the retaining rod 415 . the actuator 414 may be longitudinally coupled to the retaining rod 415 via the pins 217 . the retaining rod 415 may hold the flapper 421 in the open position . the flapper 421 may be biased towards the closed position by the spring 218 disposed on a mount , such as the pin 219 . the actuator 414 may be longitudinally coupled to the housing 416 by the shear screws 413 . fig4 a - c illustrate operation of the isolation valve 400 . once pressure in the bore of the housings 401 , 416 exceeds pressure in the liner annulus by an amount sufficient to overcome the bias of the spring 411 ( threshold pressure ), the piston 406 begins to move longitudinally downward toward the housing 409 ( fig4 a ). since movement of the piston is dampened by the choke 407 , the increased pressure must be sustained for a predetermined period of time , else once the pressure is reduced , the biasing member will return the piston 406 to the position of fig4 a . once sustained threshold pressure has been applied to the top of the piston 406 , a bottom of the piston 406 abuts a top of the actuator 414 and fractures the shear screws 413 ( fig4 b ). pressure may be then reduced to the annulus pressure or relieved at the surface , thereby allowing the spring 411 to return the piston 406 to the position of fig4 a . the spring 424 may then longitudinally move the actuator 414 and retaining rod 420 longitudinally upward away from the flapper 421 , thereby releasing the flapper and allowing the spring 218 to close the flapper ( fig4 c ). the choke 407 may time the movement of the piston 406 so that threshold pressure must be sustained for the piston to reach the actuator 414 . for example , when running the liner assembly 100 into the wellbore , a surge pressure may exceed the threshold pressure but may not be sustained to fully move the piston 406 . however , once the top plug 320 seats against the wiper 315 , then the threshold pressure may be applied for the sustained period . if pressure is relieved from the run - in string at the surface , the flapper 421 may allow annulus pressure to also be relieved . however , once pressure is reapplied to set the liner hanger 105 , the flapper 421 will close and isolate the liner 125 from setting pressure applied to the setting tool 1 . fig4 d illustrates an alternative embodiment of the isolation valve 400 . in this alternative , the piston 406 is initially longitudinally restrained by one or more frangible members , such as shear pins 455 . the shear pins 455 may keep the piston 406 from moving until a predetermined pressure has been reached . the shear pins 455 may avoid unintentional operation of the piston 406 during circulation and cementing operations . fig5 is a cross - section of an isolation valve 500 , according to another embodiment of the present invention . the isolation valve 500 may be used instead of the isolation valve 200 . the isolation valve may include one or more housings 501 , 510 , 512 , 513 , 518 , 521 , 524 one or more seals , such as o - rings 503 , 504 , 506 , 509 , 522 one or more plugs 505 , one or more frangible members , such as shear screws 514 , one or more pistons 507 , 511 , an actuator 515 , 516 , a retaining rod 517 , a choke 508 , one or more nuts 519 , one or more locator rings 520 , a valve member such as a flapper 523 , and one or more biasing members , such as springs 502 , 526 , and 218 ( see fig2 b ), one or more check valves 525 , and one or pins 217 , 219 of ( see fig2 a and 2b ). in operation , the spring 502 is used to slowly engage a release mechanism so the running of the liner and cementing of the liner can be completed before the valve closes . the actuator may include a head 516 and a ring 515 . the head 516 and the ring 515 may be longitudinally and rotationally coupled to the housing 518 by the shear screws 514 . the head 516 may be longitudinally coupled to the flapper 523 via the retaining rod 517 . the head 516 may be biased away from the flapper 523 by the spring 526 . the head 516 may be longitudinally coupled to the retaining rod 517 via the pins 217 . the retaining rod 517 may hold the flapper 523 in the open position . the flapper 523 may be biased towards the closed position by the spring 218 disposed on a mount , such as the pin 219 . a top of the piston 507 may be in fluid communication with a bore of the housings 501 , 518 via fluid path 530 defined between the housings 501 , 518 . a hydraulic fluid , such as oil , may be disposed between a shoulder 507 s of the piston 507 and a top of the piston 511 . the housing 510 may include fluid ports 510 a , b longitudinally formed therethrough . the fluid ports 510 a , b may provide limited fluid communication between an upper hydraulic chamber formed between the shoulder 507 s and a top of the housing 510 and a lower hydraulic chamber formed between a bottom of the housing 510 and the top of the piston 511 . the check valve 525 may be disposed in the path 510 b and operable to prevent flow of the hydraulic fluid from the upper hydraulic chamber to the lower hydraulic chamber and allow flow from the lower hydraulic chamber to the upper hydraulic chamber . the choke 508 may be disposed in the path 510 a and operable to restrict hydraulic flow from the upper hydraulic chamber to the lower hydraulic chamber . the choke 510 a may also restrict flow from the lower hydraulic chamber to the upper hydraulic chamber but this restriction may be negated by the open check valve 525 . the piston 511 may be longitudinally coupled to the piston 507 by incompressibility of the hydraulic fluid . the piston 507 may be biased longitudinally downward toward the housing 510 by the spring 502 . a chamber 535 between the housing 518 and the head 516 , a chamber 537 between the housings 513 , 518 , and a chamber 539 between the housing 512 and the piston 507 may be sealed at the surface with air at atmospheric pressure . in operation , once the isolation valve 500 is assembled , the spring 502 may begin to move the piston 507 longitudinally downward toward the flapper 523 . since movement of the piston 507 is dampened by the choke 508 , the piston 507 may require a predetermined period of time before a bottom of the piston 507 abuts a top of the ring 515 and fractures the shear screws 514 . the predetermined period may be selected so the liner assembly 100 may be run into the wellbore and cemented before the flapper 523 closes . alternatively , the spring 502 may be omitted and fluid pressure exerted on a top of the piston via flow path 530 may be used to operate the piston 507 . fig6 is a cross - section of an isolation valve 600 , according to another embodiment of the present invention . the isolation valve 600 may be used instead of the isolation valve 200 . the isolation valve 600 may include one or more housings 601 , 607 , 610 , 612 , 617 , 620 , 623 , 630 , a pick 602 , one or more seals , such as o - rings 604 , 605 , 608 , 611 , 621 , one or more plugs 606 , one or more frangible members , such as shear screws 613 and rupture disk 603 , one or more pistons 609 , an actuator 614 , 615 , a retaining rod 616 , one or more nuts 618 , one or more locator rings 619 , a valve member such as a flapper 622 , one or more biasing members , such as springs 624 , 218 ( see fig2 b ), one or pins 217 , 219 ( see fig2 a and 2b ), and an electronics package 650 . the actuator may include a head 615 and a ring 614 . the head 615 and the ring 614 may be longitudinally and rotationally coupled to the housing 617 by the shear screws 613 . the head 615 may be longitudinally coupled to the flapper 622 via the retaining rod 616 . the head 615 may be biased away from the flapper 622 by the spring 624 . the head 615 may be longitudinally coupled to the retaining rod 616 via the pins 217 . the retaining rod 616 may hold the flapper 622 in the open position . the flapper 622 may be biased towards the closed position by the spring 218 disposed on a mount , such as the pin 219 . an upper chamber between housings 601 and 630 , an intermediate chamber between a bottom of the housing 606 and a top of the piston 609 , and a lower chamber between a shoulder 609 s of the piston 609 and a top of the housing 612 may be sealed at the surface with air at atmospheric pressure . the housing 606 may have a first fluid port 606 a extending radially and longitudinally between a bore therethrough to the upper chamber . the rupture disk 603 may seal the first fluid port 606 a . the housing 606 may further have a second fluid port 606 b longitudinally extending therethrough between the upper and intermediate chambers . the housing 617 may have a vent 632 formed radially therethrough providing fluid communication between a bore formed therethrough and a chamber 635 between the housing 617 and the head 615 . the chamber 635 may be in fluid communication with a chamber 637 between the housings 612 , 617 via flow path 634 formed between ring 614 and housing 617 . fig6 a illustrates the electronics package 650 . the electronics package 650 may include a pressure sensor 652 , a signal amplifier 654 , a noise filter 656 , a signal detector 658 , a microprocessor 660 , a battery pack 662 , and a solenoid 664 . pressure pulses transmitted from the surface to the isolation valve 600 via the run - in string may be transformed by the pressure sensor 652 into an electrical signal . the electrical signal may then be amplified by the signal amplifier 654 and filtered by the noise filter 656 . the filtered signal may then be demodulated by the signal detector 658 into a format usable by the microprocessor 660 . the demodulated signal may be analyzed by the microprocessor 660 to determine if the signal matches a predetermined instruction signal for closing the flapper 622 . if so , then the microprocessor may energize the solenoid , thereby longitudinally moving the pick 602 to fracture the rupture disk 603 . the pick 602 may then be retracted from the fractured rupture disk 603 by a spring ( not shown ) or reversing polarity to the solenoid . once the rupture disk 603 has been fractured , circulation fluid from the bore of the isolation valve 600 may flow through the port 607 a into the upper chamber . fluid may then flow from the upper chamber through the port 607 b into the intermediate chamber , thereby moving the piston 609 longitudinally downward toward the flapper 622 . since lower chamber was sealed at the surface , minimal pressure may be exerted on the shoulder 609 s . the piston 609 may move until a bottom of the piston 609 abuts the ring 614 and fractures the shear screws 613 , thereby releasing the head 615 . the spring 624 may then move the head 615 ( and the rod 616 ) longitudinally upward away from the flapper 622 , thereby releasing the flapper . the spring 218 may then close the flapper 622 , thereby fluidly isolating the liner 125 from the setting tool 1 . the setting tool 1 may then be operated and the liner hanger 105 expanded . fig6 b illustrates surface equipment for generating pressure pulses . the pressure pulses may be generated at the surface using the displacement fluid 310 . the displacement fluid 310 may be stored in a surge tank 677 . the surge tank 677 may include a fluid barrier , such as a diaphragm 678 , separating a chamber of the tank 677 into a displacement fluid chamber and a gas chamber . a fluid line 684 may be in communication with a mud pump of the rig to fill the displacement fluid chamber . a gas line 682 may be in fluid communication with a gas source , such as a portable cylinder , and include a pressure regulator for filling and maintaining the gas chamber at a predetermined pressure . the gas 679 may be nitrogen . the pressure pulses may be applied and released from a bore of the run - in string 685 after the top plug 320 and the wiper 325 have landed in the float or landing collar . the pressure pulses may be generated by opening an inlet control valve , such as a solenoid operated ball valve 680 i , thereby providing fluid communication between the displacement fluid chamber of the surge tank 677 and the run - in string 685 . the valve 680 i may be electrically , pneumatically , or hydraulically operated . after a predetermined period of time , the valve 680 i may be closed while opening an outlet control valve 680 o , thereby relieving fluid pressure from the run - in string to a mud pit or tank ( not shown ) of the rig . control of the valves 680 i , o may be performed by a computer or programmable logic controller ( plc ) 690 located at the surface to generate the predetermined instruction signal to close the isolation valve 600 . fig6 c illustrates the computer / plc 690 . the computer / plc may be disposed in an operator interface ( not shown ), such as a console . the interface may include indicator lights r , g to provide visual feedback to the operator . a first light , such as a green light g , may indicate that the computer / plc is ready to transmit the instruction signal . the console may further include a pushbutton operable to signal the computer to begin transmission of the instruction signal . a second light , such as a red light r , may indicate that the computer is transmitting the instruction signal . the computer / plc 690 may be in electrical communication with solenoids of the valves 680 i , o . alternatively , instead of mud pulse , the electronics package 650 may include an electromagnetic ( em ) receiver or transceiver ( not shown ) or any other wireless telemetry system . an em telemetry system is discussed in u . s . pat . no . 6 , 736 , 210 , which is hereby incorporated by reference in its entirety . fig7 is a cross - section of a portion of a setting tool 700 and a liner assembly , according to another embodiment of the present invention . the remaining portion of the setting tool 700 and liner assembly may be similar to the setting tool 1 and liner assembly 100 except that the pbr 710 may be moved to between the expandable liner hanger and the run - in string and the isolation valve 200 may be omitted . the setting tool 700 may include a mandrel 703 , a piston 711 , a damping chamber 714 , a choke 716 , an atmospheric chamber 718 , a piston actuator , and an expander assembly 725 . the mandrel 703 may be a tubular member including a threaded coupling for connecting to the run - in string 685 and a longitudinal bore therethrough . although shown as one piece , the mandrel 703 may include a plurality of pieces connected by threaded connections and seals to facilitate manufacture and assembly thereof . the piston 711 may be a tubular member having a longitudinal bore therethrough . although shown as one piece , the piston 711 may include a plurality of pieces connected by threaded connections to facilitate manufacture and assembly thereof . the piston 711 may be disposed between inner and outer walls of the mandrel 703 . the piston 711 may include a head formed at a top thereof . one or more seals , such as o - rings , may be disposed between an inner surface of the head and the inner wall and between an outer surface of the head and the outer wall . the chambers 714 , 718 may be formed between the piston 711 and the outer wall of the mandrel 703 . the mandrel may include a partition dividing the chambers 714 , 718 . a seal , such as an o - ring may be disposed between the piston 711 and the partition . one or more chokes 716 may be disposed in the partition . the chokes 716 may provide limited fluid communication between the chambers 714 , 718 , thereby damping longitudinal movement of the piston . the chambers 714 , 718 may be sealed at the surface under atmospheric pressure . the damping chamber 714 may be filled with a hydraulic fluid , such as oil . the atmospheric chamber 718 may be filled with a gas , such as air . the expander assembly 725 may include an actuator 726 , one or more frangible members , such as shear screws 727 , a pusher 728 , a mandrel 729 , a collet 730 , a biasing member , such as a spring 731 , one or more retainers 732 , and a spacer 733 . the expander mandrel 729 may be tubular and disposed along an outer surface of the setting mandrel 703 so that the expander mandrel is longitudinally movable relative to the setting mandrel 703 . the expander mandrel may include a shoulder formed at a bottom thereof . the collet 730 may be disposed along an outer surface of the expander mandrel and include a base ring formed at a bottom thereof . the spring may be disposed between the base ring and the expander mandrel shoulder , thereby biasing the collet 730 longitudinally away from the expander mandrel shoulder . the collet 730 may include a plurality of radially split cones 730 c each extending longitudinally from the base ring . the cones 730 c may be radially split so that the cones may be radially movable between an expanded position ( shown ) and a retracted position . an inner surface of the cones 730 c may be held in the expanded position by abutment with the spacer 733 . an outer surface of the cones may abut the liner hanger 705 . a top of the cones 730 c may abut a bottom of the pusher 728 . the spacer 733 may be longitudinally coupled to the actuator 726 by one or more fasteners , such as screws . the pusher 728 may be longitudinally coupled to the actuator 726 by the shear screws 727 . the actuator 726 may be tubular and have a head formed at a top thereof . the actuator may further have one or more windows formed through a wall thereof . one of the retainers 732 may be disposed through each window . each retainer may be received by a groove formed in an outer surface of the expander mandrel and fastened to the expander mandrel . each retainer may also be disposed through a respective opening formed through a wall of the pusher . the retainers may be blocks and longitudinally couple the pusher to the mandrel . the windows may be sized to allow relative longitudinal movement of the actuator relative to the blocks should the shear screws fail . the collet 730 may have a recessed inner surface formed between the base ring and the cones 730 c for receiving a lower portion of the actuator and the spacer 733 should the shear screws fail . the bottom shoulder of the piston may also include a recessed inner surface for receiving an upper portion of the expander mandrel should the shear screws fail . the actuator head may abut the bottom shoulder of the piston 711 . in operation , longitudinal movement of the piston 711 may push the expander assembly 725 downward along the hanger 705 , thereby expanding the hanger into engagement with the previously set liner / casing . if the annulus between the hanger 705 and the liner / casing is sufficient , the hanger 705 may expand as forced by the expanded cones 730 c . however , if the annulus is insufficient , the reaction force may increase to fracture the shear screws 727 . as shown in fig7 b , the actuator 726 and the spacer 733 may then be free to move longitudinally relative to the rest of the expander assembly , thereby moving the spacer 733 from the inner surface of the cones and replacing the spacer 733 with the outer surface of the actuator 726 which may have a reduced outer diameter . the reduced outer diameter may allow the cones to move radially inward to the retracted position . movement of the actuator 726 may continue until a lower surface of the actuator head abuts a top of the pusher 728 , thereby resuming movement of the expander assembly 725 downward through the hanger 705 . the reduced outer diameter of the cones 730 c may reduce the expanded outer diameter of the hanger 705 which may suitable for the smaller annulus . as illustrated in fig7 c , after expansion of the liner hanger 705 into engagement with an existing casing 735 or at some other point during operation of the setting tool 700 , when the expander assembly 725 is removed from the liner assembly the cones 730 c are operable to collapse into an even further reduced outer diameter configuration . the spacer 733 may be releasably coupled to the actuator 726 by one or more frangible members , such as shear screws 734 . the cones 730 c , which are seated on the outer surface of the actuator 726 , may be forced against the end of the spacer 733 to shear the shear screws 734 and allow the cones 730 c to move relative to the actuator 726 . the cones 730 c may then be moved off of the actuator 726 outer surface until the cones 730 and the spacer 733 are seated on the outer surface of the mandrel 729 , thereby further reducing the outer diameter of the cones 730 c . in one embodiment , during retrieval of the expansion assembly 725 , a restriction , such as an inner diameter shoulder of a component of the liner assembly or a narrowed inner diameter portion of the existing casing 735 may engage the cones 730 c and obstruct passage theretherough . an upward or pull force applied to the run - in string and / or the mandrel 703 may cause a reaction force to be applied to the cones 730 c against the restriction . the reaction force may be transferred through the cones 730 c and applied to the spacer 733 until the shear screws 734 release engagement with the actuator 726 . the reaction force may then move the cones 730 c and the spacer 733 relative to the actuator 726 onto the outer surface of the mandrel 729 , thereby reducing the outer diameter of the cones 730 c and allowing the expander assembly 725 to be moved past the restriction . fig7 a is an enlarged view of the piston actuator . the piston actuator may include the electronics package 650 , one or more heating coils 706 , one or more ports 708 , one or more retainers , such as fusible rods 715 , and a plug 712 . the ports may provide fluid communication between the wellbore and a first chamber formed in the mandrel 703 . the plug may be disposed in a passage between the first chamber and a second chamber in communication with a top of the piston head . the second chamber may be sealed at the surface under atmospheric pressure and be filled with a gas , such as air . one or more seals , such as o - rings , may be disposed between each plug and the passage . each plug may be longitudinally restrained in the passage by a respective rod . in operation , when the electronics package detects an instruction signal from the surface , the microprocessor may supply electricity to the heating coil , thereby heating the rod . the increased temperature of the rod may weaken the rod until hydrostatic pressure exerted on a top of the plug fractures the rod , thereby freeing the plug . the plug may be pushed into the second chamber by wellbore fluid , thereby opening the passage . wellbore fluid may enter the second chamber through the open passage and exert hydrostatic pressure on the top of the piston head , thereby longitudinally moving the piston downward toward the expander assembly . the piston head may push the oil through the choke 716 and into the atmospheric chamber 718 , thereby controlling a rate of movement of the piston . as discussed above , movement of the piston may operate the expander assembly 725 , thereby setting the hanger 705 . cementing may occur as discussed above in relation to fig3 a - 3d . since the mud pulse signal can be varied , several difference devices can be operated down hole each with a unique signal , e . g . a surge reduction valve ( see u . s . pat . no . 6 , 834 , 726 , which is hereby incorporated by reference in its entirety ) that allows for faster run in of the liner before cementing can be closed prior to cementing ; setting the liner hanger with a vacuum operated jack system — note several vacuum chambers can be operated in series if the hydrostatic pressure is too low for a single vacuum chamber jack to set the liner hanger ; releasing the running tool from the liner hanger after the liner hanger is set ; etc . fig8 a illustrates a radio - frequency identification ( rfid ) electronics package 800 , according to another embodiment of the present invention . fig8 b illustrates an active rfid tag 850 a . fig8 c illustrates a passive rfid tag 850 p . the rfid electronics package 800 may be used instead of the electronics package 650 in the isolation valve 600 and / or the electronics package 750 in the setting tool 700 . the electronics package 800 may communicate with a passive rfid tag 850 p or an active rfid tag 850 a . either of the rfid tags 850 a , p may be embedded in the top plug 320 so that the electronics package 800 may detect passage of the top plug 320 thereby . alternatively , either of the rfid tags may be embedded in a ball , plug , bar or some other device used to initiate the release of a downhole valve . the rfid electronics package 800 may include a receiver 802 , an amplifier 804 , a filter and detector 806 , a transceiver 808 , a microprocessor 810 , a pressure sensor 812 , battery pack 814 , a transmitter 816 , an rf switch 818 , a pressure switch 820 , and an rf field generator 822 . if the active rfid tag 850 a is used , the components 816 - 822 may be omitted . if a passive tag 850 p is used , once the isolation valve 600 or setting tool 700 is deployed to a sufficient depth in the wellbore , the pressure switch 820 may close . the pressure switch may remain open at the surface to prevent the electronics package 800 from becoming an ignition source . the microprocessor may also detect deployment in the wellbore using pressure sensor 812 . the microprocessor 810 may delay activation of the transmitter for a predetermined period of time to conserve the battery pack 814 . the microprocessor may then begin transmitting a signal and listening for a response . once the top plug is pumped into proximity of the transmitter 816 , the passive tag 850 p may receive the signal , convert the signal to electricity , and transmit a response signal . the electronics package 800 may receive the response signal , amplify , filter , demodulate , and analyze the signal . if the signal matches a predetermined instruction signal , then the microprocessor 810 may monitor pressure for a predetermined threshold indicative that the top plug 320 has seated against the wiper and / or wait a predetermined period for the top plug to seat . once the predetermined threshold is detected and / or the time period has passed , the microprocessor may close the isolation valve or operate the setting tool . if the active tag 850 a is used , then the tag 850 a may include its own battery , pressure switch , and timer so that the tag 850 a may perform the function of the components 816 - 822 . since the tags send out unique signals , multiple receivers may be used . for example one receiver may be used to close a surge reduction valve ; another receiver may start a sequence leading to the operation of the setting tool 700 to set the liner hanger and release the running tool . fig9 a is a sectional view of an expandable liner system 900 disposed in a wellbore 910 proximate a lower end of a string of casing 920 , according to another embodiment of the present invention . the system 900 may include a liner assembly 925 and an expander assembly 950 . the expandable liner system 900 may be run - into the wellbore 910 using the run - in string 685 . the wellbore section below the casing 920 may be drilled without an underreamer . the liner assembly 925 may be set in the casing 920 by positioning an upper portion of the liner assembly 925 in an overlapping relationship with a lower portion of the casing 920 . thereafter , the expansion assembly 950 may be employed to expand the liner assembly 925 into engagement with the casing 920 and the surrounding wellbore 910 . the liner assembly 925 may include a tubular section 930 at an upper end thereof and a shaped or a corrugated liner section 935 disposed at the lower end thereof . it must be noted that the shape or corrugation of the liner section 935 is optional such that the liner section 935 is substantially cylindrical . alternatively , the corrugated liner section 935 may be located at any position along the liner assembly 925 . a cross section of a suitable corrugated liner section may be found at fig2 g of u . s . pat . no . 7 , 121 , 351 , which is herein incorporated by reference in its entirety . the corrugated liner section 935 and the substantially cylindrical liner section 930 may be connected by a threaded connection or may be one continuous tubular body . the corrugated liner section 935 may be fabricated from a drillable material , such as aluminum or a pliable composite . the corrugated liner section 935 may have a folded wall having an initial inner diameter which may be reformed to define a larger second folded inner diameter and subsequently may be expanded to an even larger unfolded diameter . the corrugated liner section 935 may be folded or deformed prior to insertion into the wellbore 910 , to a non - tubular - shape , such as a hypocycloid , so that grooves are formed along the length of the corrugated liner section 935 . the grooves may be symmetric or asymmetric . the liner assembly 925 may further include a shoe 940 at the lower end thereof . the shoe 940 may be longitudinally coupled to the corrugated portion , such as by a threaded connection . the shoe 940 may be a tapered or bullet - shaped and may guide the liner assembly 925 toward the center of the wellbore 910 . the shoe 940 may minimize problems associated with hitting rock ledges or washouts in the wellbore 910 as the liner assembly 925 is lowered into the wellbore . an outer portion of the shoe 940 may be made from steel . an inner portion of the shoe 940 may be made of a drillable material , such as cement , aluminum or thermoplastic , so that the inner portion may be drilled through if the wellbore is to be further drilled . a bore may be partially formed longitudinally through the shoe 940 and in fluid communication with one or more ports radially formed through the shoe . a sleeve 970 may be disposed in the bore and longitudinally movable between an open position exposing the ports and a closed position covering the ports , thereby fluidly isolating the ports from the bore . the sleeve 970 may be restrained in the open position by one or more frangible members 972 , such as shear screws . alternatively , the sleeve may have one or more ports formed radially therethrough and aligned with the shoe ports in the open position . the sleeve may be restrained in the open position by the threaded coupling between the valve 1000 and the shoe 940 and biased toward the closed position by a spring . unthreading of the valve 1000 from the shoe 940 may release the sleeve , thereby allowing the spring to move the sleeve so that a solid portion of the sleeve covers the ports , thereby fluidly isolating the ports from the bore . the expander assembly 950 may be disposed in the liner assembly 925 . the expander assembly 950 may include a tubular mandrel 955 . an upper end of the mandrel 955 may be connected to the work string 685 by a threaded connection and a lower end of the mandrel 955 may be releasably connected to the shoe 940 , such as by a threaded connection . the mandrel 955 may have a bore 990 formed therethrough in fluid communication with the surface of the wellbore 910 via a bore of the run - in string 685 . the mandrel 955 may support the liner assembly 925 during run - in . the expander assembly 950 may further include a seal 960 longitudinally coupled to the mandrel 955 and engaged with an inner surface of the tubular portion 930 . the seal 960 may be fabricated from a pliable material , such as an elastomer . the seal 960 may act as a piston to move the expansion assembly 950 through the tubular section 930 upon introduction of fluid pressure below the seal 960 . additionally or alternatively , tension from the run - in string may 685 be used to move the expansion assembly 950 through the tubular section 930 . the expander assembly 950 may further include a two - position expander 975 . detailed views of a suitable two - position expander may be found at fig3 a and 3b of u . s . pat . no . 7 , 121 , 351 . the two - position expander may include a first assembly and a second assembly . the first assembly may include a first end plate and a plurality of first cone segments and the second assembly may include a second end plate and a plurality of second cone segments . each end plate may be substantially round and have a plurality of t - shaped grooves formed therein . each groove may match a t - shaped profile formed at an end of each cone segment . an outer surface of each cone segment may include a first taper and an adjacent second taper . the first taper may have a gradual slope to form the leading shaped profile of the two - position expander 975 . the second taper may have a relatively steep slope to form the trailing profile of the two - position expander 975 . the inner surface of each cone segment may have a substantially semi - circular shape to allow the cone segments to slide along an outer surface of the mandrel 955 . a track portion may be formed on each first cone segment . the track portion may be used with a mating track portion formed on each second cone segment to align and interconnect the cone segments . the track portions may be a tongue and groove arrangement . the first assembly and the second assembly may be urged longitudinally toward each other along the mandrel . as the first assembly and the second assembly approach each other , the first and second cone segments may be urged radially outward . as the first and second segments travel longitudinally along respective track portions , a front end of each second cone segment wedges the first cone segments apart , thereby causing the first shaped profiles to travel radially outward along the first shaped grooves of the first end plate . simultaneously , a front end of each first cone segment wedges the second cone segments apart , thereby causing the second shaped profiles to travel radially outward along the second shaped grooves of the second end plate . the radial and longitudinal movement of the cone segments continues until each front end contacts a stop surface on each end plate , respectively . in this manner , the two - position expander 975 is moved from a retracted position having a first diameter to an expanded position having a second diameter that is larger than the first diameter . fig1 is a cross section of an electric valve 1000 . the expander assembly may further include the valve 1000 . the valve 1000 may include a body 1005 having a bore 1010 therethrough . the body 1005 may include an upper sub 1021 , a lower sub 1022 , and a sliding sleeve 1025 disposed therebetween . the upper and lower subs 1021 , 1022 may include threaded couplings for connection to the mandrel 955 and shoe 940 , respectively . a series of ports 1015 may be formed through a wall of the body 1005 for fluid communication between the interior and the exterior of the valve 1000 . one or more seals 1030 may be provided to prevent leakage between the sleeve 1025 and the subs 1021 , 1022 . the sliding sleeve 1025 may be longitudinally movable relative to the body 1005 for selectively opening and closing the ports 1015 . the valve 1000 may further include an actuator 1045 for moving the sliding sleeve 1025 . the actuator 1045 may be a linear actuator . the valve may further include the rfid electronics package 800 for operating the actuator in response to instruction from a ball 995 having one of the rfid tags 850 p , a embedded therein . alternatively , the electronics package 650 may be used instead . the sub 1022 may include a ball seat 1040 disposed therein and longitudinally movable relative thereto for receiving the rfid ball 995 , thereby closing the bore 1010 and longitudinally moving a longitudinal end of the ball seat 1040 into engagement with the sleeve 970 . the expandable liner system 900 may be lowered into the wellbore 910 while receiving displaced wellbore fluid through the shoe 940 . alternatively or additionally , fluid may be circulated to remove debris from the wellbore . after the system 900 is positioned within the wellbore 910 , the rfid ball 995 may be pumped from the surface through the run - in string 685 and the bores 990 , 1005 to the seat 1040 . once the ball 995 has seated , fluid pressure may increase and cause the seat 1040 to push the sleeve 970 , thereby fracturing the shear screws 972 and closing the shoe ports . the rfid ball 995 may include instructions for the electronics package 850 to open the ports 1015 after a predetermined time sufficient to sufficient for the sleeve 970 to close the shoe ports and / or after detecting a pressure sufficient to close the sleeve 970 . fig9 b is a sectional view illustrating the reforming or unfolding of the corrugated liner 935 to form a launcher . the launcher may be formed to house the unactuated two - position - expander 975 prior to expanding the liner assembly 925 into contact with the wellbore 910 . the mandrel 955 may be released from the shoe 940 , such as by rotation of the mandrel from the surface . fluid may then be pumped from the surface through the bore 990 and into the liner assembly 925 via the open ports 1015 . as fluid pressure increases in the liner assembly 925 , the corrugated liner section 935 may start to reform or unfold from the folded diameter to the larger folded diameter due to the fluid pressure . in this manner , the launcher is formed in the liner assembly 925 . fig9 c is a sectional view of the expansion system 900 after positioning the two - position expander 975 in the launcher . after the launcher is formed , the fluid pressure below the seal 960 may be released by allowing fluid to exit through the tubular member 955 . the expander 975 may then be lowered into the launcher . the electronics package 850 may close the ports 1015 after a predetermined time sufficient to sufficient for the launcher to be formed and pressure to be relieved and / or after detecting the pressure sequence for forming the launcher and relieving pressure from the liner assembly . fig9 d is a sectional view of the expandable liner system 900 illustrating the expansion of the corrugated liner section 935 . once the ports 1015 have been closed , pressure in the bore 990 may be increased to activate a hydraulic actuator ( not shown ). the hydraulic actuator may move the expander 975 from the retracted position to the expanded position . the hydraulic actuator may be similar to any of the hydraulic actuators used in any of the isolation valves or setting tools discussed herein . the electronics package 850 may open the ports 1015 after a predetermined time sufficient for actuation of the expander 975 to the expanded position and / or after detecting pressure sufficient for actuation of the expander 975 to the expanded position . once the expander 975 has been moved to the expanded position and the ports 1015 have opened , additional fluid pressure may be introduced through the bore 990 and the ports 1015 and into the liner assembly 925 ( below the seal 960 ) to move the expander assembly 950 relative to the liner assembly 925 . the two - position expander 975 may expand the corrugated liner section 935 from the folded diameter to the unfolded diameter . during expansion , the two - position expander 975 may “ iron out ” the crinkles in the corrugated liner section 935 so that the corrugated liner section 935 is substantially reformed into its initial , substantially tubular shape . reforming and subsequently expanding allows further overall expansion of the corrugated liner section 935 than would be possible with a tubular shape . fig9 e is a sectional view of the expandable liner system 900 illustrating the expansion of the upper liner section 930 . additional fluid may be introduced through the bore 990 and the ports 1015 and into the liner assembly 925 ( below the seal 960 ) to continue the movement of the expansion assembly 950 relative to the liner assembly 925 until substantially the entire length of liner sections 930 , 935 are expanded into contact with the surrounding wellbore 910 and the casing 920 . fig9 f is a sectional view of the completed wellbore 910 . once the expander 975 has reached the bottom of the casing and expanded the overlapping liner into engagement with the bottom of the casing , the expander assembly 950 may be removed from the wellbore . a drill string ( not shown ) having a drill bit disposed on a lower end thereof may be deployed into the wellbore 910 and a lower portion of the liner 935 and the shoe 940 may be drilled through . drilling of the wellbore 910 may then be continued . cementing of the expanded liner assembly 935 may not be required . alternatively , cement may be employed ( before unfolding the corrugated portion and expanding the liner ) to seal an annulus formed between the liner sections 930 , 935 and the surrounding wellbore 910 . fig1 illustrates an alternative expansion assembly 1150 , according to another embodiment of the present invention . instead of the hydraulic actuator and valve 1000 used in the expansion assembly 950 , the expansion assembly may include an electric motor 1102 operated by the rfid electronics package 800 . the sleeve 970 may be replaced by a ball seat . the rfid ball 995 may then be pumped to the ball seat in the shoe . the electronics package 800 may then wait for the launcher to be formed and the expander 1175 to be moved into the launcher . the electronics package may then operate the motor 1102 . a portion of the expander 1175 may be longitudinally coupled to a gear ( not shown ), such as a worm gear , rotationally coupled to the motor 1102 such that rotation of the motor may move the portion of the expander longitudinally relative to another portion of the expander , thereby moving the expander between the retracted and expanded positions . alternatively , the corrugated portion 935 may be formed into the launcher using a lower cone ( not shown ) instead of or in addition to fluid pressure . such an expansion system is illustrated in fig5 a - d of the &# 39 ; 351 patent . the alternative expansion system may utilize a hydraulic actuator to drive the lower cone into the corrugate portion 935 similar to fig9 a - 9f or the electric motor 1102 . alternatively , the expansion system 550 illustrated in fig5 a - d of the &# 39 ; 351 patent may be used instead of the expansion systems 950 , 1150 and modified by replacing the hydraulic valve 555 with the electric valve 1000 in order to selectively open and close hydraulic ports 520 , 565 . a second actuator may be added to the electric valve and the ball seat 1040 may be replaced by the sleeve that closes port 565 in fig5 a - d of the &# 39 ; 351 patent . the second actuator may then move the sleeve to close the port . the first actuator 1045 and the ports 1015 may replace the ports 520 of the hydraulic valve 555 . the shoe 590 may be modified to include a ball seat for catching the rfid ball 995 . the rest of the operation of the modified expansion system may be similar to that of the expansion system 555 discussed and illustrated in the &# 39 ; 351 patent . fig1 is a half section of a portion of a setting tool 1200 , according to another embodiment of the present invention . the remainder of the setting tool 1200 may be similar to the setting tool 1 or the setting tool 700 except that the isolation valve 200 may be omitted . the setting tool 1200 may include a connector sub 1202 , a mandrel 1203 , a piston assembly 1210 a , a pump 1205 , and the electronics package 800 . the connector sub 1202 may be a tubular member including a threaded coupling for connecting to the run - in string 685 and a longitudinal bore therethrough . the connector sub 1202 may also include a second threaded coupling engaged with a threaded coupling of the mandrel 1203 . one or more fasteners , such as set screws may secure the threaded connection between the connector sub 1202 and the mandrel 1203 . the mandrel 1203 may be a tubular member having a longitudinal bore therethrough and may include one or more segments connected by threaded couplings . the piston assembly 1210 may include piston 1211 , sleeves 1212 , 1214 , housing 1215 , inlets 1216 , flow path 1209 , and ratchet assembly 1218 . the piston 1211 may be an annular member . an inner surface of the piston 1211 may engage an outer surface of the mandrel 1203 and may include a recess having a seal , such as an o - ring disposed therein . the inlet 1216 may be formed radially through a wall of the mandrel 1203 and provide fluid communication between a bore of the mandrel 1203 and an inlet of the pump 1205 . the sleeves 1212 , 1214 may be longitudinally coupled to the piston 1211 by threaded connections . a seal , such as an o - ring , may be disposed between the piston 1211 and the sleeves 1212 . each of the sleeves 1212 , 1214 may be a tubular member having a longitudinal bore formed therethrough and may be disposed around the mandrel 1203 , thereby forming an annulus therebetween . the housing 1215 may be a tubular member , disposed around the mandrel 1203 , and longitudinally coupled thereto by a threaded connection . the housing 1215 may also be disposed about a shoulder formed in or disposed on an outer surface of the mandrel 1203 . seals , such as o - rings , may be disposed between the housing 1215 and the mandrel 1203 and between the housing 1215 and the sleeve 1212 . an end of the sleeve 1212 may be exposed to an exterior of the setting tool 1200 . the end of the sleeve 1212 may further include a profile formed therein or fastened thereto by a threaded connection . the profile may mate with a corresponding profile formed on an outer surface of the ratchet assembly 1218 , thereby longitudinally coupling the ratchet 1218 and the sleeve 1212 when the piston 1211 is actuated . the sleeve profile may engage the ratchet profile by compressing a spring , such as a c - ring . the c - ring may then expand to lock in a groove of the sleeve profile . teeth formed on inner and outer surfaces of a lock ring of the ratchet assembly 1218 respectively engage corresponding teeth formed on an outer surface of the mandrel 1203 and an inner surface of a ring housing , thereby longitudinally locking the sleeve 1212 and thus the expander assembly 25 once the sleeve 1212 engages the ratchet assembly 1218 . the pump 1205 and the electronics package may be disposed in the housing 1215 . the housing 1215 may include an inlet providing fluid communication between an inlet of the pump and the mandrel inlet . the housing may include an outlet providing fluid communication between an outlet of the pump and the flow path 1209 . the flow path 1209 may be formed between a recessed outer surface of the housing 1215 and an inner surface of the sleeve 1212 . the flow path 1209 may provide fluid communication between an outlet of the pump 1205 and a top of the piston 1211 . in operation , one of the rfid tags 850 a , p may be embedded in the top plug 320 . when the top plug passes the electronics package 800 , the microprocessor may receive an instruction signal from the tag 850 a , p . the microprocessor 810 may then wait a predetermined period of time and / or detect a pressure indicative of seating of the top plug against the float collar / shoe . the microprocessor may then supply electricity from the battery pack 814 to an electric motor of the pump 1205 . the pump may intake the displacement fluid from the mandrel bore via inlet 1216 , pressurize the displacement fluid , and discharge the pressurized displacement fluid into the flow path 1209 , thereby longitudinally moving the piston 1211 and setting the hanger 105 . additionally , the microprocessor 810 may detect setting of the hanger 105 , such as by including a switch ( not shown ) in the ratchet assembly that is closed when the sleeve 1212 engages the ratchet assembly or a flow meter or stroke counter in the pump 1205 . once the microprocessor 810 detects setting of the hanger 105 , the microprocessor may cease the electricity supply to the pump 1205 and then intermittently supply and cease electricity to the pump 1205 , thereby creating pressure pulses that may be detected at the surface . alternatively , the microprocessor may intermittently supply and cease reversed polarity electricity to the pump , thereby reversing flow through the pump . if the latch 50 does not release upon application of pressure in the mandrel bore , then a ball may be dropped through the run - in string and the mandrel bore to the ball seat , thereby isolating the liner from the mandrel bore . pressure may then be further increased to release the latch . alternatively , the latch 50 may include an actuator , such as any of the actuators discussed above for the isolation valves , setting tools , or expanders , and the electronics package 650 . the microprocessor 660 may detect the pressure pulses and operate the actuator , thereby releasing the latch 50 and allowing the setting tool 1200 to be removed from the wellbore . instead of the electronics package 650 , the latch actuator may be in electrical communication with the microprocessor 850 via a wire ( not shown ) extending through a wall of the mandrel 1203 . fig1 a - d illustrate a cross - section of an isolation valve 1300 , according to one embodiment of the invention . the isolation valve 1300 may be used instead of the isolation valve 200 described above . the isolation valve 1300 may include an upper adapter 1305 , a lower adapter 1395 , one or more couplers 1335 , one or more housings 1310 , 1340 , 1360 , one or more seals , such as o - rings 1301 , 1302 , 1303 , 1306 , 1307 , 1308 , 1309 , 1311 , 1312 , 1313 , 1314 , an upper piston member 1345 , a lower piston member 1347 , one or more sleeves 1315 , one or more pins 1317 , 1319 , an upper retaining member 1320 , a lower retaining member 1325 , an upper seat 1321 , a lower seat 1327 , one or more valve members , such as a ball 1330 , and one or more biasing members , such as a spring 1350 , and one or more lug rings 1365 . fig1 a illustrates an open position of the isolation valve 1300 . the upper and lower adapters 1305 , 1395 may include cylindrical members having flow bores therethrough to provide fluid communication to the isolation valve 1300 . in one embodiment , the upper and lower adapters 1305 , 1395 include threaded ends configured to couple the isolation valve 1300 to the setting tool 1 and the wiper assembly 150 , respectively , as described above . in one embodiment , the isolation valve 1300 may be located in the setting tool 1 below the seal assembly 75 . the housing 1310 is coupled to the exterior surface of the upper adapter 1305 and the upper retaining member 1320 is coupled to the interior surface of the upper adapter 1305 , such that the sleeves 1315 are movably disposed between the housing 1310 and the upper retaining member 1320 . the sleeves 1315 may include cylindrically shaped bodies that are spaced apart and / or include grooves on their outer surfaces to provide fluid passages between the sleeves 1315 and the housing 1310 for fluid communication with one or more chambers 1329 disposed above the upper piston member 1345 . the upper and lower retaining members 1320 , 1325 are configured to retain the ball 1330 within the housing 1310 , as well as retain the upper and lower seats 1321 , 1327 into a sealed engagement with the outer surface of the ball 1330 , using one or more retainers 1323 ( shown in fig1 a - 2 ). the ball 1330 includes a spherical shape having a cylindrical bore disposed therethrough . the one or more pins 1317 may be connected to the ball 1330 and may extend into a slot in the sleeve 1315 . the one or more pins 1319 may be connected to the sleeve 1315 and may extend into an opening in the ball 1330 ( shown in fig1 b - 2 ). the sleeve 1315 , ball 1330 , and one or more pins 1317 , 1319 are configured to provide rotational movement of the ball 1330 upon relative axial movement of the sleeve 1315 , thereby opening and closing fluid communication through the bore of the isolation valve 1300 . as the sleeve 1315 moves relative to the ball 1330 , the pin 1319 moves the ball 1330 and uses the pin 1317 located in the slot of the sleeve 1315 as a pivot point to rotate the ball 1330 . the bore of the ball 1330 is rotated into and out of alignment with the bore of the isolation valve 1300 to open and close fluid communication therethrough . the lower end of the sleeve 1315 is coupled to the upper end of the upper piston member 1345 to allow limited relative movement therebetween and further permit the piston member 1345 to move the sleeve 1315 relative to the ball 1330 . the upper piston member 1345 is disposed within the housings 1310 , 1340 , which are connected together using the coupler 1335 , such as with threaded connections . the upper piston member 1345 is coupled to the lower piston member 1347 , such as with a threaded connection . the lower piston member 1347 includes an upper shoulder that engages the spring 1350 , which is retained at its opposite end by the housing 1360 , which is coupled to the lower end of the housing 1340 . the spring 1350 is surrounded by the housing 1340 and is located within a chamber 1353 that is in fluid communication with the bore of the isolation valve 1300 via an opening 1349 in the wall of the lower piston member 1347 . the lower piston member 1347 extends through the housing 1360 and is coupled to the lower adapter 1395 . a nozzle 1343 may be disposed in the bore of the isolation valve 1300 above the opening 1349 to restrict the flow fluid therethrough prior to communicating with the opening 1349 and to create a pressure differential across the upper and lower ends of the isolation valve 1300 . the upper piston member 1345 , the lower piston member 1347 , and the lower adapter 1395 are movable relative to the housings 1310 , 1340 , 1360 , and may be controlled using a j - slot arrangement that is provided between the housing 1360 and the lower piston member 1347 . the j - slot arrangement includes a channel 1363 machined in the inner wall of the housing 1360 . the channel 1363 is shown in fig1 a - 1 in a “ rolled - out ,” flattened orientation . this pattern is preferably formed three times in the wall of housing 1360 so that each complete j - slot cycle covers 120 degrees of arc of the inner surface of housing 1360 . the lower piston member 1347 includes a recessed shoulder that carries one or more rotatable lug rings 1365 . the lug rings 1365 include an annular ring base which carries a projecting lug portion thereon . fig1 a illustrates a first operational position of the isolation valve 1300 having both fluid pressure and flow through the bore of the isolation valve 1300 . as the isolation valve 1300 is pressurized , fluid pressure is communicated to the chambers 1329 , which generates a force ( greater than the spring 1350 force ) on the upper end of the upper piston member 1345 , thereby moving the upper piston member 1345 , the lower piston member 1347 , and the lug rings 1365 relative to the housing 1360 until a shoulder on the upper piston member 1345 abuts the coupler 1335 . the spring 1350 is compressed between the lower piston member 1347 and the housing 1360 , and the lug rings 1365 are moved in an extended portion of the channel 1363 to the position shown in fig1 a - 1 . a shoulder on the upper end of the upper piston member 1345 engages a shoulder on the lower end of the sleeves 1315 and moves the sleeves 1315 and thus the pins 1317 , 1319 to rotate the ball 1330 so that the bore of the ball 1330 permits fluid flow through the bore of the isolation valve 1300 . as illustrated in fig1 b , when the pressure in the isolation valve 1300 is reduced , the spring 1350 returns the lower piston member 1347 , the upper piston member 1345 , and the sleeves 1315 , so that the ball 1330 is rotated using the pins 1317 , 1319 into a closed position to prevent fluid flow through the bore of the isolation valve 1300 . the lower piston member 1347 moves the lug rings 1356 relative to the housing 1360 , and the lug rings 1356 are rotated and directed by the channel 1363 into the position shown in fig1 b - 1 , which may also stop the retraction of the spring 1350 . as illustrated in fig1 c , pressure may then be applied above and to the isolation valve 1300 to conduct another operation , such as actuation of the expander assembly 25 described above , without opening fluid communication through the bore of the isolation valve 1300 . the upper piston member 1345 is moved within a recess of the sleeve 1315 a limited distance relative to the sleeve 1315 until the lug rings 1365 are moved by the lower piston member 1347 and are rotated and directed by the channel 1363 into the position shown in fig1 c - 1 , which may prevent the upper piston member 1345 from moving the sleeves 1315 and potentially re - opening fluid communication through the isolation valve 1300 . as illustrated in fig1 d , when the pressure in the isolation valve 1300 is reduced or removed , the spring 1350 returns the upper piston member 1345 back to the position shown in fig1 b . however , the lower piston member 1347 moves the lug rings 1356 into the channel 1363 to the position shown in fig1 d - 1 . from the position illustrated in fig1 d - 1 , when the isolation valve 1300 is pressurized again , the lug rings 1365 will be directed into an extended portion of the channel 1363 ( similar to the position shown in fig1 a - 1 ) to permit movement of the sleeve 1315 via the upper and lower piston members 1345 , 1347 , thereby moving the ball 1330 and opening fluid communication through the bore of the isolation valve 1300 . the isolation valve 1300 can be opened and closed indefinitely by following this procedure . fig1 a - c illustrate a cross - section of an isolation valve 1400 , according to one embodiment of the invention . the isolation valve 1400 may be used instead of the isolation valve 200 described above . the isolation valve 1400 may include an upper housing 1410 , a lower housing 1420 , an upper mandrel 1430 , a lower mandrel 1440 , a retainer 1417 , one or more seals , such as o - rings 1403 , 1405 , 1407 , 1409 , 1411 , 1413 , one or more biasing members , such as a spring 1450 , a flapper valve insert 1460 , a flapper valve 1465 , an adapter 1470 , and one or more frangible members , such as shear screws 1475 . the upper mandrel 1430 may include a cylindrical body having a bore disposed therethrough and one or more check valves 1435 located through the body of the upper mandrel 1430 . the check valve 1435 may optionally include a removable plug 1437 to prevent fluid from escaping through the top end of the upper mandrel 1430 . the upper mandrel 1430 may be coupled to the upper end of the upper housing 1410 , which may also include a cylindrical body having a bore disposed therethrough . the retainer 1417 may include a snap ring disposed within the inner surface of the upper housing 1410 and may be operable to retain the upper mandrel 1430 within the upper housing 1410 . the lower mandrel 1440 is disposed in the upper housing 1410 and extends through the lower housing 1420 , and further includes a cylindrical body having a bore disposed therethrough that sealingly engages the upper mandrel 1430 . the lower mandrel 1440 includes a shoulder that sealingly engages the upper housing 1410 and has one or more check valves 1445 disposed through the wall of the shoulder . a chamber 1480 is formed between the bottom end of the upper mandrel 1430 , the inner surface of the upper housing 1410 , the outer surface of the lower mandrel 1440 , and the top end of the shoulder of the lower mandrel 1440 . the chamber 1480 is filled with a hydraulic fluid , such as silicon oil . the upper housing 1410 includes a shoulder at its lower end that sealingly engages the lower mandrel 1440 and the lower housing 1420 and has one or more check valves 1415 disposed through the wall of the shoulder . a chamber 1455 is formed between the bottom end of the shoulder of the lower mandrel 1440 , the inner surface of the upper housing 1410 , top end of the shoulder of the upper housing 1410 , and the outer surface of the lower mandrel 1440 . the chamber 1455 is filled with a hydraulic fluid , such as silicon oil . the check valve 1415 may be configured to allow some of the fluid to escape from the chamber 1455 as an increase in temperature may cause expansion of the fluid . the check valve 1445 may be configured to direct the fluid from the chamber 1455 into the chamber 1480 and prevent fluid flow in the reverse direction . the spring 1450 is housed in the chamber 1455 and is operable to telescope apart the lower mandrel 1440 and the upper housing 1410 . the lower housing 1420 is coupled to the upper housing 1410 , such as through a threaded connection , and includes a cylindrical body having a bore disposed therethrough . a recess in the inner surface of the lower housing 1420 is configured to retain the flapper valve insert 1460 , which supports the flapper valve 1465 and abuts the bottom end of the upper housing 1410 . the flapper valve insert 1460 and the flapper valve 1465 are further retained by the outer surface of the lower mandrel 1440 . the lower end of the lower mandrel 1440 is positioned to maintain the flapper valve 1465 in an open position , which includes a spring member configured to bias the flapper valve 1465 into a closed position when unrestrained . the lower mandrel 1440 is releaseably coupled to the adapter 1470 via the one or more shear screws 1475 below the lower housing 1420 . the adapter 1470 includes a solid cylindrical member that provides a closed end of the isolation valve 1400 and is operable to couple the isolation valve 1400 to a device , such as a dart 1490 ( shown in fig1 c ) or a cement plug . in operation , the isolation valve 1400 is coupled to the dart 1490 via the adapter 1470 . the dart 1490 and the isolation valve 1400 may then be dropped from the surface of a wellbore into the setting tool 1 , the liner assembly 100 , or the wiper assembly 150 located in the wellbore . the dart 1490 may guide the isolation valve 1400 into the setting tool 1 , the liner assembly 100 , or the wiper assembly 150 until a shoulder 1425 of the lower housing 1420 engages and seals on a seat , such as a shoulder disposed in the bore of the seat 95 , the seal assembly 75 , the wiper assembly 150 , or other similar component . in an optional embodiment , the isolation valve 1400 may also include a c - ring coupled to the outer surface of the lower housing 1420 that is operable to engage a corresponding shoulder or recess to secure the isolation valve 1400 within the setting tool 1 , the liner assembly 100 , or the wiper assembly 150 . in one embodiment , the upper end of the upper housing 1410 may include a tapered shoulder configured to engage and seal on a seat , such as a shoulder disposed in the bore of the seat 95 , the seal assembly 75 , the wiper assembly 150 , or other similar component . after the isolation valve 1400 is secured , pressure above the isolation valve 1400 may be applied against the top of the adapter 1470 to shear the shear screws 1475 and release the adapter 1470 and the dart 1490 from the lower mandrel 1440 and open fluid communication through the isolation valve 1400 . the release of the adapter 1470 and the dart 1490 from the lower mandrel 1440 allows the spring 1455 to move the lower mandrel 1440 to remove its lower end from preventing the flapper valve 1465 to bias into a closed position , as illustrated in fig1 b . the fluid in the chamber 1480 and the check valves 1435 , 1445 provide a configuration operable to delay the closure of the flapper valve 1465 after the adapter 1470 is released from the lower mandrel 1440 . as the chamber 1480 is collapsed between the upper mandrel 1430 and the lower mandrel 1440 , the fluid in the chamber 1480 is prevented from flowing into the chamber 1455 by the check valve 1445 but is allowed to be slowly dissipated through the check valve 1435 into the bore of the isolation valve 1400 . the pressure developed in the chamber 1480 after release of the lower mandrel 1440 may first release the plug 1437 from the flow path of the check valve 1435 to open fluid communication therethrough . as the fluid is ejected from the chamber 1480 , the portion of the fluid remaining in the chamber 1480 provides a resistance to the force of the spring 1450 and slows the movement of the lower mandrel 1440 . the sizing of the check valve 1435 may determine the rate at which the fluid is removed from the chamber 1480 and the sizing of the chamber 1480 may determine the amount of fluid which can be filled in the chamber 1480 . these two factors may be used to provide a predetermined timed resistance against the force of the spring 1450 to delay the movement of the lower mandrel 1440 away from the flapper valve 1465 and thus the closure of the flapper valve 1465 . during the time delayed closing of the flapper valve 1465 , the released adapter 1470 and dart 1490 may be directed through the remaining assembly , such as the liner assembly 100 , to facilitate removal of any remaining fluids , such as cement , from the assembly . as illustrated in fig1 c , the dart 1490 may include a c - ring 1493 and a seal 1495 , such as an o - ring , configured to engage and seal with the body 151 of the wiper assembly 150 , the operation of which may then begin as described above after engagement with the dart 1490 and during the time delayed closing of the flapper valve 1465 . after the flapper valve 1465 closes fluid communication through the isolation valve 1400 , pressure may then be applied above and to the isolation valve 1400 to conduct another operation , such as actuation of the expander assembly 25 described above , without opening fluid communication through the bore of the isolation valve 1400 . fig1 a is a sectional view of an expandable liner system 1500 disposed in a wellbore 1510 according to one embodiment of the invention . the expandable liner system 1500 may be run - into the wellbore 1510 using the run - in string 685 . the system 1500 may include a liner assembly 1525 and an expander assembly 1550 . in one embodiment , the expandable liner system 1500 may be located proximate a lower end of a string of casing and the liner assembly 1525 may be set in the casing by positioning an upper portion of the liner assembly 1525 in an overlapping relationship with a lower portion of the casing . thereafter , the expansion assembly 1550 may be employed to expand the liner assembly 1525 into engagement with the casing and / or the surrounding wellbore 1510 . the liner assembly 1525 may include a tubular section 1530 at an upper end thereof and a shaped or a corrugated liner section 1535 disposed at the lower end thereof . it must be noted that the shape or corrugation of the liner section 1535 is optional such that the liner section 1535 is substantially cylindrical . alternatively , the corrugated liner section 1535 may be located at any position along the liner assembly 1525 . a cross section of a suitable corrugated liner section may be found at fig2 g of u . s . pat . no . 7 , 121 , 351 , which is herein incorporated by reference in its entirety . the corrugated liner section 1535 and the substantially cylindrical liner section 1530 may be connected by a threaded connection or may be one continuous tubular body . the corrugated liner section 1535 may be fabricated from a drillable material , such as aluminum or a pliable composite . the corrugated liner section 1535 may have a folded wall having an initial inner diameter which may be reformed to define a larger second folded inner diameter and subsequently may be expanded to an even larger unfolded diameter . the corrugated liner section 1535 may be folded or deformed prior to insertion into the wellbore 1510 , to a non - tubular - shape , such as a hypocycloid , so that grooves are formed along the length of the corrugated liner section 1535 . the grooves may be symmetric or asymmetric . the liner assembly 1525 may further include a shoe 1540 at the lower end thereof . the shoe 1540 may be longitudinally coupled to the corrugated portion , such as by a threaded connection . the shoe 1540 may be a tapered or bullet - shaped and may guide the liner assembly 1525 toward the center of the wellbore 1510 . the shoe 1540 may minimize problems associated with hitting rock ledges or washouts in the wellbore 1510 as the liner assembly 1525 is lowered into the wellbore . an outer portion of the shoe 1540 may be made from steel . an inner portion of the shoe 1540 may be made of a drillable material , such as cement , aluminum or thermoplastic , so that the inner portion may be drilled through if the wellbore is to be further drilled . a bore may be partially formed longitudinally through the shoe 1540 and in fluid communication with the wellbore 1510 . the expander assembly 1550 may be disposed in the liner assembly 1525 . the expander assembly 1550 may include a tubular mandrel 1555 . an upper end of the mandrel 1555 may be connected to the run - in string 685 by a threaded connection and a lower end of the mandrel 1555 may be releasably connected to the shoe 1540 , such as by a threaded connection . the mandrel 1555 may have a bore formed therethrough in fluid communication with the surface of the wellbore 1510 via a bore of the run - in string 685 . the mandrel 1555 may support the liner assembly 1525 during run - in . the expander assembly 1550 may further include one or more seals 1560 longitudinally coupled to the mandrel 1555 and engaged with an inner surface of the tubular portion 1530 . the seals 1560 may be fabricated from a pliable material , such as an elastomer . the seals 1560 may act as a piston to move the expansion assembly 1550 through the tubular section 1530 upon introduction of fluid pressure below the seals 1560 . additionally or alternatively , tension from the run - in string may 685 be used to move the expansion assembly 1550 through the tubular section 1530 . the expander assembly 1550 may further include a piston member 1570 disposed between the tubular section 1530 and the mandrel 1555 and movable relative to the tubular section and the mandrel . as illustrated in fig1 a - 1 , the piston member 1570 may form one or more vacuum chambers 1513 and one or more piston chambers 1515 with the mandrel 1555 . one or more seals , such as o - rings 1511 , 1512 , and 1514 may be used to seal the chambers 1513 and 1515 . the mandrel 1555 may include a shoulder disposed on its outer surface having a flow path 1557 providing fluid communication between the bore of the mandrel 1555 and the piston chamber 1515 . a valve 1559 , such as a rupture disk , may be located in the flow path 1557 to control fluid communication to the piston chamber 1515 . the expander assembly 1550 may further include a valve 1600 having a member 1610 , such as a pick , configured to actuate the valve 1559 to open fluid communication between the mandrel 1555 bore and the piston chamber 1515 for actuation of the piston member 1570 . in one embodiment , the valve 1600 may include the electronics package 650 or the rfid electronic package 800 described above . the valve 1600 may be actuated using an active or passive rfid tag embedded in a device , such as a dart 1580 , shown in fig1 b , or using mud pulses received from the surface . in one embodiment , alternative means of operating the valve 1600 may include a spring force , a gas spring , or an electric motor . in one embodiment , actuation of the valve 1600 may cause the member 1610 , such as a pick , to fracture the valve 1590 , such as a rupture disk , thereby opening fluid communication between the bore of the mandrel 1555 and the piston chamber 1515 . the expansion assembly 1550 further includes a two - position expander 1575 and a cone 1577 . the cone 1577 is a tapered member that is operatively attached to the piston member 1570 , whereby movement of the piston member 1570 in relation to the liner assembly 1525 will also move the cone 1577 . adjacent to the cone 1577 is the two - position expander 1575 . during run - in , both the two - position expander 1575 and the cone 1577 are disposed adjacent an end of the corrugated liner section 1535 . detailed views of a suitable two - position expander may be found at fig3 a and 3b of u . s . pat . no . 7 , 121 , 351 . the two - position expander 1575 may include a first assembly and a second assembly . the first assembly may include a first end plate and a plurality of first cone segments and the second assembly may include a second end plate and a plurality of second cone segments . each end plate may be substantially round and have a plurality of t - shaped grooves formed therein . each groove may match a t - shaped profile formed at an end of each cone segment . an outer surface of each cone segment may include a first taper and an adjacent second taper . the first taper may have a gradual slope to form the leading shaped profile of the two - position expander 1575 . the second taper may have a relatively steep slope to form the trailing profile of the two - position expander 1575 . the inner surface of each cone segment may have a substantially semi - circular shape to allow the cone segments to slide along an outer surface of the mandrel 1555 . a track portion may be formed on each first cone segment . the track portion may be used with a mating track portion formed on each second cone segment to align and interconnect the cone segments . the track portions may be a tongue and groove arrangement . the first assembly and the second assembly may be urged longitudinally toward each other along the mandrel . as the first assembly and the second assembly approach each other , the first and second cone segments may be urged radially outward . as the first and second segments travel longitudinally along respective track portions , a front end of each second cone segment wedges the first cone segments apart , thereby causing the first shaped profiles to travel radially outward along the first shaped grooves of the first end plate . simultaneously , a front end of each first cone segment wedges the second cone segments apart , thereby causing the second shaped profiles to travel radially outward along the second shaped grooves of the second end plate . the radial and longitudinal movement of the cone segments continues until each front end contacts a stop surface on each end plate , respectively . in this manner , the two - position expander 1575 is moved from a retracted position having a first diameter to an expanded position having a second diameter that is larger than the first diameter . in operation , the expandable liner system 1500 may be lowered into the wellbore 1510 adjacent an area of interest , such as an end of an existing casing section . wellbore fluids may flow up through the bore of the mandrel 1555 and the run - in string 685 as the system 1500 is run into the wellbore 1510 . a dart 1580 may be dropped from the surface of the wellbore 1510 , directed through the expandable liner system 1500 , and seated in the shoe 1540 , thereby closing fluid communication between the wellbore 1510 and the bore of the mandrel 1555 . the dart 1580 may include an embedded rfid tag used to communicate with the valve 1600 . a radio frequency communication may be directed between the dart 1580 and the valve 1600 to actuate the valve 1600 and move the member 1610 to open the valve 1559 . the pressure in the bore of the mandrel 1555 may be increased and communicated to the piston chamber 1513 via the flow path 1557 to move the piston member 1570 . the piston member 1570 causes the two - position expander 1575 and the cone 1577 to move relative to the mandrel 1555 and the liner assembly 1525 , thereby allowing the cone 1577 to reform the corrugated liner section 1535 . the cone 1577 reforms the corrugated liner section 1535 and may engage a shoulder disposed on the outer surface of the mandrel 1555 or the end of the shoe 1540 , which prevents further movement of the cone 1577 . fluid pressure continues to be introduced into the piston chamber 1515 , thereby causing the two - position expander 1575 to move closer to the cone 1577 to begin the activating process . as the fluid pressure continues to urge the two - position expander 1575 against the cone 1577 , the first and second cone segments of the two - position expander 1575 move radially outward into contact with the surrounding liner 1535 ( actuation of the two - position expander 1575 was described above ). fig1 c illustrates the two - position expander 1575 expanding the corrugated liner section 1535 and the liner section 1530 . as shown , the two - position expander 1575 has expanded a portion of the liner section 1535 from the folded diameter to the unfolded diameter . in other words , during the expansion process , the two - position expander 1575 basically “ irons out ” the crinkles in the corrugated liner section 1535 so that the liner section 1535 is substantially reformed into its initial tubular shape . reforming and subsequently expanding allows further expansion of the liner section 1535 than was previously possible because the reformation process may not use up the 25 % limit on expansion past the elastic limit . subsequently , the expansion assembly 1550 is rotated in one direction to release the connection between the mandrel 1555 and the shoe 1540 and / or dart 1580 . at this point , the expansion assembly 1550 and the liner assembly 1525 are disconnected , thereby unlocking the one or more seals 1560 . as additional fluid pressure is introduced through the bore of the mandrel 1555 , the entire expansion assembly 1550 is moved relative to the liner assembly 1525 as fluid pressure acts upon seals 1560 . in this manner , substantially the entire length of liner sections 1530 and 1535 are expanded into contact with the surrounding wellbore 1510 . fig1 d illustrates the removal of the expander assembly 1550 from the liner assembly 1525 . as illustrated , a device 1590 , such as a ball , may be dropped from the surface of the wellbore 1510 and landed into a seat of the mandrel 1555 , thereby closing fluid communication between the bore of the mandrel 1555 and the surrounding annulus of the wellbore 1510 . pressure may then be increased in the expander assembly 1550 and used to collapse the two - position expander 1575 into an unexpanded ( reduced outer diameter ) position to facilitate removal of the expander assembly 1550 . the cone segments of the two - position expander 1575 may be retracted to provide a reduced outer diameter of the expansion assembly 1550 to allow the assembly to be removed from the liner assembly 1525 and / or the wellbore 1510 . fig1 c - 1 , 15 d - 1 , and 15 d - 2 illustrate an embodiment of the expander assembly 1550 having a release mechanism 1700 used to retract the two - position expander 1575 into an unexpanded position as stated above . the release mechanism 1700 is configured to retract the two - position expander 1575 into an unexpanded position using fluid pressure and / or mechanical rotation of the expander assembly 1550 . the release mechanism 1700 may be disposed between the two - position expander 1575 and the cone 1577 of the expansion assembly 1550 . the release mechanism 1700 may include an adapter 1710 coupled to the two - position expander 1575 at an upper end and rotatively coupled to a first inner mandrel 1715 via one or more screws 1719 . the screws 1719 may reside in a slot in the body of the adapter 1710 to allow relative axial movement between the adapter 1710 and the first inner mandrel 1715 . the adapter 1710 and the first inner mandrel 1715 may include cylindrical members having bores disposed through the bodies of the members . the first inner mandrel 1715 may similarly be coupled at its upper end to a mandrel 1717 , which is disposed between the two - position expander 1575 and the mandrel 1555 and is operable to facilitate make - up of the expander assembly 1500 and the release mechanism 1700 . the release mechanism 1700 may include an upper sleeve 1720 , a middle sleeve 1725 , and a lower sleeve 1730 , each comprising cylindrical members having bores located through the bodies of the members . the upper sleeve 1720 may abut a shoulder disposed on the outer surface of the adapter 1710 and may be releaseably coupled to the middle sleeve 1725 via one or more frangible members , such as shear screws 1721 . an opening 1731 is disposed through the body of the upper sleeve 1720 , which is in communication with a chamber formed between the upper sleeve 1720 and the middle sleeve 1725 . the chamber is sealed using one or more seals , such as o - rings 1754 , 1753 , 1756 , and 1752 . the chamber is also in communication with an opening 1733 disposed through the body of the first inner mandrel 1715 , which is further in communication with an opening 1734 disposed through the body of the mandrel 1555 and thus the inner bore of the expander assembly 1550 . when the inner bore of the expander assembly 1550 is pressurized , the fluid pressure is directed to the chamber via the openings 1734 , 1733 , 1731 , which then telescopes apart the upper sleeve 1720 and the middle sleeve 1725 to shear the shear screws 1721 and allow relative movement between the upper and middle sleeves . the pressure also telescopes apart the adapter 1720 and the upper and middle sleeves 1720 , 1725 relative to the first inner mandrel 1715 . as illustrated in fig1 c - 1 , a set of dogs 1735 may be located in a slot of the upper sleeve 1720 and may extend into recesses disposed on the outer surface of the first inner mandrel 1715 . the dogs 1735 may include a cylindrical member having one or more shoulder portions extending from the inner diameter and one or more recesses disposed on the outer diameter of the member . the dogs 1735 may be surrounded by the lower sleeve 1730 , which is coupled to the upper end of a lower housing 1760 . the lower sleeve 1730 engages the outer surface of the dogs 1735 adjacent the recesses disposed on the outer diameter of the dogs 1735 to prevent the dogs 1735 from releasing engagement with the first inner mandrel 1715 . the dogs 1735 are engaged with the first inner mandrel 1715 to prevent relative movement between the adapter 1710 ( via the upper sleeve 1720 ) and the first inner mandrel 1715 , thereby preventing retraction of the two - position expander 1575 . a guide member 1740 is coupled to the lower end of the upper sleeve 1720 to facilitate translation of the upper sleeve 1720 relative to the lower housing 1760 . the housing 1760 may be releasably coupled to a second inner mandrel 1750 via one or more frangible members , such as shear screws 1722 . the second inner mandrel 1750 may also be coupled to the first inner mandrel 1715 at one end and the cone 1577 at the opposite end . a seal , such as a packing element 1751 , may be disposed between the first inner mandrel 1715 , the second inner mandrel 1750 , and the mandrel 1555 . as illustrated in fig1 d - 1 , the device 1590 ( shown in fig1 d ) may close fluid communication through the expander assembly 1550 and allow the bore of the mandrel 1555 to be pressurized , which may be communicated to the chamber between the upper sleeve 1720 and the middle sleeve 1725 . the shear screws 1721 between the upper sleeve 1720 and the middle sleeve 1725 ( and the shear screws 1722 between the lower housing 1760 and the second inner mandrel 1750 ) have been sheared ( as described above ) and the middle sleeve 1725 is used to direct a shoulder portion on the inner diameter of the lower sleeve 1730 into the recesses on the outer diameter the dogs 1735 . this engagement allows the dogs 1735 to move radially outward away from the first inner mandrel 1715 . the upper sleeve 1720 directs the dogs 1735 axially relative to the first inner mandrel 1715 to allow the dogs to disengage from the recesses in the first inner mandrel 1715 and retract into the middle sleeve 1725 . when the dogs 1735 are disengaged from the first inner mandrel 1715 , the adapter 1710 may move downward relative to the first inner mandrel 1715 to retract and pull apart the two - position expander 1575 . the movement relative to the first inner mandrel 1715 may be stopped when the guide member 1740 abuts the upper end of the second inner mandrel 1750 . the expander assembly 1550 may then be removed from the wellbore with the two - position expander 1775 in the retracted position . as illustrated in fig1 d - 2 , the two - position expander 1575 may be retracted into an unexpanded position by rotation of the mandrel 1555 . rotation of the mandrel 1555 may be used to induce relative movement between the second inner mandrel 1570 and the lower housing 1760 and thus shear the shear screws 1722 therebetween . release of the shear screws 1722 allows the middle sleeve 1730 to move relative to the dogs 1735 , which may then retract into the middle sleeve 1730 and radially outward relative to the first inner mandrel 1715 as described above . relative movement between the upper sleeve 1720 and the first inner mandrel 1715 may allow the lower end of the upper sleeve 1720 to move the dogs 1735 out of the recesses in the first inner mandrel 1715 and release the engagement therebetween to allow retraction of the two - position expander 1775 into the unexpanded position . any of the above discussed setting tools and / or liner assemblies may be installed in a pre - drilled wellbore or drilled in using a drilling with liner operation . further , any of the above discussed setting tools may be used with a conventional liner hanger , discussed in the background section . further , any of the setting tool actuators may be used for the isolation valves and vice versa . while the foregoing is directed to embodiments of the present invention , other and further embodiments of the invention may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims that follow .	4
the following detailed description is exemplary in nature and is not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the following description provides a practical illustration for implementing exemplary embodiments of the invention . fig1 is a plan view with a partial section of a lead 10 including means for retention 15 according to one embodiment of the present invention . fig1 illustrates lead 10 including a lead body 12 , a connector 16 coupled to a proximal end 121 of the lead body 12 and an electrode 14 coupled to a distal end 122 of the lead body 12 ; a conductor 13 , extending within an outer sheath 11 , couples electrode 14 to connector 16 , in order to deliver electrical stimulation , and forms a lumen for slideably engaging a stylet 18 . means and materials for constructing such a lead are well known to those skilled in the art . fig1 further illustrates retention means 15 formed along an outer surface of lead body 12 in proximity to distal end 122 . according to embodiments of the present invention , retention means 15 allows insertion of lead body 12 through a vessel , for example a vessel 607 as illustrated in fig6 , while preventing retraction of lead body 12 within the vessel due to an interference of retention means 15 along a wall of the vessel that contacts lead body 12 . retention means according to some embodiments of the present invention extends along a length greater than or equal to approximately 1 mm and may be implemented along any portion of a lead body alone or in conjunction with other retention means ; further , retention means 15 may be an integral part of outer sheath 11 or may be formed on a separate collar fitted about lead body 12 , either in - line with or about outer sheath 11 . suitable materials for outer sheath 11 and retention means 15 include those that are biocompatible , examples of which include , but are not limited to , silicone and polyurethane . various embodiments of retention means include projections formed along retaining segments as illustrated in fig2 a – d and 4 a – 5 b . it should be noted that alternate embodiments include , but are not limited to , retaining segments extending around an entire circumference of a lead body and segments extending only about a portion of the circumference of the lead body . for example , a plurality of projections may lie in a line , single file , along a length of a retaining segment , as illustrated in fig2 a , or each individual projection may extend circumferentially about all or a portion of a retaining segment , as illustrated in fig2 c , or a plurality of projections may lie approximately side - by - side about all or a portion of a circumference , as illustrated in fig2 d . in some embodiments , retaining segments as a whole or just the projections may be formed of a bioadsorbable material , examples of which include those taught in lines 10 – 24 of u . s . pat . no . 6 , 173 , 206 . according to these embodiments , if a lead body is chronically implanted , the retaining segment or projections would remain intact long enough to hold the body in place for a period of time up to tissue encapsulation of the body ; this may facilitate extraction of a chronically implanted lead . one example of an appropriate bioadsorbable material , polydioxanone is described along with means for molding the material in u . s . pat . no . 4 , 490 , 326 , the teachings of which are incorporated by reference herein . fig2 a is an enlarged plan view of means for retention according to one embodiment of the present invention . fig2 a illustrates a retaining segment 380 including a plurality of barb - like projections 385 positioned in a single - file line along a length of the segment 380 ; each of the plurality of projections 385 include a length l and extend laterally from a lead body 312 toward a proximal end 321 at an angle 33 , which , according to some embodiments , is less than approximately 45 degrees . according to this embodiment of the present invention and various other embodiments illustrated herein length l is greater than approximately 100 microns . fig2 a further illustrates projections 385 as portions of a wall 387 forming retaining segment , having been lifted out of wall 387 according to one embodiment of the present invention . fig2 b illustrates an alternate retaining segment 30 extending along a length of lead body 312 and including tread - like projections 31 extending laterally from lead body 312 to form a textured surface adapted to engage a vessel wall , similar to , for example , a sole of a shoe designed to facilitate traction . according to some embodiments of the present invention , projections , i . e . 385 , 31 , are directly formed in outer surfaces , being integral with a bulk material underlying the surfaces , but , according to alternate embodiments , the projections are formed of separate materials either embedded in or adhered to these surfaces . alternative methods of forming examples of these embodiments will be described herein below . fig2 b further illustrates retaining segment 30 including a coating 36 , which is soluble in body fluids ; according to this embodiment , coating 36 fills in around projections 31 and remains intact temporarily , during positioning of lead body 312 , so that lead body 312 may be moved back and forth through a vessel if repositioning is necessary . suitable materials forming coating 36 are soluble in body fluids ( within a temperature range encompassing normal body temperature ), non - toxic , biocompatible and non - pyrogenic ; examples of such a material include sugar derivatives , such as mannitol and dextrose , salts , such as sodium chloride and potassium chloride , and polyvinylpyrrolidone ( pvp ). portions of u . s . pat . no . 4 , 827 , 940 teaching methods for forming and applying a mannitol solution are incorporated by reference herein . according to an alternate embodiment , a covering in the form of a thin wall tube may be deployed over retaining segment 30 in place of coating 36 . it should be noted that any of the embodiments described herein may include such a coating or a covering facilitating positioning of lead bodies . fig2 c is an enlarged plan view of means for retention according to another embodiment . fig2 c illustrates a retaining segment 300 coupled to a portion of lead body 312 and including a proximal end 3210 and a plurality of projections 310 , each of which extend around all or a portion of a circumference of lead body 312 and extend laterally from lead body 312 at angle 33 with terminal ends 311 of projections 310 directed toward proximal end 3210 . fig2 d is an enlarged partial section view of means for retention according to yet another embodiment of the present invention . fig2 d illustrates a retaining segment 350 including a plurality of fish scale - like projections 355 positioned side - by - side about a circumference of lead body 312 and along a length of segment 350 and including terminal ends 351 directed toward a proximal end 3215 . fig2 d further illustrates projections 355 as discrete elements embedded in an underlying surface 375 of segment 350 according to one embodiment of the present invention . fig2 d also illustrates , by way of a dashed line connecting projections 355 around a circumference , another embodiment in which embedded elements forming projections may be rings or portions of a coil circling a portion of or the entire circumference of segment 350 creating projections similar to projections 310 illustrated in fig2 c . according to further alternate embodiments , some or all projections of a retaining segment , for example projections 385 , 31 , 310 and 355 ( fig2 a – d ), each include micro - features further enhancing engagement of the projections with the vessel wall . in fig2 a such a feature is illustrated on one of projections 385 as a hole or indentation 25 ; in fig2 b such a feature is illustrated as a modified surface 26 on one of projections 31 wherein surface 26 includes texture , adhesive spots , or some material promoting thrombotic adhesion to vessel wall . methods for forming various embodiments of retaining segments , for example those depicted in fig2 a – d , include , but are not limited to , molding , extrusion , cutting , laser ablation , and coating . these methods may form projections directly in outer surfaces , such that they are integral with a bulk material underlying the surfaces , or may integrate the projections with the surface by embedding or adhering . according to some embodiments of the present invention , transfer or injection molding , using methods known to those skilled in the art , are used to form a retaining segment including projections , examples of which include those depicted in fig2 b – c . according to other embodiments , a cutting process may be used to create projections on a retaining segment , for example segment 380 illustrated in fig2 a ; a blade may be used to nick the surface or to cut all the way through a wall of the retaining segment . alternatively , laser ablation may be used to create projections from a bulk material of a retaining segment , i . e . fig2 b – c , or by exposing , at a surface of the segment , portions of materials which have been embedded within the bulk material underlying the surface during , for example , a molding or extrusion process , i . e . fig2 d . u . s . pat . no . 5 , 580 , 699 describes a suitable laser ablation process , which may be used to form retaining segments and the pertinent teachings of the &# 39 ; 699 patent are incorporated by reference herein . u . s . pat . no . 4 , 272 , 577 describes an extrusion process for forming ski bases having direction - dependent friction coefficients wherein harder particles , within a plastic matrix flowing through a slit nozzle , become obliquely oriented relative to the surface of the base ; in one case , by means of a temperature gradient across the nozzle . we contemplate that similar methods may be developed by those skilled in the art , according to the teachings of the &# 39 ; 577 patent , in order to extrude retaining segments according to the present invention , and incorporate by reference the pertinent teachings of the &# 39 ; 577 patent herein . some composite materials suitable for embodiments of the present invention include but are not limited to polyamide and polyimide particles , polyester fibers , carbon fibers or particles and any combination thereof blended with silicone . according to further alternate embodiments a coating applied to a surface of a retaining segment may form projections and or micro - features on projections , for example similar to those illustrated in fig2 b – c . stewart et al . describe an example of a suitable coating process via plasma deposition in commonly assigned u . s . pat . no . 6 , 549 , 811 , which is incorporated by reference in its entirety herein . furthermore coatings including particles blended within , for example a silicone medical adhesive including biocompatible metal particles or hard plastic particles may form an embodiment of the present invention for example similar to those illustrated in fig2 b and 2d . fig3 is a plan view of a lead 40 , which may incorporate retention means according to embodiments of the present invention . fig3 illustrates lead 40 including a proximal portion 43 , a first preformed bend 41 extending from proximal portion 43 to an intermediate segment 45 and a second preformed bend 42 extending from intermediate segment 45 to distal segment 46 , which is terminated by a tip 44 . such a lead is fully described in commonly assigned u . s . pat . no . 5 , 999 , 858 , which is herein incorporated by reference in its entirety . according to embodiments of the present invention , first and second bends 41 and 42 acting as means for retention of lead body in a coronary vessel , for example a coronary sinus 605 or a branch vessel 607 thereof illustrated in fig6 , are supplemented by any of the retaining segments described herein , which may be formed along the lead body surface at first bend 41 , intermediate segment 45 , second bend 42 , distal segment 46 , or any combination thereof . any other combination of bends within a lead body is within the scope of the present invention . fig4 a – b are partial plan views of one embodiment of lead 40 showing only a portion at first bend 41 , which includes a retaining segment formed by projections 51 . according to some embodiments of the present invention a retaining segment may be activated by a bending of a lead body as illustrated in fig4 a – b . if a stylet , for example stylet 18 shown in fig1 , is inserted into lead 40 to straighten preformed bend 41 , projections 51 become approximately parallel with an outer surface of lead 40 , as illustrated in fig4 a . once the stylet is removed preformed bend 41 reforms such that projections 51 protrude laterally and are thus activated to prevent rearward motion of lead 40 within a vessel . if it becomes necessary to reposition lead 40 , the stylet may be reinserted to straighten bend 41 thus bringing projections into approximate alignment with the surface of lead 40 . it should be noted that the embodiment illustrated in fig2 d may be of the type illustrated in fig4 a – b . fig3 further illustrates lead 40 including an anchoring sleeve 48 positioned about proximal portion 43 thereof . according to an additional embodiment of the present invention , means for retention as illustrated herein , may be formed along an outer surface of proximal portion to provide frictional forces complementing anchoring sleeve 48 at a venous entry point . the means for retention may either engage an inner surface of anchoring sleeve 48 or engage a vein wall in proximity to the entry point . fig5 a – b schematic views of a portion of a lead body including retention means according to yet another embodiment . fig5 a – b illustrate a lead body 20 including a plurality of hair - like projections or fibers 205 each attached at one end to lead body 20 and directed by their attachment points 23 to extend out from and along a length of body 20 toward a proximal end 221 of body 20 . according to the illustrated embodiment , as lead body 20 is advanced distally in a vessel 207 per arrow a , as in fig5 a , projections 205 are suspended proximally ; when lead body 20 is retracted proximally per arrow b , as in fig5 b , projections 205 are forced toward a distal end 222 of body 20 to become bunched up and wedged between body 20 and a wall of vessel 207 , thereby providing retention means for lead body 20 . projections may be formed from a bioadsorbable polymer , for example polyglyocolic acid or polylactic acid . alternately projections 205 may be formed from polyester fibers or some other material promoting thrombotic adhesion with the vessel wall to enhance retention within vessel 207 ; such thrombotic projections may include a non - thrombogenic coating adapted to dissolve after the lead is positioned per fig5 b , examples of which include a benzalkonium chloride - heparin solution and polyvinylpyrrolidone . projections 205 may be attached at attachment points 23 by embedment within lead body 20 or by adhesive attachment , for example by means of silicone medical adhesive . fig6 is a schematic view of an exemplary medical device , which may incorporate retention means according to embodiments of the present invention . fig6 illustrates the medical device including a therapy generator 600 coupled to a lead 60 implanted within branch vessel 607 emanating from coronary sinus 605 . lead 60 including a connector terminating a proximal portion 62 , an electrode in proximity to a distal end 66 and a conductor extending through an outer insulative sheath ( similar to lead 10 illustrated in fig1 ) may deliver electrical therapy , or may deliver infusions of therapeutic fluids from generator 600 through a central lumen . fig6 further illustrates potential retention segment sites 65 , 61 , and 63 along lead 60 where projections of retention segments according to embodiments of the present invention would engage a wall of vessels 605 and 607 to prevent rearward dislodgment of lead 60 from vessel 607 . although embodiments of the present invention are described in the context of therapy delivery , diagnostic devices adapted for insertion within a blood vessel may also incorporate retention means described herein and thus fall within the scope of the present invention . in the foregoing detailed description , the invention has been described with reference to specific embodiments . however , it may be appreciated that various modifications and changes can be made without departing from the scope of the invention as set forth in the appended claims .	0
the present invention is more readily understood through the following preferred embodiments : two types of nanochannel glass arrays developed at the naval research laboratory are used as high surface area nanoporous support structures to tether dna targets or probes for hybridization . ncg materials are unique glass structures containing a regular geometric array of parallel holes or channels as small as 33 nm in diameter or as large as several micrometers in diameter . see tonucci , r . j ., justus , b . l ., campillo , a . j . and ford , c . e . 1992 . science 258 : 783 - 785 . these nanochannel glass structures can possess packing densities in excess of 3 × 10 10 channels per square centimeter , fabricated in various array configurations . a variety of materials can be immobolized or fixed to the glass surfaces within the channels of the ncg array , to yield a high surface area to volume ratio . nanochannel glass arrays are fabricated by arranging dissimilar glasses in a predetermined configuration , where at least one glass type is usually acid etchable . construction of a two - dimensional hexagonal close packing array begins by insertion of a cylindrical acid etchable glass rod ( referred to as the channel glass ) into an inert glass tube ( referred to as the matrix glass ) whose inner dimensions match that of the rod . the pair is then drawn under vacuum to reduce the overall cross - section to that of a fine filament . the filaments are then stacked , re - fused and redrawn . this process is continued until appropriate channel diameters and the desired number of array elements are achieved . by adjusting the ratio of the diameter of the etchable glass rod to that of the outside dimension of the inert glass tubing , the center - to - center spacing of the rods and their diameters in the finished product become independently adjustable parameters . once the fabrication process is complete , the ncg material is wafered perpendicular to the direction of the channels with a diamond saw and then polished to produce 0 . 1 - 1 . 0 mm sections of material . the channel glass of the array structure is then etched away with an acid solution . a hexagonal close packing arrangement of channel glasses , after acid etching , contains typically 10 7 channels and is uniform throughout . the channel diameter is typically 450 nm and the center - to - center spacing is approximately 750 nm . the type of array structure described above is useful in the ncg array hybridization assembly in accordance with the present invention . in this configuration , the tapered sample well structure defines each group of channels serving as a specific hybridization test site . a second type of hexagonal array structure , in which separated clusters of channels are formed during the fabrication process , exhibits an open array structure with typical channel diameters of 300 nm . the overall glass structure consists of an array of 18 μm diameter subarrays , each serving to contain a specific dna probe or target , and spaced typically 25 μm apart from neighboring arrays . the ncg hybridization arrays described in example 1 are bonded on the upper side to a polymeric layer containing an array of orifices which align with the array of nanochannel bundles and serve as sample wells for placement of a substantially homogeneous sample of a biomolecule ( e . g ., a single dna species ) within each hybridization site . this polymeric sample well array also provides physical support to the fragile ncg wafer . the polymeric array of orifices are fabricated using methods known in the art . for example , this polymeric layer suitable for use herein can be obtained from microfab technologies , inc . the orifices are fabricated using excimer laser machining . this method is preferred because existing technology is employed allowing for low cost / high volume manufacturing , as is currently being done in the microelectronics industry . development of the polymeric array comprises four task : ( 1 ) materials selection ; ( 2 ) ablation tooling and process development ; ( 3 ) lamination tooling and process development ; and ( 4 ) production of high density and ultra - high density polymeric arrays . these tasks are undertaken as follows : the materials useful in the polymeric array are filled polymers , epoxy resins and related composite ( e . g ., “ circuit - board ”- type ) materials . because it is a standard process in the microelectronics industry , the present invention most advantageously employs polymeric materials with the adhesive applied by the commercial vendor of the material for example , a polyamide with a 12 μm thick layer of a b - stage ( heat curing ) adhesive the primary requirements for the polymeric array material to be used are : i . high absorption in uv ( e . g ., & gt ; 4 × 10 5 / cm at 193 nm ), ii . high laser etch rate ( e . g ., 0 . 5 μm / pulse ) and low hole taper ( reduction in hole diameter with depth into material , e . g ., & lt ; 3 °); 3 . obtainable with b - stage adhesive on one side which is both laser ablatable and suitable for bonding to the nanoporous wafer ; 4 . high rigidity and thermal stability ( to maintain accurate alignment of samplewell and ncg wafer features during lamination ); contact mask excimer laser machining is a preferred processing technique because it is a lower cost technique than projection mask excimer laser machining . a projection mask is , however , employed when the feature size less than 50 μm . one or more masks with a variety of pattern sizes and shapes are fabricated , along with fixtures to hold the mask and material to be ablated . these masks are employed to determine the optimal material for laser machining and the optimal machining conditions ( i . e ., mask hole size , energy density , input rate , etc .). scanning electron microscopy and optical microscopy are used to inspect the excimer laser machined parts , and to quantify the dimensions obtained , including the variation in the dimensions . in addition to ablating the sample wells into the polymeric material , the adhesive material is also ablated . this second ablation is undertaken so that the diameter of the hole in the adhesive is made larger than diameter of the sample well on the adhesive side of the polymeric material . this prevents the adhesive from spreading into the sample well and / or the nanoporous glass during lamination . initial lamination process development is carried out using unablated polymeric material ( or alternatively , using glass slides and / or silicon wafers ). cure temperature , pressure , and fixturing are optimized during this process development . thereafter , the optimized processing parameters are employed to laminate both nanoporous wafers and polymeric arrays . the final lamination is done such that the alignment of the two layers creates functional wells . the optimal mask patterns and excimer laser parameters are determined and thereafter employed in the manufacture of contact masks and material holding fixtures . typically , fabrication is done so as to produce a large number (& gt ; 100 ) of parts as the masks wear out with use ). two general types of porous silicon devices are prepared according to the process described herein . first , known microfabrication methods are used to fabricate wafers , bounded by integral sample wells . second , uniformity porous wafer structures are bonded to the same orifice sample well arrays that were described previously ( example 2 ) for ncg glass arrays . porous silicon designs are advantageously employed herein because of their adaptability to low cost mass production processes and their ability to incorporate in the fabrication process structural elements that function in fluidic entry and exit from the hybridization site and structures ( e . g ., electrodes ) that may function in hybridization detection . stable , open - cell porous materials are used to accomplish enhancements and to introduce qualitatively new features in these devices , whereby the surface area of discrete and isolated binding regions is increased by a factor of 100 to 1000 in hybridization - based electronic , fluorescence and radiation - based dna detectors . in accomplishing this objective , controlled introduction of high - surface - area supports at the surface detection site is employed . thin - film processing technology is used to deposit chemically inert and thermally stable microporous materials . materials and processing methods are selected to achieve low - cost semiconductor batch fabrication of integrated semiconductor detectors . the microchip device provides in situ multisite analysis of binding strength as ambient conditions are varied . porous silicon materials are fabricated in oriented , pore arrays or random interconnected networks and with pore diameters selected over the range from 2 nm to several micrometers . porous silicon is produced most easily through electrochemical etching . it can be processed into two important pore structures , interconnected networks and oriented arrays . the pore diameter is tailored from approximately 2 nm to micrometer dimensions by selection of doping and electrochemical conditions . for n - type material , etching is thought to proceed through a tunneling mechanism in which electrons are injected into the pore surface through field concentration effects . in the case of p - type material the mechanism seems to be through moderation of carrier supply at the electrolyte / silicon interface . in practice , the following structures can be fabricated : i ) a dense interconnected network layer with porosity of 40 - 60 % and silicon filament size in the nanometer size regime . this is most easily obtained in lightly doped (& lt ; 1 ω - cm resistivity ) p - type silicon . ii ) a interconnected branched network of pores of typically 10 - nm diameter , axis preferentially oriented along & lt ; 100 & gt ; direction , and porosity of 30 - 80 % depending on etching conditions . this is obtained in p - type material of 10 − 1 to 10 − 2 ω - cm resistivity . iii ) dense oriented arrays of pores oriented with axis along & lt ; 100 & gt ; direction and with pore diameters in the range of 10 to 100 nm . obtained in p - type material with resistivity less than 10 − 2 ω - cm . iv ) dense oriented arrays of pores oriented along & lt ; 100 & gt ; direction and with pore diameters in the range less than 10 nm . obtained in n - type material with resistivity between 10 − 1 and 10 − 2 ω - cm . v ) dense oriented arrays of rectangular pores oriented with axis along & lt ; 100 & gt ; direction , rectangle side defined by { 001 } planes , and with pore diameters in the range less than 100 nm . obtained in p - type material with resistivity between 10 − 1 and 10 − 2 ω - cm . vi ) low density interconnected networks of large ( 1 - μm - diameter ) pores . this occurs in lightly doped n - type material . characterization can be undertaken by scanning electron microscopy . the surface wetting properties are varied using vapor treatment with silylation materials and chlorocarbons . high - porosity dielectrics which function as molecular sieves are produced by nuclear track etching . while nuclear track etching is used to produce these molecular sieves in a wide range of inorganic materials , it is most often used with dielectrics such as mica and sapphire . in this method , described in u . s . pat . no . 3 , 303 , 085 ( price , et al . ), a substrate is first bombarded with nuclear particles ( typically several mev alpha particles ) to produce disturbances or “ tracks ” within the normal lattice structure of the material and then wet - etched to produce pores which follow the tracks caused by the nuclear particles . more specifically , price et al . disclose that the exposure of a mica substrate to heavy , energetic charged particles will result in the formation of a plurality of substantially straight tracks in its lattice structure and that these tracks can be converted into pores by wet etching the substrate . pore sizes and overall porosity are variably controllable with pores typically 0 . 2 μm in diameter and densities on the order of 10 9 / cm 2 . particle track depths are energy dependent on the incident particle beam , but resulting pores can be extended through an entire 500 - μm - thick substrate . incorporation of these materials on the device structures shown above is readily accomplished . in addition , the use of implantation - etched dielectrics as the sensor element has advantages versus the porous silicon approach since the material is hydrophilic . a preferred device is the porous silicon array wafer with integral sample wells illustrated in fig3 . this may be constructed as follows : a four inch diameter , 100 μm thick wafer of crystalline silicon ( n - type , doped with 10 15 p / cm 3 ) with axis oriented along & lt ; 100 & gt ; direction is coated with photoresist and exposed to light through a mask to define a 50 × 50 array of 200 μm square areas having 200 μm space between them across the 2 cm × 2cm central area of the wafer . the process described by v . lehmann ( j . electrochem . soc . 140 ( 100 ): 2836 - 2843 ( 1993 )) is then used to create patches of closely spaced pores of diameter 2 - 5 μm , oriented perpendicular to the wafer surface , within each square area defined in the photolithographic step . a 300 μm thick wafer of silicon dioxide is coated with photoresist and exposed to light through the same mask used to define 200 μm square porous regions in the silicon wafer , and acid etching is conducted to create 200 μm square holes in the silicon dioxide wafer . the silicon dioxide wafer is then aligned with and laminated to the porous silicon wafer using a standard wafer bonding process to form the integral structure shown in the figure . during the high temperature annealing step , the silicon surface of each pore is oxidized to form a layer of silicon dioxide . the epoxysilane - amine linkage procedure described in example 4 is then carried out to covalently attach amine - containing biopolymer species to the walls of the pores . a stock solution of epoxysilane is freshly prepared with the following proportions : 4 ml 3 - glycidoxypropyl - trimethoxysilane , 12 ml xylene , 0 . 5 ml n , n - diisopropylethylamine ( hunig &# 39 ; s base ). this solution is flowed into the pores of the wafer , then the wafer is soaked for 5 hours in the solution at 80 ° c ., then flushed with tetrahydrofuran , dried at 80 ° c ., and placed in a vacuum desiccator over drierrite or stored in a desiccator under dry argon . oligonucleotide , bearing 5 ′- or 3 ′- alkylamine ( introduced during the chemical synthesis ) is dissolved at 10 μm - 50 μm in water and flowed into the porous silica wafer . after reaction at 65 ° c . overnight the surface is briefly flushed with water at 65 ° c ., then with 10 mm triethylamine to cap off the unreacted epoxy groups on the surface , then flushed again with water at 65 ° c . and air dried . as an alternative to attachment in water , amine - derivatized oligonucleotides can be attached to epoxysilane - derivatized glass in dilute ( eg ., 10 mm - 50 mm ) koh at 37 ° c . for several hours , although a higher background of nonspecific binding of target sample dna to the surface ( independent of base pairing ) may occur during hybridization reaction . a hamilton microlab 2200 robotic fluid delivery system , equipped with special low volume syringes and 8 - position fluid heads , capable of delivering volumes of 10 - 100 nl at 500 μm xyz stepping and a few percent precision . using this equipment 40 - nl samples of biomolecules ( e . g ., dna , olgionucleotides and the like ) are placed into the wells of the high density ncg wafer . a piezoelectrically controlled substage custom fitted for the microlab 2200 permits xy positioning down to submicron resolution . for 1 - nl samples , custom fabricated needles are employed . the eight - needle linear fluid head is operated in staggered repetitive steps to generate the desired close spacing across the wafer . the system has a large stage area and rapid motion control , providing the capacity to produce hundreds of replicate hybridization wafers . methods are known in the art ( microfab technologies , inc .) for delivering sub - nanoliter microdroplets of fluids to a surface at submicron precision . a microjet system capable of delivering subnanoliter dna solutions to the wafer surface is employed as follows : for placement of dna into individual hybridization sites within ultra - high density wafers , with volumes of one nl ( corresponding to a 130 μm sphere or 100 μm cube ) commercially available dispensing equipment using ink - jet technology as the microdispensing method for fluid volume below is employed . the droplets produced using ink - jet technology are highly reproducible and can be controlled so that a droplet may be placed on a specific location at a specific time according to digitally stored image data . typical droplet diameters for demand mode ink - jet devices are 30 - 100 μm , which translates to droplet volumes of 14 - 520 pl . droplet creation rates for demand mode ink - jet devices are typically 2000 - 5000 droplets per second . thus , both the resolution and throughput of demand mode inkjet microdispensing are in the ranges required for the ultrahigh density hybridization wafer . the microdispensing system is modified from a microfab drop - on - demand ink - jet type device , hereafter called a microjet device such that this type of device can produce 50 μm diameter droplets at a rate of 2000 per second . the operating principles of this type of device are known ( d . b . wallace , “ a method of characteristics model of a drop - on - demand ink - jet device using an integral drop formation method ,” asme publication 89 - wa / fe4 , december 1989 ) and used to effect the modification . to increase throughput , eight of these devices are integrated into a line array less than 1 inch ( 25 mm ) long . the eight devices are loaded with reagent simultaneously , dispense sequentially , and flush simultaneously . this protocol is repeated until all of the reagents are dispensed . most of the cycle time is associated with loading and flushing reagents , limiting the advantages of a complex of parallel dispensing capability . typical cycle time required is as on the following order : 1 minute for flush and load of 8 reagents ; 30 seconds to calibrate the landing location of each reagent ; 15 seconds to dispense each reagent on one location of each of the 16 genosensors , or 2 minutes to dispense all 8 reagents . total time to load and dispense 8 reagents onto 16 sensors is thus 3 . 5 minutes . total time for 64 reagents onto 16 sensors would be 28 minutes . the microdispensing system will consist of the subsystems listed below : a . microjet dispense head — an assembly of 8 microjet devices and the required drive electronics . the system cost and complexity are minimized by using a single channel of drive electronics to multiplex the 8 dispensing devices . drive waveform requirements for each individual device are downloaded from the system controller . the drive electronics are constructed using conventional methods . b . fluid delivery system — a beckman biomec is modified to act as the multiple reagent input system . between it and the microjet dispense head are a system of solenoid valves , controlled by the system controller . they provide pressurized flushing fluid ( deionized water or saline ) and air to purge reagent from the system and vacuum to load reagent into the system . c . x - y positioning system — a commercially available precision x - y positioning system , with controller , is used . resolution of 0 . 2 μm and accuracy of 2 μm are readily obtainable . the positioning system is sized to accommodate 16 sensors , but microjet dispense head size , purge station , and the calibration station represent the main factors in determining overall size requirements . d . vision system — a vision system is used to calibrate the “ landing zone ” of each microjet device relative to the positioning system . calibration occurs after each reagent loading cycle . also , the vision system locates each dispensing site on each sensor when the 16 sensor tray is first loaded via fiducial marks on the sensors . for economy , a software based system is used , although a hardware based vision system can be advantageously employed . e . system controller — a standard pc is used as the overall system controller . the vision system image capture and processing also reside on the system controller . in order to bind dna probes or targets within the pores of the microfabricated hybridization support , carry out the hybridization and washing steps , process the material for re - use , and potentially recover bound materials for further analysis , a means is provided for flow of liquids through the wafer . to enable flow of liquid through the hybridization wafer , it is packaged within a 2 mm × 4 mm polypropylene frame , which serves as an upper reservoir and structure for handling . a polypropylene vacuum chamber with a deltin o - ring around its upper edge to permit clamping of the wafer onto the vacuum manifold to form a seal is employed . the vacuum assembly is illustrated in fig4 . for control of fluid flow through the wafer a screw - drive device with feedback control is provided . oligonucleotides to be used in the present invention are synthesized by the phosphoramidite chemistry ( beaucage , s . l . and caruthers , m . h . 1981 . tet . lett . 22 : 1859 - 1862 ) using the segmented synthesis strategy that is capable of producing over a hundred oligonucleotides simultaneously ( beattie , k . l ., logsdon , n . j ., anderson , r . s ., espinosa - lara , j . m ., maldonado - rodriguez , r . and frost , j . d . iii . 1988 . biotechnol . appl . biochem . 10 : 510 - 521 ; beattie , k . l . and fowler , r . f . 1991 . nature 352 : 548 - 54926 , 27 ). the oligonucleotides can be derivatized with the alkylamino function during the chemical synthesis , either at the 5 ′- end or the 3 ′- end . optimal procedures for attachment of dna to silicon dioxide surfaces are based on well - established silicon chemistry ( parkam , m . e . and loudon , g . m . ( 1978 ) biochem . biophys . res . commun ., 1 : 1 - 6 ; lund , v ., schmid , r ., rickwood , d . and hornes , e . ( 1988 ) nucl . acids res . 16 : 10861 - 10880 ). this chemistry is used to introduce a linker group onto the glass which bears a terminal epoxide moiety that specifically reacts with a terminal primary amine group on the oligonucleotides . this versatile approach ( using epoxy silane ) is inexpensive and provides a dense array of monolayers that can be readily coupled to terminally modified ( amino - or thiol - derivatized ) oligonucleotides . the density of probe attachment is controlled over a wide range by mixing long chain amino alcohols with the amine - derivatized oligonucleotides during attachment to epoxysilanized glass . this strategy essentially produces a monolayer of tethered dna , interspersed with shorter chain alcohols , resulting in attachment of oligonucleotides down to 50 å apart on the surface . variable length spacers are optionally introduced onto the ends of the oligonucleotides , by incorporation of triethylene glycol phosphoryl units during the chemical synthesis . these variable linker arms are useful for determining how far from the surface oligonucleotide probes should be separated to be readily accessible for pairing with the target dna strands . thiol chemistry , adapted from the method of whitesides and coworkers on the generation of monolayers on gold surfaces ( randall lee , t ., laibinis , p . e ., folkers , j . p . and whitesides , g . m . ( 1991 ) pure & amp ; appl . chem . 63 : 821 - 828 and references cited therein . ), is used for attachment of dna to gold and platinum surfaces . dithiols ( e . g ., 1 , 10 - decanedithiol ) provide a terminal , reactive thiol moiety for reaction with bromoacetylated oligonucleotides . the density of attachment of dna to gold or platinium surfaces is controlled at the surface - activation stage , by use of defined mixtures of mono - and dithiols . part b : surface immobilization of recombinant vector dna , cdna and pcr fragments the chemical procedures described above are used most advantageously for covalent attachment of synthetic oligonucleotides to surfaces . for attachment of longer chain nucleic acid strands to epoxysilanized glass surfaces , the relatively slow reaction of surface epoxy groups with ring nitrogens and exocylic amino groups along the long dna strands is employed to achieve immobilization . through routine experimentation , optimal conditions for immobilization of unmodified nucleic acid molecules at a few sites per target are defined , such that the bulk of the immobilized sequence remains available for hybridization . in the case of immobilization tonanochannels coated with platinum or gold , hexylamine groups are first incorporated into the target dna using polymerization ( pcr or random priming ) in the presence of 5 - hexylamine - dutp , then a bromoacetylation step is carried out to activate the dna for attachment to thiolated metal surfaces . again , routine experimentation is employed ( varying the dttp / 5 - hexylamine - dutp ratio and the attachment time ) to define conditions that give reproducible hybridization results . the foregoing procedure ( omitting the bromoacetylation step ) can also serve as an alternative method for immobilization of target dna to glass surfaces . based upon quantitative measurements of the attachment of labeled oligonucleotides to flat glass and gold surfaces , the end attachment places the probes 50 - 100 å apart on the surface , corresponding to up to 10 8 probes in a 50 μm × 50 μm area . approximately 10 10 - 10 11 oligonucleotide probes can be tethered within a 50 μm cube of porous silicon in the nanofabricated wafer . the density of bound oligonucleotides per cross sectional area is estimated by end - labeling prior to the attachment reaction , then quantitating the radioactivity using the phosphorimager . known quantities of labeled oligonucleotides dried onto the surface are used to calibrate the measurements of binding density . from data on the covalent binding of hexylamine - bearing plasmid dna to epoxysilanized flat glass surfaces in mild base , it is known that at least 10 7 pbr322 molecules can be attached per mm 2 of glass surface . based on this density within the pores of the nanofabricated wafer , immobilization of 10 9 - 10 10 molecules of denatured plasmid dna per mm 2 of wafer cross section are achieved . the target dna ( analyte ) is prepared by the polymerase chain reaction , incorporating [ 32 p ] nucleotides into the product during the amplification or by using gamma - 32 p [ atp ]+ polynucleotide kinase to 5 ′- label the amplification product . unincorporated label is removed by centricon filtration . preferably , one of the pcr fragments is 5 ′- biotin - labeled to enable preparation of single strands by streptavidin affinity chromatography . the target dna is dissolved in hybridization buffer ( 50 mm tris - hcl , ph 8 , 2 mm edta , 3 . 3m tetramethylammonium chloride ) at a concentration of at least 5 nm ( 5 fmol / μl ) and specific activity of at least 5 , 000 cpm / fmol . pcr fragments of a few hundred bases in length are suitable for hybridization with surface - tethered oligonucleotides of at least octamer length . the target dna sample is flowed into the porous regions of the chip and incubated at 6 ° c . for 5 - 15 minutes , then washed by flowing hybridization solution through the porous chip at 18 ° c . for a similar time . alternatively , hybridization can be carried out in buffer containing 1m kcl or nacl or 5 . 2m betaine , in place of tetramethylammonium chloride . part c : optimization of hybridization selectivity ( discrimination against mismatch - containing hybrids although the experimental conditions described above generally yield acceptable discrimination between perfect hybrids and mismatch - containing hybrids , some optimization of conditions may be desirable for certain analyses . for example , the temperature of hybridization and washing can be varied over the range 5 ° c . to 30 ° c . for hybridization with short oligonucleotides . higher temperatures may be desired for hybridization using longer probes . the detection and quantitation of hybridization intensities is carried out using methods that are widely available : phosphorimager and film . the biorad phosphorimager has a sample resolution of about 100 μm and is capable of registering both beta emission and light emission from chemiluminescent tags . reagent kits for chemiluminescence detection available from millipore and new england nuclear , which produce light of 477 and 428 nm , respectively , are advantageously used with the biorad instrument . chemiluminescent tags are introduced into the target dna samples ( random - primed vector dna or pcr fragments ) using the procedures recommended by the supplier . thereafter , the dna is hybridized to the nanoporous wafers bearing oligonucleotide probes . radioactive tags ( 32 p and 33 p , incorporated by random priming and pcr reaction ) are also used in these experiments . film exposure is used for comparison . in the case of hybridization of labeled oligonucleotides with surface - immobilized target dnas , most preferably the radioactive tags ( incorporated using polynucleotide kinase ) are used , since optimal chemiluminescent tagging procedures for oligonucleotides are generally not available . ccd genosensor devices are capable of maximum resolution and sensitivity and are used with chemiluminescent , fluorescent and radioactive tags ( lamture , j . l ., varma , r ., fowler , r ., smith , s ., hogan , m ., beattie , k . l ., eggers , m ., ehrlick , d ., hollis , m . and kosicki , b . 1993 . nature , submitted ). genosensor experiment ; mutation detection in exon 7 / 8 region of hamster hprt gene the hprt gene is used extensively as a model system for studies of mutation . the gene has been cloned and sequenced from several mammals . a variety of mutations in this gene are known and were characterized by dna sequencing , in the hamster ( induced by chemicals and radiation in chinese hamster ovary cell lines ) and from humans ( associated with lesch nyhan syndrome ). a significant fraction of hprt mutations are found in a short region of the gene encoded by exons 7 and 8 . the nucleotide sequence of the normal and mutant genes are found in the following references : edwards , a ., voss , h ., rice , p ., civitello , a ., stegemann , j ., schwager , c ., zinimermann , j ., erfle , h ., caskey , c . t . and ansorge , w . ( 1990 ), automated dna sequencing of the human hprt locus , genomics , 6 : 593 - 608 ; gibbs , r ., nguyen , p .- n ., edwards , a ., civitello , a . and caskey , c . t . ( 1990 ), multiplex dna deletion detection and exon sequencing of the hypoxanthine phosphoribosyltransferase gene in lesch - nyhan families , genomics , 7 : 235 - 244 ; yu , y ., xu , z , gibbs , r . and hsie , a . ( 1992 ), polymerase chain reaction - based comprehensive procedure for the analysis of the mutation spectrum at the hypoxanthine - guanine phosphoribosyltransferase locus in chinese hamster cells , environ . mol . mutagen ., 19 : 267 - 273 ; and xu , z ., yu , y ., gibbs , r ., caskey , c . t . and hsie , a . ( 1993 ), multiplex dna amplification and solid - phase direct sequencing at the hprt locus in chinese hamster cells , mutat . res ., 282 : 237 - 248 . the nucleotide sequence of the cdna of hamster hprt exon 7 / 8 region is listed as follows : ( seq id no : 1 ) 500 520 540 gcaagcttgc tggtgaaaag gacctctcga agtgttggat ataggccaga ctttgttgga 560 580 600 tttgaaattc cagacaagtt tgttgttgga tatgcccttg actataatga gtacttcagg gatttgaatc the following represents the nucleotide sequence of hamster hprt genomic dna in the exon 7 / 8 region where the cho mutations are depicted above ( l ) and the human ( h ) and mouse ( m ) sequence differences below ( l ). the dna sequence which begins with “ 5 ′- aacagcttg ” and which ends with “ 5 ′- gactgtaag ” is designated as seq id no : 2 for sequences of hamster , human and mouse and seq id no : 3 for the sequence of cho cells . the remaining dna , beginning with “ 5 ′- tacagttgt ” and ending with “ gaatgtaat ” is designated as seq id no : 4 for sequences of hamster , human and mouse and seq id no : 5 the sequence of cho cells . ---------- ↑ - aacagcttgctggtgaaaaggacctctc gaagtgttgg atataggccag ↓ ↓ ↓ ↓ c a c a h h m h g - ↑ ↑ actgtaag ---- tacagttgttggatttg a aattccag a caagtttgttg + a c ↑ ↑ ttggatatgcccttgactat aa tgagtacttcag g atttgaatgt aat - ↓ ↓ ↓ a a a h h h the small letters in the beginning of the sequence represent intron sequence on the 5 ′- side of exon 7 . some flanking intron sequence between exons 7 and 8 is shown ( in small letters ) on the second line , and at the end there is again a small stretch of intron sequence following exon 8 . underlined bases in the sequence represent mutations for which dna samples are available , which can be used to demonstrate that a dna chip targeted to this region can detect and identify mutations . above the sequences are displayed mutations in hamster ( cho ) cells induced by chemicals and radiation , including a 10 - base deletion ( top line ), single base deletion ( second line ), single base insertion ( third line ) and single base substitutions ( second and third lines ). below the sequences are shown single base differences between hamster and human ( h ) and mouse ( m ). the set of oligonucleotide probes ( of 8 mer - 10 mer in length ) overlapping by two bases across the exon 7 / 8 region is depicted below for seq id nos : 2 - 5 : ---- 2 ---- ---- 4 ---- ---- 6 ---- ---- 1 ---- ---- 3 ---- ---- 5 ---- -- 7 -- - aacagcttgctggtgaaaaggacctctc gaagtgttgg atataggccag ↓ ↓ ↓ ↓ ↓ c a - 10 c a ---- 8 ----- ---- 10 ---- - 12 - - 7 - ---- 9 ----- ---- 11 --- actgtaag ---- tacagttgttggatttg a aattccag a caagtttgttg ↓ ↓ g - -- 12 - ---- 14 --- ---- 16 ---- ---- 18 --- ---- 13 --- ---- 15 --- ---- 17 --- ttggatatgcccttgactat aa tgagtacttcagg g atttgaatgtaat ↓ ↓ ↓ ↓ a + a a a c this set of probes is selected to detect any of the mutations in this region , and the lengths are adjusted to compensate for base composition effects on in duplex stability ( longer probes for at - rich regions ). the sequences of probes and primers are given in table i , as follows : table i oligonucleotides for hprt mutation detection pcr primers for exons 7 & amp ; 8 : name sequence ( 5 - 3 ) mhex71 gttctattgtctttcccatatgtc ( seq id no : 6 ) mhex82 tcagtctggtcaaatgacgaggtgc ( seq id no : 7 ) hex81 ctgtgattctttacagttgttgga ( seq id no : 8 ) hex82 cattaattacattcaaatccctgaag ( seq id no : 9 ) 9mer with amine at 5 ′- end : name sequence ( 5 ′-& gt ; 3 ′) − a ( 554 ) tgctggaat + a ( 586 / 7 ) actcatttata ( seq id no : 10 ) − 10 ( 509 - 518 ) tatatgagag ( seq id no : 11 ) a - g ( 545 ) attccaaatc ( seq id no : 12 ) g - c ( 601 ) caaatgcct 1 agcaagctg 2 tttcaccag 3 aggtccttt 4 cttcgagag 5 tccaacact 6 gcctatatc 7 agtctggc 8 tccaacaact ( seq id no : 13 ) 9 atttcaaatc ( seq id no : 14 ) 10 gtctggaat 11 acaaacttgt ( seq id no : 15 ) 12 tccaacaac 13 gggcatatc 14 tagtcaagg 15 actcattata ( seq id no : 16 ) 16 ctgaagtac 17 caaatccct 18 aattacattca ( seq id no : 17 ) a high - density or ultra - high density microfabricated device according to the above examples is constructed and attachment of oligonucleotide probes is carried out within the bounded regions of the wafer . included are the normal probes ( 1 - 18 ) plus the specific probes that correspond to five different known mutations , including the above mutations ( sites 19 and 20 , respectively ). the foregoing uses two sets of pcr primers ( table i ) to amplify the exons 7 / 8 region of hamster genomic dna . a radioactive label ( 32 p ) is incorporated into the pcr fragments during amplification , which enables detection of hybridization by autoradiography or phosphorimager . fig5 illustrates the results when the above probes are attached at one end to the surface at specific test sites within the dna chip ( numbered as above ). idealized hybridization patterns for two of the mutants ( 10 - base deletion on left and a - g transition on right ) are shown at the bottom . profiling of gene expression using cdna clones arrayed in porous silicon the procedure outlined in example 3 for fabrication of a porous silicon wafer with integral sample wells is followed , to yield a wafer with a 50 × 50 array of 200 μm square patches of pores , spaced 400 μm apart ( center - to - center ) over the surface of the wafer . the pores of the wafer are activated to bind amine - derivatized polynucleotides by reaction with epoxysilane , as described in example 4 . a set of 2 , 500 m13 clones , selected from a normalized human cdna library , is subjected to the polymerase chain reaction ( pcr ) in the presence of 5 ′- hexylamine - dutp to amplify the cdna inserts and incorporate primary amines into the strands . the pcr products are ethanol - precipitated , dissolved in water or 10 mm koh , heat - denatured at 100 ° c . for 5 min ., then quenched on ice and applied to individual sample wells of the porous wafer suing a hamilton microlab 2200 fluid delivery system equipped with an 8 - needle dispensing head . after all cdna fragments are dispensed , a slight vacuum is briefly applied from below to ensure that fluid has occupied the pores . following incubation at room temperature overnight or at 60 ° c . for 30 - 60 minutes , the porous wafer is flushed with warm water , then reacted with 50 mm triethylamine to cap off the unreacted epoxy groups on the surface , then flushed again with warm water and air dried . part c : preparation of labeled pcr fragments representing the 3 ′- regions of expressed genes cytoplasmic rna is extracted from cultured cells by the method of chomczynski and sacchi ( anal . biochem . 162 : 156 - 159 ( 1993 )), treated with dnase i to remove dna contamination , then extracted with phenol / chloroform and ethanol precipitated . reverse transcriptions and pcr are performed as described in the “ differential display ” protocol of nishio et al . ( faseb j . 8 : 103 - 106 ( 1994 )). prior to hybridization , pcr products are labeled by random priming in the presence of [ a - 32 p ] dntps , and unincorporated label is removed by centricon filtration . prior to hybridization , a solution of 1 % “ blotto ” or 50 mm tripolyphosphate is flowed through the porous silicon wafer to minimize the nonspecific binding of target dna , then the porous silicon array is washed with hybridization solution ( 50 mm tris - hcl , ph 7 . 5 , 1 mm edta , 1m nacl ). labeled pcr fragments representing the 3 ′- end of expressed genes are recovered from the centricon filtration units in hybridization buffer , and the entire porous wafer is flooded with this dna solution . the porous hybridization module is placed at 65 ° c . and a peristaltic pump , connected to the lower vacuum chamber , is used to gradually flow the labeled dna through the pores of the wafer over the course of 30 - 60 minutes . the porous wafer is washed three times with hybridization buffer at 65 ° c . following hybridization and washing , the porous wafer is briefly dried , then placed onto the phosphor screen of a phosphorimager and kept in the dark for a period of time determined by the intensity of label . the phosphor screen is then placed into the phosphorimager reader for quantitation of individual hybridization signals arising from each porous region in the array . fig6 illustrates results obtainable from a hybridization experiment . total cytoplasmic mrna is isolated from cells cultured under two conditions and subjected to the “ differential display ” procedure described above to prepare fragments representative of individual mrna species present under the two conditions . these samples are hybridized to two identical cdna arrays , to yield the two hybridization signal patterns shown . these patterns represent the profile of expressed genes under the two different culture conditions ( for example in the presence and absence of a drug or chemical that induces a change in the expression of some genes ). note that overall , the pattern of hybridization is similar for the two conditions , but as expected for a diffential expression of certain genes under the two conditions , there are a few hybridization signals that are seen only for culture condition 1 and a few that are seen only for culture condition 2 . the box in the lower left , reproduced at the bottom of the figure to assist visual comparison , represents several differences in the gene expression profile . the squares represent sites where hybridization has occurred and the darkness of the squares is proportional to the number of labeled fragments present at each site .	8
with reference to the drawings , explanation is now made below on embodiments according to the present invention . referring to fig2 , there is illustrated a block diagram showing a construction of a real - time ultrasonic diagnostic apparatus using a probe incorporating an electronic circuit , according to a first embodiment of the invention . in fig2 , the ultrasonic diagnostic apparatus of this embodiment includes an ultrasonic probe 10 , and an ultrasonic diagnostic apparatus proper 50 to which the ultrasonic probe 10 is connected through a proper - end probe connector 40 . the ultrasonic probe 10 is made up with a probe handle 12 , a probe cable 14 having one end connected to the probe handle 12 , and a probe connector 16 connected to the other end of the probe cable 14 . the probe handle 12 is made up with an ultrasonic vibrator group 20 , a pulser group 22 , a preamplifier group 24 , a sub - array beam former group 26 , and an in - probe - handle control circuit 28 for placing those under control . the ultrasonic vibrator group 20 are arranged , say , in an n × m array form as referred later , to transmit and receive an ultrasonic wave to and from a subject 30 ( e . g . heart ). the pulser group 22 is connected to the ultrasonic vibrator group 20 , to drive the ultrasonic vibrator group 20 in accordance with the different timing generated by the in - probe - handle control circuit 28 , thus generating an ultrasonic beam having a predetermined directivity . due to this , an ultrasonic beam is to be irradiated from the ultrasonic vibrator 20 to the subject 30 , according to an electric signal from the pulser group 22 . the preamplifier group 24 is to perform processing such as low - noise amplification and buffering in order to favorably obtain a weak ultrasonic echo signal to be received at the ultrasonic vibrator group 20 , by transmitting the ultrasonic beam from the ultrasonic vibrator group 20 in a manner to reflect upon an interface where acoustic impedance is different , e . g . boundary of textures of the subject 30 and obtain information about the structure , movement , etc . of the subject 30 . the sub - array beam former group 26 is to sum up the output signals of from the preamplifier group 24 by providing a delay time based on each group of several channels , thereby reducing the number of the output signal lines of from the ultrasonic probe 10 . this reduces the number of probe cables 14 . the in - probe - handle control circuit 28 is to take control the operations of the pulser group 22 , the preamplifier group 24 and the sub - array beam former group 26 . according to the control signal of from the in - probe - handle control circuit 28 , the preamplifier group 24 is set with operating conditions , e . g . bias current , on its element - by - element basis . the probe handle 12 and the probe connector 16 are connected together through the probe cable 14 . the probe connector 16 incorporates therein an electronic circuit group 34 configured by a plurality of electronic circuits and an in - probe - connector control circuit 36 . the electronic circuit group 34 is to perform additional processing , such as amplification , buffering and band adjustment , on the ultrasonic echo signal , as required . meanwhile , the in - probe - connector control circuit 36 is to control the operation of the electronic circuit group 34 , and to generate a control signal , delivered from the in - probe - handle control circuit 28 , on the basis of the control signal received from the ultrasonic diagnostic apparatus proper 50 , referred later . the ultrasonic diagnostic apparatus proper 50 is configured with an in - proper preamplifier group 52 , an in - proper reception - delay addition circuit 54 , a signal processing section 56 , an image processing section 58 , a display section 60 , an in - proper transmission - delay circuit 62 , an in - proper pulser group 64 , an in - proper control circuit 66 and an operation panel 68 . the in - proper preamplifier group 52 is to amplify the ultrasonic echo signals that were first subjected to reception - delay addition at the ultrasonic probe 10 on the group - by - group basis of several channels . the ultrasonic echo signals amplified are matched in timing together by the in - proper reception - delay addition circuit 54 . the ultrasonic echo signals are then detected by the signal processing section 56 , to extract an envelope . furthermore , the ultrasonic echo signals , extracted of the envelope , are transformed in coordinate in accordance with a sectional plane of the subject 30 at the image processing section 58 , processed in intensity level suitably for image display or so , thus being displayed on the display section 35 . this allows the display section 60 to display in real time the shape information about the subject , as shown in fig3 . meanwhile , the in - proper control circuit 66 is to control the operation of the processing sections in the ultrasonic diagnostic apparatus proper 50 and to supply control information to the in - probe - connector control circuit 36 of the probe connector 16 . the operation panel 68 is input means for the operator to input or select information , e . g . to execute a continuous wave doppler ( scw ) mode in which beam steering is available , as an operation mode . incidentally , the in - proper transmission - delay circuit 62 and the in - proper pulser group 64 are to be operated where the ultrasonic probe does not incorporate an electronic circuit , i . e . where the usual probe is connected to drive the ultrasonic vibrators 20 by the ultrasonic diagnostic apparatus proper 50 . it is usually incorporated in the ultrasonic diagnostic apparatus proper 50 but may be omitted to provide . referring to the flowchart of fig4 , description is now made on the ultrasonic diagnostic apparatus according to the first embodiment of the invention . when power is put on by means of a not - shown power supply , the present routine is started . at step s 1 , a control code is transferred to the preamplifier group 24 at all the channels , to establish a basic bias current ib . from the vibrator group 70 in a 2d n × m array arrangement as shown in fig5 a , ultrasonic echo signals amplified at the n × m preamplifier group 24 are transferred to the ultrasonic diagnostic apparatus proper 50 . the in - proper preamplifier group 52 amplifies the ultrasonic echo signals that were first subjected to reception - delay addition at the ultrasonic probe 10 on the group - by - group basis of several channels . the ultrasonic echo signals are matched in timing at the in - proper reception - delay addition circuit 54 and detected by the signal processing section 56 , to extract an envelope . then , the image processing section 58 transforms those in coordinate in accordance with a sectional plane of the subject 30 and processed in intensity level suited for image display . this allows the display section 60 , at step s 2 , to display an image in the usual mode , e . g . b mode . in this state , observation is assumed conducted in the scw mode . thereupon , at step s 3 , the operator is to select an scw mode by operating the operation panel 68 of the ultrasonic diagnostic apparatus proper 50 . in this case , an scw mode is selected by putting on a not - shown switch on the operation panel 68 . based on the input to the operation panel 68 , the in - proper control circuit 66 sets up the ultrasonic diagnostic apparatus proper 50 to operate in the scw mode . simultaneously , a control signal is supplied to the in - probe - connector control circuit 36 of the ultrasonic probe 10 . thereupon , the in - probe - connector control circuit 36 regulates the control signal into a form to be processed by the in - probe - handle control circuit 28 . thus , the regulated control signal ( control code ) is conveyed to the in - probe - handle control circuit 28 . in the in - probe - handle control circuit 28 , the pulser group 22 and the preamplifier group 24 are controlled based on the control signal . this divides the 2d n × m array arrangement of vibrator group 70 , into an area 70 a for transmission of an ultrasonic wave and an area 70 b for reception , as shown in fig5 b . at step s 4 , the in - probe - handle control circuit 28 transfers a control code to turn off the pulser group 22 lying under the scw reception area 70 b . furthermore , at the next step s 5 , the in - probe - handle control circuit 28 transfers a control code to turn off the preamplifier group 24 a lying under the scw transmission area . then , at step s 6 , control is made to add the bias current ib , usually used at the hpreamplifier group 24 a , to the bias current ib to the preamplifier 24 b lying under the scw reception area 70 b as shown in fig5 a . in the usual pulse transmission / reception mode , the 2d n × m array 70 serves for transmission / reception at all of its elements as shown in fig5 a . in such a case , the bias current to the n × m preamplifier group 24 is given ib . in the scw mode , the probe is used separated in region , i . e . a region for transmission and a region for reception . namely , division is as an ( n / 2 )× m array ( scw transmission area ) 70 a and an ( n / 2 )× m array ( scw reception area ) 70 a , as shown in fig5 b . for this reason , the preamplifier group 24 is turned off ( bias current rendered 0 ) at its ( n / 2 )× m elements in a region to be connected to the scw transmission area 70 . the bias current ( ib ), being supplied to the preamplifier group 24 a lying under the scw transmission area , is added to the bias current to the preamplifier group 24 b lying under the scw reception area . namely , the bias current , for the preamplifier group 24 b lying under the scw reception area , is given as ib + ib (= 2ib ). thus , the bias current is increased . incidentally , consumption power does not increase at the incorporated electronic circuit because the increase of bias current corresponds to the amount of consumption at the preamplifiers to be desirably put off . in this embodiment , by controlling the probe - handle 12 consumption power not to exceed a predetermined value , the preamplifiers lying under the area for scw reception can be operated to favorably amplify the extremely slight doppler signal that is superposed on a high - amplitude clutter ( reflection from the heart wall , etc .) at less noise and in an improved dynamic range without increasing the generation heat at the probe handle 12 . as a result , an ultrasonic wave is transmitted at a center frequency f 0 to the blood flowing through the subject . by moving blood corpuscles together with the slow movement of the heart and blood vessel walls , a weak ultrasonic echo based on the transmission beam frequency is favorably received at a frequency f 0 + fd experienced a doppler shift in proportion to the blood velocity , in a state superposed on a great - amplitude clutter component resulting from the slow movement of the heart and blood cell wall , etc . by detecting the doppler shift frequency fd and displaying the change thereof in time , blood velocity information is displayed as an scw doppler image as shown in fig6 . now description is made on a second embodiment according to the invention . in the first embodiment , the ultrasonic vibrator group 20 and preamplifier group 24 were divided by on the software under control of the in - proper control circuit 66 , in - probe - connector control circuit 36 and in - probe - handle control circuit 28 . the second embodiment is to divide the ultrasonic vibrator group 20 and preamplifier group 24 by means of hardware . from now on , the second embodiment of the invention is described . incidentally , the real - time ultrasonic diagnostic apparatus , using a probe incorporating an electronic circuit , is similar in configuration to that of the first embodiment . hence , by attaching identical reference numeral to identical element to thereby omit to explain , i . e . explanation will be made only on the operation . referring to fig7 , there is illustrated a flowchart explaining the operation of the ultrasonic diagnostic apparatus , according to the second embodiment of the invention . when putting on power by means of a not - shown power supply , the present routine is started . at step s 11 , a basic bias current ib is supplied through an exclusive line to the preamplifier group 24 at all the channels . then , the in - proper preamplifier group 52 amplifies the ultrasonic echo signals subjected to the first reception - delay addition on the group - by - group basis of several channels at the ultrasonic probe 10 . the amplified ultrasonic echo signals are matched in timing at the in - proper reception - delay addition circuit 54 and then detected at the signal processing circuit 56 , to be extracted of an envelope . then , those are transformed in coordinate matched to the sectional plane of the subject 30 at the image processing section 58 and processed in intensity level suitably for image display . this allows the display section 60 , at step s 12 , to display an image in the usual mode , e . g . b mode . in this state , observation is conducted at step s 13 in the scw mode . thereupon , the operator selects an scw mode by operating the operation panel 68 of the ultrasonic diagnostic apparatus proper 50 . in this case , scw mode is selected by putting on a not - shown switch on the operation panel 68 . based on the input to the operation panel 68 , the in - proper control circuit 66 sets the ultrasonic diagnostic apparatus proper 50 to operate in the scw mode . simultaneously , a control signal is supplied to the in - probe - connector control circuit 36 of the ultrasonic probe 10 . thereupon , the in - probe - connector control circuit 36 regulates the control signal into a form to be processed by the in - probe - handle control circuit 28 within the probe handle 12 . the regulated control signal ( control code ) is supplied to the in - probe - handle control circuit 28 . based on the control signal , the in - probe - handle control circuit 28 controls the pulse group 22 and the preamplifier group 24 . this divides the 2d n × m array arrangement vibrator group 70 into an area 70 a for transmission of an ultrasonic wave and an area 70 b for reception , as shown in fig5 b . at step s 14 , power is turned off to the pulser group 24 lying under the scw reception area 70 b . namely , the power line or the bias current is shut off by means of a relay or semiconductor switch provided , say , on the in - probe - handle control circuit 28 . furthermore , at the following step s 15 , power is shut off to the preamplifier 24 lying under the scw transmission area . namely , the power line or the bias current is shut off by means of a relay or semiconductor switch provided , say , in the in - probe - handle control circuit 28 . then , at step s 16 , to the preamplifier group 24 is supplied a bias current 2ib in an amount double the bias current ib usually used on the exclusive line as shown in fig5 a . with this structure , consumption power does not increase at the incorporated electronic circuit because the increase of bias current corresponds to the amount of consumption at the preamplifiers that are desirably to be put off . incidentally , in the second embodiment , the hardware was exemplified with the relay or semiconductor switch provided in the in - probe - handle control circuit 28 and for turning off the power to the pulser group 22 and preamplifier group 24 . however , this is not limitative , e . g . it may be provided in the pulser group 22 , the preamplifier group 24 or the like . in the first and second embodiments , the consumption power at the preamplifier group is naturally controlled in its total amount not to exceed the upper limit thereof even if changing the ratio of transmission and reception areas at the ultrasonic vibrators . although the first and second embodiments described the two - dimensional array case of the ultrasonic vibrator group 20 , it is not limitative . application is similarly possible to the array vibrators arranged in a one - dimensional or irregular form . the preamplifier group 24 is not limited to the incorporation in the probe handle 12 . it can be built in the probe connector 16 , in which case effects are similarly obtainable . furthermore , scw mode is not limitative but application is possible quite similarly as to the mode to use by separating the ultrasonic vibrator group 20 into different purposes of operating areas . although the invention was described by way of the embodiment , the invention is to be modified in the scope not departing from the gist thereof besides the embodiment described so far . furthermore , the foregoing embodiment includes various aspects of the invention , wherein various inventions are to be extracted by suitably combining a plurality of constituent elements disclosed . for example , in case certain elements are deleted from all the elements disclosed in the embodiment , the structure deleted of the elements is to be extracted as an invention where the problem mentioned in the introductory part can be solved and the effect therein can be obtained . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents .	0
as described above , using a manual override or reset tool an operator can reset a lock cylinder by putting it into a learn mode without requiring a valid key . this reset operation could sometimes prove challenging because of the number of actions to perform while holding a compact lock cylinder . the present invention is a reset cradle for manually resetting a quick rekey cylinder without need of a valid key , thereby allowing easier manual reset thereof , and especially for recovery of a blown cylinder of a rekeyable lock assembly . fig2 is a perspective exploded view of the reset cradle 2 according to one embodiment of the present invention . the reset cradle 2 includes a housing 22 with central recess 24 extending there through configured to receive and seat the lock cylinder 10 . as seen in fig3 the housing 22 further comprises an annular hub 124 rotatably attached to a base 126 . annular hub 124 is a hollow cover that flares outward from a central aperture 125 . the annular hub 124 rotatably seats against a peripheral groove 128 formed in the base 126 , thereby enclosing an upwardly protruding tubular post 130 formed integrally on the base 126 . the post 130 forms a hollow cylinder that defines the central recess 24 for receiving the lock cylinder 10 . post 130 protrudes axially from base 126 so that when hub 124 is seated in groove 128 the cylindrical walls of post 130 conform to the aperture 125 in hub 124 . the base 126 is formed with a recess 127 ( obscured in fig3 , see fig6 ) in its underside immediately beneath the post 130 . a spring - loaded annular driver 160 is rotatably journalled in the recess 127 in base 126 . the driver 160 is a hollow annular member having an inwardly - directed radial pin 161 for engaging the lock cylinder when inserted into the reset cradle 2 . the driver 160 has a flange 168 at the bottom for anchoring an extension spring 166 . the other end of extension spring 166 is connected internally to the base 126 for biasing rotation of the driver 160 with respect to the base 126 , providing a spring - return to a home position . the driver 160 also has an outwardly protruding arm 163 that engages a cam as described below . a washer 162 and screw 164 are secured to the bottom of the base 126 to trap driver 160 within the bottom recess . the driver 160 is held captive in the base 126 by a washer 162 screwed into the bottom of the base 126 . fig4 is an isolated view of the driver 160 with flange 168 there beneath . a compression pin 169 is inserted into a bore hole in the flange 168 for anchoring the extension spring 166 for spring - return to a home position . fig4 also provides perspective of the outwardly protruding arm 163 that engages the cam described below . the inwardly - directed axial pin 161 is inserted into a bore - hole in the wall of driver 160 for engaging the lock cylinder once inserted into the reset cradle 2 . the axial pin 161 fits into a notch formed in the lowermost edge of the lock cylinder for turning the cylinder . the bore - hole may be formed as a slot to give the axial pin 161 a limited degree of freedom in order to accommodate lock cylinders of different lengths . referring back to fig3 , a two - section cam 132 formed of halves 132 a and 132 b is rotatably seated on the post 130 inside base 126 . the cam 132 can move rotationally along with hub 124 with respect to the base 126 . the inner surface of cam 132 comprises a camming surface that radially displaces two operative components mounted in the post 130 of base 126 . as the cam 132 rotates around the post 130 of base 126 to a first position , it radially displaces , within a particular order and timing , the two working components both being housed inside the base 126 as will be described . these working components engage the lock cylinder , and are generally spring biased outward so they will return to their starting position once their particular functions are completed . the cam 132 is also formed with a downwardy - protruding finger 133 for engagement with the arm 163 of driver 160 . note also that the finger 133 protrudes laterally from the cam 132 to key the cam 132 to the hub 124 for rotation therewith . as the cam 132 rotates past the first position to a second position the finger 133 of cam 132 engages arm 163 of driver 160 and rotates the driver , which in turn rotates , the plug 40 ( see fig1 ) with respect to the cylinder body 12 . rotation of the plug 40 by 90 degrees with respect to the cylinder body 12 moves the locking bar 94 into the recess inside the cylinder body 12 , which releases the locking bar 94 , allowing a learn tool 200 to be inserted . fig5 is an enlarged illustration of the bottom of the reset cradle 2 showing the downwardly - protruding finger 133 of cam 132 which , at a predetermined angle of rotation , engages the outwardly protruding arm 163 of driver 160 . the driver 160 wields the inwardly - directed axial pin 161 that engages the edge of the lock cylinder ( here inserted into the reset cradle 2 ). consequently , turning the hub 124 of housing 22 past the first position causes the cam 132 to begin to drive the driver 160 , which in turn engages the pin 161 to rotate the lock cylinder seated therein . the cam 132 is formed with an interior camming surface . as mentioned above , as the cam 132 rotates around the post 130 of base 126 , this camming surface radially displaces , within a particular order and timing , two working components both being housed inside the base 126 . referring back to fig3 , one of these components is a reset member 150 comprising a shoulder with a plurality of protruding prongs . the reset member 150 generally fulfills the function of the rekeying tool 310 described in the background section with regard to fig1 , and the protruding prongs insert into the cylinder body to manually position the cylinder racks and pins to release the locking bar of the lock cylinder . however , in the context of the reset cradle 2 the operation of the reset member 150 becomes automatic . the shoulder of the reset member 150 is rounded and seats within an alcove 137 formed along the inner wall of the cam 132 . the forefront of the reset member 150 is slidably seated in a notch formed through the post 130 in base 126 , and is spring - biased outward by a pair of springs 152 that engage the post 130 . this way , as the hub 124 , and hence cam 132 and alcove 137 are rotated the sidewalls of the alcove 137 will engage the reset member 150 and displace it radial into the post 130 . upon radial displacement the prongs of reset member 150 are inserted through the apertures of the cylinder body , such that the prongs of the reset member 150 engage the racks 92 ( see fig1 ) of the rekeyable lock cylinder 10 . the reset member 150 thereby relocates the plurality of racks 92 , such that the racks are aligned at a common level . at about the same time that the reset member 150 engages , a detent pin 140 also begins to engage to depress the locking bar 94 and allow the plug body to rotate in the cylinder body to the rekeying position . the detent pin 140 is likewise slidably seated in a through bore formed through the post 130 in base 126 , and is spring - biased outward by a spring 142 seated inside the post 130 . referring back to fig3 , the outward end of the detent pin 140 is formed with a rounded cap that engages an arcuate bearing surface 139 protruding inward along the inner wall of the cam 132 . this way , as the cam 132 and bearing surface 139 are rotated the bearing surface 139 will engage the detent pin 140 and displace it radially into the post 130 and into the detent ball 36 ( fig1 ) of the lock cylinder 10 . upon radial displacement the pin 140 displaces the locking bar 94 , thereby fulfilling the function of the bracing tool ( described in the background section ) and allowing the plug body 40 to rotate . with the lock cylinder racks 92 aligned by the reset member 150 as above , the detent pin 140 ( of fig3 ) moves the locking bar 94 into engagement with cut - outs in the racks 92 , thereby preventing relative movement among the racks , and consequently , relative movement between the pins 113 engaged with the racks 92 . this effectively frees the plug body 40 for rotation within the cylinder body 20 and readies the rekeyable lock cylinder 10 for insertion of the learn tool 200 . in the presently - preferred embodiment , the alcove 137 and arcuate bearing surface 139 are formed along the inner wall of the cam 132 in order to move both the reset member 150 and detent pin 140 into the lock cylinder 10 at approximately 33 degrees , and then allow spring - biased retraction of the reset member at approximately 54 degrees while detent pin 140 remains displaced . fig6 is a cross - section of the of the reset cradle 2 of fig2 - 3 with rekeyable lock cylinder 10 removed from the central recess 24 of housing 22 . the hub 124 is rotatably seated on the groove 128 of base 126 , thereby enclosing post 130 of base 126 . the extent of the post 130 is visible as well as its central recess 24 for receiving the lock cylinder 10 . here only cam half 132 a is visible . as well as the detent pin 140 which is slidably seated in the through bore formed through the post 130 in base 126 . the spring 142 encircles the detent pin 140 and abuts a constriction inside the through - bore in post 130 . in use , the user should first ensure that the arrow on the front annular hub 124 is in the starting ( 0 degree ) position , as shown in fig7 . if not , then the front hub 124 should be returned clockwise until it bottoms out ( indicating the starting position shown in fig7 ). the user then rotates the hub 124 of reset cradle 2 from the home position to a first position ( 54 degrees ) which displaces detent pin 140 and reset member 130 into the lock cylinder as described above , and then retracts the reset member 150 , followed by 90 degree rotation to a second 146 degree position which rotates the plug 40 within the cylinder body 20 and readies the rekeyable lock cylinder 10 for insertion of the learn tool 200 . the learn tool 200 may then be inserted and the lock cylinder rekeyed . fig7 - 15 are sequential illustrations of the operation of the reset cradle 2 . specifically , fig7 - 9 are a front view of the reset cradle 2 in the home ( 0 degree ) position , a lower cross - section showing the position of driver 160 , and an upper cross - section showing the positions of the reset member 150 and detent pin 140 relative to post 130 and cam 132 , respectively . an arrow 12 embossed in the front face of the hub 22 of the reset cradle 2 tells the user that the assembly is in the home ( 0 degree ) position , as shown in fig7 . a second arrow 14 tells the user the direction to turn . while in the starting position the rekeyable lock cylinder 10 may be inserted frontally into the reset cradle 2 ( already done so as shown ). thus , as seen in fig8 , the arm 163 of driver 160 is not engaged since the hub 124 must be rotated approximately past the first ( 54 degree ) position before the finger 133 protruding downward from cam 132 engages the arm 163 of the driver 160 . likewise , as seen in fig9 , the reset member 150 remains seated in the alcove 137 of cam 132 and is spring - biased fully outward so as not to engage the lock cylinder , and the detent pin 140 has not yet engaged the cam surface 139 of cam 132 and is spring - biased fully outward so as not to engage the lock cylinder . further rotation to the first ( 54 degree ) position extends both the reset member 150 and the detent pin 140 into the lock cylinder , then retracts the reset member 150 . fig1 - 12 are a front view of the reset cradle 2 in the first ( 54 degree ) position , a lower cross - section showing the position of driver 160 , and an upper cross - section showing the positions of the reset member 150 and detent pin 140 relative to post 130 and cam 132 , respectively . the arrow 12 on the reset cradle 2 tells the user that the assembly has been rotated 54 degrees to the first position , as shown in fig1 , where the arrow 12 is 54 degrees offset from the keyslot of the lock . as seen in fig1 , this rotation turns the cam 132 and at approximately 54 degrees of rotation engages the arm 163 of driver 160 with the finger 133 of the cam 132 . the lock cylinder does not rotate . meanwhile , as seen in fig1 , at approximately 22 degrees the reset member 150 engages the walls of the alcove 137 of cam 132 and is urged inward to engage the lock cylinder . at approximately 33 degrees the detent pin 140 begins to engage the cam surface 139 of cam 132 and is radially extended through the post 130 to engage the lock cylinder . this in turn moves the locking bar 94 ( fig1 ) into engagement with cut - outs in the racks 92 , thereby preventing relative movement among the racks , and consequently , relative movement between the pins 113 engaged with the racks 92 . by full rotation the first 54 degree position the cam 132 frees the reset member 150 . which retracts , but the detent pin 140 remains engaged . while in this configuration it is now necessary to rotate the plug 40 ( fig1 ) approximately 90 degrees within the cylinder body 12 in order to move the locking bar 94 into the recess inside the cylinder body 12 , which in turn releases the locking bar 94 , allowing learn tool 200 to be inserted . this rotation is implemented by operation of the driver 60 . fig1 - 15 are a front view of the reset cradle 2 in a second ( 146 degree ) position , a lower cross - section showing the position of driver 160 , and an upper cross - section showing the positions of the reset member 150 and detent pin 140 relative to post 130 and cam 132 , respectively . the arrow 12 on the reset cradle 2 tells the user that the assembly has been rotated 146 degrees to the third position , which puts the lock cylinder in the learn mode , as shown in fig1 , where the arrow 12 is 146 degrees offset from the starting position . as stated above , at 54 degrees of rotation the arm 163 of driver 160 is engaged with the finger 133 of the cam 132 . consequently , this segment of rotation between 54 - 146 degrees turns the cam 132 as well as the plug along with the hub 124 . this can be seen in fig1 where the plug 40 itself is rotated approximately 90 degrees within the lock cylinder body 12 . meanwhile , as seen in fig1 , as the cam rotates to the third position the cam 132 opens up again for the detent pin 140 , the detent pin 140 falling back into the recess of the cam surface 139 and retracting from the post 130 . this backs the locking bar 94 ( fig1 ) out of engagement with cut - outs in the racks 92 , thereby allowing relative movement among the racks , and consequently , relative movement between the pins 113 engaged with the racks 92 . this effectively readies the rekeyable lock cylinder for insertion of the learn tool 200 . referring back to fig1 , the learn tool 200 may next be inserted into the keyslot in the face of the lock cylinder to configure the lock cylinder to the learn mode . once in the learn mode , the lock cylinder can be removed from the reset cradle 2 and a valid key inserted in the keyway of the lock cylinder . the new key is inserted and rotated clockwise 90 ° to key the lock cylinder 10 to the new key ( the cylinder pins correlating to the new key ). thus , rotating the key back 90 degrees to the home position effectively keys the lock cylinder 10 to the new key . any previously valid key no longer operates the lock cylinder 10 . thus , via the reset cradle 2 , without requiring a valid key , the lock assembly can be rekeyed without removing the plug assembly from the cylinder body . once the lock cylinder is removed from the reset cradle , then the reset cradle is returned to its home position , and indeed the return - bias spring 166 promotes this return . by using the reset cradle 2 the process of rekeying the lock cylinder 10 becomes easier to handle . first the reset cradle 2 holds the lock cylinder 10 in place thereby freeing up one hand of the operator . also , the reset cradle 2 automatically operates the reset member 150 and the bracing bar , thereby eliminating the need for manual manipulation of these components . this facilitates both the operation of engaging the prongs of the reset member 150 against the racks 92 ( fig1 ) and the action of using the bracing bar to move the locking bar 94 ( fig1 ) into engagement with the racks 92 . having now fully set forth the preferred embodiment and certain modifications of the concept underlying the present invention , various other embodiments as well as certain variations and modifications of the embodiments herein shown and described will obviously occur to those skilled in the art upon becoming familiar with said underlying concept . it is to be understood , therefore , that the invention may be practiced otherwise than as specifically set forth in the appended claims .	8
fig1 is a schematic illustration of a video delivery system 100 , in accordance with an exemplary embodiment of the invention . system 100 includes a plurality of video on demand ( vod ) servers 102 , which store video streams and provide them to subscribers , and / or one or more real time video sources , such as integrated receiver decoders ( ird ) 122 . the output of each vod server 102 and / or each ird 122 may feed into one or more rate adapters 104 which adjust the rate of the video stream , according to instructions from a rate controller 106 . rate controller 106 is optionally configured with the identities of a group of streams that are to be delivered together to a client and a channel size allocated for the delivery of the group of streams to the client . the rate controller 106 receives information regarding the streams and / or the streams themselves and accordingly determines how to allocate the channel size to the different streams within the group . it is noted that a single rate adapter 104 may handle a single video stream or a plurality of video streams . in addition , a single video stream may belong to a plurality of different groups of streams transmitted on separate links to separate end - users , and in such cases the stream is rate adapted into a plurality of different channels , by either a single rate adapter 104 or by a plurality of different rate adapters . similarly , rate controller 106 may be configured to handle fitting a single group of streams on one channel , or handle concurrently fitting a plurality of groups of streams into a plurality of respective channel sizes . it is noted that two different groups may include a common video stream and rate controller 106 may allocate different bandwidth allocations to the video stream at the same time , for the different groups . optionally , rate controller 106 is dynamically instructed as to which groups it is to handle . in some embodiments , a session resource manager ( srm ) 146 receives requests from clients for delivery of video streams and accordingly provides rate controller 106 with instructions regarding the groups it is to handle . the rate adapted streams from rate adapters 104 are transmitted through a network 108 as separate single program transport streams ( spts ) to a qam modulator 110 , which optionally combines the streams , modulates the combination and transmits the modulated stream via a hybrid fiber - coax ( hfc ) link 112 , or any other suitable link , toward a set - top box 114 , or other client . the combining of the streams by qam modulator 110 is a simple procedure , as the streams were previously rate adapted to fit with each other onto a channel having the bandwidth of link 112 , or of that portion of link 112 allocated to the group of streams . in the combining of the streams , qam modulator 110 optionally does not perform statistical multiplexing tasks , such as block replacements , timing adjustments or recompression . qam modulator 110 may be a standard modulator which is unaware of the operation of rate adapters 104 , such that embodiments of the invention can be implemented without replacing qam modulators 110 . real time video streams are generated shortly before they are handled by their respective one or more rate adapters 104 , generally less than 5 minutes , but perhaps less than 10 seconds or even less than 5 seconds from when they were generated . servers 102 may all be located next to each other or some or all of the servers 102 may be distanced from each other , possibly being separated by more than 100 meters , more than a kilometer or even more than 10 kilometers . rate adapters 104 are optionally separate units from servers 102 . in an exemplary embodiment , an existing video delivery system including servers 102 and qam modulator 110 is upgraded by adding rate adapters 104 and rate controller 106 , without altering servers 102 and / or qam modulator 110 . optionally , before the adding of rate adapters 104 and rate controller 106 , streams are transmitted to qam modulator 110 as constant bit rate ( cbr ) streams or as non - correlated vbr streams having a size defined by a bounding fixed rate channel . modulator 110 combines the streams into a combined stream having a size equal to the sum of the sizes of the bounding fixed rate channels . after the video delivery system is upgraded by adding rate adapters 104 and rate controller 106 , the streams are provided as size synchronized variable bit rate ( vbr ) streams in separate channels , which are combined by qam modulator 110 into a single multi - stream channel that is smaller than the sum of the bounding sizes of the channels that are combined . due to the rate adjustment , the number of streams delivered to qam modulator 110 after adding rate adapters 104 is optionally at least 20 % or even at least 40 % more than prior to the addition , while retaining a similar quality . alternatively to using rate adapters 104 separate from servers 102 , some or all of servers 102 may be adapted to perform the rate adjustment , responsive to instructions from controller 106 , during or after generation of the stream . rate adapters 104 optionally perform the rate adaptation by recompressing blocks of the video stream that are larger than the bandwidth allocated for them by rate controller 106 . the recompression may be performed using substantially any method known in the art . in some embodiments of the invention , rate adapter 104 receives for some blocks of the video stream ( e . g ., macroblocks , frames , gops ) of the video stream , a plurality of blocks representing the frame at different compression levels , and selects one of the blocks according to the allocated bandwidth . this may be performed , for example , using any of the methods described in above mentioned us patent publication 2006 / 0195881 to segev et al . alternatively or additionally , the rate adaptation includes shifting one or more blocks backwards in the timeline of the video stream such that they are transmitted slightly before they are required , at a time in which other video streams within the same group have lower bandwidth requirements . it is noted , however , that in some cases , no rate adaptation is required , since the received video stream fits onto the allocated bandwidth without size adaptation . in such cases , the processing of the video stream by the rate adapter may consist of merely adding or removing null filler bits or even merely transferring the input of the rate adapter to its output port . rate controller 106 may operate using any method for allocating bandwidth that is known in the art . in some embodiments of the invention , rate controller 106 periodically receives meta - data on each of the streams in a group of streams which are to be size synchronized and accordingly , for each time segment , assigns a portion of the available bandwidth to each of the streams . the allocation is optionally based on an attempt to achieve equal quality for all the streams of the group , for example using methods described in u . s . patent application ser . no . 12 / 152 , 814 , titled “ quality based video encoding ”, filed may 16 , 2008 , the disclosure of which is incorporated herein by reference in its entirety . alternatively or additionally , other stream synchronization methods are used , such as the test model 5 method described in http :// www . mpeg . org / mpeg / mssg / tm5 /, the disclosure of which is incorporated herein by reference . the size of the time segments for which rate controller 106 periodically provides bandwidth allocations to rate adapters 104 , may be defined , for example , in terms of a video portion length or in terms of a time period . for example , for each video stream in the handled group rate controller 106 may provide an indication of the bandwidth it is to use for a next time period . alternatively or additionally , rate controller 106 provides indications of a bandwidth to be used for a next given portion of the video stream , such as the next gop or frame . optionally , in these embodiments , each bandwidth allocation relates to at least the length of a group of pictures ( gop ) or even several gops . alternatively , the allocations relate to shorter portions , for example for a single frame or even for durations shorter than a single frame . while the bandwidth allocation may be performed repeatedly for periods of the same length , this is not mandatory , and the allocation may be performed at different times for segments of different lengths . in some embodiments of the invention , when dealing with non - real - time streams , instead of separately providing bandwidth allocations for each time segment slightly before that time segment , bandwidth allocations are provided at once for a plurality of time segments . possibly , rate controller 106 provides bandwidth allocations in advance for an entire video stream or for a substantial portion thereof , e . g ., at least 10 % or even 20 % of the stream . alternatively to using a rate controller 106 to perform the bandwidth allocation , the allocation is performed in a distributed manner by the rate adapters 104 . in some such embodiments , the rate adapters 104 dynamically select one of them to serve as the rate controller for each given group of streams to be transmitted to a specific client . alternatively , each rate adapter 104 determines on its own the bandwidth allocation it is to use , based on a predetermined distributed algorithm . optionally , in accordance with this alternative , the meta - data of the streams of the groups is sent to all the rate adapters 104 participating in handling streams of the group and accordingly the rate adapters determine the allocations of the streams they handle , possibly as a result of determining the allocations of all the streams of the group . the bandwidth allocation optionally provides equal service to all the streams , for example being directed at achieving equal quality degradation for all the streams and / or equal average bandwidth amounts . alternatively or additionally , the video streams are associated with quality of service ( qos ) ratings and their bandwidth allocations depend on their qos ratings . in some embodiments of the invention , one or more of the video streams in the group may be classified as a high priority stream which is not to be degraded or altered at all . such streams are passed through rate adapters 104 without alterations ; the remaining streams of the groups receiving bandwidth allocations according to the bandwidth remaining after the high priority stream is allocated its bandwidth . as other streams received by rate adapters 104 , the high priority streams may be cbr or vbr streams . as mentioned above , the video streams of a correlated group of streams are transmitted to qam modulator 110 in a plurality of separate channels . optionally , each video stream is transmitted from its rate adapter 104 in a separate channel , although two or more video streams may be transmitted together in a single channel , for example when these video streams are always supplied together . each channel is optionally identified by a separate and unique channel classifier ( e . g ., a unique header ). the different channels optionally have different control signals . for example , the channels may be transmitted on separate physical / link layer interfaces ( e . g ., separate ethernet interfaces ) and / or with separate transport layer ( e . g ., ip , udp ) address and / or port identifiers . in an exemplary embodiment of the invention , the channels are transmitted according to the mpeg - 2 transport stream ( ts ) protocol . in such embodiments , each channel containing a video stream is optionally transmitted as a separate ts stream having a unique channel id . the streams of the correlated group of streams are not necessarily provided from a single server and even not necessarily from a single location . thus , they do not necessarily have the same source network layer address , e . g ., ip address . in some embodiments of the invention , each video stream of the correlated group is transmitted from its server 102 to qam modulator 110 on a separate constant bit rate ( cbr ) channel , adhering to cbr timing constraints , such as those of the mpeg - 2 transport stream protocol . for example , if the streams are originally vbr streams , they are optionally encased in cbr streams with padding bits . the total size of the cbr channels provided to qam modulator 110 is optionally substantially greater than the maximal size of the combination of all the rate adjusted streams , for example at least 20 % or even at least 30 % greater . transmitting the rate adjusted channels to qam modulator 110 in separate cbr channels makes the delivery of the streams simple and easy , while still allowing simple combination of the streams into a suitable size , by qam modulator 110 . in some embodiments of the invention , the video streams are transmitted to qam modulator 110 in a synchronized manner , such that the segments of the video streams are transmitted according to their relative times in the streams . accordingly , if the entire bandwidth of link 112 is utilized by the group of streams , the amount of data belonging to the group transmitted toward qam modulator 110 during each time segment would be substantially equal to the size of the link 112 . optionally , the transmitted segments of the video streams are received by qam 110 according to the relative timing of the segments of the video streams . optionally , the jitter in the transmission of the segments is smaller than a given value , for example less than 50 milliseconds or even less than 10 milliseconds . in other embodiments , qam modulator 110 has a large buffer and / or a large buffer is provided before qam modulator 110 , and stream portions may be transmitted in advance and buffered , before modulator 110 organizes the data for transmission . fig2 is a schematic illustration of three video channels generated by one or more rate adapters 104 ( fig1 ), in accordance with an exemplary embodiment of the invention . based on allocation instructions from rate controller 106 , three streams 202 a , 202 b and 202 c are generated by one or more rate adapters 104 . each stream 202 a - c is packed into a respective cbr channel 204 ( marked 204 a , 204 b and 204 c ) and is transmitted separately to qam modulator 110 . qam modulator 110 extracts the video streams 202 a - c from channels 204 and combines them onto a single combined stream 206 . the padding of the vbr stream into a cbr stream may include null bits which do not carry information , such as null mpeg - 2 transport stream ts packets , or may include packets including additional information beyond that included in the vbr stream , such as packets with additional content , quality enhancement packets and / or packets which aid in further handling of the vbr stream . alternatively to transmitting the streams in cbr channels , one or more of the streams is provided as a vbr stream without padding into a cbr stream . the video stream is optionally transmitted in accordance with any suitable video encapsulation format , such as mp - 4 , avi , flv or mpeg - 2 ts , and / or using any suitable video coding , such as h . 264 , vp6 or vc - 1 . in some embodiments of the invention , the video streams are transmitted in accordance with the real - time protocol ( rtp ). although the above description relates to video streams , the principles of the present invention may be applied to audio streams ( e . g ., high quality audio streams ) and / or other data types . it will be appreciated that the methods described hereinabove may be varied in many ways , including , changing the order of some of the steps , and / or performing a plurality of steps concurrently . it should also be appreciated that the above described description of methods and apparatus are to be interpreted as including apparatus for carrying out the methods and methods of using the apparatus . it should be understood that features and / or steps described with respect to one embodiment may be used with other embodiments and that not all embodiments of the invention have all of the features and / or steps shown in a particular figure or described with respect to one of the embodiments . variations of embodiments described will occur to persons of the art . furthermore , within the claims , the terms “ comprise ,” “ include ,” “ have ” and their conjugates , mean , “ including but not necessarily limited to .” it is noted that some of the above described embodiments may describe the best mode contemplated by the inventors and therefore may include structure , acts or details of structures and acts that may not be essential to the invention and which are described by way of example only . structure and acts described herein are replaceable by equivalents which perform the same function , even if the structure or acts are different , as known in the art . therefore , the scope of the invention is limited only by the elements and limitations as used in the claims .	7
according to fig1 , a bearing housing cover 1 comprises at least one cylindrical fixing region 2 and a disc - like covering region 3 . with the cylindrical fixing region 2 at least one piston ring 4 , 4 ′ or a shaft sealing ring or a bearing ring can be fixed in radial direction . a charging device not shown in the figures as a rule has a turbine housing on the turbine side in whose interior a turbine wheel is arranged and a compressor housing on the compressor side , in whose interior a compressor wheel is positioned . between the turbine and the compressor housing a bearing housing is arranged which serves as rotation - moveable mounting for the shaft of the rotor , which comprises the turbine wheel , the compressor wheel and the shaft . in order to protect a bearing housing interior from the gases flowing in the turbine housing or in the compressor housing , the bearing housing is closed with a bearing housing cover on the turbine side and / or compressor side . here , the bearing housing cover is arranged on the compressor side . as shown in fig1 the bearing housing cover 1 is orientated with its fixing region 2 towards the turbine side or compressor side 6 while the covering region 3 is orientated towards the bearing housing side 5 . by means of fastening elements not shown in fig1 the covering region 3 can be fastened to the bearing housing which is likewise not shown . screws , rivets , press - in studs or the like can be used as fastening elements . it is likewise conceivable that the covering region 3 is glued , welded or joined by brazing , caulking , flanging or collaring - over to the bearing housing . in addition , the covering region 3 can also comprise webs , by means of which the covering region 3 , 7 can be joined to the bearing housing in the manner of a bayonet closure . fastening of the bearing housing cover 1 to the bearing housing by pressing a marginal region 7 of the covering region 3 into a groove on the bearing housing side is likewise conceivable . in addition , as shown in fig2 , the bearing housing cover 1 can have a cylindrical joining region 8 . by means of the joining region 8 the bearing housing cover 1 can be joined to the bearing housing . here , the joining region 8 and the fixing region 2 can be arranged on different sides with respect to the covering region 3 , as shown in fig2 , so that the fixing region 2 is orientated towards the turbine side or compressor side 6 while the joining region 8 is orientated towards the bearing housing side 5 . according to fig3 , another arrangement of the fixing region 2 and the joining region 3 is also possible however . in this embodiment , the fixing region 2 and the joining region 8 are orientated towards the bearing housing side 6 . thus the bearing housing cover 1 can have a cylindrical fixing region 2 and / or a perforated disc - like covering region 3 and / or a cylindrical joining region 8 . preferably , the bearing housing cover 1 is formed of a metal sheet . as material for such a metal sheet , all formable steel types can be utilised , also including bake - hardening sheets . preferably aluminium or an aluminium alloy is used as material . the use of precision - casting sheets is also preferred . however , other metal materials suitable for a forming process can also be used . bake - hardening sheets means sheets of a metal material that is subjected to a hardness increase through heating to temperatures around approximately 200 ° c . here , the bake - hardening sheet is formed prior to heating and hardened through baking after the forming method . particularly preferably metal sheets are used which are formed in the manner of a tailored - blank design . a metal sheet in tailored - blank design means a metal sheet that is composed of different material qualities and / or sheet thicknesses . this prefabricated semi - finished product is subsequently formed into the desired bearing housing cover 1 for example through deep - drawing or through other forming methods . if the bearing housing cover 1 is designed in the manner of a tailored - blank design , the bearing housing cover 1 can be designed in the corresponding regions in accordance with the respective loads in these regions . thus it is conceivable that the bearing housing cover 1 also performs the function of a heat shield for the bearing housing . in this case , precisely those portions that are exposed to a high temperature can be formed of suitably temperature - resistant material by means of the tailored - blank design . preferably , the bearing housing cover 1 is a unitary design of a metal sheet . however , a multiple part design of the bearing housing cover 1 is also possible , wherein the individual part regions are joined to one another through a joining method following the forming of the individual part regions . a part region can for example be the fixing region 2 and / or the covering region 3 and / or the joining region 8 . the embodiment of a bearing housing cover 1 shown in fig4 has a profiling 9 in the covering region 3 , which in the covering region 3 is formed as annular groove 10 . with respect to an axis of rotation 11 of the shaft not shown in fig4 the annular groove 10 runs at a constant radial distance to the axis of rotation 11 in the covering region 3 . such a profiling 9 is used as a radially active clamping element for clamping the bearing housing cover 1 in the bearing housing . thus , a bearing housing cover 1 , as for instance shown in fig4 , can be pressed into the bearing housing and because of the clamping element or the profiling 9 subjected to clamping can be joined to the bearing housing in the manner of a press seat . in this case , fastening by means of fastening elements can advantageously be omitted for example in the covering region 3 . such a profiling 9 can also be designed wave - shaped , while the wave shape has a radial course . thus the profiling 9 together with the joining region 8 forms a joining device 12 by means of which the bearing housing cover 1 can be fastened to the bearing housing . in fig5 a further embodiment of the joining device 12 is shown . in this case , a radial groove 13 is formed in the joining region 8 of the bearing housing cover 1 . in this radial groove 13 a sealing element 14 can be inserted so that the bearing housing cover 1 by means of the sealing element 14 can be joined to the bearing housing . in the case that a sealing element 14 is used , the bearing housing cover 1 can additionally be joined to the bearing house in a tight manner . the sealing element 14 can be designed as sealing ring , o - ring or the like . in this case the joining device 12 is formed through the radial groove 13 and the sealing element 14 , both of which are arranged in the joining region 8 . in a further embodiment a tongue formed on the bearing housing can engage in the radial groove 13 of the bearing housing cover 1 provided the latter is in installation position . in this case no sealing element 14 if applicable is arranged in the radial groove 13 and / or the joining device 12 designed in the manner of a groove / tongue joining device , wherein the joining device 12 in this case comprises a radial groove arranged in the joining region 8 and a tongue on the bearing housing side . in contrast with the annular groove 10 , which has an opening orientated towards the axis of rotation 11 in longitudinal direction , the radial groove 13 is equipped with an opening orientated in radial direction . the joining device 12 can likewise be designed as screw joining device or bayonet joining device . in the case of being designed as screw joining device , an outer thread can be arranged in the joining region 8 by means of which the joining region 8 can be screwed into an inner thread formed on the bearing housing . in the case of being designed as bayonet joining device , webs or bulges interrupted in circumferential direction are formed on the bearing housing cover 1 in the joining region 8 , so that the joining region 8 with its webs or bulges can be joined to the bearing housing in the manner of a bayonet closure . the formation of a radial groove 13 which is interrupted through longitudinal grooves arranged in the joining region 8 is likewise conceivable . in this case the webs or bulges of the bearing housing region can be inserted in the longitudinal grooves and inserted in the radial groove 13 through twisting . thus in this case the bearing housing cover 1 can likewise be fixed to the bearing housing in the manner of a bayonet closure .	5
the present invention relates to a real - time optical imaging system communicatively connected to a microwave energy producing source thereby providing means to record real - time data of biomolecule interactions and reactions in biological systems during the application of a microwave field . the system of the present invention can provide for real - time imaging microwave or radiofrequency driven interaction between protein - protein , dna - protein , rna - protein , dna - rna , chemical - protein , chemical - dna , and chemical - protein interactions at surfaces , in solution , in living organisms , including prokaryotes and eukaryotes . further , the present invention provides for real - time imaging of microwave induced effects on biological systems , induced biomolecular reactions in prokaryotic and eukaryotic organisms , at interfaces , surfaces and in solutions . still further , the present invention provides for real - time imaging of microwave induced transfection of small biomolecules into living organisms , prokaryotes and eukaryotes . the term “ biomolecule ” as used herein means any molecule occurring in nature or a derivative of such a molecule . the biomolecule can be in active or inactive form . “ active form ” means the biomolecule is in a form that can perform a biological function . “ inactive form ” means the biomolecule must be processed either naturally or synthetically before the biomolecule can perform a biological function . exemplary biomolecules include nucleic acids , aromatic carbon ring structures , nadh , fad , amino acids , proteins , peptides , carbohydrates , steroids , flavins , dna , rna , oligonucleotides , nucleic acids , fatty acids , myoglobin , sugar groups such as glucose etc ., vitamins , cofactors , purines , pyrimidines , formycin , lipids , phytochrome , phytofluor , peptides , lipids , antibodies and phycobiliproptein . the term “ receptor - ligand ” as used herein means any naturally occurring or unnaturally occurring binding couple wherein the components have affinity for each other . for example , the binding couple may include an antibody / antigen complex , viral coat ligand / protein cell receptor or any combination of probe and binding partner . the term “ receptor ” refers to a chemical group , molecule , biological agent , naturally occurring or synthetic that has an affinity for a specific chemical group , molecule , virus , probe or any biological agent target in a sample . the choice of a receptor - ligand for use in the present invention will be determined by nature of the disease , condition , or infection to be assayed . the system of the present invention includes a detector molecule or a detectable chemical reaction that is responsive to electromagnetic excitation , chemical excitation , excitation by a light source , or a laser beam of continuous or pulsed excitation to produce luminescence , including chemiluminescence , fluorescence , or phosphorescence emissions . detector molecules include fluorophores that emit electromagnetic energy such as light at a certain wavelength ( emission wavelength ) when the substance is illuminated by radiation of a different wavelength ( excitation wavelength ) and is intended to encompass a chemical or biochemical molecule or fragments thereof that is capable of interacting or reacting specifically with an analyte of interest in a sample to provide one or more optical signals . additionally fluorophore includes both extrinsic and intrinsic fluorophores . extrinsic fluorophore refer to fluorophores bound to another substance . intrinsic fluorophores refer to substances that are fluorophores themselves . exemplary fluorophores include but are not limited to those listed in the molecular probes catalogue which is incorporated by reference herein . representative fluorophores include but are not limited to alexa fluor ® 350 , dansyl chloride ( dns - cl ), 5 -( iodoacetamida ) fluoroscein ( 5 - iaf ); fluoroscein 5 - isothiocyanate ( fitc ), tetramethylrhodamine 5 -( and 6 -) isothiocyanate ( tritc ), 6 - acryloyl - 2 - dimethylaminonaphthalene ( acrylodan ), 7 - nitrobenzo - 2 - oxa - 1 , 3 ,- diazol - 4 - yl chloride ( nbd - cl ), ethidium bromide , lucifer yellow , 5 - carboxyrhodamine 6g hydrochloride , lissamine rhodamine b sulfonyl chloride , texas red ™. sulfonyl chloride , bodipy ®, naphthalamine sulfonic acids including but not limited to 1 - anilinonaphthalene - 8 - sulfonic acid ( ans ) and 6 -( p - toluidinyl ) naphthalen - e - 2 - sulfonic acid ( tns ), anthroyl fatty acid , dph , parinaric acid , tma - dph , fluorenyl fatty acid , fluorescein - phosphatidylethanolamine , texas red - phosphatidylethanolamine , pyrenyl - phophatidylcholine , fluorenyl - phosphotidylcholine , merocyanine 540 , 1 -( 3 - sulfonatopropyl )- 4 -[-. beta .-[ 2 [( di - n - butylamino )- 6 naphthyl ] vinyl ] pyridinium betaine ( naphtyl styryl ), 3 , 3 ′ dipropylthiadicarbocyanine ( dis - c 3 -( 5 )), 4 -( p - dipentyl aminostyryl )- 1 - methylpyridinium ( di - 5 - asp ), cy - 3 lodo acetamide , cy - 5 - n - hydroxysuccinimide , cy - 7 - isothiocyanate , rhodamine 800 , ir - 125 , thiazole orange , azure b , nile blue , al phthalocyanine , oxaxine 1 , 4 ′, 6 - diamidino - 2 - phenylindole ( dapi ), hoechst 33342 , toto , acridine orange , ethidium homodimer , n ( ethoxycarbonylmethyl )- 6 - methoxyquinolinium ( mqae ), fura - 2 , calcium green , carboxy snarf - 6 , bapta , coumarin , phytofluors , coronene , and metal - ligand complexes . representative intrinsic fluorophores include but are not limited to organic compounds having aromatic ring structures including but not limited to nadh , fad , tyrosine , tryptophan , purines , pyrimidines , lipids , fatty acids , nucleic acids , nucleotides , nucleosides , amino acids , proteins , peptides , dna , rna , sugars , and vitamins . additional suitable fluorophores include enzyme - cofactors ; lanthanide , green fluorescent protein , yellow fluorescent protein , red fluorescent protein , or mutants and derivates thereof . any chemiluminescent species may be used in the present invention that provides for a chemical reaction which produces a detectable reaction ( observed emission ) wherein the excited state responsible for the observed emission including , but not limited to the following excitation mechanisms : examples of suitable chemiluminescence detector molecules include but without limitation , peroxidase , bacterial luciferase , firefly luciferase , functionalized iron - porphyrin derivatives , luminal , isoluminol , acridinium esters , sulfonamide and others . a recent chemiluminescent label includes xanthine oxidase with hypoxanthine as substrate . the triggering agent contains perborate , a fe - edta complex and luminol . choice of the particular chemiluminescence labels depends upon several factors which include the cost of preparing labeled members , the method to be used for covalent coupling to the detector molecule , and the size of the detector molecules and / or chemiluminescence label . correspondingly , the choice of chemiluminescence triggering agent will depend upon the particular chemiluminescence label being used . chemiluminescent reactions have been intensely studied and are well documented in the literature . for example , peroxidase is well suited for attachment to the detector molecule for use as a chemiluminescence . the triggering agent effective for inducing light emission in the first reaction would then comprise hydrogen peroxide and luminol . other triggering agents which could also be used to induce a light response in the presence of peroxidase include isobutyraldehyde and oxygen . procedures for labeling detector molecules , such as antibodies or antigens with peroxidase are known in the art . for example , to prepare peroxidase - labeled antibodies or antigens , peroxidase and antigens or antibodies are each reacted with n - succinimidyl 3 -( 2 - pyridyldithio ) proprionate ( hereinafter spdp ) separately . spdp - labeled peroxidase , or spdp - labeled antigen or antibody is then reacted with dithiothreitol to produce thiol - labeled peroxidase , or thiol - labeled antigen or antibody . the thiol derivative is then allowed to couple with the spdp - labeled antigen or antibody , or spdp - labeled peroxidase . generally , any combination of optical imaging systems and microwave based technologies may be used in the present invention . as shown in fig1 the system includes a microwave cavity for placement of a sample and a source for generating electromagnetic energy having a wavelength and frequency in a microwave or radiofrequency range , and more preferably in the microwave range . the application of low level microwave energy for heating of the sample may be used to speed up any biological / biochemical kinetics within the system . notably , low level microwaves do not destroy or denature proteins , dna , or rna , but instead heat the sample sufficiently to provide for accelerated kinetics such as binding , hybridization or chemical interaction . microwaves ( about 0 . 3 to about 300 ghz ) lie between the infrared and radio frequency electromagnetic radiations . it is widely thought that microwaves accelerate chemical and biochemical reactions by the heating effect , where the heating essentially follows the principle of microwave dielectric loss . polar molecules absorb microwave radiation through dipole rotations and hence are heated , where as non - polar molecules do not absorb due to lower dielectric constants are thus not heated . the polar molecules align themselves with the external applied field . in the conventional microwave oven cavity employed in this work , the radiation frequency ( 2450 mhz ) changes sign 2 . 45 × 10 9 times per second . heating occurs due to the tortional effect as the polar molecules rotate back and forth , continually realigning with the changing field , the molecular rotations being slower than the changing electric field . the dielectric constant , the ability of a molecule to be polarized by an electric field , indicates the capacity of the medium to be microwave heated . thus , solvents such as water , methanol and dimethyl formamide are easily heated , where as microwaves are effectively transparent to hexane , toluene and diethylether . in the present invention , microwave radiation may be provided by an electromagnetic source having a frequency in a range between 0 . 3 and 10 ghz , more preferably from about 1 ghz and 5 ghz , and more preferably from 2 ghz to 3 , and a power level in a range between about 10 mwatts and 700 watts , preferably from 30 mwatts to about 500 watts , and more preferably from about 50 watts to 300 watts . any source , known to one skilled in the art may be used , such as a laser having the capacity to emit energy in the microwave range . the microwave radiation may be emitted continuously or intermittently ( pulsed ), as desired . in the alternative , microwave energy can be supplied through a hollow wave guide for conveying microwave energy from a suitable magnetron . the microwave energy is preferably adjusted to cause an increase of heat within the metallic material without causing damage to any biological materials in the assay system . in one embodiment , a sample plate is modified by adhering metallic surfaces fabricated to form a geometric shape such as triangle , square , oblong , elliptical , rectangle , or any shape that provides at least one apex area of the metallic surface . further multiple metallic geometric shapes may be adhered to a surface in the form of a pattern to provide at least one reactive zone positioned between the apex areas . it is envisioned that the apex area includes not only pointed regions but regions with rounded edges such as found in an oblong or elliptical shape . the apex areas are preferably arranged so that one apex area is opposite from another apex area and aligned to cause the reactive zone to be positioned therebetween . the distances between the apex areas may range from 0 . 01 mm to 5 mm , more preferably from 2 mm to about 3 mm and depending on the size of the required reactive zone . the thickness of the metallic geometric shaped forms ranges from 25 nm to about 1000 nm , and more preferably from about 45 nm to about 250 nm . the geometric shapes can be formed on the surface substrate by any means known to those skilled in the art , including masking the surface substrate with subsequent deposition of the metallic material , fixing preformed metallic geometric shapes directly onto the substrate surface , or impregnating a geometric shaped recess in the surface substrate with a metallic material that provides for a continuous planar surface on the substrate . further , the geometric shapes may include a diversity of material including dielectric materials . for example a layer of metallic material can be deposited on a substrate surface with a layer of sio 2 deposited thereon . in another embodiment , the present invention provides enhanced emissions using metalized islands of elliptical , spherical , triangular or rod - like forms . further , the metallic material may be in the form of a porous three dimensional matrix . the three dimensional matrix may be a nano - porous three dimensional matrix . the metallic material may include metal colloid particles and or shaped particles imbedded into the surface of a glass of polymeric polymer matrix . as further shown in fig1 , the system includes a source of electromagnetic energy , communicatively connected to the cavity to transmit irradiating energy to the sample and detector material thereby inducing chemical excitation , electrical excitation , or single or multiphoton excitation to produce characteristic luminescence in the detector material . notably , the source used for applying electromagnetic energy can include any device that applies the necessary frequency or wavelength such as arc lamps , including mercury or xenon ; laser diode and led sources having the ability to generate single or multiple photons in a continuous or pulsing modes , wherein the intensity of said electromagnetic energy corresponds to absorption and subsequent luminescence of said detector molecule or detectable reaction . laser commonly employed are high - intensity monochromatic light sources , however , it should be noted that multiple point lasers are also envisioned . in another embodiment , using 2 - photon excitation at 700 - 1000 nm and also using short pulse width (& lt ; 50 pi ), high repetition rate ( 1 - 80 mhz ), laser diode and led ( 1 ns , 1 - 10 mhz ) sources provide enhanced sensitivity as compared to 1 - photon excitation . if a fluorophore absorbs two photons simultaneously , it will absorb enough energy to be raised to an excited state . the fluorophore will then emit a single photon with a wavelength that depends on the fluorophore used and typically in the visible spectra . the optical imaging / microwave system of the present invention includes not only the light source discussed herein above but also the optics needed to observe the emitted excitation signal , such as fluorescence . the light source emit lights , likely in the ultraviolet range and hits a dichroic mirror that reflects one range of wavelengths and allows another range to pass through . the dichroic mirror reflects the light to the sample for excitation of fluorescence within molecules in the sample and / or detector molecules . an objective lens collects the fluorescent - wavelength light produced . this fluorescent light passes through the dichroic mirror , and preferably a filter that eliminates wavelengths other than fluorescent , making it to the imaging device . preferably , the fluorescence microscope uses an epifluorescence setup wherein the objective lens is used both to focus the irradiating light onto the sample / detector molecule and also collect the fluorescent light emitted from the sample / detector molecule . the structure comprising the microwave cavity is constructed for connectivity to the optical imaging system wherein an opening is fabricated in the cavity for directing the focused light onto the sample and for existing of emitted fluorescent wavelength light . the light source generates a beam of light directed into the objective and preferably the beam of light is passed through a beam expander lens for expansion of the light beam sufficient to provide an expanded beam of excitation light entering into the cavity for focusing on the sample . excited emissions existing the cavity and through the objective can be detected using an optical detector . various optical detectors , such as photodiode , charge - coupled device ( ccd ), photomultiplier tube ( pmt ), or photon counting detector , may be used wherein each has a different degrees of sensitivity . pmt and photon counting detectors can achieve an electronic amplification factor as high as 10 6 - 10 8 . conventional pmts require a ˜ 1 kv power source , but new miniaturized detector requires only a 5 v . most of the chemiluminescence emission wavelengths are in the visible region . a narrow - band optical filter may be used to ensure detecting luminescence wavelengths . the system may further include a microactuator , detector , microprocessor , electronics , a display , and translation stage . the output of the detector may be interfaced to an analog to digital converter and a microprocessor to calculate analyte concentration . further , the system of the present invention may include a sample platform that is movable in xy and z directions . additionally , the use of a multi - point laser is considered for generating an array of point excitation directed to the objective for focusing on the sample , thereby creating an array of multiple focused spots . still further , the system can include means for adjusting lenses in the system to select focal points at different depths within the sample to impinge upon the detector molecule or detectable reaction at the object plane . notably , the systems can include a combination of components for delivering simultaneous or sequential spatially and / or temporally controlled electromagnetic radiation to control the activity of biological or chemical reactions that directly or indirectly relates to any small biomolecule , chemical molecule , any sized or collection of particles composed of any dielectric material , including any nanoparticles or carbon nanotubes , prokaryotic organism , eukaryotic organism and / or combination thereof . still further , the combined optical imaging and microwave system of the present invention may include an optical imaging system including but not limited to fluorescence , luminescence , wide - field , confocal reflected , confocal , two - photon , multiphoton , wide - field , spinning disk , nipkow spinning disk , 4 - pi confocal , fluorescence resonance energy transfer ( fret ) for imaging molecular interactions , total internal reflection fluorescence microscopy ( tirfm ) for imaging interactions of molecules with surfaces , multi - foci , multi - foci multiphoton , near - field , single molecule , spectral imaging , lifetime imaging , fluorescence imaging , fluorescence correlation spectroscopy , raster imaging correlation spectroscopy ( rics ), and image correlation spectroscopy ( ics ). premium quality aps - coated glass slides ( 75 × 25 mm ) were obtained from sigma - aldrich . coverwell imaging chamber gaskets with adhesive ( 2 . 5 mm diameter , 2 mm deep and 5 mm diameter , 2 mm deep for temperature measurements ) were obtained from molecular probes ( eugene , oreg .). ru ( by ) 2 cl 2 salt was obtained from sigma - aldrich . commercially available chemiluminescence materials were purchased from unique industries , inc . at the base of a microwave cavity ( 0 . 7 cu ft , ge compact microwave model : jes735bf , max power 700 w ), a 1 inch hole was drilled and subsequent exposed metal surfaces were covered with white enamel paint to prevent sparking and arcing . using a beam expander the spot size of a 473 nm laser source was expanded to approximately 1 inch and focused to a point with a 175 mm lens at the back aperture of the objective . the incident excitation beam was reflected with a dichroic mirror ( z479 / 532rpc , chroma , brattleboro , vt .) into an infinity corrected brightfield objective ( lwd plan achromat objective − lpl10 × objective / na = 0 . 25 ). the fluorescent emission intensity , which is generated by wide - field excitation working in epifluorescence mode , is collected through the infinity corrected optics and imaged onto a ccd camera using a razor edge 488 nm and a 570 lp filter to block any bleedthrough of the excitation light as shown in fig1 . chemiluminescence intensity images are imaged through the infinity corrected optics and imaged onto a ccd camera in the absence of any optical filters . ccd images were taken with a retiga - srv ccd camera ( qimaging , burnaby , b . c .) with 4 × 4 binning at 10 fps . emission spectra were collected using an ocean optics spectrometer , model sd 2000 ( dunedin , fla .) that is connected to an ocean optics 1000 μm diameter fiber with a na of 0 . 22 ( dunedin , fla .). a collimator is connected to the end of the fiber and positioned to maximize the coupling of the fluorescence emission into the spectrometer . ru ( by ) 2 cl 2 time - dependent emission spectra were collected with an integration time of 100 milliseconds . all exposed metal surfaces of the objective and adaptive optics were coated with white reflective paint to prevent sparking and arcing during the application of microwave pulses . the preparation of glass slides modified with ‘ bow - tie ’ structures has been described previously [ 23 ]. briefly , disjointed ‘ bow - tie ’ equilateral 2 . 5 mm triangles stencils were made from an adhesive mask . the disjointed ‘ bow - tie ’ structure was formed from two inverted 5 mm triangles , such that the distance between the apexes or gap size was approximately 2 - 3 mm , as shown in fig2 . triangle tape masks were affixed to plain glass slides and glass slides modified with ag triangle structures were created by vapor depositing 75 nm of au films on glass using an emf corp . ( ithaca , n . y .) vapor deposition instrument . film thicknesses were monitored during the deposition process with an edwards ftm6 film thickness monitor . glass substrates with and without modified ‘ bowtie ’ metal structures were cut into 10 × 10 mm sample sizes . image wells were placed between the two vapor deposited au triangles 75 nm thick or at the ‘ bowtie ’ gap and on the unmodified plain glass substrates . the samples were subsequently filled with 20 μl of 10 μm ru ( by ) 2 cl 2 solution or 6 μl of chemiluminescence material ( fig2 .). the commercially available glow - sticks contain a phenyl oxalate ester , a fluorescent probe and a glass capsule containing the activating agent ( hydrogen peroxide ). activation of the chemicals is accomplished by breaking an encapsulated glass capsule that contains the peroxide and subsequently mixes the chemicals to begin the chemiluminescence reaction . the hydrogen peroxide oxidizes the phenyl oxalate ester to a peroxyacid ester and phenol [ 24 ]. the unstable peroxyacid ester decomposes to a peroxy compound and phenol , the process chemically inducing an electronic excited state [ 24 ]. previously , ruthenium chloride aqueous solutions have been used to calibrate a temperature imaging system with a ccd sensor [ 25 ]. it is known that the emission intensity of these solutions decrease with temperature . the temperature dependence of the photophysical and photochemical properties of ruthenium chloride aqueous solutions have been described in detail elsewhere [ 26 , 27 ]. subsequently , a pre - calibrated intensity vs . temperature plot of a 10 μm aqueous solutions of ru ( by ) 2 cl 2 was recorded using a cary eclipse fluorescence spectrometer with temperature controller . calibration temperatures were 10 , 20 , 30 , 40 , 50 , 60 , and 70 ° c ., which is within the linear range of the relationship between the relative fluorescence to the temperature , as shown in fig3 [ 25 ]. for the microwave imaging experiments , the intensity of fluorescence emission was measured from 10 μm aqueous solutions of ru ( by ) 2 cl 2 on glass substrates in the presence and absence of the thin continuous metal film triangle geometries 75 nm thick ( fig3 ). ru ( by ) 2 cl 2 aqueous solutions were excited with a 473 nm laser source . before and during the application of a 5 second low power 2 . 45 ghz microwave pulses ( 10 % power ), the spectral emission from the ru ( by ) 2 cl 2 aqueous solutions was recorded at 100 millisecond time intervals for 20 seconds using the fiber detection and spectrometer optical configuration of fig1 . the recorded fluorescence spectral intensity from the ru ( by ) 2 cl 2 aqueous solutions on glass substrates and ‘ bow - tie ’ modified substrates before and during the application of the microwave pulse were normalized , as shown in fig3 . the normalized spectra are superimposed to determine if the microwave fields induce any spectral change to the ru ( by ) 2 cl 2 emission , as shown in fig4 . the ccd time dependent intensities are normalized with respect to the maximum emission intensity ( time = 0 ). normalized intensity ratios are calculated as the ratio of the time dependent emission intensity during to the maximum emission intensity before exposure to short microwave pulse . subsequently , these ratios multiplied by a factor of 0 . 9 ( fig3 , rt ) to reflect the normalized intensity ratio for 10 μm aqueous solutions of ru ( by ) 2 cl 2 at room temperature ( fig4 ). subsequently , the corresponding temperature values for microwave heated solutions on glass substrates and substrates with ‘ bow - tie geometries could be approximated from the pre - calibrated intensity vs . temperature plot of a ru ( by ) 2 cl 2 sample of the same concentration ( fig3 , arrow and dashed line ). total emission intensity images for ru ( by ) 2 cl 2 aqueous solutions and chemiluminescence samples were captured at frame rate of 10 hz using a ccd camera ( fig6 - 10 ). in order to obtain the same initial chemiluminescence emission for all measurements , approximately 6 μl of the chemiluminescence solution was placed inside the imaging chamber . data collection commenced 10 seconds prior to the application of the five second microwave pulse and continued until 20 seconds after microwave exposure . since it is well established that the emission intensity of ru ( by ) 2 cl 2 solutions are inversely proportional to temperature , the emission spectra for ru ( by ) 2 cl 2 solutions was recorded over a range of temperatures [ 28 ]. from these spectra , a linear relationship was observed between the emission intensity and temperature for the 10 μm ru ( by ) 2 cl 2 solutions between 10 ° c . and 70 ° c ., which is consistent with previously published results [ 23 ]. using the fiber detection configuration of the optical scheme ( fig1 ), the fluorescence intensity was recorded from the ru ( by ) 2 cl 2 aqueous solution at 100 millisecond time intervals for approximately 60 seconds . during the 60 second recording , we applied a five second 2 . 45 ghz pulse microwave pulse . normalized intensity vs . temperature plots of the ru ( by ) 2 cl 2 sample of the same concentration ( fig3 ) was fit to a linear function ( data not shown ). the approximate microwave induced maximum temperature increases to the solutions on the glass and ‘ bow - tie sample geometries are marked with an arrow and dashed line , respectively , as shown in fig3 . although only part of the ru ( by ) 2 cl 2 spectra is transmitted in the presence of the dichroic , the superimposed normalized intensity spectra of the ru ( by ) 2 cl 2 before the application of a microwave pulse is shown in fig4 . typically , spectral shifts in chromophore emission are ascribed to the changes in the electronic distribution of the energies of electronic transitions [ 29 ]. since the normalized intensity spectra of ru ( by ) 2 cl 2 solutions before the application of a microwave pulse ( fig4 , black line ) is not permuted during the application of a low power microwave pulse ( fig4 , dotted and dashed lines ), it was concluded that the microwave heating does not create any noticeable change in the photophysical properties of the ru ( by ) 2 cl 2 solutions [ 29 ]. using the ccd imaging configuration , the fluorescence intensity images was recorded of the ru ( by ) 2 cl 2 aqueous solutions on the glass substrates with and without ‘ bow - tie ’ structures in the microwave cavity at a frame rate of 10 hz for 10 seconds ( fig5 ). during image collection , samples were exposed to five second microwave pulses . the pre - microwave fluorescence intensity is averaged over a 100 pixel 2 region selected from the center of the image ( fig5 . insets , box outlines ). the average intensity vs . time data of the ccd images for the 10 μm ru ( by ) 2 cl 2 solution at disjointed ‘ bow - tie ’ junction and on plain glass slides ( control ) is normalized with respect to the maximum pre - microwave fluorescence intensity ( fig5 ) and scaled to the pre - calibrated room temperature normalized intensity ( fig3 and 9 at rt ). during exposure to the microwave pulse , a slight decrease in the fluorescence intensity was observed of the 10 μm ru ( by ) 2 cl 2 solutions on the glass substrates , which corresponds to a temperature increase of about 5 - 8 ° c . ( fig5 — top right , inset ). on the other hand , a significant decrease in the fluorescence intensity was observed of the 10 μm ru ( by ) 2 cl 2 solutions in the gap of a ‘ bow - tie ’ geometry during exposure to the microwave pulse ( fig5 — bottom right , inset ), recalling that emission is inversely proportional to temperature . with respect to calibration curve of the 10 μm ru ( by ) 2 cl 2 solutions intensity versus temperature , the temperature of the solutions on the glass substrate rose slightly above room temperature ( fig3 , glass ), while the change in intensity of the 10 μm ru ( by ) 2 cl 2 solutions in the gap of a ‘ bow - tie ’ geometry corresponds to a dramatic temperature decrease that is outside the linear range of the temperature versus intensity plot ( fig3 , dashed line ). real time movies of the decrease in fluorescence intensity of these solutions during exposure to a low power microwave pulse are shown here to demonstrate the functionality of the fluorescence microscope in a microwave cavity , as shown in fig6 a , b . in addition to real - time imaging of temperature dependent ru ( by ) 2 cl 2 solutions , the local ‘ triggering ’ of chemiluminescent solutions was also imaged to further validate the effectiveness of the microscope in a microwave concept . 6 μl of blue chemiluminescence solution was placed in an imaging well affixed to plain glass substrates and in the 2 mm gap of the continuous gold thin film bow - tie ’ geometry [ 23 , 30 ]. the chemiluminescence emission was recorded over at a frame rate of 10 hz for 10 seconds ( fig7 ). during the 10 second time interval , samples were exposed to a five second microwave pulse , which induces the ‘ triggered ’ emission or dramatic rise in the maximum photon flux , as shown in fig7 . discrete time points are labeled in fig7 and correspond to a ) steady state emission b ) emission upon initial exposure to microwave pulse c ) during the onset of microwave pulse d ) maximum ‘ triggered ’ emission during pulse and e ) final microwave emission . during recording of the disjointed ‘ bow - tie ’ geometries intensity images , the ccd camera gain was decreased by about a factor of 4 . 5 to prevent saturation . subsequently , the resulting ccd pixel intensities for the ‘ bow - tie ’ geometry are scaled accordingly to derive an absolute comparison to recorded chemiluminescence intensities from the glass substrates . ccd images of the chemiluminescence emission at these discrete time points are shown for the plain glass substrates ( fig8 ) and at the disjointed ‘ bow - tie junction ( fig9 ). pixel intensity scales for the both glass and ‘ bow - tie ’ images are equivalent to accurately reflect the dramatic increase in ‘ on - demand ’ photon flux from the chemiluminescent reactions . again , real time movies of the increase in ‘ photon flux ’ form the chemiluminescence solutions during exposure to a low power microwave pulse are shown here to demonstrate the functionality of the fluorescence microscope in a microwave , as shown in fig1 a , b . the feasibility of constructing a fluorescence microscope in a microwave cavity has been demonstrated herein . using this optical configuration , microwave induced real - time temperature decreases in 10 μm ru ( by ) 2 cl 2 solutions were observed on plain glass substrates and in proximity to discrete planar structure geometries . the chemiluminescence emission results show approximately 100 - fold increases in chemiluminescence emission from the ‘ bow - tie ’ geometry . with regards to the ‘ triggering of the chemiluminescent reactions , the ‘ triggered ’ emission commences from the side that is closest to the incident microwave field generated by the magnetron . the ccd images of the chemiluminescent solutions depict the acceleration of the chemiluminescent reactions due to microwave heating or dielectric loss to the chemiluminescence solution . since the right side of the image ( fig9 b ) is oriented closest to the magnetron , it is seen that the ‘ triggered ’ emission commence from the side closest to the microwave source . in a subsequent image ( fig9 c ), it was observed that the triggered emission from the wave reflected from the far wall of the cavity ( note : a standing wave is created in the cavity ). it is important to note that the ‘ bow - tie ’ tips are slightly offset to facilitate the viewing of ‘ triggered ’ emission that results from reflected waves in a microwave cavity . using the herein described microwave focused and triggering technologies , the feasibility of capturing real - time images of microwave induced solution heating and accelerated chemiluminescence reactions was demonstrated . the contents of the references discussed herein are incorporated by reference herein for all purposes . 1 . v . sridar , “ rate acceleration of fischer - indole cyclization by microwave irradiation ,” indian journal of chemistry section b - organic chemistry including medicinal chemistry 36 , 86 - 87 ( 1997 ). 3 . v . sridar , “ microwave radiation as a catalyst for chemical reactions ,” current science 74 , 446 - 450 ( 1998 ). 4 . r . s . varma , “ advances in green chemistry : chemical synthesis using microwave irradiation ,” ( astrazeneca research foundation , india , bangalore , 2002 ). 5 . c . o . kappe , “ high - speed combinatorial synthesis utilizing microwave irradiation ,” current opinion in chemical biology 6 , 314 - 320 ( 2002 ). 6 . d . adam , “ microwave chemistry : out of the kitchen ,” nature 421 , 571 - 572 ( 2003 ). 7 . k . aslan , s . n . malyn , and c . d . geddes , “ multicolor microwave - triggered metal - enhanced chemiluminescence ,” j am . chem . soc . 128 , 13372 - 13373 ( 2006 ). 8 . r . s . varma , “ solvent - free organic syntheses — using supported reagents and microwave irradiation ,” green chemistry 1 , 43 - 55 ( 1999 ). 9 . i . roy , and m . n . gupta , “ applications of microwaves in biological sciences ,” current science 85 , 1685 - 1693 ( 2003 ). 10 . r . gedye , f . smith , k . westaway , h . ali , l . baldisera , l . laberge , and j . rousell , “ the use of microwave - ovens for rapid organic - synthesis ,” tetrahedron letters 27 , 279 - 282 ( 1986 ). 11 . s . jain , s . sharma , and m . n . gupta , “ a microassay for protein determination using microwaves ,” analytical biochemistry 311 , 84 - 86 ( 2002 ). 12 . a . g . whittaker , and d . m . p . mingos , “ microwave - assisted solid - state reactions involving metal powders ,” j chem . soc . dalton trans . 12 , 2073 - 2079 ( 1995 ). 13 . s . caddick , “ microwave assisted organic reactions ,” tetrahedron 51 , 10403 - 10432 ( 1995 ). 14 . m . pagnotta , c . l . f . pooley , b . gurland , and m . choi , “ microwave activation of the mutarotation of alpha - d - glucose — an example of an intrinsic microwave effect ,” journal of physical organic chemistry 6 , 407 - 411 ( 1993 ). 15 . a . b . copty , y . neve - oz , i . barak , m . golosovsky , and d . davidov , “ evidence for a specific microwave radiation effect on the green fluorescent protein ,” biophysical journal 91 , 1413 - 1423 ( 2006 ). 16 . a . shaman , s . mizrahi , u . cogan , and e . shimoni , “ examining for possible non - thermal effects during heating in a microwave oven ,” food chemistry 103 , 444 - 453 ( 2007 ). 17 . r . k . adair , “ biophysical limits on athermal effects of rf and microwave radiation ,” bioelectromagnetics 24 , 39 - 48 ( 2003 ). 18 . k . r . foster , “ thermal and nonthermal mechanisms of interaction of radiofrequency energy with biological systems ,” ieee transactions on plasma science 28 , 15 - 23 ( 2000 ). 19 . r . weissenborn , k . diederichs , w . welte , g . maret , and t . gisler , “ non - thermal microwave effects on protein dynamics ? an x - ray diffraction study on tetragonal lysozyme crystals ,” acta crystallographica section d - biological crystallography 61 , 163 - 172 ( 2005 ). 20 . h . bohr , and j . bohr , “ microwave - enhanced folding and denaturation of globular proteins ,” physical review e 61 , 4310 - 4314 ( 2000 ). 21 . j . gellermann , w . wlodarczyk , b . hildebrandt , h . ganter , a . nicolau , b . rau , w . tilly , h . fahling , j . nadobny , r . felix , and p . wust , “ noninvasive magnetic resonance thermography of recurrent rectal carcinoma in a 1 . 5 tesla hybrid system ,” cancer research 65 , 5872 - 5880 ( 2005 ). 22 . k . hamad - schifferli , j . j . schwartz , a . t . santos , s . g . zhang , and j . m . jacobson , “ remote electronic control of dna hybridization through inductive coupling to an attached metal nanocrystal antenna ,” nature 415 , 152 - 155 ( 2002 ). 23 . m . j . r . previte , and c . d . geddes , “ spatial and temporal control of microwave triggered chemiluminescence : a rapid and sensitive small molecule detection platform ,” analytical chemistry in preparation ( 2007 ). 24 . c . l . r . catherall , t . f . palmer , and r . b . cundall , “ chemi - luminescence from reactions of bis ( pentachlorophenyl ) oxalate , hydrogen - peroxide and fluorescent compounds — kinetics and mechanism ,” journal of the chemical society — faraday transactions ii 80 , 823 - 836 ( 1984 ). 25 . o . filevich , and r . etchenique , “ 1d and 2d temperature imaging with a fluorescent ruthenium complex ,” analytical chemistry 78 , 7499 - 7503 ( 2006 ). 26 . b . durham , j . v . caspar , j . k . nagle , and t . j . meyer , “ photochemistry of ru ( bpy ) 3 2 + ,” journal of the american chemical society 104 , 4803 - 4810 ( 1982 ). 27 . j . vanhouten , and r . j . watts , “ temperature - dependence of photophysical and photochemical properties of tris ( 2 , 2 ′- bypridyl ) ruthenium ( ii ) ion in aqueous solution ,” journal of the american chemical society 98 , 4853 - 4858 ( 1976 ). 28 . o . filevich , and r . etchenique , “ 1d and 2d temperature imaging with a fluorescent ruthenium complex ,” analytical chemistry 78 , 7499 - 7503 ( 2006 ). 29 . n . a . nemkovich , a . n . rubinov , and a . t . tomin , “ inhomogeneous broadening of electronic spectra of dye molecules in solutions ,” in topics in fluorescence spectroscopy , vol . 2 , principles , j . r . lakowicz , ed . ( plenum press , new york , 1991 ), pp . 367 - 428 . 30 . m . j . r . previte , and c . d . geddes , “ microwave - triggered chemiluminescence with planar geometrical aluminum substrates : theory , simulation and experiment ,” journal of fluorescence 17 , 279 - 287 ( 2007 ).	6
hereinafter , embodiments of a navigation apparatus , a navigation server and a navigation system according to the present invention will be described in detail with reference to the drawings . fig1 is a structural diagram illustrating the configuration of the navigation system of the present invention . fig2 to fig4 are functional diagrams of the navigation system of the present invention . the configuration of the navigation system of the present invention will be described with reference to fig1 . the navigation system is comprised of a navigation server 100 , and a navigation apparatus 200 which is mounted in a vehicle ( mobile subject ) q . it should be noted that the navigation apparatus 200 may be mounted in a mobile subject other than a vehicle . it is also acceptable for the navigation apparatus 200 to be carried by a user . the navigation server 100 is comprised of one or a plurality of server computers . the navigation server 100 is provided with a first road traffic information storing element 101 , a second road traffic information storing element 102 , a situation information storing element 103 , a support map storing element 104 , a first support processing element 110 , and a second support processing element 120 . the first road traffic information storing element 101 is stored with first road traffic information ( required moving time , traffic congestion information or the like for an individual link ) on the basis of probe information ( position of an individual probe car at an individual time ) transmitted or uploaded from the navigation apparatus 200 to the navigation server 100 . the navigation apparatus 200 is mounted in a vehicle q which serves as a probe car or a floating car . the second road traffic information storing element 102 is stored with second road traffic information ( traffic regulation information , event information around an individual link , event type information if there were an event and the like , in addition to the required moving time and traffic congestion information for the individual link ) transmitted from a road traffic information center server or the like to the navigation server 100 . the situation information storing element 103 is stored with an area ( a specified area ) where a situation which is possible to exert obstruction against the moving or traveling of the vehicle q is happening or is possible to happen , and situation information of the situation ( summary of the situation , effect extent of the situation against the moving of the vehicle q ). the specified area and the situation information are associated to each other . the specified area and the situation information stored in the situation information storing element 103 may be updated appropriately according to the variations of the specified area and the situation information , respectively . the support map storing element 104 is stored with support map information . in the support map information , the location , shape and posture or the like of an individual link constituting a road are expressed by a series of coordinates (( latitude , longitude ), or ( latitude , longitude , altitude )). moreover , an individual link is tagged with link identification information for identifying the individual link and road type data . the boundary of an individual area is defined according to the series of coordinates of the support map information stored in the support map storing element 104 . the first support processing element 110 searches or retrieves the situation information from the situation information storing element 103 . the second support processing element 120 , on the basis of communication with the navigation apparatus 200 , causes the navigation apparatus 200 to recognize the specified area a and the situation information inf ( a ). the navigation apparatus 200 is comprised of an ecu or a computer mounted in the vehicle q as hardware , and a navigation program which provides the computer with various functions . it should be noted that the navigation program may be pre - installed in the memory ( rom ) in the vehicular computer ; or the entire or a part of the navigation program may be downloaded or broadcasted from a server ( not shown ) via a network or a satellite to the vehicular computer to store in the memory ( eeprom , ram ) or the like thereof at an arbitrary timing when there is a request or the like from the vehicular computer . the navigation apparatus 200 is provided with an input device 201 , an output device 202 , a navigation map storing element 204 , a first processing element 210 , and a second processing element 220 . the input device 201 is comprised of operating buttons disposed in a center console and a microphone in the vehicle q . it is possible for a user to perform various settings by operating or vocally instructing the input device 201 . the output device 202 is a display device disposed in the center console of the vehicle q for displaying or outputting map information or the like . the navigation map storing element 204 is stored with navigation map information or the like to be output to the output device 202 . in the navigation map information , the location , shape and posture or the like of an individual link constituting a road are expressed by a series of coordinates . moreover , an individual link is tagged with the link identification information for identifying the individual link . even the definitions of the coordinates in the navigation map information and the support map information are different due to the different specifications and data architectures therebetween , it is possible to match the links by tagging the identical links with common link identification information . the first processing element 210 searches or defines a navigation route r which is comprised of a plurality of links and joins a present position p 1 and a destination p 2 of the vehicle q . the second processing element 220 recognizes the specified area a and the situation information inf ( a ) representing a situation which will affect the moving of the vehicle q in the specified area a , and outputs the navigation route r defined by the first processing element 210 to the output device 202 . further , the second processing element 220 determines whether an entry position p in to the specified area a is present in the navigation r . on a condition that the presence of the entry position p in is determined , the second processing element 220 displays the entry position p in on a map based on the navigation map information and outputs an icon x having a design corresponding to the situation information inf ( a ) to the output device 202 . furthermore , the second processing element 220 recognizes a distance from the present position p 1 to the entry position p in along the searched navigation route r , and outputs a notification when the distance is equal to or smaller than a predefined distance . note that “ a component of the navigation server 100 or the navigation apparatus 200 which serves as hardware “ recognizes ” information ” means that the component performs a possible information processing on apiece of information to prepare the piece of information ready for other information processing , for example , the component receives the piece of information ; searches the piece of information in a database or memory or retrieves the piece of information from a database or memory ; calculates , estimates , configures , determines , searches the piece of information or the like via arithmetic processing on the basis of the received basic information or the like ; elicits information by decoding packages ; and stores in memory or the like the calculated information or the like . in addition , “ a component serving as hardware “ outputs ” information ” means that the component outputs the information in form of picture , voice , vibration and the like , which may be recognized by a human by means of five senses thereof such as eyesight , hearing , touch , etc . the function of the navigation system with the above - mentioned configuration will be explained with reference to fig2 through fig4 . the first processing element 210 in the navigation apparatus 200 recognizes the present position p 1 and the destination position p 2 of the vehicle q ( fig2 / s 211 ). the present position of the vehicle q is calculated or determined according to an arithmetic computation on gps signals received by a gps receiver , or output signals from a vehicular acceleration sensor or a vehicular gyro sensor . the destination position p 2 of the vehicle q is defined or recognized on the basis of operation signals inputted via the input device 201 to the navigation apparatus 200 or phonetic signals issued by the user . the first processing element 210 retrieves the navigation map information from the navigation map storing element 204 , and receives the road traffic information ( containing the first road traffic information and the second road traffic information ) distributed or broadcasted from the navigation server 100 . thereafter , on the basis of the navigation map information and the road traffic information , the first processing element 210 searches one or a plurality of routes joining the present position p 1 and the destination position p 2 of the vehicle q ( fig2 / s 212 ). the road traffic information contains cost ( required moving time or the like ) for an individual link . if the cost for a link where traffic regulation , for example , is probably conducted is high , a route which does not contain the link may be searched in high priority . accordingly , the navigation route r which joins the present position p 1 and the destination position p 2 of the vehicle q and contains a plurality of links is searched or defined , as illustrated in fig3 , for example . in the navigation server 100 , the first support processing element 110 searches the specified area a and the situation information inf ( a ) from the situation information storing element 103 ( fig2 / s 122 ). thereby , a framed specified area a illustrated in fig3 , for example , is recognized . the situation information inf ( a ) includes weather - relating information or natural phenomenon - relating information , such as “ the precipitation is surpassing 00 mm / h , therefore , it is possible for the floods or the earth - flow disaster to happen .”, “ the vision is bad due to fog .”, “ there is a earth fissure occurred .” and the like , and man - made disaster - related information , such as “ the vehicles involved in the traffic accident are still left on the road .”, “ there is a fire nearby .” and the like . thereafter , the second support processing element 120 distributes or broadcasts the specified area a and the situation information inf ( a ) to the navigation apparatus 200 ( fig2 / arrow a 1 ). accordingly , the second processing element 220 receives or recognizes the specified area a and the situation information inf ( a ) distributed or broadcasted from the navigation server 100 ( fig2 / s 221 ). thereafter , the second processing element 220 determines where the entry position p in to the specified area a is present in the navigation route r searched by the first processing element 210 ( fig2 / s 222 ). for example , in the case where the mobile subject is passing the specified area a in the searched navigation route r as illustrated in fig3 , the presence of the entry position p in is determined . in the case where the presence of the entry position p in is determined ( fig2 / s 222 . . . yes ), the second processing element 220 outputs the icon x indicating the entry position p in at the searched navigation router to the output device 202 ( fig2 / s 223 ). thereby , as illustrated in an example in fig4 , a map with the searched navigation route r , the icon x and the situation information inf ( a ) is displayed on the output device 202 . the design of the icon x is configured in association with the situation information inf ( a ) and is stored in memory . subsequently , the second processing element 220 recognizes or measures a distance from the present position p 1 of the vehicle q to the entry position p in to the specified area a . thereafter , the second processing element 220 determines whether the distance is within a predefined distance ( fig2 / s 224 ). if the determination result is positive ( fig2 / s 224 . . . yes ), an approaching notification indicating an approach to the entry position p in to the specified area a is outputted . thereby , for example , when the distance is equal to or smaller than the predefined distance , a piece of message , such as “ the road ahead is slippery due to rain .” or the like is displayed on the output device ( display device ) 202 ; or the aforementioned message or a pop sound is phonetically output to the output device ( speaker ) 202 . on the other hand , if the entry position p in is determined to be absent ( fig2 / s 222 . . . no ), the second processing element 220 retrieves the navigation route r from memory , overlaps the navigation route r on the map based on the navigation map information and output it to the output device 202 ( fig2 / s 226 ). according to the navigation system exhibiting the functions mentioned above , in the case where the vehicle q enters moves along the searched navigation route r , the enter to the specified area a and the situation information inf ( a ) of a situation happening in the specified area a or possible to happen in the specified area can be recognized by a user via the icon x which has a design corresponding to the situation information inf ( a ) to indicate the entry position p in to the specified area a ( refer to fig2 / s 223 and fig4 ). further , when the vehicle q approaches the entry position p in to the specified area a in the searched navigation route r , it will be recognized by the driver of the vehicle q via the output of the approaching notification ( refer to fig2 / s 225 ). furthermore , it is possible for the user to take an appropriate action according to the situation information , such as determining whether to detour the specified area , issuing a re - searching instruction for another route to the navigation apparatus on the basis of the determination , or detouring along the outputted navigation route . it is acceptable that the present position p 1 and the destination position p 2 of the vehicle q is transmitted or uploaded from the navigation apparatus 200 to the navigation server 100 , together with a navigation identifier for identifying the navigation apparatus 200 , a support route joining the present position p 1 and the destination position p 2 is defined on the basis of the support map information or the like stored in the support map storing element 203 in the navigation server 100 , and a link identifier of an individual link constituting a part of or the entire part of the support route is transmitted or uploaded as the road traffic information from the navigation server 100 to the navigation apparatus 200 having the navigation identifier . thereby , in the navigation apparatus 200 , the first processing element 210 may define a navigation route r which is partially or completely identical or similar to the support route ( refer to fig2 / s 212 and fig3 ). in other words , the navigation route r may be defined or set in the navigation apparatus 200 according to a definition algorithm for defining the support route in the navigation server 100 . although the present invention has been explained in relation to the preferred embodiments and drawings but not limited , it should be noted that other possible modifications and variations made without departing from the gist and scope of the invention will be comprised in the present invention . therefore , the appended claims encompass all such changes and modifications as falling within the gist and scope of the present invention .	6
fig1 illustrates a configuration for a prior art bootstrapping interference canceler which entitled &# 34 ; bootstrapping adaptive cross pol cancelers for satellite communications &# 34 ; in icc &# 39 ; 82 , philadelphia , pa ., at pages 4f . 5 . 1 - 4f . 5 . 5 . in this particular configuration , two cross - coupled interference cancellation loops each use a measure of the correlation between the two output signals as their source of feedback information . in fig1 the input to one rail 10 of the canceler will be designated s ( t )+ bn ( t ) comprising a first one of two orthogonally polarized signals , designated &# 34 ; s &# 34 ;, with some interference from a second one of the two orthogonally polarized signals designated &# 34 ; n &# 34 ;. the input on the other rail 11 is designated cs ( t )+ n ( t ) comprising the second one of the two orthogonally polarized signals , &# 34 ; n &# 34 ;, with some interference from the first one of the two orthogonally polarized signals , &# 34 ; s &# 34 ;. in the above designations , s ( t ) and n ( t ) are the first and second orthogonally polarized complex signals to be separated , and b and c are the complex depolarization coefficients . in the known canceler of fig1 the goal is to adjust a complex cancellation coefficient α so as to obtain an interference - free version of the first signal &# 34 ; s &# 34 ;, and to vary a cancellation coefficient β so as to obtain an interference - free version of the second signal &# 34 ; n &# 34 ;. this is accomplished by taking a sample of the first signal on rail 10 and sending it through a discriminator 12 to provide an output signal representative of the discrimination between the first signal s ( t ) and the interference bn ( t ), which output signal is correlated in correlator 13 with the signal cs ( t )+ n ( t ) found on rail 11 and the result of such correlation is then provided as an input to , for example , a power detector 14 . correlator 13 generally functions to measure the in - phase and quadrature components of the correlation between the signals from discriminator 12 and the signal from rail 11 . power detector 14 takes the result of this correlation and generates an output control signal which is used to appropriately adjust the cancellation coefficient β in circuitry 15 in a cross - over path from rail 10 to rail 11 to introduce a signal into rail 11 which cancels , or substantially reduces , the value of the interference cs ( t ) in the signal on rail 11 . an example of the above - described arrangement for elements 12 - 15 is shown and described in u . s . pat . no . 4 , 283 , 795 issued to m . l . steinberger on aug . 11 , 1981 . a similar arrangement , including a discriminator 16 , a correlator 17 , and a power detector 18 , is used with rail 11 to appropriately adjust the cancellation coefficient α in circuitry 19 in a cross - over path from rail 11 to rail 10 to introduce a signal into rail 10 which cancels , or substantially reduces , the value of the interference bn ( t ) in the signal on rail 10 . in the absence of the discriminator 12 or 16 , the two correlation measurements provided in correlators 13 and 17 would be the same , and the interference canceler could not possibly converge for both directions of cancellation . the purpose of discriminators 12 and 16 , again , is to provide discrimination between the signal and the interference on the appropriate output signal so that the corresponding correlation measurement is more sensitive to the interference than it is to the signal . when the discrimination function is present , then at least one cancellation loop can converge toward the desired cancellation . as the one cancellation loop converges , it provides a cleaner sample of interference to the other cancellation loop . with this cleaner sample of interference , the second cancellation loop can converge towards its desired cancellation , providing a cleaner sample of interference to the first cancellation loop . this allows the first cancellation loop to converge further , and the process is continued until complete interference cancellation has been obtained in both directions . the advantage of the bootstrapping configuration is that neither correlation measurement need be completely sensitive to the corresponding interference and completely insensitive to the signal . instead , all that is required is that there be a discrimination method which is somewhat more sensitive to the appropriate interference than it is to the corresponding signal . in the article &# 34 ; cross - coupled cancellation system for improving cross - polarisation discrimination &# 34 ; by d . h . brandwood in international conf . on antennas & amp ; propagation , london , nov . 1978 at pages 41 - 45 , an arrangement similar to that shown in fig1 is disclosed . in the adaptive cancellation system in fig2 of the article , it is suggested that limiters be used in the phase reference side of the correlators . a similar suggestion was made in the bar - ness et al article , parts of which will be summarized hereinafter for purposes of background understanding of the present invention . the bar - ness et al . article discloses a limiter simulation circuit which introduces two qpsk signals having slightly different baud rates as the two source signals . this limiter simulation circuit is shown in present fig2 for completeness of discussion . in fig2 the two modulators 20 and 21 are asynchronous in both clock and carrier phase . the output from each of modulators 20 and 21 is transmitted through a separate filter 22 and 23 , respectively . in a summation junction 24 , a small but variable amount of signal n , as obtained from filter 22 through a variable attenuating means 25 , was added to signal s , as obtained from filter 23 , and the resultant signal passed through a limiter or some other device under test ( dut ) 26 . the output from a limiter 26 was then correlated in correlators 27 and 28 with the signal s and the signal n , respectively , to obtain the associated output signals . from the bar - ness et al article , it was shown that the inclusion of a limiter provided small signal suppression . if two 64 qam source signals are substituted for the two qpsk source signals provided by modulators 20 and 21 in the limiter simulation circuit of fig2 and first a path which introduces no distortion is substituted as the ( dut ) 26 and a first test run is made , and then an ideal limiter is introduced for the dut 26 and another corresponding test is run , the results shown in fig3 would be obtained . in fig3 the dashed line represents the resultant curve for the ratio n / s of the signals at the input vs . the n / s ratio of the signals at the output in the arrangement of fig2 as found for an undistorted path being used for the limiter , while the solid line represents the resultant curve of the corresponding ratios when an ideal limiter is used as dut 26 . from fig3 it can be seen that the ideal limiter provides a slight amount of signal suppression , which agrees with the results of the bar - ness et al article . more particularly , when the interference is a nearly constant envelope , then the ideal limiter can be expected to display a small signal suppression . however , when the interference has large amplitude fluctuations , the small signal suppression is very slight . if one considers only those times at which the input envelope to the limiter in fig2 is above a given threshold , where presumably the desired signal is greater than both the threshold and the small undesired signal , it should result in greater suppression of the smaller signal . using the limiter arrangement shown in fig4 e . g ., an ecl schmitt - trigger circuit having the p in vs . p out characteristics shown in fig4 for the limiter or dut 26 in the simulation circuit of fig2 the results obtained are shown in fig5 . as shown in fig5 it was found that such limiter arrangement actually enhances the effect of the small signal , rather than suppressing it . in accordance with the present invention , this problem is overcome by the use of a novel noise - blanking limiter of the type shown in fig6 having the p in vs . p out characteristic shown in fig6 rather than the characteristic of the limiter of fig4 . this limiter comprises two ecl comparators 40 and 41 , where each comparator can comprise an operational amplifier including &# 34 ;+&# 34 ; and a &# 34 ;-&# 34 ; input terminals and an output terminal . the input signal to this limiter is applied to the &# 34 ;+&# 34 ; and &# 34 ;-&# 34 ; terminals of comparators 40 and 41 , respectively , via a capacitor 42 . the other input terminal of each of comparators 40 and 41 has applied thereto a separate threshold voltage for purposes of comparison . the output terminal of comparators 40 and 41 are each applied to a separate input terminal of an or gate 43 . the results obtained with the limiter of fig6 when tested as the dut in the arrangement of fig2 is shown in fig7 . as seen in fig7 different small signal suppressions are found over a wide range of thresholds . noise - blankers are well known . in this regard see , for example , u . s . pat . no . 140 , 445 issued to r . t . myers et al in july 7 , 1964 ; and u . s . pat . no . 3 , 699 , 457 issued to l . r . wright on oct . 17 , 1972 . noise blankers are generally used to suppress interference which has a high amplitude , but small duty cycle , such as ignition , impulse , or power line noise . with input cross - polarization signals , however , the interference has essentially ( a ) a one hundred percent duty cycle , and ( b ) a small amplitude which almost never exceeds the amplitude of the desired signal . therefore , with such signal , the application of a noise blanking limiter , as applied in the prior art , would have no effect whatsoever on such cross - polarized signals . fig8 is a block diagram of a bootstrapping cross - polarization canceler in accordance with the present invention which includes a noise - blanking limiter for use as a discriminator and a correlation means to provide interference suppression . the numbering of the elements of fig8 have been related to each of the numbers of the elements of fig1 where possible when a corresponding function exists , to provide an ease of understanding similar parts of the present cross - polarization canceler . in fig8 the input signal on rail 10 is connected to a delay line 50 and a β adjust circuit 15 in the cross - over path between rail 10 and rail 11 . similarly , the input signal on rail 11 is connected to a delay line 51 and an α adjust circuit 19 in the crossover path between rail 11 and rail 10 . delay lines 50 and 51 function to match the delay times encountered in adjusting circuits 19 and 15 , respectively . the outputs from delay line 50 and α adjust circuit 19 are added in an adder 53 , which can comprise a summing amplifier . the result of adding these two input signals in adder 53 is to provide an output signal from adder 53 with a reduced cross - polarization component &# 34 ; bn ( t )&# 34 ; on rail 10 . similarly , the outputs from delay line 51 and β adjust circuit 15 are added in an adder 54 to provide an output signal from adder 54 with a reduced cross - polarization component &# 34 ; cs ( t )&# 34 ; on rail 11 . the output from adder 53 is the output signal on rail 10 from the canceler and is also applied to a noise blanking limiter 12 , of the type shown in fig6 which functions as the discriminator 12 in the arrangement of fig1 . the output from noise blanking limiter 12 is correlated in correlation detector means 13 with the output signal on rail 11 , which can be amplified in an optional buffer amplifier 55 . the output from correlation detector means 13 is then applied to a digital signal processor ( dsp ) means 57 via , for example , an analog - to - digital ( a / d ) converter 58 . similarly , the output from adder 54 is the output signal on rail 11 from the canceler and is also applied to a noise blanking limiter 16 , of the type shown in fig6 which functions as the discriminator 16 in the arrangement of fig1 . the output from noise blanking limiter 16 is correlated in correlation detector means 17 with the output signal on rail 10 , which can be amplified in optional buffer amplifier 56 . noise blanking limiter 16 is shown with dashed lines to signify that only one of either one of noise blanking limiters 12 and 16 is actually required , since the present cross - polarization canceler will operate with only one noise - blanking limiter , but not as well as with both noise blanking limiters which is the preferred embodiment . the output of correlation detector means 17 is then applied to dsp means 57 via an a / d converter 59 . dsp means 57 functions , in accordance with steps stored in an associated eprom 115 , as both the power detecting means 14 and 18 in the arrangement of fig1 to provide appropriate control signals to adjusting circuits 15 and 19 for converging the present cross - polarization canceler . the output from the present cross - polarization canceler on rails 10 and 11 are then applied to a receiver terminal which appropriately demodulates the converged output signal &# 34 ; s ( t )&# 34 ; on rail 10 in a demodulator 60 using a predetermined carrier frequency generated by a carrier signal means 61 , and demodulates the converged output signal &# 34 ; n ( t )&# 34 ; on rail 11 in a demodulator 62 using a predetermined carrier frequency generated by a carrier signal means 61 . the output signals from demodulators 60 and 62 can be applied to optional pseudo error detector means 64 and 65 , respectively , which function to determined the error rate in each output signal . if such detector means are used , the output signal from detector means 64 and 65 , indicating the bit error rate in the output signals on rails 10 and 11 , respectively , can be applied as separate inputs to dsp means 57 . such error rate control signals can be then used by dsp means 57 to determine if such error rate is below or above a predetermined threshold level . if the error rate is below the threshold level , then dsp means 57 can use the control signals from detector means 64 and 65 in aiding in the converging of the canceler by monitoring if the bit error rate is increasing or decreasing . if , however , the error rate is above the threshold level , indicating , for example , an outage or trouble condition , dsp means 57 can be arranged to not use the output signals from detector means 64 and 65 in aiding the converging process of the canceler , for reasons stated previously , and in turn use the correlation measurements of correlation detector means 13 and 17 . in fig8 α and β adjusting means 19 and 15 are shown using a typical arrangement which is for purposes of explanation only and not for purposes of limitation since other and different circuitry can be used to obtain similar results . more particularly , each of adjusting means 15 and 19 are shown as including a tapped delay line with four delay sections 70 , four transversal taps with weighting circuits 71 , two optional recursive taps with weighting circuits 72 , a summing amplifier 73 , and a matching arrangement 74 . each of the optional recursive tap weighting circuit 72 outputs are combined and added to the input signal on the associated rail in summing amplifier 73 to provide a resultant output signal which is provided to the input of the delay line comprising delay sections 70 . the outputs from the weighting circuits 71 associated with the transversal taps are added together and added to the input signal of the other rail in associated added 53 or 54 . each of the weighting circuits 71 and 72 apply a separate predetermined weighting coefficient which is determined by dsp means 57 and transmitted to weighting circuits 71 and 72 via control signals on a tap weight control signal bus 75 . fig9 illustrates a block diagram of a typical noise - blanking limiter and correlation detector means for use in the canceler of fig8 . it is to be understood that the arrangement of fig9 applies to the combination of either one of noise - blanking limiter 12 and correlator detector means 13 or noise - blanking limiter 16 and correlation detector means 17 , since both combinations comprise the same arrangement . however , the discussion hereinafter of the arrangement of fig9 will be directed only toward the combination of noise - blanking limiter 12 and correlation detector means 13 . in fig9 the input signal on rail 10 , designated input a , propagates along rail 10 to the output and is also applied to noise - blanking limiter 12 . noise - blanking limiter 12 as shown in fig9 is an equivalent circuit to that shown in fig6 and comprises a first and second operational amplifier ( op - amp ) 80 and 81 with the input signal on rail 10 being applied to the &# 34 ;+&# 34 ; input terminal of each op - amp and a separate threshold level being applied to each &# 34 ;-&# 34 ; input terminal . the output of op - amp 80 is inverted and added to the non - inverted output from op - amp 81 and the resultant signal is concurrently applied to one input of a first exclusive - or ( ex - or ) gate 82 and through a delay circuit 83 to one input of a second ex - or gate 84 . for purposes of discussion , it will be assumed that the input to ex - or gate 84 is phase shifted by approximately 90 degrees from the input to ex - or gate 82 by delay circuit 83 . ex - or gates 82 and 84 are used to multiply the output of noise - blanking limiter 12 by a &# 34 ;+ 1 &# 34 ; or a &# 34 ;- 1 &# 34 ;, under control of the input control signals designated control 1 and control 2 from dsp 57 . each of the outputs from ex - or gates 82 and 84 are added to the signal propagating on rail 11 , designated signal b , in summing junctions 85 and 86 , respectively , which form part of correlator detector means 13 . the outputs of summing junctions 85 and 86 are , therefore , b ± a and b ± ja , respectively . the outputs from summing junctions 85 and 86 are then passed through a first and second passband filter 87 and 88 , respectively , and then into respective square law devices 89 and 90 . the passband filters 87 and 88 are used to remove higher frequency products from the output of the noise - blanking limiter 12 which would otherwise cause a dc offset in the square law devices 89 and 90 . the outputs from square law devices 89 and 90 can be optionally conditioned by opamp circuits 91 and 92 , respectively . the square law devices can comprise any suitable circuit as , for example , a differential pair of transistors arranged in a current - mirror configuration with the nonlinear element being the base - emitter junction of the input transistor which is biased to a quiescent current . the resultant combination of signals a and b at the output of correlator detector means 13 are shown in fig9 and are then sent to a / d converter 58 as shown in fig8 . to have the bootstrapping mode , however , in order to provide a convergence which is close to the capabilities of the cancellation network , it is preferred the correlation detector measure the correlation at the same number of relative delays as found in the cancellation network of adjusting means 15 or 19 . an exemplary approach is shown in fig1 where both noise - blanking limiters 12 and 16 are shown with the correlation detecting portion of correlator detecting means 13 and 17 . more particularly , noise blanking limiter 12 and 16 each comprise op - amps 80 and 81 connected as shown for limiter in fig9 . two outputs are obtained from this op - amp combination . the first output is the combination of the inverted output of op - amp 80 and the normal output of op - amp 81 , as provided in the arrangement of fig9 and the second output is an inverted output of op - amp 81 which is connected to one input of an ex - or gate 100 , the output of which acts as a true limiter . a similar arrangement is provided for noise blanking limiter 16 comprising op - amps 105 and 106 and ex - or gate 107 . the first output from noise blanking limiter 12 is provided to correlation detector means 17 where it is propagated through a tapped delay line portion thereof comprising separate predetermined delays 101 . each tap provides a first input to a separate ex - or gate 102 with the second input to each gate being provided from the second output from noise - blanking limiter 16 which is the limited signal b on rail 11 . it is to be understood that an ex - or gate can not only multiply a digital signal by &# 34 ;+ 1 &# 34 ; or &# 34 ;- 1 &# 34 ;, as found in gates 100 and 107 , but can also perform a mixing , or multiplication , function on two digital signals as found in gates 102 . therefore , ex - or gates 102 function to perform the correlation of one signal with the output of a noise blanking limiter . additional ex - or gates can be used to obtain both a correlation and its complement , so that the zero point of the correlation detector means could be removed . op - amp circuits 103 may also be required to condition the measured correlation for input to a / d converter 58 or 59 via a low - pass filter . a similar arrangement of delays 101 , ex - or gates 102 and op - amps 103 is provided in a corresponding portion of correlation detector means 13 . it is to be understood that the number of taps formed by delays 101 are preferably the same number as the number of taps found in either one of adjusting means 15 and 19 . each of the delays 101 has a same or different delay from that of the other delays 101 to provide predetermined correlation measurements at different offsets in time . in this manner the increased number of taps provide the added measurement points which improve the acquisition performance of the present canceler . fig1 is a block diagram of an exemplary arrangement of dsp 57 of fig8 . the control algorithm used is somewhat similar to that used in the interference canceler of u . s . pat . no . 4 , 320 , 535 issued to d . m . brady et al on mar . 16 , 1982 . as was stated hereinbefore , prior art cross - polarization cancelers had severe difficulties when the digital terminal lost the carrier and / or clock . if either the carrier or clock were lost , then the error indications from the pseudo error detector 64 or 65 no longer had any meaning and the cross - polarization canceler was without a desirable feedback signal . in the absence of cross - polarization cancellation , the cross - polarization interference prevented the digital terminal from re - acquiring carrier and clock in a timely manner . this problem can be solved with the present cross - polarization canceler by providing an optional primary source of feedback to dsp 57 from optional pseudo error detectors 64 and 65 , and a secondary source of feedback to dsp 57 from correlator detector means 13 and / or 17 , which is the primary source when feedback from detectors 64 and 65 is not present or usable . it is to be understood that the discussion of fig1 hereinafter assumes the use of pseudo error detectors 64 and 65 . however , it is to be understood that such feedback from detectors 64 and 65 is a supplementary feature of the present invention since the present novel canceler arrangement is capable of continuous operation using only the feedback from correlator detector means 13 and 17 . with this in mind , as shown in fig1 , the control signals corresponding to the correlation measurements from correlation detector means 13 and 17 are received and temporarily stored in a buffer 110 , while the control signals corresponding to the error count from optional pseudo error detectors 64 and 65 are temporarily stored in a buffer 111 . a processor 112 , which can comprise any suitable processing means such as a microprocessor or hard - wired circuit , can function to compare the pseudo error count control signals stored in buffer 111 with a predetermined threshold level and determine if an outage condition exists . if no outage condition exists , processor 112 places a switch 113 in a position to output the pseudo error count control signal onto lead 114 to each control channel 117 . if an outage condition exists , then processor 112 positions switch 113 to provide the correlation measurement control signal stored in buffer 110 as an output on lead 114 to each control channel 117 . processor 112 also addresses an associated read - only - memory ( rom ) 115 to obtain a predetermined dither signal corresponding to the error count or correlation measurement which is transmitted along lead 116 to each control channel 117 . a separate control channel 117 is provided for each of the transversal taps 71 and the optional recursive taps 71 in each of adjusting means 15 and 19 . each control channel is shown as including a multiplier 120 which multiplies the feedback control signal on lead 114 with the dither signal from rom 115 on lead 116 . the output signal from multiplier 120 is then filtered by two single pole low pass filtering means . the first filtering means comprises a summing circuit 121 which adds the output signal from multiplier 120 with a feedback signal obtained by multiplying the output from summer 121 in a multiplier 122 with a first constant &# 34 ; a2 &# 34 ; and then delaying the resultant signal by one sample signal period in a delay - by - 1 circuit 123 . the second filtering means is in series with the first filtering means and comprises a similar arrangement of a summing circuit 124 for summing the output from summer 121 with a feedback signal obtained by multiplying the output from summer 124 with a second constant &# 34 ; a1 &# 34 ; in multiplier 125 and delaying the resultant signal by one sample period in a delay - by - one circuit 126 . essentially , one filter is an integrator to provide the loop gain , and the other filter is a higher frequency filter which minimizes the effect of statistical variations in the pseudo error count or correlation measurement . the dither signal on lead 116 is also propagated down a second path 127 where it is multiplied by a constant &# 34 ; k &# 34 ; in multiplier 128 . the output from multiplier 128 is delayed by two sample periods in a delay means 129 to arrive at a summing means 130 at the same time as the twice delayed and adjusted control signal from summer 124 . summing means 130 adds the two signals and provides the output signal from the control channel to the associated tap 71 or 72 in an associated one of adjusting means 15 or 19 . it must be understood that when a dither signal is added to a control signal during a particular program cycle , it does not affect the control voltage until the beginning of the next program cycle . the feedback signal , which results from that dither signal , is , therefore , not available until the end of the second program cycle , and is not processed by the control algorithm until the third program cycle . the correction for this two - cycle delay is , therefore , built into the control algorithm . a switching means 131 , under the control of processor 112 , is provided at the output of the control channels 117 associated with the optional recursive taps 72 in an associated one of adjusting means 15 or 19 for the following reason . in the acquisition mode , using only the measured correlations from detector means 13 and / or 17 , the recursive taps in adjusting means 15 or 19 should be set to zero when present , thus setting the recursive equalizer to unity gain . this is achieved by processor means 112 positioning switch 131 to apply a ground at each of the recursive taps 72 . this is necessary because a recursive equalizer is capable of oscillating , which , if it were to occur , would cause a reduction in the measured correlations . since the dither algorithm is attempting to reduce the measured correlation , it will drive the recursive equalizer further into oscillation , which is undesirable .	7
fig1 shows an exploded view of the inner assembly of an accelerometer with internal temperature compensation . for purposes of clarity the outer package of the accelerometer which typically consists of a metal can and header with electrical connections is not shown . the inner accelerometer assembly includes system electronics 8 , an exemplary quartz proof mass 1 with support ring 9 and two support hinges 6 , bottom pole piece 3 , top pole piece 2 and torque feedback coil 5 . in the completed assembly the two pole pieces and proof mass are clamped together by screws 4 as shown in fig3 . in one embodiment , the support hinges 6 are laser trimmed , as described in the co - pending application entitled “ laser ablation of accelerometer proof mass .” the proof mass 1 is positioned between first and second pole pieces 2 and 3 and is able to move a small amount either toward pole piece 2 or toward pole piece 3 due to application of an acceleration or a pull of gravity . this movement is possible because the proof mass support ring has a slightly increased thickness at the top semicircular end 7 . the position of the proof mass is determined by measuring the capacitance between the top metalized surface of the proof mass and the bottom pole piece and between the bottom metalized surface of proof mass and the top pole piece . the bottom pole piece has a cylindrical permanent magnet 6 mounted within it . a feedback coil 5 is mounted to the proof mass and together with the magnetic field from the magnet produces a torque on the proof mass when energized with a current . the system electronics enables measurement of the two capacitances and equalization of them through application of current to the feedback coil thus continually centering the proof mass and balancing out applied accelerations . fig2 shows an exemplary temperature compensated accelerometer controller 102 . the controller 102 measures the current in the feedback coil 5 of the tba 108 , and the output is suitably filtered and digitized with the low pass filer and a / d converter 212 . the output of the a / d converter 212 is provided to a processor 210 in the controller 102 . the controller 102 may also include a temperature sensor 202 connected to the processor 210 for determining temperature of the environment of the electronic device 102 . it will be appreciated that the temperature sensor 202 may take many forms such as , for example , an electrical resistance thermometer which has a resistance which varies with temperature . the processor 210 runs a temperature adjustment module 110 . in some embodiments , the processor 210 may utilize data stored in a memory 214 of the electronic device 102 , such as a look - up table or formula , to determine a temperature correction factor to correct for bias factor and scale factor variations due to temperature in accordance with the measured temperature . that is , a temperature mapping may be used to determine a temperature compensation factor . because temperature sensitivity may vary between accelerometers , the temperature mapping ( e . g . the look - up table or formula ) for a particular tba may be constructed by measuring the accelerometer output over a range of temperatures in which the tba is intended to operate . the temperature correction factor can then be used to adjust the accelerometer output during measurement to compensate for the temperature sensitivity . the temperature mapping ( e . g . the look - up table or formula ) data may be provided in a memory of the ic , such as eeprom or flash memory . as shown in fig2 a , a digital to analog converter ( d / a converter ) can be driven by the processor 210 to provide analog output corresponding to acceleration . the processor 210 can run a serial communication module 112 that drives serial input / outputs 104 / 106 to communicate with an external processor reading for the acceleration data . the processor 210 may provide an industry standard interface such as an rs - 232 , spi or i2c interface for connecting to an external electronic device . fig3 shows another exemplary circuit with a temperature compensated accelerometer and support electronics . in this embodiment , a microprocessor 230 generates a pulse excitation signal through an amplifier 202 and a matched resistor array 204 whose outputs are provided to an accelerometer proof mass 210 . a differential amplifier 212 is connected to the proof mass 210 and the matched resistors 204 , and the output of the differential amplifier 212 is provided to a synchronous demodulator 214 whose output are is connected to a buffer 216 . the buffer drives a loop compensation unit 218 , which in turn is connected to a driver 220 . the output of the driver 220 is connected to a feedback drive coil 222 to generate an accelerometer analog signal output . an analog to digital converter ( adc ) 226 is connected to the accelerometer analog signal and sense resistor 224 . the processor 230 receives the output of the adc 226 . the processor 230 can also drive a dac 232 to provide temperature calibrated analog output , and the processor 230 reads from a temperature calibration memory 234 . in one exemplary embodiment , the processor 210 can store the following sensor constants in memory : memory constant description of constant 16 accelerometer offset correction ( milligees * 10 ) at − 25 c ., default 0 17 accelerometer offset correction ( milligees * 10 ) 0 c ., default 0 18 accelerometer offset correction ( milligees * 10 ) 25 c ., default 0 19 accelerometer offset correction ( milligees * 10 ) 50 c ., default 0 20 accelerometer offset correction ( milligees * 10 ) 75 c ., default 0 21 accelerometer offset correction ( milligees * 10 ) 100 c ., default 0 22 accelerometer offset correction ( milligees * 10 ) 125 c ., default 0 23 accelerometer offset correction ( milligees * 10 ) 150 c ., default 0 24 accelerometer offset correction ( milligees * 10 ) 175 c ., default 0 25 accelerometer scale factor ( v / gee ) @− 25 c ., default 1 , 000 26 accelerometer scale factor ( v / gee ) @ 0 c ., default 1 , 000 27 accelerometer scale factor ) v / gee ) @ 25 c ., default 1 , 000 28 accelerometer scale factor ( v / gee ) @ 50 c ., default 1 , 000 29 accelerometer scale factor ( v / gee ) @ 75 c ., default 1 , 000 30 accelerometer scale factor ( v / gee ) @ 100 c ., default 1 , 000 31 accelerometer scale factor ( v / gee ) @ 125 c ., default 1 , 000 32 accelerometer scale factor ( v / gee ) @ 150 c ., default 1 , 000 33 accelerometer scale factor ( v / gee ) @ 175 c ., default 1 , 000 the temperature compensated controller 102 enables the scale and offset calibration data to be measured at the factory and stored in the tba internal memory . by adding an internal microprocessor and an analog to digital converter to the tba electronics , the system can temperature - correct the accelerometer digital data output before transmission of the data . in addition by including a digital to analog converter to the system electronics it is possible to output an analog voltage proportional to acceleration that is temperature calibrated . the process of temperature calibration of the tba is lengthy in that it involves cooling and heating the system to various set temperatures e . g . − 25 , 0 , 25 , 50 , 75 , 100 , 125 , 150 , 175 degrees celsius and measuring the scale factor and offset at each temperature . by performing this process at the factory and downloading the calibration data to the tba memory instead of temperature calibrating the tba after it is installed in an external system , considerable time is saved by the user of the tba . in addition performing an external calibration of the tba requires considerable equipment and expertise . internal calibration performed at the factory hence removes the burden of the difficult and time consuming calibration process from the tba user . fig4 shows an exemplary factory calibration methodology . in this process , a plurality of tbas are put into a temperature controlled chamber system and the chamber performs cooling and heating the system to various set temperatures e . g . − 25 , 0 , 25 , 50 , 75 , 100 , 125 , 150 , and 175 degrees celsius . the tbas are interrogated and the factory system determines the scale factor and offset at each temperature for each tba . thus , in fig4 , the temperature range is specified in 302 , and the chamber heats the tbas to the first desired temperature in 304 . the tbas are queried and the factory system determines the scale factor and offset for each tba in 305 ; the measured data is saved in the factory system memory . the factory system checks to determine if all specified temperatures in the range in 310 have been selected and if this is true initiates a cool down to ambient temperature . if all temperatures have not been selected the factory system heats or cools the tbas to the next temperature in 311 and proceeds to measure the scale and offset data when the specified temperature is met . when all temperature measurements have been done , and the tbas have been cooled to ambient temperature , the calibration data is stored in the memory of each tba in 312 . by performing this process at the factory and downloading the calibration data to the tba memory , the user needs not perform the temperature calibration in the field . fig5 shows an exemplary temperature calibration methodology . in this process , the tba electronics system ( es ) determines the accelerometer output in 402 . next , the es determines a temperature corrected scale factor ( e . g . by the use of a look up table and linear interpolation ) in 404 . the es then determines a temperature corrected offset ( e . g . by use of a look up table and linear interpolation ) in 406 . finally the es generates both a temperature compensated digital output in 408 a temperature compensated analog output in 409 . in one illustrative example , the accelerometer analog output voltage is adjusted nominally to be (@ 25 c ) 1v = 1gee , and for the a to d converter , 2 . 5v = 32 , 768 counts . therefore 1 . 000v = 13 , 107 counts the scale factors for temperatures ranging from − 25 c to + 150 c are determined during the calibration process and stored in constants 25 - 33 . to determine the temperature corrected scale factor linear interpolation using constants 25 - 33 is used . these constants are encoded as 1 , 000 * actual scale constant . the values of the offset constants 16 to 24 are also determined during the temperature calibration process . to determine the temperature corrected offset , linear interpolation using constants 16 - 24 is used . offset constants are encoded as 10 times the actual offset value in milligees . temperature calibration example : temperature = 110 c a to d counts per volt = 16 , 000 counts / volt scale correction constant for 75 c , ( constant 30 ) 1 , 002 / 1000 = 1 . 002 v / gee scale correction constant for 125 c , ( constant 31 ) 1 , 007 / 1000 = 1 . 007 v / gee offset correction constant for 100 c constant 21 / 10 = 0 . 003 offset correction constant for 125 c constant 22 / 10 = 0 . 001 uncorrected a to d reading ad = 10 , 450 counts convert counts to volts v = 10 , 450 / 16000 = 0 . 6531 volts convert volts to gees ( linear interpolation ) gt = v /( scale correction constant 31 / 1000 )+( scale correction constant 31 − scale correction constant 30 )/ 1000 )( current temp − low base temp )/ temp bin width ) gt = 0 . 6531 /( 1 . 002 +( 1 . 007 − 1 . 002 )( 110 − 100 )/ 25 ) gt = 0 . 6531 / 1 . 005 = 0 . 6498 gee the scale factors always increase smoothly with increasing temperature because the system torqueing magnet field strength decreases with increasing temperature . offset ( os ) determination ( linear interpolation ) os =( constant 21 )+(( current temp − constant 21 temp )/ temp bin width )( constant 22 − constant 21 ) os = 0 . 003 +(( 110 − 100 )/ 25 )*( 0 . 001 − 0 . 003 ) os = 0 . 0022 temperature corrected scale and offset output , gto gto = g − os = 0 . 6498 − 0 . 0022 = 0 . 6476 gee thus , by adding an internal microprocessor and an analog to digital converter to the tba electronics , the system can perform temperature correct the accelerometer digital data output before transmission of the data . in addition by including a digital to analog converter to the system electronics one embodiment can output an analog voltage proportional to acceleration that is temperature calibrated . by performing this process at the factory and downloading the calibration data to the tba memory instead of temperature calibrating the tba after it is installed in an external system , considerable time is saved by the user of the tba . in addition performing an external calibration of the tba requires considerable equipment and expertise . internal calibration performed at the factory hence removes the burden of the difficult and time consuming calibration process from the tba user . while the present disclosure is primarily described in terms of methods , a person of ordinary skill in the art will understand that the present disclosure is also directed to various apparatus such as a handheld electronic device including components for performing at least some of the aspects and features of the described methods , be it by way of hardware components , software or any combination of the two , or in any other manner . moreover , an article of manufacture for use with the apparatus , such as a pre - recorded storage device or other similar computer readable medium including program instructions recorded thereon , or a computer data signal carrying computer readable program instructions may direct an apparatus to facilitate the practice of the described methods . it is understood that such apparatus , articles of manufacture , and computer data signals also come within the scope of the present disclosure . the embodiments of the present disclosure described above are intended to be examples only . those of skill in the art may effect alterations , modifications and variations to the particular embodiments without departing from the intended scope of the present disclosure . in particular , features from one or more of the above - described embodiments may be selected to create alternate embodiments comprised of a sub - combination of features which may not be explicitly described above . in addition , features from one or more of the above - described embodiments may be selected and combined to create alternate embodiments comprised of a combination of features which may not be explicitly described above . features suitable for such combinations and sub - combinations would be readily apparent to persons skilled in the art upon review of the present disclosure as a whole . the subject matter described herein and in the recited claims intends to cover and embrace all suitable changes in technology .	6
in standard abist designs for single - port array macros , one address counter is exclusively used to stimulate the address port of the array . a multi - port array with a separate read port and write port makes testing more complicated . one solution in the prior art sets up two distinct counters read and write address testing , but expedient increases the overall size of the abist engine significantly and also increases the complexity of the internal logic . as shown in fig1 , a simpler solution used in previous designs has been to hard - wire an inversion ( 4 ) of one bit of the main address port ( 1 ). the write address bits ( 2 ) come from the main address port while the read address bits ( 3 ) contain the low order inversion . this is done in order to make sure that the same address is not undergoing a read and write operation during the same cycle . if this operation , a simultaneous read from and write to the same cell , was to occur , the cell would be written to , but the read operation could not be guaranteed . while a simple inversion solution is acceptable , this does not allow for much flexibility or control of whatever address port is not connected directly to the address counter . a more flexible approach as described herein below increases testability . the method , system , and program product tests a multi - port memory array with an abist engine that provides test patterns to the array . the abist engine includes logic for controlling read and write addresses of the memory array to avoid simultaneously reading from and writing to the same cell . this is accomplished by setting ( through the abist engine ) mode bits for read / write address relationships . in order to accomplish this the abist engine multiplexes the mode bits to select bit or word addressing . the abist engine allows for logic transform from write addressing to read addressing , with the logic controlling a dynamic relationship between the read and write addresses of the macro to avoid simultaneously reading from and writing to the same cell . the control signals provide an address control configuration that avoids simultaneously reading from and writing to the same cell . the circuitry generates the read addresses from multi - port array address configuration logic . in one example the address configuration logic receives inputs indicating the abist engine mode , and if the abist engine is in the write mode outputting control bits and xor the control bits with a write address to produce a read address . the addressing produced by the abist can be an inversion of the write addressing , or equal to the write addressing , or inversions of the write addressing in the low or high order bits , or in the middle order bits . fig2 shows one solution to this problem . the write addresses ( 6 ) are still generated directly from the n - number address generation logic . ( 5 ) however , instead of a simple inversion , the read addresses ( 7 ) is generated from multi - port address reconfiguration logic . ( 8 ) fig3 shows a configuration with m - number latches providing various decoded configurations . scan - only latches ( 9 ) allow bits to be set that control the relationship between the write and read addresses . these bits are then processed through write control and multiplexing logic . ( 10 ) this logic receives inputs from other circuitry to know when the abist engine is in write mode and if the address counter is in bit mode or word mode . the logic block ( 10 ) will output k + 2 control bits , which are xored with n - number write addresses to produce n - number read addresses . ( 11 ) the method , system , and program product of our invention can generate a wide range of addresses . fig4 shows , as an example , what operations are available using only three scan latches . while eight distinct configurations are available , only four prove to be useful . the first configuration enables the read address to be the total inversion of the write address . ( 12 ) data is written from the starting address upward while data is read from the final address downward . these operations would cross over at the middle address of the array , and no array cell will be in read and write mode simultaneously . this is perhaps the most useful and important configuration of the four . the second configuration allows for the read address to equal the write address . ( 13 ) data can never be read from the array , but cells will be written with information . this configuration is used to test if the 2 - port array cell can indeed guarantee a write when the read and write addresses are equal . the third configuration provides for a read address that is equivalent to the write address except for the inversion of the low order bit . ( 14 ) this would allow for the reading and writing of 2 - port cells that are on the same wordline , which would provide meaningful test results . for the fourth illustrated mode of operation , the high order bit of the write address is inverted for the read address . ( 15 ) the reading of data from the array will begin from the middle of the array and will wrap around to the starting address at the end of the array . the writing of data will proceed from the starting address on upward . the other four configurations would provide combinations of inversions of the middle group of read address bits , which would be redundant and confusing to debug . these four modes of operation are a definite improvement over an inversion of a low or high order bit as in the prior art designs . it is also more cost - effective and efficient than having to add extra stand - alone latches for the read address counter . the flow diagrams depicted herein are illustrative examples . there may be many variations to these diagrams or the steps ( or operations ) described therein without departing from the spirit of the invention . for instance , the steps may be performed in a differing order , or steps may be added , deleted or modified . all of these variations are considered a part of the claimed invention . the invention may be implemented , for example , by having the bist read address generator as a software application ( as an operating system element ), a dedicated processor , or a dedicated processor with dedicated code . the code executes a sequence of machine - readable instructions , which can also be referred to as code . these instructions may reside in various types of signal - bearing media . in this respect , one aspect of the present invention concerns a program product , comprising a signal - bearing medium or signal - bearing media tangibly embodying a program of machine - readable instructions executable by a digital processing apparatus to perform a method for bist read address generator . this signal - bearing medium may comprise , for example , memory in a server . the memory in the server may be non - volatile storage , a data disc , or even memory on a vendor server for downloading to a processor for installation . alternatively , the instructions may be embodied in a signal - bearing medium such as the optical data storage disc . alternatively , the instructions may be stored on any of a variety of machine - readable data storage mediums or media , which may include , for example , a “ hard drive ”, a raid array , a ramac , a magnetic data storage diskette ( such as a floppy disk ), magnetic tape , digital optical tape , ram , rom , eprom , eeprom , flash memory , magneto - optical storage , paper punch cards , or any other suitable signal - bearing media including transmission media such as digital and / or analog communications links , which may be electrical , optical , and / or wireless . as an example , the machine - readable instructions may comprise software object code , compiled from a language such as “ c ++”. additionally , the program code may , for example , be compressed , encrypted , or both , and may include executable files , script files and wizards for installation , as in zip files and cab files . as used herein the term machine - readable instructions or code residing in or on signal - bearing media include all of the above means of delivery . while the preferred embodiment to the invention has been described , it will be understood that those skilled in the art , both now and in the future , may make various improvements and enhancements which fall within the scope of the claims which follow . these claims should be construed to maintain the proper protection for the invention first described .	6
referring first to fig1 ( a ) and 1 ( b ), a bag of the present invention is composed of two sidewalls 1 , 2 and a filter sheet 3 . in the embodiment in this drawing , the two sidewalls 1 , 2 are made from two plastic sheets , but these two sidewalls may be constructed by folding one sheet , needless to say . the two sidewalls 1 , 2 are sealed along three edges a1 , a2 and a3 thereof . however , as described hereinafter , the filter sheet 3 is interposed at a position a4 on the bottom sealing edge a3 between the opposite sidewalls 1 , 2 , and therefore the respective sidewalls 1 , 2 are not in contact with each other directly . as shown in fig1 ( b ), the filter sheet 3 is folded in two and its opposite end portions are stuck to the sidewalls 1 , 2 . the portion where the filter sheet 3 is stuck to the sidewall 1 is represented by a symbol b and the portion where it is stuck to the sidewall 2 is represented by a symbol c . at a position a4 where the filter sheet 3 is stuck to the bottom sealing edge a3 , the plastic material constituting the opposite sidewalls 1 , 2 penetrates through the filter sheet 3 , so that the respective portions of the folded filter sheet 3 are joined to each other hermetically at the position a4 , that is , so that the opposite sidewalls 1 , 2 are joined integrally and hermetically to the filter sheet 3 . an embodiment shown in fig2 is identical with the bag in fig1 with the exception that a partition wall d is additionally provided by sealing . this partition wall d can be separated into a portion d1 contacting with the filter sheet 3 and another portion d2 contacting with no filter sheet . at the portion d1 , the opposite sidewalls 1 , 2 are stuck to the filter sheet 3 , but the respective portions of the folded filter sheet 3 are not stuck to each other . at the portion d2 , the opposite sidewalls 1 , 2 are directly sealed . this partition wall d is not used when taking out a sample solution by a pipet but functions to prevent the sample solution from flowing out from the crude solution chamber x when the sample solution is poured from the sample chamber y into another container as in the conventional case . therefore , it is preferred that the partition wall is formed obliquely toward the bottom seal portion a3 in the crude solution chamber x . in the embodiment in fig3 ( a ) and ( b ), a filter sheet 3 is stuck , along the opposite edges thereof , to sidewalls 1 , 2 . the portion where the filter sheet 3 is stuck on the sidewall 1 is represented by a symbol b and the portion where it is stuck on the sidewall 2 is represented by a symbol c . as understood from the comparison with the embodiment in fig1 ( b ), one end portion of the filter sheet 3 is stuck to the sidewall 1 and the other portion thereof is stuck to the sidewall 2 . that is , one surface of the filter sheet 3 is stuck to the sidewall 1 and the other surface thereof is stuck to the sidewall 2 . since fig3 ( b ) shows an opened bag , the filter sheet 3 seems to be in a folded state , but when the bag is closed , the filter sheet 3 is not folded but straight . an embodiment shown in fig4 is identical with the bag in fig3 ( a ) and 3 ( b ) with the exception that a partition wall d is additionally provided . this partition wall d can be separated into a portion d1 contacting with the filter sheet 3 and another portion d2 contacting with no filter sheet 3 . at the portion d1 , the filter sheet 3 is stuck to the sidewall 1 but is not stuck to the sidewall 2 . this bag in fig4 can be used in the same manner as that in fig2 . examples of the usable raw materials for the sidewalls 1 , 2 include plastics such as polyethylenes , polypropylenes , polyesters and the like , and each of these raw materials may be used in the form of a film , a laminate , a film the inside surface of which is coated with a heat - sealing material , or the like . a usable raw material for the filter sheet 3 is a finely porous sheet in which at least either surface has heat - sealing properties and which is permeable to a liquid but impermeable to a solid material , and examples of raw materials for such sheet include synthetic resin nonwoven fabrics , perforated plastic sheets , and the like . the bags of the present invention can be piled , for example , every 10 bags , put in another large bag , sterilized with a radiation such as gamma rays , and then forwarded . when used , the bag of the present invention is opened . this operation can be easily carried out by sliding the opposite sidewalls 1 , 2 on each other at the filter sheet 3 where the sidewalls 1 , 2 do not adhere to each other . then , a specimen such as a piece of bread or the like and a sterilized physiological saline are placed in the crude solution chamber x of the bag . in this case , the total volume of these materials should be limited to one third of the depth of the bag , since when they are too much , the bag is difficult to handle . afterward , the opening inlet of the bag is clamped hermetically , and the bag is shaken to homogenize the contents therein sufficiently . the thus prepared sample solution is taken out by the use of a pipet or the like . a strip - like nonwoven fabric heat pack ( the japan paper industry co ., ltd ., 18 g / m 2 ) having heat - sealing properties on its one side and compo pack ( asahi chemical industry co ., ltd ., 20 g / m 2 ) were thermally stuck to the inside surface of a cylindrical film consisting of a polyester ( 12 μm ) and a polyethylene ( 60 μm ), in order to form a partition wall . next , the bottom portion of the cylindrical film was pressed at a high temperature to melt the polyethylene sufficiently , so that the latter was allowed to penetrate through the nonwoven fabric material and a strong heatsealing state was obtained , thereby preparing two kinds of bags ( which were the same as in fig1 ). a large bag consisting of a polyester ( 12 μm ) and a polyethylene ( 40 μm ) was packed with one hundred of the thus prepared examination bags , and was then irradiated with gamma rays of 1 . 5 mrod , thereby obtaining the product of the present invention . suitable amounts of a potato salad and a sterilized physiological saline were placed in the thus prepared bag of the present invention , and homogenization was then carried out by the use of a stomacher made by a . j . seward , uac house , london , england . as a result , a clean sample solution could be prepared in the sample solution chamber and could be taken out by a pipet . further , the bag was very easily opened at the portion where the filter sheet was present thereon , since at this portion , the films did not adhere to each other . a strip - like nonwoven fabric melfit ( teijin limited , 40 g / m 2 ) having heat sealing properties on its one side was thermally stuck to the inside surface of a cylindrical film consisting of a polyester ( 12 μm ) and a polyethylene ( 60 μm ). next , the bottom portion of the cylindrical film was heated and pressed sufficiently to seal this bottom portion hermetically , thereby preparing bags shown in fig1 . afterward , sterilization was similarly carried out by irradiation with gamma rays . subsequently , a potato salad was used as a specimen , and homogenization was then carried out by the use of a stomacher . as a result , a clean sample solution could be prepared in the sample solution chamber and could be taken out by a pipet . further , the sidewalls of the bag were very easily opened at the portion where the filter sheet was present thereon , since at this portion , the films did not adhere to each other . a strip - like nonwoven fabric bt 0706 w ( teijin limited , 35 g / m 2 ) having heat sealing properties on its opposite sides was stuck to the inside surface of a cylindrical film consisting of a polyester ( 12 μm ) and a polyethylene ( 60 μm ) so that one surface of the fabric material might be thermally stuck to one sidewall of the bag and the other surface thereof might be thermally stuck to the other sidewall of the bag . next , the bottom portion of the cylindrical film was pressed at a high temperature to form a bottom seal , thereby preparing bags ( which were the same as in fig3 ). a large bag consisting of a polyester ( 12 μm ) and a polyethylene ( 40 μm ) was packed with one hundred of the thus prepared examination bags , and was then irradiated with gamma rays of 1 . 5 mrod , thereby obtaining the product of the present invention . suitable amounts of a potato salad and a sterilized physiological saline were placed in the thus prepared bag of the present invention , and homogenization was then carried out by the use of a stomacher made by a . j . seward , uac house , london , england . as a result , a clean sample solution could be prepared in the sample solution chamber and could be taken out by a pipet . further , the bag was very easily opened at the portion where the filter sheet was present thereon , since at this portion , the films did not adhere to each other . as described above , according to the bag of the present invention , a solid material can be separated sanitarily from a crude solution in the bag , and it is possible to take out a sample solution from the bag by a pipet .	1
the present invention presents add - compare - select circuits and methods , and applications thereof . add - compare - select circuits and methods are used to implement digital communications systems such as , for example , digital communications systems employing convolutional encoding with viterbi decoding . convolutional encoding with viterbi decoding is a forward error correction technique that improves the capacity of a digital communications channel . viterbi decoding can be viewed as a process for identifying a most likely transition path through a trellis diagram representing possible state transitions in a digital communications system . fig1 a illustrates an example viterbi decoder 102 that can be implemented using the add - compare - select circuits and methods of the present invention . viterbi decoder 102 includes a branch metric unit 104 , an add - compare - select ( acs ) unit 106 , and a survivor path memory 108 . viterbi decoder 102 implements the viterbi algorithm to decode digital data sequences that have been encoded using a convolutional encoder ( not shown ). the branch metric unit 104 computes minimum or maximum branch metrics , λ ij , for a trellis diagram . as described herein , these branch metrics represent the difference between a received symbol and one or more symbols responsible for a state transition in the trellis diagram . once computed , the branch metrics , λ ij , are passed to the acs unit 106 . the acs unit 106 computes state metrics , γ j . this computation is performed using the branch metrics , λ ij , computed by branch metric unit 104 . acs unit 106 then compares the computed state metrics , γ j , and selects maximum or minimum state metrics , γ j , associated with survivor paths of the trellis diagram . survivor paths represent the paths in the trellis diagram that have the best metric ( e . g ., maximum or minimum state metric ) at a point in time under consideration . the survivor path memory 108 stores the survivor paths selected by acs unit 106 . a final determination of the best path is made from the stored survivor paths residing in the survivor path memory 108 . fig1 b further illustrates the acs unit 106 shown in fig1 a . as illustrated in fig1 b , the acs unit 106 includes an adder 110 , a code converter 112 , and a maximum / minimum select circuit 114 . the adder 10 is used to add state metrics and branch metrics to form new state metrics . these new state metrics are provided to code converter 112 . the code converter 112 re - codes the output of adder 110 ( the new state metrics ) and provides the re - coded output to the maximum / minimum select circuit 114 . this re - coding performed by code converter 112 simplifies the logic needed to implement the maximum / minimum select circuit 114 . in embodiments , the maximum / minimum select circuit 114 compares and selects either a maximum state metric or a minimum state metric from a group of state metrics . circuits according to the invention for implementing acs unit 106 are described in detail below . while only one adder 110 , one code converter 112 , and one maximum / minimum select circuit 114 are shown in fig1 b , it will be apparent to persons skilled in the relevant arts given the description herein that more than one adder 110 , more than one code converter 112 , and more than one maximum / minimum select circuit 114 can be used to implement acs unit 106 without departing from the scope of the present invention ( see , e . g ., fig8 ). fig2 illustrates an example trellis diagram 200 for a four - state viterbi decoder that can be implemented in accordance with the circuits and the methods of the present invention . the four states 0 , 1 , 2 , and 3 at time index “ n ” are indicated along the left side of the trellis diagram 200 . these four states each have an associated state metric ( i . e ., γ 0 ( n ), γ 1 ( n ), γ 2 ( n ), and γ 3 ( n )) that represents the accumulated metric along the shortest or longest path leading to the particular state . the four states 0 , 1 , 2 , and 3 at time index “ n + 1 ” are indicated on the right side of the trellis diagram 200 . as would be known to persons skilled in the relevant arts , the viterbi algorithm implemented by a viterbi decoder can be used to correct data transmission errors in a digital communication system . the viterbi algorithm involves , for example , determining the most likely path taken to reach a particular state of a given trellis diagram such as trellis diagram 200 . in embodiments , this is achieved by calculating all possible metrics for a particular state of the trellis diagram and selecting the path associated with either the maximum metric or the minimum metric as the most likely path taken to reach the particular state . the branch metrics λ ij ( n ) for the trellis diagram 200 are indicated along each path leading from one state at time index “ n ” to another state at time index “ n + 1 ”. the branch metric λ 01 ( n ), for example , represents the metric associated with a transition from state 0 to state 1 along branch 202 . the metric associated with the state 0 , for a transition along branch 202 , is equal to the sum of the metric associated with state 0 ( i . e ., γ 0 ( n )) and the metric λ 01 ( n ). as illustrated in fig2 , a state at time index “ n + 1 ” can be reached from more than one state at time index “ n ”. for example , the state 0 can be reached from 0 or from 1 . the metric for states 0 , 1 , 2 , and 3 of trellis diagram 200 at time index “ n + 1 ” are given by γ 0 ( n + 1 ), γ 1 ( n + 1 ), γ 2 ( n + 1 ), and γ 3 ( n + 1 ), respectively . in an embodiment , the state metrics γ 0 ( n + 1 ), γ 1 ( n + 1 ), γ 2 ( n + 1 ), and γ 3 ( n + 1 ) represent maximum metrics . the maximum metric for each state of trellis diagram 200 at time index “ n + 1 ” can be calculated using eqs . 1 – 4 below . γ 0 ( n + 1 )= max [ γ 0 ( n )+ λ 00 ( n ), γ 2 ( n )+ λ 20 ( n )] eq . 1 γ 2 ( n + 1 )= max [ γ 1 ( n )+ λ 12 ( n ), γ 3 ( n )+ λ 32 ( n )] eq . 2 γ 1 ( n + 1 )= max [ γ 0 ( n )+ λ 01 ( n ), γ 2 ( n )+ λ 21 ( n )] eq . 3 γ 3 ( n + 1 )= max [ γ 1 ( n )+ λ 13 ( n ), γ 3 ( n )+ λ 33 ( n )] eq . 4 where it is desired to identify the minimum metric for each state , the minimum ( min ) function can be used in place of the maximum ( max ) function in eqs . 1 – 4 . as would be known to persons skilled in the relevant arts , the operation of a viterbi decoder is often limited by speed bottlenecks found in add - compare - select circuits . these speed bottlenecks are created , for example , as a result of applying conventional design techniques to the recursive nature of add - compare - select operations . one technique that can be used to accelerate the operating speed of a viterbi decoder is to use an n - step look - ahead network , where n is an integer greater than 0 , to provide inputs to parallel processing pipelines . an advantage of using an n - step look - ahead network is that it will result in a fully connected trellis diagram such as the one illustrated in fig3 . fig3 illustrates a four - state trellis diagram 300 using 2 - steps of look - ahead . eq . 5 illustrates how to calculate the maximum path metric or state metric , γ 0 ( n + 2 ), for state 2 at a time index “ n + 2 ”. γ 0 ( n + 2 )= max [ γ 0 ( n )+ λ ′ 00 ( n + 1 ), γ 1 ( n )+ λ ′ 10 ( n + 1 ), γ 2 ( n )+ λ ′ 20 ( n + 1 ), γ 3 ( n )+ λ ′ 30 ( n + 1 )] eq . 5 where λ ′ ij ( n ) is the combined branch metric of the path i - j . the path metric , γ j ( n + 2 ), for the state “ j ” of trellis diagram 300 is given by eq . 6 . γ j ( n + 2 )= max j [ γ i ( n )+ λ ij ′( n )] ∀ i , j = 0 , 1 , 2 , 3 eq . 6 where it is desired to identify the minimum metric for each state , the minimum ( min ) function can be used in place of the maximum ( max ) function in eq . 6 . fig4 illustrates state transitions for three time - steps of a trellis diagram 402 for a four - state viterbi decoder . trellis diagram 402 can be used , for example , to form the trellis diagram 300 illustrated in fig3 . as described herein , the minimum metric for the states 0 , 1 , 2 , and 3 at time index “ n + 3 ” can be found using eq . 7 below . the computations for the state metrics γ 0 ( n + 2 ), γ 1 ( n + 2 ), γ 2 ( n + 2 ), and γ 3 ( n + 2 ) are given by eqs . 8 – 11 below . the state metric for the state γ 0 ( n + 3 ) is given by eq . 12 below . ⁢ eq . ⁢ 7 γ j ⁡ ( n + 3 ) = max j ⁢ [ γ i ⁡ ( n ) + λ ij ′ ⁡ ( n ) ] ⁢ ⁢ ∀ i , j = 0 , 1 , 2 , 3 ⁢ eq . ⁢ 8 γ 0 ⁡ ( n + 2 ) = min ⁡ [ γ 0 ⁡ ( n ) + { λ 00 ⁡ ( n ) + λ 00 ⁡ ( n + 1 ) } , γ 1 ⁡ ( n ) + { λ 12 ⁡ ( n ) + λ 20 ⁡ ( n + 1 ) } , γ 2 ⁡ ( n ) + { λ 20 ⁡ ( n ) + λ 00 ⁡ ( n + 1 ) } , γ 3 ⁡ ( n ) + { λ 32 ⁡ ( n ) + λ 20 ⁡ ( n + 1 ) } ] ⁢ eq . ⁢ 9 γ 1 ⁡ ( n + 2 ) = min ⁡ [ γ 0 ⁡ ( n ) + { λ 00 ⁡ ( n ) + λ 01 ⁡ ( n + 1 ) } , γ 1 ⁡ ( n ) + { λ 12 ⁡ ( n ) + λ 21 ⁡ ( n + 1 ) } , γ 2 ⁡ ( n ) + { λ 20 ⁡ ( n ) + λ 01 ⁡ ( n + 1 ) } , γ 3 ⁡ ( n ) + { λ 32 ⁡ ( n ) + λ 21 ⁡ ( n + 1 ) } ] ⁢ eq . ⁢ 10 γ 2 ⁡ ( n + 2 ) = min ⁡ [ γ 0 ⁡ ( n ) + { λ 01 ⁡ ( n ) + λ 12 ⁡ ( n + 1 ) } , γ 1 ⁡ ( n ) + { λ 13 ⁡ ( n ) + λ 32 ⁡ ( n + 1 ) } , γ 2 ⁡ ( n ) + { λ 21 ⁡ ( n ) + λ 12 ⁡ ( n + 1 ) } , γ 3 ⁡ ( n ) + { λ 33 ⁡ ( n ) + λ 32 ⁡ ( n + 1 ) } ] ⁢ eq . ⁢ 11 γ 3 ⁡ ( n + 2 ) = min ⁡ [ γ 0 ⁡ ( n ) + { λ 01 ⁡ ( n ) + λ 13 ⁡ ( n + 1 ) } , γ 1 ⁡ ( n ) + { γ 13 ⁡ ( n ) + λ 33 ⁡ ( n + 1 ) } , γ 2 ⁡ ( n ) + { λ 21 ⁡ ( n ) + λ 13 ⁡ ( n + 1 ) } , γ 3 ⁡ ( n ) + { γ 33 ⁡ ( n ) + λ 33 ⁡ ( n + 1 ) } ] ⁢ eq . ⁢ 12 γ 0 ⁡ ( n + 3 ) = min ⁡ [ γ 0 ⁡ ( n ) + min ⁢ { λ 00 ⁡ ( n ) + λ 00 ⁡ ( n + 1 ) + λ 00 ⁡ ( n + 2 ) , λ 01 ⁡ ( n ) + λ 12 ⁡ ( n + 1 ) + λ 20 ⁡ ( n + 2 ) } γ 1 ⁡ ( n ) + min ⁢ { λ 12 ⁡ ( n ) + λ 20 ⁡ ( n + 1 ) + λ 00 ⁡ ( n + 2 ) , λ 13 ⁡ ( n ) + λ 32 ⁡ ( n + 1 ) + λ 20 ⁡ ( n + 2 ) } γ 2 ⁡ ( n ) + min ⁢ { λ 20 ⁡ ( n ) + λ 00 ⁡ ( n + 1 ) + λ 00 ⁡ ( n + 2 ) , λ 21 ⁡ ( n ) + λ 12 ⁡ ( n + 1 ) + λ 20 ⁡ ( n + 2 ) } γ 3 ⁡ ( n ) + min ⁢ { λ 32 ⁡ ( n ) + λ 20 ⁡ ( n + 1 ) + λ 00 ⁡ ( n + 2 ) , λ 33 ⁡ ( n ) + λ 32 ⁡ ( n + 1 ) + λ 20 ⁡ ( n + 2 ) } ] the four - state trellis diagrams of fig3 and fig4 are provided for example only and not limitation . based on the teachings described herein , persons skilled in the relevant arts will recognize that other multi - state n - step look - ahead configurations can be formed and implemented in accordance with the present invention . for example , fig5 illustrates an 8 - state trellis diagram 502 , using 2 - steps of look - ahead , formed from a trellis diagram 504 . fig6 illustrates an 8 - state trellis diagram 602 , using 3 - steps of look - ahead , formed from a trellis diagram 604 . fig7 illustrates a partial 8 - state trellis diagram 702 , using 4 - steps of look - ahead , formed from a trellis diagram 704 . fig8 illustrates a section of an example most - significant - bit ( msb ) first acs unit 800 . acs unit 800 is used for processing 8 - bit words . acs unit 800 performs bit - wise operations . acs unit 800 shows only one bit - slice out of n - slices , where n is the number of states in the viterbi decoder . as shown in fig8 , acs unit 800 is formed from eight acs circuits 802 a – h . each acs circuit 802 includes an adder 110 , a code converter 112 , and a maximum / minimum select ( ms ) circuit 114 . for each acs circuit 802 , a feedback loop 804 couples a state metric output , γ 0 , i ( n + 1 ), of ms circuit 114 to an input of adder 110 . a delay device 806 placed in each feedback path 804 delays the state metrics , γ 0 , i ( n + 1 ), from reaching the input of adder 110 for a period of time ( t ). the eight acs circuits 802 a – h are interconnected as shown in fig8 . in some embodiments of the invention , each adder 110 is replaced by two adders . a first adder is used to perform the carry computation shown in fig8 . the second adder is used to perform the sum computation shown in fig8 . acs unit 800 contains a number of loops or paths . these loops or paths are illustrated in fig9 a – c . fig9 a illustrates a loop 902 . loop 902 includes adder 110 a , code converter 112 a , ms circuit 114 a , feedback path 804 a , and delay device 806 a . as shown in fig9 a , in embodiments , ms circuit 114 a comprises both a maximum / minimum select circuit ( m ) 904 a and a decision logic circuit ( d ) 906 a . the decision logic circuit 906 a is not included in loop 902 . loop 902 is representative of other similar loops in acs unit 800 . fig9 b illustrates a loop 910 . loop 910 includes adder 110 b , code converter 112 a , decision logic circuit 906 a , maximum / minimum select circuit 904 b , feedback path 804 b , and delay device 806 b . as can be seen by comparing loop 910 to loop 902 , loop 910 includes more devices than loop 902 . thus , the settling time of loop 910 following a change in branch metric inputs , λ 00 , j ( n ), is longer than the settling time of loop 902 . loop 902 is representative of other similar loops in acs unit 800 . fig9 c illustrates a path 920 of acs unit 800 . path 920 is a critical path for acs unit 920 ( i . e ., path 920 has the longest path settling time or operating time of any path in acs unit 800 following a change in inputs ). as shown in fig9 c , critical path 920 includes adder 110 a , code converter 112 a , and ms circuits 114 a – h . as can be seen from fig9 c , the critical path 920 of acs unit 800 will grow linearly with word - length if acs unit 800 is used to process longer length words ( e . g ., word lengths of 16 - bits , 32 - bits , or 64 - bits ). acs unit 800 can be retimed , however , to eliminate path 920 as the critical path of acs unit 800 . fig1 illustrates four cut - sets 1002 , 1004 , 10006 , and 1008 that can be used to retime acs unit 800 . the retiming of acs unit 800 using the cut - sets 1002 , 1004 , 1006 , and 1008 leads to the circuit 1100 shown in fig1 . fig1 illustrates the retimed circuit 1100 formed from acs unit 800 . the critical path of circuit 1100 is path 1102 . as shown in fig1 , path 1102 includes adders 110 b and 110 c , code converters 112 a and 112 b , ms circuits 114 a and 114 b , and feedback path 804 b . the settling time of path 1102 is the settling time of two adders , two code converters , and two ms circuits . an advantage of the retimed circuit 1100 is that its critical path will not grow with word - length . in a typical implementation , the computation time for an adder 110 is approximately 0 . 4 ns , the computation time for a code converter 112 is approximately 0 . 15 ns , and the computation time for an ms circuit 114 varies with the total number of states being implemented . for example , in a typical 8 - state viterbi decoder , the computation time for a ms circuit 114 is approximately 1 . 2 ns . a computation time of 1 . 2 ns is attributable to the decision logic circuit 906 and 0 . 8 ns is attributable to the maximum / minimum select circuit 904 . the maximum time of these two computation times is the computation time of ms circuit 114 . in a typical 4 - state viterbi decoder , the computation time for a ms circuit 114 is approximately 0 . 7 ns . this is because 0 . 7 ns is attributable to the decision logic circuit 906 and 0 . 4 ns is attributable to the maximum / minimum select circuit 904 . the increased computation time of the ms circuit 114 in an 8 - state viterbi decoder is due to the extra logic needed to select among a larger number of states . using the typical computation times stated above , the settling time of the critical path 1102 in fig1 ( for an 8 - state viterbi decoder ) is 3 . 1 ns . this time is the computation time of two adders 110 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ), the computation time of two code converters 112 ( 0 . 15 ns + 0 . 15 ns = 0 . 3 ns ), the computation time of one maximum / minimum select circuit 904 ( 0 . 8 ns ), and the computation time of one decision logic circuit 906 ( 1 . 2 ns ). this is greater than the loop bound of circuit 1100 ( i . e ., loop 910 shown in fig9 b ), which is 2 . 55 ns ( i . e ., the computation time of one adder 110 ( 0 . 4 ns ), the computation time of one code converter ( 0 . 15 ns ), the computation time of one maximum / minimum select circuit 904 ( 0 . 8 ns ), and the computation time of one decision logic circuit 906 ( 1 . 2 ns )). the loop bound of loop 910 is also the iteration bound of circuit 1100 . using the typical computation times stated above for a 4 - state viterbi decoder , the settling time of the critical path 1102 is 2 . 2 ns . this time is the computation time of two adders 110 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ), the computation time of two code converters 112 ( 0 . 15 ns + 0 . 15 ns = 0 . 3 ns ), the computation time of one maximum / minimum select circuit 904 ( 0 . 4 ns ), and the computation time of one decision logic circuit 906 ( 0 . 7 ns ). this is greater than the loop bound of a 4 - state viterbi decoder circuit ( i . e ., loop 910 shown in fig9 b ), which is 1 . 65 ns ( i . e ., the computation time of one adder 110 ( 0 . 4 ns ), the computation time of one code converter ( 0 . 15 ns ), the computation time of one maximum / minimum select circuit 904 ( 0 . 4 ns ), and the computation time of one decision logic circuit 906 ( 0 . 7 ns )). table 1 below summarizes the iteration bound times and the critical path times of a typical 4 - state viterbi decoder and a typical 8 - state viterbi decoder implemented using the circuits and methods described above . using the circuits and methods of the invention described below , the critical path times shown in table 1 can be further reduced . as described below , the present invention improves the retiming technique applied to acs unit 800 to form circuit 1100 by pipelining the functions of the acs unit . in this way , the acs unit can be retimed to achieve a critical path time that is closer to the iteration bound . fig1 illustrates a detailed view of the critical path 1102 of circuit 1100 . as shown in fig1 , during the retiming of acs unit 800 described above , delay devices 806 were placed between decision logic circuit 906 a and maximum / minimum select circuit 904 b and between decision logic circuit 906 a and between decision logic circuit 906 b . this is because the decision logic circuits 906 and the maximum / minimum select circuits 904 are conventionally not thought of and implemented as a single unit . this is also not so in accordance with the present invention . as shown in fig1 , in accordance with the invention , decision logic device 906 can be divided into a first decision logic segment ( d 1 ) 1302 and a second decision logic segment ( d 2 ) 1304 . this division allows for pipelining of the decision logic computations in accordance with the invention . the first decision logic segment 1302 has a first computation time t d1 . the second decision logic segment 1304 has a second computation time t d2 . by dividing up decision logic circuit 906 into two segments 1302 and 1304 , it becomes possible to place a pipelining delay ( e . g ., a delay 806 ) between segment 1302 and segment 1304 . placing a delay between the two segments 1302 and 1304 shortens the path 1102 formed during retiming of acs unit 800 . this feature of the present invention is further described below with reference to fig1 a and fig1 b . the computation times t d1 , and t d2 represent the time required for each decision logic segment to perform its computation . in an embodiment of the present invention , the computation time t d2 is set equal to a propagation delay time ( t ). the propagation delay time ( t ) is used to ensure that the calculations performed by the decision logic segment 1304 are completed at approximately the same time as the calculations performed in the code converter 112 . since decision logic segment 1304 and code converter 112 each provide an input to a decision logic segment 1302 , it is advantageous in embodiments to have these input values available for input to decision logic segment 1302 at approximately the same time . thus , in embodiments , the decision logic segment 1304 is designed to have a computation time approximately equal to the computation time of an adder 110 and code converter 112 ( i . e ., 0 . 4 ns + 0 . 15 ns = 0 . 55 ns or approximately 0 . 6 ns ). although fig1 illustrates dividing up decision logic circuit 906 , the invention is not limited to dividing up just decision logic circuit 906 to achieve pipelining and better retiming results . decision logic circuit 906 was selected for division in fig1 because it had the longest computation time of the devices included in critical path 1102 . in accordance with the present invention , other devices , units , or circuits in the critical path can be divided to achieve pipelining and better retiming results . fig1 a illustrates a circuit 1400 formed from acs unit 800 by dividing each of the decision logic circuits 906 of the ms circuits 114 into a first decision logic segment 1302 and a second decision logic segment 1304 as shown in fig1 . four cut - sets 1402 , 1404 , 1406 , and 1408 are shown in fig1 a . these four cut - sets are used to retime circuit 1400 and thereby form the circuit 1420 shown in fig1 b . as can be seen in fig1 a , the cut - set 1402 intersects the circuit branch between decision logic segment 1302 a and decision logic segment 1304 a . the cut - set 1404 intersects the circuit branch between decision logic segment 1302 c and decision logic segment 1304 c . the cut - set 1406 intersects the circuit branch between decision logic segment 1302 e and decision logic segment 1304 e . the cut - set 1408 intersects the circuit branch between decision logic segment 1302 g and decision logic segment 1304 g . fig1 b illustrates the retimed circuit 1420 formed from circuit 1400 . for the retimed circuit 1420 , the path 1422 includes adders 110 b and 110 c , code converters 112 a and 112 b , maximum / minimum select circuit 904 a , decision logic segment 1302 a , and feedback path 804 b . using the typical computation times stated above for an 8 - state viterbi decode , the settling time of the path 1422 is approximately 2 . 5 ns . this time is the computation time of two adders 110 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ), the computation time of two code converters 112 ( 0 . 15 ns + 0 . 15 ns = 0 . 3 ns ), the computation time of one maximum / minimum select circuit 904 ( 0 . 8 ns ), and the computation time of one decision logic segment 1302 ( 0 . 6 ns ) ( i . e ., assuming segment 1304 has a computation time of 0 . 6 ns , the approximate computation time of an adder 110 and a code converter 112 ). this is less than the iteration bound of 2 . 55 ns ( see loop 902 in fig9 b ), thus path 1422 is no longer the critical path . two other paths present in circuit 1420 are path 1424 and path 1426 . path 1424 includes two adders 110 , two code converters 112 , and two maximum / minimum select circuits 904 . using the typical computation times stated above for an 8 - state viterbi decode , the settling time of the path 1424 is approximately 2 . 7 ns . this time is the computation time of two adders 110 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ), the computation time of two code converters 112 ( 0 . 15 ns + 0 . 15 ns = 0 . 3 ns ), and the computation time of two maximum / minimum select circuit 904 ( 0 . 8 ns + 0 . 8 ns = 1 . 6 ns ). path 1426 includes one decision logic segment 1304 , one adder 110 , code converter 112 , and two maximum / minimum select circuits 904 . using the typical computation times stated above for an 8 - state viterbi decode , the settling time of the path 1424 is approximately 2 . 75 ns . this time is the computation time of one decision logic segment 1304 ( 0 . 6 ns ), the computation time of one adder 110 ( 0 . 4 ns ), the computation time of one code converter 112 ( 0 . 15 ns ), and the computation time of two maximum / minimum select circuit 904 ( 0 . 8 ns + 0 . 8 ns = 1 . 6 ns ). thus , based on the above stated computation times , path 1424 is the critical path of circuit 1420 . for the retimed circuit 1420 , using the typical computation times stated herein for a 4 - state viterbi decode , the settling time of the path 1424 is approximately 1 . 9 ns . this time is the computation time of two adders 110 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ), the computation time of two code converters 112 ( 0 . 15 ns + 0 . 15 ns = 0 . 3 ns ), and the computation time of two maximum / minimum select circuit 904 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ). the settling time of the path 1424 is approximately 1 . 7 ns . this time is the computation time of one decision logic segment 1304 ( 0 . 35 ns or one - half of the total computation time ( 0 . 7 ns ) of decision logic circuit 906 ), the computation time of one adder 110 ( 0 . 4 ns ), the computation time of one code converter 112 ( 0 . 15 ns ), and the computation time of two maximum / minimum select circuit 904 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ). based on these computation times , path 1424 is the critical path for a 4 - state viterbi decoder . as would be known to persons skilled in the relevant arts , once the critical path of a circuit has been determined , a clock period for the circuit can be set equal to the settling time of the critical path plus a margin factor . table 2 below shows the iteration bound and critical path results for a 4 - state viterbi decoder and an 8 - state viterbi decoder designed in accordance with both the pipelining and retiming techniques of the present invention described herein . as shown in table 2 , the present invention achieves critical path computation times that are close to the iteration bound . such computation times are not possible using conventional design techniques . fig1 illustrates an example circuit 1500 that can be used to implement code converter 112 in embodiments of the invention . circuit 1500 includes an and gate 1502 and an or gate 1504 . circuit 1500 recodes input sum and carry bits as illustrated in table 3 below . the digit ( c , s ) equals ( 1 , 0 ) is not permitted . fig1 illustrates an example circuit 1600 for implementing ms circuit 114 in embodiments of the invention . circuit 1600 performs bit - level maximum - select operations for a four - digit sequence {( c a , s a ), ( c b , s b ), ( c c , s c ), ( c d , s d )}. circuit 1600 operates as follows . a maximum select circuit 1602 is used to select the maximum digit of the digits ( c b , s b ), ( c c , s c ), and ( c d , s d . this maximum digit is shown in fig1 as ( c i max , s i max ) the digit ( c i max , s i max ) is passed to decision logic circuit 1604 . c i max is passed to or gate 1606 . s i max is passed to or gate 1608 . the digit ( c a , s a ) is combined with a preliminary decision value d i p , 0 using and gates 1610 and 1612 to produce a preliminary digit ( c i p , s i p ). c i p is provided to or gate 1606 . s i p is provided to or gate 1608 . or gates 1606 and 1608 are used to select the maximum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ) of the two digits ( c i p , s i p ) and ( c i max , s i max ). the maximum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ) is fed back to an adder 110 ( not shown ). as shown in fig1 , decision state values d i f , 0 and d i p , 0 are used in the selection of maximum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ), the value d i f , 0 is a final decision state value . the value d i p , 0 is a preliminary decision state value . when the values of the decision state values d i f , 0 and d i p , 0 equal ( 0 , 0 ), the preliminary digit ( c i p , s i p ) has lost in the comparison to digit ( c i max , s i max ) to be selected as the maximum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ). when the values of the decision state values d i f , 0 and d i p , 0 equal ( 0 , 1 ), the preliminary digit ( c i p , s i p ) still has the potential to be selected over the digit ( c i max , s i max ) as the maximum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ). when the values of the decision state values d i f , 0 and d i p , 0 equal ( 1 , 1 ), the preliminary digit ( c i p , s i p ) is winning the comparison to digit ( c i max , s i max ) to be selected as the maximum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ) the decision state values d i f , 0 and d i p , 0 may never equal ( 1 , 0 ). the inputs to the decision logic circuit 1604 include the values c i max , s i max , d i f , d i p , c i f , and s i f . the digit ( c a , s a ) is combined with the final decision value d i f , 0 using and gates 1614 and 1616 to produce the final digit value ( c i f , s i f ). using some or all of these inputs , decision logic circuit 1604 computes two decision state values d i − 1 f , 0 and d i − 1 p , 0 . fig1 illustrates an example circuit 1700 that can be used for the decision logic circuit 1604 shown in fig1 . circuit 1700 includes three stages of 2 - to - 1 multiplexers . the first stage includes 2 - to - 1 multiplexers 1702 a , 1702 b , 1702 c and 1702 d . the second stage includes 2 - to - 1 multiplexers 1704 a , 1704 b , and 1704 c . the third stage includes 2 - to - 1 multiplexers 1706 a and 1706 b . the inputs to the first stage of 2 - to - 1 multiplexers include c i f , s i f , and d i p . the inputs to the second stage of 2 - to - 1 multiplexers include s i max and the outputs of the first stage of 2 - to - 1 multiplexers . the inputs to the third stage of 2 - to - 1 multiplexers include c i max and the outputs of the second stage of 2 - to - 1 multiplexers . circuit 1700 generates the two decision state values d i − 1 f , 0 and d i − 1 p , 0 in accordance with the mapping shown in table 4 below . fig1 illustrates a circuit 1800 formed by applying the pipelining technique of the present invention to the circuit 1700 . as shown in fig1 , circuit 1800 includes four delays 1802 , 1804 , 1806 , and 1808 . delay 1802 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 1702 a to the input of 2 - to - 1 multiplexer 1704 a . delay 1804 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 1702 c to the inputs of 2 - to - 1 multiplexers 1704 a and 1704 b . delay 1806 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 1702 b to the inputs of 2 - to - 1 multiplexers 1704 b and 1704 c . delay 1808 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 1702 d to the input of 2 - to - 1 multiplexer 1704 c . the four delays 1802 , 1804 , 1806 , and 1808 in circuit 1800 divide the circuit 1800 into part of a first decision logic segment 1820 and a second decision logic segment 1840 . the first decision logic segment 1820 includes the four 2 - to - 1 multiplexers 1702 a – d ( shown in fig1 ), the maximum select circuit 1602 ( shown in fig1 ), and the two and gates 1614 and 1616 ( shown in fig1 ). assume the computation time of each 2 - to - 1 multiplexer in circuit 1800 is approximately 0 . 2 ns . further assume , the computation time of and gates 1614 and 1616 are 0 . 2 ns each , and the computation time of maximum select circuit 1602 is 0 . 4 ns . then , the operating time or critical path of decision logic segment 1820 is approximately 0 . 4 ns . the operating time of decision logic segment 1840 is also approximately 0 . 4 ns . fig1 illustrates a circuit 1900 formed by applying the pipelining technique of the present invention to the circuit 1600 . as shown in fig1 , circuit 1900 includes two delays 1902 and 1904 . delay 1902 is located in the circuit branch that connect or gate 1906 to the decision logic circuit 1604 . delay 1904 is located in the circuit branch that connect or gate 1908 to the decision logic circuit 1604 . fig2 illustrates a minimum - select circuit 2000 that can be used to implement a minimum - select embodiment of ms circuit 114 . circuit 2000 operates as follows . a minimum select circuit 2002 is used to select the minimum digit of the digits ( c b , s b ), ( c c , s c ), and ( c d , s d ). this minimum digit is shown in fig2 as ( c i min , s i min ) the digit ( c i min , s i min ) is passed to decision logic circuit 2004 . c i min is passed to and gate 2006 . s i min is passed to and gate 2008 . the digit ( c a , s a ) is combined with a preliminary decision value d i p , 0 using or gates 2010 and 2012 to produce a preliminary digit ( c i p , s i p ). c i p is provided to and gate 2006 . s i p is provided to and gate 2008 . and gates 2006 and 2008 are used to select the minimum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ) of the two digits ( c i p , s i p ) and ( c i min , s i min ). the minimum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ) is fed back to an adder 110 ( not shown ). features similar to those described above with reference to circuit 1600 are also found in circuit 2000 . fig2 illustrates an example circuit 2100 that can be used for the decision logic circuit 2004 shown in fig2 . circuit 2100 includes three stages of 2 - to - 1 multiplexers . the first stage includes 2 - to - 1 multiplexers 2102 a , 2102 b , 2102 c and 2102 d . the second stage includes 2 - to - 1 multiplexers 2104 a , 2104 b , and 2104 c . the third stage includes 2 - to - 1 multiplexers 2106 a and 2106 b . the inputs to the first stage of 2 - to - 1 multiplexers include c i f , s i f , and d i p . the inputs to the second stage of 2 - to - 1 multiplexers include s i min and the outputs of the first stage of 2 - to - 1 multiplexers . the inputs to the third stage of 2 - to - 1 multiplexers include c i min and the outputs of the second stage of 2 - to - 1 multiplexers . circuit 2100 generates two decision state values d i − 1 f , 0 and d i − 1 p , 0 in accordance with the mapping shown in table 5 below . fig2 illustrates a circuit 2200 formed by applying the pipelining technique of the present invention to the circuit 2100 . as shown in fig2 , circuit 2200 includes four delays 2202 , 2204 , 2206 , and 2208 . delay 2202 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 2102 a to the input of 2 - to - 1 multiplexer 2104 a . delay 2204 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 2102 c to the inputs of 2 - to - 1 multiplexers 2104 a and 2104 b . delay 2206 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 2102 b to the inputs of 2 - to - 1 multiplexers 2104 b and 2104 c . delay 2208 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 2102 d to the input of 2 - to - 1 multiplexer 2104 c . the four delays 2202 , 2204 , 2206 , and 2208 in circuit 2200 divide the circuit 2200 into part of a first decision logic segment 2220 and a second decision logic segment 2240 . the first decision logic segment 2220 includes the four 2 - to - 1 multiplexers 2102 a – d ( shown in fig2 ), the minimum select circuit 2002 ( shown in fig2 ), and the two and gates 2014 and 2016 ( shown in fig2 ). assume the computation time of each 2 - to - 1 multiplexer in circuit 2200 is approximately 0 . 2 ns . further assume , the computation time of and gates 2014 and 2016 are 0 . 2 ns each , and the computation time of minimum select circuit 2002 is 0 . 4 ns . then , the operating time or critical path of decision logic segment 2220 is approximately 0 . 4 ns . the operating time of decision logic segment 2240 is also approximately 0 . 4 ns . fig2 illustrates a circuit 2300 formed by applying the pipelining technique of the present invention to the circuit 2000 . as shown in fig2 , circuit 2300 includes two delays 2302 and 2304 . delay 2302 is located in the circuit branch that connect and gate 2306 to the decision logic circuit 2004 . delay 2304 is located in the circuit branch that connect and gate 2308 to the decision logic circuit 2004 . referring to fig2 a and fig2 b , it has been observed that a number of common computations are used by the various decision logic circuits and the various maximum / minimum select circuits described herein . these decision logic circuits and maximum / minimum select circuits are represented in fig2 a by a decision logic circuit 2402 and a maximum / minimum select circuit 2404 . accordingly , in an embodiment of the present invention , a preprocessing block 2406 is provided to calculate at least one common computation for use by the decision logic circuit 2402 and the maximum / minimum select circuit 2404 . this allows for the removal of at least some common hardware from decision logic circuit 2402 and the maximum / minimum select circuit 2404 to form the decision logic circuit 2408 and the maximum / minimum select circuit 2409 shown in fig2 b . as described herein , the present invention can be used to design and implement high - speed digital communications circuits and systems that cannot be designed and implemented using conventional circuits and techniques . this point is illustrated by the following example . consider , for a moment , how to implement a 10 gb / s viterbi decoder . as would be known to persons skilled in the relevant arts , in order to implement a 10 gb / s viterbi decoder some form of parallel viterbi decoding using look - ahead or a sliding block viterbi decoder is needed . in a conventional implementation , an 8 - state viterbi decoder requires a clock period of at least 3 . 4 ns . this is based on a 3 . 1 ns critical path and a clock setup / hold time of 0 . 3 ns . unfortunately , this does not permit a 32 - parallel design using conventional msb - first pipelined operations because a 32 - parallel design must be clocked with a clock period of 3 . 2 ns to achieve a decoding speed of 10 gb / s . thus , using conventional circuits and design techniques , a 10 gb / s viterbi decoder must be implemented using either a 64 - parallel design in a look - ahead viterbi decoder or a 48 - parallel design in a sliding - block viterbi decoder . in a look - ahead parallel viterbi decoder , the level of parallelism is constrained to be a power of two ( e . g ., 2 x ). in a sliding - block viterbi decoder , the level of parallelism is assumed to be a multiple of eight ( e . g ., 8 ×). using the circuits and methods of the present invention described herein , an 8 - state viterbi decoder can be implemented that has a critical path of only 2 . 7 ns . how this is achieved is described above . thus , using a clock setup / hold time of 0 . 3 ns , an 8 - state viterbi decoder designed and implemented in accordance with the present invention can be clocked with a clock period of 3 ns . in this way , a 32 - parallel implementation for achieving a 10 gb / s viterbi decoder is feasible . further features and advantages of the present invention will become apparent to persons skilled in the relevant arts given the description herein . various embodiments of the present invention have been described above . it should be understood that these embodiments have been presented by way of example only , and not limitation . it will be understood by those skilled in the relevant arts that various changes in form and details of the embodiments described above may be made without departing from the spirit and scope of the present invention as defined in the claims . thus , the breadth and scope of the present invention should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents .	7
it will be readily understood that the components of the present invention , as generally described and illustrated in the drawings herein , could be arranged and designed in a wide variety of different configurations . thus , the following more detailed description of the embodiments of the system and method of the present invention , as represented in the drawings , is not intended to limit the scope of the invention , as claimed , but is merely representative of various embodiments of the invention . the illustrated embodiments of the invention will be best understood by reference to the drawings , wherein like parts are designated by like numerals throughout . referring to fig1 , an apparatus 10 in accordance with the invention may include a vessel 12 or distributor 12 . the distributor 12 may be configured to be flexible or may be pre - formed to fit the anatomy of a user . typically , the distributor 12 will be placed on the upper lip of a user to provide the outputs 14 ( e . g ., output ports 14 , or simply ports 14 ) access to the nostrils of a user during breathing . each of the outputs 14 has an opening 15 for delivering nitric oxide directly into the nostrils of a user . typically , sufficient clearance provides a bypass for air in addition to the nitric oxide from the distributor 12 . in certain embodiments of an apparatus in accordance with the invention , a distributor 12 may include a port 16 to operate as an input 16 for receiving nitric oxide from another source . for example , the port 16 may have an opening 17 for receiving from a line 18 a supply of nitric oxide . in the illustrated embodiment , a reactor 20 provides a supply of nitric oxide to the distributor 12 . as illustrated , one end 22 of a line 18 may connect to the input port 16 of the distributor 12 . the opposite end 24 of the line 18 connects to the reactor 20 . the opening 26 of the line 18 provides a lumina 26 value or passage 26 for passing the nitric oxide gas from the opening 28 of the fitting 30 on the reservoir 20 . in certain embodiments , the reactor 20 may be manufactured in a single - dose size . accordingly , the distributor may be reused or disposed of . the reactor 20 may typically be disposed of after a single use . circumferential hoop stresses are not high . accordingly , the distributor 12 , the line 18 , and the reactor 20 may all be fabricated from comparatively lightweight and inexpensive materials such as plastic . parts may be cast , molded , vacuum formed , assembled from film , or the like . referring to fig2 , the distributor 12 may be configured in various cross - sectional shapes . for example , the distributor 12 may typically have a principal wall 32 enclosing a chamber 34 or volume 34 containing all necessary materials for therapy , thereby creating a continuous , or monolithic , distributor 12 containing all necessary materials for therapy . in certain embodiments , the chamber 34 may simply act as a manifold or distributor channel conducting nitric oxide gas . in other embodiments , the chamber 34 may completely enclose the reaction constituents and structures . thus , the distributor 12 may serve as both a distributor 12 and reactor 20 in a single , integrated apparatus 10 ( monolithic apparatus ). in various embodiments , the chamber 34 may include a vessel 36 inside or completely enclosed within the wall 32 and chamber 34 of the distributor 12 . the internal vessel 36 may have a wall 38 that is permeable or impermeable . in certain embodiments , the vessel 36 may have a wall 38 formed of glass to maintain the vessel 36 sealed from the contents of the chamber 34 . accordingly , upon fracture of the wall 38 , the contents of the vessel 36 may be spilled into the chamber 34 to mix with other reactants . in certain embodiments , the chamber 40 formed by the wall 38 of the vessel 36 may contain a reactant . in other embodiments , the chamber 40 may simply contain a liquid . in yet other embodiments , the chamber 40 may contain dry ingredients that will become exposed to liquid from the chamber 34 upon fracture of the wall 38 and exposure of the chamber 40 to the contents of the chamber 34 . all the foregoing roles can likewise be traded or reversed . as can be seen , reactants may be separated to render them inactive . the reactants may later be combined to render them active and initiate a reaction . likewise , the reactants may be maintained in proximity to one another in the chamber 34 , the chamber 30 , or both , or one may be maintained in a chamber 30 , 34 dry and another wet . however , once both reactants are present in the presence of a liquid ( e . g ., transport fluid ) in the opposite chamber 34 , 30 , the reaction to release nitric oxide may begin . any of the embodiments of fig2 may be provided with an adhesive strip 42 . one function of the adhesive strip is to secure the distributor 12 proximate the nostrils of a user in order that the distributor 12 may deliver nitric oxide through the openings 15 of the output ports 14 . for clarity , the adhesive strip 42 has not been illustrated in every embodiment , although it may . nevertheless , each of the embodiments may be provided with an adhesive strip 42 . meanwhile , any of the distributors 12 may be secured by some other method . for example , the distributor 12 may be positioned within a mask covering the nose , the mouth , or both . likewise , the distributor may be positioned by an air inlet to such a mask . in other embodiments , the distributor 12 may be positioned directly near the mouth , nostrils , or both . accordingly , the output ports 14 may be shaped to accommodate the positioning thereof for delivery of nitric oxide to the breathing air stream of a subject . in certain embodiments , an additional volume 48 may be separated within the chamber 34 . for example , a layer 50 or wall 50 may seal the reactants away from one another . the wall 50 may be formed of a film , such as a molecular sieve . such molecular sieves are available from suppliers and may be formed of various materials . one film produced under the trademark nafion ™ operates as a molecular sieve . the value of a molecular sieve is that it is configured to have a pore size that will not permit passage of a compound of nitrogen having more than a single oxygen . accordingly , only nitric oxide may pass through the molecular sieve . the molecular sieve , thus restrains the reactant liquids , any particulate matter , and all constituents larger than the nitric oxide molecule . thus , the nitric oxide molecule may pass through the wall 50 and exit the chamber 34 through the output ports 14 . in yet other embodiments , the basic chamber 34 may be separated away from an additional chamber 48 or volume 48 by a seal 50 or wall 50 . meanwhile , the main chamber 34 may be further subdivided to create an additional volume 52 separated by a wall 54 or seal 54 . in the illustrated embodiment , a volume of a first reactant in the chamber 48 is separated entirely from a volume of a second reactant in a chamber 52 . meanwhile , the remaining volume of the chamber 34 may be left as air space to receive the reactant gas passing through the molecular sieve of the layer 50 . referring to fig2 , embodiment a is configured simply as a distributor 12 in which the chamber 34 enclosed by the wall 32 merely passes the nitric oxide for distribution to the output ports 14 . meanwhile , an adhesive layer 42 is bonded to the wall 32 and may be secured to the skin of a user upon removal of a layer 44 or cover 44 protecting the adhesive properties of the layer 42 from their environment during handling . embodiment b of fig2 includes an additional chamber 40 separated by a wall 36 . in this embodiments , one reactant may occupy the principal chamber 34 , while a second reactant occupies the chamber 40 within the wall 36 . if the wall 36 is formed of glass , then bending the distributor 12 may fracture the wall 36 , exposing the reactants in the chamber 34 to the reactants in the chamber 40 . accordingly , the relative sizes of the chambers 34 , 40 may be configured according to the necessary and appropriate quantities of the reactants contained therein , respectively . the reactants in the chambers 34 , 40 may be dry , wet , or one may be dry and one may be wet . likewise , one chamber 34 , 40 may contain both reactive ingredients mixed together but completely dry , while the other chamber 40 , 34 contains a liquid capable of acting as a transport medium and thus activating the reaction between the dry ingredients . substantially all the illustrated embodiments for a reactor 20 or for a distributor 12 may benefit , as appropriate , from one of the foregoing configurations of dry , wet , or wet and dry ingredients , or dry ingredients and a wet transport material 12 . embodiment c provides for a distributor 12 having one volume 48 enclosed by a molecular sieve layer 50 . meanwhile , a wall 36 encloses another chamber 40 containing another reactant . in this embodiment , the remainder of the volume of the chamber 34 outside the wall 50 of the molecular sieve is available as free space . meanwhile , all reactants are contained within the molecular sieve layer 50 . a fracture of the wall 36 may release the reactants from the chambers 40 , 48 to mix with one another and react . meanwhile , the molecular sieve layer 50 contains all the reactants , as well as species of reaction that may be other than nitric oxide . typically , nitric oxide is the principal output of the proposed reactants . nevertheless , when exposed to the reaction process too long or when provided with outside oxygen , nitric oxide may become a more oxygenated reactant of nitrogen . embodiment d illustrates a more easily bendable shape , that may be more comfortable and more practical for forming about the upper lip of a user . for example , in any illustrated embodiment , any of the materials used to form the wall 32 of the chamber 34 may be comparatively rigid , moderately flexible such as a soft plastic or elastomer , or very flexible such as the materials used to form a toothpaste tube or other collapsible tube for containing a paste or liquid . accordingly , the distributor 12 may be formed to fit the lip a user . internal materials such as a wire imbedded in part of the wall 32 may facilitate bending the distributor 12 to a specific and permanent shape . meanwhile , the adhesive strip 42 may secure a comparatively weak and soft material to the lip of a user and thus maintain the desired shape . in embodiment d , the molecular sieve layer 50 may be a flexible film that provides additional space in the chamber 34 as gas accumulation space , while still containing the volume 48 of one reactant . in the illustrated embodiment , the chamber 40 is maintained within the wall 38 of a vessel 36 . if the vessel 36 has a rigid wall 38 , such as one formed of glass , a simple bending of the distributor 12 may permit mixing of the reactants in the chambers 40 , 48 and discharge of the nitric oxide reactant through the wall 50 to accumulate in the remaining dry portion of the chamber 34 for ultimate discharge through the output ports 14 . embodiment e provides a molecular sieve layer 50 permanently disposed across the chamber 34 separating a portion of the chamber 34 from a cavity 48 or volume 48 containing a reactant . thus , a portion of the chamber 34 remains dry , while a portion is separated off as the volume 48 for containing a reactant . in this embodiment , the volume 40 is likewise contained by a wall 38 as a separate vessel 36 containing one of the reactants . typical reactants are moderate acids such as citric acid , ascorbic acid , acetic acid , or the like . meanwhile , typical reactants may involve compositions of nitrogen such as potassium nitrite , sodium nitrite , or the like . reactants may be disposed as granules , powders , liquids in solution , solutions gelled to thixotropic consistency , or the like . embodiment f illustrates a distributor 12 that contains no reactants and does not act as a reactor 20 or reactant chamber 34 . rather , the chamber 34 of embodiment f is simply an empty cavity for distributing nitric oxide to the output ports 14 . embodiment g may actually be configured in various shapes . however , as a manufacturing matter , alignment , assembly , and the like may be best served by more linear envelopes rather than curved ones . nevertheless , the arrangement of embodiment g may actually be imposed on other shapes . in this embodiment , the chamber 34 may be separated by a molecular sieve layer 50 from a chamber 48 containing one reactant . meanwhile , another seal 54 or wall 54 may separate the ingredients in the chamber 48 from the volume 52 or chamber 52 containing the second ingredient . the entire reaction is contained within the wall 32 , but the individual wall 50 acts a molecular sieve and will not be ruptured . by contrast , in order to initiate the reaction , the wall 54 may be compromised by perforating , fracture , rupture , tearing , cutting , or the like . meanwhile , the remainder of the chamber 34 provides head space for the gas to accumulate for discharge through the output ports 14 . referring to fig3 , a reactor 20 in the apparatus 10 may be configured in any suitable shape . circular cross - sections tend to provide an equalization of hoop stresses . however , the reaction of materials contemplated for an apparatus 10 in accordance with the invention need not operate at an elevated pressure . typically , the reaction may occur at about ambient conditions . in embodiment a of fig3 , the reactor 20 may be configured as a rounded , yet somewhat flattened device having an aspect ration of width to thickness that is substantially larger than unity . thus the width is more than the thickness , and in the illustrated embodiment is several times the thickness . meanwhile , the aspect ratio of height to width may be selected according to space available in a convenient location for holding the reactor 20 . for example , embodiment d may be a suitable configuration for setting on a table top . by contrast , embodiment a may be better suited for slipping into a shirt pocket , jacket pocket , or the like for portability . meanwhile , the reactor 20 of embodiment c may be suitable for holding in a jacket pocket , or sitting on a night stand beside a bed or other flat surface . referring to fig4 , any of the reactors 20 of fig3 may be configured to contain any or all of the chambers of fig2 . the reactor 20 may enclose various individual volumes . for example , in the illustrated embodiment , a volume 58 is enclosed within the wall 56 of the reactor 20 . the volume 58 is bounded below by a layer 60 or sieve layer 60 . optionally , a region of expansion space 62 may exist above a closure layer 64 . the layer 64 initially forms a retainer or seal 64 to contain the volume 66 of a first reactant . the first reactant volume 66 is separated from a volume 68 containing the second reactant by a seal 70 that may be ruptured or otherwise compromised to initiate a reaction . the closure layer 64 may be permeable . alternatively it may be sealed impervious , to be breached in preparation for initiating the reaction in the reactor 20 . it may be burst or otherwise opened or by the reaction . in one embodiment , the layers 64 , 70 may be formed of a polymer film , wax , or the like capable of maintaining the volumes 66 , 68 separated from one another with their reactants . a mechanism such as a plunger , perforator , mixer , spatula , or other apparatus extending through the wall 56 may serve to break , rupture , tear , cut , or otherwise compromise the layer 70 . likewise , the layer 64 may be so opened and compromised in order to make the expansion space 62 available to the reactants . the reactants in the volumes 66 , 68 may be solid , liquid , one of each , or some other combination . for example , an additional layer , possibly even including the volume 62 , may contain a liquid to provide a transport fluid for dry reactants in the volume surface 66 , 68 . by whatever mechanism , the layers 64 , 70 may be opened to expose the volumes 66 , 68 with their reactant contents to one another in order to activate the reactor 20 and begin the chemical reaction to produce nitric oxide . nitric oxide passes through the molecular sieve layer 60 , which may be optional , but is useful in maintaining the purity of nitric oxide . the molecular sieve 60 or the layer 60 may include not only a molecular sieve , such as a film or solid layer , but may also include any other barrier materials suitable to maintain reactants outside of the collection volume 58 collecting the nitric oxide . ultimately , the nitric oxide in the volume 58 is passed through the fitting 30 into a line 18 for delivery into a distributor 12 . notwithstanding the illustrated embodiment of fig4 , any suitable shape may be used for the cross - section of the reactor 20 . accordingly , the reactor of fig4 may actually be configured according to the relations , shapes , or both illustrated in any of the alternative embodiments illustrated in fig1 - 3 . in one alternative embodiment , the wall 56 may be highly flexible . moreover , shape may be selected having an aspect ration of length to width that is comparatively larger than unity . the ratio of width to thickness may also be selected to be substantially larger than unity . accordingly , the reactor 20 may be configured as a comparatively long , narrow tube , of a comparatively smaller thickness . accordingly , the reactor 20 may be rolled up like a toothpaste tube or kneaded in order to rupture the seal layers 64 , 70 and to mix the reactants in the volumes 66 , 68 . if the volumes 66 , 68 are filled with solutions , for example , reactants disposed in a solute liquid , or freely flowing gel , then mixing may readily occur . in other embodiments , diffusion alone may control the migration of reactant species between the volumes 66 , 68 . thus , sealing layers 64 , 70 may be formed , dividing the chambers or volumes 66 , 68 containing reactants , which may then be extruded , mixed , drawn , flown , stirred , or otherwise introduced to one another to increase the available species participating in the reaction . referring to fig5 , one embodiment of an apparatus and method in accordance with the invention may rely on a series of process steps constituting a method 80 or process 80 . for example , providing 82 a distributor 12 may involve any one or more of the required tasks of identifying materials , selecting a shape , selecting a cross - sectional profile and area , selecting aspect ratios of length to width to thickness , and determining the structural and mechanical characteristics for such a distributor 12 . accordingly , providing a distributor 12 may involve design , engineering , manufacture and acquisition of such a device . providing 80 a reactor may involve selection of materials , selection profile and of cross - sectional area , engineering , design , fabrication , acquisition , purchase , or the like of a reactor 20 in accordance with the discussion hereinabove . providing reactants 86 may include selection of reacting species , selecting a configuration , such as granules , powder , liquid , a solution , or the like . likewise , the particular configuration of a solidous configuration of reactants may involve selecting a sieve size for the particles . this site can affect chemical reaction rates . thus , selecting or otherwise providing 86 reactants for the reactor 20 may involve consideration of any or all aspects of chemistry , reaction kinetics , engineering , design , fabrication , purchase or other acquisition , delivery , assembly , or the like . assembling 88 the apparatus may involve a single distributor as an integrated embodiment as described with respect to fig2 , or assembly of a reactor , with a feed line 18 , connected to a distributor 12 . likewise , assembling 88 may also include the disposition of reactants within various locations within a reactor 20 , distributor 12 , or the like as discussed hereinabove . deploying 90 the distributor may involve opening up a package provided during assembly 88 of the apparatus 10 . for example , assembling 88 may also include packaging . accordingly , deploying 90 may involve opening packages , unsealing components , and otherwise rendering the apparatus 10 ready for use . likewise , deploying 90 the distributor 12 may involve positioning the distributor 12 with respect to a user , including , for example , adhering the distributor 12 to the skin of a user proximate the nostrils for inhaling the nitric oxide provided by the distributor 12 . activating 92 the reactants in the reactor 20 may involve , either adding a liquid , mixing the reactant components together , dispersing individual reactants in respective solutes to provide solutions for mixing , adding a liquid transport carrier to dry ingredients in order to initiate exchange between reactants , a combination thereof , or the like . likewise , activation 92 of the reactants may also involve opening valves , opening seals , rupturing or otherwise compromising seals as described hereinabove , or otherwise moving or manipulating reactants with or without carriers in order to place them in chemical contact with one another . in certain embodiments , nitric oxide may be separated 94 from the reactants themselves . for example , the concept of a molecular sieve 60 was introduced hereinabove as one mechanism to separate 94 nitric oxide form other reactants and from other species of nitrogen compounds . in other embodiments , pumps , vacuum devices , or the like may also tend to separate 94 nitric oxide . accordingly , in certain embodiments , a suitably sized pump may actually be connected to the reactor 20 in order to draw nitric oxide away from other species of reactants or reacted outputs . conducting 96 therapy using nitric oxide may involve a number of steps associated with delivery and monitoring of nitric oxide through the distributor 12 . for example , in certain embodiments , conducting 96 therapy may involve activating a reactor 20 or the contents thereof . likewise , conducting 96 a therapy session may involve proper application of the distributor 12 to the person of the user such as by adhering an adhesive strip 42 to the skin of a user in order to position the output ports 14 in the nostrils of a user for receiving nitric oxide therefrom . it may include assembling the necessary conduit 18 or line 18 with the distributor 12 to send nitric oxide from the reactor 20 to the distributor 12 , and ultimately to a user . monitoring may involve adding gauges or meters , taking samples , or the like in order to verify that the delivery of nitric oxide from the reactor 20 to the distributor 12 does meet the therapeutically designed maximum and minimum threshold requirements specified by a medical professional . ultimately , after the expiration of an appropriate time specified , or the exhaustion of a content of a reactor 20 , a therapy session may be considered completed . accordingly , the apparatus 10 may be removed 98 from use , discarded , or the like . accordingly , the removal or discarding 98 of the apparatus 10 may be by parts , or by the entirety . for example , the distributor 12 , if it does not include an integrated reactor therewithin , may simply act as a manifold and be reused with a new reactor 20 . it is contemplated that the reactor 20 may typically be a single dose reactor but need not be limited to such . multiple - dose or reusable reactors may also be used . for example , the reactor 20 may actually contain a cartridge placed within the wall 56 . the internal structure of the cartridge may be ruptured in the appropriate seal locations , such as the seals 64 , 70 by a mechanism associated with the main containment vessel or wall 56 , and thus activated . accordingly , the reactor 20 may be reused by simply replacing the cartridge of materials containing the reactant volumes 66 , 68 . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative , and not restrictive . the scope of the invention is , therefore , indicated by the appended claims , rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .	1
a first aspect of the invention will be described below . fig2 is a side sectional view roughly showing a front loading - type image forming apparatus to which the first aspect of the invention is applied . referring to fig2 reference numeral 1 designates a body of the image forming apparatus of which paper supplying portion la is provided with a plurality of paper supplying decks 2 to be inserted therein and removed therefrom in a multi - step manner from a front side of body 1 . each paper supplying deck 2 is provided with a paper carrying portion 3 having a paper width setting mechanism 4 and a paper supplying roller 5 for supplying paper supplying portion 1a of the body 1 with a paper p carried on paper carrying portion 3 . the body 1 is electrically connected with the paper supplying decks 2 through a drawer - type connector 6 . that is to say , a deck side member 6a and a body side member 6b constituting drawer - type connector 6 are connected with each other under the condition that the paper supplying deck 2 is mounted on paper supplying portion 1a of the body 1 and are separated from each other when the paper supplying deck 2 is dismounted or withdrawn . fig3 is a perspective view roughly showing the paper carrying portion 3 of the paper supplying deck 2 . referring to fig3 reference numeral 7 designates a paper carrying plate provided with a pair of paper end regulating plates 8 constituting the paper width setting mechanism 4 . plates 8 are arranged oppositely and movably in back and forth directions upstream and downstream relative to a moving direction q of the paper supplying deck 2 . the paper end regulating plates 8 are provided with respective racks 9 extending in the back and forth directions and formed at lower ends of plates 8 . thus , plates can be moved in an interlocked relation with a movement of one plate 8 by engaging racks 9 with a pinion 10 pivoted below paper carrying plate 7 . in addition , a variable resistor 11 is arranged in the moving direction of the plates 8 below paper carrying plate 7 , and a sliding tap 11a ( refer to fig1 ) of variable resistor 11 is connected with a lower end of one paper end regulating plate 8 through a connecting member 12 . thus , a resistance value of the variable resistor 11 is variable set in an interlocked relation with movement of the paper end regulating plates 8 , i . e . a width setting operation of the paper width setting mechanism 4 . fig1 is a circuit diagram showing an electric connecting structure between the variable resistor 11 on the side of the paper supplying deck 2 and a controller 13 on the side of the body 1 . referring to fig1 on the side of the paper supplying deck 2 , the variable resistor 11 and an upper limit voltage suppressing resistance 16 are connected in series between a constant voltage power source 14 of 5v and a ground 15 . that is , resistance 16 and the variable resistor 11 are connected in the order described from the side of constant voltage power source 14 , and sliding tap 11a of the variable resistor 11 is connected with deck side member 6a of the drawer - type connector 6 . the upper limit voltage suppressing resistance 16 ensures that a voltage output from the sliding tap 11a is lower than the voltage ( 5v ) of the constant voltage power source 14 even if the resistance value of the variable resistor 11 becomes maximum , i . e . a resistance value r x between the sliding tap 11a and ground 15 becomes equal to a total resistance value r s of the variable resistor 11 . on the other hand , on the side of the body 1 , a constant voltage power source 17 of 5v is connected with body side member 6b of the drawer - type connector 6 through a pull up resistance 18 , and the body side member 6b is connected with one analog input port of a controller 13 . a resistance value r 2 of pull up resistance 18 is set so as to be sufficiently large compared with a resistance value r 1 of the upper limit voltage suppressing resistance 16 and total resistance value r s , that is so that the following relation ( 1 ) occurs : the controller 13 consists of a microcomputer , and a ram 19 for memorizing various types of data is connected with controller 13 . next , an operation under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body in the above described paper supplying device will be described . under the condition that the paper supplying deck 2 is not mounted on the paper supplying portion la of the body 1 , i . e . the deck side member 6a and the body side member 6b forming the drawer - type connector 6 are separated from each other , a voltage v 1out of the body side member 6b is expressed by the following expression : on the contrary , under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , i . e . the deck side member 6a and the body side member 6b of the drawer - type connector 6 are connected with each other , a voltage v 1in of the body side member 6b is expressed by the following expression ( 2 ) on the basis of the expression ( 1 ): wherein r x represents a resistance value from the sliding tap 11a to a ground side terminal in the variable resistor 11 , r 1 represents a resistance value of the upper limit voltage suppressing resistance 16 , and r s represents a total resistance value of the variable resistor 11 . accordingly , under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , the maximum value v 1inmax of voltage v 1in of the body side member 6b of the drawer - type connector 6 is expressed by the following expression ( 3 ): that is , the voltage v 1in input to the controller 13 from the body side member 6b under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , i . e . the paper width detecting signal , is always of low level compared with the voltage v 1out (≈ 5v ) input to the analog input port of the controller 13 from the body side member 6b under the condition that the paper supplying deck 2 is not mounted on the paper supplying portion 1a of the body 1 . thus , it can be judged in the controller 13 whether or not the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 . that is to say , it can be judged that when the voltage input to the controller 13 from the body side member 6b of the drawer - type connector 6 has a value close to 5v the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , while it can be judged that when the voltage input to the controller 13 from the body side member 6b of the drawer - type connector 6 has a value lower than 5v the paper supplying deck 2 is not mounted on the paper supplying portion 1a of the body 1 . in addition , a plurality of paper width standard data corresponding to the paper widths of respective typical papers p for comparing a paper width detecting signal v in therewith , to judge to which paper width such signal corresponds , are previously written or entered in ram 19 in an assembling step . that is to say , when such paper standard data are entered , the paper width detecting signals v 1in1 , v 1in2 . . . input to the controller 13 through the drawer - type connector 6 are written in the ram 19 as a data map shown in fig4 in correspondence to , for example , respective typical papers b6 , b5 , . . . every time when the respective typical papers p are carried on the paper carrying portion 3 of the paper supplying deck 2 , i . e . when the paper end regulating plates 8 of the paper width setting mechanism 4 are moved to accommodate the width of the respective papers p , thereby setting the paper width . thus , by entering the paper width standard data in the ram 19 in the above described manner , even in the case where the resistance value of the variable resistor 11 is dispersed , it is possible to omit an operation that a semi - fixed resistance is connected in series with the variable resistor 6 and such semi - fixed resistance is regulated so that the previously determined voltage corresponding to the respective typical papers , i . e . the paper width detecting signal , may be obtained . fig5 is a circuit diagram showing a second preferred embodiment of the first aspect of the invention . in a paper supplying device according to this preferred embodiment , on the side of the paper supplying deck 2 the variable resistor 11 and a lower limit voltage rising resistance 21 , used in place of the upper limit voltage suppressing resistance 16 in the above described first preferred embodiment , are connected in series between the constant voltage power source 14 and the ground 15 . that is , resistance 21 and the variable resistor 11 are connected in the order described from the side of the ground 15 . on the other hand , on the side of the body 1 , a pull down resistance 23 is connected between the body side member 6b of the drawer - type connector 6 and the ground 15 in place of the pull up resistance 18 in the first preferred embodiment . a resistance value r 4 of pull down resistance 23 is set so as to be sufficiently large as compared with a resistance value r 3 of the lower limit voltage rising resistance 21 and the total resistance value r s of the variable resistor 11 , that is , so that the following relation ( 5 ) occurs : other constructions of this embodiment are similar to those in the first preferred embodiment . in this second preferred embodiment , under the condition that the paper supplying deck 2 is not mounted on the paper supplying portion 1a of the body 1 , a voltage v 2out of the body side member 6b of the drawer - type connector 6 is expressed by the following expression : on the contrary , under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , a voltage v 2in of the body side member 6b is expressed by the following expression ( 6 ) on the basis of the expression ( 5 ): accordingly , under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , the minimum value v inmin of voltage v 2in of the body side member 6b is expressed by the following expression ( 7 ): that is to say , the voltage v 2in input to the controller 13 from the body side member 6b under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , i . e . the paper - width detecting signal , is always high in level as compared with the voltage v 2out (= 0v ) input to the controller 13 from the body side member 6b under the condition that the paper supplying deck 2 is not mounted on the paper supplying portion 1a of the body 1 . thus , it can be judged in the controller 13 whether or not the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 . that is to say , it can be judged that when the voltage input to the controller 13 from the body side member 6b of the drawer - type connector 6 has a value of 0v then the paper supplying deck 2 is not mounted on the paper supplying portion 1a of the body 1 , while it can be judged that when the voltage input to the controller 13 from the body side member 6b of the drawer - type connector 6 has a value higher than 0v then the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 . next , a second aspect of the invention will be described . fig7 is a side sectional view roughly showing a front loading - type image forming apparatus to which the second aspect of the invention is applied . referring to fig7 reference numeral 31 designates a body of the image forming apparatus of which paper supplying portion 31a is provided with a plurality of paper supplying decks 32 so as to be inserted therein and withdrawn therefrom in a multi - step manner from a front side of body 31 . each paper supplying deck 32 is provided with a paper carrying portion 33 having a paper width setting mechanism 34 and a paper supplying roller 35 for supplying paper supplying portion 31a of the body 31 with a paper p carried on paper carrying portion 33 . the body 31 is electrically connected with the paper supplying decks 32 through a drawer - type connector 36 . that is to say , a deck side member 36a and a body side member 36b forming drawer - type connector 36 are connected with each other under the condition that the paper supplying deck 32 is mounted on paper supplying portion 31a of the body 31 and are separated from each other when the paper supplying deck 32 is dismounted or withdrawn . fig8 is a perspective view roughly showing the paper carrying portion 33 of the paper supplying deck 32 . referring to fig8 reference numeral 37 designates a paper carrying plate provided with a pair of paper end regulating plates 38 constituting the paper width setting mechanism 34 . plates 38 are arranged oppositely and movable in back and forth directions upstream and downstream relative to a moving direction q of the paper supplying deck 32 . the paper end regulating plates 38 are provided with respective racks 39 extending in the back and forth directions and formed at lower ends of the plates 38 . thus , plates 38 can be moved in an interlocked relation with a movement of plate 38 by engaging racks 39 with a pinion 40 pivoted below paper carrying plate 37 . in addition , a variable resistor 41 is arranged in the moving direction of the plates 38 below paper carrying plate 37 , and a sliding tap 41a ( refer to fig6 ) of variable resistor 41 is connected with a lower end of one paper end regulating plate 38 through a connecting member 42 . thus , a resistance value of the variable resistor 41 is variable set in an interlocked relation with movement of the paper end regulating plates 38 , i . e . a width setting operation of the paper width setting mechanism 34 . in addition , a longitudinal size detecting switch 43 for discriminating the typical papers of centimeter measure , i . e . of b4 from b5 and of a3 from a4 , is arranged at the downstream side of the paper width setting mechanism 34 in a direction transverse to moving direction q of the paper supplying deck 32 , i . e . in a paper supplying direction r . that is to say , when typical papers b5 , a4 size are carried on paper carrying portion 33 with short sides thereof parallel to paper supplying direction r , rear portions thereof are not overlapped on switch 43 . however , when typical papers of b4 , a3 size are carried on the paper carrying portion 33 with short sides ( equal to long sides of typical papers of b5 , a4 size , respectively ) thereof parallel to moving direction q , rear portions thereof are overlapped on the switch 43 . the switch 43 is an always closed switch which is pushed down and switched off by rear portions of the paper p carried on the paper carrying portion 33 and is maintained switched on when not pushed down . fig6 is a circuit diagram showing an electric connecting structure between the side of the paper supplying deck 32 and a controller 44 consisting of a microcomputer included on the side of the body 31 . in fig6 in order to simplify the circuit , the drawer - type connector 6 is omitted . referring to fig6 a resistance 47 , a variable resistor 41 and a resistance 48 are connected in series between a constant voltage power source 45 of 5v and a ground 46 . that is , resistance 47 , variable resistor 41 and resistance 48 are connected in the order described from the side of constant voltage power source 45 . the switch 43 is connected in parallel with the resistance 48 , and a sliding tap 41a of the variable resistor 41 is connected with an analog input port of controller 44 . a resistance value r 22 of the resistance 48 is set to be larger than a total resistance value r s2 of the variable resistor 41 so that a level of a voltage output from sliding tap 41a when the switch 43 is switched off always will be higher than that when the switch 43 is switched on . next , an operation of detecting sizes of typical papers of centimeter measure in the above described paper supplying device will be described . in the case where the papers p carried on the paper carrying portion 33 of the paper supplying deck 2 are b6 , a5 , b5r , a4r , b5 and a4 size , rear portions of such papers are not overlapped on the switch 43 , so that switch 43 is kept under the switched - on condition . accordingly , a width direction size detecting voltage v on2 output from the sliding tap 41a of the variable resistor 41 at such time is expressed by the following expression ( 9 ): wherein r x2 represents a resistance value from the sliding tap 41a to a ground - side terminal in the variable resistor 41 . in such case , width direction size detecting voltage v onmax2 when r x2 becomes the maximum value (= r s2 ) is expressed by the following expression ( 10 ): on the contrary , in the case where the papers p carried on the paper carrying portion 33 of the paper supplying deck 2 are b4 and a3 size , the rear portions of the papers are overlapped on the switch 43 , so that the switch 43 is pushed down and switched off . accordingly , the width direction size detecting voltage v off2 output from the sliding tap 41a at such time is expressed by the following expression ( 11 ): in such case , the width direction size detecting voltage v offmin2 when r x2 becomes the minimum value (= 0 ) is expressed by the following expression ( 12 ): as above described , r 22 is set to be larger than r s2 so that the following expression ( 13 ) occurs , whereby the width direction size detecting voltage v offb4 in the case where the papers p are b4 size , as shown in fig9 is higher than the width direction size detecting voltage v ona4 in the case where the papers p are a4 size , and also the width direction size detecting voltage v offa3 in the case where the papers p are a3 size is higher than v ona4 : in addition , the following relation ( 14 ) occurs between v offb 4 and v offa3 : thus , the controller 44 can discriminate not only papers of b4 size from papers of b5 size but also papers of a3 size from papers of a4 size . in addition , although the case were the paper width setting mechanism 34 and the longitudinal size detecting switch are carried on the paper supplying deck 32 is described above with regard to this preferred embodiment , the paper supplying device according to the present invention also can be employed with an image forming apparatus in which the paper width setting mechanism 34 and the longitudinal size detecting switch 43 are carried on a normal paper supplying cassette not provided with a paper supplying roller .	1
with reference to fig1 - 3 , in accordance with the present invention , a structure for firmly combining cables with a clamping element is provided with locking ribs or locking grooves on the clamping element . the clamping element 10 can be a circular , c - shaped , 6 - shaped or h - shaped section . referring to fig1 , the clamping element 10 is a tubular - like body having a circular section . an outer surface of the clamping element 10 is circumferentially provided with corresponding semi - circular locking ribs 11 . the locking ribs ii are straight and parallel to a central axis of the clamping element 10 . referring to fig2 , the clamping element 10 is a tubular - like body having a circular section . an inner surface of the clamping element 10 is circumferentially provided with corresponding semi - circular locking grooves 12 . the locking grooves 12 are straight and parallel to the central axis of the clamping element 10 . next , with reference to fig3 and 3 a , in practical application , two cables a , and b are inserted into the clamping element 10 of fig1 , and then a press die presses the locking ribs 11 of the clamping element 10 . the compression stress on the inner surface of the clamping element 10 can be effectively reduced , thereby facilitating to firmly crimp the clamping element 10 and the two cables a , and b . as a result , the clamping element 10 can be sufficiently attached on the outer surface of the cables a , and b and kept in the shape of the cables . referring to fig4 , the clamping element 10 has a circular section and a terminal extended from a rear portion thereof . the outer surface of the clamping element 10 is circumferentially provided with corresponding semi - circular locking ribs 11 . the locking ribs 11 are straight and parallel to the central axis of the clamping element 10 . referring to fig5 , the clamping element 10 has a circular section and a terminal extended from a rear portion thereof . the inner surface of the clamping element 10 is circumferentially provided with corresponding semi - circular locking grooves 12 . the locking grooves 12 are straight and parallel to the central axis of the clamping element 10 . next , with reference to fig6 , in practical application , a cable a is inserted into the clamping element 10 of fig4 , and then a press die presses the locking ribs 11 of the circular clamping element 10 . the compression stress on the inner surface of the clamping element 10 can be effectively reduced , thereby facilitating to firmly crimp the clamping element 10 and the cable a . as a result , the clamping element 10 can be sufficiently attached on the outer surface of the cable a , and kept in the shape of the cable . referring to fig7 , a clamping element 20 in accordance with the present invention is a tubular - like body having a c - shaped section . an upper end 21 and a lower end 22 of the clamping element 20 form a first cable groove 23 and a second cable groove 24 , respectively . an outer surface of the upper end 21 and lower end 22 has a semi - circular locking rib 25 , respectively . the locking ribs 25 are straight and parallel to a central axis of the clamping element 20 . referring to fig8 , the clamping element 20 is a tubular - like body having a c - shaped section . an upper end 21 and a lower end 22 of the clamping element 20 form a first cable groove 23 and a second cable groove 24 , respectively . an inner surface of the upper end 21 and lower end 22 has a semi - circular locking groove 26 , respectively . the locking grooves 26 are straight and parallel to the central axis of the clamping element 20 . next , with reference to fig9 , in practical application , two cables a , and b are inserted into the c - shaped clamping element 20 of fig7 , and then a press die presses the locking ribs 25 of the clamping element 20 . the compression stress on the inner surfaces of the two cable grooves 23 , 24 can be effectively reduced , thereby facilitating the first cable groove 23 and the second cable groove 24 to bend on the outer surface of the cables a , and b . thus , both ends of first cable groove 23 and the second cable groove 24 abut against the cables a , and b . as a result , the cables a , and b can be firmly crimped , such that the first cable groove 23 and the second cable groove 24 can be sufficiently attached on the outer surface of the cables a , and b and kept in the shape of the cables referring to fig1 , a clamping element 30 in accordance with the present invention is a tubular - like body having a 6 - shaped section . a partition 31 is provided in the middle of the clamping element 30 . both ends of the clamping element 30 form a first cable groove 32 and a second cable groove 33 , respectively . the first cable groove 32 is of similar circular and provided with a notch 34 . near both ends of the notch 34 of the first cable groove 32 , an outer surface of the clamping element 30 has two semi - circular locking ribs 35 . the second cable groove 33 is of similar semi - circular . the outer surface of the second cable groove 33 of the clamping element 30 has a semi - circular locking rib 35 . the locking ribs 35 are straight and parallel to a central axis of the clamping element 30 . referring to fig1 , the clamping element 30 is a tubular - like body having a 6 - shaped section . a partition 31 is provided in the middle of the clamping element 30 . both ends of the clamping element 30 form a first cable groove 32 and a second cable groove 33 , respectively . the first cable groove 32 is of similar circular and provided with a notch 34 . near one side of the notch 34 of the first cable groove 32 , the inner surface of the clamping element 30 has a semi - circular locking groove 36 . the second cable groove 33 is of similar semi - circular . the inner surface of the second cable groove 33 of the clamping element 30 has a semi - circular locking groove 36 . the locking grooves 36 are straight and parallel to the central axis of the clamping element 30 . next , with reference to fig1 , in practical application , two cables a , and b are inserted into the 6 - shaped clamping element 30 of fig1 , and then a press die presses the locking ribs 35 of the clamping element 30 . the compression stress on the inner surfaces of two cable grooves 32 , 33 can be effectively reduced , thereby facilitating the first cable groove 32 and the second cable groove 33 to bend on the outer surface of the cables a , and b . thus , both ends of first cable groove 32 and the second cable groove 33 abut against the cables a , and b . as a result , the cables a , and b can be firmly crimped , such that the first cable groove 32 and the second cable groove 33 can be sufficiently attached on the outer surface of the cables a , and b and kept in the shape of the cables . referring to fig1 , the clamping element 40 is a tubular - like body having a h - shaped section . each end of the clamping element 40 forms a cable groove 41 with symmetry in vertical direction . an upper end of the cable groove 41 is connected with a cap 42 , and an outside middle surface of the cap 42 is provided with a semi - circular locking rib 43 . the h - shaped clamping element 40 has another semi - circular locking rib 43 on the connection between the upper end of each of the cable grooves 41 and its corresponding cap 42 . referring to fig1 , the clamping element 40 is a tubular - like body having a h - shaped section . each end of the clamping element 40 forms a cable groove 41 with symmetry in vertical direction . an upper end of the cable groove 41 is connected with a cap 42 , and an inside middle surface of the cap 42 is provided with a semi - circular locking groove 49 . the h - shaped clamping element 40 has a semi - circular locking rib 43 on the connection between the upper end of each of the cable grooves 41 and its corresponding the cap 42 . next , with reference to fig1 , in practical application , two cables a , and b are inserted into the h - shaped clamping element 40 of fig1 , and then a press die presses the locking ribs 43 of the clamping element 40 . the cables a , and b can be fixed in the clamping element 40 . further , the locking rib 43 formed on the connection between the upper end of the cable groove 41 and the cap 42 can enhance the strength of the cap 42 , such that it cannot break at the connection of the clamping element 40 . as a result , the cables a , and b can be firmly crimped , such that the clamping element 40 can be sufficiently attached on the outer surface of the cables a , and b and kept in the shape of the cables . although the present invention has been described with reference to the preferred embodiment thereof , it is apparent to those skilled in the art that a variety of modifications and changes may be made without departing from the scope of the present invention which is intended to be defined by the appended claims .	7
select embodiments of the present invention employ a pyrolytic catalytic chemical vapor deposition ( ccvd ) technique . hart , a . j . & amp ; a . h . slocum , rapid growth and flow - mediated nucleation of millimeter - scale aligned carbon nanotube structures from a thin - film catalyst , journal of physical chemistry b 110 ( 16 ), 8250 - 8257 , 2006 . in association with ccvd , silicon single - crystal growth substrates have been used . typically , growth of conventional cnts is associated with a scribed substrate region . chen y . and j . yu , patterned growth of carbon nanotubes on si substrates without pre - deposition of metal catalysts , appl phys lett , 87 ( 3 ): 033103 , 2005 ; fan s . et al ., carbon nanotube arrays on silicon substrates and their possible application , physica e , 8 ( 2 ): 179 - 83 , 2000 ; yu j . and y . chen , “ scratching ” carbon nanotubes onto si substrates , materials research society symposium , san francisco , calif ., materials research society , p . 55 - 60 , 2006 . yue , y . et al ., selecting the growth sites of carbon nanotubes on silicon substrates by ion implantation , appl phys lett 88 ( 26 ): 263115 - 3 , 2006 . some researchers , for specific conditions , state that growth is not possible on the polished and otherwise unprepared side of a silicon ( si ) ( 111 ) wafer . select embodiments of the present invention induce prolific growth localized to a scribed substrate region on silicon and grow cnts on the polished side of a silicon ( 111 ) wafer . select embodiments of the present invention yield structure by depositing on a clean si substrate ( see fig4 a ) silicon particles ( see fig4 b and c ) prior to ccvd growth . 25 in developing select embodiments of the present invention , a modified ccvd method was employed for multiple cnt growth experiments on si ( 111 ) wafers to explore the effect of surface quality on growth behavior . barreiro , a . et al ., thermal decomposition of ferrocene as a method for production of single - walled carbon nanotubes without additional carbon sources , the journal of physical chemistry b 110 ( 42 ), 20973 - 20977 , 2006 ; barreiro , a . et al ., on the effects of solution and reaction parameters for the aerosol - assisted cvd growth of long carbon nanotubes , applied physics a : materials science & amp ; processing 82 ( 4 ), 719 - 725 , 2006 . single - crystal 10 . 2 cm silicon wafers with a ( 111 ) surface orientation were cut into approximately rectangular slides 100 using a diamond - tip scribe and straightedge . the narrower dimension was chosen to be approximately 25 mm in part for convenience of insertion into the fused quartz reaction tube 205 . a wash sequence of acetone followed by methanol and then isopropanol was used to clean the substrate of any debris . nel et al . ( 1998 ). prior to silicon particle deposition and growth , the surface roughness of the silicon single - crystal surface was characterized via profilometry using a sloan dektak3 instrument . the profile of the matte side of the wafer is shown in fig8 . a 500 micron scan shows roughness that spans approximately 125 nm in the dimension perpendicular to the surface . any single surface feature does not , however , appear to exceed approximately 50 microns in lateral extent parallel to the surface . the fact that the perpendicular features are approximately three orders of magnitude smaller than the lateral surface irregularities indicates surface topography varies only slightly . in comparison , the polished side of the silicon single crystal surface was also characterized by profilometry as shown in fig9 . a similar 500 micron scan ( fig9 ) shows considerably less roughness , i . e ., approximately 5 nm perpendicular to the surface . this variation indicates a flatness within two orders of magnitude of atomic scale . sample substrates 100 were left either in this clean state or deposited with silicon particles after cleaning . a 1 . 0 % mol mixture of ferrocene powder in xylene was prepared and loaded into a glass syringe . refer to fig2 . a fused quartz reaction tube 205 ( 610 mm length × 35 mm inner diameter ) was laid in a mullite process tube 206 inside a lindberg 55320 tube furnace 207 inclined at an angle , a , of 10 °. after placing the prepared substrate in the reaction tube 205 at the desired depth of 14 . 0 cm ( 5 . 5 in .) from the entrance of the quartz reaction tube 205 , a ferrocene mixture and ultra - high purity ( uhp ) helium delivery apparatus 201 with a smooth nozzle was inserted into the 25 high end of the quartz tube 205 . helium flow was controlled at 1 . 0 slpm for five minutes before setting the furnace to 875 ° c . refer to fig3 showing the temperature profile of the quartz reaction tube 205 . following a one - hour dwell time , a syringe pump 202 regulated the mixture flow at 0 . 500 ml / minute into a sono - tek 06 - 05108 ultrasonication nozzle 204 from an ultrasonic processor 203 running at 2 . 1 w and 120 khz . after 26 ml of the mixture was dispensed , the pump 202 was halted and the furnace 207 was allowed to cool to 100 ° c . before stopping helium flow . characterization of samples was performed using both sem ( jeol jsm 6390 ) and tem ( jeol 2010lab6 , single tilt stage , operated at 200 kv ). the silicon particles used in experiments were produced by abrading a si ( 111 ) wafer sample . the particles were characterized by both sem imaging and dynamic light scattering ( dls ) techniques . the dls instrument used was a microtrac nanotrac 150 . particles larger than 2 . 75 5 microns did not stay in suspension and were not recorded by the dls instrument . the presumption by the dls instrument of perfectly spherical particles undergoing brownian motion also renders this characterization method as semi - quantitative for non - spherical morphologies . particle separation was achieved using an electrostatically charged polypropylene sheet such as a lid to a silicon wafer carrier . in this manner a differential size separation was achieved , with the larger particles being removed . to investigate the nucleation and growth mechanism , silicon particles were deposited in two different size ranges together with a control sample . in all experiments the si ( 111 ) substrates were exposed to identical growth conditions . the sample position in the furnace was purposefully chosen to include a slight temperature gradient across the wafer , and this positioning was consistently employed . fig3 shows the steady - state temperature profile of the furnace as well as the sample position . the temperature range across the silicon substrate was 750 - 850 ° c . the first substrate was a control , using a published cleaning protocol , and consisted of only the si wafer . nel , j . m . et al ., using scanning force microscopy ( sfm ) to investigate various cleaning procedures of different transparent conducting oxide substrates , appl surf sci , 134 ( 1 - 4 ), 22 - 30 , 1998 . two wafers ( fig4 b and c ), similarly prepared using the same cleaning procedure , had silicon particles of two different size classes deposited thereon . the larger size class ( fig4 b ) was measured to encompass particles 1 - 250 microns in diameter . the smaller silicon particle size class ( fig4 c ) was measured to encompass particles of 1 - 100 microns in diameter . fig4 a - c shows the three prepared substrates immediately prior to growth . note the differing sized scale bars , especially 25 between fig4 b and c . refer to fig4 a - f . depositing large si particles yielded clumped sats growth ( fig4 c , d ) on the cnt forest ( shown by itself in fig4 a , b ) while small si particles contributed individual sats growth ( fig4 e , f ) on the cnt forest . the presence of cnts was confirmed by raman spectroscopy and tem imaging . heller , d . a , et al ., using raman spectroscopy to elucidate the aggregation state of single - walled carbon nanotubes , the journal of physical chemistry b 108 ( 22 ), 6905 - 6909 , 2004 . these new cnt structures erupted from the surface of the dense cnt forest growth ( fig4 a , b ). refer to fig1 a - c depicting the cnt growth regimes initially explored with just the unpolished ( rough ) matte side of a ( 111 ) single - crystal silicon wafer 100 as the substrate ( fig1 a ), then adding large si particles ( fig1 b ) and finally small si particles ( fig1 c ) to the substrate 100 . initially , a uniform and dense forest 101 of multiwall cnts was produced on the unpolished side with no deposits of si particles , as shown in fig1 a . this mode of growth had an additional feature that was not caused by any external alteration of experimental parameters : the formation of discrete and distributed worm - like structures ( see fig4 a ) that erupted from the dense forest 101 . their characterization was performed using scanning electron microscopy ( sem ) ( fig4 a and b ) and raman spectroscopy ( fig4 c ). for fig4 a and b 40 ° of tilt was used on the sample stage . accounting for this alteration in perspective , the actual length of the grown sats is approximately 3 . 0 mm . upon close examination of the inner surface , an intermediate hierarchical structure of regular lateral ridges and larger longitudinal angular sections can be discerned . for fig4 c the sample was placed on a silicon chip . the conditions used for the raman spectroscopy characterization were a laser wavelength of 532 nm set at a power of 44 mw and an exposure time of 600 sec . the d and g bands ( fig4 c ) shown are indicative of the presence of cnts . after growth , the control sample evidenced a uniform and dense multiwall cnt forest growth ( fig4 a and 45b ). some irregularities atop the forest can be observed , but they exhibit no particular or regular structure . in contrast , for the sample deposited with larger silicon particles , profusions of dense clumps of sats structures formed along with individual sats ( fig4 c and d ). for the sample deposited with smaller silicon particles , fewer clumps of sats were present , and more individual and more isolated sats were formed ( fig4 e and f ). these individual sats grew to considerably greater lengths , up to approximately 3 mm . refer to fig4 - 7 . the sats structures were further characterized using tem with 25 progressively increased magnification . fig4 shows an overall view of a single sats 400 . the multi - wall cnts are generally well aligned although not all perfectly parallel . the denser center region could be a result of a greater cross section . fig5 shows detail of both alignment of the cnts 500 and the presence of iron particle debris 501 inherent from the growth method . fig6 shows individual multi - wall cnts 600 , providing a sense of their relative orientation , and also shows residual catalytic iron particles 601 . fig7 shows the multi - wall nature of these cnts 700 . fig4 a shows the surface as prepared with the scratch 4600 inscribed . there were no irregularities other than the scratch 4600 . after growth , a normal cnt forest 4601 is observed ( fig4 b and c ). this result is contrary to results by other researchers who reported growth on single crystal silicon substrates is difficult without either depositing metal catalysts or xenon ion implantation . chen et al . ( 2005 ), yu et al . ( 2006 ), yue et al . ( 2006 ). in addition , many sats structures 4601 are entirely confined to the region of the scribed line 4600 ( fig4 c ). this result further supports the finding that surface roughness is necessary and sufficient to produce sats . refer to fig4 d showing one of a number of holes 4602 with a characteristic morphology in the cnt forest 4601 . these holes 4602 are not spatially associated with the scribed region 4600 and have a uniform surface density of approximately 1 . 5 holes / mm2 . the repeated morphology of these holes 4602 consists of a very regular inner circular hole of approximately 20 microns in diameter , surrounded by a less - regular circular region of denser cnt forest growth with a diameter of approximately 55 microns . the density of this annular region has a radial dependency , appearing to be highest near the center and decreasing outward . there is also a distinct encircling outer narrow ring feature of approximately 75 microns in diameter that is characterized by an absence of cnts . these features may represent failed sats growth sites , or conversely , locations where sats were formed and then subsequently detached . the nearly atomically smooth substrate 100 may imply formation followed consistently by release . thus , the dynamic forces felt at the base during growth likely exceed the bond or adhesion strength . this suggests initiation and growth from the substrate 100 upward versus initiation from the forest surface and growing both downward and upward simultaneously . an alternate explanation may be a mechanism that consistently shears off a proto - sats at the forest surface . such a mechanism could be associated with gaseous reactant release from the encircling annular break ( hole ) 4602 in the cnt forest 4600 . common to all cases , effects from the flow of gaseous reactants within and through the cnt forest 4600 need be considered . the interaction among inhomogeneities , irregularities , and surface roughness is almost 25 certain to change the gaseous reactant flow properties and hence the localized reaction conditions . for the above specific growth conditions , formation of the sats is associated with surface roughness or a locally “ enhanced ” surface area such as the inscribed scratch 4600 . as shown in fig4 b and c , the roughness is provided by the si particles . roughness in the form of a scribe - damaged surface 4600 ( fig4 a ) is also shown as a means to promote sats growth . while iron is also present in the system , as derived from the ferrocene catalyst , it is only observed as very small particles 601 common to individual multi - wall cnts ( fig6 ). given that sats are observed , in the instance of these experiments , only when si particles are present , and are not observed in the control sample , any direct contribution of iron to the surface roughness effect is negligible . however , iron may have a collaborative and contributory role when used with silicon particles . the intentional production of surface roughness being both necessary and sufficient to form sats for these specific catalytic cvd growth conditions is established . with either the inscribed irregularities or deposited silicon particles , heterogeneous nucleation sites are formed , i . e ., these “ irregularities ” decrease the free energy needed for formation of the sats . this preferentially promotes formation of a hierarchal tube structure . while initiation of growth at the substrate surface is highly likely , interactions and effects from the forest top surface may be possible . a contributing factor may include the evolving conditions of gaseous reactant flow , both above and especially below the forest surface during the growth process . musso , s . et al ., fluid dynamic analysis of gas flow in a thermal - cvd system designed for growth of carbon nanotubes , j cryst growth , 310 ( 2 ): 477 - 83 ; 2008 . for tensile testing , each sats was laid on a tab of standard cardstock across a central horizontal disposed rectangular cut - out , producing a gage length of approximately 500 microns . while spanning the cut - out , both ends of the sats were attached to the cardstock using loctite fixmaster epoxy pak ( as detailed in astm d3379 - 75 , withdrawn 1998 ). specimens were then loaded into the tensile apparatus ( not shown separately ), which consisted of a lever arm , a counterweight , and a sartorius type 1602 mp 8 - 1 balance . the upper and lower tabs were gripped by pelco reverse tweezers at both the lever arm end and fixed counterweight points . the two sides of the card stock were then cut with the balance zeroed . the lever arm was then pushed downward a fixed distance past the fulcrum using a calibrated micrometer screw gauge to provide a known displacement . on the opposite side , this lifted the attached counterweight off the balance under the support of the sats only . 25 in addition , the sats were characterized by measurement of their ultimate tensile strength ( uts ). a preliminary value of 140 mpa was obtained . without optimization , this is approximately 32 % of the uts for a common commercial steel ( i . e ., aisi 1018 ). fig1 is an example of the tensile failure surface 1000 on the left side . in this case there is no evidence of permanent deformation , suggesting a brittle failure mechanism . a different sats sample that failed during preparation also suggests brittle failure . fig1 shows the result of some uncharacterized lateral loading . here a number of longitudinal fractures 1100 are evident , suggesting the presence of only weak cross bonding perpendicular to the long axis . further investigation involved using more control to prepare the surface of the substrate 100 . standard photo - resist and processing techniques from the semi - conductor industry used deep reactive ion etching ( drie ) to produce a very regular array of square 25 × 25 micron towers , 75 microns high . column spacing for four different configurations of 12 . 5 , 25 , 37 , and 50 microns were designed , examples of all these configurations are described below and represented in the figures . refer to fig1 - 18 and 20 - 22 for examples of the towers . a first array was grown using a position in the reactor tube 205 that placed the leading edge of the prepared substrate 22 cm from the entrance of a 20 ml xylene / ferrocene flow at a rate of 0 . 75 l / min to the reactor tube 205 with a 37 . 5 micron column spacing and 25 micron column width . fig2 - 32 show results of the tower growth . fig2 shows the tops of the towers at the leading edge enlarged at 250 ×. fig2 is an elevation view of the tops of the towers showing the formation of cubes on each side of the tops of the towers enlarged at 250 ×. fig2 is an elevation view of the tops of the towers showing the formation of cubes on each side of the tops of the towers enlarged at 500 ×. fig2 shows the tops of the towers at the midpoint enlarged at 200 ×. fig2 shows the tops of the towers at the midpoint enlarged at 250 ×. fig3 shows the tops of the towers at the midpoint enlarged at 100 ×. fig3 shows a close - up of the tops of the towers at the trailing edge enlarged at 1000 ×. fig3 shows the tops of the towers at the trailing edge enlarged at 250 ×. a second array was grown using a position in the reactor tube 205 that placed the leading edge of the prepared substrate 20 cm from the entrance of a 25 ml xylene / ferrocene flow at a rate of 0 . 75 l / min to the reactor tube 205 with a 25 micron column spacing and 25 micron column width . fig3 - 46 show results of the tower growth . fig3 shows the tops of the towers with some dislodged towers at the leading edge enlarged at 75 ×. fig3 shows the tops of the towers at the leading edge enlarged at 75 × with some partially grown towers . fig3 shows the tops of the 25 towers enlarged at 250 ×. fig3 shows a close - up of the top of a tower at the leading enlarged at 2500 ×. fig3 shows the tops of the towers at the midpoint enlarged at 100 ×. fig3 shows the tops of the towers at the trailing edge enlarged at 100 ×. fig3 shows a perspective view of the towers at the trailing edge enlarged at 75 ×. fig4 shows the tops of the towers at the trailing edge enlarged at 1000 ×. fig4 shows the surrounding rim of a dense , long cnt forest that held together even as the underlying substrate 100 cracked off while being removed from the quartz tube 205 . fig4 shows the surrounding cnt forest rim , with cnt length of approximately 1170 microns , on the leading edge enlarged at 200 ×. a third array was grown using a position in the reactor tube 205 that placed the leading edge of the prepared substrate 20 cm from the entrance of a 20 ml xylene / ferrocene flow at a rate of 0 . 75 l / min to the reactor tube 205 with a 12 . 5 micron column spacing and 25 micron column width . fig1 - 24 show results of the tower growth . fig1 shows the tops of the towers at the leading edge enlarged at 100 ×. fig1 is close - up of the tops of the towers at the leading edge enlarged at 100 ×. fig1 is a perspective view of the towers enlarged at 250 ×. fig1 shows a perspective view of the towers at the midpoint enlarged at 100 ×. fig1 shows the tops of the towers at the midpoint enlarged at 100 ×. fig1 shows the tops of the towers at the midpoint enlarged at 500 ×. fig1 shows a close - up of the tops of the towers at the midpoint enlarged at 5000 ×. fig2 is a perspective view of the towers at the trailing edge enlarged at 30 ×. fig2 is an elevation view of the towers at the trailing edge enlarged at 500 ×. fig2 is a perspective view of a broken off piece of towers at the trailing edge enlarged at 150 ×. fig2 is a close - up of a broken off piece of towers at the trailing edge enlarged at 1000 ×. fig2 shows pieces of iron among the towers at the trailing edge enlarged at 250 ×. a fourth array was grown using a position in the reactor tube 205 that placed the leading edge of the prepared substrate 20 cm from the entrance of a 25 ml xylene / ferrocene flow at a rate of 0 . 75 l / min to the reactor tube 205 with a 50 micron column spacing and 25 micron column width . fig4 a , 47 b , 47 c & amp ; 47 d show results of the tower growth , and are all views from the top side of the substrate . fig4 a shows the claimed quad configuration and is from the leading edge , 47 b , 47 c & amp ; 47 d are from the middle . fig4 a shows the trailing edge of the top of the substrate and resembles the quad configuration , albeit with “ softened ” edges . fig4 b , 48 c & amp ; 48 d show results from the bottom of the substrate . fig4 a shows yet another view of the quad configuration , fig4 b and 49c show instances where non - sats material grows on the substrate between the substrate and the sats material and fig4 d is an excellent perspective of two towers with 50 micron spacing . fig5 a shows the quad configuration after compression testing and fig5 c shows an enlarged view of a central section of the tested section . fig5 d shows the diagonal propagation of the fracture outside the testing area of a portion of fig5 b above it . fig5 shows the plot of the claimed compression testing results , the solid line to the left being in accordance with the claimed invention and the dotted line to the right being a control . note the “ splitting ” behavior after some amount of sats growth . at the 37 . 5 micron spacing ( see fig2 ) above this takes the form of reproducing the square base geometry in each of the four faces . assuming any kind of surface reaction ( gas or liquid ) this could yield considerable specific area . other possibilities for preparing a substrate include surface rows with a power law or log normal type of increasing spacing , or a variation employing concentric circles . a wide variety of patterns or features could be prepared and then cnts grown on them . one purpose would be to grow patterns , such as fractal patterns , to have a set of discrete responses for producing radio wave passive sensors . upon external perturbation or some other sensing reaction , the patterned cnt 25 forest is disturbed and the em signature altered , permitting remote detection . there are many potential uses for and applications of the sats structure . directed growth of interconnects for integrated circuits may be possible . through control of chirality the conductive properties could be further designed for purpose . given appropriate substrate material , sats may be employed in electronic connections or sequential semiconductor junctions . applications could include “ super ” capacitors , strain sensing , piezoelectric coated generation including a variation with dielectric elastomers , and conductive ic - chip interconnects and the like . further , sats may be incorporated in hybrid structures that employ both electrical conduction and controlled micro - fluidics to mimic nervous system activity . possibilities include use as a boundary layer surface treatment to affect fluid flow and heat transfer . medical applications include scaffolding for blood vessel or nerve cells , kidney structures , cochlear implants to restore hearing , and the like . sats - 1 . a self - assembled tube structure grown on a substrate under specified process conditions comprising an elongate body comprising a plurality of carbon nanotubes , said elongate body having a longitudinal axis and a proximal end and a distal end opposite said proximal end , said proximal end attached to said substrate either directly or indirectly ( indirectly = attached to the substrate by non sats material ), said sats being either hollow ( having a central cavity ) or solid , said sats being generally symmetrical around said longitudinal axis . sats - 2 . the sats of sats - 1 , when viewed in an axial cross - section , i . e ., a section taken perpendicular to and at a midpoint along said longitudinal axis , may be in the shape of a circle , an oval , a square , a rectangle , a triangle , a polygon , a sheet , or other geometric forms . sats - 3 . the sats of any of sats - 1 to sats - 2 , when viewed in an axial cross - section at said distal end , i . e ., a section taken perpendicular to said longitudinal axis , may expand into a cross section larger in area than said midpoint axial cross section . sats - 4 . the sats of any of sats - 1 to sats - 3 wherein a shape of said expanded distal end is selected from the group consisting of a flared end , a flower like end , at least one petal - shaped element , at least one petal shaped end terminating in a square , frayed rope , and combinations thereof . sats - 5 . the sats of sats - 1 wherein said midpoint axial cross - section is in the shape of a cross . sats - 6 . the cross - shaped sats of sats - 5 comprised of five sections , a central core , and four appendage sections in contact with said central core , said five sections being substantially similar in shape and area and in the form of squares , said four appendage sections each being positioned at 0 degrees , 90 degrees , 180 degrees and 270 degrees , respectively . sats - 7 . the cross - shaped sats of sats - 5 comprised of at least four sections (“ n ”), one of said sections being a central core , and the remaining appendage sections (“ n − 1 ”) in contact with said central core , said remaining (“ n − 1 ”) sections being substantially similar in shape and area , and being positioned at positions in contact with said core , and equidistant from each other by an angular amount determined by the formula ( 360 degrees /( n − 1 ))= angular amount . sats - 8 . the cross - shaped sats of any of sats - 5 to sats - 7 wherein the central section of said cross is hollow . sats - 9 . the cross - shaped sats of any of sats - 5 to sats - 7 wherein the central section of said cross is solid . sats - 10 . the sats of sats - 1 having a cavity therein in the shape of the sats . sats - 10 . the sats of sats - 1 having a cavity therein in a different shape than the sats . sats - 11 . the sats of sats - 1 having a cavity with a cross - sectional area comprising 50 % to 90 % of the cross - sectional area of the sats . sats - 12 . the sats of sats - 1 having a cavity with a cross - sectional area comprising 10 % to 50 % of the cross - sectional area of the sats . sats - 13 . the sats of sats - 1 with a cross - sectional area , the longest linear dimension of which taken in any direction being less than about 25 microns . sats - 14 . the sats of sats - 1 with a cross - sectional area , the longest linear dimension of which taken in any direction being less than about 50 microns . sats - 15 . the sats of sats - 1 with a cross - sectional area , the longest linear dimension of which taken in any direction being less than about 100 microns . sats - 16 . the sats of sats - 1 having an ultimate tensile strength of 20 , 000 psi . sats - 17 . the sats of sats - 1 having a distance from proximal end to distal end of at least 3 millimeters . array - 1 . an array of at least 4 sats of any of the preceding ( sats ) claims in a 2 × 2 configuration . array - 2 . the array of array - 1 wherein the sats are in contact with each other . array - 3 . the array of array - 1 wherein the sats are circular in cross section and are separated from each other in every direction by a distance at equal to or greater than their diameter . array - 3 . the array of array - 1 wherein the sats are square in cross section and are separated from each other in every direction by a distance at equal to or greater than their edge dimension . the quad array . an array of at least 4 cross - shaped sats in a 2 × 2 configuration , each of said at least 4 cross - shaped sats comprised of five sections , a central core , and four appendage sections in contact with said central core , said five sections being substantially similar in shape and area and in the form of squares , said four appendage sections each being positioned at 0 degrees , 90 degrees , 180 degrees and 270 degrees , respectively , and wherein an axis taken through the center of the 0 degree and 180 degree appendage of one of said sats is aligned with an axis taken through the center of the 0 degree and 180 degree appendage of an adjacent sats , and said 0 degree appendage is in contact with said 180 degree appendage of said adjacent cross - shaped sats , and wherein an axis taken through the center of the 90 degree and 270 degree appendage of one of said sats is aligned with an axis taken through the center of the 90 degree and 270 degree appendage of an adjacent sats , and said 90 degree appendage is in contact with said 270 degree appendage of said adjacent cross - shaped sats , thus forming a square shaped cavity central to said array having an area four times the area of an appendage . the quad array 2 . the quad array having a greater stress versus deflection compressive stiffness of at least 20 %, relative to a non - sats control array , beginning at about 20 mpa of stress and continuing to at least about 50 mpa . the quad array 3 . the quad array having fracture behavior wherein the fracture appears at a 45 degree angle and spreads through said array in a diagonal direction and through diagonally oriented cross - shaped sats and travels outside the area of applied force . a method of producing a self - assembled tube structure ( sats ), said sats comprising an elongate body comprising a plurality of carbon nanotubes , said elongate body having a longitudinal axis and a proximal end and a distal end opposite said proximal end , said proximal end attached to said substrate either directly or indirectly ( indirectly = attached to the substrate by non sats material ), said sats being either hollow ( having a central cavity ) or solid , said sats being generally symmetrical around said longitudinal axis , said method comprising the steps of : providing a prepared substrate in a reaction zone introducing a catalyst into said reaction zone , said catalyst functioning to build said sats providing a source of carbon into said reaction zone providing an atmosphere of shield gas into said reaction zone to keep oxygen away from said reaction zone , and providing heat to said reaction zone , wherein at least one sats is produced . the method of producing sats wherein said prepared substrate is a silicon substrate with silicon particles distributed thereon . the method of producing sats wherein said prepared substrate is a silicon substrate having channels and towers and is prepared by deep reactive ion etching . the method of producing sats wherein said carbon source and said catalyst are combined and are selected from the group consisting of ferrocene and metallocene , and are in solution , said solution being introduced into said reaction zone by atomization . the method of producing sats wherein said atomization is performed by an ultrasonic device . the method of producing sats wherein said reaction zone is a tubular furnace . the method of producing sats wherein the temperature measured at the substrate is in the range of 800 degrees c . to 850 degrees c . the method of producing sats wherein the temperature measured at the substrate is about 820 degrees c . the method of producing sats wherein said shield atmosphere is selected from the group consisting of hydrogen , helium , argon and nitrogen . the abstract of the disclosure is provided to comply with the rules requiring an abstract that will allow a searcher to quickly ascertain the subject matter of the technical disclosure of any patent issued from this disclosure . ( 37 cfr § 1 . 72 ( b )). any advantages and benefits described may not apply to all embodiments of the invention . while the invention has been described in terms of some of its embodiments , those skilled in the art will recognize that the invention can be practiced with modifications within the spirit and scope of the appended claims . for example , although the system is described in specific examples for growing sats , it may be used for producing any type of cnts that may be useful in such diverse applications as electronics , medical devices and treatment , security systems , military systems and the like . in the claims , means - plus - function clauses are intended to cover the structures described herein as performing the recited function and not only structural equivalents , but also equivalent structures . thus , although a nail and a screw may not be structural equivalents in that a nail employs a cylindrical surface to secure wooden parts together , whereas a screw employs a helical surface , in the environment of fastening wooden parts , a nail and a screw may be equivalent structures . thus , it is intended that all matter contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative rather than limiting , and the invention should be defined only in accordance with the following claims and their equivalents .	8
the present invention provides a novel synthesis of irbesartan and analogues thereof , including the step of reacting a 2 -( 5 - tetrazoyl ) phenylboronic acid with a 3 -( haloaryl )- 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one . the step is carried out in the presence of a palladium or nickel catalyst . such a synthetic step is known by one of skill in the art as a suzuki coupling reaction . see , e . g ., n . miyaura et al ., tetrahedron letters 1979 , 3437 . see also , n . miyaura , a . suzuki , chem . commun . 1979 , 866 . the step can be carried out in a two - phase reaction system having first and second liquid phases . the first and second phases include first and second solvents , respectively , which are substantially immiscible in each other so that , when combined in a reaction vessel , a two - phase system is formed . solvents are substantially immiscible in each other when equal volumes of them are mixed together , a two - phase system is formed in which the volume of the two phases is essentially equal . preferably , substantially immiscible solvents are soluble in each other to the extent of about 1 % ( weight basis ) or less . the first solvents are organic solvents . examples of preferred organic solvents include , but are not limited to : ether solvents such as 1 , 2 - dimethoxyethane ( dme ), diethoxymethane , ( glymes ), and tetrahydrofuran ( thf ); formals such as diethyl formal ; and hydrocarbon solvents such as , toluene , m - xylene , o - xylene , the tetralins ; and mixtures of any of the foregoing . other hydrocarbons useful as first solvents in the practice of the present invention will be apparent to the skilled artisan . diethyl formal is the preferred formal . 1 , 2 - dimethoxyethane ( dme ) is the preferred glyme and is particularly preferred as an ether first solvent , especially in combination with thf when the catalyst includes a palladium complex . the second solvent can be water , or , preferably , an inorganic base combined with water . when an inorganic base is used , the preferred inorganic base is potassium carbonate . potassium hydroxide and sodium hydroxide are other examples of inorganic bases . the novel synthesis of irbesartan , and analogues thereof , of the present invention includes the step of reacting a protected ( e . g . tritylated ) 2 -( 5 - tetrazoyl ) phenylboronic acid with a 3 - haloaryl - 1 , 3diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one . a preferred 2 -( 5 - tetrazoyl ) phenylboronic acid is 2 -( 5 -( 1 - trityl - 1h - tetrazole )) phenylboronic acid ( irb - 07 ), structure ii . a preferred 3 - haloaryl - 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 3 - 4 - one is 2 - butyl - 3 -( 4 ′- bromobenzyl )- 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 3 - one ( irb - 05 ), structure iii . the step is carried out in a two - phase reaction system having first and second liquid phases . a catalyst is combined with the first liquid phase , preferably including an ether solvent . any known catalyst for the suzuki reaction can be used . preferably , the catalyst is selected from palladium and nickel complexes . most preferred catalysts include pd ( o ( o ) cch 3 ) 2 , pdcl 2 and nicl 2 . when a palladium complex such as pd ( o ( o ) cch 3 ) 2 [ e . g . pdoac 2 ] is used , the catalyst also includes a triaryl phosphine , especially triphenyl phosphine . when the catalyst includes a palladium complex , the first solvent preferably includes an ether solvent , like dme , that can form a complex with pd . as described above , the first liquid phase is an organic solvent phase , most preferably and particularly when the catalyst includes a palladium complex , the first liquid phase is a mixture of 1 , 2 - dimethoxyethane and thf . the ratio of 1 , 2 - dimethoxyethane : thf can be from about 10 : 1 to about 1 : 5 , the most preferred ratio of 1 , 2 - dimethoxyethane : thf is from about 6 : 1 to about 2 : 1 . the reaction is carried out in the presence of a catalyst . subsequently , irb - 07 is combined with the solvent mixture . water , a base , and irb - 05 are added , preferentially sequentially , to the reaction mixture , and a two - phase reaction system having a first organic solvent phase and a second aqueous phase is formed . the reaction mixture is heated under reflux conditions for a reaction time of between 2 to 4 hours . after the reaction time , the reaction mixture is allowed to cool , and the two phases are separated . if desired , the aqueous phase can be extracted one or more times with toluene and the extract ( s ) combined with the first ( aromatic hydrocarbon ) phase . the first phase is evaporated to obtain crude residue of product irb - 03 . in embodiments in which 2 -( 1 - trityl - 1h - tetrazol - 5 - yl ) phenylboronic acid , ( irb - 07 ), is the phenylboronic acid , the synthetic method of the present invention can and preferably does include a further step in which the trityl group is cleaved from the tetrazole ring to produce irbesartan ( irb - 00 ), or an analogue thereof . crude residue produced in the synthetic step described above is dissolved in a suitable water - miscible solvent . a solvent is water miscible if it is miscible with water at least in any proportion from 80 : 20 to 20 : 80 ( weight basis ). acetone is a preferred water - miscible solvent . the resulting solution is acidified and agitated at a temperature between about 15 ° c . and about 30 ° c . the time of the cleavage reaction can be conveniently monitored using thin layer chromatography . the acid is neutralized with a molar excess of base , preferably aqueous koh or naoh , and the water - miscible solvent is evaporated , preferably at reduced pressure . the trityl alcohol formed is separated and the liquid phase is acidified ( e . g . to a ph of about 4 ), preferably with mineral acid , most preferably with hcl or h 2 so 4 . the resulting suspension is cooled and the product recovered by , for example , filtration . if desired , the isolated product can be washed with an organic solvent , preferably a lower aliphatic alcohol , most preferably iso - propanol or butanol , and dried , preferably at reduced pressure . the 2 -( 5 - tetrazoyl ) phenylboronic acid and 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 3 -( haloaryl )- 4 - one which are reacted in the method of the present invention to produce irbesartan or an analogue thereof , can be prepared by methods known in the art , or by the following synthetic procedures . the 2 -( tetrazol - 5 - yl ) phenylboronic acid can be prepared by first reacting a 5 - phenyl - 1h - tetrazole with chlorotriphenylmethane in the presence of a base , especially an amine ( e . g . triethylamine ) in a suitable solvent system to provide a 5 - phenyl - 1 - trityl - 1h - tetrazole . a preferred 5 - phenyl - 1 - trityl - 1h - tetrazole is irb - 06 ( structure shown in examples ). suitable solvents for the solvent system include organic solvents . a particularly preferred solvent system is a mixture of thf and triethyl amine as the base . following removal of by - products , the 5 - phenyl - 1 - trityl - 1h - tetrazole , such as irb - 06 , can be isolated prior to use in the next step of the synthesis , or used in solution form . the protected tetrazole so formed is subsequently reacted with a suitable borate in the presence of a base , to form the desired boronic acid derivative , such as 2 -( 1 - trityl - 1h - tetrazol - 5 - yl ) phenylboronic acid ( irb - 07 ; structure shown in examples ). the reaction is carried out in solution , preferably in an organic solvent . the organic solvent is most preferably thf . suitable bases will be apparent to the skilled artisan . a preferred base is butyllithium . the preparation can be at any suitable temperature , preferably at a temperature lower than about − 20 ° c . the reaction is allowed to proceed for a time that the skilled artisan will know to adjust according to the reaction temperature . the 3 - haloaryl - 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one can be prepared by combining a 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one acid addition salt , preferably a hydrochloride salt , with a haloaryl compound . a preferred 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one acid addition salt is 2 - butyl - 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one hydrochloride ( irb - 01 ). a preferred haloaryl compound is 4 - bromobenzyl bromide . reaction of 2 - butyl - 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one hydrochloride ( irb - 01 ) with 4 - bromobenzyl bromide leads to the production of 2 - butyl - 3 -( 4 ′- bromobenzyl )- 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one ( irb - 05 ). 2 - butyl - 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one is known in the art and is disclosed , for example , in u . s . pat . no . 5 , 559 , 233 , which is incorporated herein by reference . the reaction is carried out in a two - phase reaction system having first and second liquid phases . a first liquid phase comprising the haloaryl compound and a phase transfer catalyst in a suitable solvent is prepared . the solvent may be an organic solvent . a most preferred solvent is toluene . phase transfer catalysts are well known to one skilled in the art of organic synthesis . phase transfer catalysts are of particular utility when at least first and second compounds to be reacted with each other have such different solubility characteristics that there is no practical common solvent for them and , accordingly , combining a solvent for one of them with a solvent for the other of them results in a two - phase system . typically , when such compounds are to be reacted , the first reactant is dissolved in a first solvent and the second reactant is dissolved in a second solvent . because the solvent for the first reactant is essentially insoluble in the solvent for the second reactant , a two - phase system is formed and reaction occurs at the interface between the two phases . the rate of such an interfacial reaction can be greatly increased by use of a phase transfer catalyst ( ptc ). several classes of compounds are known to be capable of acting as phase transfer catalysts , for example quaternary ammonium compounds and phosphonium compounds , to mention just two . tetrabutylaminonium hydrogensulfate is a preferred ptc for use in the practice of present invention . a second liquid phase comprising a 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one acid addition salt , water and a base , preferably an inorganic base , most preferably , koh . the base is present in an amount between about 1 and about 6 molar equivalents relative to the number of moles of 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one acid salt . the first and second solutions are combined to form a reaction system ( mixture ) that has first and second phases . the combining can be in any suitable vessel that is equipped with means for vigorous agitation of the reaction system to maximize the interfacial area between the two phases . the combining can be at any temperature from about 20 ° c . to about 95 ° c ., preferably at about 90 ° c . the reaction is allowed to proceed in the two phase system for a time that the skilled artisan will known to adjust according to the reaction temperature . when the reaction temperature is about 90 ° c ., a reaction time between about 1 and about 2 hours is usually sufficient . after the reaction time , the reaction system is allowed to cool , the two phases are separated . if desired , the aqueous phase can be extracted one or more times with toluene and the extract ( s ) combined with the first ( aromatic hydrocarbon ) phase . the first phase is evaporated to obtain crude residue . the present invention can be illustrated in one of its embodiments by the following non - limiting example . to a preheated ( 90 ° c .) solution of 4 - bromobenzyl bromide and phase transfer catalyst ( bu 4 nhso 4 ) in toluene was added a prestirred ( 40 min at room temperature ) solution of koh and irb - 01 in water . the resulting two - phase mixture was heated for 1 hour at 90 ° c . with vigorous stirring . the mixture was cooled to room temperature , water ( 500 ml ) was added and the mixture was stirred for additional 30 min . the phases were separated and the aqueous phase was extracted with an additional portion of toluene ( 100 ml ). the combined organic portions were washed with water and brine , dried over na 2 so 4 and evaporated under reduced pressure . 74 . 0 g of irb - 05 was obtained as a colorless oil . the yield was 94 %, with a purity of 94 %. to a solution of 5 - phenyl - 1h - tetrazol and triethylamine in dry thf was added , in one portion , chlorotriphenylmethane . the reaction was slightly exothermic , about 40 ° c . the resulting suspension was stirred under argon for 2 hours ( tlc monitoring ; hex / etoac 4 : 1 ). the mixture was cooled to 0 ° c ., stirred for 30 min and the precipitated triethylammonium chloride was filtered and washed with cold thf ( 100 ml ). the filtrate was evaporated under reduced pressure and the yellow solid residue ( approx . 180g ) was crystallized from acetonitrile ( 800 ml ) to give 141 . 5 g . the yield was 94 %, with a purity of 94 %. the solution of 5 - phenyl - 1 - trityl - 1h - tetrazole ( irb - 06 ) in dry thf ( prepared in example 1b ) was cooled to − 20 ° c . under argon . traces of water were quenched with n - butyllithium ( approx . 5 ml ). when the mixture remained red for 5 minutes the addition was stopped . the main charge of n - butyllithium was then added dropwise at temperature below − 15 ° c . and the resulting red suspension was stirred for additional 30 minutes at − 20 ° c . the mixture was cooled to − 30 ° c ., and triisopropyl borate was slowly added , with the reaction temperature maintained at below − 20 ° c . at this point , the slurry was dissolved and the resulting red solution was stirred for 30 minutes at − 25 ° c ., and then warmed to room temperature over 40 minutes . the solvents were evaporated under reduced pressure and the yellow semisolid residue was extracted with isopropyl alcohol ( ipa ) ( 200 ml ) and cooled to 0 ° c . saturated aqueous nh 4 cl ( 40 ml , approx . 180 mmol ) was slowly added , keeping the temperature below 10 ° c ., and the slurry of boronic acid was warmed to room temperature . water ( 160 ml ) was added over 20 minutes , and the resulting suspension was stirred for 2 hours at room temperature . the solid was filtered , washed with ipa / h 2 0 / et 3 n 50 : 50 : 2 ( 2 × 50 ml ) and dried under reduced pressure at 40 ° c . until constant weight to give 47 . 0 g of irb - 07 as the 1 : 0 . 5 thf - h 2 o solvate ( off - white solid ) that was used without additional purifications . the yield was 92 %, with a purity of 94 . 5 %. a mixture of dme and thf was degassed by vacuum / nitrogen purges ( 3 times ) and ph 3 p was added in one portion . after the triphenylphosphine dissolved , pd ( oac ) 2 was added , and the yellow - green mixture was degassed again ( 2 times ), and stirred for 30 min at room temperature . irb - 07 was suspended , and stirring was continued for 10 min at room temperature . the water was added , and the slurry was stirred for additional 30 min . powdered k 2 co 3 and irb - 05 were then added sequentially and the resulting mixture was degassed ( 3 times ), and refluxed ( approx . 80 ° c .) for 3 hours ( tlc monitoring : hex / etoac 2 : 1 ). the solvents were evaporated under reduced pressure , and toluene ( 20 ml ) and water ( 20 ml ) were added . after separation , the aqueous phase was extracted with toluene ( 10 ml ) and the combined organic phases were washed with water and brine , dried over na 2 so 4 and evaporated under reduced pressure to give 2 . 1 g of the semisolid residue . the crude material was crystallized from ipa ( 15 ml ) to give 1 . 6 g of irb - 03 as a white solid . the yield was 90 %, with a purity of 98 %. irb - 03 ( as produced in example 1d ) was dissolved in acetone and 3n hcl , and stirred for 2 hours at room temperature ( tlc or hplc monitoring ). a solution of koh in 3 ml of water was slowly added , and acetone was evaporated under reduced pressure . the precipitate ( trityl alcohol ) was filtered and washed with water ( 2 × 5 ml ). the combined aqueous filtrate washed with 5 ml of ethyl acetate , and slowly acidified to ph 4 with 3n aqueous hcl . the resulting suspension was cooled down to 0 - 4 ° c ., stirred for additional 30 min and filtered . the cake was washed several times with water and dried under reduced pressure at 50 - 60 ° c . the yield was 0 . 58 g of irb - 00 .	2
fig1 - 9 show an apparatus 1 for minimising bunching or entanglement of any elongate means ( unit ) 2 which can be used in combination with a retracting and extending mechanism 3 which can retrofitted or made in combination therewith . apparatus 1 for minimising bunching or entanglement includes a support means ( unit ) and moving means ( unit ). the support means can include at least one first shaft 4 having a length and defining a first rotating axis . the moving means ( unit ) includes at least one or two rollers 5 & amp ; 6 . first shaft 4 is adapted to be stationary and rollers 5 & amp ; 6 are adapted to be rotatably supported by shaft 4 such that in use , the rollers 5 & amp ; 6 are able to slideably move about the shaft axis parallel to the length , in response to movement of the elongate means 2 . each roller 5 & amp ; 6 as shown in fig6 & amp ; 7 includes a groove portion that can be circumferential groove 8 being adapted and constructed to receive and guide an elongate means ( unit ). groove 8 can be at least part way circumferential in extent . the elongate means ( unit ) 2 can be any type of elongate means that enables an object to be pulled / retracted or extended . typically elongate means can be a cable or wire or rope and the object to be pulled or extended can be a cover 9 such as a pool cover or an awning for a building / shelter . in this example the elongate means can be a flexible elongate means ( unit ) in the form of a cable or rope attachable to the cover as two separate lengths 10 and 11 . the apparatus 1 for minimising bunching or entanglement can be attached to any retractable or extendable mechanised cover system 3 . typically cover 9 can be rectangular in shape having sides and ends . other cover shapes are equally possible . each side of the cover can have at least one cable 10 and 11 attached to each side of the cover such that there are two separate cable lengths . the apparatus 1 for minimising bunching or entanglement as described is adapted to be retro - fitted or combined with an existing retractable and extending cover mechanism 3 . apparatus 1 can be sold as a kit for ready attachment by way of attachment means . the retractable and extending cover mechanism 3 can include an activating means 12 , support 13 , a cable retracting means and extending means and locating means 15 . activating means ( unit ) 12 can comprise a motor or similar with the operating means ( unit ) being any system that can operate the motor . for example this can be electricity , both mains or portable , a fuel based system , solar or wind or hydraulics or pneumatics system . support 13 can include any suitable structure like for example a housing 16 having a frame 17 and bracketing 18 which can be suitably removably connected together in any shape or dimensions as required . locating means 15 includes at least one guide roller ( 19 , 20 , 21 ) rotatable fixedly mounted on separate support shafts ( not shown ) which is not rotatable but in other options may be rotatable . fig1 and 2 show the cable guide having for example three rollers 19 - 21 . the cable retractable and extendable mechanism 3 includes a driving shaft 30 having at least two pulleys 31 & amp ; 32 mounted thereon . other features can also be included with the mechanism 3 such as a drum 33 mounted on the drive shaft 30 for the cover or covers 9 . the drive shaft 30 having a motor end 34 and non motor end 35 . an electrical limit switch 36 with chain sprocket 37 can be located at the non motor end 35 of the drive shaft 30 . there can also be fixing brackets 38 to support the non motor end of the drive shaft 30 . at the motor end 34 of the drive shaft 30 the motor 12 can be operatively connected to a gear box 39 , which is operatively connected to a housing 40 having within , locking collars 41 , cable pulleys 31 , 32 , a 3 - pin male dog clutch 42 and 3 - pin female dog clutch 43 being operatively connected to the apparatus for minimising bunching and entanglement of elongate means 1 or a rope retainer ( see fig3 , 4 and 5 ). other parts or components can be included as is necessary to enable the drive shaft to work such as bearings 44 and drums 45 . the bunching and entangling apparatus shaft 4 can also be positioned parallel to the other drive shaft 20 placing the apparatus 1 on the side of the housing and guide means being positioned on top of the housing . in use the cable has a distal end when compared to the apparatus which is removably anchored to the distal end of the cover . the size of the cover can also have slideable attachment means to the cable — not shown . the proximal cable end can be located on each pulley via and in consecutive order through each guide roller through to the bunching entanglement apparatus roller through to a respective adjacent pulley . the pulley can be activated by activating the motor which rotates the pulley drive shaft in either a clockwise or anti - clockwise direction . normally both pulleys will be activated to rotate in a similar direction such that the cable and hence the cover can either be retracted or extended . in another aspect of the mechanism the distal end of the cable can have a further roller support device ( not shown ) which enables the cover to slideably move either in a retracted or extending orientation by virtue or roller supports that are supported by the sides of a pool if it is a pool cover or by a tracking system ( not shown ) if we are using the apparatus in an awning . in other variations there can be extra rollers per shaft if the cover is of certain dimensions . also the mechanism or the apparatus can have further framing parts that enable shafts to be correctly supported while not moving . there can also be further devices which enable the apparatus to be remotely controlled through wire or wireless operation . the apparatus is also designed to be retrofitted to existing retracting and extendable pool cover mechanisms . the rollers can be made from any suitable material such as nylon or teflon . apparatus 1 for minimising bunching and or entanglement as shown in fig4 and 5 includes a guard structure or rope retainer 50 that can be used to movably hold elongate means 2 in groove 8 for each and or both rollers . this is especially important when the elongate means is not in tension when being retracted or extended though equally at any other point whenever the elongate means is in tension . the guard or rope or elongate means retainer 50 includes a shaft attaching portion 51 and holding portion 52 . attaching portion 51 can have apertures shaped to receive shaft 4 . holding portion 42 can include an elongate portion shaped to be able to cover groove 8 of each roller 5 and or 6 . for example holding portion 52 can be a strip or angled or elongate member and attaching portion 51 can be at least one ring shaped members 53 , 54 and 55 . other means of attachment to the shaft are equally possible as long as the elongate means is held in place in the groove 8 . the strip member can be curved as shown in fig4 , to match the outer surface of the roller 5 or 6 and rings 53 , 54 and 55 and better hold the elongate means in place . the strip member can be affixed to the rings both removably or permanently by welding for example . the apparatus for minimising bunching and or entanglement can be attached to any other mechanism . the apparatus can be designed to include remote and or automatic control such that the cover can always be automatically extended to provide a safe barrier to unwanted trespassers , thereby negating the need for expensive pool fencing . in this regard the cover can be designed to allow walking thereon . as the apparatus provides minimal entanglement or bunching and an even tension in any extending or retracting of cover cabling , this type of cover is then adapted to be easily and dependably extended or retracted . the apparatus for minimising bunching and or entanglement can include sensors 56 which serve to facilitate automatic operation , whereby non - use or unwanted use of the pool for a specified time period can be prevented . in operation the apparatus or motor can be initiated to start and extend the pool cover to completely cover the pool or water . this feature enables the pool to always be covered and be an alternative or addition to pool fencing . additionally security coding can also be used in combination with the apparatus , to further secure the pool against unwanted use . for example , the sensors can be heat or movement activated and can be set up to extend or retract the cover . in another aspect there is a method of inserting a cable via the apparatus 1 to minimise tangling and bunching . the method may include feeding the cable ( s ) via a guide and then through the retracting and extending apparatus followed by going through and being supported by the apparatus 1 and back to the cover . other variations of this method of installation are equally possible such as feeding the cable in a different order as described . to those skilled in the art to which the invention relates , many changes in construction and widely differing embodiments and applications of the invention will suggest themselves without departing from the scope of the invention as defined in the appended claims . the disclosures and the description herein are purely illustrative and are not intended to be in any sense limiting . throughout the description and claims of this specification the word “ comprise ” and variations of that word , such as “ comprises ” and “ comprising ”, are not intended to exclude other additives , components , integers or steps . the apparatus and method for minimising bunching and or entanglement and / or retracting or extending mechanism can have some of the following advantages : 1 . simple operation . 2 . reduced maintenance . 3 . quick operation . 4 . safe operation . 5 . less likelihood of twisting covers . 6 . retro - fitting is possible . 7 . able to be included in new machines during manufacture . 8 . able to be sold as a kit . 9 . few parts . 10 . modest cost of manufacture . 11 . automatic control . 12 . dependable long life .	1
in order to reduce the time it takes to add a fluid to a dispensing container , a flexible container having a flexible pouch with a valve assembly is provided for refilling a dispensing container . the fluid in the flexible pouch can pass from the flexible pouch through the valve assembly into the dispensing container . the flexible pouch of the dispensing container provides an improved manner of transferring a viscous liquid or fluid to a dispensing container . with the valve assembly open , the flexible pouch may be squeezed , there by applying pressure to the viscous fluid invoicing the same through the opening valve assembly into the dispensing container , which is attached to the valve assembly . with a flexible refilling container , transportation is greatly simplified , whether the container is or empty . with the flexible refilling container being shipped as full , such flexibility permits more compact shipping in that more containers can be stored or shipped in the same shipping space . also , when empty , this flexible refilling container is even more compact and can be shipped in less space . thus , the empty containers are more easily transported for either recycling or reuse . clearly such containers can also be refilled if desired . in a preferred form , the valve assembly provides for a secure attachment to a dispensing container . the squeezing of flexible pouch permits fluid to be forced from flexible container out of flexible pouch through valve assembly into a dispensing container . by the same token , the valve assembly further permits securing so that the flexible refilling container may itself be a dispensing container and have a plurality of uses as a refilling container . also in a preferred form , the valve assembly attached to the flexible refilling container has a vent passage . this debt passage permits entry of air into the transfer area of the fluid passing between the flexible container and the dispensing container . a further preferred valve assembly is one - piece . the one - piece valve may be formed by injection molding . such formation minimizes the assembly requirements of the valve assembly . it is also possible for both an accumulated valve , or a washer valve to be injection molded , but supported by a washer . referring now to fig1 flexible refilling container 100 has accumulated valve assembly 120 mounted on flexible pouch 150 . accumulated valve assembly 120 combines with flexible pouch 150 in order to permit a release of a desired amount of fluid from the flexible pouch 150 . adding fig2 to the consideration , valve assembly 120 has a connector cap 122 with a spout 124 extending therefrom . spout 124 communicates with flexible pouch 150 through connector cap 122 . closing cap 128 fits over spout 124 onto male spout threads 130 . closing cap 128 includes female cap threads 132 . clearly female cap threads 132 can be attached to or released from male spout threads 130 as desired . with fig3 additionally considered , spout 124 is closed with cap 128 . connector cap 122 is held in place between spout base 136 and neck base support 172 , thereby allowing connector cap 122 to turn freely . adjacent to spout base 136 is washer gasket 140 . neck base nozzle 174 is secured to spout 124 , by glue , sonic weld or another suitable bonding system . washer gasket 140 seals the connection between refilling pouch 100 and dispensing container 110 of fig5 . from male spout threads 130 extends spout 124 . spout 124 communicates with flexible pouch 150 and permits refilling of dispensing container 110 . from fig4 a fixed seal 154 can close spout 124 . with cutting device 152 , fixed seal 154 can be separated from spout 124 and permit flow from flexible refilling container 100 to dispensing container 110 of fig5 . with fig5 and fig6 the connection of flexible refilling pouch 100 to dispensing container 110 can be seen . such a tight seal is due to the gasket 140 with the structure of accumulated valve assembly 120 . female valve threads 160 are secured to male dispensing container threads 162 , thereby providing a tight seal as required . in fig6 and fig7 the connection of flexible refilling pouch 100 is assisted by base vent 176 . in this manner , the vacuum created by the fluid transfer is minimized . with fig7 showing an exploded view of valve assembly 120 , the structure becomes even more clear . neck base 170 is secured to flexible pouch 150 , and provides support for the balance of accumulated valve assembly 120 to the secured thereto . connector cap 140 fits over neck base 170 and onto neck base support 172 and around that neck base nozzle 174 . over neck base nozzle 174 fits dispensing nozzle 162 . then , the gasket 140 and cap 160 may be attached in the previously described fashion . flexible pouch 150 is shown as opened with a first flap 180 and second flap 182 . first flap 180 can be folded over second flap 182 at fold 184 . opposite fold 184 is first seal 186 . adjacent to first seal 186 is base seal 188 to close bottom 190 of flexible pouch 150 . top seal 192 receives accumulated valve assembly 120 and seals flexible pouch 150 therearound . more specifically , neck base 170 both receives top seal 192 and locks the accumulated valve assembly 120 in flexible pouch 150 . thus , flexible refilling container 100 can be completely emptied and reused . turning now to fig8 and fig9 washer valve assembly 200 has a structure similar to accumulated valve assembly 120 . however , instead of the variety of pieces for accumulated valve assembly 120 attachable to flexible pouch 150 in order to form flexible refilling container 100 , washer valve assembly 200 is injected molded or otherwise shaped to form all elements of accumulated valve assembly 120 . if desired , washer valve assembly 200 has inserted therein a vented gasket 202 . vented gasket 202 has a vent aperture 204 which aligns with housing aperture 206 and threaded base 208 . the threaded base 208 forms a top portion of threaded attachment 210 , which secures washer valve assembly 200 to dispensing container 110 . fig1 and fig1 combined to show the preferred unitary valve assembly 230 attachable to flexible pouch 150 in order to form flexible refilling container 100 of this invention . this unitary valve assembly 230 may simply be molded and requires no assembly or insertion of any washer . the structure of this unitary valve assembly 230 is similar to accumulated valve assembly 120 . however , with the one step molding process , no assembly is required . the structure present in the accumulated valve assembly 120 is provided by the structure of the mold . this application — taken as a whole with the abstract , specification , claims , and drawings being combined — provides sufficient information for a person having ordinary skill in the art to practice the invention as disclosed and claimed herein . any measures necessary to practice this invention are well within the skill of a person having ordinary skill in this art after that person has made a careful study of this disclosure . because of this disclosure and solely because of this disclosure , modification of this method and device can become clear to a person having ordinary skill in this particular art . such modifications are clearly covered by this disclosure .	1
we consider the problem of controlling a team of n planar auvs to collaboratively track the material lines that separate regions of flow with distinct fluid dynamics . this is similar to the problem of tracking the stable ( and unstable ) manifolds of a general nonlinear dynamical system where the manifolds separate regions in phase space with distinct dynamical behaviors . we assume the following 2d kinematic model for each of the auvs : where x i =[ x i , y i ] t is the vehicle &# 39 ; s planar position , v i and θ i are the vehicle &# 39 ; s linear speed and heading , and u i =[ u i , v i ] t is the velocity of the fluid current experienced / measured by the i th vehicle . additionally , we assume each agent can be circumscribed by a circle of radius r , i . e ., each vehicle can be equivalently described as a disk of radius r . in this work , u i is provided by a 2d planar conservative vector field described by a differential equation of the form in essence , u i = f x ( x i ) and v i = f y ( x i ). let b s and b u denote the stable and unstable manifolds of eq . ( 2 ). in general , b s and b u are the separating boundaries between regions in phase space with distinct dynamics . for 2d flows , b * are simply one - dimensional curves where * denotes either stable ( s ) or unstable ( u ) boundaries . for a small region centered about a point on b , the system is unstable in one dimension . finally , let ρ ( b ) denote the radius of curvature of b * and assume that the minimum of the radius of curvature ρ min ( b )& gt ; r . this last assumption is needed to ensure the robots do not lose track of the b due to sharp turns . the objective is to develop a collaborative strategy to enable a team of robots to track b * in general 2d planar conservative flow fields through local sampling of the velocity field . while the focus is on the development of a tracking strategy for b s , the method can be easily extended to track b u since b u are simply stable manifolds of eq . ( 2 ) for t & lt ; 0 . the method of the invention originates from the proper interior maximum ( pim ) triple procedure , h . e . nusse and j . a . yorke , “ a procedure for finding numerical trajectories on chaotic saddles ,” physica d nonlinear phenomena , vol . 36 , pp . 137 - 156 , 1989 ( hereinafter “ nusse et al .”)— a numerical technique designed to find stationary trajectories in chaotic regions with no attractors . while the original procedure was developed for chaotic dynamical systems , the approach can be employed to reveal the stable set of a saddle point of a general nonlinear dynamical system . the procedure consists of iteratively finding an appropriate pim triple on a saddle straddling line segment and propagating the triple forward in time . given the dynamical system described by eq . ( 2 ), let d ∈ r 2 be a closed and bounded set such that d does not contain any attractors of eq . ( 2 ). given a point x ∈ d , the escape time of x , denoted by t e ( x ), is the time x takes to leave the region d under the differential map given by eq . ( 2 ). let j be a line segment that crosses the stable set b s in d , i . e ., the endpoints of the j are on opposite sides of b s . let { x l , x c , x r } denote a set of three points in j such that x c denotes the interior point . then { x l , x c , x r } is an interior maximum triple if t e ( x c )& gt ; max { t e ( x l ), t e ( x r )}. furthermore , { x l , x c x r } is a proper interior maximum ( pim ) triple if it is an interior maximum triple and the interval [ x l , x r ] in j is a proper subset of j . then the numerical computation of any pim triple can be obtained iteratively starting with an initial saddle straddle line segment j 0 , let x t0 and x r0 denote the endpoints of j 0 and apply an ε 0 & gt ; 0 discretization of j 0 such that x l0 = q 0 & lt ; q 1 & lt ; . . . & lt ; q m = x r0 . for every point qi , determine t e ( q i ) by propagating q i forward in time using eq . ( 2 ). then the pim triple in j 0 is given by the points { q k − 1 , q k , q k + 1 } where q k = argmax i = 1 , . . . , m t e ( q i ). this pim triple can then be further refined by choosing j 1 to be the line segment containing { q k − 1 , q k , q k + 1 } and reapplying the procedure with another ε 1 & gt ; 0 discretization where ε 1 & lt ; ε 0 . given an initial saddle straddling line segment j 0 , it has been shown that the line segment given by any subsequent pim triple on j 0 is also a saddle straddling line segment [ h . e . nusse and j . a . yorke , “ a procedure for finding numerical trajectories on chaotic saddles ,” physica d nonlinear phenomena , vol . 36 , pp . 137 - 156 , 1989 .]. furthermore , if we use a pim triple x ( t )={ x l , x c , x r } as the initial conditions for the dynamical system given by eq . ( 2 ) and propagate the system forward in time by δt , then the line segment containing the set x ( t + δt ), j t + δt , remains a saddle straddle line segment . as such , the same numerical procedure can be employed to determine an appropriate pim triple on j t +≢ t . this procedure can be repeated to eventually reveal the entire stable set b s and unstable set b u within d if time was propagated forwards and backwards respectively . furthermore , since the procedure always begins with a valid saddle straddling line segment , by construction , the procedure always results in a non - empty set . building upon the pim triple procedure , as described below the invention utilizes a cooperative saddle straddle control strategy for a team of n ≧ 3 robots to track the stable ( and unstable ) manifolds of a general conservative time - independent flow field f ( x ). the invention differs from the pim procedure where it relies solely on information gathered via local sensing and shared through the network . in contrast , a straight implementation of the pim triple procedure necessitates global knowledge of the structure of the system dynamics throughout a given region given its reliance on computing escape times . consider a team of three robots and identify them as robots { l , c , r }. while the robots may be equipped with similar sensing and actuation capabilities , we propose a heterogeneous cooperative control strategy . let x ( 0 )=[ x l t ( 0 ), x c t ( 0 ), x r t ( 0 )] t be the initial conditions for the three robots . assume that x ( 0 ) lies on the line segment j 0 where j 0 is a saddle straddle line segment and { x l ( 0 ), x c ( 0 ), x r ( 0 )} constitutes a pim triple . similar to the pim triple procedure , the objective is to enable the robots to maintain a formation such that a valid saddle straddle line segment can be maintained between robots l and r . instead of computing the escape times for points on j 0 as proposed by the pim triple procedure , robot c must remain close to b s using only local measurements of the velocity field provided by the rest of the team . as such , we refer to robot c as the tracker of the team while robots l and r maintains a straddle formation across the boundary at all times . robots l and r may be thought of herding robots , since they control and determine the actions of the tracking robot . the controller for the straddling robots consists of two discrete states : a passive control state , u p , and an active control state , u a . the robots initialize in the passive state u p where the objective is to follow the flow of the ambient vector field . therefore , v i = 0 for i = l , r . robots execute u p until they reach the maximum allowable separation distance d max from robot c . when ∥ x i − x c ∥& gt ; d max robot i switches to the active control state , u a , where the objective is to navigate to a point p i on the current projected saddle straddle line segment ĵ i such that ,∥ p i − p c \|= d min and p c denotes the midpoint of ĵ i . when robots execute u a , v i =∥ p i − x i − u i ∥ and θ i ( t )= α i ( t ) where α i is the angle between the desired , ( p i − x i ), and current heading , u i , of robot i as shown in fig1 . in summary , the straddling control strategy for robots l and r is given by we note that while the primary control objective for robots l and r is to maintain a straddle formation across b s , robots l and r are also constantly sampling the velocity of the local vector field and communicating these measurements and their relative positions to robot c . robot c is then tasked to use these measurements to track the position of b s . let û l ( t ), û c , and û c ( t ) denote the current velocity measurements obtained by robots l , c , and r at their respective positions . let d (•,•) denote the euclidean distance function and assume that d ( x c , b s )& lt ; ε such that ε & gt ; 0 is small . given the straddle line segment j t such that x l ( k ) and x r ( k ) are the endpoints j t , we consider an ε t & lt ; ε discretization of j t such that x l = q 1 & lt ; q 2 & lt ; . . . & lt ; q m = x r . the objective is to use the velocity measurements provided by the team to interpolate the vector field at the points q 1 , . . . , q m . since eq . ( 2 ) has c l continuity and if x c is ε - close to b s , then the point q b = argmax k = 1 , . . . , m u ( q k ) t û c ( t ) should be δ - close to b s where ε & lt ; δ & lt ; a and a is a small enough positive constant . while there are numerous vector field interpolation techniques available ( j . c . agui and j . jimenez , “ on the performance of particle tracking ,” journal of fluid mechanics , vol . 185 , pp . 447 - 468 , 1987 , and e . j . fuselier and g . b . wright , “ stability and error estimates for vector field interpolation and decomposition on the sphere with rbfs ,” siam j . numer . anal ., vol . 47 , pp . 3213 - 3239 , 2009 ), we employ the inverse distance weighting method . for a given set of velocity measurements û i ( t ) and corresponding position estimates { circumflex over ( x )} i ( t ), the velocity vector at some point q k is given by where w ij =∥{ circumflex over ( x )} i ( j )− q i ∥ − 2 . rather than rely solely on the current measurements provided by the three robots , it is possible to include the recent history of û i ( t ) to improve the estimate of u ( q k ), i . e ., û i ( t − δt ), û i ( t − 2δt ), and so on , where δt is the sampling period and i ={ l , c , r }. thus , the control strategy for the tracking robot c is given by v c =∥[( q b + bû b )− x c ]− u c ∥ ( 4a ) where β c denotes the difference in the heading of robot c and the vector ( q b − û b ) and b & gt ; r is a small number . the term bû b is included to ensure that the control strategy aims for a point in front of robot c rather than behind it . as such , the projected saddle straddle line segment ĵ t at each time step is given by p c = q c + bu c with ĵ t orthogonal to b s at q c and ∥ ĵ t ∥ chosen to be in the interval [ 2d min , 2d max ]. regarding the implementation of the saddle straddle control strategy , we begin with the following key assumption on the robots &# 39 ; initial positions . assumption 1 given a team of three robots { l , c , r }, assume that d ( x c ,( 0 ), b s )& lt ; ε for a small value of ε & gt ; 0 , ∥ x l − x c ∥=∥\| x r − x ∥= d min with d min & gt ; 2r , and robots l and r are on opposite sides of b s . in other words , assume that the robots initialize in a valid pim triple formation and their positions form a saddle straddle line segment orthogonal to b s . our main result concerns the validity of the saddle straddle control strategy . theorem 1 given a team of 3 robots with kinematics given by eq . ( 1 ) and u i given by eq . ( 2 ), the feedback control strategy eq . ( 3 ) and eq . ( 4 ) maintains a valid saddle straddle line segment in the time interval [ t , t + δt ] if the initial positions of the robots , x ( t ), is a valid pim triple . the above theorem guarantees that for any given time interval [ t , t + δt ] the team maintains a valid pim triple formation . as such , the iterative application of the proposed control strategy leads to the following proposition . proposition 1 given a team of 3 robots with kinematics given by eq . ( 1 ) and u i given by eq . ( 2 ), the feedback control strategy results in an estimate of b s , denoted as { circumflex over ( b )} s , such that & lt ; b s , { circumflex over ( b )} s & gt ; l2 & lt ; w for some w & gt ; 0 where & lt ;•,•& gt ; l2 denotes the inner product ( which provides an l 2 measure between the b s and { circumflex over ( b )} s curves ). from theorem 1 , since the team is able to maintain a valid pim triple formation across b s for any given time interval [ t , t + δt ], this ensures that an estimate of b s in the given time interval also exists . applying this reasoning in a recursive fashion , one can show that an estimate of b s can be obtained for any arbitrary time interval . preferably , one also determines the bound on w such that { circumflex over ( b )} s results in a good enough approximation since w depends on the sensor and actuation noise , the vector interpolation routine , the sampling frequency , and the time scales of the flow dynamics . we illustrate the proposed control strategy given by eq . ( 3 ) and eq . ( 4 ) with the following simulation results . fig2 a shows the trajectories of three robots tracking a sinusoidal boundary while fig2 b shows the team tracking a 1d star - shaped boundary . we note that throughout the entire length of the simulation , the team maintains a saddle straddle formation across the boundary . in both examples , u =− a ∇ φ − b ∇× ψ where a , b & gt ; 0 and •( x ) is an artificial potential function such that φ ( x )= 0 for all x ∈ b • and φ ( x )& lt ; 0 for any x ∈ r 2 / b •. the vector ψ is a 3 × 1 vector whose entries are given by [ 0 , 0 , γ ( x , y )] t where γ ( x , y ) is the curve describing the desired boundary . lastly , the estimated position of the boundary is given by the position of the tracking robot , i . e ., robot c . in these examples , we filtered the boundary position using a simple first - order low pass filter . we also implemented the control strategy on our multi - robot testbed . the testbed consisted of three msrv - 1 robots in a 4 . 8 × 5 . 4 meter workspace . the msrv - 1 are differential - drive robots equipped with an embedded processor , color camera , and 802 . 11 wireless capability . localization for each robot was provided via a network of overhead cameras . fig3 a shows the trajectories of the robots tracking a star shaped boundary . fig3 b is a snapshot of the experimental run . next , we consider the system of 3 robots with kinematics given by eq . ( 1 ) where u i is determined by the wind - driven double - gyre flow model with noise when ε = 0 , the double - gyre flow is time - independent , while for ε ≠ 0 , the gyres undergo a periodic expansion and contraction in the x direction . in eq . ( 5a - c ), a approximately determines the amplitude of the velocity vectors , ω / 2π gives the oscillation frequency , ε determines the amplitude of the left - right motion of the separatrix between the gyres , ψ is the phase , μ determines the dissipation , s scales the dimensions of the workspace , and η i ( t ) describes a stochastic white noise with mean zero and standard deviation σ =√{ square root over ( 2i )}, for for noise intensity i . in this work , η i ( t ) can be viewed as either measurement or environmental noise . fig4 shows the phase portrait of the time - independent double - gyre model . fig5 a - 5h show trajectories of the team of 3 robots tracking lagrangian coherent structures of the system described by eq . ( 5a - c ) with a = 10 , μ = 0 . 005 , ε = 0 . 1 , ψ = 0 , i = 0 . 01 , and s = 50 . the trajectories of the straddling robots are shown in black and the estimated lcs is shown in white . while the present invention has been described with respect to exemplary embodiments thereof , it will be understood by those of ordinary skill in the art that variations and modifications can be effected within the scope and spirit of the invention .	6
reference will now be made in detail to the present preferred embodiments of the invention , examples of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers are used in the drawings and the description to refer to the same or like parts . this invention uses a self - aligned method in the production of vias , and so the conventional photolithographic and etching steps are no longer needed . therefore , problems caused by the misalignment of via are eliminated , and considerations for the extension rules can be lifted . furthermore , the dimensions of the vias will be unaffected by the optical systems used in the production , and a lower resistance will be obtained for the vias . hence , the invention provides a step towards future device miniaturization . fig2 is a top view showing a layout of a via structure according to a first preferred embodiment of this invention . as shown in fig2 a number of vias 21 are distributed in the dielectric layer 20 . underneath the dielectric layer 20 are a number of conductive lines 22 ( shown in dashed lines ), which are connected electrically to a metallic layer ( not shown ) through vias 21 . comparing this via structure 21 with the conventional via structure 11 ( as shown in fig1 ), the via structure 21 here do not need to consider the extension rules , nor has to allow an extra width d around the via 21 . therefore , space occupied by the devices can be greatly reduced , and the level of integration in wafers can be greatly increased . fig3 a through 8a are top views showing the progression of manufacturing steps in the production of a via structure according to the first preferred embodiment of this invention , fig3 b through 6b are perspective views of fig3 a through 6a respectively ; and fig7 b and 8b are cross - sectional views along line aa &# 39 ; of fig7 a and 8a respectively . first , as shown in fig3 a and 3b , a semiconductor substrate 30 is provided , then a conductive layer 31 is formed over the substrate . next , a dielectric layer 32 is formed over the conductive layer 31 . the dielectric layer 32 is formed by depositing silicon nitride or an oxide using a chemical vapor deposition method , and the thickness is preferably between 500 å to 2000 å . next , as shown in fig4 a and 4b , hollow cavities are etched in the dielectric layer 32 , for example , a first cavity 33 and a second cavity 34 . the length and width of the each cavity are determined by the size of the via and the desired conductive lines . for example , the length of the first cavity 33 is about ( 2 × desired width of the conductive line + desired distance between two conductive lines + 0 . 1 ˜ 0 . 2 μm ), and its width is about the same as the desired width of the via ; the length of the second cavity 34 is about ( desired width of the via + 0 . 1 ˜ 0 . 2 μm ) and its width is about ( 2 × desired width of the via + desired distance between two conductive lines ); and here , 0 . 1 ˜ 0 . 2 μm is the necessary tolerance . next , as shown in fig5 a and 5b , photolithographic processing is performed by forming a photoresist layer 35 over the dielectric layer 32 , the first cavity 33 and the second cavity 34 . then , the photoresist layer 35 is patterned such that the photoresist layer 35 forms an overlapping region 36a with the first cavity 33 , and the photoresist layer 35 forms another overlapping region 36b with the second cavity 34 . next , as shown in fig6 a and 6b , the dielectric layer 32 is then etched in a first etching operation using the photoresist layer 35 as a mask . then , the conductive layer 31 is etched in a second etching operation also using the photoresist layer 35 as a mask to expose the substrate 30 and forming conductive lines 31a and dielectric lines 32a . next , as shown in fig7 a and 7b , a selective liquid phase deposition ( lpd ) is performed to deposit an oxide layer 37 over the substrate 30 . the deposited oxide layer is preferably silicon dioxide , and the lpd is carried out at about 35 ° c . because the liquid phase deposition will selectively deposit oxide on silicon dioxide layers , and not on other materials , for example , photoresist material , the oxide will form in the region above the substrate away from the photoresist layer . next , as shown in fig8 a and 8b , the photoresist layer 35 is removed to form via structures 38 of this invention at the former overlapping locations 36a or 36b . the oxide layer 37 and the dielectric layer 32a form the insulating layer surrounding the conductive lines 31a . the vias 38 formed here is not restricted by any extension rules . furthermore , because the vias 38 are formed at the overlapping locations 36a or 36b , size of the vias 38 are determined only by the first cavity 33 ( or the second cavity 34 ) and the conductive lines 31a . therefore , the via alignment and photolithographic exposure problems of a convention method can be completely avoided . fig9 a through 16a are top views showing the progression of manufacturing steps in the production of a via structure according to the second preferred embodiment of this invention ; fig9 b through 12b are perspective views of fig9 a through 12a respectively , and fig1 b through 16b are cross - sectional views along line bb &# 39 ; of fig1 a through 16a respectively . first , as shown in fig9 a and 9b , a semiconductor substrate 90 is provided , then a conductive layer 91 is formed over the substrate . next , a dielectric layer 92 is formed over the conductive layer 91 . the dielectric layer 92 can be , for example , a silicon nitride layer having a thickness preferably between 500 å to 2000 å . next , as shown in fig1 a and 10b , a first etching operation is perform to etch the dielectric layer 92 forming a first protruding pad 93a and a second protruding pad 93b , for example . the length and width of the protruding pads are determined by the size of the via and the desired conductive lines . for example , the length of the first protruding pad 93a is about ( 2 × desired width of the conductive line + desired distance between two conductive lines + 0 . 1 ˜ 0 . 2 μm ), and its width is about the same as the desired width of the via , the length of the second protruding pad 93b is about ( desired width of the via + 0 . 1 ˜ 0 . 2 μm ) and its width is about ( 2 × desired width of the via + desired distance between two conductive lines ). next , as shown in fig1 a and 11b , photolithographic processing is performed by forming a photoresist layer 94 over the dielectric layer 92 , the first protruding pad 93a and the second protruding pad 93b . then , the photoresist layer 94 is patterned such that portions of the photoresist layer 94 forms overlaps 95a with the first protruding pad 93a , and the photoresist layer 94 forms another overlaps 95b with the second protruding pad 93b . next , as shown in fig1 a and 12b , using the photoresist layer 94 as a mask , the conductive layer 91 is etched to form conductive lines 91a in a second etching operation . next , as shown in fig1 a and 13b , the photoresist layer 94 is removed , and in fig1 a and 14b , a thin first insulating layer 96 is deposited over the substrate 90 . the first insulating layer 96 , for example , can be an undoped teos layer formed using a chemical vapor deposition method with tetraethyl orthosilicate ( teos ) as the reactive gas . next , as shown in fig1 a and 15b , a second insulating layer 97 is formed over the first insulating layer 96 . the second insulating layer 97 can be an oxide layer , for example . subsequently , portions of the second insulating layer 97 are removed to expose surfaces of the first protruding pad 93a and the second protruding pad 93b . the second insulating layer 97 can be removed using an etching back method or a chemical - mechanical polishing ( cmp ) method . next , as shown in fig1 a and 16b , the first protruding pad 93a at the original overlapping locations 95a and the second protruding pad 93b at the original overlapping locations 95b are removed using a selective etching method . thus , the via structures 98 of this invention are formed at the former overlapping locations 95a and 95b , whose sidewalls are the first insulating layer 96 . the vias 98 formed here is not restricted by any extension rules . furthermore , because the vias 98 are formed at the overlapping locations 95a or 95b , size of the vias 98 are determined only by the first protruding pad 93a ( or the second protruding pad 93b ) and the conductive lines 91a . therefore , the via alignment and photolithographic exposure problems of a convention method can be avoided . as a summary , the self - aligned via structure provided by this invention includes the following advantages ( 1 ) no photolithographic and etching operations are used in forming the via structure of this invention . therefore , there is no need to consider via misalignment problems and the extension rules . in addition , resistance of the via is lower and the devices can be further miniaturized , thus raising the level of integration . ( 2 ) there is no rounding of corners for the vias and production is not limited by the optical processing . therefore , this invention provides impetus for future miniaturization . it will be apparent to those skilled in the art that various modifications and variations can be made to the structure of the present invention without departing from the scope or spirit of the invention . in view of the foregoing , it is intended that the present invention cover modifications and variations of this invention provided they fall within the scope of the following claims and their equivalents .	7
reference is made to fig1 in which the reference numeral 10 designates generally the coupled cavity type traveling wave tube that includes a known arrangement of magnets 12 , pole pieces 13 and spacer members 15 , which is to be described in detail later . it is sufficient at this point in the description to state that the spacer members and internal portions of the pole pieces function as a slow wave structure for propagating an electromagnetic wave with a phase velocity substantially less than the velocity of light and substantially equal to the velocity of an electron beam . and the magnets and pole pieces constitute a periodic permanent magnet focusing system for focusing the electron beam traversing the length of a slow wave structure . an input coaxial transducer 14 is coupled to the input end of the slow wave structure and is adapted for coupling the assembled traveling wave tube to an external microwave transmission line , not illustrated . the construction of the coupling includes a microwave seal , not illustrated , transparent to microwave energy but capable of maintaining the vacuum within the traveling wave tube and is essentially of a known structure . a waveguide type output transducer 20 , including an impedance step transformer 22 and a coupling flange 24 is coupled to the output end of the slow wave structure . the coupling flange includes a microwave window , not illustrated , transparent to microwave energy but capable of maintaining the vacuum within the traveling wave tube and is essentially of a known structure . an electron gun 28 , illustrated partially in section , is disposed at one end of the traveling wave tube and functions in operation to generate and propel a beam of electrons along longitudinal axis 31 of tube 10 . the electron gun contains a cathode 29 of electron emissive material and may be of any conventional construction well known in the art , such as exemplified by the electron gun illustrated in u . s . pat . no . 2 , 985 , 792 and u . s . pat . no . 2 , 936 , 393 . at the opposite end of traveling wave tube 10 , a cooled collector structure 16 , illustrated in section , is provided . the collector may be of any conventional structure and functions to collect those spent electrons from the beam which have passed through the tube &# 39 ; s interaction region . inasmuch as the details of the collector are not necessary to an understanding of the invention , reference may be made to collectors described in u . s . pat . nos . 2 , 985 , 792 and 2 , 860 , 277 for exemplary constructions and structure . the tube includes circuit &# 34 ; severs &# 34 ; 11 of conventional construction at several locations which , as is known , function to isolate the output signal from the input signal in a known manner . the permanent magnets 12 used in the traveling wave tube construction disclosed are pill - shaped magnets , a known alternative to the ring - shaped permanent magnets illustrated in the patents earlier herein cited , and has the purpose of extending a magnetic field through the pole pieces into the vacuum region of the traveling wave tube . each pole piece has essentially four corner portions and a permanent magnet is located at each corner sandwiched between adjacent pole pieces , with the polarity of the magnets arranged in the same direction parallel to the tube axis . the set of magnets is poled oppositely to the set of magnets situated between the common pole piece and the next adjacent pole piece . this is a conventional prior art magnetic focusing structure . the cutaway section of fig1 reveals the arrangement of pole pieces 13 and nonmagnetic electrically conductive metal spacers 15 which together form serially axially spaced interaction cavities 17 coupled by coupling holes 19 located off - axis of a central electron beam passage . the pole piece assembly , as presented in the front view of fig2 to an enlarged scale , includes a first portion 32 of iron , a ferromagnetic material , and a second circular portion 34 , also of iron . portion 34 contains a protruding cylindrical lip 36 surrounding a circular cylindrical passage 30 . a hollow cylindrical - shaped liner of copper material 38 is fixed within lip 36 and lines the passage walls . and a kidney - shaped coupling slot 35 extends through the pole piece . to insure an understanding of the relationship , the position of one of the pill - shaped magnets 12 &# 39 ; is represented in dash lines in fig2 . magnets such as 12 &# 39 ; are included at each of the four corners of the pole piece in the completed tube . fig3 which shows in cross - section the pole piece of fig2 taken along line 2 -- 2 thereof and in which identical elements are identically labeled shows in section the pole piece portion 34 containing the lip 36 , the main pole piece section 32 which similarly contains a protruding lip portion 27 at the pole piece back wall in the form of an annulus or lip surrounding passage 30 , which was not visible in fig2 . copper liner 38 is of a hollow cylinder geometry which extends through the length of passage 30 between the ends of lips 27 and 36 . sandwiched in between the flat surfaces of pole piece sections 32 and 34 is a washer - shaped copper member 40 . the copper member is seen to be in a thermal conducting relationship with the liner 38 as well as with portions 34 and 32 . although not labeled , very thin brazing material is situated between each of the surfaces of member 40 and pole piece sections 32 and 34 , liner 38 , and each of the pole piece sections and the member 40 as well . as is recognized , the metal iron material possesses magnetic properties , more specifically ferromagnetic properties , as well as being electrically conductive , has certain heat or thermal conductivity characteristics and certain coefficient or expansion . the copper metal is nonmagnetic but is electrically conductive and has substantially better thermal conductivity characteristics than iron , as well as a larger thermal coefficient of expansion . the overall relationship of the elements of the pole piece is more apparent from the exploded view presented in fig4 to which reference is now made . the exploded view illustrates the assembly of the pole piece in an intermediate stage . when fully assembled according to the teachings of the specification , including the formation of a coupling slot , such as 35 in fig2 the configuration of fig2 results . thus , pole piece section 32 contains cylindrical passage 30 along the axis 31 and a cylindrical well 33 of a predetermined depth , t b , which depth t b is less than the total thickness , t a , of pole piece portion 32 and is of a predetermined diameter , d 1 . the well 33 is coaxial with cylindrical passage 30 which opens into the well . the copper washer - shaped member 40 contains a central circular passage 41 of essentially slightly larger radius than passage 30 and the member is a thickness , t c . the outer diameter of member 40 , d 2 , is slightly less than said d 1 of well 33 . intermediate the pole piece section 32 and copper member 40 and represented in dash lines , is a washer - shaped wafer 37 of brazing material , typically a known 50 / 50 copper - gold alloy brazing composition , which serves to join elements 32 and 40 together . the thickness of this brazing material is usually very small , on the order of 0 . 038 millimeters . the washer - shaped pole piece portion 34 containing the cylindrical protruding lip 36 is illustrated . pole piece portion 34 is of an outer diameter , d 3 , slightly larger than the diameter of washer member 40 but barely less than the diameter d 1 of well 33 in pole piece section 32 , described as a &# 34 ; clearance &# 34 ; fit . for example , it is desired that the relationship between the diameters be as follows : d 3 ≅ d 1 & gt ; d 2 and suitably \| d 3 - d 2 \| ≅ 0 . 012 inch , \| d 3 - d 1 \|≅ 0 . 002 inch . another thin washer - shaped member 39 of 50 / 50 brazing material essentially identical to member 37 is located between elements 34 and 40 and is represented in dash lines which serves to join together elements 40 and 34 . brazing washers 37 and 39 are of essentially the same thickness . the hollow cylindrical copper liner 38 is illustrated in the most left hand portion of this figure . suitably the outer diameter of liner 38 , d 4 , is less than that of the diameter of passage 30 by an amount sufficient to just accommodate sandwiching of a thin hollow cylinder of brazing material 43 , represented in dash lines . the brazing material 43 is approximately the same length as metal copper liner 38 and serves to join the liner to each of the members 34 , 32 and 40 . the component elements heretofore described and illustrated are formed to the desired shape and dimension , as represented by block 51 in fig5 using conventional machining techniques , including milling on a milling machine and turning in a lathe , which need not be described in detail . the washer - like or annular portion of member 34 is of a thickness , t c , essentially equal to the thickness , t d , of the underlying annular base portion of well 33 in pole piece portion 32 . the elements are assembled together , as represented by block 53 in fig5 by inserting brazing material 37 in well 33 , followed consecutively by the copper washer 40 , brazing material 39 , washer - shaped pole piece portion 34 which , as was earlier noted , fits snugly in the well 33 . then the copper liner 38 and brazing cylinder 43 are pushed into place within passage 30 . as is represented by block 55 in fig5 the assembly of metal elements is brazed together in suitable conventional brazing apparatus , not illustrated . in brazing , the temperature of the assembly is raised to the vicinity of 970 ° centigrade , sufficient to melt the brazing material 37 and 39 , without melting the other iron and copper elements . as those skilled in the art are aware , the thermal coefficient of expansion of copper is greater than that of iron . as earlier described , the outer diameter d 2 of copper member 40 was slightly less than the diameter d 1 of well 33 in pole piece portion 34 . accordingly , the copper washer expands to reduce the clearance between its periphery and the walls of well 33 , but with enough clearance remaining at the brazing temperature to allow the brazing material on each side of member 50 to flow into the space between the washer and the iron walls bounding well 33 . additionally , brazing material flows throughout the length of the copper liner 38 , including that space between copper washer 40 and liner 38 . thereafter in the brazing process the assembly is allowed to cool so that the brazing material solidifies and forms a strong mechanical and thermally conductive bond between the surfaces of the adjoining elements . hence , the resulting structure may be referred to as a laminate or integral structure . because copper washer member 40 expanded to a greater degree during the heating portion of the brazing step , it should during cooling contract more than the iron portions 32 and 34 , presenting a pulling force on the walls of well 33 . for this reason , it is important that the thickness of the iron portion 34 be the same as the thickness remaining between the bottom of well 33 and the opposite side of pole piece portion 32 so as to achieve a balance and minimize the possibility of warpage or bowing of the surfaces . as a finishing step , represented as block 57 in fig5 the pole piece assembly is placed in a lathe and turned so as to flatten the pole piece surfaces ; to cut off any bowed portion . and the kidney - shaped coupling slot , element 35 in fig2 is cut through the assembly in the position illustrated in fig2 . additionally , it is sometimes desired to taper the outer surface of the protruding lips , such as 27 and 36 in fig2 for known purposes . that additional cutting operation may conveniently be performed at this stage of the fabrication process . it is found that if the pole piece is reheated to the high temperatures that are expected within the operating environment of the completed traveling wave tube , and less than the brazing temperatures , that the re - expansion of copper member 40 does not cause significant bending of the surfaces of the iron portion of the pole piece . a particular coupled cavity traveling wave tube constructed with the improved pole pieces obtained performance of a 6 percent duty cycle at about 7 kilowatts average power and about 150 kilowatts peak power . even though a portion of the iron material of the pole piece essentially was deleted to effectively reduce the cross - section of magnetic material available to conduct the magnetic flux from the magnets and is replaced by the copper material , a nonmagnetic material , it was found that the cross - section of magnetic material remaining was still sufficient to conduct the flux provided by the magnets , without magnetically saturating the magnetic path , at the desired intensity to the ferrule or lip portion of the pole pieces . understanding the foregoing described structure of my invention , the reader skilled in the art may easily grasp its significance . in contrast to the external copper patches of the prior art discussed in connection with the background to this invention , during the brazing steps the present structure essentially &# 34 ; traps &# 34 ; the copper material with its greater thermal coefficient of expansion within the iron &# 34 ; shell &# 34 ; formed between the main pole piece portion 32 and washer - shaped portion 34 , which are of the iron material , and that effect leads to a more complete braze between those elements with less ensuing warpage of the assembly . and the final machining is performed only after completion of the brazing steps so as to maintain accuracy of dimension and shape in the laminated pole piece structure . a further result grasped by the reader is that any errant electrons which stray off the beam axis and which would otherwise strike the beam passage walls within the pole piece including the ferrule or lip portions thereof , as in the prior art devices , do so by striking the copper liner 38 . the heat so generated is transmitted in great part through the copper liner 38 to the sandwiched copper portion 40 by means of which it may be conducted external of the traveling wave tube . there is thus no need for the heat to pass through iron ferrule or lip portions of the pole pieces and the main heat conducting path is a copper to copper path . this i regard as a significant advantage . lastly , it appears that the copper liner 38 has the effect of magnetically shielding the iron lip portions from the electron beam . thus the high gradient of magnetic field which appears near the pole piece ferrule tip or lip portions does not significantly affect the electron beam and i believe that effect beneficial in maintaining focusing of the electron beam during operation of the traveling wave tube . it is believed that the preceding description of a preferred embodiment of my invention is presented in such detail as to enable one skilled in the art to practice the invention . it is expressly understood however that the details presented for the foregoing purpose are not intended to restrict the scope of my invention , inasmuch as various changes , modifications or substitutions of equivalents , all of which embody the invention , suggest themselves to those skilled in the art upon reading this specification . it is therefore respectfully requested that my invention be broadly construed within the full spirit and scope of the claims appended hereto .	8
in the description which follows , like parts are marked throughout the specification and drawing with the same reference numerals , respectively . the drawing figures are not necessarily to scale and certain elements may be shown in somewhat schematic form in the interest of clarity and conciseness . referring to fig1 , there is illustrated a flagpole ornament in accordance with the invention and generally designated by the numeral 10 . the flagpole ornament 10 is illustrated mounted on the peak of a vertical oriented flagpole 12 having a conventional upper bracket or truck assembly 14 suitably mounted thereon . truck assembly 14 includes a somewhat inverted cup - shaped truck member 16 mounted on the peak of flagpole 12 in a conventional manner and supporting a conventional rotatable pulley 18 over which is trained a flag halyard 20 . flagpole ornament 10 is characterized as a generally spherical member or ball 11 and includes an upstanding post member 22 suitably connected to the truck member 16 as will be described in further detail herein . referring now to fig2 , the flagpole ball 11 is characterized by opposed hollow , shelllike , hemispherical parts 24 and 26 which are interengaged to form a substantially spherical member . hemispherical parts 24 and 26 are each , preferably formed of relatively thin - walled aluminum , for example , and are fabricated in a conventional manner by suitable forming technique , known to those skilled in the art . however , hemispherical ornament part 26 includes a slightly radially inwardly displaced circular rim 28 delimited by a circumferential edge 30 and dimensioned to fit snugly within and engaged with the inside wall 24 a of part 24 , as illustrated . the radially inwardly displaced rim 28 provides an annular shoulder 32 which is adapted to engage circumferential edge 25 of part 24 in a snug - fitting relationship to form the spherical ball member 11 . ball member 11 is held in assembly and strengthened against deformation by an internal diametral column or brace member 34 preferably comprising a cylindrical aluminum rod which is provided with opposed axially extending internally threaded bores or tapped holes 36 and 38 , as shown . hemispherical part 24 is preferably somewhat flattened at a circular portion 24 b opposite another somewhat flattened circular portion 26 b of part 26 . parts 24 and 26 are also provided with fastener receiving openings 24 c and 26 c , respectively . a pan - head machine screw 40 is operable to be inserted through opening 24 c and threadedly engaged with brace member 34 at threaded bore 36 , as shown , for securing part 24 to brace member 34 . referring further to fig2 , ornament post member 22 includes an externally threaded end part 23 which is shown threadedly engaged with truck member 16 and suitably locked in engagement therewith by a conventional hex - shaped locknut 43 . the opposite end of post member 22 includes an internally threaded bore 27 opening to a transverse end - face 29 of post member 22 which is engageable with the flattened part 26 b of hemispherical ornament part 26 . an externally , continuous threaded or “ allthread ” fastener member 46 extends through opening 26 c , is threadedly engaged with brace member 34 at threaded bore 38 and is threadedly engaged with post member 22 at threaded bore 27 . fastener member 46 is preferably formed of steel while post member 22 and , as mentioned previously , brace member 34 are preferably formed of aluminum . generally planar transverse end faces 34 a and 34 b of brace member 34 are tightly engaged with the respective flattened or planar circular portions 24 b and 26 b of the hemispherical parts 24 and 26 . accordingly , the head 41 of fastener 40 may be in complete area contact with a surface of the hemispherical part 24 and the end - face 29 of post member 22 is also in substantially total area contact with the flattened or planar portion 26 b of hemispherical part 26 . in this way , upon assembly of the ornament 10 , the brace member 34 is in engagement with the hemispherical parts 24 and 26 over relatively large areas to distribute stresses thereon while aiding in maintaining the assembly as a consequence of tightening the fastener 40 and tightening the post 22 against hemispherical part 26 , thanks to the allthread fastener member 46 . still further , the flagpole ornament 10 may advantageously utilize thread locking and sealant compositions coated on the cooperating threads of the brace member 34 and the fasteners 40 and 46 , including a thread locking composition available under the trademark loctite , for example . referring briefly to fig3 , an alternate embodiment of a post member for use with the ornament 10 , in place of post member 22 , is illustrated and generally designated by the numeral 52 . post member 52 includes a transverse end face 53 , an internally threaded bore 54 and an axially extending externally threaded part 55 which may be of a different thread size than the threaded portion 23 of post member 22 . in this way , post members may be interchanged as required by the particular flagpole upper bracket or truck member to which the ornament 10 is to be connected . as previously mentioned , parts 24 and 26 are preferably formed of relatively thin - walled aluminum . for a ball diameter of about 4 . 0 inches , the wall thickness may be about 0 . 030 inches and the height “ x ” of the rim 28 , fig2 , is preferably about 0 . 38 to 0 . 50 inches . the brace member 34 and the post members 22 or 52 may be formed of aluminum cylindrical rod having a diameter of about 0 . 625 inches . the overall length of the post members 22 and 52 may be about 4 . 0 inches with the externally threaded portions being about 2 . 0 inches and the internally threaded portions 27 and 54 being about 1 . 0 inch deep and being of a thread size 5 / 16 - 18nc , for example . the allthread faster member 46 is preferably at least about 1 . 0 inches to 2 . 0 inches in length . fabrication and assembly of the ornament 10 , based on the foregoing description , is believed to be within the purview of one skilled in the art . referring now to fig4 , another embodiment of a flagpole ball ornament in accordance with the invention is illustrated and generally designated by the numeral 60 . the flagpole ornament 60 , utilizes the components of the flagpole ball ornament 10 , as indicated in fig4 , including the opposed hemispherical parts 24 and 26 and the post or column member 22 . however , the internal brace member 34 has been replaced by a similar brace member 34 g , which is provided with a fastener clearance bore 38 a for receiving an elongated machine screw or bolt 62 having a distal threaded portion 63 engageable with threaded bore 27 of post member 22 . brace member 34 g also includes the opposed transverse end faces 34 a and 34 b . machine screw or bolt 62 includes a conventional hexhead 64 and is of a diameter slightly less than the diameter of the bore 38 a . accordingly , fastener 62 comprising the hexhead machine screw or bolt is operable to secure the hemispherical parts 24 and 26 tightly together and braced by the brace member 34 g and further wherein a single fastener may be utilized to secure the ball ornament to the post or column member 22 . when assembling the flagpole ornament 60 , a thread locking and sealant composition as mentioned hereinabove is preferably used on the threads of the threaded shank part 63 and / or the bore 27 . the brace member 34 g may , in fact , be identical to the brace member 34 except for the bore 38 a , which may be of the same diameter as required for pre - drilling the brace member 34 to accommodate the threaded bores 36 and 38 when such bores are tapped in the brace member 34 . although preferred embodiments of the invention have been described in detail herein , those skilled in the art will recognize that various substitutions and modifications may be made without departing from the scope and spirit of the appended claims .	8
the preferred embodiment of the present invention is illustrated by way of example in fig1 and 2 . with specific reference to fig1 the cooling plant load reduction device 10 is shown comprising blower 12 , which collects returned air 14 from a building at approximately 75 degrees fahrenheit . blower 12 directs this 75 degree return air to freon vaporizer / expansion device 16 . vaporizer 16 has piping 18 that contains liquid freon 20 under pressure from pump 22 . waste heat in return air 14 heats the liquid freon 20 under pressure in freon vaporizer 16 so that the liquid freon 20 is vaporized . freon vapor 24 is then directed to turbine 26 where , because of lower pressure on the exhaust side 28 of turbine 26 , freon vapor 24 is expanded . turbine 26 is connected to generator 30 so that when freon vapor 24 passes through turbine 26 generator 30 produces electricity . turbine 26 is also mechanically connected to blower 12 and liquid pump 22 and drives them . freon vapor 24 , having left turbine 26 at the exhaust side 28 is then directed to condenser 32 . condenser 32 is maintained at a lower condensing temperature by utilization of chilled water 34 from a central chilling plant 36 ( not shown ) of a typical building cooling system . in the typical design of a central cooling plant 36 known in the art , chilled water / liquid 34 leaves the cooling plant 36 at 35 to 40 degrees fahrenheit . this chilled water 34 is then typically pumped directly to an air handling unit and chill coil ( not shown ) where heat from return air stream 14 at 75 degrees fahrenheit would be directly by a blower , such as blower 12 , to a coil ( not shown ) where heat is transferred to the chilled liquid . this is the system whereby the building air supply is cooled in the typical system . the net cooling effect of the air is proportional to the quantity and temperature rise of the liquid passing through the chill coil . in the typical case , the liquid , chilled water is at a temperature of 40 degrees entering and 55 degrees leaving . as is known in the art , the fuel source to produce chilled liquid in the central chilling plant 36 and the power required to operate blower 12 may be made from fossil fuel , nuclear energy or the like . the intended purpose of the central cooling plants , known in the art , is to produce chilled liquid at a temperature low enough so that heat may be transferred from the higher temperature in the space to be cooled to the lower temperature of the chilled liquid so that heat may be removed from an area where it is not desired to an area where it is less objectional , i . e . outdoors . the present invention better utilizes natural and recovered &# 34 ; waste &# 34 ; heat energy that is accumulated or generated within the structure to be cooled . as illustrated in this invention , the device may be assembled in the space to be cooled , consisting of freon vaporizer / expansion device 16 , turbine 26 , electrical generator 30 , condenser 32 , and feed pump 22 . this invention then , takes advantage of the temperature difference between building return air 14 load at 75 degrees fahrenheit and the 40 degree fahrenheit chilled liquid 34 produced by central chilling plant 36 for the primary purpose of cooling the structure . as fig1 indicates , the cooling plant load reduction device 10 of the present invention can transfer the same quantity of heat from building return air 14 at 75 degrees fahrenheit by means of blower 12 and pass return air 14 through freon vaporizer / expansion device 16 which causes liquid freon 20 to change phase to freon vapor 24 while the desired pressure is maintained by feed pump 22 . because of the enthalpy decrease experienced through turbine 26 as work energy is removed from the freon vapor 24 and transformed to shaft horsepower to do work on blower 12 and liquid pump 22 and electrical generator 30 , the capacity requirements for chilled water / liquid 34 from central chilling plant 36 is reduced . a key element of the novelty of this invention is the &# 34 ; host &# 34 ; arrangement of the structure of the invention within a building so that it takes advantage of the temperature drop between the building &# 39 ; s return air 14 at 75 degrees fahrenheit and the chilled water 34 , at about 40 degrees fahrenheit , supplied by the central chilling plant 36 which is produced by a separate fuel source for the purpose of cooling the structure . utilization of the device of this invention provides for simultaneous additional cooling of the building and the production of electricity which may be used for purposes other than the production of cooling . additional cooling is accomplished by removing the required volume heat energy from building return air 14 , transferring this energy to the liquid freon 20 which results in freon vapor 24 which increases enthalpy and which is then directed to turbine 26 where enthalpy is decreased by work done to drive blower 12 and liquid pump 22 and produce electricity with generator 30 . most importantly , the heat source that allows production of electricity with generator 30 and eliminates the requirements for electricity to drive blower 12 is what is known in the art as &# 34 ; waste &# 34 ; heat . that is , solar energy that is accumulated in the atmosphere within a structure and heat energy given off by the human body that is converted from food intake by the body and is absorbed into the cooler atmosphere of the structure at 75 degrees fahrenheit . these &# 34 ; waste &# 34 ; sources of heat may also include heat generated within a structure by electrical apparatus such as computers , motors and any other processes that require steam motivation , result in friction of mechanical parts within devices , etc . all of this &# 34 ; waste &# 34 ; heat is gathered in the return air 14 stream and transferred by blower 12 into freon vaporizer / expansion device 16 which contains liquid freon 20 under pressure by pump 22 . freon vapor 24 is directed from freon vaporizer 16 to the turbo expander , turbine 26 , which forcefully drives generator 30 and blower 12 and liquid pump 22 and which , ultimately , converts the accumulated &# 34 ; waste &# 34 ; heat energy , such as solar heat , body heat and the like , that is generated within a structure , to electricity and shaft horsepower to drive blower 12 and liquid pump 22 . simultaneously , extra cooling is being produced . this cycle is completed by the direction of the freon vapor 24 from turbine 26 by means of exiting through the exhaust side 28 of turbine 26 to condenser 32 where sufficient heat is removed by chilled water 34 at approximately 40 degrees fahrenheit to allow condensation of freon vapor 24 into freon liquid 20 so that the liquid freon 20 can be recirculated by pump 22 back to freon vaporizer 16 to continue the cycle . referring now to fig2 the physical properties of the invention are demonstrated by means of an enthalpy diagram . starting at position number 1 , the diagram demonstrates heat in equalling approximately 70 degrees with the source being the return air stream 14 handling a building load at 75 degrees fahrenheit . the descending vertical line from 1 to 2 illustrates the enthalpy drop of work done in turbine 26 as freon vapor 24 passes therethrough . the vertical line from number 2 to number 3 demonstrates the effect of the condenser 32 wherein reversible constant pressure heat transfer from vapor is shown ending in freon liquid 20 . the connecting lines from number 3 to number 4 demonstrates work added by pump 22 to provide liquid freon 20 under pressure . finally , from number 4 to 1 , the horizontal line demonstrates the reversible constant pressure heat transfer to liquid resulting in the transformation of liquid freon 20 to freon vapor 24 . demonstration of the thermal efficiency of this cycle can be shown using the following mathematical equations . ## equ1 ## thermal efficiency of the rankine cycle = network out divided by heat supplied . ## equ2 ## therefore , work turbine ( wt ) is greater than work pump ( wp ) and by utilizing &# 34 ; waste &# 34 ; heat from return air 14 , useful shaft work is done simultaneously while the central chilling plant 34 cools the building . because heat out by condenser 32 ( lines 2 - 3 in fig2 ) is less than heat in ( line 4 - 1 in fig2 ) because of work removed by turbine ( lines 1 - 2 in fig2 ), less cooling capacity is required from central chilling plant 36 and the efficiency of central chilling plant 36 is thereby enhanced . in summary then , the cooling plant load reduction device 10 of the present invention accomplishes its purposes by arranging a blower 12 for directing return air 14 to a heat exchanger , such as freon vaporizer 16 , connected to a vapor expanding engine , such as turbine 26 , which is connected to condenser 32 connected to liquid feed pump 22 which pumps liquid freon 20 back to the starting point and the heat exchanger of the air handling unit . this arrangement forms a closed loop section which is well know as a &# 34 ; rankine &# 34 ; cycle . the heat source for this &# 34 ; rankine &# 34 ; cycle , however , is &# 34 ; waste &# 34 ; heat absorbed from the air at approximately 75 degrees in the building space to be cooled . the &# 34 ; heat sink &# 34 ; for the condenser 32 of this cycle is provided by the lower temperature of the chilled liquid , chilled water 34 , provided by the refrigeration part of the standard building air conditioning plant , central chilling plant 36 . this chilled liquid , chilled water 34 , is maintained , typically , at approximately 35 degrees fahrenheit . when motive fluids , such as refrigerant 502 and the like , are incorporated into this closed loop cycle , pressure drops are achieved at this stated temperature difference of 75 degrees to 40 degrees fahrenheit that is sufficient to substantially drive both blower 12 and liquid feed pump 22 . this then , substantially eliminates the need to purchase external energy sources to operate the air handling unit of the present invention . as a result , the operating cost of providing air conditioning is reduced . this cost is reduced again by this invention because of the decrease in entropy associated with the drop of pressure through the turbine 26 that drives the blower 12 and liquid feed pump 22 . this is true because in a rankine cycle , the heat out of a turbine or expander equals the heat in minus work done by the turbine . while the present invention has been disclosed in connection with the preferred embodiment thereof , it should be understood that there may be other embodiments which fall within the spirit and scope of the invention as defined by the following claims .	5
hereinafter , the present invention will be described in detail with reference to the accompanying drawings . fig1 is a block diagram showing the configuration of an adaptive frequency hopping apparatus according to the present invention . as shown in fig1 , the adaptive frequency hopping apparatus comprises a frequency table 10 for monitoring the current qualities of channels for 79 frequency bands , and storing and outputting information on the channel quality for each 1 mhz frequency band accumulated n scan times , a frequency hopping transceiver 11 for generating and outputting a frequency pattern in accordance with predetermined rules , a link controller 12 for generating an asynchronous connectionless ( acl ) link , which is text data , in accordance with output signals of the frequency table 10 and the frequency hopping transceiver 11 and controlling selection of an operating mode between a channel avoidance scheme and a channel selection scheme , a packet handler 13 for generating packet data by integrating a synchronous connection oriented ( sco ) link and the acl link inputted therein , a gaussian frequency shift keying ( gfsk ) modulator 14 for performing gfsk modulation for signals outputted from the packet handler 13 , a mode selector 15 for selecting the operating mode between the channel avoidance scheme and the channel selection scheme in accordance with the output signals of the frequency hopping transceiver 11 and the link controller 12 , a frequency synthesizer 16 for synthesizing frequencies in accordance with output signals of the mode selector 15 , a first multiplier 17 for mixing signals from outputted from the frequency synthesizer 16 and the gfsk modulator 14 , and for outputting the multiplied signals as transmission signals , a second multiplier 18 for multiplying the output signals of the frequency synthesizer 16 by the receiving signals , an rssi detector 19 for detecting the rssi from output signals of the second multiplier 18 , a gfsk demodulator 20 for performing gfsk demodulation for the output signals of the second multiplier 18 , a packet handler 21 for restoring packet - type data from output signals of the gfsk demodulator 20 , and a channel quality detector 22 for estimating the channel quality by using the output signals of the rssi detector 19 and the packet handler 21 and storing it in the frequency table 10 . in the adaptive frequency hopping apparatus of the present invention having the configuration as described above , upon transmission of the predetermined data , the link controller 12 performs the mode selection for the frequency hopping in accordance with the sco and acl links . in addition , the apparatus operates in a frequency - hopping manner corresponding to each link according to the contents stored in the frequency table 10 and the frequency generated at the frequency hopping transceiver 11 , as described above . further , the apparatus performs transmission of the signals at a hop frequency generated by means of the relevant frequency hopping method from the finally modulated signals . further , upon reception of the predetermined data , the second multiplier 18 multiplies the received signals by the output signals of the frequency synthesizer 16 to perform the modulation , and then outputs the multiplied signals to both the rssi detector 19 and the gfsk demodulator 20 . the rssi detector 19 and the gfsk demodulator 20 perform the rssi measurement and the gfsk demodulation for the signals outputted from the second multiplier 18 , respectively . the packet handler 21 receives the signals demodulated at the gfsk demodulator 20 and restores the data , which have been transmitted thereto , in accordance with the types of packets . then , the channel quality detector 22 estimates the channel quality using the restored data and the detected rssi value . the channel quality detector 22 operates as shown in fig2 . if the access code correlator is triggered , the channel quality detector 22 checks a header error check ( hec ). if there is not the hec , the channel quality detector 22 estimates the channel as a good channel , and if there is the hec , the channel quality detector 22 does the channel as a bad channel . meanwhile , if the access code correlator is not triggered , the channel quality detector 22 compares the rssi value with a threshold value th . as the result of the comparison , if the rssi value is larger than the threshold value th , the channel quality detector 22 estimates the channel as a bad channel , and if not , the channel quality detector 22 do not operate any longer . furthermore , even at a receiving end , a relevant frequency hopping method is selected by comparing the contents registered in the frequency table 10 with the frequency generated at the frequency hopping transceiver 11 in accordance with the types of the transmitted packets . the signals are restored at a hop frequency generated by means of the relevant frequency hopping method from the finally received signals . that is , in case of the acl link , the master unit and the slave units in the piconet adopt the channel selection scheme in which a long packet is assigned to a good channel and a short packet is assigned to a bad channel by using the registered frequency table 10 . meanwhile , in case of the sco link , the channel avoidance scheme , in which voice information is transmitted through a good channel by avoiding a bad channel where the interference exists , is adopted . the channel selection scheme maximizes the data throughput of total users by transmitting data of the users as little as possible using a segment type 1 or 2 packet for rf channels with high packet error probability , and transmitting a segment type 3 or 4 packet for rf channels with good quality . in a process of packetizing the data of the user to be transmitted , the acl link can generate a proper type of packet by comparing the sequence of the frequency hopping transceiver 11 with the quality of the rf channel stored in the frequency table 10 . that is , in case of the frequency band corresponding to the bad channel , a short packet of 1 time slot , such as dm 1 ( dm : data medium ) of segment type 1 , which ⅔ forward error check ( fec ) is applied is generated . in case of the good channel , a relatively long packet of 3 or 5 time slots such as dh 3 ( dh : data high ), dh 5 , dm 3 and dm 5 of segment type 3 and segment type 4 is assigned thereto . this channel selection scheme of the acl link is performed using a link manager and a link controller of the bluetooth unit which controls the generation of the packets . generally , while a connection is established , the transmitters and the receivers of the master unit and the slave units hop onto new frequencies at every 625 μs . a channel is divided into 625 μs time slots according to the clocks of the master unit , and each time slot is numbered . according to the tdd scheme , the master unit transmits the data in even - numbered time slot and the slave units transmit the data in odd - numbered time slot . the link controller of the master unit and the slave unit obtain the channel quality information from the frequency table for the hop frequency generated at the frequency hopping transceiver at each transmission time slot . the link controller transfers the information on the quality of the rf channel to the link manager . furthermore , the channel selection scheme may be used in association with a power control scheme of the bluetooth . a receiving bluetooth unit can request a counterpart unit to increase or decrease the transmission power if difference between the measured rssi value and the threshold value is large . this power control message is defined in the link manager protocol in the existing bluetooth specification . in the adaptive frequency hopping method of the acl link , if the rf channel quality is bad , the packets are transmitted using the channel selection scheme with the increased transmission power . however , the power controlling method is not applied to all bad channels . the power control scheme is used in association with the channel selection scheme when the interference level of the bad channel stored in the frequency table is lower than the threshold value . establishing the connection of sco links , the link manager assigns the slots at intervals of t sco ( t sco is a unit time in which the master unit and the slave units can hop onto all frequency bands ) based on acl link . accordingly , since the type of the packet to be used is predetermined , an rf channel changing scheme is more advantageous than the channel selection scheme which changes the type of the packet according to the channel condition . upon reception and transmission of the signals , if the rf channel generated at the frequency hopping transceiver 11 is a bad channel stored in the frequency table 10 , the frequency band used upon reception and transmission of the signals is determined by changing the hop frequency into the good channel . in the channel selection scheme of the acl link , a transmitting bluetooth unit determines the type of the packet by estimating the channel quality of the hop frequency . however , in the channel avoidance scheme , both the transmitting and receiving unit must estimate the channel quality and hop onto an identical rf channel among the good channels . at this time , a good channel mapper determines which channel among the good channels is to be used . the implementation complexity of the channel avoidance scheme is affected by an implementation method of the good channel mapper . in order to meet the characteristics of the bluetooth such as simplicity , the good channel mapper is also implemented as a simple architecture which can use the conventional bluetooth specification . when the hop frequency is a bad channel , the good channel mapper uses a hop frequency that last hopped onto the good channel . assuming that the frequency band of the interference signals which can interfere with the bluetooth system is 20 – 30 mhz , in practice , the probability in which the hop sequence generated at the frequency hopping transceiver 11 will consecutively be assigned to three or more bad channels is low . therefore , even if the frequency assigned to the bad channel is replaced with a hop frequency last assigned to the good channel , the random property of the hop sequence is rarely affected . upon implementation thereof , the link controller updates only a register for storing the hop frequency last assigned to the good channel , and if the rf channel generated at the frequency hopping transceiver is a bad channel as the result of the comparison with the frequency table , the link controller simply uses the channel stored in the register . the master unit transmits the dm x ( x = 1 , 2 , 3 ) packets , and the slave units transmit the dm y ( y = 1 , 2 , 3 ) packets . the throughput p sco of the conventional frequency hopping system and the adaptive frequency hopping system for the sco link is given in accordance with hv z ( hv : high - quality voice , z = 1 , 2 , 3 ) of each sco packet as follows : where p t is a probability of successful transmission of the packet . each p t for the conventional frequency hopping system and the adaptive frequency hopping system according to the present invention can be expressed as the following equations 2 and 3 , respectively . where nba is the number of occurrence of good channel erroneously estimated as bad channels and nga is the number of occurrence of bad channels erroneously estimated as good channels . meanwhile , the throughput p acl of the acl link can be expressed as follows : p acl =( 1600 / w )·( p t 2 + p t 3 ) ( 4 ) the probability of successful transmission of the packet is p t = ng / nh , and w for the conventional frequency hopping system and the adaptive frequency hopping system of the present invention can be expressed as the following equations 5 and 6 , respectively . w = 2 ·( nb − nga + nba )/ nh + ( x + y )·( nh − nb + nga − nba )/ nh ( 6 ) considering the length of the packet , the data rate can be expressed as follows : r acl =( 1600 / w )· p t ·( 1 + p t )·[( nba / nh )· l 1 +{( nh − nb − nba )/ nn }· l 3 / 5 ] ( 7 ) where l 3 / 5 means l 3 or l 5 , and li is data length of dm i packet ( i = 1 , 3 or 5 ). fig3 and 4 are graphs illustrating the respective performances of the sco and acl links . as shown in fig3 and 4 , the adaptive frequency hopping system represents the improved data rate for both the sco and acl links . furthermore , the graphs show that as the channel estimation error pg = nba / ng and pb = nga / nb increase , the data rate decreases . the proposed adaptive frequency hopping scheme monitors the frequency channel quality so that the transmission packet can be less affected by an interference component . therefore , the entire data rate can be improved .	7
accordingly , the present invention relates to the compounds of the general formula ( i ) represented below and their pharmaceutically acceptable salts , enantiomers and their diastereomers ; wherein , v , w , x , y & amp ; z independently represents , ‘ c ’ or ‘ n ’; r 1 , represents groups selected from hydrogen , keto , halogen , unsubstituted or substituted groups selected from cyano , alkyl , haloalkyl , aryl , alkoxy , acyloxy , aryloxy , arylalkyl , heteroaryl , heterocyclyl , heterocycloalkyl , cycloalkyl , cycloalkylalkyl , aryloxyaryl , aryloxyalkyl , aryloxyheteroaryl groups ; wherein r 3 at each occurrence is independently selected from hydrogen , haloalkyl , c 1 - 7 alkyl , c 2 - 7 alkenyl , c 2 - 7 alkynyl , aryl , cycloalkyl , heterocycloalkyl , cycloalkyl ( c 1 - 7 ) alkyl , heterocycloalkyl ( c 1 - 7 ) alkyl , c ( o ) nh ( c 1 - 7 ) alkyl , c ( o )— ch ═ ch 2 , c ( o )— ch ═ ch — r 4 , c ( o )— c ( cn )═ ch 2 , c ( o )— c ( cn )═ ch — r 4 , so 2 — nh ( c 1 - 7 ) alkyl , so 2 — ch ═ ch 2 , so 2 — ch ═ ch — r 4 groups ; r 4 is selected from —( ch 2 ) n - nr 5 r 6 ; wherein , n = 0 - 7 and each of r 5 and r 6 are independently selected from hydrogen , haloalkyl , c 1 - 7 alkyl , c 2 - 7 alkenyl , c 2 - 7 alkynyl , aryl , cycloalkyl , carbocycle , heterocycloalkyl , cycloalkyl ( c 1 - 7 ) alkyl , heterocycloalkyl ( c 1 - 7 ) alkyl ; ‘ u ’ represent unsubstituted or substituted groups selected from alkyl , alkenyl , alkynyl , alkoxy , acyloxy , aryl , aryloxy , arylalkyl , cycloalkyl , cycloalkylalkyl , biaryl , heteroaryl , heterocycle , heterocycloalkyl , o - aryl , o - cycloalkyl , o - heteroaryl , o - heterocycle , o - heterocycloalkyl , aryloxyaryl , aryloxyalkyl , aryloxyheteroaryl , heteroaryloxyaryl , heteroaryl oxyalkyl , heteroaryloxyheteroaryl , ph - co — n ( r 7 r 8 ), ph - n ( r 9 )— co — r 10 , wherein , r 7 , r 8 and r 10 are independently selected from hydrogen , halogen , alkyl , haloalkyl , alkoxy ; aryl , cycloalkyl , heteroaryl , heterocycloalkyl ; further substituted with halogen , alkyl , alkoxy , haloalkoxy groups and r 9 are independently selected from hydrogen , c 1 - 7 alkyl , c 2 - 7 alkenyl , c 2 - 7 alkynyl . in a preferred embodiment , the groups , radicals described above may be selected from : “ alkyl ”, as well as other groups having the prefix “ alk ”, such as alkoxy and alkanoyl , means a carbon chain which may further be substituted with an oxygen atom as is well understood by a skilled artisan , which may further be either linear or branched , and combinations thereof , unless the carbon chain is defined otherwise . examples of alkyl group include but not are limited to methyl , ethyl , propyl , isopropyl , butyl , sec - butyl , tert .- butyl , pentyl , hexyl etc . where the specified number of carbon atoms permits e . g . from c 3 - 10 , the term alkyl also includes cycloalkyl groups , and combinations of linear or branched alkyl chains combined with cycloalkyl structures . when no number of carbon atoms is specified , c 1 - 6 is intended . “ alkenyl ” means carbon chains which contain at least one carbon - carbon double bond , and which may be linear or branched or combinations thereof , unless the carbon chain is defined otherwise . examples of alkenyl include vinyl , allyl , isopropenyl , hexenyl , pentenyl , heptenyl , 1 - propenyl , 2 - butenyl , 2 - methyl - 2 - butenyl etc . where the specified number of carbon atoms permits , e . g ., from c 5 - 10 , the term alkenyl also includes cycloalkenyl groups and combinations of linear , branched and cyclic structures . when no number of carbon atoms is specified , c ( 2 - 6 ) is intended . “ alkynyl ” means carbon chains which contain at least one carbon - carbon triple bond , and which may be linear or branched or combinations thereof . examples of alkynyl include ethynyl , propargyl , 3 - methyl - 1 - pentynyl etc . when no number of carbon atoms is specified , c ( 2 - 6 ) is intended . as used herein , “ carbocycle ” or “ carbocyclic residue ” is intended to mean any stable monocyclic or bicyclic or tricyclic ring , any of which may be saturated , partially unsaturated , or aromatic . examples of such carbocycles includecyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl , adamantyl , cyclooctyl , [ 3 . 3 . 0 ] bicyclooctane , [ 4 . 3 . 0 ] bicyclononane , [ 4 . 4 . 0 ] bicyclodecane ( decalin ), [ 2 . 2 . 2 ] bicyclooctane , fluorenyl , phenyl , naphthyl , indanyl , adamantyl , or tetrahydronaphthyl ( tetralin ). in a broader perspective , the term carbocycle is intended to include , wherever applicable , the groups representing cycloalkyl , phenyl and other saturated , partially saturated or aromatic residues ; “ cycloalkyl ” is the subset of alkyl and means saturated carbocyclic ring having a specified number of carbon atoms , preferably 3 - 6 carbon atoms . examples of cycloalkyl include cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl etc . a cycloalkyl group generally is monocyclic unless otherwise stated . cycloalkyl groups are saturated unless and otherwise stated . the “ alkoxy ” refers to the straight or branched chain alkoxides of the number of carbon atoms specified . “ aryl ” means a mono - or polycyclic aromatic ring system containing carbon ring atoms . the preferred aryls are monocyclic or bicyclic 6 - 10 membered aromatic ring systems . phenyl and naphthyl are preferred aryls . the terms “ heterocycle ” or “ heterocyclyl ” refer to saturated or unsaturated non - aromatic rings or ring systems containing at least one heteroatom selected from o , s , n further optionally including the oxidized forms of sulfur , namely so & amp ; so 2 . examples of heterocycles include tetrahydrofuran ( thf ), dihydrofuran , 1 , 4 - dioxane , morpholine , 1 , 4 - dithiane , piperazine , piperidine , 1 , 3 - dioxolane , imidazoline , imidazolidine , pyrrolidine , pyrroline , tetrahydropyran , dihydropyran , oxathiolane , dithiolane , 1 , 3 - dioxane , 1 , 3 - dithiane , oxathiane , thiomorpholine , etc . the term “ heterocycloalkyl ” refers to a heterocyclic group as defined above connected to an alkyl group as defined above ; “ heteroaryl ” means an aromatic or partially aromatic heterocycle that contains at least one ring heteroatom selected from o , s and n . heteroaryls thus include heteroaryls fused to the other kinds of rings , such as aryls , cycloalkyls , and heterocycles that are not aromatic . examples of heteroaryl groups include ; pyrrolyl , isoxazolyl , isothiazolyl , pyrazolyl , pyridyl , oxazolyl , oxadiazolyl , thiadiazolyl , thiazolyl , imidazolyl , triazolyl , tetrazolyl , furyl , triazinyl , thienyl , pyrimidyl , benzisoxazolyl , benzoxazolyl , benzthiazolyl , benzothiadiazolyl , dihydrobenzofuranyl , indolinyl , pyridazinyl , indazolyl , isoindolyl , dihydrobenzothienyl , indolinyl , pyridazinyl , indazolyl , isoindolyl , dihydrobenzothienyl , indolizinyl , cinnolinyl , phthalazinyl , quinazolinyl , napthyridinyl , carbazolyl , benzodioxolyl , quinoxalinyl , purinyl , furazanyl , isobenzylfuranyl , benzimidazolyl , benzofuranyl , benzothienyl , quinolyl , indolyl , isoquinolyl , dibenzofuranyl etc . for heterocyclyl and heteroaryl groups , rings and ring systems containing from 3 - 15 carbon atoms are included , forming 1 - 3 rings . an “ aryloxy ” group used either alone or in combination with other radicals , is selected from groups containing an aryl radical , as defined above , attached directly to an oxygen atom , more preferably groups selected from phenoxy , naphthyloxy , tetrahydronaphthyloxy , biphenyloxy , and the like ; “ cycloalkylalkyl ” means an alkyl radical substituted with cycloalkyl group as defined herein . cycloalkylalkyl groups include cyclopropylmethyl , cyclobutylmethyl , cyclopentylmethyl , cyclohexylmethyl , and the like . an “ arylalkyl ” group as used herein is an aromatic substituent that is linked to an alkyl group having from one to about six carbon atoms . examples of arylalkyl groups include benzyl group , phenethyl and the like . the “ acyloxy ” group used either alone or in combination with other radicals , is selected from a suitable acyl group , directly attached to an oxygen atom ; more preferably such groups are selected from acetyloxy , propionyloxy , butanoyloxy , iso - butanoyloxy , benzoyloxy and the like ; the term “ haloalkyl “ means a alkyl structure in which at least one hydrogen is replaced with a halogen atom . in certain embodiments in which two or more hydrogen atoms are replaced with halogen atoms , the halogen atoms are all the same as one another . in certain other embodiment in which two or more hydrogen atoms are replaced with halogen atoms , the halogen atoms are not all the same as one another . “ aryloxyalkyl ” means an alkyl radical substituted with aryloxy group as defined herein . “ aryloxyaryl ” means an aryl radical substituted with aryloxy group as defined herein . “ aryloxyheteroaryl ” means a heteroaryl radical substituted with aryloxy group as defined herein . “ halo / halogen ” refers to fluorine , chlorine , bromine , iodine . chlorine and fluorine are generally preferred . suitable groups and substituents on the groups may be selected from those described anywhere in the specification . the term “ substituted ,” as used herein , means that any one or more hydrogens on the designated atom is replaced with a selection from the indicated group , provided that the designated atom &# 39 ; s normal valency is not exceeded , and that the substitution results in a stable compound . the term “ substituted ,” as used herein , means that any one or more hydrogens on the designated atom is replaced with a selection from the indicated group , provided that the designated atom &# 39 ; s normal valency is not exceeded , and that the substitution results in a stable compound . “ pharmaceutically acceptable salts ” refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof . examples of pharmaceutically acceptable salts include mineral or organic acid salts of the basic residues . such conventional non - toxic salts include those derived from inorganic and organic acids selected from 1 , 2 - ethanedisulfonic , 2 - acetoxybenzoic , 2 - hydroxyethanesulfonic , acetic , ascorbic , benzenesulfonic , benzoic , bicarbonic , carbonic , citric , edetic , ethane disulfonic , ethane sulfonic , fumaric , glucoheptonic , gluconic , glutamic , glycolic , glycollyarsanilic , hexylresorcinic , hydrabamic , hydrobromic , hydrochloric , hydroiodide , hydroxymaleic , hydroxynaphthoic , isethionic , lactic , lactobionic , lauryl sulfonic , maleic , malic , mandelic , methanesulfonic , napsylic , nitric , oxalic , pamoic , pantothenic , phenyl acetic , phosphoric , polygalacturonic , propionic , salicyclic , stearic , subacetic , succinic , sulfamic , sulfanilic , sulfuric , tannic , tartaric , and toluenesulfonic . the term ‘ optional ’ or ‘ optionally ’ means that the subsequent described event or circumstance may or may not occur , and the description includes instances where the event or circumstance occur and instances in which it does not . for example , ‘ optionally substituted alkyl ’ means either ‘ alkyl ’ or ‘ substituted alkyl ’. further an optionally substituted group includes an unsubstituted group . unless otherwise stated in the specification , structures depicted herein are also meant to include compounds which differ only in the presence of one or more isotopically enriched atoms . the novel compounds of the present invention can be prepared using the reactions and techniques described below , together with conventional techniques known to those skilled in the art of organic synthesis , or variations thereon as appreciated by those skilled in the art . the reactions can be performed in solvents appropriate to the reagents and materials employed and suitable for the transformations being affected . preferred methods include those described below , where all symbols are as defined earlier unless and otherwise defined below . the compounds of the formula ( i ) can be prepared as described in schemes below along with suitable modifications / variations which are well within the scope of a person skilled in the art . wherein ‘ u ’, r 2 and r 3 are as defined earlier . compound of formula ( i ) can be prepared by variety of methods familiar to those skilled in art . compound of formula ( i ) was transformed into compound ( ii ) by reacted with hydrazine hydrate ( scheme - i ). compound of formula ( ii ) was cyclized using formamide to afford the compound of formula ( iii ). compound ( iii ) was reacted with n - iodosuccinimide to get compound ( iv ). compound ( iv ) reacted with compound ( v ) using different base to furnish the compound of formula ( vi ). compound ( vi ) can subjected to suzuki type of reaction , with compound ( vii ) using suitable catalysts , base and appropriate solvents to obtain compound of formula ( viii ). the deprotection of compound ( viii ) gives compound ( ix ). compound ( ix ) is reacted with optionally substituted acid chlorides ( x ) to obtain compounds of formula ( i ). the examples and preparations provided below further illustrate and exemplify the compounds of the present invention and methods of preparing such compounds . in the following examples molecules with a single chiral center , unless otherwise noted , exist as a racemic mixture . those molecules with two or more chiral centers , unless otherwise noted , exist as a racemic mixture of diastereomers . single enantiomers / diastereomers may be obtained by methods known to those skilled in the art . the compounds of formula ( i ) may also be synthesized as described in scheme ii . wherein ‘ u ’, r 2 and r 3 are as defined earlier . compound ( i ) may be continently prepared by variety of methods familiar to those skilled in art . compound ( i ) was transformed into compound ( ii ) by reacting with dibenzyl amine using different bases . compound of formula ( ii ) was reacted with different protected cycloalkyl amines ( iii ) using suitable bases to furnish compound ( iv ). compound ( iv ) was reduced to amine to afford the compound ( v ). compound ( v ) was reacted with triphosgene to get the compound ( vi ). compound ( vi ) was deprotected to using pd ( oh ) 2 to afford compound ( vii ). compound ( vii ) was reacted with different boronic acid to obtain compound ( viii ). compound ( viii ) was deproted using suitable acid to get the compound ( ix ). compound ( ix ) was reacted with optionally substituted acid chlorides using base to obtain compound of formula ( i ). the compounds of formula ( i ) may also be synthesized as described in scheme iii wherein ‘ u ’, r 2 and r 3 are as defined earlier . compound ( i ) may be continently prepared by variety of methods familiar to those skilled in art . compound ( i ) was transformed into compound ( ii ) using ammonia . compound ( ii ) reacted with compound ( iii ) using different base to furnish the compound of formula ( iv ). compound ( iv ) can be subjected to suzuki type of reaction , with compound ( v ) using suitable catalysts , base and appropriate solvents to obtain compound of formula ( vi ). compound ( vi ) can be halogenated to afford compound ( vii ). the deprotection of compound ( vii ) gives compound ( viii ). compound ( viii ) is reacted with optionally substituted acid chlorides to obtain compounds of formula ( i ). compounds of the present invention can be isolated either as free amine form or as a salt corresponding to the acid used such as trifluoroacetic acid , hydrochloric acid , hydrobromic acid , oxalic acid , maleic acid , fumeric acid , succinic acid , p - toluene sulfonic acid or benzene sulfonic acid . the compounds can be purified where ever required , by recrystallization , trituration , precipitation , preparative thin layer chromatography , flash chromatography or by preparative hplc method . the compounds of the present invention can be used either alone or in combination with one or more therapeutic agents or pharmaceutically acceptable salts thereof . such use will depend on the condition of the patient being treated and is well within the scope of a skilled practitioner . the invention is further illustrated by the following examples which describe the preferred way of carrying out the present invention . these are provided without limiting the scope of the present invention in any way . 1 h nmr spectral data given in the examples ( vide infra ) are recorded using a 400 mhz spectrometer ( bruker avance - 400 ) and reported in δ scale . until and otherwise mentioned the solvent used for nmr is cdcl 3 using tms as the internal standard . synthesis of titled compound was carried out , as described in scheme - iv and step - wise procedure is described below . intermediate 1 ( 2 . 0 g , 7 . 66 mmol ), prepared as per general process disclosed in us 2012 / 0088912 and triphenylphosphine ( 6 . 53 g ) were mixed together , in thf ( 20 ml ). tert - butyl 5 - hydroxyhexahydrocyclopenta [ c ] pyrrole - 2 ( 1h )- carboxylate 2 ( 3 . 47 g , 15 . 32 mmol ) was added to the mixture followed by the addition of diisopropyl diazodicarboxylate ( 2 . 26 ml , 11 . 49 mmol ). the reaction mixture was stirred at room temperature overnight , filtered and concentrated . the residue obtained was purified by flash chromatography ( ch 2 cl 2 / meoh = 98 / 2 ) to get intermediate 3 as a white solid ( 2 . 75 g , 76 % yield ). 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 1 . 40 ( s , 9h ), 1 . 94 - 2 . 00 ( m , 2h ), 2 . 17 - 2 . 24 ( m , 2h ), 2 . 82 - 3 . 00 ( m , 2h ), 3 . 10 - 3 . 14 ( m , 2h ), 3 . 45 - 3 . 50 ( m , 2h ), 5 . 27 - 5 . 30 ( m , 1h ), 8 . 29 ( s , 1h ). ms ( esi - ms ): m / z 471 . 10 ( m + h ) + . to a stirred solution intermediate 3 ( 2 . 7 g , 5 . 74 mmol ), dissolved in dry dmf ( 27 ml ), pdcl 2 ( pph 3 ) 2 ( 0 . 4 g , 0 . 57 mmol ), 4 - phenoxyphenylboronicacid 4 ( 1 . 84 g , 8 . 61 mmol ) and khco 3 ( 3 . 44 g , 34 . 46 mmol ) was added . the reaction mixture was heated at 90 ° c . for 2 hrs , under n2 atmosphere . mixture was cooled to room temperature , diluted with water ( 50 ml ) and extracted with etoac ( 3 × 50 ml ). the combined organic layer was washed with water ( 2 × 25 ml ) and brine solution ( 25 ml ), dried over na 2 so 4 , and concentrated to dryness . the residue obtained was purified by column chromatography ( using 0 - 5 % methanol in dcm as a mobile phase ) to obtain intermediate 5 as an off white solid ( 2 . 2 g , 74 % yield ). 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 1 . 48 ( s , 9h ), 1 . 98 - 2 . 04 ( m , 2h ), 2 . 27 - 2 . 34 ( m , 2h ), 2 . 89 ( s , 2h ), 3 . 13 - 3 . 17 ( m , 2h ), 3 . 47 ( q , 2h , j = 8 . 0 hz ), 5 . 36 ( q , 1h , j = 8 . 0 hz ), 7 . 10 - 7 . 14 ( m , 4h ), 7 . 144 - 7 . 20 ( m , 1h ), 7 . 40 - 7 . 43 ( m , 2h ), 7 . 65 - 7 . 68 ( m , 2h ), 8 . 23 ( s , 1h ). esi - ms ( esi - ms ): m / z 535 . 23 ( m + na ) + . to a solution of intermediate 5 ( 2 . 1 g , 4 . 09 mmol ) in ch 2 cl 2 ( 40 ml ) was added tfa ( 1 . 25 ml , 16 . 37 mmol ). after stirring 2 hrs at room temperature , the solvent was removed and the residues were dissolved in a mixture of ethyl acetate ( 50 ml ) and dilute aq . k 2 co 3 . the organic layer was separated , dried over mgso 4 , filtered and concentrated to provide intermediate 6 as a white solid ( 1 . 2 g , 71 % yield ). 1 h nmr ( 400 mhz ) δ ppm : 1 . 92 - 1 . 96 ( m , 2h ), 2 . 31 - 2 . 39 ( m , 2h ), 2 . 74 - 2 . 78 ( m , 2h ), 2 . 89 - 2 . 30 ( m , 2h ), 3 . 12 - 3 . 20 ( m , 2h ), 5 . 43 - 5 . 37 ( m , 1h ), 7 . 11 - 7 . 20 ( m , 5h ), 7 . 41 - 7 . 45 ( m , 2h ), 7 . 64 - 7 . 66 ( m , 2h ), 8 . 24 ( s , 1h ); ms ( esi - ms ): m / z 413 . 20 ( m + h ) + . to a solution of intermediate 6 ( 1 . 1 g , 2 . 66 mmol ), dissolved in ch 2 cl 2 ( 30 ml ), tri - ethyl amine ( 1 . 11 ml , 8 . 00 mmol ) was added followed by addition of acryl chloride ( 0 . 2 ml , 2 . 53 mmol ). the reaction was stopped after 2 hrs . the reaction mixture was washed with water and then with brine . the organic layer was separated , dried over mgso 4 , filtered and concentrated . residue obtained was purified by flash chromatography ( using ch 2 cl 2 / meoh = 25 / 1 , as a mobile phase ) to get compound 1 as a white solid ( 0 . 75 g , 60 % yield ). 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 36 ( s , 1h ), 7 . 66 - 7 . 62 ( m , 2h ), 7 . 37 - 7 . 41 ( m , 2h ), 7 . 13 - 7 . 20 ( s , 3h ), 7 . 07 - 7 . 09 ( m , 2h ), 6 . 36 - 6 . 50 ( m , 2h ), 5 . 68 - 5 . 71 ( m , 1h ), 5 . 53 - 5 . 59 ( m , 3h ), 3 . 82 - 3 . 87 ( m , 2h ), 3 . 45 - 3 . 53 ( m , 2h ), 3 . 10 - 3 . 21 ( m , 2h ), 2 . 50 - 2 . 58 ( m , 2h ), 2 . 11 - 2 . 17 ( m , 2h ); esi - ms : (+ ve mode ) 467 . 20 ( m + h ) + ( 100 %); uplc : 98 . 09 %. synthesis of titled compound was carried out , as described in scheme - v and step - wise procedure is described below . intermediate 1 ( 0 . 22 g , 0 . 851 mmol ) and triphenylphosphine ( 0 . 71 g ) were mixed together in thf ( 10 ml ). tert - butyl 5 - hydroxyhexahydrocyclopenta [ c ] pyrrole - 2 ( 1h )- carboxylate 2 ( 0 . 38 g , 1 . 7 mmol ) was added to the reaction mixture followed by the addition of diisopropyl diazodicarboxylate ( 0 . 24 ml , 1 . 22 mmol ). the reaction mixture was stirred at room temperature overnight , filtered and concentrated . the residue obtained was purified by flash chromatography ( ch 2 cl 2 / meoh = 98 / 2 ) to get intermediate 3 as a white solid ( 0 . 3 g , 76 % yield ). 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 1 . 40 ( s , 9h ), 1 . 94 - 2 . 00 ( m , 2h ), 2 . 17 - 2 . 24 ( m , 2h ), 2 . 82 - 3 . 00 ( m , 2h ), 3 . 10 - 3 . 14 ( m , 2h ), 3 . 45 - 3 . 50 ( m , 2h ), 5 . 27 - 5 . 30 ( m , 1h ), 8 . 29 ( s , 1h ). ms ( esi - ms ): m / z 471 . 10 ( m + h ) + . to a stirred solution of intermediate 3 ( 0 . 3 g , 0 . 638 mmol ), dissolved in dry dmf ( 3 ml ) were added pdcl 2 ( pph 3 ) 2 ( 0 . 089 g , 0 . 127 mmol ), ( 4 -( pyridin - 2 - ylcarbamoyl ) phenyl ) boronic acid 4 ( 0 . 31 g , 0 . 95 mmol ) and khco 3 ( 0 . 340 g , 3 . 56 mmol ). the reaction mixture was heated at 90 ° c . for 2 hrs , under n2 atmosphere . mixture was cooled to room temperature , diluted with water ( 50 ml ) and extracted with etoac ( 3 × 50 ml ). the combined organic layer was washed with water ( 2 × 25 ml ) and brine solution ( 25 ml ), dried over na 2 so 4 and concentrated to dryness . the residue obtained was purified by column chromatography ( silica gel , 0 - 5 % methanol in dcm ) to obtain intermediate 5 as an off white solid ( 0 . 25 g , 72 . 56 % yield ). 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 1 . 59 ( s , 9h ), 2 . 11 - 2 . 17 ( m , 2h ), 2 . 49 - 2 . 57 ( m , 2h ), 3 . 07 - 3 . 09 ( m , 2h ), 3 . 28 ( bs , 2h ), 3 . 64 ( bs , 2h ), 5 . 55 ( q , 1h , j = 8 . 0 hz ), 7 . 11 ( q , 1h , j = 8 . 0 hz ), 7 . 78 - 7 . 81 ( m , 1h ), 7 . 82 ( m , 2h ), 8 . 10 ( d , 2h , j = 8 . 0 hz ), 8 . 35 ( m , 1h ), 8 . 41 - 8 . 43 ( m , 2h ), 8 . 63 ( s , 1h ). esi - ms ( esi - ms ): m / z 541 . 41 ( m + h ) + . to a solution of intermediate 5 ( 0 . 25 g , 0 . 462 mmol ) in ch 2 cl 2 ( 10 ml ), tfa ( 1 . 0 ml , 15 . 87 mmol ) was added and the reaction mixture was stirred for 2 hrs at room temperature . the solvent was removed and the residue obtained was dissolved in a mixture of ethyl acetate ( 50 ml ) and dilute aq . k 2 co 3 . the organic layer was dried over mgso 4 , filtered and concentrated to get intermediate 6 as a white solid ( 0 . 13 g , 63 . 85 % yield ). 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 1 . 15 - 1 . 23 ( m , 2h ), 2 . 32 - 2 . 37 ( m , 2h ), 2 . 54 - 2 . 58 ( m , 2h ), 2 . 93 - 2 . 97 ( m , 2h ), 3 . 24 - 3 . 29 ( m , 2h ), 5 . 33 - 5 . 37 ( m , 1h ), 7 . 16 - 7 . 19 ( m , 1h ), 7 . 77 ( q , 2h , j = 12 . 0 hz ), 7 . 84 - 7 . 88 ( m , 1h ), 8 . 18 - 8 . 20 ( m , 2h ), 8 . 22 - 8 . 24 ( m , 1h ), 8 . 25 - 8 . 30 ( m , 1h ), 8 . 40 - 8 . 41 ( m , 1h ), 10 . 83 ( s , 1h ); ms ( esi - ms ): m / z 441 . 15 ( m + h ) + . to a solution of intermediate 6 ( 0 . 13 g , 0 . 295 mmol ), dissolved in ch 2 cl 2 ( 30 ml ) and tri - ethyl amine ( 0 . 090 g , 0 . 886 mmol ), acryl chloride ( 0 . 026 g , 0 . 295 mmol ) was added and the reaction mixture was stirred for 2 hrs . the reaction mixture was washed with water and brine solution . the organic layer was dried over mgso 4 , filtered , concentrated and residue obtained was purified by flash chromatography , using ch 2 cl 2 / meoh ( 25 / 1 ) to get compound 13 as a white solid ( 0 . 03 g , 20 . 58 % yield ). 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 72 ( s , 1h ), 8 . 43 ( d , 1h , j = 6 . 4 hz ), 8 . 39 ( s , 1h ), 8 . 35 - 8 . 34 ( m , 1h ), 8 . 13 ( d , 2h , j = 8 . 4 hz ), 7 . 88 ( d , 2h , j = 8 . 4 hz ), 7 . 83 - 7 . 79 ( m , 1h ), 7 . 14 - 7 . 11 ( m , 1h ), 6 . 49 ( dd , 1h , j 1 = 10 . 0 hz , j 2 = 16 . 8 hz ), 6 . 42 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 72 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 10 . 0 hz ), 5 . 61 - 5 . 55 ( m , 3h ), 3 . 89 - 3 . 84 ( m , 2h ), 3 . 57 - 3 . 47 ( m , 2h ), 3 . 24 - 3 . 21 ( m , 1h ), 315 - 3 . 12 ( m , 1h ), 2 . 60 - 2 . 52 ( m , 2h ), 2 . 21 - 2 . 14 ( m , 1h ); esi - ms : (+ ve mode ) 495 . 4 ( m + h ) + ( 100 %); hplc : 99 . 09 . 1 h nmr : ( cdcl 3 , 400 mhz ): δ 9 . 11 ( s , 1h ), 8 . 41 ( s , 1h ), 8 . 34 - 8 . 30 ( m , 2h ), 7 . 87 ( dd , 1h , = 1 . 6 hz , j 2 = 8 . 4 hz ), 6 . 49 ( dd , 1h , = 9 . 6 hz , j 2 = 16 . 8 hz ), 6 . 42 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 16 . 8 hz ), 5 . 72 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 9 . 6 hz ), 5 . 64 - 5 . 57 ( m , 1h ), 5 . 50 ( bs , 2h ), 3 . 89 - 3 . 84 ( m , 2h ), 3 . 57 - 3 . 47 ( m , 2h ), 3 . 25 - 3 . 20 ( m , 1h ), 3 . 17 - 3 . 11 ( m , 1h ), 2 . 62 - 2 . 54 ( m , 2h ), 2 . 22 - 2 . 13 ( m , 2h ); esi - ms : (+ ve mode ) 431 . 9 ( m + h ) + ( 100 %); hplc : 96 . 04 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 27 ( s , 1h ), 8 . 11 - 8 . 09 ( m , 1h ), 7 . 63 - 7 . 61 ( m , 2h ), 7 . 44 - 7 . 40 ( m , 1h ), 7 . 48 - 7 . 44 ( m , 2h ), 7 . 19 - 7 . 17 ( m , 1h ), 7 . 13 - 7 . 09 ( m , 5h ), 6 . 56 - 6 . 49 ( m , 1h ), 6 . 44 - 6 . 41 ( m , 1h ), 6 . 11 - 6 . 06 ( m , 1h ), 5 . 64 - 5 . 61 ( m , 1h ), 5 . 39 ( s , 2h ), 4 . 41 - 4 . 39 ( m , 2h ), 3 . 81 - 3 . 80 ( m , 1h ), 3 . 64 - 3 . 57 ( m , 2h ), 3 . 46 - 3 . 45 ( m , 2h ), 3 . 19 - 3 . 16 ( m , 2h ); esi - ms : (+ ve mode ) 559 . 35 ( m + h ) + ( 100 %); hplc : 95 . 82 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 37 ( s , 1h ), 7 . 65 ( dd , 2h , j 1 = 2 . 0 hz , j 2 = 6 . 4 hz ), 7 . 40 ( t , 2h , j = 4 . 4 hz ), 7 . 18 - 7 . 13 ( m , 3h ), 7 . 09 ( d , 2h , j = 7 . 6 hz ), 6 . 37 - 6 . 27 ( m , 2h ), 5 . 61 ( dd , 1h , j 1 = 3 . 6 hz , j 2 = 9 . 2 hz ), 5 . 41 ( bs , 2h ), 3 . 79 - 3 . 68 ( m , 2h ), 3 . 35 ( dd , 1h , = 4 . 8 hz , j 2 = 12 . 8 hz ), 3 . 27 ( dd , 1h , = 4 . 8 hz , j 2 = 10 . 4 hz ), 3 . 08 - 3 . 05 ( m , 1h ), 2 . 96 ( t , 1h , j = 6 . 0 hz ), 2 . 89 - 2 . 86 ( m , 1h ), 2 . 77 - 2 . 75 ( m , 1h ), 2 . 70 - 2 . 57 ( m , 4h ); esi - ms : (+ ve mode ) 496 . 15 ( m + h ) + ( 100 %); hplc : 96 . 62 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 40 ( s , 1h ), 8 . 19 ( d , 1h , j = 2 . 0 hz ), 8 . 12 ( d , 1h , j = 8 . 4 hz ), 7 . 77 ( dd , 1h , = 2 . 0 hz , j 2 = 8 . 4 hz ), 6 . 49 ( dd , 1h , = 10 . 0 hz , j 2 = 16 . 8 hz ), 6 . 42 ( dd , 1h , = 2 . 8 hz , j 2 = 16 . 8 hz ), 5 . 72 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 9 . 6 hz ), 5 . 61 - 5 . 57 ( m , 1h ), 5 . 31 ( bs , 2h ), 3 . 89 - 3 . 83 ( m , 2h ), 3 . 56 - 3 . 47 ( m , 2h ), 3 . 24 - 3 . 22 ( m , 1h ), 3 . 14 - 3 . 12 ( m , 1h ), 2 . 91 ( s , 3h ), 2 . 59 - 2 . 55 ( m , 2h ), 2 . 19 - 2 . 14 ( m , 2h ); esi - ms : (+ ve mode ) 446 . 0 ( m + h ) + ( 100 %); hplc : 95 . 09 %. 1 h nmr : ( dmso , 400 mhz ): δ 8 . 24 ( s , 1h ), 8 . 16 ( dd , 2h , j 1 = 6 . 0 hz , j 2 = 4 . 4 hz ), 7 . 85 ( d , 1h , j = 5 . 6 hz ), 7 . 65 ( dd , 1h , j 1 = 8 . 4 hz , j 2 = 1 . 6 hz ), 7 . 56 ( d , 1h , j = 5 . 2 hz ), 7 . 62 ( dd , 1h , j 1 = 10 . 4 hz , j 2 = 16 . 8 hz ), 6 . 14 ( dd , 1h , j 1 = 16 . 8 hz , j 2 = 2 . 4 hz ), 5 . 67 ( dd , 1h , j 1 = 10 . 0 hz , j 2 = 2 . 4 hz ), 5 . 45 - 5 . 41 ( m , 1h ), 3 . 81 - 3 . 76 ( m , 1h ), 3 . 66 - 3 . 60 ( m , 1h ), 3 . 54 - 3 . 50 ( m , 1h ), 3 . 42 - 3 . 35 ( m , 1h ), 3 . 00 - 3 . 08 ( m , 1h ), 23 . 00 - 2 . 98 ( m , 1h ), 2 . 38 - 2 . 31 ( m , 2h ), 2 . 09 - 2 . 04 ( m , 2h ); esi - ms : (+ ve mode ) 431 . 0 ( m + h ) + ( 100 %), 453 . 2 ( m + na ) + ( 25 %); uplc : 98 . 53 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 22 ( s , 1h ), 7 . 55 - 7 . 51 ( m , 2h ), 7 . 42 - 7 . 38 ( m , 2h ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 16 - 6 . 11 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 17 . 2 hz ), 5 . 68 - 5 . 66 ( m , 1h ), 5 . 64 - 5 . 39 ( m , 1h ), 3 . 42 - 3 . 40 ( m , 1h ), 3 . 39 - 3 . 37 ( m , 1h ), 3 . 35 - 3 . 35 ( m , 1h ), 3 . 32 - 3 . 30 ( m , 3h ), 3 . 10 - 2 . 83 ( m , 2h ), 2 . 82 - 2 . 80 ( m , 2h ), 2 . 33 - 2 . 29 ( m , 3h ), 2 . 04 - 2 . 03 ( m , 2h ); ( esi - ms ): (+ ve mode ) 433 . 05 ( m + h ) + ( 100 %), uplc : 95 . 80 %. 1 h nmr : ( dmso , 400 mhz ): δ 8 . 30 - 8 . 28 ( m , 1h ), 8 . 26 ( s , 1h ), 8 . 22 - 8 . 20 ( m , 1h ), 7 . 92 ( d , 1h , j = 0 . 8 hz ), 7 . 75 - 7 . 69 ( m , 2h ), 7 . 58 - 7 . 54 ( m , 1h ), 7 . 46 - 5 . 43 ( m , 1h ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 14 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 67 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 46 - 5 . 43 ( m , 1h ), 3 . 82 - 3 . 77 ( m , 1h ), 3 . 65 - 3 . 61 ( m , 1h ), 3 . 55 - 3 . 51 ( m , 1h ), 3 . 39 - 3 . 35 ( m , 1h ), 3 . 17 - 2 . 92 ( m , 2h ), 2 . 41 - 2 . 33 ( m , 2h ), 2 . 11 - 2 . 05 ( m , 2h ); esi - ms : (+ ve mode ) 465 . 1 ( m + h ) + ( 100 %), 487 . 3 ( m + na ) + ( 10 %); uplc : 95 . 50 . 1 h nmr : ( dmso , 400 mhz ): δ 12 . 41 ( s , 1h ), 8 . 24 ( s , 2h ), 8 . 87 - 8 . 85 ( m , 1h ), 7 . 69 - 7 . 67 ( m , 1h ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 14 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 14 . 4 hz ), 5 . 66 ( dd , 1h , j 1 = 1 . 2 hz , j 2 = 10 . 4 hz ), 5 . 44 - 5 . 41 ( m , 1h ), 3 . 81 - 3 . 38 ( m , 3h ), 3 . 40 - 3 . 33 ( m , 1h ), 3 . 11 - 2 . 99 ( m , 2h ), 2 . 50 - 2 . 37 ( m , 2h ), 2 . 20 ( s , 3h ), 2 . 12 - 1 . 90 ( m , 2h ); esi - ms : (+ ve mode ) 489 . 3 ( m + h ) + ( 100 %), 511 . 0 ( m + na ) + ( 10 %); uplc : 95 . 29 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 23 ( s , 1h ), 8 . 17 ( s , 1h ), 7 . 79 ( m , 1h , j = 8 . 4 hz ), 7 . 67 - 7 . 65 ( m , 1h ), 6 . 64 - 6 . 58 ( m , 1h ), 6 . 30 - 6 . 11 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 70 - 5 . 65 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 45 - 5 . 42 ( m , 1h ), 4 . 19 ( s , 3h ), 3 . 80 - 3 . 76 ( m , 1h ), 3 . 62 - 3 . 53 ( m , 1h ), 3 . 40 - 3 . 38 ( m , 1h ), 3 . 10 - 2 . 83 ( m , 1h ), 2 . 82 - 2 . 80 ( m , 2h ), 2 . 36 - 2 . 32 ( m , 2h ), 2 . 06 - 2 . 05 ( m , 2h ); ( esi - ms ): (+ ve mode ) 462 . 05 ( m + h ) + ( 100 %), uplc : 95 . 22 %, ret . time = 3 . 09 min . 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 23 ( s , 1h ), 7 . 67 - 7 . 64 ( m , 2h ), 7 . 44 - 7 . 40 ( m , 2h ), 7 . 19 - 7 . 10 ( m , 5h ), 5 . 4 ( s , 1h ), 4 . 21 - 4 . 18 ( m , 1h ), 3 . 83 - 3 . 74 ( m , 1h ), 3 . 65 - 3 . 61 ( m , 2h ), 3 . 05 - 3 . 03 ( m , 2h ), 2 . 34 - 2 . 31 ( m , 2h ), 2 . 05 - 2 . 03 ( m , 2h ); esi - ms : (+ ve mode ) 465 . 50 ( m + h ) + ( 100 %); hplc : 99 . 12 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 38 ( s , 1h ), 7 . 37 - 7 . 33 ( m , 3h ), 7 . 22 ( dd , 1h , j 1 = 8 . 0 hz , j 2 = 2 . 0 hz ), 7 . 14 - 7 . 08 ( m , 2h ), 7 . 03 ( d , 2h , j = 8 . 0 hz ), 6 . 51 - 6 . 37 ( m , 2h ), 5 . 70 ( dd , 1h , j 1 = 10 . 0 hz , j 2 = 2 . 4 hz ), 5 . 65 ( bs , 2h ), 5 . 60 - 5 . 53 ( m , 1h ), 3 . 95 ( s , 3h ), 3 . 89 - 3 . 84 ( m , 2h ), 3 . 55 - 3 . 51 ( m , 2h ), 3 . 24 - 3 . 21 ( m , 1h ), 3 . 15 - 3 . 11 ( m , 1h ), 2 . 63 - 2 . 54 ( m , 2h ), 2 . 21 - 2 . 12 ( m , 2h ); esi - ms : (+ ve mode ) 497 . 1 ( m + h ) + ( 100 %), 519 . 25 ( m + na ) + ( 50 %); uplc : 95 . 90 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 41 ( s , 1h ), 8 . 27 ( d , 1h , j = 1 . 6 hz ), 8 . 23 ( d , 1h , j = 8 . 0 hz ), 8 . 15 - 8 . 13 ( m , 2h ), 7 . 82 ( dd , 1h , j 1 = 8 . 0 hz , j 2 = 2 . 0 hz ), 7 . 56 - 7 . 53 ( m , 3h ), 6 . 52 - 6 . 38 ( m , 2h ), 5 . 70 ( dd , 1h , j 1 = 10 . 0 hz , j 2 = 2 . 0 hz ), 5 . 63 - 5 . 59 ( m , 1h ), 5 . 49 ( bs , 2h ), 3 . 90 - 3 . 84 ( m , 2h ), 3 . 57 - 3 . 48 ( m , 2h ), 3 . 25 - 3 . 22 ( m , 1h ), 3 . 17 - 3 . 14 ( m , 1h ), 2 . 63 - 2 . 55 ( m , 2h ), 2 . 22 - 2 . 13 ( m , 2h ); esi - ms : (+ ve mode ) 507 . 6 ( m + h ) + ( 100 %), 530 . 1 ( m + no + ( 30 %); uplc : 97 . 51 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 21 ( s , 1h ), 7 . 15 - 7 . 13 ( m , 1h ), 7 . 12 - 7 . 10 ( m , 1h ), 7 . 09 - 7 . 07 ( m , 1h ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 16 - 6 . 12 ( m , 1h ), 6 . 11 ( s , 2h ), 5 . 68 - 5 . 64 ( m , 1h ), 5 . 42 - 5 . 35 ( m , 1h ), 3 . 83 - 3 . 81 ( m , 1h ), 3 . 80 - 3 . 75 ( m , 1h ), 3 . 65 - 3 . 60 ( m , 1h ), 3 . 50 - 3 . 49 ( m , 1h ), 3 . 08 - 3 . 06 ( m , 1h ), 2 . 99 - 2 . 96 ( m , 1h ), 2 . 36 - 2 . 82 ( m , 2h ), 2 . 07 - 2 . 04 ( m , 2h ); esi - ms : (+ ve mode ) 419 . 58 ( m + h ) + ( 100 %); hplc : 96 . 33 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 25 ( s , 1h ), 8 . 13 - 8 . 11 ( d , 2h , j = 8 . 0 hz ), 7 . 89 - 7 . 87 ( d , 2h , j = 8 . 0 hz ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 16 - 6 . 11 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 16 . 8 hz ), 5 . 68 - 6 . 65 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 20 hz ), 5 . 46 - 5 . 41 ( m , 1h ), 3 . 78 - 3 . 76 ( m , 1h ), 3 . 64 - 3 . 61 ( m , 1h ), 3 . 54 - 3 . 50 ( m , 1h ), 3 . 39 - 3 . 34 ( m , 1h ), 3 . 23 - 3 . 08 ( m , 1h ), 3 . 07 - 3 . 00 ( m , 1h ), 2 . 61 ( s , 3h ), 2 . 38 - 2 . 32 ( m , 2h ), 2 . 07 - 2 . 05 ( m , 2h ); esi - ms : (+ ve mode ) 457 . 10 ( m + h ) + ( 100 %); uplc : 95 . 87 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 40 ( s , 1h ), 8 . 22 ( s , 1h ), 7 . 99 - 7 . 97 ( m , 2h ), 7 . 74 - 7 . 72 ( m , 1h ), 6 . 47 - 6 . 42 ( m , 1h ), 5 . 73 - 5 . 70 ( m , 1h ), 5 . 78 - 5 . 60 ( m , 2h ), 3 . 86 - 3 . 84 ( m , 2h ), 3 . 57 - 3 . 55 ( m , 2h ), 3 . 22 - 3 . 19 ( m , 2h ), 2 . 56 - 2 . 54 ( m , 2h ), 2 . 18 - 2 . 16 ( m , 2h ); esi - ms : (+ ve mode ) 416 . 78 ( m + h ) + ( 100 %); hplc : 96 . 12 %. 1 h nmr : ( dmso , 400 mhz ): δ 8 . 24 ( s , 1h ), 7 . 64 ( dd , 2h , j 1 = 6 . 8 hz , j 2 = 2 . 0 hz ), 7 . 44 - 7 . 40 ( m , 2h ), 7 . 19 - 7 . 10 ( m , 5h ), 6 . 94 - 6 . 87 ( m , 1h ), 6 . 21 ( d , 1h , j = 10 . 0 hz ), 6 . 15 ( d , 1h , j = 16 . 8 hz ), 5 . 41 - 65 . 30 ( m , 1h ), 3 . 29 - 3 . 24 ( m , 2h ), 3 . 04 - 3 . 01 ( m , 4h ), 2 . 34 - 2 . 32 ( m , 2h ), 2 . 10 - 1 . 90 ( m , 2h ); esi - ms : (+ ve mode ) 503 . 15 ( m + h ) + ( 100 %); uplc : 95 . 16 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 41 ( s , 1h ), 8 . 32 - 8 . 30 ( m , 2h ), 7 . 96 - 7 . 93 ( m , 2h ), 7 . 73 - 7 . 70 ( m , 1h ), 7 . 59 - 7 . 57 ( m , 3h ), 6 . 52 - 6 . 43 ( m , 1h ), 5 . 72 - 5 . 69 ( m , 1h ), 5 . 62 - 5 . 59 ( m , 1h ), 5 . 50 - 5 . 49 ( m , 1h ), 3 . 90 - 3 . 84 ( m , 2h ), 3 . 58 - 3 . 48 ( m , 2h ), 3 . 23 - 3 . 19 ( m , 2h ), 2 . 60 - 2 . 58 ( m , 2h ), 2 . 20 - 2 . 17 ( m , 2h ); esi - ms : (+ ve mode ) 492 . 35 ( m + h ) + ( 100 %); hplc : 95 . 63 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 22 ( s , 1h ), 7 . 82 ( d , 1h , j = 8 . 4 hz ), 7 . 70 - 7 . 68 ( m , 1h ), 7 . 56 - 7 . 53 ( m , 2h ), 7 . 49 - 7 . 47 ( m , 2h ), 7 . 42 - 7 . 40 ( m , 1h ), 6 . 65 - 6 . 61 ( m , 1h ), 6 . 16 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 14 . 4 hz ), 5 . 68 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 64 - 5 . 40 ( m , 1h ), 3 . 58 - 3 . 50 ( m , 1h ), 3 . 38 - 3 . 36 ( m , 1h ), 3 . 35 - 3 . 33 ( m , 1h ), 3 . 25 - 2 . 84 ( m , 2h ), 2 . 82 - 2 . 80 ( m , 2h ), 2 . 36 - 2 . 32 ( m , 2h ), 2 . 08 - 2 . 00 ( m , 2h ); ( esi - ms ): (+ ve mode ) 524 . 15 ( m + h ) + ( 100 %), uplc : 95 . 74 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 38 ( s , 1h ), 7 . 86 - 7 . 83 ( m , 1h ), 7 . 71 - 7 . 70 ( m , 3h ), 7 . 69 - 7 . 63 ( m , 2h ), 6 . 51 - 6 . 37 ( m , 2h ), 5 . 72 - 5 . 69 ( m , 1h ), 5 . 59 - 5 . 44 ( m , 2h ), 3 . 99 ( s , 1h ), 3 . 50 - 3 . 46 ( m , 2h ), 3 . 23 - 3 . 14 ( m , 2h ), 2 . 57 - 2 . 55 ( m , 2h ), 2 . 18 - 2 . 14 ( m , 2h ), 1 . 68 - 1 . 59 ( m , 2h ); ( esi - ms ): (+ ve mode ) 455 . 10 ( m + h ) + ( 100 %), hplc : 95 . 98 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 84 ( s , 1h ), 8 . 24 ( s , 1h ), 8 . 01 ( s , 1h ), 7 . 93 - 7 . 91 ( d , 1h , j = 8 . 0 hz ), 7 . 73 - 7 . 71 ( d , 1h , j = 8 . 0 hz ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 16 - 6 . 11 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 16 . 8 hz ), 5 . 68 - 5 . 65 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 11 . 2 hz ), 5 . 44 - 5 . 41 ( m , 1h ), 3 . 78 - 3 . 66 ( m , 2h ), 3 . 63 - 3 . 60 ( m , 2h ), 3 . 53 - 3 . 50 ( m , 1h ), 3 . 40 - 3 . 38 ( m , 1h ), 3 . 15 - 2 . 85 ( m , 2h ), 2 . 07 - 2 . 05 ( m , 2h ); esi - ms : (+ ve mode ) 416 . 10 ( m + h ) + ( 100 %); uplc : 95 . 64 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 24 - 8 . 27 ( m , 3h ), 8 . 02 - 8 . 01 ( d , 1h , j = 4 . 0 hz ), 7 . 95 - 7 . 93 ( d , 1h , j = 8 . 0 hz ), 7 . 73 - 7 . 70 ( m , 1h ), 7 . 67 - 7 . 63 ( m , 3h ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 16 - 6 . 12 ( m , 1h ), 5 . 68 - 5 . 65 ( m , 1h ), 5 . 45 - 5 . 42 ( m , 1h ), 3 . 81 - 3 . 66 ( m , 1h ), 3 . 64 - 3 . 61 ( m , 1h ), 3 . 55 - 3 . 50 ( m , 1h ), 3 . 39 - 3 . 35 ( m , 1h ), 3 . 10 - 3 . 00 ( m , 2h ), 2 . 44 - 2 . 31 ( m , 2h ), 2 . 09 - 2 . 04 ( m , 2h ); esi - ms : (+ ve mode ) 492 . 05 ( m + h ) + ( 100 %); uplc : 97 . 40 %. 1 h nmr : ( d 2 o , 400 mhz ): δ 8 . 38 ( s , 1h ), 7 . 65 ( d , 2h , j = 6 . 8 hz ), 7 . 62 - 7 . 47 ( m , 2h ), 7 . 46 - 7 . 45 ( m , 1h ), 7 . 29 - 7 . 16 ( m , 2h ), 6 . 81 - 6 . 69 ( m , 2h ), 5 . 56 - 5 . 52 ( m , 1h ), 3 . 99 - 3 . 91 ( m , 3h ), 3 . 80 ( dd , 1h , j 1 = 8 . 4 hz , j 2 = 13 . 2 hz ), 3 . 63 ( dd , 1h , j 1 = 4 . 4 hz , j 2 = 11 . 2 hz ), 3 . 50 ( dd , 1h , j 1 = 4 . 8 hz , j 2 = 13 . 2 hz ), 3 . 20 - 3 . 11 ( m , 2h ), 2 . 93 ( s , 6h ), 2 . 47 - 2 . 41 ( m , 2h ), 2 . 23 - 2 . 16 ( m , 2h ); esi - ms : (+ ve mode ) 525 . 7 ( m + h ) + ( 100 %); hplc : 97 . 25 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 12 ( s , 1h ), 7 . 45 - 7 . 41 ( m , 4h ), 7 . 20 - 7 . 17 ( m , 1h ), 7 . 15 - 7 . 11 ( m , 1h ), 6 . 63 - 6 . 56 ( m , 1h ), 6 . 15 ( dd , 1h , j 1 = 4 . 0 hz , j 2 = 16 . 0 hz ), 5 . 74 - 5 . 72 ( m , 2h ), 5 . 97 - 5 . 64 ( m , 1h ), 5 . 01 - 4 . 93 ( m , 1h ), 3 . 62 - 3 . 46 ( m , 3h ), 3 . 40 - 3 . 35 ( m , 2h ), 3 . 20 - 2 . 90 ( m , 3h ), 1 . 90 - 1 . 97 ( m , 2h ); ( esi - ms ): (+ ve mode ) 483 . 10 ( m + h ) + ( 100 %); hplc : 98 . 02 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 84 - 8 . 83 ( d , 1h , j = 4 . 0 hz ), 8 . 31 - 8 . 26 ( m , 4h ), 8 . 12 - 8 . 08 ( m , 1h ), 7 . 95 - 7 . 93 ( d , 2h , j = 8 . 0 hz ), 7 . 69 - 7 . 66 ( m , 1h ), 6 . 65 - 6 . 59 ( m , 1h ), 6 . 16 - 6 . 12 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 65 - 5 . 68 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 47 - 5 . 44 ( m , 1h ), 3 . 81 - 3 . 77 ( m , 1h ), 3 . 65 - 3 . 61 ( m , 1h ), 3 . 55 - 3 . 50 ( m , 1h ), 3 . 39 - 3 . 33 ( m , 1h ), 3 . 12 - 2 . 90 ( m , 2h ), 2 . 42 - 2 . 31 ( m , 2h ), 2 . 09 - 2 . 07 ( m , 2h ); esi - ms : (+ ve mode ) 520 . 20 ( m + h ) + ( 85 %); uplc : 95 . 96 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 13 ( s , 1h ), 7 . 46 - 7 . 41 ( m , 4h ), 7 . 21 - 7 . 19 ( m , 1h ), 7 . 15 - 7 . 13 ( m , 2h ), 7 . 11 - 7 . 09 ( m , 2h ), 6 . 65 - 6 . 54 ( m , 1h ), 6 . 16 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 68 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 35 - 5 . 33 ( m , 1h ), 3 . 52 - 3 . 50 ( m , 1h ), 3 . 38 - 3 . 34 ( m , 1h ), 3 . 33 - 3 . 31 ( m , 1h ), 3 . 12 - 2 . 83 ( m , 1h ), 2 . 81 - 2 . 80 ( m , 1h ), 2 . 67 - 2 . 65 ( m , 2h ), 2 . 37 - 2 . 35 ( m , 1h ), 2 . 33 - 2 . 00 ( m , 2h ); ( esi - ms ): (+ ve mode ) 546 . 15 ( m + h ) + ( 100 %); uplc : 95 . 60 %. 1 h nmr : ( cdcl 3 - d 1 , 400 mhz ): δ 8 . 38 ( s , 1h ), 7 . 67 - 7 . 65 ( m , 2h ), 7 . 42 - 7 . 32 ( m , 2h ), 7 . 19 - 7 . 15 ( m , 3h ), 7 . 11 - 7 . 09 ( m , 2h ), 6 . 87 - 6 . 84 ( d , 1h , j = 11 . 6 hz ), 5 . 59 - 5 . 53 ( m , 1h ), 5 . 41 ( s , 2h ), 4 / 05 - 3 . 88 ( m , 2h ), 3 . 68 - 3 . 54 ( m , 2h ), 3 . 23 - 3 . 12 ( m , 2h ), 2 . 62 - 2 . 52 ( m , 2h ), 2 . 17 - 2 . 08 ( m , 2h ), 1 . 44 - 1 . 26 ( m , 2h ), 0 . 98 - 0 . 93 ( m , 2h ), 0 . 89 - 0 . 87 ( m , 1h ); esi - ms : (+ ve mode ) 532 . 25 ( m + h ) + ( 100 %); uplc : 95 . 05 %. 1 h nmr : ( dmso , 400 mhz ): δ 10 . 42 ( s , 1h ), 8 . 26 ( s , 1h ), 8 . 23 - 8 . 21 ( m , 1h ), 8 . 16 - 8 . 10 ( m , 1h ), 8 . 07 ( d , 1h , j = 8 . 0 hz ), 7 . 45 - 7 . 42 ( m , 2h ), 7 . 03 - 7 . 02 ( m , 1h ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 15 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 4 hz ), 5 . 67 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 10 . 4 hz ), 5 . 46 - 5 . 42 ( m , 1h ), 4 . 08 ( s , 3h ), 3 . 85 - 3 . 75 ( m , 1h ), 3 . 70 - 3 . 57 ( m , 1h ), 3 . 56 - 3 . 45 ( m , 2h ), 3 . 15 - 2 . 90 ( m , 2h ), 2 . 45 - 2 . 38 ( m , 5h ), 2 . 18 - 2 . 06 ( m , 2h ); esi - ms : (+ ve mode ) 539 . 2 ( m + h ) + ( 100 %); uplc : 96 . 93 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 59 ( bs , 1h ), 8 . 39 ( s , 1h ), 8 . 26 ( s , 2h ), 8 . 19 ( d , 1h , j = 5 . 2 hz ), 8 . 11 ( d , 2h , j = 8 . 0 hz ), 7 . 87 ( d , 2h , j = 8 . 0 hz ), 6 . 95 ( d , 1h , j = 5 . 2 hz ), 6 . 48 ( dd , 1h , = 10 . 0 hz , j 2 = 16 . 8 hz ), 6 . 40 ( dd , 1h , = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 70 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 12 . 4 hz ), 5 . 60 - 5356 ( m , 1h ), 5 . 44 ( bs , 2h ), 3 . 88 - 3 . 83 ( m , 2h ), 3 . 56 - 3 . 46 ( m , 2h ), 3 . 23 - 3 . 21 ( m , 1h ), 3 . 14 - 3 . 12 ( m , 1h ), 2 . 59 - 2 . 54 ( m , 2h ), 2 . 43 ( s , 3h ), 2 . 20 - 2 . 09 ( m , 2h ); esi - ms : (+ ve mode ) 509 . 1 ( m + h ) + ( 100 %); hplc : 96 . 67 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 16 ( s , 1h ), 7 . 45 - 7 . 41 ( m , 3h ), 7 . 15 - 7 . 13 ( m , 2h ), 6 . 70 - 6 . 66 ( m , 5h ), 6 . 86 - 6 . 59 ( m , 1h ), 6 . 16 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 10 . 4 hz ), 5 . 68 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 30 - 5 . 24 ( m , 1h ), 3 . 80 - 3 . 78 ( m , 1h ), 3 . 66 - 3 . 51 ( m , 2h ), 3 . 51 - 3 . 35 ( m , 1h ), 3 . 10 - 2 . 95 ( m , 1h ), 2 . 37 - 2 . 34 ( m , 1h ), 2 . 32 - 2 . 25 ( m , 3h ), 2 . 07 - 2 . 05 ( m , 2h ); ( esi - ms ): (+ ve mode ) 466 . 05 ( m + h ) + ( 100 %); uplc : 97 . 65 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ10 . 82 ( s , 1h ), 8 . 77 - 8 . 76 ( m , 1h ), 8 . 23 ( s , 1h ), 8 . 18 - 8 . 12 ( m , 1h ), 8 . 11 - 8 . 09 ( m , 3h ), 7 . 71 - 7 . 65 ( m , 3h ), 6 . 65 - 6 . 59 ( m , 1h ), 6 . 16 - 6 . 11 ( m , 1h ), 5 . 68 - 5 . 65 ( m , 1h ), 5 . 43 - 5 . 41 ( m , 1h ), 3 . 82 - 3 . 79 ( m , 1h ), 3 . 76 - 3 . 73 ( m , 1h0 , 3 . 50 - 3 . 48 ( m , 1h ), 3 . 37 - 3 . 35 ( m , 1h ), 3 . 23 - 3 . 19 ( m , 2h ), 2 . 35 - 2 . 32 ( m , 2h ), 2 . 08 - 2 . 04 ( m , 2h ); esi - ms : (+ ve mode ) 495 . 15 ( m + h ) + ( 100 %); hplc : 98 . 31 %. 1 h nmr : ( dmso , 400 mhz ): δ 8 . 12 ( s , 1h ), 7 . 45 - 7 . 40 ( m , 4h ), 7 . 21 - 7 . 19 ( m , 1h ), 7 . 17 - 7 . 13 ( m , 4h ), 6 . 94 - 6 . 87 ( m , 1h ), 6 . 21 - 6 . 12 ( m , 2h ), 5 . 71 ( m , 1h ), 4 . 97 ( m , 1h ), 3 . 34 - 3 . 33 ( m , 1h ), 3 . 00 - 2 . 96 ( m , 4h ), 2 . 61 - 2 . 59 ( m , 2h ), 1 . 86 - 1 . 81 ( m , 2h ); esi - ms : (+ ve mode ) 519 . 15 ( m + h ) + ( 100 %); 541 . 35 ( m + na ) + ( 10 %); uplc : 95 . 21 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 13 . 0 ( s , 1h ), 8 . 32 - 8 . 30 ( m , 2h ), 8 . 26 ( s , 1h ), 8 . 19 - 8 . 17 ( m , 1h ), 7 . 86 - 7 . 84 ( m , 2h ), 7 . 82 - 7 . 80 ( m , 1h ), 7 . 49 - 7 . 47 ( m , 1h ), 7 . 36 - 7 . 34 ( m , 1h ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 17 - 6 . 12 ( m , 1h ), 5 . 68 - 5 . 65 ( m , 1h ), 5 . 49 - 5 . 47 ( m , 1h ), 3 . 83 - 3 . 81 ( m , 1h ), 3 . 76 - 3 . 73 ( m , 1h ), 3 . 09 - 3 . 06 ( m , 1h ), 2 . 45 - 2 . 44 ( m , 2h ), 2 . 37 - 2 . 35 ( m , 2h ); esi - ms : (+ ve mode ) 551 . 78 ( m + h ) + ( 100 %); hplc : 97 . 74 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 10 . 92 ( s , 1h ), 9 . 32 ( s , 1h ), 8 . 95 ( s , 1h ), 8 . 84 - 8 . 83 ( m , 1h ), 8 . 23 ( s , 1h ), 8 . 11 - 8 . 09 ( d , 2h , j = 8 . 0 hz ), 7 . 69 - 7 . 67 ( d , 2h , j = 8 . 0 hz ), 6 . 65 - 6 . 59 ( m , 1h ), 6 . 16 - 6 . 11 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 16 . 8 hz ), 5 . 68 - 5 . 43 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 43 - 5 . 40 ( m , 1h ), 3 . 81 - 3 . 76 ( m , 1h ), 3 . 66 - 3 . 61 ( m , 1h ), 3 . 54 - 3 . 50 ( m , 1h ), 3 . 38 - 3 . 34 ( m , 1h ), 3 . 10 - 3 . 08 ( m , 1h ), 3 . 00 - 2 . 98 ( m , 1h ), 2 . 37 - 2 . 32 ( m , 2h ), 2 . 08 - 2 . 03 ( m , 2h ); esi - ms : (+ ve mode ) 496 . 15 ( m + h ) + ( 100 %); uplc : 95 . 55 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 19 ( s , 1h ), 7 . 21 - 7 . 19 ( m , 1h ), 7 . 17 - 7 . 14 ( m , 1h ), 7 . 07 - 7 . 05 ( m , 1h ), 6 . 59 - 6 . 55 ( m , 1h ), 6 . 15 - 6 . 12 ( m , 1h ), 5 . 67 - 5 . 64 ( m , 1h ), 5 . 40 - 5 . 32 ( m , 1h ), 3 . 81 - 3 . 79 ( m , 1h ), 3 . 78 - 3 . 75 ( m , 1h ), 3 . 59 - 3 . 57 ( m , 1h ), 3 . 51 - 3 . 48 ( m , 1h ), 3 . 03 - 3 . 00 ( m , 1h ), 2 . 97 - 2 . 93 ( m , 1h ), 2 . 36 - 2 . 82 ( m , 2h ), 2 . 02 - 2 . 00 ( m , 2h ); esi - ms : (+ ve mode ) 455 . 78 ( m + h ) + ( 100 %); hplc : 96 . 22 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 11 . 22 ( s , 1h ), 9 . 45 ( s , 1h ), 8 . 50 - 8 . 49 ( m , 1h ), 8 . 44 - 8 . 43 ( m , 1h ), 8 . 23 - 8 . 22 ( m , 2h ), 7 . 83 - 7 . 81 ( m , 2h ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 16 - 6 . 12 ( m , 1h ), 5 . 68 - 5 . 65 ( m , 1h ), 5 . 47 - 5 . 44 ( m , 1h ), 3 . 81 - 3 . 80 ( m , 1h ), 3 . 79 - 3 . 76 ( m , 1h ), 3 . 54 - 3 . 53 ( m , 1h ), 3 . 39 - 3 . 38 ( m , 2h ), 3 . 08 - 3 . 01 ( m , 2h ), 2 . 39 - 2 . 31 ( m , 2h ), 2 . 09 - 2 . 06 ( m , 2h ); esi - ms : (+ ve mode ) 496 . 25 ( m + h ) + ( 100 %); hplc : 96 . 38 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 10 . 44 ( s , 1h ), 8 . 24 ( s , 1h ), 7 . 98 ( d , 4h , j = 8 . 0 hz ), 7 . 65 ( d , 2h , j = 8 . 4 hz ), 7 . 60 - 7 . 53 ( m , 3h ), 6 . 62 ( dd , 1h , = 16 . 8 hz , j 2 = 10 . 2 hz ), 6 . 14 ( dd , 1h , = 16 . 8 hz , j 2 = 2 . 4 hz ), 5 . 67 ( dd , 1h , = 10 . 2 hz , j 2 = 2 . 4 hz ), 5 . 42 - 5 . 38 ( m , 1h ), 3 . 78 - 3 . 75 ( m , 1h ), 3 . 66 - 3 . 60 ( m , 1h ), 3 . 55 - 3 . 50 ( m , 1h ), 3 . 37 - 3 . 33 ( m , 1h ), 3 . 10 - 3 . 06 ( m , 1h ), 3 . 01 - 2 . 98 ( m , 1h ), 2 . 37 - 2 . 32 ( m , 2h ), 2 . 08 - 2 . 05 ( m , 2h ); esi - ms : (+ ve mode ) 494 . 1 ( m + h ) + ( 100 %); uplc : 96 . 83 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 74 - 8 . 76 ( m , 1h ), 8 . 33 - 8 . 35 ( m , 1h ), 8 . 22 - 8 . 26 ( m , 3h ), 8 . 08 - 8 . 15 ( m , 1h ), 7 . 87 - 7 . 89 ( m , 2h ), 7 . 62 - 7 . 64 ( m , 1h ), 6 . 59 - 6 . 66 ( m , 1h ), 6 . 12 - 6 . 17 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 65 - 5 . 68 ( m , 1h ), 5 . 41 - 5 . 48 ( m , 1h ), 3 . 75 - 3 . 90 ( m , 1h ), 3 . 58 - 3 . 68 ( m , 1h ), 3 . 55 - 3 . 58 ( m , 1h ), 3 . 35 - 3 . 37 ( m , 1h ), 2 . 90 - 3 . 10 ( m , 2h ), 2 . 35 - 2 . 37 ( m , 2h ), 2 . 07 - 2 . 08 ( m , 2h ); esi - ms : (+ ve mode ) 536 . 05 ( m + h ) + ( 100 %); uplc : 97 . 81 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 9 . 02 ( bs , 1h ), 8 . 73 ( s , 1h ), 8 . 51 ( d , 1h , j = 5 . 2 hz ), 8 . 39 ( s , 1h ), 8 . 14 ( d , 2h , j = 8 . 4 hz ), 7 . 89 ( d , 2h , j = 8 . 4 hz ), 7 . 33 ( dd , 1h , j 1 = 0 . 8 hz , j 2 = 5 . 2 hz ), 6 . 48 ( dd , 1h , j 1 = 10 . 0 hz , j 2 = 16 . 8 hz ), 6 . 40 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 69 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 9 . 6 hz ), 5 . 60 - 5 . 56 ( m , 3h ), 3 . 87 - 3 . 83 ( m , 2h ), 3 . 56 - 3 . 47 ( m , 2h ), 3 . 25 - 3 . 20 ( m , 1h ), 3 . 18 - 3 . 09 ( m , 1h ), 2 . 57 - 2 . 53 ( m , 2h ), 2 . 18 - 2 . 15 ( m , 2h ); esi - ms : (+ ve mode ) 563 . 3 ( m + h ) + ( 100 %); hplc : 99 . 55 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 47 ( d , 2h , j = 8 . 4 hz ), 8 . 32 ( s , 2h ), 7 . 75 ( d , 2h , j = 8 . 4 hz ), 7 . 53 ( d , 1h , j = 6 . 4 hz ), 6 . 52 - 6 . 45 ( m , 2h ), 6 . 42 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 72 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 10 . 0 hz ), 5 . 59 - 5 . 55 ( m , 1h ), 3 . 91 ( s , 3h ), 3 . 87 - 3 . 83 ( m , 2h ), 3 . 56 - 3 . 47 ( m , 2h ), 3 . 26 - 3 . 21 ( m , 1h ), 3 . 16 - 3 . 11 ( m , 1h ), 2 . 58 - 2 . 53 ( m , 2h ), 2 . 36 ( s , 3h ), 2 . 19 - 2 . 15 ( m , 2h ); esi - ms : (+ ve mode ) 523 . 2 ( m + h ) + ( 100 %); hplc : 98 . 58 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 10 . 77 ( s , 1h ), 8 . 26 - 8 . 25 ( m , 2h ), 8 . 19 - 8 . 17 ( m , 2h ), 8 . 08 ( m , 1h ), 7 . 80 - 7 . 78 ( m , 2h ), 7 . 03 - 7 . 02 ( m , 1h ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 16 - 6 . 12 ( m , 1h ), 5 . 68 - 5 . 65 ( m , 1h ), 5 . 48 - 5 . 43 ( m , 1h ), 3 . 81 - 3 . 79 ( m , 1h ), 3 . 77 - 3 . 74 ( m , 1h ), 3 . 61 - 3 . 58 ( m , 1h ), 3 . 22 - 3 . 18 ( m , 2h ), 3 . 13 - 3 . 07 ( m , 2h ), 2 . 35 ( s , 3h ), 2 . 08 - 2 . 06 ( m , 2h ); esi - ms : (+ ve mode ) 509 . 35 ( m ) + ( 100 %); hplc : 97 . 99 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 24 ( s , 1h ), 8 . 20 - 8 . 18 ( dd , 1h , j 1 = 8 . 0 hz , j 2 = 8 . 0 hz ), 7 . 90 - 7 . 86 ( m , 1h ), 7 . 71 - 7 . 69 ( d , 2h , j = 8 . 0 hz ), 7 . 29 - 7 . 27 ( d , 2h , j = 16 hz ), 7 . 18 - 7 . 15 ( m , 1h ), 7 . 11 - 7 . 09 ( d , 1h , j = 8 . 0 hz ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 16 - 6 . 11 ( dd , 1h , j 1 = 4 . 0 hz , j 2 = 8 . 0 hz ), 5 . 68 - 5 . 65 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 hz ), 5 . 44 - 5 . 40 ( m , 1h ), 3 . 80 - 3 . 76 ( m , 1h ), 3 . 65 - 3 . 50 ( m , 3h ), 3 . 08 - 3 . 07 ( m , 1h ), 3 . 00 - 2 . 97 ( m , 1h ), 2 . 38 - 2 . 32 ( m , 2h ), 2 . 08 - 2 . 03 ( m , 2h ); esi - ms : (+ ve mode ) 468 . 00 ( m + h ) + ( 100 %); uplc : 95 . 99 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 10 . 89 ( s , 1h ), 9 . 83 - 9 . 81 ( m , 1h ), 8 . 35 - 8 . 29 ( m , 1h ), 8 . 28 - 8 . 23 ( m , 1h ), 8 . 22 - 8 . 20 ( m , 3h ), 7 . 89 - 7 . 81 ( m , 1h ), 7 . 80 - 7 . 78 ( m , 1h ), 6 . 72 - 6 . 70 ( m , 1h ), 6 . 66 - 6 . 64 ( m , 1h ), 5 . 53 - 5 . 50 ( m , 1h ), 3 . 91 - 3 . 89 ( m , 2h ), 2 . 79 ( d , 6h , j = 4 . 4 hz ); ( esi - ms ): (+ ve mode ) 552 . 40 ( m + h ) + ( 100 %); uplc : 98 . 02 %. 1 h nmr : ( d 2 o , 400 mhz ): δ 8 . 47 ( s , 1h ), 8 . 34 ( d , 1h , j = 6 . 4 hz ), 8 . 23 ( d , 2h , j = 8 . 4 hz ), 7 . 96 ( d , 2h , j = 8 . 4 hz ), 7 . 59 - 7 . 56 ( m , 2h ), 6 . 83 - 6 . 70 ( m , 2h ), 5 . 64 - 5 . 51 ( m , 1h ), 4 . 01 - 3 . 95 ( m , 3h ), 3 . 83 ( dd , 1h , j 1 = 8 . 4 hz , j 2 = 13 . 2 hz ), 3 . 67 ( dd , 1h , j 1 = 4 . 8 hz , j 2 = 11 . 2 hz ), 3 . 55 ( dd , 1h , j 1 = 4 . 8 hz , j 2 = 13 . 2 hz ), 3 . 27 - 3 . 23 ( m , 1h ), 3 . 21 - 3 . 18 ( m , 1h ), 2 . 91 ( s , 6h ), 2 . 65 ( s , 3h ), 2 . 54 - 2 . 47 ( m , 2h ), 2 . 30 - 2 . 24 ( m , 2h ); esi - ms : (+ ve mode ) 566 . 3 ( m + h ) + ( 100 %); hplc : 96 . 24 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 9 . 53 ( s , 1h ), 8 . 87 - 8 . 85 ( m , 2h ), 8 . 27 - 8 . 25 ( m , 3h ), 7 . 90 - 7 . 88 ( d , 2h , j = 8 . 0 hz ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 17 - 6 . 12 ( m , 1h ), 5 . 68 - 5 . 65 ( m , 1h ), 5 . 47 - 5 . 42 ( m , 1h ), 3 . 80 - 3 . 78 ( m , 1h ), 3 . 56 - 3 . 52 ( m , 1h ), 3 . 37 - 3 . 33 ( m , 1h ), 3 . 10 - 2 . 90 ( m , 3h ), 2 . 39 - 2 . 32 ( m , 2h ), 2 . 10 - 2 . 07 ( m , 2h ); esi - ms : (+ ve mode ) 537 . 20 ( m + h ) + ( 100 %); hplc : 97 . 71 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 24 ( s , 1h ), 8 . 21 - 8 . 19 ( m , 1h ), 7 . 90 - 7 . 86 ( m , 1h ), 7 . 71 - 7 . 69 ( m , 2h ), 7 . 30 - 7 . 28 ( m , 2h ), 7 . 19 - 7 . 15 ( m , 1h ), 7 . 12 - 7 . 10 ( d , 1h , j = 8 . 0 hz ), 6 . 66 - 6 . 60 ( m , 1h ), 6 . 42 - 6 . 38 ( d , 1h , j = 16 hz ), 5 . 44 - 5 . 41 ( m , 1h ), 3 . 77 - 3 . 74 ( m , 1h ), 3 . 62 - 3 . 59 ( m , 1h ), 3 . 52 - 3 . 48 ( m , 1h ), 3 . 37 - 3 . 36 ( m , 1h ), 3 . 09 - 2 . 99 ( m , 4h ), 2 . 36 - 2 . 31 ( m , 2h ), 2 . 15 ( s , 6h ), 2 . 08 - 2 . 04 ( m , 2h ); esi - ms : (+ ve mode ) 525 . 45 ( m + h ) + ( 100 %); hplc : 96 . 91 %. 1 h nmr : ( cd 3 od , 400 mhz ): δ 8 . 43 ( s , 1h ), 8 . 09 ( d , 2h , j = 6 . 4 hz ), 7 . 45 - 7 . 41 ( m , 2h ), 7 . 22 - 7 . 16 ( m , 3h ), 7 . 13 - 7 . 11 ( m , 2h ), 6 . 87 ( d , 1h , j = 15 . 2 hz ), 6 . 77 ( dd , 1h , j 1 = 6 . 8 hz , j 2 = 14 . 0 hz ), 5 . 69 - 5 . 64 ( m , 1h ), 3 . 98 ( d , 2h , j = 6 . 8 hz ), 3 . 97 - 3 . 92 ( m , 1h ), 3 . 83 - 3 . 78 ( m , 1h ), 3 . 67 - 3 . 64 ( m , 4h ), 3 . 54 ( dd , 1h , j 1 = 4 . 8 hz , j 2 = 13 . 2 hz ), 3 . 32 - 3 . 28 ( m , 1h ), 3 . 21 - 3 . 17 ( m , 1h ), 2 . 93 ( s , 6h ), 2 . 55 - 2 . 50 ( m , 2h ), 2 . 24 - 2 . 19 ( m , 2h ); esi - ms : (+ ve mode ) 524 . 3 ( m + h ) + ( 100 %); hplc : 97 . 39 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 11 . 25 ( s , 1h ), 9 . 45 ( s , 1h ), 8 . 51 - 8 . 50 ( m , 1h ), 8 . 44 ( m , 1h ), 8 . 26 ( s , 1h ), 8 . 23 - 8 . 21 ( m , 2h ), 7 . 83 - 7 . 81 ( m , 2h ), 6 . 64 - 6 . 61 ( m , 1h ), 6 . 43 - 6 . 39 ( m , 1h ), 5 . 48 - 5 . 45 ( m , 1h ), 3 . 81 - 3 . 78 ( m , 1h ), 3 . 76 - 3 . 72 ( m , 1h ), 3 . 68 - 3 . 62 ( m , 1h ), 3 . 20 - 3 . 18 ( m , 1h ), 3 . 04 - 3 . 02 ( m , 3h ), 2 . 99 - 2 . 97 ( m , 1h ), 2 . 37 - 2 . 15 ( m , 2h ), 2 . 15 ( m , 6h ), 2 . 08 ( m , 2h ); esi - ms : (+ ve mode ) 553 . 45 ( m + h ) + ( 100 %); hplc : 95 . 44 %. 1 h nmr : ( cd 3 od , 400 mhz ): δ 8 . 73 ( d , 1h , j = 6 . 4 hz ), 8 . 47 ( s , 1h ), 8 . 31 ( d , 2h , j = 8 . 4 hz ), 8 . 13 ( s , 1h ), 7 . 98 ( d , 2h , j = 8 . 4 hz ), 7 . 77 - 7 . 76 ( m , 1h ), 6 . 87 ( d , 1h , j = 15 . 2 hz ), 6 . 78 ( dd , 1h , j 1 = 6 . 8 hz , j 2 = 13 . 6 ), 5 . 72 - 5 . 68 ( m , 1h ), 4 . 31 ( s , 3h ), 3 . 98 ( d , 2h , j = 7 . 2 hz ), 3 . 96 - 3 . 93 ( m , 1h ), 3 . 81 ( dd , 1h , j 1 = 8 . 0 hz , j 2 = 12 . 8 hz ), 3 . 68 ( dd , 1h , = 4 . 8 hz , j 2 = 11 . 2 hz ), 3 . 53 ( dd , 1h , = 4 . 8 hz , j 2 = 13 . 2 hz ), 3 . 31 - 3 . 26 ( m , 2h ), 2 . 70 ( s , 3h ), 2 . 57 - 2 . 52 ( m , 2h ), 2 . 26 - 2 . 24 ( m , 2h ); esi - ms : (+ ve mode ) 580 . 5 ( m + h ) + ( 100 %); hplc : 96 . 62 %. 1 h nmr : ( cd 3 od , 400 mhz ): δ 8 . 68 ( d , 1h , j = 5 . 6 hz ), 8 . 55 ( s , 1h ), 8 . 48 ( s , 1h ), 8 . 30 ( d , 2h , j = 8 . 4 hz ), 7 . 94 ( d , 2h , j = 8 . 4 hz ), 7 . 65 ( dd , 1h , = 1 . 2 hz , j 2 = 5 . 6 hz ), 6 . 9 ( d , 1h , j = 15 . 2 hz ), 6 . 80 - 6 . 75 ( m , 1h ), 5 . 69 - 5 . 66 ( m , 1h ), 4 . 09 ( d , 2h , j = 7 . 2 hz ), 4 . 00 - 3 . 94 ( m , 1h ), 3 . 81 ( dd , 1h , j 1 = 8 . 0 hz , j 2 = 12 . 8 hz ), 3 . 69 ( dd , 1h , j 1 = 4 . 4 hz , j 2 = 11 . 2 hz ), 3 . 53 ( dd , 1h , j 1 = 4 . 4 hz , j 2 = 13 . 2 hz ), 3 . 32 - 3 . 27 ( m , 2h ), 2 . 93 ( s , 6h ), 2 . 57 - 2 . 52 ( m , 2h ), 2 . 28 - 2 . 23 ( m , 2h ); esi - ms : (+ ve mode ) 620 . 4 ( m + h ) + ( 100 %); hplc : 97 . 87 %. 1 h nmr : ( cdcl 3 - d 1 , 400 mhz ): δ 8 . 50 - 8 . 46 ( m , 2h ), 8 . 35 ( s , 1h ), 7 . 70 - 7 . 68 ( d , 2h , j = 8 . 0 hz ), 7 . 43 - 7 . 7 . 34 ( m , 2h ), 7 . 21 - 7 . 19 ( d , 2h , j = 8 . 0 hz ), 6 . 47 - 6 . 39 ( m , 2h ), 5 . 73 - 5 . 70 ( m , 1h ), 5 . 59 - 5 . 55 ( m , 1h ), 3 . 88 - 3 . 83 ( m , 2h ), 3 . 61 - 3 . 47 ( m , 4h ), 3 . 23 - 3 . 13 ( m , 2h ), 2 . 57 - 2 . 52 ( m , 2h ), 2 . 18 - 2 . 16 ( m , 2h ); esi - ms : (+ ve mode ) 468 . 15 ( m + h ) + ( 100 %); hplc : 95 . 64 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 47 - 8 . 48 ( m , 1h ), 8 . 41 - 8 . 39 ( m , 1h ), 8 . 23 ( s , 1h ), 7 . 70 - 7 . 67 ( m , 2h ), 7 . 58 - 7 . 55 ( m , 1h ), 7 . 48 - 7 . 45 ( m , 1h ), 7 . 23 - 7 . 21 ( m , 2h ), 6 . 64 - 6 . 59 ( m , 1h ), 6 . 42 - 6 . 38 ( m , 1h ), 5 . 43 - 5 . 40 ( m , 1h ), 3 . 77 - 3 . 74 ( m , 1h ), 3 . 64 - 3 . 61 ( m , 1h ), 3 . 52 - 3 . 49 ( m , 1h ), 3 . 09 - 2 . 96 ( m , 5h ), 2 . 35 - 2 . 30 ( m , 2h ), 2 . 15 ( s , 6h ), 2 . 06 - 2 . 04 ( m , 2h ); esi - ms : (+ ve mode ) 525 . 45 ( m + h ) + ( 100 %); hplc : 95 . 44 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 23 ( s , 1h ), 8 . 21 - 8 . 20 ( m , 1h ), 7 . 58 ( d , 1h , j = 8 . 4 hz ), 7 . 12 - 7 . 10 ( m , 1h ), 7 . 04 - 7 . 02 ( m , 1h ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 16 - 6 . 11 ( m , 1h ), 5 . 40 - 5 . 38 ( m , 1h ), 3 . 77 - 3 . 75 ( m , 1h ), 3 . 62 - 3 . 59 ( m , 1h ), 3 . 53 - 3 . 49 ( m , 1h ), 3 . 43 ( s , 3h ), 3 . 11 - 3 . 08 ( m , 1h ), 2 . 98 - 2 . 96 ( m , 1h ), 2 . 34 - 2 . 29 ( m , 3h ), 2 . 21 ( s , 3h ), 2 . 06 - 2 . 03 ( m , 2h ); esi - ms : (+ ve mode ) 523 . 35 ( m + h ) + ( 100 %); hplc : 98 . 29 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 22 ( s , 1h ), 8 . 20 ( d , 1h , j = 8 . 4 hz ), 7 . 57 - 7 . 55 ( m , 2h ), 7 . 43 - 7 . 41 ( m , 2h ), 7 . 11 - 7 . 09 ( m , 1h ), 7 . 03 - 7 . 02 ( m , 1h ), 6 . 63 - 6 . 59 ( m , 1h ), 6 . 41 ( m , 1h ), 5 . 39 ( m , 1h ), 3 . 79 - 3 . 72 ( m , 1h ), 3 . 59 - 3 . 57 ( m , 2h ), 3 . 43 - 3 . 42 ( m , 2h ), 3 . 08 ( s , 3h ), 3 . 05 - 3 . 03 ( m , 2h ), 2 . 32 - 2 . 30 ( m , 2h ), 2 . 16 - 2 . 09 ( m , 3h ), 2 . 09 - 2 . 06 ( m , 3h ), 2 . 04 - 2 . 02 ( m , 6h ); esi - ms : (+ ve mode ) 580 . 55 ( m + h ) + ( 100 %); hplc : 96 . 27 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 9 . 54 ( s , 1h ), 8 . 88 - 8 . 86 ( m , 2h ), 8 . 27 - 8 . 25 ( m , 3h ), 7 . 90 - 7 . 88 ( d , 2h , j = 8 . 0 hz ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 43 - 6 . 39 ( d , 2h , j = 16 hz ), 5 . 47 - 5 . 43 ( m , 1h ), 3 . 80 - 3 . 75 ( m , 1h ), 3 . 65 - 3 . 60 ( m , 1h ), 3 . 53 - 3 . 51 ( m , 1h ), 3 . 83 - 3 . 33 ( m , 1h ), 3 . 09 - 3 . 00 ( m , 4h ), 2 . 40 - 2 . 32 ( m , 2h ), 2 . 15 ( s , 6h ), 2 . 09 - 2 . 07 ( m , 2h ); esi - ms : (+ ve mode ) 594 . 40 ( m + h ) + ( 100 %); hplc : 97 . 57 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 85 - 8 . 84 ( m , 1h ), 8 . 32 - 8 . 27 ( m , 4h ), 8 . 13 - 8 . 09 ( m , 1h ), 7 . 95 - 7 . 93 ( m , 2h ), 7 . 69 - 7 . 67 ( m , 1h ), 6 . 50 - 6 . 61 ( m , 1h ), 6 . 43 - 6 . 39 ( m , 1h ), 5 . 47 - 5 . 44 ( m , 1h ), 3 . 77 - 3 . 75 ( m , 1h ), 3 . 62 - 3 . 60 ( m , 1h ), 3 . 52 - 3 . 50 ( m , 1h ), 3 . 17 - 3 . 03 ( m , 5h ), 2 . 37 - 2 . 32 ( m , 2h ), 2 . 15 ( s , 6h ), 2 . 12 - 2 . 08 ( m , 2h ); esi - ms : (+ ve mode ) 577 . 55 ( m + h ) + ( 100 %); hplc : 99 . 24 %. using the above procedures , following compounds ( table - 2 ) can be prepared , using different boronic acids and finally reacting with optionally substituted acid chlorides . in vitro btk inhibitory activity of test compounds were screened using btk kinase assay on adp glo platform ( li , h ., totoritis , r . d ., lor , l . a ., schwartz , b ., caprioli , p ., jurewicz , a . j and zhang , g ., assay drug dev . technol ., 2009 , 7 ( 6 ), 598 - 605 ). briefly , fixed amount of recombinant purified human btk ( 3 ng / reaction from signalchem , usa ) were incubated with increasing concentration of test compounds , in 1 × kinase reaction buffer ( 40 mm tris - cl , ph7 . 5 , 20 mm mgcl 2 , 2 mm mncl 2 , 0 . 1 mg / ml bsa and 50 μm dtt ). enzymatic reaction was initiated by adding a substrate cocktail containing 50 μm of atp ( final concentration ) and 5 μg of polygln4tyr1 ( signal chem ) in total 25 μl of reaction , in round bottom white 96 well plate . the reaction mixture was incubated at room temperature for 2 hr . after 2 hr of incubation , 10 μl of the reaction mix was mixed with 10μ of adp glo reagent , in another round bottom white 96 well plate and incubated at room temperature for 40 min . this was followed by addition of kinase detection reagent ( 20 μl per reaction ) and incubation at room temperature for 30 min . finally , plate was read for luminescence at an integration time of 500 millisecond per well . data were plotted taking enzyme with no inhibitor set as the 100 % kinase activity and for dose response curve , % kinase activity was plotted against conc on log scale and ic 50 was determined by non linear curve fitting method using graphpad prism software 6 . the invitro btk inhibitory activity ( ic 50 ) for representative compounds are listed in cyp inhibition studies were performed with test compounds , at two concentrations ( 2 μm and 10 μm ), using human liver microsomes ( yao , m ., zhu , m ., sinz , m . w ., zhang , h ., humphreys , w . f ., rodrigues , a . d and dai , r ., journal of pharmaceutical and biomedical analysis , 2007 , 44 , 211 - 223 ; walsky , r . l and obach , r . s ., drug metab . dispos ., 2004 , 32 , 647 - 660 ). human liver microsomes were mixed with 100 mm phosphate buffer ( ph 7 . 4 ) and probe substrate and warmed to 37 ° in microcentrifuge tubes . aliquots of this mixture ( 499 μl ) were transferred to each pre - labeled microcentrifuge tubes , followed by addition of the 1 μl of inhibitors ( test compound / cyp - specific positive control inhibitor ) or control solvent ( dmso ). aliquots of this mixture ( 90 μl ) were transferred to each pre - labeled microcentrifuge tubes in duplicate . final solvent concentrations were 0 . 2 % ( v / v ) or less . incubations were commenced with the addition of 10 μl nadph stock ( assay concentration , 1 mm ) to a final incubation volume of 100 μl and incubated in shaking water bath ( at 37 ° c . and 100 rpm ), for the period defined in tables 1 . incubations were terminated by addition of 400 μl of termination solvent ( ch 3 cn ) containing internal standard . the terminated samples were vortex - mixed , centrifuged at 10000 rpm for 5 min and supernatant transferred into hplc vials for lc - ms / ms analysis to monitor metabolites produced by marker cyp reactions . cyp inhibitory activity (% inhibition ) of test compounds is listed in table 3 . demonstration of in vivo efficacy of test compounds in rats mice , oral routes of administration . all the animal experiments were carried out in female rats and mice , bred in - house . animals were housed in groups of 6 animals per cage , for a week , in order to habituate them to vivarium conditions ( 25 ± 4 ° c ., 60 - 65 % relative humidity , 12 : 12 h light : dark cycle , with lights on at 7 . 30 am ). all the animal experiments were carried out according to the internationally valid guidelines following approval by the ‘ zydus research center animal ethical committee ’. female sprague dawley ( sd ) rats were primed with an intra - articular injection of 20 μl of peptidoglycan polysaccharide ( pgps ), at 0 . 5 mg / ml of rhamnose in the right ankle . at 2 weeks the paw swelling were measured using a plethysmometer and rats assigned to groups based on initial paw swelling . on day 14 after model initiation , rats were dosed orally ( po ) with the test compounds . following the dose administration , 1 h later , the rats received a booster dose of 0 . 5 ml of pgps ( 0 . 5 mg / ml of rhamnose ) via i . v . injection using their tail vein . compounds were dosed for the following two more days and their paw volumes were measured for 3 more days . the efficacy of the compound was determined as percentage inhibition of paw swelling verses the control ( untreated ) group . representative data of some of the test compounds are listed in table - 4 . female scid mice were inoculated sc with 10 × 10 6 tmd - 8 cells in 0 . 1 ml of pbs to the right flank . animals were observed twice weekly for occurrence of tumor . once the tumors became palpable ( around 100 mm 3 ) around 14 days after injection , treatment was initiated via oral route . tumor volume was determined every alternate day using digital calipers and the tumor volume was calculated using the formula : [ length / 2 ]×[ width 2 ]. body weights of the animals were also recorded 3 times a week as a measure of treatment related side effect . treatment was continued for two more weeks and inhibition of tumor volume compared to vehicle control was considered as efficacy endpoint . representative data of some of the test compounds are listed in table - 4 . cia is a frequently used animal model of human ra ( courtenay , j . s ., dallman , m . j ., dayan , a . d ., martin , a . and mosedale , b ., nature , 1980 , 283 , 666 - 668 ; bevaart , l ., vervoordeldonk , m . j ., tak , p . p ., methods mol . biol ., 2010 , 602 , 181 - 192 ). following 7 days acclimation , mice were randomly assigned to groups according body weight . mice were immunized subcutaneously in the tail using bovine type ii collagen mix in complete freund &# 39 ; s adjuvant ( cfa ). twenty - one days after the first immunization , mice were given booster dose of collagen in incomplete freund &# 39 ; s adjuvant ( ifa ). mice were monitored every other day after the booster dose for the development of arthritis . mice were recruited for the study once clinical signs were visible . eight animals were assigned each of three groups [ vehicle , positive control and test compounds ] and treatment was continued for four weeks and percentage inhibition in clinical score is recorded as per graded score . body weights of the animals were also recorded 3 times a week as a measure of treatment related side effect , paw thickness measured twice a week and blood serum are collected at termination for cytokines profile . representative data of some of the test compounds are listed in table - 4 . the novel compounds of the present invention can be formulated into suitable pharmaceutically acceptable compositions by combining with suitable excipients by techniques and processes and concentrations as are well known . the compounds of formula ( i ) or pharmaceutical compositions containing them are useful as a medicament for the inhibition of btk activity and suitable for humans and other warm blooded animals , and may be administered either by oral , topical or parenteral administration . thus , a pharmaceutical composition comprising the compounds of the present invention may comprise a suitable binder , suitable bulking agent & amp ;/ or diluent and any other suitable agents as may be necessary . optionally , the pharmaceutical composition may be suitably coated with suitable coating agents . the compounds of the present invention ( i ) are btk inhibitors and are useful in the treatment of disease states mediated by btk enzyme , preferably cancer , arthritis and related disorders . in one of the embodiments the present invention of formula ( i ) in combination with one or more suitable pharmaceutically active agents selected from following therapeutic agents in any combination . immunosuppressants ( e . g ., methotrexate , mercaptopurine , cyclophosphamide ), glucocorticoids , non - steroidal anti - inflammatory drugs , cox - 2 specific inhibitors , tnf - binding proteins ( eg ., infliximab , etanercept ), interferon - 13 , interferon - , interleukin - 2 , antihistamines , beta - agonist , anticolinergics , anti - cancer agents or their suitable pharmaceutically acceptable salts . further examples of anticancer agents for use in combination with btk inhibitors include chemotherapy or a targeted therapy , alkylating agents , platinum compounds , dna altering agents , topoisomerase inhibitors , microtubule modifiers , antimetabolites , anticancer antibiotics , hormones , aromatase inhibitors , antibodies , cytokines , vaccines , drug conjugates , inhibitors of mitogen - activated protein kinase signaling ( ex : bay 43 - 9006 ), syk inhibitors , mtor inhibitors , antibodies ( rituxan ), other anticancer agents that can be employed in combination include , vinblastin , bleomycin , cisplatin , acivicin , azacitidine , decitabine , doxorubicin , enloplatin , flurouracil , methotrexate , vinblastin , vincristine and bcr / abl antagonist the quantity of active component , that is , the compounds of formula ( i ) according to this invention , in the pharmaceutical composition and unit dosage form thereof may be varied or adjusted widely depending upon the particular application method , the potency of the particular compound and the desired concentration . generally , the quantity of active component will range between 0 . 5 % to 90 % by weight of the composition .	0
as summarized above , described herein are novel methods for providing liposomal formulations of camptothecins , camptothecin prodrugs , and analogs thereof , and compositions formulated thereby . it will be understood that the term camptothecin as used herein is intended to refer collectively to various camptothecins , camptothecin prodrugs , and camptothecin analogs as are well known in the art . the methods and compositions described herein may be accomplished by various means which are illustrated in the examples below . these examples are intended to be illustrative only , as numerous modifications and variations will be apparent to those skilled in the art . it is known that at ph ranges which favor the lactone - form camptothecin , during liposomal encapsulation the drug preferentially partitions into liposomal membranes . this minimizes exposure to the aqueous environment , resulting in a decrease in ring opening of the active lactone . accordingly , conventional liposomal formulations for camptothecins employ a low ph in liposomes to stabilize camptothecins in the active lactone form . however , this strategy requires use of an aqueous buffer to dissolve the drug prior to preparation of liposomes by conventional hydration - extrusion , sonication , or drug - lipid film techniques . because of the low water - solubility of neutral camptothecins and the concomitant reductions in retention time for liposomal formulations of neutral camptothecins ( see table 1 ), such conventional strategies are more favorable to liposomal encapsulation of cationic camptothecins than neutral camptothecins . camptothecins , including neutral camptothecins , exist predominantly in the active lactone form in aqueous solution at ph less than 6 . 0 , whereas the inactive carboxylate species dominates in aqueous solution at ph above 6 . 0 . at physiological ph ( 7 . 4 ), approximately 70 % of camptothecin is in the carboxylate form . thus , in plasma , approximately 70 % of the drug is in carboxylate ( inactive ) form and 30 % in lactone ( active ) form . the half - life of lactone - form camptothecin in rat plasma is approximately 40 min . encapsulating the lactone form of a representative neutral camptothecin , db - 67 , in pegylated liposomes at low ph ( 4 ) prolongs the half - life of the drug . however , at this ph it was not possible to retain the drug in liposomes in aqueous buffers for long periods of time . it has been found that preparing liposomes containing entrapped camptothecins , prodrugs , or analogs thereof , including neutral camptothecins , at a ph sufficient to keep substantially an entirety of the intraliposomal drug in the inactive carboxylate form significantly increased the half - life for retention in liposomes . this is because the release of the carboxylate form from the liposomes is negligible . surprisingly , however , slow conversion of the entrapped , ring - opened carboxylate occurs , providing a low , steady - state concentration of lactone form drug which is then slowly released from the liposome . thus , the present invention provides a slow and prolonged release of the active lactone form from the liposome . this release rate can be varied by changing the intraliposomal ph . that is , an increase in the intraliposomal ph slows the release of active lactone from the liposome , and vice - versa . the compositions contemplated herein may be formulated for delivery to patients in need thereof using methods and formulations well within the skill in the art . for example , the compositions may be prepared for direct delivery , or as pharmaceutical formulations along with suitable carriers or excipients as are well known to the skilled artisan . for example , one or more additives may be included with the compositions , such as one or more stabilizers , buffers , salts , preservatives , fillers , and the like . suitable buffers include without limitation phosphates , carbonates , citrates , and others . suitable preservatives include without limitation edta , egta , bha , bht , and others . the skilled artisan will also readily appreciate that pharmaceutical formulations comprising the present compositions will be highly dependent on the route of administration chosen . by way of non - limiting example , injectable formulations of the compositions may be provided as aqueous solutions , typically in physiologically compatible buffers such as hank &# 39 ; s solution , ringer &# 39 ; s solution , or physiological saline buffer . pharmaceutical formulations intended for parenteral injection , e . g ., by bolus injection or continuous infusion , may be provided in unit dosage form , e . g ., in ampoules or in multi - dose containers , typically with an added preservative as set forth above . set forth in greater detail below are specific details related to selected modes for carrying out the methods and compositions of the present invention . the examples set forth herein are in no way intended to limit the scope of the invention . those of skill in the art will realize that , given the teachings provided herein , many variations of the methods are possible that will fall within the scope of the present invention . unless otherwise indicated , all citations of literature are specifically incorporated by reference herein in their entirety . phospholipids and pegylated phospholipids were purchased as powders from avanti polar lipids ( alabaster , ala .). a representative neutral camptothecin , db - 67 , was from novartis pharmaceutical corp . ( east hanover , n . j .). sprague - dawley rat plasma was from bioreclamation , inc . ( east meadow , n . y .). centricon ® ( mwco : 100000 ) centrifugal filter devices from millipore ( billerica , mass .) and sephadex ® g - 25 m prepacked size exclusion columns ( ge healicare bio - sciences corp ., piscataway , n . j .) were used in liposome studies . all other reagents were from fisher scientific ( florence , ky .). liposomes were prepared by conventional hydration - extrusion technique . however , the skilled artisan will appreciate that any suitable method for preparing liposomes having a desired particle size and lamellarity is contemplated . in one aspect , liposomes having a particle size range of from about 50 to about 300 nm are contemplated for use in the present invention . methods for preparing liposomes falling within a predetermined size range are known in the art ( see drummond et al ., 1999 ). for the hydration - extrusion technique , films of the desired lipid mixtures were prepared in test tubes by dissolving weighed amounts of lipids in chloroform , evaporating the solvent under nitrogen , and drying overnight in vacuo . a stock solution of drug ( db - 67 ) in a buffer providing the desired ph was added to hydrate the lipids , followed by shaking and extrusion through polycarbonate membranes at 60 ° c . to obtain unilamellar vesicles containing entrapped drug . thus , intraliposomal ph of the final liposome - entrapped drug preparation prepared as described was substantially in accordance with the ph of the buffer / db - 67 solution in which phospholipid mixtures were hydrated . the liposomal permeability of db - 67 in aqueous solution was measured over a ph range of 4 . 5 to 9 . 5 using a dynamic dialysis method [ v . joguparthi and b . d . anderson , liposomal delivery of hydrophobic weak acids : enhancement of drug retention using a high intraliposomal ph , j . pharm . sci . 97 , 433 - 454 ( 2008 )]. liposome - encapsulated db - 67 solutions were prepared at varying ph values as described above . for liposome solutions at each ph evaluated , liposome - entrapped drug was separated from free drug by passing liposomes through a sephadex ® column followed by 5 ml of the same buffer added in 1 ml increments . the liposome - containing eluent was dialyzed at 37 ° c . in the same buffer . at intervals , 100 μl of liposome suspension was removed from the dialysis tube and added to 900 μl cold methanol / acetonitrile ( 2 : 1 , v / v ). these samples were dried under nitrogen and stored (− 25 ° c .) prior to analysis . with reference to table 2 , db - 67 was retained in liposomes ( prepared by hydration - extrusion ) in aqueous solution for increased periods of time when liposomes were prepared at high ph . in aqueous solution , the half - life for retention of db - 67 in liposomes increased from 3 hours at ph 4 to about 90 hours at ph 9 . 5 . without being restricted to any particular theory , this may be due to conversion of db - 67 lactone to the carboxylate form in the intraliposomal space . as shown in fig2 , when intraliposomal ph was maintained whereby the carboxylate species of db - 67 predominated , release of the drug from liposomes was negligible . for release to occur , ph conditions allowing formation of the active , lactone species were required . the efflux of db - 67 from liposomes in plasma was monitored . aliquots of liposome suspension containing db - 67 ( with unentrapped drug separated as described above ) were added to plasma and incubated at 37 ° c . at intervals , an aliquot of plasma was withdrawn , added to cold methanol / acetonitrile ( 2 : 1 v / v ), centrifuged ( 14000 rpm ) and stored frozen (− 25 ° c .) for hplc analysis . hplc analyses used herein have been previously described in detail ( joguparthi et al ., 2006 ). db - 67 carboxylate standards ( 10 - 100 nm ) were prepared in 10 mm carbonate buffer ( ph 10 . 4 ). db - 67 lactone standards ( 5 - 30 nm ) were prepared in acidified methanol . all standards were diluted into the desired concentration range using cold methanol / acetonitrile ( 2 : 1 v / v ). hplc retention times were 1 . 6 and 5 . 2 min for db - 67 carboxylate and lactone , respectively . fig3 shows liposomal release of db - 67 in plasma at ph 4 . 5 and ph 9 . 5 . in plasma , the half - life for retention in liposomes was 3 . 5 hours when intraliposomal ph was 4 . 5 and 6 . 3 hours when intraliposomal ph was 9 . 5 . the half - life for retention at intraliposomal ph 9 . 5 was less in plasma than in aqueous solution due to a decrease in intraliposomal ph observed after adding liposomes to plasma . however , even in plasma , preparing liposomes at ph 9 . 5 and maintaining intraliposomal ph at levels which preserve the carboxylate form of the entrapped neutral camptothecin prolonged intraliposomal retention . thus , the potential for exposure of healthy tissue to the drug was reduced . this improved intraliposomal retention enables the drug to remain in the liposomes while they are circulating in the bloodstream . after the liposomes collect in solid tumors due to their enhanced permeation across the tumor vasculature and their improved retention within the tumor tissue ( drummond et al ., 1999 ), the entrapped drug will be slowly released as the active , lactone form of the drug directly at the tumor site , providing a significant enhancement in efficiency of delivery . a 10 mg / ml solution of db - 67 was prepared in ph 9 . 5 sodium carbonate buffer and filtered through a 0 . 2 μm syringe filter . the drug solution was used to hydrate phospholipids ( dspc + 5 mol % m - peg dspe ) with shaking at 60 ° c . to form a 30 mg / ml suspension of multilamellar vesicles . the suspension was extruded through a high pressure extruder to form unilamellar vesicles . the vesicles were then cooled at room temperature and stored below 5 ° c . until use . prior to use , liposomes were separated from unentrapped db - 67 by passing through a gel filtration column which was pre - equilibrated with ph 7 . 4 phosphate buffered saline . 100 μl of liposomes collected from gel filtration were immediately added to 4 ml of plasma to study the release of liposome - entrapped db - 67 carboxylate from plasma as described above . samples were taken at various time intervals and db - 67 was extracted from 100 μl of plasma using 300 μl of ice - cold methanol solution and acetonitrile ( 2 : 1 v / v ) at − 9 ° c . the concentration of db - 67 was determined by hplc as described above . a 10 mg / ml solution of db - 67 was prepared in ph 9 . 5 sodium carbonate buffer and filtered through a 0 . 2 μm syringe filter . the drug solution was used to hydrate phospholipids ( dspc + 5 mol % m - peg dspe ) with shaking at 60 ° c . to form a 30 mg / ml suspension of multilamellar vesicles . the suspension was extruded through a high pressure extruder to form unilamellar vesicles . the vesicles were then cooled at room temperature and stored below 5 ° c . until use . prior to use , liposomes were separated from unentrapped db - 67 by passing through a gel filtration column which was pre - equilibrated with ph 9 . 5 sodium carbonate buffer . the liposomes collected from gel filtration were immediately loaded into a dialysis tube and dialyzed ( 37 c ) against 1000 ml of ph 9 . 5 sodium carbonate buffer . db - 67 analysis was by hplc as described above . a 20 mg / ml solution of db - 67 is prepared in ph 10 . 5 sodium carbonate buffer and filtered through a 0 . 2 μm syringe filter . the drag solution is used to hydrate phospholipids ( dspc + 5 mol % m - peg dspe ) with shaking at 60 ° c . to form a 30 mg / ml suspension of multilamellar vesicles . the suspension is extruded through a high pressure extruder to form unilamellar vesicles . the vesicles are then cooled at room temperature and stored below 5 ° c . until use . prior to use , liposomes are warmed to room temperature and separated from unentrapped db - 67 by gel filtration as described . 10 mg of db - 67 is added to 60 mg of a phospholipid mixture in 2 ml of a 2 : 1 mixture of chloroform : ethanol . the solution is evaporated under nitrogen to form a drug - lipid film . the film is hydrated with ph 10 . 5 carbonate buffer with shaking to form multilamellar vesicles . the suspension is extruded to form unilamellar vesicles . the vesicles are cooled to room temperature and unentrapped drug is separated from entrapped drug as described . the liposomes are then stored below 5 ° c . until use . drug is loaded in vesicles as described in examples 6 and 7 , except the drug and phospholipids are dissolved in pure chloroform , pure acetone , pure methanol , or a suitable combination of those solvents . subsequently , solvent is evaporated to form a drug - lipid film . unilamellar vesicles are prepared as described in examples 4 - 8 using ph 9 . 5 borate buffer . unilamellar vesicles are prepared as described in examples 4 - 8 using ph 9 . 5 tris - hcl buffer . unilamellar vesicles are prepared as described in examples 4 - 8 using ph 9 . 3 ammonium hydroxide . unilamellar vesicles are prepared as described in examples 4 - 8 using ph 9 glycine . unilamellar vesicles are prepared as described in examples 4 - 12 , with the exception that the vesicles are formed by sonication rather than extrusion . unilamellar vesicles are prepared as described in examples 4 - 13 , except the drug used is sn - 38 . unilamellar vesicles are prepared as described in examples 4 - 13 , except the drug used is karenitecan . unilamellar vesicles are prepared as described in examples 4 - 13 , except the drug used is gimatecan . unilamellar vesicles are prepared as described in examples 4 - 13 , except the drug used is 9 - nitro camptothecin . unilamellar vesicles are prepared as described in examples 4 - 17 , with the exception that during separation of entrapped from unentrapped drug , the extraliposomal buffer is exchanged for ph 7 . 4 phosphate with the proviso that intraliposomal ph is maintained the same as that used in liposome preparation . unilamellar vesicles are prepared as described in examples 4 - 17 , with the exception that during separation of entrapped from unentrapped drug , the extraliposomal buffer is exchanged for a desired concentration of nacl solution with the proviso that intraliposomal ph is maintained the same as that used in liposome preparation . unilamellar vesicles are prepared as described in examples 4 - 17 , with the exception that during separation of entrapped from unentrapped drug , the extraliposomal buffer is exchanged for a desired concentration of sucrose solution , with the proviso that intraliposomal ph is maintained the same as that used in liposome preparation . unilamellar vesicles are prepared as described in examples 4 - 20 , using a lipid mixture comprising 80 % dspc , 15 % cholesterol , and 5 % m - peg dspe . unilamellar vesicles are prepared as described in examples 4 - 20 , using a lipid mixture comprising 80 % hspc , 15 % cholesterol , and 5 % pegylated pe . unilamellar vesicles are prepared as described in examples 4 - 20 , using a lipid mixture comprising 55 % dspc , 40 % cholesterol , and 5 % m - peg dspe . the skilled artisan will readily appreciate that the present disclosure sets forth an efficient and efficacious method for preparing a liposomal formulation of a camptothecin , in one aspect being a neutral camptothecin , camptothecin prodrug , or analog thereof . advantageously , the compositions formulated by the present method provide a stable liposomal camptothecin in therapeutically effective amounts , wherein the drug is retained in the liposome under physiological conditions for increased periods of time . this allows accumulation of the liposomal camptothecin formulations at a tumor site , with limited side effects on healthy cells and tissue , and further allows in situ delivery of the active lactone form of the drug to directly to tumor tissue in adequate concentrations for effective tumor cell killing and / or growth inhibition . by increasing intraliposomal ph and maintaining that ph prior to administration and during in vivo delivery to a tumor site , it has been surprisingly found that liposomal retention of a camptothecin may be prolonged , reducing the potential for exposure of healthy tissue to the drug when administered in vivo . this improvement in retention allows the drug to accumulate at tumor tissue , i . e ., an in vivo enhanced permeation and retention effect ( drummond et al ., 1999 ). as the liposomes accumulate within the tumor tissue , over time the drug is released as the lactone form in situ , thus achieving release of drug in the active form directly at the tumor site , rather than drug residing in the bloodstream at physiological conditions favoring conversion to the inactive carboxylate form . accordingly , the problems of enhanced liposomal retention and delivery of the active lactone form camptothecin to a tumor site are simultaneously solved . the foregoing description of preferred embodiments has been presented for purposes of illustration and description . it is not intended to be exhaustive or limiting to the precise forms disclosed . obvious modifications or variations are possible in light of the above teachings . the embodiments were chosen and described to provide the best illustration of the principles described herein and their practical application to thereby enable one of ordinary skill in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . all such modifications and variations are within the scope of the invention as determined by the appended claims when interpreted in accordance with the breadth to which they are fairly , legally and equitably entitled .	0
the invention is applicable in general to polar amplification stages . in the following description the invention is described with specific reference to the example of an amplification stage incorporating an envelope tracking ( et ) polar modulation technique . however this is for the purposes of illustrating an exemplary implementation of the invention , and to aid in understanding the invention , and the invention is not limited to such a specific technique . the skilled person will appreciate the invention may also be implemented in other polar transmitter technologies including , for example , envelope elimination and restoration technologies . one skilled in the art will appreciate that the invention and its embodiments may be utilised in a broader range of polar transmitters than is set forth herein . in the following description , where an element of one figure corresponds to an element of another figure , like reference numerals are used to denote a correspondence . the presentation of a combination of features in an embodiment does not represent a limitation that the combination of features is necessarily essential to an embodiment , nor exclude the possibility that elements of an embodiment may be used without other illustrated elements or with other non - illustrated elements . the invention will now be described with further reference to the exemplary rf amplification architecture of fig2 , which modifies the arrangement of fig1 in accordance with exemplary embodiments of the invention . the invention , and its embodiments , is not however limited in its applicability to the exemplary architecture and implementation as illustrated in fig2 . with reference to fig2 , the rf amplification architecture is adapted to include a calibration control stage 142 including the signal generation block 122 , a programmable delay adjustment block 124 , and a measurement block 120 , in accordance with an exemplary implementation of the present invention . as illustrated in the embodiment of fig2 , the envelope signal , i component of the input signal , and q component of the signal for the respective digital - to - analogue converters 126 a to 126 c are generated on lines 125 a , 125 b and 125 c respectively by the signal generation block 122 via the programmable delay adjustment block 124 . the signal generation block 122 optionally generates signals to the measurement and correlation block 120 on lines 156 , and the measurement block 120 generates signals to the programmable delay adjustment block 124 on lines 157 . a diode 114 is connected to the output of the power amplifier 102 on line 140 in order to provide the functionality of a power detector . the diode 114 is further connected to a filter 118 , which in turn is connected to an analogue - to - digital converter 116 to provide a digital and filtered representation of the signal detected by the diode 114 to the measurement block 120 on line 121 . the implementation shown is exemplary , and the invention is not limited to the use of a diode as a power detector to provide feedback to the measurement block 120 . in general , the diode 114 represents a functional block for providing a signal representing the amplitude or power of the signal at the output of the rf power amplifier 102 on line 140 . in an alternative implementation , the detection could for example be implemented using a receiver chain including an analogue to digital converter , with detection of the envelope being implemented in the digital domain . the adaptation of an rf power amplification stage in accordance with the exemplary arrangement of fig2 provides for a calibration system that reduces the delay uncertainty in the envelope path and the rf path , and that can be implemented as a self - calibration . in accordance with the principles of this invention the power amplifier is driven in and out of compression , such that it operates in both a linear mode of operation ( without compression ) and a saturated mode of operation ( with compression ). this is preferably achieved by providing a signal for the rf input path which has an increasing and decreasing slope , whilst at the same time the envelope path is driven with a signal with opposite slopes to that of the signal on the rf input path . this is illustrated with respect to fig3 , which shows a triangular signal in fig3 ( a ) and 3 ( b ) which may be applied to the input envelope path , and an inverse triangular signal applied to the rf input path as shown in fig3 ( b ). the signal to the input envelope path is denoted by reference numeral 308 , and the signal to the rf input path is denoted by reference numeral 310 . as illustrated in fig3 ( a ) and 3 ( b ), the signals contain two distinct slopes , one increasing and one decreasing , and one signal is the inverse of the other . as noted above , the levels of the signal applied to the rf input path and the envelope path must be set such that both linear and saturation modes of operation are obtained in the power amplifier . the effect of this is that when the signal in the rf input path is small enough , i . e . lower than the power supply voltage provided to the power amplifier as determined by the signal in the envelope path , the power amplifier operates in a linear mode of operation . in a linear mode of operation , the power amplifier output power is a strong function of the power amplifier input level . when the rf input path signal becomes large enough , i . e . higher than the power supply voltage provided to the power amplifier by the signal in the envelope path , the power amplifier operates in saturation mode and the power amplifier output level becomes a strong function of the signal in the envelope path to the power amplifier supply voltage . this means that due to the opposite signal slopes on each path , there will be a peak of the power amplifier output voltage at the point when the power amplifier transitions from a linear mode of operation to a saturated ( non - linear ) mode of operation and a peak where the power amplifier transitions from a saturated ( non - linear ) mode of operation to a linear mode of operation . this will occur both during the up and down slopes of the input signals , which therefore generate two power amplifier output voltage peaks . for the simple example of the input signals of fig3 ( a ) and 3 ( b ), the rf output signal is illustrated in fig3 ( c ), and denoted by reference numeral 312 . as can be seen , the rf output signal has two peaks . the first peak represents the transition point from saturated operation to linear operation , and the second point represents the transition from linear operation to saturated operation . although in the example of fig3 ( a ) to 3 ( c ) the input signals are shown as triangular waves , the invention is not limited to the input signals being of any particular shape . the input signals can be , for example , sine waves or any other type of signal . the only characteristic required of the input signals is that they contain two distinct slopes , one increasing and one decreasing , and that the signal in one path is the inverse of the other . with reference to fig4 there is illustrated a further example . in fig4 waveform 302 represents the input voltage on the rf input path , which as illustrated is a sinusoidal signal . waveform 304 represents the supply voltage provided by the et modulator . waveform 306 represents the voltage at the output of the power amplifier . as illustrated in fig4 , between times t 0 and t 1 the amplifier operates in non - linear or saturated mode , between times t 1 and t 2 the amplifier operates in linear mode , and between times t 2 and t 3 the amplifier operates in saturated or non - linear mode . at the time at which the amplifier changes from non - linear to linear mode , at time t 1 , a peak in the output signal is generated . similarly at the time that the amplifier transitions from linear to non - linear mode , time t 2 , a peak in the output signal occurs . if there is a timing misalignment in either the first or second peak at times t 1 and t 2 one peak would be larger than the other , due to the transition in power amplifier operating mode occurring at a slightly different operating condition . for example if the envelope path to the power amplifier supply voltage has a signal which is slightly earlier than the signal on the rf input path , then its rising flank will cause the transition into linear mode to occur earlier , and the first peak will be larger than the second peak . similarly the transition out of linear mode also occurs slightly earlier and therefore non - linear mode will occur earlier and the second peak will be slightly less in amplitude . reference is made to fig5 ( a ) and 5 ( b ) to help further understand the occurrence of one peak being larger than the other when a timing misalignment is present . fig5 ( a ) illustrates as a main plot a typical device transfer characteristic of a transistor of the amplifier stage , comprising numerous plots 550 of amplifier output voltage against amplifier input voltage . the numerous plots 550 reflect the sweeping of the power amplifier supply voltage , such that the higher the output voltage the higher the supply voltage . such a transfer characteristic as represented by waveforms 550 is well - known in the art . also illustrated in fig5 ( a ) is a plot 552 of supply voltage to the amplifier in a calibration mode of operation in accordance with an embodiment of the invention . in the illustration of fig5 ( a ) there is represented a condition , in the calibration mode of operation , where there is no delay between the envelope path signal and the rf input path signal . as shown 552 illustrates a falling supply voltage as the input voltage increases . further illustrated is a plot 554 of output voltage against the input voltage in association with the falling supply voltage 552 . as illustrated in fig5 ( a ), the output voltage increases in accordance with the normal behaviour of the transistor device characteristics , following the input voltage . however at some point denoted by time t a the output voltage peaks and starts to fall , as the amplifier has reached saturation due to the decreasing supply voltage 552 in combination with the increasing input voltage . the output voltage the slopes off as the input voltage continues to rise and the supply voltage continues to decrease . with reference to fig5 ( b ), there is illustrated the effect on the amplitude of the peak of waveform 554 of fig5 ( a ) as a result of relative delays between the envelope signal and the input signal , which results in the differences in peak amplitudes which are detected in the circuit of fig2 . as illustrated by arrow 558 , for the device transfer characteristics waveforms 550 the output voltage of the amplifier increases as the input voltage increases , for increasing supply voltages . as denoted by arrow 560 , during a calibration operation in accordance with the invention the slope of the supply voltage relative to the input voltage will vary in dependence on the relative delay in the input signal path and the envelope signal path . as denoted by arrow 560 , for a given input voltage the instantaneous supply voltage will vary in dependence on the relative delay . the supply voltage waveform 552 of fig5 ( a ) is thus replaced by supply voltage waveforms 552 a and 552 b in fig5 ( b ). fig5 ( b ) represents a timing misalignment with respect to fig5 ( a ). the output voltage waveform 554 of fig5 ( a ) is also replaced by the output voltage waveforms 554 a and 554 b . the output voltage waveform 554 a is associated with the supply voltage 552 a , and the output voltage waveform 554 b is associated with the supply voltage 552 b . these output voltage waveforms 554 a and 554 b show the effect of timing misalignment between the envelope and input signal paths on the size of the peaks in the output . for the supply voltage waveform 552 a , the corresponding output voltage waveform is 554 a , which peaks at an output voltage level a . for the supply voltage waveform 552 b , the corresponding output voltage waveforms is 554 b , which peaks at output voltage level b . the voltage peak b is less than voltage peak a . the output voltage 554 b is not able to reach as a high a level as the output voltage 554 a , because the decreasing supply voltage 552 b results in saturation being reached at a lower input voltage than for supply voltage 552 a . for supply voltage 552 b the amplifier enters saturation for a lower input voltage , and is thus not able to achieve as a high a peak as for supply waveform 554 a . in general , the later the supply voltage is in comparison to the input waveform , the higher the associated peak at a transition from linear mode to saturation will be . in summary , the supply drops down to a certain level and then the amplifier output is dominated by the supply . the supply goes down as the input increases , due to the inverse nature of the signals . if the supply is early , then a low peak is obtained . if the supply is late , then a high peak is obtained . the peaks also provide information about the direction of delay . if the first peak is larger than the second peak then the signal on the envelope path to the power amplifier supply voltage needs to be delayed , or alternatively the signal on the rf input path needs to be advanced , and if the second peak is larger than the first peak then the signal on the envelope path to the power amplifier voltage supply needs to be advanced ( or the signal on the rf input path needs to be delayed ). the principles of the present invention as exemplified by the arrangement of fig2 are now further described with reference to an exemplary procedure as set out in the flow diagram of fig6 . as denoted in step 502 , the signal generation block 122 is arranged to generate first and second signals for the envelope path and the rf input path . one signal is a signal with increasing and decreasing slopes , and the second signal is the inverse of the first signal , with opposite slopes . the first and second signals may be generated independently by the signal generation block 122 , or one signal may be generated for one path and then inverted for the other path . in a step 504 the first and second signals are applied to the envelope path and the input path respectively . it should be noted that there is no requirement for the signals to be applied to a particular one of the paths , it is merely a requirement that the signal applied to the two paths have opposite slopes . in this exemplary arrangement , the first signal is processed by the envelope path and the second signal is processed by the input path . the diode detector 114 , as denoted by step 506 , detects the power of the output of the rf amplifier , which is delivered to the measurement block 122 through the feedback path formed by the diode 114 , the filter 118 , and the analogue - to - digital converter 116 . the measurement block 120 detects and measures a first peak , as denoted by step 508 . the measurement block then detects and measures a second peak as denoted by step 510 . as indicated in fig2 , the measurement block 120 may receive a signal from the signal generation block 122 , so that the measurement block 120 can associate detected peaks with a particular pair of input signals generated for the input path and envelope paths . for example , a signal on line 156 may provide a trigger to the measurement block 102 to associate two detected peaks with a single input sequence . as denoted by step 512 , the measurement block then compares the first and second detected peaks . as discussed hereinabove , the measurement block makes a determination as to which of the input and envelope paths contains a signal which is more advanced than the other . in dependence upon determination of one signal being more advanced than the other , then an appropriate delay or adjustment is made as denoted by step 514 . in the event of the first peak being detected as greater than the second peak , the first signal is delayed ( or the second signal advanced ). in determination of the second peak being greater than the first peak , the second signal is delayed ( or the first signal advanced ). in detection of the first and second peaks being equal , no adjustment is made . the adjustment is preferably made by the measurement block 120 providing an appropriate adjustment to the programmable delay adjustment block 124 on lines 157 in dependence on the measured difference of the peaks and if appropriate the direction of the measured difference . the process may then be applied iteratively , until the measurement block 120 determines that the delay between the two paths is determined to fall within an acceptable tolerance . the measurement timing resolution restrictions of the adc 116 may be relaxed by post - processing the peak information to interpolate the peaks . the technique as described for reducing delay between the signals in the rf input path and the envelope path has a number of advantages . the main advantage of the technique described herein is that the delay is detected based on very large power amplifier output signals . on this basis there is no requirement for a particularly sensitive detection device . the technique is relatively insensitive to quantisation , noise or isolation effects . a second advantage of the described technique is that the direction of required delay adjustment can be seen from the signal generated at the power amplifier output by comparing the two peaks generated when entering linear mode and exiting linear mode . this means that the detection of the correction direction of delay adjustment is not needed . detection of the correction direction may take additional time and processing effort , which is not a problem incurred by the present techniques . thirdly , it is possible to calculate the amount of delay adjustment required due to the amplitude difference ( or ratio , or some other characteristic of signal peak differences ). if the delay can be calculated from the peak amplitudes then the requirement for a search algorithm is negated . however , tolerances , timing setup and other real world effects may make it impractical to directly calculate the delay requirement absolutely . nevertheless the ability to provide some measurement of the delay is provided . the invention is described herein with reference to particular examples and embodiments , which are useful for understanding the invention and understanding a preferred implementation of the invention . the invention is not , however , limited to the specifics of any given embodiment , nor are the details of any embodiment mutually exclusive . the scope of the invention is defined by the appended claims .	7
referring now to fig1 a and 1b , there is shown an all - metal ultra - high vacuum ( uhv ) o - ring seal arrangement 10 in accordance with one embodiment of the invention having an o - ring 12 with a strong tendency to increase in outside diameter and reduce in inside diameter . the o - ring is comprised of a heat - recoverable material such as nitinol , for example , an alloy of 55 weight percent nickel and 45 weight percent titanium , which can be annealed in the austenitic phase , transformed by cooling into a martensitic phase , and then strained to as much as 10 percent deformation . upon reheating it transforms again to austenite and energetically tries to return to its original austenitic dimensions . for the uhv sealing arrangements disclosed herein , the o - ring is preferably fabricated by means such as extrusion or machining into a tubular shape with an outside diameter approximately 21 / 2 percent larger and an inside diameter approximately 21 / 2 percent smaller than the surfaces against which the o - ring will seal , such as an inner metallic tube 14 and a concentric axially aligned outer metallic tube or sleeve 16 . the seal tube 12 is then transformed to a relatively low strength martensite by chilling through the transformation temperature range of the heat - recoverable material . while it remains in the martensitic temperature range it is stretched axially , as in a tensile test , approximately 10 percent . when a tube is strained axially in this manner , the mean diameter is unchanged , but the outside diameter is reduced and the inside diameter is increased , in this case approximately 5 percent of the radial thickness each . while still in the martensitic condition the tube is cut into short rings of given length by any process , well known in the art , which does not raise the metal temperature into the transformation range . the o - rings 12 can be stored at this low temperature until installation . for installation , the o - ring 12 is placed between the tubular cylinders 14 , 16 which are preferably prechilled to the o - ring 12 temperature , with clearances approximately twice as large as would normally be provided for similar seal assemblies . the assembly is then allowed to warm through the transformation temperature range and , as the o - ring 12 transforms , its radial dimensional changes establish the seal zones . while the o - ring can merely be so transformed so as to contact , plastically deform and circumferentially seal against the tubular surfaces , preferred orientations for uhv application seal against specific protruding circumferential rings . in fig1 a and 1b the inner tube 14 is provided with two preferably integral external seal rings 18 and 20 , and the outer sleeve 16 is provided with a singular internal seal ring 22 . the seal rings are oriented such that the internal seal ring 22 is longitudinally positioned between the external seal rings 18 , 20 . additionally , radial holes 24 are provided through the wall 26 of the inner tube 14 , also positioned longitudinally between the external seal rings 18 , 20 , to provide fluid communication between an annular area 28 bounded by the external rings 18 , 20 and the cylindrical surfaces of the o - ring 12 and inner tube 14 between the rings 18 , 20 . the radial holes 24 allow the annulus 28 to be pumped down , and the arrangement thus alleviates the virtual leaks often associated with ultra - high vacuum system sealing arrangements . the o - ring 12 , initially a short cylinder of uniform wall thickness ( fig1 a ) is of a length such that at initial installation the ends of the o - ring are in contact with locating shoulders 30 , 32 of the inner tube 14 and sleeve 16 . with the sleeve internal sealing ring 22 centered between the tube external sealing rings , this configuration forces the o - ring 12 to deflect under the seal loads rather than rotate about its centroid . the o - ring dimensions can be determined as follows , the illustrative example being an o - ring seal with a mean diameter of two inches . the allowance &# 34 ; a &# 34 ; between a plug and a bore recommended by v . l . maleev in &# 34 ; machine design ,&# 34 ; international textbook company , 1939 , page 156 , for a loose interchangeable assembly is a = 0 . 0025 3 √ d 2 , where d is the mean diameter of the mating components in inches . to assure ease of assembly for rapid and remote installation , the allowance between the o - ring and the seal rings is made twice the recommended allowance and the tolerance on each diameter is made equal to the recommended allowance . thus , the total resolved strain of a two - inch mean diameter o - ring may be eight times the maleev recommended allowance , or 0 . 03175 inch . resolved strain with respect to heat recoverable alloys and this application refers to the mechanically induced strain upon axial tensioning in the martensitic phase , as opposed to unresolved strain which is the strain of the nitinol following the martensite to austenite transformation , restrained by the surrounding structures . plastic deformation of aisi 305 stainless steel by a nitinol uhv seal contact requires a radial force of approximately 4 , 000 pounds per inch of seal length . for such forces to be generated by hoop stress in the nitinol o - ring , reasonably assumed to be distributed as shown in fig2 the o - ring thickness &# 34 ; t &# 34 ; must be 0 . 2 inch for a mean seal diameter of two inches and a maximum hoop stress of , for example , 50 , 000 psi . however , the total radial strain of 10 percent for such a ring is a deformation of only 0 . 020 inch , which is less than the possible clearance . thus , the minimum thickness o - ring with satisfactory stress is too thin , and must be increased . according to a stress - strain curve for austenitic nitinol published in raychem corporation &# 39 ; s brochure numbered me - 005 , the unresolved strain equivalent to 50 , 000 psi stress is 0 . 75 percent . the 10 percent initial strain of the o - ring should therefore be : using conventional rounded - off dimensions , the thickness of the o - ring is therefore taken to be 3 / 8 inch or 0 . 375 inch . the seal element dimensions determined as described above are accordingly shown in fig3 . these dimensions result in the unresolved strain ranging from 0 . 79 percent to 1 . 95 percent , with the corresponding hoop stresses ranging from 52 , 000 psi to 69 , 000 psi . the depth of the seal ring protrusions can be varied , and in this example is five mils . another sealing arrangement 40 is shown in fig4 a and 4b . here an o - ring 42 is positioned between an inner tube 44 and outer sleeve 46 , each of which have only one protruding sealing surface . a protruding internal sealing ring 48 on the sleeve is here positioned in the same plane as an external sealing ring 50 on the inner tube . the alignment is arranged at installation by the contact of the ends of the ring with the shoulders 52 , 54 of the tube and sleeve . while this arrangement provides a shorter and lighter o - ring , if the seal ring 48 , 50 are not properly aligned , moments may be created which would tend to rotate the o - ring about its centroid , lessening the integrity of the arrangement for uhv application . the alignment of the seal rings 48 , 50 can be further assured by contact between the tube end and the sleeve - locating shoulder as shown at 56 in fig5 but a virtual leak could result from the volume 58 , through the contact 56 , and into the ultra - high vacuum zone 60 . it will be apparent that many alternatives and equivalents are possible in view of the above teachings . for example , all available grades of nitinol can be utilized , with transformation temperature ranges compatible with the specific uhv system employed . additionally , the shape of the seal rings can be of various configuratons , such as flat , wedged , truncated or rounded , among others . ohter alternates are possible . it therefore is to be understood that within the scope of the appended claims , the invention may be practiced other than as specifically described .	1
as shown in the drawings , the steam engine of the present invention comprises a high pressure boiler 11 surrounded by a low pressure feedwater tank 13 . supported on top of the boiler 11 and feedwater tank 13 is a low pressure water storage tank 15 . rainwater , which should be used in this system whenever possible , is supplied through a pipe 17 into the storage tank 15 . cold water may be caused to flow from the tank 15 through a valve 19 into the low pressure feedwater tank 13 . the valve 19 is controlled by a valve control 21 in response to the water level in the tank 13 . a water level detector 23 is provided in the tank 13 comprising a float 25 , a lower limit detector 27 , and an upper limit detector 29 . when the water level in the tank 13 drops to the lower limit level , the float 25 will come adjacent to the detector 27 , which will then send a signal to the valve control 21 . in response to this signal , the valve control 21 will open the valve 19 and allow cold water to flow from the tank 15 by gravity into the tank 13 . water will then continue flowing into the tank 13 until the tank 13 becomes filled , at which time the float 25 will come adjacent to the upper limit sensor 29 . the upper limit sensor will then send to the valve control 21 a signal , in response to which the valve control 21 will close the valve 19 . the water level in the tank 15 is sensed by a water level detector 30 and indicated by a meter 32 . in the tank 13 , the water is kept at temperatures ranging from 205 ° to 210 ° f ., that is just below the boiling point . from the tank 13 , preheated water is pumped into the boiler 11 by a high pressure pump 31 . the pump 31 is controlled to keep an adequate level of water in the boiler 11 in response to a water level detector 34 , similar to the detector 23 , in the boiler 11 . in the boiler 11 , the water is speedily converted into steam and enters a turbine 33 driving a revolving output shaft 35 . the rate of flow of steam from the boiler to the turbine is controlled by a throttle 36 . the decompressed exhaust steam from the turbine has two paths out of the system . if the temperature in the tank 13 drops below 205 ° f ., a valve control 37 comes into action opening the valve 39 and closing the valve 41 so that the exhaust steam from the turbine will enter a long open ended pipe 43 which is coiled in several turns around the boiler in the bottom of the tank 13 . the pipe 43 is replete with small holes throughout its length and the exhaust steam enters directly into the water in the tank 13 through the holes in the pipe 43 and rapidly dissipates raising the water temperature in the tank 13 and adding to the water volume . any overflow of water is discharged through a pipe 44 . when the water temperature reaches 210 ° f ., the valve control 37 will move the valve 39 back into its closed position and open the valve 41 letting steam out into the atmosphere surrounding the steam engine , or , if desired , into a condenser for returning the condensed steam back into the storage tank 15 . it is only at the point at which the water in tank 13 has been heated up to 210 ° and the valve 41 is opened and the valve 39 is closed that the system loses thermal energy . however , such loss occurs with minimal expense and fuel consumption . instead of having to heat cold water from about 60 ° up to about 215 ° or a full 155 °, heating of only 5 ° to 10 ° is required . the valve control 37 controls the valves 39 and 41 to open and close in response to the temperature in the tank 13 by means of a thermocouple 42 which senses the temperature in the tank 13 and applies a signal to the valve control 37 representing the temperature . if desired , the heat energy in the exhausted steam may be recovered and used to provide heat for the building in which the steam engine is located . to enable the engine to respond to variable demand , the engine has been furnished with a special kind of fuel burner 45 , which has an adjustable position with respect to the boiler 11 and which has a regulated fuel supply provided by an electronically controlled fuel pump 47 . the burner can be moved up or down , closer or further from the boiler , by means of a drive 49 depending on the workload that the machine experiences at any given instant . the workload demand is reflected in changes of the steam pressure in the boiler , which is sensed and converted into an electric signal representing the pressure by a pressure monitoring device 51 . the present monitoring device 51 includes a pressure meter 52 to indicate the pressure in the boiler . the pressure monitoring device 51 also functions as a safety valve for the boiler 11 . any change in the boiler pressure due to a change in workload demand for steam is promptly communicated by the device 51 to an electronic pressure control 53 which controls the fuel pump 47 and a burner positioner 55 . the burner positioner 55 , which may be a conventional servo mechanism , operates the drive 49 to position the burner at a position corresponding to the signal received from the electronic pressure control 53 and thus corresponding to the pressure sensed by the pressure monitoring device 51 . if the boiler pressure drops , the control 53 will cause the fuel pump 47 to increase the fuel flow rate to the burner 45 and at the same time cause the burner positioner 55 to lower the burner 45 so that the higher burner flame will be properly positioned relative to the boiler 11 . conversely , when the boiler pressure increases , the control 53 will cause the fuel pump 47 to decrease the fuel flow rate to the burner 45 and at the same time cause the burner positioner 55 to raise the burner 45 . control of the fuel flow rate in this manner effectively diminishes the danger of a boiler blowup . combustion products from the boiler are drawn out through a stack 57 , which passes up through the middle of the tank 15 , by means of a fan 59 , which is driven by a variable speed fan drive 61 . the fan drive 61 is controlled by the electronic pressure control 53 , which will apply a signal to the fan drive 61 to cause it to operate at a higher speed in response to lower boiler pressure signalled by the pressure monitoring device 51 and at lower speeds in response to higher boiler pressure signalled by the device 51 . thus , when the burner flame is increased in response to lower boiler pressure , the exhaust fan speed will be increased to handle the increased combustion products and also to draw increased air flow to the burner for combustion . rather heavy insulation 63 , 64 , 65 and 67 is applied to the water tanks 13 and 15 , the boiler 11 and the turbine 33 , respectively . the insulation serves to reduce the dissipation of heat from the system and provides protection against severe environmental temperature to which the system might be subjected . the above described engine is of relatively simple , low cost construction , and yet it achieves high efficiency and high economy in fuel consumption with very little environmental pollution or operating noise and full safety of operation .	5
the problems set forth above as well as further and other problems are solved by the present teachings . these solutions and other advantages are achieved by the various embodiments of the teachings described herein below . the system and method of the present embodiment automatically minimize delay in updating time at a client computer . referring now to fig1 , ntp version 4 packet 10 is a user datagram protocol ( udp ) datagram including a basic header — leap indicator 11 , version number 13 , mode 15 , stratum 17 , poll exponent 21 , precision exponent 25 , root delay 27 , root dispersion 29 , reference identification 31 , reference timestamp 33 , origin timestamp 35 , receive timestamp 37 , and transmit timestamp 39 . ntp packet 10 also includes optional extension fields 41 and 43 including , for example , but not limited to , a destination timestamp . finally , ntp packet includes an optional message authentication code including key identification 45 and message digest field 49 . leap indicator 11 warns of an impending leap second , version number 13 is the ntp version number , and mode 15 indicates , among other things , whether or not ntp packet 10 is part of a time broadcast . stratum 17 indicates the reliability of the time source , poll 21 is the maximum interval between successive messages , and precision is the precision of the system clock of the computer creating ntp packet 10 . root delay 27 is the total round - trip delay to the reference clock , root dispersion 29 is the total dispersion to the reference clock , reference identification 31 identifies a particular server computer or reference clock , and reference timestamp 33 is the time when the system clock of the system identified by reference identification 31 was last set or corrected . origin timestamp 35 is the time at the client computer when the request departed for the server computer , receive timestamp 37 is the time at the server computer when the request arrived from the client computer , and transmit timestamp 39 is the time at the server computer when the response left for the client computer . destination timestamp , possibly located in optional extension field 41 , is the time at the client computer when the reply arrived from the server computer . destination timestamp is determined upon arrival of ntp packet 10 . key identifier 45 is used by the client and server computers to designate a secret 128 - bit md5 algorithm key defined in rfc 1321 and used to verify data integrity . message digest 49 is calculated over the ntp header and optional extension fields , but not including key identifier 45 and message digest 49 . referring now to fig2 , protocol 20 can include , but is not limited to including , server computer 19 sending set - up options 135 to client computer 102 , which executes set - up processor 101 receiving and processing set - up options 135 including , for example , but not limited to , a security option and a time format . packet processor 103 sends client packet 123 that is a time request , and that can include , but is not limited to including , ntp packet 10 ( fig1 ) including origin timestamp 35 ( fig1 ), and client identification information . server packet creator 51 creates and sends server packet ( or packets ) 128 that can include , but is not limited to including , client identification information , server identification information , ntp packet 10 ( fig1 ) including receive timestamp 37 ( fig1 ) and transmit timestamp 39 ( fig1 ). time processor 107 computes , by client computer 102 , a time difference between client time 131 ( fig7 ) and at least one of the server times ( receive timestamp 37 ( fig1 ) and transmit timestamp 39 ( fig1 )). the measured time difference is calculated as 0 . 5 *( sr + st − cr − ct ), where sr is receive timestamp 37 ( fig1 ), st is transmit timestamp 39 ( fig1 ), cr is the destination timestamp , and ct is origin timestamp 35 ( fig1 ). secure packet processor 109 receives secure packet 111 which is an encrypted and optionally signed version of server packet 128 . secure packet processor 109 decodes secure packet 111 with a public key and compares server packet 128 with the unencrypted version of secure packet 111 . identification bits can be compared as well . if secure packet 111 and server packet 128 are signed , secure packet processor verifies the signatures . should the packets pass verification test , update processor 105 can compute an updated time 119 ( fig7 ) by updating the client time 131 ( fig7 ) based on the measured time difference and via the client &# 39 ; s time computation system &# 39 ; s parameters . if the packets do not pass verification tests , spoof processor 23 can test for spoofing and can set spoof indication 127 ( fig7 ) if a spoof has been attempted . referring now to fig3 , in an alternative embodiment , in configuration 30 , server 1 computer 19 a sends server packet 128 ( fig2 ) to client computer 102 . processing as above occurs in client computer 102 . however , the subsequent transmission of secure packet 111 is generated by server 2 computer 19 b and sent to client computer 102 . server 1 computer 19 a can have a relationship with server 2 computer 19 b such as , for example , but not limited to , being directly wired to server 2 computer 19 b as indicated in fig3 by dashed lines , or can involve some form of electronic communications 124 such as a router . referring now to fig4 , protocol 40 , which operates in the context of configuration 30 ( fig3 ), can include , but is not limited to including , more than one server — server 1 computer 19 a and server 2 computer 19 b in the depicted embodiment — and client computer 102 . in protocol 40 , server 1 computer 19 a sends set - up options 135 to client computer 102 which processes are similar to client computer 102 processes in protocol 20 ( fig2 ). however , server 1 computer 19 a executes server unencrypted packet creator 51 a to send server packet 128 to client 102 , which server 2 computer 19 b executes server encrypted packet creator 51 b to send secure packet 111 to client 102 . server 1 computer 19 a can also share server packet 128 with server 2 computer 19 b , forming a relationship between server 1 computer 19 a and server 2 computer 19 b . referring now to fig5 , method 150 of the present embodiment can include , but is not limited to including , receiving 151 , by the client computer , set - up information including options and possibly defaults from at least one server computer . the options could , for example , but not limited to , be indirectly available via such means as public web pages or internal computation . method 150 can also include transmitting 153 , by the client computer to at least one server computer , a client packet including client identification information , timing information , and selected options from the options . if 152 the server computer is operating in broadcast mode , no transmitting step is required from the client . method 150 can also include receiving 155 , by the client computer , a server packet including at least one server time formatted based on the selected options and possibly the default options , computing 157 , by the client computer , a time difference between the at least one server time and the client time , receiving 159 , by the client computer , a secure version of the server packet , the secure version including secure time data , and updating 161 , by the client computer , the client time based on the time difference only if the secure time data and the server data associated with at least one server time match . referring now to fig6 , method 250 for circumventing spoofing of time - critical data can include , but is not limited to including , receiving 251 , by the client computer , set - up information including options from at least one server computer . the options could , for one example , be indirectly available via such means as public web pages or internal computation . method 250 can also include transmitting 253 , by the client computer to at least one server computer , a client packet including client identification information , timing information , and selected options from the options . if 252 the server computer is operating in broadcast mode , no transmitting step by the client is required . method 250 can also include receiving 255 , by the client computer , a server packet including server data formatted based on the options or the selected options , computing 257 , by the client computer , at least one difference between the server data and the time - critical data , receiving 259 , by the client computer , a secure version of the server packet , the secure version including secure time - critical data , and updating 261 , by the client computer , the time - critical data based on the at least one difference only if the secure data and the server data match . the options can include an encryption method and a decryption key . method 250 can optionally include decrypting the secure version according to the decryption key , the decrypted secure version including decrypted client information , updating , by the client computer , the data based on the at least one difference only if the decrypted data and the server data match , and if the received client identification information and the decrypted client identification information match , and indicating , by the client computer , a possible spoof when the secure version and the server packet do not match . referring now to fig7 , system 100 for minimizing delay in updating client time 131 at client computer 102 can include , but is not limited to including , set - up processor 101 receiving , by client computer 102 , set - up information including options 135 from at least one server computer 19 . the options could also be indirectly available by , for example , but not limited to , such means as public web pages or internal update mechanisms . system 100 can also include packet processor 103 optionally transmitting , by client computer 102 to at least one server computer 19 , client packet 123 including client identification information , timing information , and selected options from options 135 . packet processor 103 can also receive , by client computer 102 , server packet 128 including sever time data and at least one server time 47 formatted based on the options or the selected options . system 100 can also include time processor 107 computing , by client computer 102 , a time difference between at least one server time 47 and client time 131 , and secure packet processor 109 receiving , by client computer 102 , a secure version 111 of server packet 128 , secure version 111 including secure time data . system 100 can also include update processor 105 updating , by client computer 102 , time 131 , creating updated time 119 , based on the time difference only if the secure time data and the server time data associated with the at least one server time 47 match . security options 133 can include an encryption method and a decryption key . secure packet processor 109 can also decrypt the secure version according to the decryption key . the decrypted secure version can include decrypted client information . update processor 105 can update , by client computer 102 , time 131 based on the time difference only if the decrypted time and at least one server time 47 match , and if the received client identification information and the decrypted client identification information match indicated by , for example , but not limited to , update switch 132 . system 100 can optionally include spoof processor 23 indicating , by client computer 102 , a possible spoof using , for example , but not limited to , spoof indication 127 , when the secure version 111 and server packet 128 do not match indicated by , for example , but not limited to , update switch 132 . options can include an encryption method , a decryption key , and time format 134 . secure packet processor 109 can optionally decrypt secure version 111 according to the decryption key . the decrypted secure version can include decrypted client identification information . update processor 105 can optionally update , by client computer 102 , client time 131 based on the time difference only if the decrypted time and at least one server time 47 match , and if the received client identification information and the decrypted client identification information match . referring now to fig8 , system 200 for circumventing spoofing of time - critical data 138 at client computer 102 can include , but is not limited to including , set - up processor 101 receiving , by client computer 102 , set - up information including options 135 from at least one server computer 19 . the options could also be indirectly available by , for example , but not limited to , such means as public web pages or internal update mechanisms . system 200 can also include packet processor 103 optionally transmitting , by client computer 102 to at least one server computer 19 , client packet 123 including client identification information , timing information , and selected options from options 135 . packet processor 103 can also receive , by client computer 102 , server packet 128 including sever time data and server data 48 formatted based on the options or the selected options . system 200 can also include server data processor 142 computing , by client computer 102 , at least one difference between server data 48 and time - critical data 138 , and secure packet processor 109 receiving , by client computer 102 , a secure version 111 of server packet 128 , secure version 111 including secure time - critical data . system 200 can also include update processor 105 updating , by client computer 102 , time - critical data 138 , creating updated data 120 , based on the at least one difference only if the secure data and server data 48 match . security options 133 can include an encryption method and a decryption key . secure packet processor 109 can also decrypt the secure version according to the decryption key . the decrypted secure version can include decrypted client information . update processor 105 can update , by client computer 102 , time - critical data 138 based on the at least one difference only if the decrypted time and server data 48 match , and if the received client identification information and the decrypted client identification information match indicated by , for example , but not limited to , update switch 132 . system 200 can optionally include spoof processor 23 indicating , by client computer 102 , a possible spoof using , for example , but not limited to , spoof indication 127 , when the secure version 111 and server packet 128 do not match indicated by , for example , but not limited to , update switch 132 . options can include an encryption method , a decryption key , and data format 136 . secure packet processor 109 can optionally decrypt secure version 111 according to the decryption key . the decrypted secure version can include decrypted client identification information . update processor 105 can optionally update , by client computer 102 , time - critical data 138 based on the at least one difference only if the decrypted data and server data 48 match , and if the received client identification information and the decrypted client identification information match . embodiments of the present teachings are directed to computer systems such as system 100 ( fig7 ) and system 200 ( fig8 ) for accomplishing the methods such as method 150 ( fig5 ) and method 250 ( fig6 ) discussed in the description herein , and to computer readable media containing programs for accomplishing these methods . the raw data and results can be stored for future retrieval and processing , printed , displayed , transferred to another computer , and / or transferred elsewhere . communications links such as electronic communications 124 ( fig7 ) can be wired or wireless , for example , using cellular communication systems , military communications systems , and satellite communications systems . in an exemplary embodiment , the software for the system is written in fortran and c . the system can operate on a computer having a variable number of cpus . other alternative computer platforms can be used . the operating system can be , for example , but is not limited to , linux ®. the present teachings are also directed to software for accomplishing the methods discussed herein , and computer readable media storing software for accomplishing these methods . the various modules described herein can be accomplished on the same cpu , or can be accomplished on different computers . in compliance with the statute , the present embodiment has been described in language more or less specific as to structural and methodical features . it is to be understood , however , that the present embodiment is not limited to the specific features shown and described , since the means herein disclosed comprise forms of putting the present teachings into effect . methods such as method 150 ( fig5 ) and method 250 ( fig6 ) of the present teachings can be , in whole or in part , implemented electronically . signals representing actions taken by elements of the system and other disclosed embodiments can travel over at least one live communications network 124 ( fig7 ). control and data information can be electronically executed and stored on at least one computer - readable medium . system 100 ( fig7 ) and system 200 ( fig8 ) can be implemented to execute on at least one computer node in at least one live communications network 124 ( fig7 ). common forms of at least one computer - readable medium can include , for example , but not be limited to , a floppy disk , a flexible disk , a hard disk , magnetic tape , or any other magnetic medium , a compact disk read only memory or any other optical medium , punched cards , paper tape , or any other physical medium with patterns of holes , a random access memory , a programmable read only memory , and erasable programmable read only memory ( eprom ), a flash eprom , or any other memory chip or cartridge , or any other medium from which a computer can read . further , the at least one computer readable medium can contain graphs in any form including , but not limited to , graphic interchange format ( gif ), joint photographic experts group ( jpeg ), portable network graphics ( png ), scalable vector graphics ( svg ), and tagged image file format ( tiff ). although the present teachings have been described with respect to various embodiments , it should be realized these teachings are also capable of a wide variety of further and other embodiments .	7
referring more particularly to the drawings , fig1 and 2 show the first embodiment of the exercise apparatus 10 according to the present invention . the exercise apparatus 10 comprises a dynamic means 12 , a framework means 14 and a resistance means 16 . the dynamic means 12 comprises an upper frame 40 which is pivotally attached to a lower frame 60 . the dynamic means 12 further comprises arm rests 80 which are attached to lateral members 41 of the upper frame 40 , a seat 50 which is pivotally mounted to a top frame member 62 of the lower frame 60 , and a foot rest 70 . the framework means 14 comprises a vertical frame 20 which is maintained in an upright position by a horizontal frame 30 . horizontal frame 30 is configured to lie on a flat surface . however , there are other ways known in the art to stabilize the dynamic means 12 such as bolting the vertical frame 20 to the ceiling . both the upper frame 40 and the lower frame 60 are pivotally mounted to the vertical frame 20 . additionally , the upper frame 40 is slideably mounted to the vertical frame 20 . as shown in fig3 pivotal attachments 42 on the upper frame 40 are mounted on linear bearings 44 which slide along rods 46 secured to flanges 48 which in turn are secured to the lateral members 24 of the vertical frame 20 . as shown in more detail in fig2 arms 72 of the foot rest 70 are pivotally attached to a cross frame member 32 of the horizontal frame 30 in a manner well known in the art . the components of the present invention are constructed of commercially available materials , the selection of which is within the ability of the ordinary skilled worker . as shown in fig2 and 3 , the arm rests 80 have hand grips 87 attached to elbow rests 83 which in turn are attached to sleeves 84 that fit around and slide along the lateral members 41 of the upper frame 40 , enabling the arm rests 80 to be adjusted to the heights of different users . the arms rests 80 also have adjustment pins 86 which fit through holes 85 of the sleeves 84 and two of a plurality of adjustment holes 88 on the lateral members 41 of the upper frame 40 , thereby securing the arm rests 80 to the upper frame 40 . alternatively , the arm rests may be configured such that the arm rests are connected to each other so that the user need make only one adjustment . as shown in fig2 and 4 , the lower frame 60 has a projecting member 66 attached to a bottom frame member 64 of the lower frame 60 such that the projecting member 66 remains at a fixed angle with respect to the plane defined by the lower frame 60 . rollers 68 attached to the end of the projecting member 66 contact the foot rest 70 such that the pivoting motion of the lower frame 60 with respect to the vertical frame 20 effects a concurrent pivoting motion in the foot rest 70 about the cross frame member 32 . in the embodiment shown in fig1 resistance to both the forward folding movement and the return straightening movement is provided by a fly wheel - fan resistance mechanism 90 which is known in the art . as seen in more detail in fig2 cables 92 are attached to the pair of cable connections 49 attached to each side of the top member 43 of the upper frame 40 . one of the cables 92 runs up to the top member 22 of the vertical frame 20 , within the top member 22 of the vertical frame 20 , then down within the lateral member 24 of the vertical frame 20 to the base of the vertical frame 20 . the other one of the cables 92 runs to the lateral member 24 of the vertical frame 20 to the base of the vertical frame 20 . the cables 92 are guided by a system of pulleys 94 to the fly wheel - fan resistance mechanism 90 having a drum 96 , a shaft 97 and a fly wheel - fan 98 . the cables 92 are wrapped around the drum 96 so that movement of the upper frame 40 causes the cables 92 to rotate the drum 96 . the drum 96 is ratchet mounted on and drives the shaft 97 , which in turn drives resistance means such as the fly wheel - fan 98 . in order to use this apparatus , the user first stands on the foot rest 70 , leans back against the seat 50 and places his arms in the arm rests 80 . as described above , a user may adjust the arm rests 80 along the lateral members 41 of the upper frame 40 to suit his particular height . in addition , the hand grips 87 of the arm rests 80 are curved such that any user may grip the hand grips 87 while resting his elbows in the elbow rests 83 regardless of the length of his forearms . exercise on this apparatus essentially comprises two movements , a forward folding movement as illustrated in fig5 and a return straightening movement as illustrated in fig6 . the angle θ , which is defined by the upper frame 40 and the lower frame 60 as shown in fig5 constantly changes during exercise , decreasing steadily during the forward folding movement and increasing steadily during the return straightening movement . during the forward folding movement , the user exerts his abdominal muscles to pull the arm rests 80 toward the foot rest 70 , thereby rocking or pivoting the upper frame 40 toward the lower frame 60 . as the lower frame 60 pivots , the rollers 68 at the end of the projecting member 66 push against and roll along the foot rest 70 , causing it to pivot about the foot pivots 74 as shown in fig5 and 6 . the pivoting action of the foot rest 70 causes the knees to bend as θ decreases . then during the return straightening movement , the user exerts his back muscles to pull the arm rests 80 away from the foot rest 70 , rocking or pivoting the upper frame 40 away from the lower frame 60 . the apparatus stops as soon as the user stops exerting his muscles . stops 26 may be provided on the vertical frame 20 as shown in fig5 and 6 to control the range of movement of this apparatus . the stops 26 prevent θ from exceeding 180 °, thereby reducing the chance of physical injury to the user by preventing him from extending his pelvic region beyond his feet in a vertical stance . of course , the stops 26 may be designed such that the upper limit of θ is less than 180 ° in a manner known in the art . the cables 92 may also be used to control the range of θ or movement of this apparatus . persons of ordinary skill in the art will appreciate that resistance means other than the fly wheel - fan resistance mechanism described above may be readily adapted to the present invention . for example , as shown in fig7 the apparatus may employ an electro - magnetic resistance mechanism 90a . as seen more fully in fig8 chains 92a , 92b connected to the upper and lower frame 40 , 60 respectively , traverse around sprockets 99a , 99b , which are mounted concentrically with sprocket 99c on shaft 97a . shaft 97a is mounted to the horizontal frame 30 . the chains 92a , 92b then continue in a parallel arrangement around a system of pulleys 94a ( not shown ) to connect with return springs 95a . chain 92c is wound around the associated sprocket of the electromagnetic resistance mechanism 90a , the operation of which is understood by persons skilled in the art . a further alternative embodiment of the present invention is illustrated in fig9 . in this embodiment , resistance is provided only against the forward folding movement , and not against the return straightening movement . in this embodiment , only one cable 92 runs from one cable connection 49 , up to the top member 22 of the vertical frame 20 , within the top member 22 of the vertical frame 20 , then down within the lateral member 24 of the vertical frame 20 to the base of the vertical frame 20 . the cable 92 is guided by pulleys 94 to the fly wheel - fan resistance mechanism 90 having a drum 96 , a shaft 97 and a fly wheel - fan 98 . the fly wheel - fan resistance mechanism 90 functions as previously set forth in connection with the description of the first embodiment . the drum 96 is further provided with torsion springs to rewrap the cable during the return straightening movement . an additional , optional spring , such as extension spring 95 can be provided for greater resistance and faster return . a further alternative embodiment of the present invention is illustrated in fig1 . in this embodiment , resistance is provided only against the return straightening movement , and not against the forward folding movement . the resistance mechanism of this embodiment is the same as the resistance mechanism of the alternative embodiment illustrated in fig7 and 8 except that the former lacks the chain 92b and the sprocket 99b . a weight stack also may be used for resistance in a manner known in the art . fig1 schematically illustrates the apparatus in which resistance against the forward folding movement is provided by a weight stack . cable 92d is secured to upper frame 40 and traverses around pulleys 94b to weight stack 100 . the user may select the amount of weight desired . it is contemplated that a resistance mechanism which employs a weight stack also may be configured by a person of ordinary skill such that resistance may be provided against the return straightening movement . a further alternative embodiment of the present invention is illustrated in fig1 . in this embodiment , the upper frame 40 and the lower frame 60 are pivotally mounted to the vertical frame 20 in a manner well known in the art . in this embodiment , the lower frame 60 is also slideably mounted to the vertical frame 20 . whereas , in the first embodiment of the present invention , the user pulls the arm rests 80 toward the foot rest 70 in order to effect the forward folding movement , in this embodiment , the user pulls the foot rest 70 toward the arm rests 80 to effect the forward folding movement . this embodiment increases the force required by the user &# 39 ; s muscles and provides a more strenuous workout . in this embodiment , the foot rest 70 is additionally provided with foot stirrups 76 . any of the resistance means previously discussed may be easily adapted to this embodiment . in addition , the resistance means may be adapted to provide resistance against both the forward folding movement and the return straightening movement or either of the two . it is also contemplated that each of the embodiments described above will include an adjustment means known in the art for providing varying degrees of resistance . the present invention may be embodied in other forms without departing from its spirit or essential characteristics . the described embodiments are to be considered only as illustrative and not as restrictive . the scope of the invention is , therefore , indicated by the appended claims .	0
the present invention is illustrated with an implementation utilizing a touch pad as the medium . the touch pad , a pressure sensitive surface that can sense a contact point , which is the point impressed upon its surface by the user &# 39 ; s motion , transmits the coordinates of the contact point to an operating system . the operating system is a collection of various software and hardware subsystems tailored for a specific apparatus where the input device is to be applied . fig1 shows the layout of the perimeter regions 2 , and center regions 3 on a standard touch pad . the input device can be in four different modes : alphanumeric mode , standard 12 - key telephone keypad mode , pointing device mode , and symbol mode . the system interprets the movement of the contact point within and across the regions to determine the appropriate signal for the selected mode . dtmf and pulse dialing subsystems can also be incorporated for applications on telephones . fig2 shows a heads - up display 4 , when mounted in an appropriate position , serves as a visual aid to the user by displaying the state of the virtual keypad . fig3 shows a standard setup of the system which includes a collection of perimeter regions 2 , a collection of center regions 3 , a label 5 displaying the characters each region in the perimeter regions 2 can be assigned to , a heads - up display 4 , and a collection of auxiliary keys 6 positioned above and below the touch pad . the touch pad 1 is connected to an appropriate interface ( not shown ) where communication with an appropriate software driver ( not shown ) occurs , which in turn communicates with the operating system ( not shown ). similarly , heads - up display 4 is connected to an appropriate interface ( not shown ) to receive instructions from the operating system to display the state of the touch pad 1 . the auxiliary push button keys can be programmed for standard input functions such as mouse left , mouse right , mode , escape , delete , insert , shift , enter , and cursor navigation . the character set used in this set up is made up of the following character groups similar to the arrangement found on a standard 12 - key telephone keypad , with an “-” character indicating unavailability , a null value or an alternative character : group 1 [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 0 ] group 2 [ _ , a , d , g , j , m , p , t , w , _ ] group 3 [ _ , b , e , h , k , n , r , u , x , _ ] group 4 [ _ , c , f , i , l , o , s , v , y , _ ] when in alphanumeric mode , each of the perimeter regions represents no more than one character from the currently selected character group . when a signal to increment the character group that the perimeter regions are representing is received , each of the perimeter regions is assigned a character from the succeeding character group specified . similarly , when a signal to decrement the character group that the perimeter regions are representing is received , each of the perimeter regions is assigned a character from the preceding character group specified . when the first or the last group is reached , the system can be programmed to wrap around to the last or first character groups respectively . alternative schemes can also be arranged to customize the character assigned to a region according to the current state of the system . an alternative character set which contain the characters “ q ” and “ z ” can be arranged as follows : group 1 [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 0 ] group 2 [ _ , a , d , g , j , m , p , t , w , _ ] group 3 [ _ , b , e , h , k , n , q , u , x , _ ] group 4 [ _ , c , f , i , l , o , r , v , y , _ ] group 5 [ _ , _ , _ , _ , _ , _ , s , _ , z , _ ] the actions by the user on the touch pad are fed into the driver , a subsystem of the operating system , and an algorithm translates them and generates an appropriate signal . communication between the touch pad and the driver takes place for each of the following events : the user touching down on the touch pad ; the user lifting off from the touch pad , and the user moving across the touch - pad surface . the driver organizes the information received from the touch pad and transmits it to the operating system as follows : a flag indicating that the center regions have received focus ; a flag indicating that the center regions have lost focus ; the previous contact region ; the current contact region ; a single tap as a single click or a single select ; two successive taps as a double click or a double select ; two successive taps and holding down after the second tap as a click and hold ; a touch down followed by movement as moving the pointer ; a click and hold followed by movement as a hold and drag ; and a lift off as a mouse button release . a flag indicating that the perimeter regions have received focus ; a flag indicating that the perimeter regions have lost focus ; the previous contact region ; the current contact region ; the direction of movement — clockwise or counter clockwise ; and a single tap as a single click . the operating system can be in one of the following four modes when interpreting the information from the driver : alphanumeric mode ; standard 12 - key telephone keypad mode ; pointing device mode ; and symbol mode . the operating system interprets the information received from the driver and acts depending on the current mode . the contact point traversing across the touch pad with a substantially sliding motion is interpreted as a swiping or a tracing motion . the contact point touching down and lifting off within a certain time interval is interpreted as a single tap , and two successive taps within a certain time interval is interpreted as a double tap . a double tap without a lift off after the second touch down motion followed by a lateral movement of the contact point is interpreted as a drag and hold action . fig4 shows the heads - up display in alphanumeric mode , where the first group of characters is assigned to the 10 perimeter regions . a circle is displayed on region 40 a where the current contact point is positioned . character group 1 is assigned to the perimeter regions at this stage . tapping on a perimeter region sends the character that it is currently assigned to the region to the operating system . circular sliding movements , clockwise or counterclockwise , on the perimeter regions respectively increment or decrement the character group assignment to the perimeter regions . the number of character groups changed equals the number of adjacent perimeter regions that the contact point moves into in the process of traversing the perimeter regions . the character group assignment is also arranged to wrap around . fig5 shows the state after the user makes a clockwise swipe one region . the circle indicates that the contact point is now positioned on perimeter region 40 b . character group 2 is assigned to the perimeter regions at this stage . fig6 shows the state after the use makes a clockwise swipe three regions . the circle indicates that the contact point is now positioned on perimeter region 40 d . character group 4 is assigned to the perimeter regions at this stage . fig7 shows the state after the user makes a counterclockwise swipe one region from the state shown in fig4 . the circle is now positioned on perimeter region 40 j . character group 4 is assigned to the perimeter regions at this stage . the character groups wrapped around backward to the last character group in this case , since the previously selected character group was the first of the four character groups . the resulting character assignment is the same as making a clockwise swipe spanning three consecutive regions , as shown in fig6 . fig8 shows the heads - up display in the standard 12 - key telephone keypad mode , where the nine center regions 50 , and the three perimeter regions 40 e , 40 f and 40 g represent the alphanumeric keys found on a standard 12 - key telephone keypad . the numeric digit or the character displayed on the region that the user taps is fed into the operating system for further processing as required . the rest of the perimeter regions remain inactive in this mode . fig9 shows the heads - up display in pointing device mode , where the collection of the center regions acts as a regular touch pad . the contact point 50 e on the touch pad is displayed in a darker shade . the usual actions such as tapping , moving and dragging as it is on a typical touch pad are transmitted to the operating system for appropriate processing as required . fig1 and fig1 show the heads - up display in symbol mode , where the collection of center regions acts as a trace pad for drafting symbols . the adjacent regions 50 a , 50 b and 50 c , where the contact point moves across with a tracing motion are marked as line segments , and the region 50 h where the contact point briefly rests or tapped once , depending on how the system is configured , is marked as a dot . repeating the same actions on the marked regions erases the markings . if a significant pause where no contact is detected , the system assumes that the user has completed drawing the symbol and tries to match it with the patterns stored in its memory . the system can be configured to recognize alphanumeric characters from standard english or other languages , and can also be trained to recognize custom symbols . fig1 shows the letter “ t ” and fig1 shows the “!” mark , drawn on the collection of center regions . alphanumeric mode can be simultaneously active with pointing device mode and symbol mode , but it cannot be simultaneously active with standard 12 - key telephone keypad mode , since the lower three regions 40 e , 40 f and 40 g as shown in fig8 are used to represent the characters “#,” “ 0 ” and “*” respectively in this mode , unless alternative arrangements have been made . fig1 shows the virtual keypad system on a corded ( cord not shown ) desktop telephone unit . fig1 shows the virtual keypad system on a mobile telephone unit . due to the limited space available , the heads - up display 4 is positioned on the display and the character labels 5 are positioned inside the perimeter regions . one possible configuration is to have the heads - up display show up only when the user touches the keypad . it would also be possible to dim the material currently displayed to give the heads - up display greater visibility . another possibility is to use a touch - screen , which is not only pressure sensitive like a touch pad , but also capable of displaying information , and display the state of the keypad on the touch - screen itself . a number of alternative embodiments are illustrated to demonstrate potential improvements for ergonomics or aesthetics . fig1 shows an alternative embodiment with ridges 70 around the regions for improved tactile feedback . when the user moves her contact point across the touch pad surface , the ridges give a tactile feed back of the movement across the regions . fig1 shows another alternative embodiment with recessed center regions and downward sloping perimeter regions 72 for improved tactile feedback . when the user moves the contact point across the touch pad surface , the angular edge where the sloping surface of the perimeter regions and the flat center regions meet , gives a tactile feed back of which set of regions the contact point is positioned in . fig1 shows another alternative embodiment with dimpled regions 74 for improved tactile feedback . when the user moves the contact point across the touch pad surface , the dimples snuggly lodge the contact point on the touch pad surface and gives the user extra assurance that the contact point is inside a region . fig1 shows another alternative embodiment with raised regions 76 for improved tactile feedback . when the user moves her contact point across the touch pad surface , sensation of ascending the raised side of a region and reaching the crown of the raised surface gives the user extra assurance that the contact point is inside and in the center of a region . fig1 shows another alternative embodiment with a circular perimeter region 78 for improved appearance . a circular groove ( not shown ) can be implemented in the area of the perimeter regions for improved tracking when making a swiping motion . when the user makes a swiping motion on the perimeter regions , the groove helps the contact point to remain in the perimeter regions . fig1 shows another alternative embodiment with asymmetric perimeter regions 80 to aid one - handed operations . in one - handed operations , the user would most likely hold the device with one hand with the scale - downed side of the regions located next to the base of her thumb , and operate the device with her thumb . in this case , the scaled down regions would better accommodate the more restrictive movement of the thumb when it is folded closer to its base or the palm . fig2 shows another alternative embodiment where a subset of regions 82 , regions in the positions of numerals 1 , 2 , 3 , 4 , 6 , 7 , 8 and 9 in a standard 12 - key telephone keypad layout , serve as common regions . in alphanumeric mode , when the contact point moves across the regions designated to double as perimeter regions , the character assignment to each region is changed in a fashion similar to the operation of the device with a layout with separate perimeter and center regions . fig2 shows another alternative embodiment where push button keys 86 are covered by a flexible pressure sensitive touch pad 84 . the push button keys capture the distinct downward pressure , and the pressure sensitive surface captures the movement of the contact point across regions , offering the capability of fast character input while retaining the familiar tactile sense of the push button keys to the device . the reader will see that the present invention provides a means to enter text with speed and ease , and at the same time is intuitive and compact . it also effectively quadruples as an alphanumeric input device , a standard 12 - key telephone keypad , a regular touch pad , and a symbol input device . while the above description contains many specifications , these should not be construed as a limitation of the scope of the invention , but rather as an exemplification of a few embodiments thereof . many other variations are possible . for example , other embodiments with more or less regions , different character sets or label sets , various symbol libraries , a combination of features from different embodiments , a combination of surface textures and shapes , and arrangements where the center and perimeter regions are designed to work in coordination . variants of the present design can also be implemented with push button keys , or a combination of a pressure sensitive touch pad and push button keys . in addition , touch sensitive mediums implemented by optical , thermal , chemical , or organic means , in addition to the type of mediums implemented by tactual means , could also be employed . accordingly , the scope of the invention should be determined not by the embodiments illustrated , but by the appended claims and their legal equivalents .	6
an embodiment of the invention leverages key information captured by the invention disclosed in the following document , and provides an extension from persons and systems to track request scope in terms of affected record types . this document is incorporated herein in its entirety by this reference thereto : [ pa3697us ], u . s . patent application ser . no . 11 / 505 , 537 , systems and methods for utilizing an enterprise map to determine affected people and systems , filed . an embodiment of the invention creates , manages , and maintains a list of external sources that are able to provide a list of affected people , based upon specific litigation context parameters . communication protocols are provided that enable the import of a list of affected elements from the external sources . a user interface triggers or executes the import of the affected list using the communication protocol . conflicts between different affected lists imported in the same request scope are resolved , as are conflicts between different affected lists from the same external source which are imported at different points in time . external systems are tracked , displayed , and reported with regard to where each element in the affected list originated , modifications that occurred after the initial import , and all reasons provided by the operator or the external source to justify the initial import or the follow - up changes . affected lists that could be tracked in external sources include , for example : persons who are not part of the enterprise , e . g . contractors and service providers ; hosted systems or repositories that are not managed and maintained within the company ; persons , systems , and classes of information that were jointly involved in the same project , where a project describes any temporary association of persons from one or multiple organizations , using specific systems to store information in the form of a specific set of information classes , as used in the specific context of the project ; persons catalogs in ldap , active directory , and other it data stores of person information ; persons catalogs from hr systems , financial systems , and other information systems that maintain employee information via web services calls / apis ; persons lists defined based on an access list of structured applications via application specific apis . for example , an application administrator knows the people accessing the application and the context . this embodiment provides a list of persons , and their unique id , that accessed a certain file in a document management systems or a source control system ; persons from mail servers , e . g . distribution lists and aliases . those that reflect a common functional context and access to information ; isolated partial lists of data sources . systems are dynamically provisioned in a company , i . e . some new systems become available and old systems go offline . it is difficult to keep any single source of truth updated to the extent of complete confidence because there is a time lag between it implemented changes to the inventory list and tracking by legal applications that manage the business process of litigation . provisioning such external systems and people responsible for such systems , data and evidence , makes it possible to capture them into the request scope within the context of litigation , for example csv lists of assets , e . g . data storage systems , can be imported into the request scope ; asset lists can be imported using more tighter integration mechanisms with applications that manage it assets via web service calls / apis ; and any repository of data and evidence , e . g . not restricted to building , warehouse , garage or file cabinet address , can be imported into the request scope . a similar tracking and conflict resolution problem exists in enterprises that have started a retention management program , but still suffer from large gap between the creation and the classification of the data . this means that a large amount of data may not yet be classified or tracked in the central retention management program . as the process for identification of potential evidence progresses , some specific silo of unclassified data may be investigated and classified . at this point the relevant classes of information become immediately known and should be imported into the request scope through , for example , the following steps : csv import of record types into the request scope ; manage association of such record types with external data sources imported ; and inclusion of such data sources into the request scope when external record types are included . an implementation of a mechanism for creating , managing , and maintaining a list of external sources containing people , systems or classes of information is provided in the following example : integration with ldap , where a list of sources of affected elements is described as ldap server details , e . g . hostname , port number , and security credentials . import of affected list can be performed as a single ldap lookup . web service urls can be managed as a source of affected elements . import of affected elements can be performed as a single web service call . connector configuration urls can be managed for connector type integration , where the connector provides a range of services that can be discovered through a single configuration services . this can support a more sophisticated ui integration , as different functionality accesses specific services ( see details below ). examples of communication protocols that enable the import of a list of affected elements from the external sources include : systems that have the affected element related information can export the list to a file . the file can be formatted to the csv format or the list can be exported in csv format itself . the list of elements can be imported into the request scope of an ongoing litigation or an impending litigation context . an ldap browser - like interface searches people details and imports a list via ldap protocol integration . for external sources that expose web services interfaces , implementing a web services client and importing a list of affected elements returned . an example web service operation is : list returnlist getelements ( list filterlist ). this is a generic operation and depends on source side implementations , i . e . web services exposed . filterlist is a generic list of filter criteria that can be sent to the source service provider . returnlist is a list of elements returned and element type . for external sources exposing other non - standard interfaces , implementing integration glue code , i . e . connectors , that bridge between standard web services apis and native source side service provider apis to extract and import the list of affected elements . examples of user interface actions to trigger or execute the import of the affected list using the above communication protocols include the following : fig1 is screen shot showing an import through csv files according to the invention . in fig1 , an element type can comprise a person , system , or record type . the file to import is selected from the file system . a preview of the imported list is provided . the legal team can then decide which items in the imported list are to be included in the request scope . this decision can also be deferred until all elements are imported . the list of elements in the csv file can be created or filtered based on any appropriate litigation specific parameters , but in that case those parameters are enforced by the user creating the csv file content . fig2 is screen shot showing an import using a mailing list lookup according to the invention . in fig2 , a distribution list is selected . a preview of the imported list is provided . this list includes all elements ( email addresses ) included in the distribution list . any filtering based on litigation context specific parameter can be applied at that point . the legal team can decide which items in the imported list are to be included in the request scope . this decision can also be deferred until all elements are imported . fig3 is a screen shot showing an import using a web service lookup according to the invention . in fig3 , a list of web services that are available for access in the context of litigation can be pre - configured , so it is easily accessible to a user after that . a preview of the imported list is provided . in this case , a number ( potentially all ) of the parameters known about the litigation context were passed as input parameters to the web service , which means that the system had the other end at the ability to filter the list down to reflect only the appropriate affected elements . the legal team can also decide which items in the imported list are to be included in the request scope . this decision can also be deferred until all elements are imported . fig4 is a screen shot showing an import using a web service based lookup via connectors . connectors provide additional filters , defined per connector , that allow the end user to refine a selection further before importing the affected list , through a simple iterative process of trial and error . the user can apply specific filters , and the web service will provide both the corresponding list and additional comments on how the filters were understood ( or not ) and applied . a selection may be made from a list of connectors that are configured with external sources of information on affected people , systems , and record types that are accessible in the context of litigation . this model may support continuous mode for certain systems , where the affected list source systems regularly provide any update to the lists that are being imported . if the mode is continuous , then the search results and selection area are not shown . the search criteria are stored in the continuous mode . conflict resolution is automatically performed based on configured rules . a filter area provides query templates to use for search based upon connector configuration . the criteria are saved if the system is in the continuous mode . the user can refine the filter criteria . fig5 is a screen shot showing an import using an ldap lookup according to the invention . in fig5 , a configured list of ldap servers that are accessible in the context of litigation is shown . if the mode is continuous , then the search results and selection area are not shown . the search criteria are stored in the continuous mode . conflict resolution is automatically performed based on configured rules . a filter area provides query templates to use for search based upon connector configuration . the criteria are saved if the system is in the continuous mode . the user can refine the filter criteria . in any of the examples of fig1 - 5 , described above , an additional user interface can be added to setup automatic refresh of the affected list lookup by configuring a start date allowing the user to select a date , defaulting to today ; a refresh period expressed in , for example , days , weeks , months ; and an end date , which can be empty , which indicates refresh indefinitely . once these three parameters are configured , the corresponding affected elements lookup source is refreshed using the pre - configured parameters on the following dates : the affected list is automatically refreshed on the following dates : 6 / 2 / 08 , 6 / 9 / 08 , 6 / 16 / 08 . 6 / 23 / 08 , 6 / 30 / 08 . implementation of conflict resolution between different affected lists imported in a request scope includes the following example : keep the union of all elements ; always add external elements , or any other similar rule driven by rules engine that doesn &# 39 ; t require any human review or approval . initially , keep the union of all elements , but trigger workflows to resolve conflicts based on configured rule sets . trigger workflows before the external elements are included into request scope . in this case , the imported elements stay in a pending state and are added to the request scope only when approved . elements are added only after completion of the workflow . keep the union of all elements , but allow manual override and track where the inclusion , modification , or deletion of elements from external sources happened . keep the union of all elements , and track external sources when the same element came from multiple sources . for example , if person a is added because of a list imported by attorney a , as well as by attorney b . it is useful to know and record this fact . additional implementations of conflict resolution between different affected lists , where the same external source is imported at different point in time include the following example : use a reference count to keep track of which source added which elements , and remove elements that are no longer included in any of their original sources of affected elements . such change should be tracked and auditable , and may require review by a user or it may be fully automated , depending the audit and check and balance level used by the legal team an implementation of a mechanism for tracking , displaying , and reporting on the change history of each element is provided in the following example : last name , first name , email , login identifier , date of inclusion , date of modification , reason , litigation context identifier , request scope identifier name , unique identifier , date of inclusion , date of modification , reason , list of related record types , list of related people , litigation context identifier , request scope identifier record type , date of inclusion , date of modification , reason , litigation context identifier , request scope identifier people master list comprising a union of affected people across all request scopes associated with an ongoing litigation or an impending litigation context . people can be included because of explicit inclusion ; and people can be included because of their association with systems . the master list also indicates which follow - up actions have already been taken regarding an affected person , for example sending a legal hold , setting a preservation plan , setting and fulfilling collections , interviewing the person , etc . this additional context may also be critical to decide how to manage the lifecycle of that person in the affected list . system master list comprising a union of affected systems across all request scopes associated with an ongoing litigation or an impending litigation context . systems can be included because of explicit inclusion . systems can also be included because of their association with record types . the master list also indicates which follow - up actions have already been taken regarding an affected system , for example setting a preservation plan , setting and fulfilling collections , and interviewing the system steward . this additional context may be critical to also decide how to manage the lifecycle of that system in the affected list . record type master list comprising a union of affected record types across all request scopes associated with an ongoing litigation or an impending litigation context . the record type list can also be included because of an association with systems . various reports , including for example : list of external request scopes per legal matter ( litigation context ), across selected legal matters ( litigation contexts ). drill down to details of the external request scope , i . e . source of inclusion . external request scope with the following details : litigation context identifier ; request scope identifier ; external element reference with drill down to details , including affected people details , affected system details , and affected record type details ; and affected element details that may include the history of changes , and reasons for inclusion , including which source of affected elements they were referred from , and when . filter criteria , including : litigation context identifier ; selected time duration ; and element type , i . e . affected people , system , and record type . fig6 is a screen shot showing an example of implementation of the ability to alert on the change of request scope according to the invention . in the example of fig6 , the head of litigation for legal matter xyz vs . pqr wants to know when new affected people are added to the request scope , and the resulting scope change is indicated with regard to three added people : jane ho , joe blow , and alice chang , connection with two external sources : distribution list : dev - all and ldap server 3 , in the form of an alert . each request scope change includes a mode , e . g . manual or continuous ; an operator , e . g . john smith or the system ; and a type of notification to be sent to those individuals on the list , e . g . a legal hold notice lh1 and an individual collection notice ic1 , ic2 . fig7 is a screen shot showing an example implementation of the overall solution according to the invention . the solution comprises of a software layer , called the external data sources adapters . these adapters are integration components that interact with various disparate external data sources and aggregate the data ( people , system and classes of information ) into the application that manages the business process around a litigation context . there are various ways of communicating with the sources of data as indicated in the diagram ( but not restricted to the only ones shown ). for example the file can be a formatted file generated by the source of data , system , the application managing the data or manually constructed file by a human being . the connector can practically integrate with any external system . some of the interfaces shown in the diagram just represent the interaction with some well know data sources of information ( like ldap , mail servers ) as examples . 1 . collects and persists the data from various adapters and associates the elements ( person , systems and classes of information ) with request scopes and litigation contexts . 2 . transforms the data if needed ( transformation engine ) a . example : cleaning the data to make it suitable for being processed by the application 3 . the rules engine manages all the configured rules in the application driving the request scoping business process in the context of a litigation . 4 . events engine generates and tracks change in the request scope because of the import of data from external sources ( or changes by the application or users ). 5 . preference engine manages the preferences of the users of the application managing the business processes around the litigation . for example the legal head of legal matter xyz vs . pqr wants to receive alerts via emails when the request scope changes 6 . escalation engine converts change events into alerts based on preferences and configured rules . 7 . the delivery engine make sure the alerts are delivered to the appropriate users based on preferences . for example the legal head of legal matter xyz vs . pqr wants to receive alerts only on the application dashboard when the request scope changes and keep them around for a specified interval of time . the delivery engine makes sure that the alert is delivered to the users dashboard . the rules engines ensures that the alert stays on the dashboard only for the specified interval of time as configured by the user and then cleans them up . 8 . alert engine manages the life cycle of the alert 9 . the business process management engine manages the workflows and interaction between the various software components and users of the system . it allows the users of the system to manage the request scope life cycle in the context of litigation . 10 . the user interface layer exposes all the functionality of the application managing the business process around the litigation context for creating and managing request scope for ongoing litigations or impending ones . i . managing the adapter configurations ii . managing the search filters selected by the users for different adapters iii . managing the frequency of import of data by various adapters iv . managing the changes in the request scope because of import of data by various adapters v . managing changes in the request scope manually after the imports are done or configuring automated rules that take care of the changes vi . managing conflicts and escalation based on configured rules 11 . the reporting engine generates the different reports for the users to get insight into changes in the request scope and various other analytics that are possible with the aggregated data for the request scopes . although the invention is described herein with reference to the preferred embodiment , one skilled in the art will readily appreciate that other applications may be substituted for those set forth herein without departing from the spirit and scope of the present invention . accordingly , the invention should only be limited by the claims included below .	6
referring now to the drawings , in which like numerals indicate like elements throughout the several figures , fig1 illustrates an optical chromakey field shown generally at 10 according to a preferred embodiment of the present invention , in the environment of a television studio . the optical chromakey field 10 is placed in the field of view of the video camera 5 . as illustrated , a television personality 7 such as a weather reporter , stands in front of the optical chromakey field 10 in the field of view of the video camera 5 . the optical chromakey field 10 is transparent and allows the television personality 7 , when facing the optical chromakey field , to see through the optical chromakey field to the monitor or teleprompter 6 which is located behind the optical chromakey field . fig2 illustrates the preferred embodiment in greater detail . a perspective view of the optical chromakey field 10 is shown in fig2 from its front side 11 , which is the side placed in the field of view of the video camera 5 . the optical chromakey field 10 includes a transparent assembly 29 and an illumination apparatus 20 . the transparent assembly 29 is in the field of view of the video camera 5 . the transparent assembly 29 of the preferred embodiment comprises a plurality of transparent horizontal members 30 , which are supported in a vertical array by a support structure 40 . in the preferred embodiment , these transparent members 30 are flat louvers of equal length , width and thickness . however , the length , width , thickness and number of the members used in the optical chromakey field 10 may be varied according to the particular needs of the video presentation . for example , for a weather report a wall - size optical chromakey field 10 may be used to present the special effect of a weather map across the entire background of the video presentation . the optical chromakey field 10 may have a smaller configuration and be placed in different locations depending upon the intended special effects . for instance , for a window effect such as is used in showing news clips over a reporter &# 39 ; s shoulder during a newscast , shorter and fewer transparent members 30 would be necessary to achieve the desired effect within the apparent window . the optical chromakey field 10 for such a newscast would be placed in the camera &# 39 ; s field of view so that the news clips appear in the correct place . the thickness of each transparent member in the preferred embodiment is 3 / 4 of an inch , but thicker members may be necessary in other embodiments to prevent bowing where the optical chromakey field 10 is large and the length of each transparent member is long . the transparent members 30 of the preferred embodiment are made of plexiglass , but they may be made of other transparent materials known to those skilled in the art , such as glass , acrylic or other plastics . as illustrated in fig2 the transparent members 30 of the preferred embodiment are arranged in a vertical array and supported by a support structure 40 . the support structure 40 of the preferred embodiment comprises two vertical walls 41a and 41b connected at their respective interior rear upper corners to a spacing rod 42 . for additional support , the vertical walls 41a and 41b may be connected at their respective interior rear lower corners or elsewhere so long as such support does not interfere with the transparency of the optical chromakey field 10 . each of the vertical walls 41a and 41b is further supported in the preferred embodiment by a stabilizer , 43a and 43b , which is connected along the base width of each wall to lend greater vertical stability . alternate forms of supporting the transparent members 30 without interfering with the transparency of the optical chromakey field 10 are well known to those skilled in the art . each of the transparent members 30 of the preferred embodiment has a front surface 31 , a leading edge 32 and a trailing edge 35 . the transparent members 30 are supported by the support structure 40 so that the front surface 31 of each transparent member 30 is at an angle with respect to the vertical axis 44 of the structure 40 . the transparent members 30 are angled so that they operate together with the illumination apparatus 20 to present light of a certain color for reception by the video camera 5 . fig3 illustrates the angled transparent members 30 in greater detail . the transparent members 30 of the preferred embodiment are angled at approximately 45 degrees with respect to the vertical axis 44 of the support structure 40 , with the front surface 31 of each transparent member facing downwardly . however , this angle may be varied in a manner well known to those skilled in the art according to the circumstances necessary to present light of a certain color for reception by the video camera 5 . fig3 also illustrates the illumination apparatus 20 of the preferred embodiment . the depicted illumination apparatus 20 comprises a light source 21 and a reflector panel 25 . the reflector panel 25 is positioned to lie flat in front of the angled transparent members 30 at the foot of the vertical array so as to receive light from the light source 21 and to reflect light to the transparent assembly 29 . although the light source 21 of the preferred embodiment is an array of fluorescent tubes , any other kind of lighting means may be used if it satisfies the requirements of the present invention . the light source 21 is positioned between the vertical walls 41a and 41b and behind the lowermost transparent member 30 , and directs illumination forwardly through the lowermost transparent member to strike the reflector panel 25 . the angular relation between the downwardly - facing front surface 31 of each angled transparent member 30 , the flat reflective panel 25 , and the light source 25 is chosen so that each front surface 31 receives reflected illumination from the light source 25 whenever that source is turned on . the reflector panel 25 of the preferred embodiment is a blue reflector panel which receives light from the light source 21 , but reflects only blue light towards the front surfaces 31 of the transparent members 30 . the front surfaces 31 in turn reflect the blue light for reception by the video camera 5 . this causes the video camera 5 to produce a characteristic video signal operative to cue special effects . thus , in operation , the optical chromakey field is 10 placed in the field of view of the video camera 5 where it does not interfere with the video presentation because of its transparency . in the preferred embodiment , the light source 21 directs light towards the blue reflector panel 25 . the blue reflector panel 25 receives the light , but reflects only blue light towards the front surfaces 31 of the transparent members 30 . the transparent members 30 of the preferred embodiment are angled at approximately 45 degrees with respect to the vertical axis 44 of the support structure 40 . each front surface 31 faces downwardly . thus , blue light directed by the reflector panel 25 towards the angled front surfaces 31 of the transparent members 30 is reflected by the front surfaces for reception by the video camera 5 . when special effects are desired , the video control apparatus substitutes a special effect signal for the corresponding blue light signal presented by the transparent assembly 29 . the viewer of the video presentation sees special effects in place of the optical chromakey field 10 . nevertheless , the transparency of the transparent assembly 29 allows the on - camera television personality 7 to see through the optical chromakey field 10 to view a teleprompter or monitor 6 as necessary . it will be understood to those skilled in the art that the light source 21 may be specialized so as to provide blue light to the reflector panel 25 to be reflected to the transparent assembly 29 . alternatively , the light source 21 may provide blue light directly illuminating the transparent assembly 29 without requiring a reflector panel 25 . as another alternative , the front surfaces 31 of the transparent members 30 may be configured or treated so as to reflect only blue light . while the preferred embodiment uses blue light , it will be understood to those skilled in the art that other colors may be designated to cue special effects . blue and green colors are chosen generally because they are most opposite flesh tones on the color wheel , and thus allow for the greatest flexibility in creating special effects . further , fig3 illustrates that the transparent members 30 are spaced so as to prevent irregularities in the presentation of the light of a certain color for reception by the video camera . gaps between the transparent members 30 may pass through some of the light from the illumination apparatus 20 . this may result in the presentation of a striped or otherwise irregular pattern of light of a certain color for reception by the video camera 5 . the transparent members 30 of the preferred embodiment are spaced along the vertical axis 44 of the support structure 40 so that the leading edge 32 of each transparent member 30 overlaps the front surface 31 of the next transparent member 30 in the array . this overlap provides that the optical chromakey field 10 presents a uniform surface to the video camera 5 without any gaps which might cause stripes or other aberrations to appear in the video presentation . fig4 a and 4b illustrate two embodiments of a leading edge 32 or a trailing edge 35 of a transparent member 30 . the leading edge 34 of the preferred embodiment is shown in fig4 a . the leading edge 34 is beveled and its flatness is perpendicular with respect to the plane of the array . the beveled edge 34 thus is substantially parallel to the sight lines of the video camera 5 , and any light reflected from those edges will not strike the camera lens . if the leading edge 34 is beveled , the trailing edge 35 should also be beveled and perpendicular to the plane of the array . this prevents stripes or other irregularities from appearing in the presentation . fig3 illustrates beveled leading edges 34 and beveled trailing edges 35 . an alternative embodiment utilizing a rounded leading edge 33 is shown in fig4 b . a rounded leading edge 33 requires a rounded trailing edge ( not shown ). the rounded edges lack any plane surface which could reflect light to the camera . rounded or beveled leading edges thus are provided by the present invention to minimize the amount of light which is scattered away from its directed path towards the video camera 5 . a rounded or a beveled edged will also minimize the problems of reflection or glare created by ambient light which may affect the quality of the video presentation . the preferred embodiment of the present invention has been disclosed by way of example and it will be understood that other modifications may occur to those skilled in the art without departing from the scope and the spirit of the appended claims .	7
in general terms , the present invention seeks to detect airborne particles and / or to provide discrimination according to particle size using apparatus that has low cost , small size , low weight , high ruggedness , high reliability , low maintenance and long service life , and is suitable for high production volumes . this is achieved with the use of only a single sensor , together with at least two inexpensive light sources . use of a single sensor and its associated electronic amplifier necessarily designed for high sensitivity with low noise , simplifies the design and reduces the cost of the system . it also avoids any lack of consistency that could occur in the sensitivity and linearity of additional sensors and it avoids the possibility of the incremental addition of noise contributions from plural sensors . discrimination of airborne particle size could be achieved in a number of ways . the two or more light sources may differ in wavelength , polarization , position ( specifically the solid angle of incidence to the detection zone axis ), or a combination of these . in the preferred embodiment of the invention , two light emitting diodes ( led &# 39 ; s ) operating at different wavelengths are employed . this permits the use of wavelengths as distant as 430 nm ( blue ) and 880 nm ( infrared ) such that the wavelengths are separated by a full octave . such a large difference in wavelength can produce a significantly different strength of signal when light of alternate wavelength is scattered off particles toward the sensor . alternative combinations such as 430 nm ( blue ) with 660 nm ( red ) are possible . closer - spaced wavelengths such as 525 nm ( green ) with 660 nm ( red ) could be used , accompanied by a reduction in size discrimination and sensitivity to small particles . it is known from rayleigh theory that the intensity of the scattered light reduces according to the fourth power of wavelength , for particles smaller than the wavelength of light . this has proven relevant to smoke detection in experiments using xenon lamps which produce a complete spectrum embracing infrared , visible and ultraviolet wavelengths , where it was found that wavelengths in the blue region are necessary for the detection of certain kinds of fires liberating small particles . therefore , a particular advantage of being able to employ a blue light source is that its short wavelength provides high resolution of small particles that become invisible at longer wavelengths . whereas a blue or violet laser diode may be preferable to a blue led , the former are expensive , have increased alignment complexity , require automatic power control and have a lower tolerance of elevated temperatures . the combination of readily available red and infrared laser diodes could be used , but in addition to the difficulties presented by using lasers , these longer wavelengths fail to adequately resolve small particles . accordingly the preferred embodiment of the invention is configured to utilize the broad beam spread of a high - intensity led ( approx 12 deg ). although the broad spread of the led beam could be confined by focusing with a lens , this adds cost , complexity in alignment and size to the product . whereas the led does not have the localized high light intensity of a collimated laser beam , the aggregate intensity of the led light scattered from the large volume of the detection zone when integrated on the sensor is of comparable magnitude . therefore the sensitivity of the led based system is comparable with laser , but the cost is reduced without compromising reliability . nevertheless , the same invention could be configured to use laser diodes as alternative light sources of differing wavelength , polarization or position ( angle ). such arrangements can provide particle size discrimination also , but at a higher cost and greater temperature intolerance than led designs . the ability to use led &# 39 ; s is achieved by the novel configuration of the optical chamber which accommodates the broad projector beam angle of each led , opposite a specially designed light trap located beyond the detection zone , to completely absorb the remnant projected light , thereby preventing its detection at the sensor . the chamber also contains a further light trap opposite the sensor and beyond the detection zone , to eliminate stray projected light from being detected . thus the signal - to - noise ratio caused by remnant projected light compared with the detected scattered light , is maximized to ensure very high sensitivity of the system . this is further ensured by the close mutual proximity of the led &# 39 ; s and the sensor to the detection zone , so that inverse - square light intensity losses are minimized . moreover , a lens is preferably used in conjunction with the sensor to gather scattered light from throughout the detection zone while minimizing visibility of chamber wall surfaces as a result of focusing . control irises are used to further minimize stray light reaching the sensor . through the combination of all these methods the system sensitivity is on the order of 0 . 01 to 0 . 1 %/ m equivalent smoke obscuration . it should be noted that the ability to utilize a broad projector beam enables the use of laser diodes without costly collimation optics . in one preferred embodiment of the invention , each light source is pulsed in sequence for a short period such as 10 ms . at the sensor , a signal is generated in response to each pulse of scattered light at each wavelength . the system is pre - calibrated to account for the sensitivity of the sensor at each wavelength , preferably by adjusting the intensity of the led projections during manufacture . the signals are amplified using digital filtering to improve the signal - to noise ratio , and both the absolute and relative amplitudes of the pulse signals are stored . the absolute value indicates the particle concentration whereas the relative value indicates the particle size or the average size of a group of particles . from rayleigh theory , at a given mass concentration of airborne particles , the long wavelength light will produce a low amplitude signal in the case of small particles , or a large amplitude signal in the case of large particles . the short wavelength light will produce a relatively equal amplitude signal in the case of both small and large particles . by comparing the ratio of the signals it is therefore possible to determine whether the particles are large or small . signals produced over a period of time are analyzed according to trend . a slow increase in the concentration of large particles is indicative of pyrolysis and eventually a smoldering condition . alternatively , a rapid increase in small particles is indicative of a fast flaming fire and , in the absence of a prior period of pyrolysis and smoldering , could indicate the involvement of accelerants ( such as with arson ). this information is used to produce separate alarm outputs in the case of smoldering and flaming fires , or alternatively , to reduce the alarm activation threshold ( i . e ., provide earlier warning ) in the case of flaming fires ( which are more dangerous ). it should be noted that the concentration of smoke alone , does not necessarily indicate the level of danger of an incipient fire . the concentration detected will depend upon the degree of smoke dilution by fresh air , and the proximity of the incipient fire to the detector . by characterizing the smoke in accordance with our invention it becomes possible to determine the level of smoke concentration necessary for an alarm , that is appropriate to the protected environment , thereby providing early warning with minimum false alarms . moreover , the low cost of the system encourages its comprehensive use throughout a facility . in a further embodiment of the invention , particle size discrimination is used to determine the airborne dust content for the purpose of avoiding false alarms or for dust level monitoring within the protected environment . two led &# 39 ; s may be used , but by the use of additional led &# 39 ; s it is possible to discriminate within differing particle size ranges . preferred embodiments of the present invention will now be described with reference to the accompanying drawings . in one embodiment of the invention , and referring to fig1 , the smoke detector housing 10 is produced by the molding of two substantially identical halves 10 a , 10 b ( see fig4 ). two led lamps 11 are positioned to project light across the detection chamber 12 into a region that is viewed by the sensor 13 . smoke 14 is drawn across the chamber 12 in the direction of arrows 15 so that it can be irradiated by the projectors 11 in sequence . some light 16 scattered off the airborne smoke particles is captured by a focusing lens 17 onto the receiving sensor 13 . a series of optical irises 18 confine the spread of the projector beams and another series of irises 19 confine the field of view of the sensor 13 . an absorber gallery 39 / 40 ( light trap ) is provided opposite each projector 11 to absorb essentially all of the remaining essentially unscattered light and thereby prevent any swamping of the scattered light 16 at the sensor 13 by the projected light . a further light trap 20 is provided opposite the sensor to further ensure that essentially no projector light is able to impinge on the sensor . the smoke detector housing 10 preferably incorporates pipework 21 to provide airflow through the detector chamber 12 . this pipework 21 may incorporate a nozzle 22 opposite a collector 23 , to direct the airflow across the chamber 12 , such that the chamber is quickly purged of smoke in the event that the smoke level is reducing . included in the pipework pathway is a dust filter 33 . coupling to the dust filter cavity is by inlet and outlet diffusers 24 , 25 designed to minimize head loss ( pressure drop ) in the airflow through the detector , and to facilitate the use of a large filter 33 for long service life . over a period of years , a small quantity of fine dust may pass through the filter . to prevent or minimize soiling , the arrangement of the nozzle and collector is such as to minimize deposition of dust on the chamber walls and optical surfaces . fig1 b and 1 c illustrate alternative positioning of the light source ( s ) 11 of fig1 a . this has necessitated the re - positioning of the light trap 39 , 40 . in many other respects , the features of fig1 b and 1 e are identical to the illustration of fig1 and the accompanying description . fig1 b and 1 c do not show all the detail of fig1 a , only as a matter of clarity . it is to be noted that fig1 b and 1 c allow for backscatter detection or a combination of back and forward scatter , i . e ., different angles . fig2 illustrates a sectional elevation view taken along line 2 - 2 of the smoke detector body of fig1 . again , many features shown in fig1 a are numbered identically . fig2 indicates the preferred position of the main electronics printed circuit board pcb 1 for efficient and low - interference electrical connection to the projecting light sources and the receiving sensor including its pre - amplifier printed circuit board pcb 2 . conveniently the upper half of the smoke detector body 10 b may be removed without disturbing the connections to pcb 1 for the purposes of setup and maintenance . referring to fig3 , there is shown a cross - sectional view taken along line 3 - 3 of fig1 and showing the gas sample inlet pipework including socket and bends . a cross - sectional view taken on line 4 - 4 of fig1 shows its filter chamber and is represented in fig4 . the filter element is preferably of open - cell foam construction with a relatively large filter pore size such as 0 . 1 mm . this causes dust particles to be arrested progressively throughout the large depth of the element . use of such a large pore size means that smoke particles are not arrested in the filter , even when the filter becomes loaded with dust , which if it occurred would reduce the sensitivity of the detector to smoke . this element is easily removed for cleaning or renewal . in fig5 , there is a sectional view taken long line 5 - 5 of the smoke detector body of fig6 . this indicates how the detector body and the detector housing are secured with screws , and in exploded view shows where the housing may be attached to the duct such as a circular ventilation duct ( which is more challenging than a flat - sided duct ). for example , attachment may be achieved by screws , magnets or adhesive tape . fig6 illustrates a sectional view taken on line 6 - 6 of fig5 of the smoke detector body . fig1 a also shows line 6 - 6 . in fig6 a view of the outer casing , mounted on a pcb pcb 11 , together with a gasket 31 is shown . this particular arrangement is suitable for mounting to a duct , although the present invention should not be limited to only such an application . fig7 is an end view of the inlet / outlet gas port to the smoke detector body showing gasket 31 in plan view . this gasket provides a releasable seal to a duct such as a round ventilation duct of unspecified radius the following description relates to one preferred arrangement of the invention , and with reference to fig8 a , 8 b , 8 c and 9 . it is to be noted that the following description equally applies to the alternative high volume and low volume embodiments shown in fig1 a , 11 b , 12 a to 12 k , and 13 a and 13 b . the same numeral references have been used in the various figures to avoid duplication . the high volume embodiment is used when fluid flow in the duct is relatively high . thus the inlet and outlet openings 28 and 29 , respectively are designed to be smaller , so with a high volume of fluid flow , a smaller sample area is captured and substantially the same volume of fluid to the detector of the present invention . equally , the low volume embodiment is designed with relatively larger openings 28 and 29 , as the fluid flow is lower , a larger opening is provided to present substantially the same amount of fluid flow to the detector of the present invention . the pipework is configured with appropriate bends and sockets suitable for attachment to a probe 26 , which draws smoke from the ventilation duct 27 . the probe 26 is preferably of unit construction containing an inlet port 28 and an outlet port 29 , so that only one penetration hole 30 need be cut into the duct wall to provide access for the probe 26 . this hole is releasably sealed using a closed - cell foam gasket 31 to prevent leakage . fig8 shows a view along line c - c from fig8 b . fig1 a also shows a view along line c - c of fig1 c and 12 h . fig8 a shows a view along line d - d of fig8 . fig1 b shows a view along line d - d of fig1 a for the high volume embodiment . fig1 g shows a view along line d - d of fig1 a for the low volume embodiment . fig8 b shows a sectional view along line e - e of fig8 indicating that it comprises a stem with a detachable head . fig1 c and 12 h show , respectively , high volume and low volume embodiments of the probe viewed along line e - e of fig1 a . p fig8 c shows a view along line f - f . fig1 e and 12 j show plan views of the , respective , high volume and low volume probes . fig1 d and 12 l show sectional views of the heads of the , respective high and low volume probes . the probe 26 is suitable for being inserted into a duct by requiring only a single round penetration of the duct . the probe is inserted so that its inlet faces upstream and its outlet faces downstream . the probe is designed to provide an adequate airflow rate through the detection chamber 12 , driven by the dynamic head associated with the airflow in the ventilation duct 27 . this dynamic head produces a pressure drop across the inlet port 28 and outlet port 29 of the probe 26 , sufficient to overcome the combined restriction of the detection chamber 12 , pipework 21 and dust filter 33 . the efficiency of the probe is maximized by the use of rounding of the inlet orifice followed by a bend to change the direction of the sampled flow with minimum loss . this is repeated at the outlet . the inlet and outlet bends are incorporated without any requirement to enlarge the duct penetration . this high efficiency enables the use of an effective dust filter to ensure a long service interval for the product , such as 10 years in a typical office environment . given such a long interval , it is considered appropriate ( but not essential ) that the detector body 10 can be easily dismantled for cleaning and re - calibration , avoiding the need for a removable filter cartridge that is costly and difficult to make airtight . the high efficiency of the probe also facilitates its use in ventilation ducts operating at relatively low air velocity such as 4 m / sec . for use at low ventilation duct velocities , an alternative probe head is provided . this uses an enlarged air scoop design which incorporates a diffuser to efficiently accelerate the inlet air and ensure that the detector &# 39 ; s rapid response to smoke is maintained . in a preferred embodiment of the invention , with reference to fig8 b and 9 , the probe 26 is constructed with an elliptical or similar cross - section that will minimize drag ( to minimize restriction to flow in the ventilation duct ), as well as minimizing forced vibration at the strouhal frequency caused by the duct flow . in the particular embodiment illustrated by fig8 b and 9 , the aerodynamic coefficient of drag is reduced by a factor of ten compared with a pair of round pipes of similar dimensions . fig1 b to 12 k show similar features , but in respect of the high and low volume probes . the advantages of using an elliptical shape instead of an aerofoil are that the probe may be installed in either direction , and that the overall width of the probe is reduced , without unduly compromising the reduction in drag . by the addition of further stem sections , the probe 26 may be extended in length to meet the needs of different sized ductwork , ensuring adequate flow without the need of an aspirator . the pressure inside the duct 27 can be significantly different from the ambient atmosphere outside the duct ( where the detector is usually mounted ). in a preferred embodiment of the invention best shown in fig1 and 6 , the halves of the chamber are releasably joined in an airtight manner by means of only one continuous o - ring seal 34 . this sets the detector chamber internal pressure to approximate that of the ventilation duct and avoids any leakage to or from ambient atmosphere . leakage into the detector could cause an unwanted alarm from smoke in the ambient environment . leakage of smoke from the detector to the ambient environment could cause an unwanted alarm in other smoke detection equipment protecting that environment . alternatively , with reference to fig1 if a relatively small duct or pipe is used such that the probe in inappropriate , then this duct may be configured to produce a venturi which develops the necessary pressure drop to ensure an adequate flow rate through the detector chamber , filter and pipework . again only a small proportion of the smoke need be passed through the detector and this proportion is minimized in order to minimize the rate of detector soiling and filter loading , thereby to maximize the service interval .	6
generally speaking , the invention features a transaction printer that encodes and reads micr indicia at a point - of - sale . a sensor is provided in the micr encoding portion of the printer to detect the edge of the check and allow precise registration of the edge for subsequent printing of the micr characters . the sensor also provides check location information to the printer control electronics for various other operations required in the encode print sequence or other printer functions . referring to fig1 a check processing apparatus 10 is shown . a check ( not shown ) is inserted into the check processing apparatus 10 at point a with a face down orientation . the check is fed into the apparatus 10 , along the check feed path 11 . the apparatus 10 is designed to encode the check with micr indicia at the point - of - sale . to provide the micr characters , a micr encoder print head 16 and a micr verifying read head 19 are disposed along feed path 11 . a pressure pad 20 is located above the micr read head 19 . this pressure pad presses the check , or other printed media , against the read head 19 to ensure good contact . a link 22 is connected to the pressure pad 20 through a pivot pin 21 . a slot 12 at the distal end of the link 22 causes the link to be guided by link pin 24 , which is fixedly attached to the end of the print head arm 14 . the print head arm 14 is biased upwardly ( arrow 33 , fig2 ) via spring 18 that is anchored to the housing pin 26 . the pin 24 , which rides in slot 12 , is biased against the upper end of slot 12 by the tension spring 23 that is attached at its other end to pin 25 . the spring 23 provides the contact force for pressure pad 20 , as pin 24 moves away from pin 25 guided by the slot in link 22 . the check , or other media , is driven by feed rollers 27 and 28 , which are part of the point - of - sale printer ( not shown ), which is positioned to the rear of the check processing apparatus 10 . a reflective optical sensor 29 disposed at point a stages the check for the various positions of the micr print mechanism . in the home position 1 , shown in fig1 the cam 6 holds the print head 16 away from the platen 30 by bearing against pin 15 . pressure pad 20 is also held away from the micr read head 19 in the home position , as previously mentioned . therefore , a check or other media can now be inserted into the print zone b of the check processing apparatus 10 . feed rollers 27 and 28 , which are normally separated , are now clamped together to grip the inserted check , and feed it into the main printer unit for validation of account information on the check using a second micr read head ( not shown ). the feed rollers 27 and 28 are rotated by a stepper motor ( not shown ). the check is driven back out ( arrow 32 ) when the account validation operation is complete . the feed rollers 27 and 28 stop feeding the check when the lead edge of the check is detected by the reflective optical sensor 29 at point a . the check is now positioned for printing ( encoding ) of the micr characters in the amount field of the check . referring to fig2 the second position of the check processing apparatus 10 is illustrated . in this position , also known as the micr encode position , cam 6 rotates clockwise ( arrow 34 ), so that there is now clearance between the cam 6 and pin 15 . this allows the print head 16 to press a print ribbon ( not shown ) and the check against platen 30 . a detent spring 7 engages in a suitable notch 6b in the cam , to hold the cam position . the cam 6 and platen 30 are both rotatively fixed upon the power input shaft 1 . the cam 6 or platen 30 are selectively driven by the shaft 1 , when the shaft 1 rotates either clockwise ( arrow 34 ) to drive cam 6 , or counter - clockwise ( arrow 36 , fig2 ) to drive the platen 30 . this is accomplished by a bi - directional clutch mechanism 50 disposed within the cam 6 , as is explained hereinafter with reference to fig4 a , 4b , and 5 . shaft 1 is driven in the counter - clockwise direction 36 , in order to drive the platen 30 in the same direction . the edge of the check is detected by the reflective optical sensor 29 at point a . this commands the control electronics of the check processing apparatus 10 to start energizing the heater elements on the print head 16 , which melts and transfers a wax - based ink from the ribbon to the check , thereby forming the micr characters . it should be noted that feed rollers 27 and 28 are disengaged ( opened ) before platen 30 starts rotating . pressure pad 20 and micr read head 19 are also held apart . referring to fig3 the third position of apparatus 10 is shown . in this position , the micr indicia printed upon the check are read . feed rollers 27 and 28 are clamped together and grip the check after the micr indicia has been printed . power input shaft 1 rotates clockwise and drives the cam 6 half - way to its high point . in this position , there is clearance between the print head 16 and platen 30 , and also between pressure pad 20 and the micr read head 19 . the check is then driven back out of the apparatus 10 , where it is detected by the reflective optical sensor 29 , which stops the feed rollers 27 and 28 . shaft 1 continues rotating clockwise and drives cam 6 to its high point against pin 15 , and stops . this allows pressure pad 20 to contact and press the check against the micr read head 19 . feed rollers 27 and 28 then drive the check past the micr read head 19 , which verifies the printed micr characters . cam 6 is then rotated clockwise back to position 1 , so that there is again clearance between print head 16 and platen 30 , and pressure pad 20 and the micr read head 19 . feed rollers 27 and 28 then drive the check back out of the check processing apparatus 10 , and present it to the operator . feed rollers 27 and 28 open to allow removal of the check . the mechanism is now back at the home position ( fig1 ), and is now ready for another point - of - sale transaction . it can be observed that the optical sensor 29 plays a very important role in the processing of micr imprinting and reading . the amount field must be precisely and accurately ascertained for both operations . sensing the leading edge of the check precisely locates the amount field upon the check being processed . it then becomes a simple matter to advance the check by a stepper drive and print motor a fixed number of step increments in order to start the printing or read sequences . now referring to fig4 a and 4b , respective frontal cut - away and side views are shown of the bi - directional clutch 50 , which drives cam 6 and platen 30 . a drive dog 2 is fixedly coupled to the input shaft 1 via set screws 3 . a drive pawl 4 is pivotally attached to the drive dog 2 via pivot pin 5 . the pawl tooth 4a ramps away from the angular detent surface of notch 8a disposed in clutch surface 8 , when the shaft 1 is rotated in the clockwise direction ( arrow 34 , fig2 ). the tooth 4a then engages in notch 6a disposed on cam 6 . the cam 6 is normally held in position by leaf spring 7 , which engages detent notch 6b . as the drive dog 2 continues to rotate in the clockwise direction ( arrow 34 ), the detent force of leaf spring 7 is overcome , and the cam 6 rotates to the micr encode position shown in fig2 . the pawl tooth 4b ramps away from the angular detent surface 6a in cam 6 , when the shaft 1 rotates in the counterclockwise direction ( arrow 36 , fig2 ). the leaf spring 9 normally disposed in the detent 8b of the clutch surface 8 , and which holds same in position , is overcome by the counter - rotative force , allowing the check processing apparatus 10 to achieve the micr read position , shown in fig3 . the clutch 50 is driven by a stepper motor 40 , whose shaft 1 supports platen 30 via bearings 41 , shown in fig4 b . an arm 42 attached to shaft 1 passes through an optical sensor 43 , as shown . the optical sensor 43 detects a home position of stepper motor 40 , and hence the position of the cam 6 . referring to fig5 an exploded , perspective view of the actual check processing apparatus 10 , is shown . a cassette 70 contains a roll 71 of thermal ribbon 72 . the ribbon 72 is moved across the stage 73 of cassette 70 , as the roll 71 is rotated by shaft 1 . the ribbon 72 is threaded through the printing stage 74 . the platen 30 , which is influenced by the bi - directional clutch 50 , acts to control the encoding of micr indicia by forcing the ribbon 32 into contact with the printing head 16 . the read head 19 comes into contact with the pad 20 via a pivot arm 75 that pivots about pivot 76 . the pivot arm 75 has a finger 77 that rests in detent 8b . movement of the bi - directional clutch 50 to the micr read position forces the arm 75 to pivot , causing the read head 19 to come into contact with pad 20 . the pivot arm 75 is biased against contact with pad 20 by leaf spring 78 . since other modifications and changes varied to fit particular operating requirements and environments will be apparent to those skilled in the art , the invention is not considered limited to the example chosen for purposes of disclosure , and covers all changes and modifications which do not constitute departures from the true spirit and scope of this invention . having thus described the invention , what is desired to be protected by letters patent is presented in the subsequently appended claims .	6
the embodiments below explain the invention more specifically . however , it should be construed that such embodiments are only for explaining the invention by examples , instead of limiting the scope of the invention in any forms . the steps are : add diethyl methylmalonate and anhydrous dmf into a reaction flask , stir well , t = 40 , add nah , after 1 - hour consecutive reaction dip the dmf solution of 3 -( 1 - bromopropyl ) anisole while stirring , stir at 85 for 18 hours , track that the reaction is substantially completed by tlc ( developer : petroleum ether / ethyl acetate ( 8 : 1 )), pour the reaction product in the water , perform extraction by ethyl acetate until the water layer is not fluorescent , wash the organic layer twice by water without drying to obtain a yellow oily product after decompression and concentration , i . e ., diethyl 2 -( 3 - methoxphenyl ) propylmalonate . molecular formula : c 18 h 26 o 5 , molecular weight : 322 . 4 , ms ( m / z ): 322 . elementary analysis : theoretical values : c : 67 . 06 %, h : 8 . 13 %; measured values : c : 67 . 16 %, h : 8 . 19 %. the steps are : add diethyl 2 -( 3 - methoxphenyl ) propylmalonate , ethanol and water into a reaction flask , adjust the ph value to 14 by sodium hydroxide after stirring them well , perform heating reflux reaction , track the reaction by tlc , keep the ph value of the solution at 14 , ( developer : petroleum ether / ethyl acetate ( 4 : 1 )), distil ethanol by decompression , and perform extraction twice by ethyl acetate to separate an organic layer out ; adjust the ph value of the water layer to 2 to 3 by an acid , perform extraction by ethyl acetate , separate organic layers out , combine the organic layers , and perform drying by anhydrous magnesium sulphate to obtain a yellow oily product after decompression and concentration ; add the yellow oily production in a three - neck flask , reflux and heat it in an oil bath of 15 for 5 hours , pour the resultant into the sodium hydroxide solution to make the ph become alkaline , and exact the undissolved substance by ethyl acetate ; and adjust the ph of the water layer to 3 by hydrochloric acid , perform extraction by ethyl acetate , and distil a solvent out after drying and decompression to obtain a yellow liquid , i . e ., 2 - methyl - 3 -( 3 - methoxyphenyl ) valeric acid . molecular formula : c 13 h 18 o 3 , molecular weight : 222 . 3 , ms ( m / z ): 223 ( m + + h ). elementary analysis : theoretical values : c : 70 . 24 %, h : 8 . 16 %; measured values : c : 70 . 32 %, h : 8 . 09 %. δ : 7 . 09 ( t , j = 8 . 5 hz , 1h , ar — h ), 6 . 77 ( d , j = 8 . 5 hz , 2h , ar — h ), 6 . 77 ( d , j = 8 . 5 hz , 1h , ar — h ), 3 . 90 ( s , 3h , — och 3 ), 3 . 10 ( m , 1h , ar — ch ), 2 . 90 ( m , 1h , ar — ch — ch — cooh ), 1 . 62 ( m , 2h ), 1 . 19 ( d , j = 6 . 5 hz , 3h ), 0 . 73 ( d , j = 6 . 0 hz , 3h ); 13 c - nmr ( cdcl 3 , 125 mhz ) δ : 176 . 0 , 160 . 1 , 139 . 6 , 127 . 3 , 123 . 1 , 116 . 3 , 113 . 1 , 60 . 3 , 56 . 8 , 55 . 8 , 44 . 5 , 26 . 5 , 14 . 3 , 11 . 2 . the steps are : add 2 - methyl - 3 -( 3 - methoxyphenyl ) valeric acid into a reaction flask , add hydroiodic acid , and perform heating and reflux for 12 hours ; detect the reaction process by tlc ; after that , cool the resultant to the room temperature , pour it into an alkaline solution to make the ph become 9 , perform extraction by ethyl acetate , reversely adjust the ph of the water layer to about 3 . 0 after the water layer is separated out , and add ethyl acetate for extraction ; and dry the ethyl acetate extracting solution by anhydrous magnesium sulphate , and recycle the solvent by decompression to obtain a light yellow liquid , 2 - methyl - 3 -( 3 - hydroxyphenyl ) valeric acid . molecular formula : c 18 h 26 o 5 , molecular weight : 208 . 3 , ms ( m / z ): 209 ( m + + h ). elementary analysis : theoretical values : c : 69 . 21 %, h : 7 . 74 %; measured values : c : 65 . 35 %, h : 7 . 56 %. the steps are : add 2 - methyl - 3 -( 3 - hydroxyphenyl ) valeric acid into a three - neck flask , add thionyl chloride , perform reflux for 4 hours , detect that the reaction is substantially completed by tlc , ( developer : petroleum ether / ethyl acetate ( 4 : 1 )); and distil a solvent by decompression to obtain valeryl 2 - methyl - 3 -( 3 - methoxyphenyl ) chloride ( compound 1 ). molecular formula : c 13 h 17 clo 2 , molecular weight : 240 . 7 , ms ( m / z ): 240 ( m + ). elementary analysis : theoretical values : c : 64 . 86 %, h : 7 . 12 %; measured values : c : 65 . 02 %, h : 7 . 24 %. the steps are : add compound 1 and methanol into a three - neck flask , perform reflux for 5 hours , detect that the reaction is substantially completed by tlc , distil a solvent by decompression to obtain a light yellow oily product , valeryl 2 - methyl - 3 -( 3 - methoxyphenyl ) chloride ( compound 2 ). molecular formula : c 14 h 20 o 3 , molecular weight : 236 . 3 , ms ( m / z ): 236 ( m + ). elementary analysis : theoretical values : c : 71 . 16 %, h : 8 . 53 %; measured values : c : 71 . 09 %, h : 8 . 39 %. the step are : add the aqueous solution of dimethylamine ( 33 %) into a three - neck flask , t = 10 , dip compound 1 and naoh to make ph = 12 to 14 ; after that , keep performing the reaction at the room temperature for 2 hours ; perform extraction twice by ethyl acetate , prepare the organic phase , rinse twice by 10 % hydrochloric acid , and perform drying by anhydrous magnesium sulfate ; recycle the solvent by decompression to obtain a light yellow oily product which is dissolved by isopropanol ; and add a seed crystal to obtain a white solid , n , n - dimethyl - 2 - methyl - 3 -( 3 - methoxyphenyl ) valeramide ( compound 7 ). molecular formula : c 15 h 23 no 2 , molecular weight : 249 . 4 , ms ( m / z ): 249 ( m + ). elementary analysis : theoretical values : c : 72 . 25 %, h : 9 . 30 %, n : 5 . 62 %; measured values : c : 72 . 31 %, h : 9 . 35 %, n : 5 . 73 %. the steps are : add compound 7 into a reaction flask , add hydroiodic acid , perform heating and reflux for 5 hours ; detect the reaction process by tlc ; after that , cool the resultant to the room temperature , pour it to an alkaline solution to make the ph become 9 , and perform extraction by ethyl acetate and rinse by water ; and recycle the solvent after drying and decompression to obtain a light yellow liquid , n , n - dimethyl - 2 - methyl - 3 -( 3 - hydroxyphenyl ) valeramide ( compound 9 ). molecular formula : c 14 h 21 no 2 , molecular weight : 235 . 3 , ms ( m / z ): 235 ( m + ). elementary analysis : theoretical values : c : 71 . 46 %, h : 8 . 99 %, n : 5 . 95 %; measured values : c : 71 . 33 %, h : 9 . 05 %, n : 5 . 92 %. 1 h - nmr ( cdcl 3 , 500 mhz ) δ : 7 . 11 ( t , j = 8 . 0 hz , 1h , ar — h ), 6 . 74 ( d , j = 8 . 0 hz , 2h , ar — h ), 6 . 62 ( d , j = 8 . 0 hz , 1h , ar — h ), 3 . 03 ( m , 2h , ar — ch , ar — ch — ch — cooh ), 2 . 86 ( s , 6h , n ( ch 3 ) 2 ), 1 . 66 ( m , 2h ), 1 . 12 ( d , j = 6 . 5 hz , 3h ), 0 . 75 ( d , j = 6 . 0 hz , 3h ); 13 c - nmr ( cdcl 3 , 125 mhz ) δ : 176 . 0 , 158 . 3 , 140 . 6 , 129 . 3 , 121 . 8 , 114 . 9 , 113 . 6 , 59 . 2 , 42 . 7 , 39 . 4 , 26 . 5 , 15 . 2 , 11 . 1 . compound 11 can be obtained by replacing dimethylamine in embodiment 6 with diethylamine . molecular formula : c 17 h 27 no 2 , molecular weight : 277 . 4 , ms ( m / z ): 277 ( m + ). elementary analysis : theoretical values : c : 73 . 61 %, h : 9 . 81 %, n : 5 . 05 %; measured values : c : 73 . 43 %, h : 9 . 75 %, n : 5 . 09 %. compound 12 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 6 with dipropylamine . molecular formula : c 19 h 31 no 2 , molecular weight : 305 . 5 , ms ( m / z ): 305 ( m + ). elementary analysis : theoretical values : c : 74 . 71 %, h : 10 . 23 %, n : 4 . 59 %; measured values : c : 74 . 68 %, h : 10 . 21 %, n : 4 . 61 %. compound 13 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 6 with diisopropylamine . molecular formula : c 19 h 31 no 2 , molecular weight : 305 . 5 , ms ( m / z ): 305 ( m + ). elementary analysis : theoretical values : c : 74 . 71 %, h : 10 . 23 %, n : 4 . 59 %; measured values : c : 74 . 74 %, h : 10 . 30 %, n : 4 . 56 %. compound 14 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 6 with piperidine . molecular formula : c 18 h 27 no 2 , molecular weight : 289 . 4 , ms ( m / z ): 289 ( m + ). elementary analysis : theoretical values : c : 74 . 70 %, h : 9 . 40 %, n : 4 . 84 %; measured values : c : 74 . 79 %, h : 9 . 35 %, n : 4 . 77 %. compound 15 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 6 with 4 - methylpiperidine . molecular formula : c 19 h 29 no 2 , molecular weight : 303 . 45 , ms ( m / z ): 304 ( m + + 1 ). elementary analysis : theoretical values : c : 75 . 21 %, h : 9 . 63 %, n : 4 . 62 %; measured values : c : 75 . 19 %, h : 9 . 57 %, n : 4 . 76 %. compound 16 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 6 with morpholine . molecular formula : c 17 h 25 no3 , molecular weight : 291 . 39 , ms ( m / z ): 291 ( m + ). elementary analysis : theoretical values : c : 70 . 07 %, h : 8 . 65 %, n : 4 . 81 %; measured values : c : 70 . 11 %, h : 8 . 57 %, n : 4 . 79 %. compound 17 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 6 with pyrrolidine . molecular formula : c 17 h 25 no 2 , molecular weight : 275 . 39 , ms ( m / z ): 275 ( m + ). elementary analysis : theoretical values : c : 74 . 14 %, h : 9 . 15 %, n : 5 . 09 %; measured values : c : 74 . 12 %, h : 9 . 17 %, n : 4 . 98 %. compound 18 can be obtained according to the operation of the method by replacing 3 -( 1 - bromopropyl ) anisole in embodiment 1 with 3 -( 1 - bromopropyl ) chlorobenzene . molecular formula : c 14 h 20 clno , molecular weight : 253 . 77 , ms ( m / z ): 253 ( m + ). elementary analysis : theoretical values : c : 66 . 26 %, h : 7 . 94 %, n : 5 . 52 %; measured values : c : 66 . 32 %, h : 8 . 05 %, n : 5 . 56 %. compound 19 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with diethylamine . molecular formula : c 16 h 24 clno , molecular weight : 281 . 83 , ms ( m / z ): 281 ( m + ). elementary analysis : theoretical values : c : 68 . 19 %, h : 8 . 58 %, n : 4 . 97 %; measured values : c : 68 . 22 %, h : 8 . 65 %, n : 4 . 86 %. compound 20 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with dipropylamine . molecular formula : c 18 h 28 clno , molecular weight : 309 . 88 , ms ( m / z ): 309 ( m + ). elementary analysis : theoretical values : c : 69 . 77 %, h : 9 . 11 %, n : 4 . 52 %; measured values : c : 69 . 83 %, h : 9 . 21 %, n : 4 . 56 %. compound 21 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with isopropylamine . molecular formula : c 17 h 24 clno , molecular weight : 293 . 84 , ms ( m / z ): 294 ( m + ). elementary analysis : theoretical values : c : 69 . 77 %, h : 9 . 11 %, n : 4 . 52 %; measured values : c : 69 . 84 %, h : 9 . 23 %, n : 4 . 59 %. compound 22 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with piperidine . molecular formula : c 17 h 24 clno , molecular weight : 293 . 84 , ms ( m / z ): 294 ( m + ). elementary analysis : theoretical values : c : 69 . 49 %, h : 8 . 23 %, n : 12 . 07 %; measured values : c : 69 . 44 %, h : 8 . 31 %, n : 4 . 75 %. compound 23 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with 4 - methylpiperidine . molecular formula : c 18 h 26 clno , molecular weight : 307 . 87 , ms ( m / z ): 307 ( m + ). elementary analysis : theoretical values : c : 70 . 23 %, h : 8 . 51 %, n : 4 . 55 %; measured values : c : 70 . 22 %, h : 8 . 65 %, n : 4 . 62 %. compound 24 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with morpholine . molecular formula : c 18 h 26 clno , molecular weight : 307 . 87 , ms ( m / z ): 307 ( m + ). elementary analysis : theoretical values : c : 64 . 97 %, h : 7 . 50 %, n : 4 . 73 %; measured values : c : 65 . 02 %, h : 7 . 55 %, n : 4 . 68 %. compound 25 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with pyrrolidine . molecular formula : c 16 h 22 clno , molecular weight : 279 . 81 , ms ( m / z ): 279 ( m + ). elementary analysis : theoretical values : c : 68 . 68 %, h : 7 . 93 %, n : 5 . 01 %; measured values : c : 68 . 70 %, h : 7 . 02 %, n : 5 . 12 %. the steps are : add anhydrous ether into a reaction flask , and add lithium aluminum hydride under the condition of ice bath ; dip compound 7 , control the temperature within 10 , after the dipping detect the reaction process by tlc ; after the reaction is ended , pour the reaction liquid in the ice water slowly , separate the ether layer out , rinse by water , perform drying , and recycle the solvent by decompression to obtain a light yellow liquid , 3 -( 3 - methoxy - phenyl )- n , n , 2 - trimethyl pentylamine . yield : 85 %. molecular formula : c 15 h 25 no , molecular weight : 235 . 4 , ms ( m / z ): 235 ( m + ). the steps are : add 3 -( 3 - methoxy - phenyl )- n , n , 2 - trimethyl pentylamine into a reaction flask , add hydroiodic acid , and perform heating and reflux for 5 hours ; detect the reaction process by tlc ; after that , cool the resultant to the room temperature , pour it to an alkaline solution to make the ph become 9 , perform extraction by ethyl acetate and rinse by water ; recycle the solvent by drying and decompression to obtain a light yellow liquid , 3 -( 3 - hydroxy - phenyl )- n , n , 2 - trimethyl pentylamine ; and separate the mother solution by a separator , form the salt by the acidification of hydrochloric acid to obtain tapentadol hydrochloride . hplc : 99 . 56 %, ee %& gt ; 99 . 5 %. molecular formula : c 14 h 23 no . hcl , molecular weight : 257 . 8 , ms ( m / z ): 221 ( m + - hcl ). elementary analysis : theoretical values : c : 65 . 23 %, h : 9 . 38 %, n : 5 . 43 %; measured values : c : 65 . 31 %, h : 9 . 35 %, n : 5 . 31 %. 1 h - nmr ( d 2 o , 500 mhz ) δ : 7 . 15 ( t , j = 8 . 0 hz , 1h , ar — h ), 6 . 69 ( dd , j = 8 . 0 hz , 2h , ar — h ), 6 . 65 ( d , j = 8 . 0 hz , 1h , ar — h ), 2 . 71 ( m , 2h , — ch 2 ), 2 . 62 ( s , 6h , n ( ch 3 ) 2 ), 2 . 20 ( m , 1h , — ch — ch 3 ), 2 . 04 ( m , 1h , — ch —), 1 . 73 , 1 . 42 ( m , 2h , — ch 2 ch 3 ), 0 . 96 ( d , 3h , — chch 3 ), 0 . 54 ( t , 3h , — ch 2 ch 3 ). 3 -( 3 - methoxy - phenyl )- 2 - methyl - n , n - diethyl pentylamine can be obtained by compound 11 according to embodiment 23 . molecular formula : c 17 h 29 no , molecular weight : 263 . 4 , ms ( m / z ): 264 ( m + + h ). elementary analysis : theoretical values : c : 77 . 51 %, h : 11 . 09 %, n : 5 . 31 %; measured values : c : 77 . 39 %, h : 11 . 15 %, n : 5 . 42 %. ( 1r , 2r )- 3 -( 3 - diethylamine - 1 - ethyl - 2 - methylpropyl )- phenol hydrochloride can be obtained by 3 -( 3 - methoxy - phenyl )- 2 - methyl - n , n - diethyl pentylamine according to embodiment 24 . molecular formula : c 16 h 27 no . hcl , molecular weight : 285 . 8 , ms ( m / z ): 249 ( m + - hcl ). elementary analysis : theoretical values : c : 71 . 21 %, h : 10 . 46 %, n : 5 . 19 %; measured values : c : 71 . 11 %, h : 10 . 35 %, n : 5 . 21 %. 3 -( 3 - methoxy - phenyl )- 2 - methyl - n , n - dipropyl pentylamine can be obtained by compound 12 according to embodiment 23 . molecular formula : c 19 h 33 no , molecular weight : 291 . 5 , ms ( m / z ): 290 ( m + - h ). elementary analysis : theoretical values : c : 78 . 29 %, h : 11 . 41 %, n : 4 . 81 %; measured values : c : 78 . 33 %, h : 11 . 52 %, n : 4 . 76 %. ( 1r , 2r )- 3 -( 3 - dipropylamine - 1 - ethyl - 2 - methylpropyl )- phenol hydrochloride can be obtained by 3 -( 3 - methoxy - phenyl )- 2 - methyl - n , n - dipropyl pentylamine according to embodiment 24 . molecular formula : c 18 h 31 no . hcl , molecular weight : 313 . 9 , ms ( m / z ): 277 ( m + - hcl ). elementary analysis : theoretical values : c : 68 . 87 %, h : 10 . 28 %, n : 4 . 46 %; measured values : c : 68 . 74 %, h : 10 . 33 %, n : 4 . 36 %. 3 -( 3 - methoxy - phenyl )- 2 - methyl - n , n - isopropyl pentylamine can be obtained by compound 13 according to embodiment 23 . molecular formula : c 19 h 33 no , molecular weight : 291 . 5 , ms ( m / z ): 290 ( m + - h ). elementary analysis : theoretical values : c : 78 . 29 %, h : 11 . 41 %, n : 4 . 81 %; measured values : c : 78 . 33 %, h : 11 . 52 %, n : 4 . 76 %. ( 1r , 2r )- 3 -( 3 - isopropylamine - 1 - ethyl - 2 - methylpropyl )- phenol hydrochloride can be obtained by 3 -( 3 - methoxy - phenyl )- 2 - methyl - n , n - dipropyl pentylamine according to embodiment 24 . molecular formula : c 18 h 31 no . hcl , molecular weight : 313 . 9 , ms ( m / z ): 277 ( m + - hcl ). elementary analysis : theoretical values : c : 68 . 87 %, h : 10 . 28 %, n : 4 . 46 %; measured values : c : 68 . 74 %, h : 10 . 33 %, n : 4 . 36 %. 1 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- piperidine can be obtained by compound 14 according to embodiment 23 . molecular formula : c 18 h 29 no , molecular weight : 275 . 4 , ms ( m / z ): 275 ( m + ). elementary analysis : theoretical values : c : 78 . 49 %, h : 10 . 61 %, n : 5 . 09 %; measured values : c : 78 . 42 %, h : 10 . 55 %, n : 5 . 21 %. ( 1r , 2r )- 3 -( 1 - ethyl - 2 - methyl - 3 - piperidin - 1 - yl - propyl )- phenol hydrochloride can be obtained by 1 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- piperidine according to embodiment 24 . molecular formula : c 17 h 27 no . hcl , molecular weight : 297 . 9 , ms ( m / z ): 261 ( m + - hcl ). elementary analysis : theoretical values : c : 72 . 44 %, h : 10 . 01 %, n : 4 . 97 %; measured values : c : 72 . 36 %, h : 10 . 15 %, n : 5 . 02 %. 1 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- 4 - methyl - piperidine can be obtained by compound 15 according to embodiment 23 . molecular formula : c 19 h 33 no , molecular weight : 291 . 5 , ms ( m / z ): 291 ( m + ). elementary analysis : theoretical values : c : 78 . 29 %, h : 11 . 41 %, n : 4 . 80 %; measured values : c : 78 . 31 %, h : 11 . 35 %, n : 4 . 82 %. ( 1r , 2r )- 3 -[ 1 - ethyl - 2 - methyl - 3 -( 4 - methyl - piperidin - 1 - yl )- propyl ]- phenol hydrochloride can be obtained by 1 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- 4 - methyl - piperidine according to embodiment 24 . molecular formula : c 18 h 29 no . hcl , molecular weight : 311 . 89 , ms ( m / z ): 275 ( m + - hcl ). elementary analysis : theoretical values : c : 69 . 31 %, h : 9 . 70 %, n : 4 . 49 %; measured values : c : 69 . 42 %, h : 9 . 72 %, n : 4 . 46 %. 4 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- morpholine can be obtained by compound 16 according to embodiment 23 . molecular formula : c 17 h 27 no 2 , molecular weight : 277 . 4 , ms ( m / z ): 277 ( m + ). elementary analysis : theoretical values : c : 73 . 60 %, h : 9 . 81 %, n : 5 . 05 %; measured values : c : 73 . 71 %, h : 9 . 85 %, n : 5 . 01 %. ( 1r , 2r )- 3 -( 1 - ethyl - 2 - methyl - 3 - morpholin - 4 - yl - propyl )- phenol hydrochloride can be obtained by 4 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- morpholine according to embodiment 24 . molecular formula : c 16 h 27 no 2 . hcl , molecular weight : 299 . 8 , ms ( m / z ): 263 ( m + - hcl ). elementary analysis : theoretical values : c : 64 . 09 %, h : 8 . 74 %, n : 4 . 67 %; measured values : c : 64 . 12 %, h : 9 . 79 %, n : 4 . 71 %. 1 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- pyrrolidine can be obtained by compound 17 according to embodiment 23 . molecular formula : c 17 h 27 no , molecular weight : 261 . 4 , ms ( m / z ): 261 ( m + ). elementary analysis : theoretical values : c : 78 . 11 %, h : 10 . 41 %, n : 5 . 35 %; measured values : c : 78 . 24 %, h : 10 . 35 %, n : 5 . 29 %. ( 1r , 2r )- 3 -( 1 - ethyl - 2 - methyl - 3 - pyrrolidin - 1 - yl - propyl )- phenol hydrochloride can be obtained by 1 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- pyrrolidine according to embodiment 24 . molecular formula : c 14 h 23 no . hcl , molecular weight : 283 . 8 , ms ( m / z ): 247 ( m + - hcl ). elementary analysis : theoretical values : c : 67 . 70 %, h : 9 . 23 %, n : 5 . 64 %; measured values : c : 67 . 76 %, h : 9 . 31 %, n : 5 . 59 %. the steps are : under the condition of ice bath , add methanol and 3 -( 3 - methoxyphenyl )- 2 - pentanol into a reaction flask , stir , introduce n 2 , after the system is reduced about 0 add 96 % sodium borohydride for four times , keep performing the reaction at the temperature for 30 minutes , track that the reaction is substantially completed by tlc , distil the solvent by decompression , pour the reaction product in the water , and perform extraction by ethyl acetate and drying by anhydrous magnesium sulfate to obtain 3 -( 3 - methoxyphenyl )- 2 - pentanol after decompression and concentration , yield : 99 %. molecular formula : c 12 h 18 o2 , molecular weight : 194 . 3 , ms ( m / z ): 195 ( m + + h ). elementary analysis : theoretical values : c : 74 . 19 %, h : 9 . 34 %; measured values : c : 74 . 22 %, h : 9 . 32 %. the steps are : under the protection of n 2 , add 3 -( 3 - methoxyphenyl )- 2 - pentanol and dichloromethane into a reaction flask , lower the temperature to about − 5 by ice bath , dip pbr 3 , keep the temperature , stir at the temperature for 1 hour , track that the reaction is substantially completed by tlc , pour the reaction product in the ice water , perform extraction by dichloromethane , rinse the organic layer by the aqueous solution of sodium bicarbonate and then by water , and perform drying by anhydrous magnesium sulfate to obtain 1 -( 2 - bromopentane )- 3 - methoxybenzene after decompression and concentration , yield : 95 %. molecular formula : c 12 h 17 bro , molecular weight : 256 . 2 , ms ( m / z ): 257 ( m + + h ). elementary analysis : theoretical values : c : 56 . 04 %, h : 6 . 66 %; measured values : c : 56 . 11 %, h : 6 . 62 %. the steps are : add sodium cyanide and dmf into a reaction flask , rise the temperature to 85 , dip the dmf solution of 1 -( 2 - bromopentane )- 3 - methoxybenzene , keep the temperature , stir at the temperature for 8 hours , track that the reaction is substantially completed by tlc , and lower the temperature to the room temperature ; and pour the reaction liquid in the water , perform extraction by ethyl acetate until the water layer is not fluorescent , and rinse the organic layer twice by water without drying to obtain 2 - methyl - 3 -( 3 - methoxyphenyl ) pentanenitrile after decompression and concentration . molecular formula : c 13 h 17 no , molecular weight : 203 . 3 , ms ( m / z ): 204 ( m + + h ). elementary analysis : theoretical values : c : 76 . 81 %, h : 8 . 43 %; measured values : c : 76 . 75 %, h : 8 . 46 %. the invention has been described in connection with the embodiments . it should be construed that the description and embodiments above are only used for explaining the invention by examples . various replacements and improvements of the invention can be made by those skilled in the art within the spirit and scope of the invention and should be construed to be within the protection scope of the invention	2
as a preliminary matter , it will readily be understood by one having ordinary skill in the relevant art (“ ordinary artisan ”) that the present invention has broad utility and application . furthermore , any embodiment discussed and identified as being “ preferred ” is considered to be part of a best mode contemplated for carrying out the present invention . other embodiments also may be discussed for additional illustrative purposes in providing a full and enabling disclosure of the present invention . moreover , many embodiments , such as adaptations , variations , modifications , and equivalent arrangements , will be implicitly disclosed by the embodiments described herein and fall within the scope of the present invention . accordingly , while the present invention is described herein in detail in relation to one or more embodiments , it is to be understood that this disclosure is illustrative and exemplary of the present invention , and is made merely for the purposes of providing a full and enabling disclosure of the present invention . the detailed disclosure herein of one or more embodiments is not intended , nor is to be construed , to limit the scope of patent protection afforded the present invention , which scope is to be defined by the claims and the equivalents thereof . it is not intended that the scope of patent protection afforded the present invention be defined by reading into any claim a limitation found herein that does not explicitly appear in the claim itself . thus , for example , any sequence ( s ) and / or temporal order of steps of various processes or methods that are described herein are illustrative and not restrictive . accordingly , it should be understood that , although steps of various processes or methods may be shown and described as being in a sequence or temporal order , the steps of any such processes or methods are not limited to being carried out in any particular sequence or order , absent an indication otherwise . indeed , the steps in such processes or methods generally may be carried out in various different sequences and orders while still falling within the scope of the present invention . accordingly , it is intended that the scope of patent protection afforded the present invention is to be defined by the appended claims rather than the description set forth herein . additionally , it is important to note that each term used herein refers to that which the ordinary artisan would understand such term to mean based on the contextual use of such term herein . to the extent that the meaning of a term used herein — as understood by the ordinary artisan based on the contextual use of such term — differs in any way from any particular dictionary definition of such term , it is intended that the meaning of the term as understood by the ordinary artisan should prevail . furthermore , it is important to note that , as used herein , “ a ” and “ an ” each generally denotes “ at least one ,” but does not exclude a plurality unless the contextual use dictates otherwise . thus , reference to “ a picnic basket having an apple ” describes “ a picnic basket having at least one apple ” as well as “ a picnic basket having apples .” in contrast , reference to “ a picnic basket having a single apple ” describes “ a picnic basket having only one apple .” when used herein to join a list of items , “ or ” denotes “ at least one of the items ,” but does not exclude a plurality of items of the list . thus , reference to “ a picnic basket having cheese or crackers ” describes “ a picnic basket having cheese without crackers ”, “ a picnic basket having crackers without cheese ”, and “ a picnic basket having both cheese and crackers .” finally , when used herein to join a list of items , “ and ” denotes “ all of the items of the list .” thus , reference to “ a picnic basket having cheese and crackers ” describes “ a picnic basket having cheese , wherein the picnic basket further has crackers ,” as well as describes “ a picnic basket having crackers , wherein the picnic basket further has cheese .” referring now to the drawings and , in particular , fig4 - 6 , one or more preferred embodiments of the present invention are next described . the following description of one or more preferred embodiments is merely exemplary in nature and is in no way intended to limit the invention , its implementations , or uses . in this regard , fig4 is a perspective view of an elbow orthotic 400 in accordance with a preferred embodiment of the present invention , wherein the arm is in an extended position ; and fig5 is a perspective view of the elbow orthotic 400 wherein the arm is in a flexed position . additionally , fig6 is a perspective view of an elbow orthotic 600 in accordance with another preferred embodiment of the present invention that is similar in construction and design to orthotic 400 , but that further includes a padding component 602 as part of the orthotic 600 . in general , an orthotic of the present invention preferably comprises : an upper arm component that is configured to be secured to the upper arm above the elbow ; and a lower arm component that is configured to be secured to the lower arm below the elbow . in particular , the lower arm section is secured to the wrist ; to the wrist and hand ; or to the wrist , hand , and fingers , as shown in fig4 . in the orthotics 400 , 600 , the upper arm section preferably is in the form of a cuff 402 that is approximately 4 to 6 inches in length . as shown in fig4 and 7 , upper cuff 402 may have either a anterior or lateral opening in order to secure the cuff to the user &# 39 ; s upper arm . the cuff is secured to the arm with one or more attachments such as straps , clasps , buckles , or the like . the lower arm component itself comprises forearm - wrist - hand orthotics 404 substantially as shown and described in u . s . pat . no . 7 , 001 , 352 , which is hereby incorporated herein by reference ; however , other designs of the lower arm component are certainly with the scope of the present invention , and the invention is not limited to use only of orthotics 404 of this patent . in accordance with the present invention , upper arm component 402 and lower arm component 404 are connected by one or more elongate members 406 . in contrast to conventional elbow orthotics , the upper and lower arm components are not hinged together . in the illustrated embodiments of fig4 - 6 , the elongate members comprise elastic cords 406 each of which provides a line of tension in the orthotic that tends to bias the upper and lower arm components toward a particular orientation relative to one another . in particular , elastic cord 406 is attached both to upper arm component 402 and to lower arm component 404 . the attachments of elastic cord 406 can be accomplished , for example , using hooks , cleats , cams , clips , and the like . in the embodiment shown in fig4 , cleats 407 and 409 are used . furthermore , an outrigger 408 is attached to the posterior and / or lateral aspects of cuff 402 and can be adjustably mounted in the proximal and / or distal directions via additional attachment openings in the cuff . outrigger 408 serves to guide each elastic cord 406 from cuff 402 to a point located below the apex of the elbow , from which elastic cord 406 extends and is attached to lower arm component 404 . this arrangement assists with pulling the elbow into an extension position . outrigger 408 thus defines a point of tensional redirection that is located below the elbow . in a variation not shown , but which will be apparent to the ordinary artisan over the drawings disclosed and described herein , another attachment to the cuff may be provided that locates the point of tensional redirection above the apex of the elbow in order to assist the elbow into a flexed position . the tensional redirection of an elastic cord is achieved in the preferred embodiment by means of a pulley 410 , i . e ., a freely rotatable wheel mounted at the distal end of the outrigger . fig7 - 16 shows another embodiment where redirection is achieved by a fixed end of outrigger 408 . when using elastic / shock cords to facilitate elbow extension , it is preferred that the cord or cords attach to outrigger 408 on upper component 402 , with a cord ( or more cords if using more than one cord ) passing down outrigger 408 , passing behind and being redirected below the apex of the elbow , and extending and attaching to lower component 404 . the adjustable force generated in various flexed positions will help pull the elbow back into an extension position . in this case , the tension / force mimics the non - functioning muscle ( triceps ) that moves the elbow into extension . it also provides resistance to the weakened non - functioning muscle ( biceps ) that moves the elbow into flexion , thus assisting with strengthening . when using elastic / shock cords to facilitate elbow flexion , it is preferred that the cord or cords attach to a site on the posterior or lateral aspect of upper arm component 402 , with a cord ( or more cords if using more than one cord ) passing above and being redirected above the apex of the elbow , and extending to attach to lower arm component 404 . the adjustable force then generated will help pull the elbow into a flexed position . in this case , the tension / force mimics the non - functioning muscle ( biceps ) that moves the elbow into flexion . it also provides resistance to the weakened non - functioning muscle ( triceps ) that moves the elbow into extension , thus assisting with strengthening . the attachment sites on the lower component may also allow for force / tension adjustments , such as when cleats / cams 407 are used in conjunction with elastic / shock cords ( e . g . when pulling the elastic cord further through the cleat thus increasing the tension / force ). as an alternative to elastic - cord 406 and - pulley 410 , an elongate energy storing material like spring steel or a flex rod may be used as the elongate member for connecting and biasing the upper and lower arm sections toward a particular orientation relative to one another . various energy storing materials may be used , and different forces will be generated depending on the respective physical properties of such materials ( e . g . a ⅛ of an inch diameter elastic / shock cord will offer less force than a 3 / 16 of an inch diameter elastic / shock cord ). outrigger 408 may also incorporate a padding component 602 at the posterior aspect of the elbow , as shown in fig6 . padding component 602 helps maintain the position of upper cuff 402 and lower cuff 404 is moved . still yet , fig7 - 11 are different perspective views of an orthotic 700 in accordance with another preferred embodiment of the invention . this orthotic 700 is similar to orthotic 400 in that it has an upper cuff 702 , lower arm component 704 that attaches to the forearm and hand and further spans the wrist . an outrigger 708 is releasably coupled to upper cuff 702 similar to that in the embodiments shown in fig4 - 6 . elastic cord 706 coupled upper cuff 702 to lower cuff 704 . in contrast , fig1 - 13 are different perspective views of another orthotic 1200 in accordance with a preferred embodiment of the invention , wherein lower arm component 704 attaches only to the forearm . in this embodiment , upper cuff 1202 has two outriggers 1208 that redirect elastic cords 1206 . cords 1206 connect to lower cuff 1204 by cleats 1207 ( only one is shown in the figure ). a pad 1210 is coupled to outrigger 1208 to provide additional upper arm support . as shown in fig1 , pad 1210 is secured to outrigger 1208 by an adjustable spring clamp 1212 . fig1 - 16 illustrate variations of the upper arm component . in fig1 , upper arm component 1400 has conduit guides 1402 that are attached to cuff 1404 by adjustable spring plates 1408 and 1414 and that receive therethrough the elastic cords ( not shown for clarity ). moreover , the elastic cords are guided by bent or curved sections outrigger end sections 1406 located proximate to the end of the conduit guides as shown in fig1 . for reference , upper arm component 1400 of fig1 is utilized in the orthotic 700 of fig7 - 11 . in contrast , fig1 is intended to illustrate an upper arm component 1500 having telescoping conduit guides , in that the bent or curved sections 1506 located at the end of the conduit guides 1502 actually extend within the conduit guides 1502 in frictional fit therewith and may pulled out to lengthen the protraction of the curved sections 1506 from cuff 1504 , whereby the point of tensional redirection can be adjusted and positioned as desired along the direction of the axes of the conduit guides . in the structural design of the upper arm component 1400 , 1500 of fig1 and 15 , the conduit guides are removably attached to the cuff by spring plate 1408 , which includes curved sides 1410 that receive and retain the conduit guides against the cuff but that may be raised so as to release and remove the conduit guides from the cuff . furthermore , as shown , a padding component 1412 is adjustably attached to the conduit guides via a second spring plate 1414 . fig1 illustrates another upper arm component 1600 in accordance with another preferred embodiment thereof . in this embodiment , outriggers 1602 are provided with pulleys 1604 attached at their distal ends . proximal ends of the outriggers ( i . e ., the opposite ends thereof ) include retention members 1606 for receiving and retaining ends of the elastic cords ( not shown for clarity ) that are used to connect the upper and lower components together in an orthotic , which elastic cords are engaged and redirected by the pulleys . outriggers 1602 is secured to the cuff by a mounting member 1608 and the outrigger preferably is adjustable along the axis thereof by sliding frictional engagement through bores formed in mounting member 1608 . a padding component 1610 also is releasably mounted to outriggers 1602 using a spring plate 1612 and , in fig1 , spring plate 1612 and padding component 1610 are actually shown in a disengaged state with padding component 1610 disposed below outriggers 1602 . padding component 1610 is secured to spring plate 1612 using conventional fasteners , such as screws . based on the foregoing description , it will be readily understood by those persons skilled in the art that the present invention is susceptible of broad utility and application . many embodiments and adaptations of the present invention other than those specifically described herein , as well as many variations , modifications , and equivalent arrangements , will be apparent from or reasonably suggested by the present invention and the foregoing descriptions thereof , without departing from the substance or scope of the present invention . accordingly , while the present invention has been described herein in detail in relation to one or more preferred embodiments , it is to be understood that this disclosure is only illustrative and exemplary of the present invention and is made merely for the purpose of providing a full and enabling disclosure of the invention . the foregoing disclosure is not intended to be construed to limit the present invention or otherwise exclude any such other embodiments , adaptations , variations , modifications or equivalent arrangements , the present invention being limited only by the claims appended hereto and the equivalents thereof .	0
the compounds of this invention are useful in the inhibition of farnesyl - protein transferase and the farnesylation of certain proteins . in a first embodiment of this invention , the farnesyl - protein transferase inhibitors are illustrated by the formula i : ## str2 ## wherein : b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o )-- nr 10 --; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , n ( r 10 ) 2 , no 2 , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , r 11 oc ( o ) nr 10 -- and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocycle and c 3 - c 10 cycloalkyl ; or r 3a and r 3b are combined to form --( ch 2 ) s -- wherein one of the carbon atoms is optionally replaced by a moiety selected from : o , s ( o ) m , -- nc ( o )--, and -- n ( cor 10 )--; b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , r 10 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 -- c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nh --, cn , h 2 n -- c ( nh )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 10 oc ( o ) nh --; b ) alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c --( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, -- nr 10 c ( o )--, o , -- n ( r 10 )--, -- s ( o ) 2 n ( r 10 )--, -- n ( r 10 ) s ( o ) 2 --, or s ( o ) m ; d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; in a second embodiment of this invention the prodrugs of compounds of formula i are illustrated by the formula ii : ## str4 ## wherein : b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o )-- nr 10 --; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , n ( r 10 ) 2 , no 2 , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , r 11 oc ( o ) nr 10 -- and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocycle and c 3 - c 10 cycloalkyl ; or r 3a and r 3b are combined to form --( ch 2 ) 3 -- wherein one of the carbon atoms is optionally replaced by a moiety selected from : o , s ( o ) m , -- nc ( o )--, and -- n ( cor 10 )--; a ) substituted or unsubstituted c 1 - c 8 alkyl or substituted or unsubstituted c 5 - c 8 cycloalkyl , wherein the substituent on the alkyl is selected from : b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , r 10 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nh --, cn , h 2 n -- c ( nh )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 10 oc ( o ) nh --; b ) alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c --( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and ( c ) c 1 - c 6 alkyl unsubstituted or substituted by perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; r 12 is independently selected from hydrogen and c 1 - c 6 alkyl ; r 13 is independently selected from c 1 - c 6 alkyl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, -- nr 10 c ( o )--, o , -- n ( r 10 )--, -- s ( o ) 2 n ( r 10 )--, -- n ( r 10 ) s ( o ) 2 --, or s ( o ) m ; d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; in a third embodiment of this invention , the inhibitors of farnesyl transferase are illustrated by the formula iii : ## str7 ## wherein : b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o )-- nr 10 --; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , r 10 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nh --, cn , h 2 n -- c ( nh )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 10 oc ( o ) nh --; b ) alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c --( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; a 1 and a 2 are independently selected from : a bond , ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, -- nr 10 c ( o )--, o , -- n ( r 10 )--, -- s ( o ) 2 n ( r 10 )--, -- n ( r 10 ) s ( o ) 2 --, or s ( o ) m ; d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; in a fourth embodiment of this invention the prodrugs of compounds of formula iii are illustrated by the formula iv : ## str9 ## wherein : b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o )-- nr 10 --; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , r 10 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nh --, cn , h 2 n -- c ( nh )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 10 oc ( o ) nh --; b ) alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c --( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, -- nr 10 c ( o )--, o , -- n ( r 10 )--, -- s ( o ) 2 n ( r 10 )--, -- n ( r 10 ) s ( o ) 2 --, or s ( o ) m ; d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; in a more preferred embodiment of this invention , the ras farnesyl transferase inhibitors are illustrated by the formula ia : ## str11 ## wherein : r 1a is independently selected from : hydrogen or c 1 - c 6 alkyl ; b ) aryl , heterocycle , cycloalkyl , r 10 o --, -- n ( r 10 ) 2 or alkenyl , c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, or -- n ( r 10 ) 2 ; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , no 2 , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , r 11 oc ( o ) nr 10 -- and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocycle and c 3 - c 10 cycloalkyl ; b ) c 1 - c 6 alkyl , c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl , c 2 - c 6 perfluoroalkyl , r 10 o --, r 10 c ( o ) nr 10 --, ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; b ) c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, o , -- n ( r 10 )--, or s ( o ) m ; b ) heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl , d ) c 1 -- c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; w is a heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , or isoquinolinyl ; r is 0 to 5 , provided that r is 0 when v is hydrogen ; and in a second more preferred embodiment of this invention , the prodrugs of the preferred compounds of formula i are illustrated by the formula iia : ## str13 ## r 1a is independently selected from : hydrogen or c 1 - c 6 alkyl ; b ) aryl , heterocycle , cycloalkyl , r 10 o --, -- n ( r 10 ) 2 or alkenyl , c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, or -- n ( r 10 ) 2 ; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , no 2 , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , r 11 oc ( o ) nr 10 -- and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocycle and c 3 - c 10 cycloalkyl ; a ) substituted or unsubstituted c 1 - c 8 alkyl or substituted or unsubstituted c 5 - c 8 cycloalkyl , wherein the substituent on the alkyl is selected from : b ) c 1 - c 6 alkyl , c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl substituted by c 1 - c 6 perfluoroalkyl , r 10 o --, r 10 c ( o ) nr 10 --, ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; b ) c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; and c ) c 1 - c 6 alkyl unsubstituted or substituted by c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; r 12 is independently selected from hydrogen and c 1 - c 6 alkyl ; r 13 is independently selected from c 1 - c 6 alkyl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, o , -- n ( r 10 )--, or s ( o ) m ; b ) heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl , d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; w is a heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , or isoquinolinyl ; r is 0 to 5 , provided that r is 0 when v is hydrogen ; and in a third more preferred embodiment of this invention , the inhibitors of farnesyl transferase are illustrated by the formula iia : ## str16 ## wherein : r 1a is independently selected from : hydrogen or c 1 - c 6 alkyl ; b ) aryl , heterocycle , cycloalkyl , r 10 o --, -- n ( r 10 ) 2 or alkenyl , c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, or -- n ( r 10 ) 2 ; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m , r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 oc ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) c 1 - c 6 alkyl , c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 , and c ) c 1 - c 6 alkyl substituted by c 1 - c 6 perfluoroalkyl , r 10 o --, r 10 c ( o ) nr 10 --, ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; b ) c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, o , -- n ( r 10 )--, or s ( o ) m ; b ) heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl , d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; w is a heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , or isoquinolinyl ; r is 0 to 5 , provided that r is 0 when v is hydrogen ; and in a fourth more preferred embodiment of this invention , the prodrugs of the preferred compounds of formula iii are illustrated by the formula iva : ## str18 ## wherein : r 1a is independently selected from : hydrogen or c 1 - c 6 alkyl ; b ) aryl , heterocycle , cycloalkyl , r 10 o --, -- n ( r 10 ) 2 or alkenyl , c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, or -- n ( r 10 ) 2 ; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 )--, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) c 1 - c 6 alkyl , c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl substituted by c 1 - c 6 perfluoroalkyl , r 10 o --, r 10 c ( o ) nr 10 --, ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; b ) c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, o , -- n ( r 10 )--, or s ( o ) m ; b ) heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl , d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; w is a heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , or isoquinolinyl ; r is 0 to 5 , provided that r is 0 when v is hydrogen ; and n -( 1 ( s )- carboxy - 3 - methylthiopropyl )- 3 -[ n , n - bis -( 4 - nitrophenylmethyl ) aminomethyl ] benzamide ## str20 ## n -( 1 ( s )- carbomethoxy - 3 - methylthiopropyl )- 3 -[ n , n - bis -( 4 - nitrophenylmethyl ) aminomethyl ] benzamide ## str21 ## n -( 1 ( s )- carboxy - 3 - methylthiopropyl )- 3 -[ n , n - bis ( 4 - imidazolemethyl ) aminomethyl ] benzamide ## str22 ## n -( 1 ( s )- carbxomethoxy - 3 - methylthiopropyl )- 3 -[ n , n - bis ( 4 - imidazolemethyl ) aminomethyl ] benzamide ## str23 ## n -( 1 ( s )- carboxy - 3 - methylthiopropyl )- 3 -[ n -( 4 - imidazolylymethyl )- n -( 4 - nitrobenzyl ) aminomethyl ] benzamide ## str24 ## n -( 1 ( s )- carbomethoxy - 3 - methylthiopropyl )- 3 -[ n -( 4 - imidazolylymethyl )- n -( 4 - nitrobenzyl ) aminomethyl ] benzamide ## str25 ## or the pharmaceutically acceptable salts thereof . in the present invention , the amino acids which are disclosed are identified both by conventional 3 letter and single letter abbreviations as indicated below : ______________________________________alanine ala aarginine arg rasparagine asn naspartic acid asp dasparagine or asx baspartic acidcysteine cys cglutamine gln qglutamic acid glu eglutamine or glx zglutamic acidglycine gly ghistidine his hisoleucine ile ileucine leu llysine lys kmethionine met mphenylalanine phe fproline pro pserine ser sthreonine thr ttryptophan trp wtyrosine tyr yvaline val v______________________________________ the compounds of the present invention may have asymmetric centers and occur as racemates , racemic mixtures , and as individual diastereomers , with all possible isomers , including optical isomers , being included in the present invention . as used herein , &# 34 ; alkyl &# 34 ; is intended to include both branched and straight - chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms . as used herein , &# 34 ; cycloalkyl &# 34 ; is intended to include non - aromatic cyclic hydrocarbon groups having the specified number of carbon atoms . examples of cycloalkyl groups include cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl and the like . &# 34 ; alkenyl &# 34 ; groups include those groups having the specified number of carbon atoms and having one or several double bonds . examples of alkenyl groups include vinyl , allyl , isopropenyl , pentenyl , hexenyl , heptenyl , cyclopropenyl , cyclobutenyl , cyclopentenyl , cyclohexenyl , 1 - propenyl , 2 - butenyl , 2 - methyl - 2 - butenyl , isoprenyl , farnesyl , geranyl , geranylgeranyl and the like . as used herein , &# 34 ; aryl &# 34 ; is intended to include any stable monocyclic , bicyclic or tricyclic carbon ring ( s ) of up to 7 members in each ring , wherein at least one ring is aromatic . examples of aryl groups include phenyl , naphthyl , anthracenyl , biphenyl , tetrahydronaphthyl , indanyl , phenanthrenyl and the like . the term heterocycle or heterocyclic , as used herein , represents a stable 5 - to 7 - membered monocyclic or stable 8 - to 11 - membered bicyclic or stable 11 - 15 membered tricyclic heterocycle ring which is either saturated or unsaturated , and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of n , o , and s , and including any bicyclic group in which any of the above - defined heterocyclic rings is fused to a benzene ring . the heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure . examples of such heterocyclic elements include , but are not limited to , azepinyl , benzimidazolyl , benzisoxazolyl , benzofurazanyl , benzopyranyl , benzothiopyranyl , benzofuryl , benzothiazolyl , benzothienyl , benzoxazolyl , chromanyl , cinnolinyl , dihydrobenzofuryl , dihydrobenzothienyl , dihydrobenzothiopyranyl , dihydrobenzothio - pyranyl sulfone , furyl , imidazolidinyl , imidazolinyl , imidazolyl , indolinyl , indolyl , isochromanyl , isoindolinyl , isoquinolinyl , isothiazolidinyl , isothiazolyl , isothiazolidinyl , morpholinyl , naphthyridinyl , oxadiazolyl , 2 - oxoazepinyl , 2 - oxopiperazinyl , 2 - oxopiperidinyl , 2 - oxopyrrolidinyl , piperidyl , piperazinyl , pyridyl , pyridyl n - oxide , pyridonyl , pyrazinyl , pyrazolidinyl , pyrazolyl , pyrimidinyl , pyrrolidinyl , pyrrolyl , quinazolinyl , quinolinyl , quinolinyl n - oxide , quinoxalinyl , tetrahydrofuryl , tetrahydroisoquinolinyl , tetrahydro - quinolinyl , thiamorpholinyl , thiamorpholinyl sulfoxide , thiazolyl , thiazolinyl , thienofuryl , thienothienyl , and thienyl . as used herein , the terms &# 34 ; substituted aryl &# 34 ;, &# 34 ; substituted heterocycle &# 34 ; and &# 34 ; substituted cycloalkyl &# 34 ; are intended to include the cyclic group which is substituted with 1 or 2 substitutents selected from the group which includes but is not limited to f , cl , br , cf 3 , nh 2 , n ( c 1 - c 6 alkyl ) 2 , no 2 , cn , ( c 1 - c 6 alkyl ) o --, -- oh , ( c 1 - c 6 alkyl ) s ( o ) m --, ( c 1 - c 6 alkyl ) c ( o ) nh --, h 2 n -- c ( nh )--, ( c 1 - c 6 alkyl ) c ( o )--, ( c 1 - c 6 alkyl ) oc ( o )--, n 3 , ( c 1 - c 6 alkyl ) oc ( o ) nh -- and c 1 - c 20 alkyl . when r 3a and r 3b are combined to form --( ch 2 ) s --, cyclic moieties are formed . examples of such cyclic moieties include , but are not limited to : ## str26 ## in addition , such cyclic moieties may optionally include a heteroatom ( s ). examples of such heteroatom - containing cyclic moieties include , but are not limited to : ## str27 ## the pharmaceutically acceptable salts of the compounds of this invention include the conventional non - toxic salts of the compounds of this invention as formed , e . g ., from non - toxic inorganic or organic acids . for example , such conventional non - toxic salts include those derived from inorganic acids such as hydrochloric , hydrobromic , sulfuric , sulfamic , phosphoric , nitric and the like : and the salts prepared from organic acids such as acetic , propionic , succinic , glycolic , stearic , lactic , malic , tartaric , citric , ascorbic , pamoic , maleic , hydroxymaleic , phenylacetic , glutamic , benzoic , salicylic , sulfanilic , 2 - acetoxy - benzoic , fumaric , toluenesulfonic , methanesulfonic , ethane disulfonic , oxalic , isethionic , trifluoroacetic and the like . it is intended that the definition of any substituent or variable ( e . g ., r 10 , z , n , etc .) at a particular location in a molecule be independent of its definitions elsewhere in that molecule . thus , -- n ( r 10 ) 2 represents -- nhh , -- nhch 3 , -- nhc 2 h 5 , etc . it is understood that substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art as well as those methods set forth below . the pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods . generally , the salts are prepared by reacting the free base with stoichiometric amounts or with an excess of the desired salt - forming inorganic or organic acid in a suitable solvent or various combinations of solvents . the compounds of the invention can be synthesized from their constituent amino acids by conventional peptide synthesis techniques , and the additional methods described below . standard methods of peptide synthesis are disclosed , for example , in the following works : schroeder et al ., &# 34 ; the peptides &# 34 ;, vol . i , academic press 1965 , or bodanszky et al ., &# 34 ; peptide synthesis &# 34 ;, interscience publishers , 1966 , or mcomie ( ed .) &# 34 ; protective groups in organic chemistry &# 34 ;, plenum press , 1973 , or barany et al ., &# 34 ; the peptides : analysis , synthesis , biology &# 34 ; 2 , chapter 1 , academic press , 1980 , or stewart et al ., &# 34 ; solid phase peptide synthesis &# 34 ;, second edition , pierce chemical company , 1984 . the teachings of these works are hereby incorporated by reference . abbreviations used in the description of the chemistry and in the examples that follow are : ______________________________________ac . sub . 2 o acetic anhydride ; boc t - butoxycarbonyl ; dbu 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ; dmap 4 - dimethylaminopyridine ; dme 1 , 2 - dimethoxyethane ; dmf dimethylfoffnamide ; edc 1 -( 3 - dimethylaminopropyl )- 3 - ethyl - carbodiimide - hydrochloride ; hobt 1 - hydroxybenzotriazole hydrate ; et . sub . 3 n triethylamine ; etoac ethyl acetate ; fab fast atom bombardment ; hoobt 3 - hydroxy - 1 , 2 , 2 - benzotriazin - 4 ( 3h )- one ; hplc high - performance liquid chromatography ; mcpba m - chloroperoxybenzoic acid ; mscl methanesulfonyl chloride ; nahmds sodium bis ( trimethylsilyl ) amide ; py pyridine ; tfa trifluoroacetic acid ; thf tetrahydrofuran . ______________________________________ compounds of this invention are prepared by employing the reactions shown in the following reaction schemes a - j , in addition to other standard manipulations such as ester hydrolysis , cleavage of protecting groups , etc ., as may be known in the literature or exemplified in the experimental procedures . some key bond - forming and peptide modifying reactions are : ______________________________________reaction a amide bond formation and subsequenmt generation of the amino methyl moiety using standard solution or solid phase methodologies . reaction b preparation of a reduced peptide subunit by reductive alkylation of an amine by an aldehyde using sodium cyanoborohydride or other reducing agents . reaction c alkylation of the amino moiety of the central phenyl ring . reaction d peptide bond formation and protecting group cleavage using standard solution or solid phase methodologies . ______________________________________ these reactions may be employed in a linear sequence to provide the compounds of the invention or they may be used to synthesize fragments which are subsequently joined by the alkylation reactions described in the reaction schemes . ## str28 ## where x l is a leaving group , e . g ., br -, i - or mso -;. reaction schemes e - m illustrate reactions wherein the non - sulfhydryl - containing moiety at the n - terminus of the compounds of the instant invention is attached to an aminomethylbenzamide subunit which may be further elaborated to provide the instant compounds . these reactions may be employed in a linear sequence to provide the compounds of the invention or they may be used to synthesize fragments which are subsequently joined by the reactions described in reaction schemes a - d . the intermediates whose synthesis are illustrated in reaction schemes a - d can be reductively alkylated with a variety of aldehydes , such as i , as shown in reaction scheme e . the aldehydes can be prepared by standard procedures , such as that described by o . p . goel , u . krolls , m . stier and s . kesten in organic syntheses , 1988 , 67 , 69 - 75 , from the appropriate amino acid ( reaction scheme e ). the reductive alkylation can be accomplished at ph 5 - 7 with a variety of reducing agents , such as sodium triacetoxyborohydride or sodium cyanoborohydride in a solvent such as dichloroethane , methanol or dimethylformamide . the product ii can be deprotected to give the final compounds iii with trifluoroacetic acid in methylene chloride . the final product iii is isolated in the salt form , for example , as a trifluoroacetate , hydrochloride or acetate salt , among others . the product diamine iii can further be selectively protected to obtain iv , which can subsequently be reductively alkylated with a second aldehyde to obtain v . removal of the protecting group , and conversion to cyclized products such as the dihydroimidazole vii can be accomplished by literature procedures . alternatively , the aminomethylbenzamide subunit can be reductively alkylated with other aldehydes such as 1 - trityl - 4 - carboxaldehyde or 1 - trityl - 4 - imidazolylacetaldehyde , to give products such as viii ( reaction scheme f ). the trityl protecting group can be removed from viii to give ix , or alternatively , viii can first be treated with an alkyl halide then subsequently deprotected to give the alkylated imidazole x . alternatively , the aminomethylbenzamide subunit can be acylated or sulfonylated by standard techniques . the imidazole acetic acid xi can be converted to the acetate xiii by standard procedures , and xiii can be first reacted with an alkyl halide , then treated with refluxing methanol to provide the regiospecifically alkylated imidazole acetic acid ester xiv . hydrolysis and reaction with the aminomethylbenzamide subunit in the presence of condensing reagents such as 1 -( 3 - dimethylaminopropyl )- 3 - ethylcarbodiimide ( edc ) leads to acylated products such as xv . if the aminomethylbenzamide subunit is reductively alkylated with an aldehyde which also has a protected hydroxyl group , such as xvi in reaction scheme h , the protecting groups can be subsequently removed to unmask the hydroxyl group ( reaction schemes h , i ). the alcohol can be oxidized under standard conditions to e . g . an aldehyde , which can then be reacted with a variety of organometallic reagents such as grignard reagents , to obtain secondary alcohols such as xx . in addition , the fully deprotected amino alcohol xxi can be reductively alkylated ( under conditions described previously ) with a variety of aldehydes to obtain secondary amines , such as xxii ( reaction scheme j ), or tertiary amines . the boc protected amino alcohol xviii can also be utilized to synthesize 2 - aziridinylmethylpiperazines such as xxiii ( reaction scheme k ). treating xviii with 1 , 1 &# 39 ;- sulfonyldiimidazole and sodium hydride in a solvent such as dimethylformamide led to the formation of aziridine xxiii . the aziridine reacted in the presence of a nucleophile , such as a thiol , in the presence of base to yield the ring - opened product xxiv . in addition , the aminomethylbenzoate subunit can be reacted with aldehydes derived from amino acids such as o - alkylated tyrosines , according to standard procedures , to obtain compounds such as xxx , as shown in reaction scheme l . when r &# 39 ; is an aryl group , xxx can first be hydrogenated to unmask the phenol , and the amine group deprotected with acid to produce xxxi . alternatively , the amine protecting group in xxx can be removed , and o - alkylated phenolic amines such as xxxii produced . reaction scheme m illustrates a one pot synthesis of an instant compound wherein the n - terminus nitrogen is substituted with two different non - sulfhydryl - containing moieties . thus , the aminomethylbenzamide subunit is treated with one equivalent of an appropriate aldehyde and , after the reductive adduct has been formed , the in situ intermediate is treated with an equivalent of a different aldehyde . similar procedures as are illustrated in reaction schemes e - m may be employed using other intermediates such as those whose synthesis is illustrated in reaction schemes b - d . ## str29 ## the -- nr 4 r 5 moiety of the compounds of the instant invention may provide advantages over a cysteinyl moiety that is incorporated in other types of molecules that are known to be inhibitors of farnesyl protein transferase . in particular , modification of the benzodiazepine compounds described in published pct application wo 26723 with the such -- nr 4 r 5 substituents as described herein will provide inhibitors of farnesyl protein transferase of the following formulae a and b : ## str30 ## wherein the substituents r , r &# 39 ; and r 25 are as defined in wo 94 / 26723 , r 4benz , r 4 &# 39 ; benz , r 7benz and w benz are r 4 , r 4 &# 39 ;, r 7 and w respectively as defined in wo 94 / 26723 and r a and r b are defined as r 4 and r 5 are defined herein respectively . preferably , the following combinations of r a and r b are selected for incorporation into the compounds of formulae a and b : most preferably , the benzodiazepine compound would be selected from the following formulae : ## str31 ## wherein r and r &# 39 ; are as defined in wo 94 / 26723 and w &# 39 ; benz is w &# 39 ; as defined in wo 94 / 26723 and r a and r b are defined as r 4 and r 5 are defined herein respectively . such benzodiazepine analogs may be synthesized by techniques well known in the art , as well as procedures outlined in wo 26723 . general methods of synthesis of the benzediazapine analogs of this invention are shown in schemes n , p and q . typically a convergent route is employed , which joins the key intermediate 9 ( scheme n ) with suitably functionalized amine and r a and r b components ( schemes p and q ) using standard amide bond - forming procedures . as shown in scheme n , the protected amino acid 9 may be prepared from a suitably substituted 2 - aminobenzophenone ( 1 ). many 2 - aminobenzophenones are known in the art or are available form commercial sources such as aldrich chemical co . general methods for the synthesis of new 2 - aminobenzophenones may be found in the literature ( c . f . walsh , d . a . synthesis , 677 - 688 ( 1980 ). acylation of 1 with a haloacetyl halide , such as bromoacetyl bromide in a suitable solvent mixture , such as water / ch 2 cl 2 , typically at temperatures ranging from 0 ° c . to 24 ° c ., produces amide 2 . reaction of 2 with ammonia in a polar solvent such as methanol at 25 ° to 75 ° c . then gives the 1 , 4 - benzodiazepin - 2 - one 3 , after evaporation of the solvent . alkylation of 3 with a substituted organic ester ( 4 ), preferably tert - butyl bromacetate , in the presence of a base , preferably cs 2 co 3 in 1 - methyl - 2 - pyrrolidinone at ambient temperature , gives 5 . alternatively , 3 may be alkylated at n - 1 with a variety of other alkylating agents , for instance , esters of substituted or unsubstituted acrylates , 4 - bromobutanoates , etc . branched compounds ( i . e . r 4benz and / or r 4 &# 39 ; benz ≠ h ), may be prepared by generation of the polyanion of 5 with base and alkylation with an appropriate alkyl halide . subsequent to alkylation , the ester of 5 may be cleaved with an acid such as tfa ( for the tert - butyl esters ) or under mild aqueous base hydrolysis ( for other alkyl esters ) at temperatures between 0 ° and 25 ° c . the acid 6 is converted to amino acid 8 via reaction of the dianion , generated with at least two equivalents of a strong base with an electrophilic aminating agent . alternatively , 6 may be halogenated and reacted with an amine source such as azide ( followed by reduction ) or ammonia . preferably , 6 is reacted with 4 equivalents of potassium tert - butoxide in glyme at - 5 ° c . for 30 min and treated with 1 . 1 equivalents of isobutyl nitrite . the resulting oxime 7 can then be reduced to the racemic amino acid 8 using a variety of reductants , preferably hydrogenation at 40 psig in the presence of ruthenium on carbon or raney nickel in methanol at 50 ° to 70 ° c . for 1 - 4 days . amino acid 8 is then suitably protected for selective coupling at the carboxyl terminus . for example , 8 can be converted to the n - boc derivative 9 using standard amino acid protection conditions , preferably , reaction with equimolar amounts of di - tert - butyl dicarbonate and triethyl amine in dmf / water at ambient temperature . for compounds where r a ≠ h , 9 can be alkylated at nitrogen with a wide variety of alkylating agents including n - alkyl , branched alkyl , and benzyl , according to the standard procedure of benoiton , et al ., can . j . chem . 1977 , 55 , 906 . for example , reaction of 9 with at least 2 equivalents of base and an alkylating agent in a polar , aprotic solvent at 0 ° to 50 ° c . for 0 . 5 to 48 h give 10 . also , the reactions shown in schemes e - m may be utilized with the compound 9 . ## str32 ## compounds 9 and 10 can be further elaborated according to schemes p . in general , the carboxylic acid function of 9 and 10 is reacted with a suitably protected amine component using standard solid phase ( scheme p ) or solution phase peptide synthesis procedures . the boc or other protecting group of n - 3 of the benzodiazepinone is removed and the amine function then coupled with a third component , for example , a suitably protected amino acid , and then deprotected , again employing standard procedures . the resulting product is subsequently purified by chromatography or crystallization . ## str33 ## alternatively , 3 may be directly alkylated with the &# 34 ; top &# 34 ; sidechain in one intact piece , as shown in scheme q . reaction of 3 with an alkyl halide such as a suitably substituted benzyl bromide , alkyl bromide , in the presence of a base , preferably nah or cs 2 co 3 , gives 11 , which may be processed according to the reactions illustrated in scheme i to provide the desired fptase inhibitors . ## str34 ## wherein p . g . is a suitably selected protecting group which is utilized if necessary . the compounds of this invention inhibit ras farnesyl transferase which catalyzes the first step in the post - translational processing of ras and the biosynthesis of functional ras protein . these compounds are useful as pharmaceutical agents for mammals , especially for humans . these compounds may be administered to patients for use in the treatment of cancer . examples of the type of cancer which may be treated with the compounds of this invention include , but are not limited to , colorectal carcinoma , exocrine pancreatic carcinoma , and myeloid leukemias . the compounds of this invention may be administered to mammals , preferably humans , either alone or , preferably , in combination with pharmaceutically acceptable carriers or diluents , optionally with known adjuvants , such as alum , in a pharmaceutical composition , according to standard pharmaceutical practice . the compounds can be administered orally or parenterally , including the intravenous , intramuscular , intraperitoneal , subcutaneous , rectal and topical routes of administration . for oral use of a chemotherapeutic compound according to this invention , the selected compound may be administered , for example , in the form of tablets or capsules , or as an aqueous solution or suspension . in the case of tablets for oral use , carriers which are commonly used include lactose and corn starch , and lubricating agents , such as magnesium stearate , are commonly added . for oral administration in capsule form , useful diluents include lactose and dried corn starch . when aqueous suspensions are required for oral use , the active ingredient is combined with emulsifying and suspending agents . if desired , certain sweetening and / or flavoring agents may be added . for intramuscular , intraperitoneal , subcutaneous and intravenous use , sterile solutions of the active ingredient are usually prepared , and the ph of the solutions should be suitably adjusted and buffered . for intravenous use , the total concentration of solutes should be controlled in order to render the preparation isotonic . the present invention also encompasses a pharmaceutical composition useful in the treatment of cancer , comprising the administration of a therapeutically effective amount of the compounds of this invention , with or without pharmaceutically acceptable carriers or diluents . suitable compositions of this invention include aqueous solutions comprising compounds of this invention and pharmacologically acceptable carriers , e . g ., saline , at a ph level , e . g ., 7 . 4 . the solutions may be introduced into a patient &# 39 ; s intramuscular blood - stream by local bolus injection . when a compound according to this invention is administered into a human subject , the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age , weight , and response of the individual patient , as well as the severity of the patient &# 39 ; s symptoms . in one exemplary application , a suitable amount of compound is administered to a mammal undergoing treatment for cancer . administration occurs in an amount between about 0 . 1 mg / kg of body weight to about 20 mg / kg of body weight per day , preferably of between 0 . 5 mg / kg of body weight to about 10 mg / kg of body weight per day . the compounds of the instant invention are also useful as a component in an assay to rapidly determine the presence and quantity of farnesyl - protein transferase ( fptase ) in a composition . thus the composition to be tested may be divided and the two portions contacted with mixtures which comprise a known substrate of fptase ( for example a tetrapeptide having a cysteine at the amine terminus ) and farnesyl pyrophosphate and , in one of the mixtures , a compound of the instant invention . after the assay mixtures are incubated for an sufficient period of time , well known in the art , to allow the fptase to farnesylate the substrate , the chemical content of the assay mixtures may be determined by well known immunological , radiochemical or chromatographic techniques . because the compounds of the instant invention are selective inhibitors of fptase , absence or quantitative reduction of the amount of substrate in the assay mixture without the compound of the instant invention relative to the presence of the unchanged substrate in the assay containing the instant compound is indicative of the presence of fptase in the composition to be tested . it would be readily apparent to one of ordinary skill in the art that such an assay as described above would be useful in identifying tissue samples which contain farnesyl - protein transferase and quantitating the enzyme . thus , potent inhibitor compounds of the instant invention may be used in an active site titration assay to determine the quantity of enzyme in the sample . a series of samples composed of aliquots of a tissue extract containing an unknown amount of farnesyl - protein transferase , an excess amount of a known substrate of fptase ( for example a tetrapeptide having a cysteine at the amine terminus ) and farnesyl pyrophosphate are incubated for an appropriate period of time in the presence of varying concentrations of a compound of the instant invention . the concentration of a sufficiently potent inhibitor ( i . e ., one that has a ki substantially smaller than the concentration of enzyme in the assay vessel ) required to inhibit the enzymatic activity of the sample by 50 % is approximately equal to half of the concentration of the enzyme in that particular sample . examples provided are intended to assist in a further understanding of the invention . particular materials employed , species and conditions are intended to be further illustrative of the invention and not limitative of the reasonable scope thereof . the standard workup referred to in the examples refers to solvent extraction and washing the organic solution with 10 % citric acid , 10 % sodium bicarbonate and brine as appropriate . solutions were dried over sodium sulfate and evaporated in vacuo on a rotary evaporator . to a solution of ( s ) methionine methyl ester hydrochloride ( 10 . 56 g , 52 . 9 mmol ) and 4 - n - methylmorpholine ( 21 . 34 g , 211 . 6 mmol ) under nitrogen in 200 ml of methylene chloride at o ° c . was added 3 - chloro - methyl benzoyl chloride ( 10 . 00 g , 52 . 9 mmol ) dropwise via syringe . after addition the cooling bath was removed and the resulting solution was stirred for 16 h at 20 ° c . the methylene chloride solution was extracted with 125 ml each of water , 2 % potassium hydrogen sulfate , saturated sodium hydrogen carbonate , and saturated sodium chloride . the methylene chloride was dried over magnesium sulfate and concentrated in vacuo to the title compound as an oil . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 85 ( 1h , s ), 7 . 76 ( 1h , d , j = 8 hz ), 7 . 56 ( 1h , d , j = 8 hz ), 7 . 45 ( 1h , t , j = 8 hz ), 6 . 96 ( 1h , d , j = 7 hz ), 4 . 94 ( 1h , q , j = 5 hz ), 4 . 62 ( 2h , s ), 3 . 81 ( 3h , s ), 2 . 60 ( 2h , t , j = 8 hz ), 2 . 30 ( 1h , m ), 2 . 15 ( 1h , m ), 2 . 12 ( 3h , s ). to a stirred solution of the product from step a ( 13 . 52 g , 42 . 80 mmol ) in 50 ml of dimethylsulfoxide under nitrogen was added lithium azide ( 2 . 3 g , 47 . 10 mmol ). the solution was stirred for 2 h . the reaction mixture was then partitioned with 300 ml of ethyl acetate and 200 ml of water . the ethyl acetate layer was washed with 125 ml of saturated sodium chloride , dried over magnesium sulfate and concentrated in vacuo to afford the title compound as an oil . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 75 ( 2h , m ), 7 . 47 ( 2h , m ), 7 . 02 ( 1h , d , j = 8 hz ), 4 . 94 ( 1h , q , j = 5 hz ), 4 . 41 ( 2h , s ), 3 . 80 ( 3h , s ), 2 . 60 ( 2h , t , j = 6 hz ), 2 . 30 ( 1h , m ), 2 . 15 ( 1h , m ), 2 . 11 ( 3h , s ). to a solution of the product from step b ( 11 . 8 g , 35 . 08 mmol ) in 150 ml of methanol under nitrogen was added 1 . 5 g 10 % palladium on carbon . hydrogen was applied to the mixture at 1 atmosphere for 1 . 5 h . the reaction mixture was filtered and concentrated in vacuo to obtain 10 . 3 g ( 34 . 76 mmol ) of crude product as an oil . the crude product was chromatographed on 500 g of silica gel with chloroform / methanol 95 / 5 as eluant to afford the title compound as an oil . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 78 ( 1h , s ), 7 . 68 ( 1h , d , j = 7 hz ), 7 . 47 ( 1h , d , j = 7 hz ), 7 . 40 ( 1h , t , j = 8 hz ), 7 . 02 ( 1h , d , j = 7 hz ), 4 . 93 ( 1h , q , j = 5 hz ), 3 . 92 ( 2h , s ), 3 . 79 ( 3h , s ), 2 . 59 ( 2h , t , j = 8 hz ), 2 . 24 ( 1h , m ), 2 . 12 ( 1h , m ), 2 . 10 ( 3h , s ), 1 . 85 ( 2h , s ). to a solution of the product from step c ( 0 . 228 g , 0 . 767 mmol ) in 10 ml of 1 , 2 - dichloroethane was added glacial acetic acid dropwise until a ph 5 . 5 was achieved . to this mixture at 20 ° c . was added 0 . 5 g of crushed 4 å molecular sieves , sodium triacetoxyborohydride ( 0 . 487 g , 2 . 30 mmol ), and 1 -( triphenylmethyl )- 4 - imidazole carboxaldehyde ( 0 . 130 g , 0 . 384 mmol ). the resulting solution was stirred for 12 - 72 h . the reaction mixture was filtered through celite and partitioned with 125 ml of water and 150 ml of ethyl acetate . the ethyl acetate layer was washed with 125 ml each of saturated sodium hydrogen carbonate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield 0 . 363 g of crude product . the crude product was chromatographed on silica gel eluting with chloroform / methanol 95 / 5 to afford the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 83 ( 1h , s ), 7 . 71 ( 1h , d , j = 7 hz ), 7 . 40 ( 4h , m ), 7 . 32 ( 8h , m ), 7 . 25 ( 1h , s ), 7 . 12 ( 7h , m ), 6 . 71 ( 1h , s ), 4 . 93 ( 1h , q , j = 5 hz ), 3 . 85 ( 2h , s ), 3 . 77 ( 3h , s ), 3 . 71 ( 2h , s ), 2 . 58 ( 2h , t , j = 8 hz ), 2 . 25 ( 1h , m ), 2 . 10 ( 1h , m ), 2 . 09 ( 3h , s ). to a solution of the product from step d ( 0 . 220 g , 0 . 356 mmol ) in 10 ml of methylene chloride was added triethylsilane ( 0 . 165 g , 1 . 42 mmol ) and 5 ml of trifluoroacetic acid . the solution was stirred for 45 min , evaporated in vacuo , and partitioned with hexane and 0 . 1 % trifluoroacetic acid in water : methanol 2 : 1 . the 0 . 1 % trifluoroacetic acid / water - methanol solution was injected directly onto a delta - pak ( c - 18 , 100 å , 15 mm , 40 mm × 100 mm ) prep hplc column 40 ml / min . was 100 % 0 . 1 % tfa / water for 5 min . followed by 95 % 0 . 1 % tfa / water : 5 % 0 . 1 % tfa / acetonitrile to 70 % 0 . 1 % tfa / water : 30 .% 0 . 1 % tfa / acetonitrile over a period of 40 min . the pure fractions were pooled , evaporated in vacuo to near dryness , and then taken up in 5 ml of water . this water solution was passed through a 1 . 2 gm . column of bio - rad ag 3 - x 4 chloride anion exchange resin . the resulting aqueous column eluant was lyophillized overnight to yield the title compound as a solid . 1 hnmr ( 300 mhz , cd 3 od ) δ9 . 04 ( 1h , s ), 8 . 06 ( 1h , s ), 7 . 96 ( 1h , d , j = 8 hz ), 7 . 83 ( 1h , s ), 7 . 76 ( 1h , d , j = 8 hz ), 7 . 63 ( 1h , t , j = 8 hz ), 4 . 81 ( 1h , q , j = 5 hz ), 4 . 52 ( 2h , s ), 4 . 42 ( 2h , s ), 3 . 77 ( 3h , s ), 2 . 63 ( 2h , m ), 2 . 22 ( 1h , m ), 2 . 16 ( 1h , m ), 2 . 13 ( 3h , s ). fab mass spectrum m / e 377 ( m + 1 ). analysis calculated for c 18 h 24 n 4 o 3 s . 3 . 3 hcl : c , 43 . 57 ; h , 5 . 55 ; n , 11 . 29 . found : c , 43 . 56 ; h , 5 . 54 ; n , 11 . 82 . the product from step e ( 0 . 030 g , 0 . 067mmol ) was dissolved in 5 ml of methanol and 3 ml of 5 % sodium hydroxide and stirred for 1 h under nitrogen . the reaction mixture was injected directly onto a preparative reverse phase hplc column with conditions identical as in the preparation of the compound in step e . pure fractions were pooled , evaporated in vacuo , and the sample was converted to the hydrochloride salt as before . lyophillization overnight afforded 0 . 022 g ( 0 . 051 mmol ) of the title compound as a solid . 1 hnmr ( 300 mhz , cd 3 od ) δ9 . 06 ( 1h , s ), 8 . 06 ( 1h , s ), 7 . 96 ( 1h , d , j = 8 hz ), 7 . 83 ( 1h , s ), 7 . 76 ( 1h , d , j = 8 hz ), 7 . 61 ( 1h , t , j = 8 hz ), 4 . 78 ( 1h , q , j = 5 hz ), 4 . 53 ( 2h , s ), 4 . 47 ( 2h , s ), 2 . 63 ( 2h , m ), 2 . 25 ( 1h , m ), 2 . 15 ( 1h , m ), 2 . 13 ( 3h , s ). fab mass spectrum m / e 363 ( m + 1 ). analysis calculated for c 17 h 22 n 4 o 3 s . 3 . 3 hcl . 0 . 5 h 2 o : c , 41 . 57 ; h , 5 . 40 ; n , 11 . 41 . found : c , 41 . 54 ; h , 5 . 42 ; n , 11 . 05 . to a solution of the product from example 1 , step c ( 0 . 100 g , 0 . 357 mmol ) in 10 ml of 1 , 2 - dichloroethane was added glacial acetic acid dropwise until the ph was 5 . 5 . to this mixture at 20 ° c . was added 0 . 5 g of crashed 4 å sieves , sodium triacetoxyborohydride ( 0 . 226 g , 2 . 30 mmol ), and 1 -( triphenylmethyl )- 4 - imidazole carboxaldehyde ( 0 . 130 g , 1 . 07 mmol ). the resulting solution was stirred for 12 - 72 h . the reaction mixture was filtered through celite and partitioned with 125 ml of water and 150 ml of ethyl acetate . the ethyl acetate layer was washed with 125 ml each of saturated sodium hydrogen carbonate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the title compound . to a solution of the product from step a ( 0 . 320 g , 0 . 341 mmol ) in 10 ml of methylene chloride was added triethylsilane ( 0 . 159 g , 1 . 36 mmol ) and 5 ml of trifluoroacetic acid . the solution was stirred for 45 min , evaporated , and partitioned between hexane and 0 . 1 % tfa in water - methanol 2 : 1 . the 0 . 1 % tfa / water : methanol solution was injected directly onto a delta - pak ( c - 18 , 100 å , 15 mm , 40 mm × 100 mm ) preparative hplc column . the gradient at 40 ml / min was 100 % 0 . 1 % tfa / water for 5 min followed by 95 % 0 . 1 % tfa / water to 60 % 0 . 1 % tfa / water : 40 % 0 . 1 % tfa / acetonitrile over 40 min . the pure fractions were pooled , evaporated to near dryness , and then taken up in 5 ml of water . the aqueous solution was passed through a 1 . 2 gm . column of bio - rad ag 3 - x4 chloride anion exchange resin . the resulting aqueous column eluant was lyophillized overnight to yield the title compound as a solid . 1 hnmr ( 300 mhz , cd 3 od ) δ8 . 92 ( 2h , s ), 7 . 94 ( 1h , s ), 7 . 78 ( 1h , d , j = 8 hz ), 7 . 62 ( 2h , s ), 7 . 58 ( 1h , d , j = 8 hz ), 7 . 44 ( 1h , t , j = 8 hz ), 4 . 81 ( 1h , q , j = 5 hz ), 4 . 06 ( 4h , s ), 3 . 93 ( 2h , s ), 3 . 77 ( 3h , s ), 2 . 63 ( 2h , m ), 2 . 22 ( 1h , m ), 2 . 16 ( 1h , m ), 2 . 13 ( 3h , s ). fab mass spectrum m / e 457 ( m + 1 ). analysis calculated for c 22 h 28 n 6 o 3 s . 4 . 8 hcl . 0 . 2 h 2 o : c , 41 . 66 ; h , 5 . 28 ; n , 13 . 25 . found : c , 41 . 62 ; h , 5 . 27 ; n , 13 . 02 the compound from step b ( 0 . 035 g , 0 . 052 mmol ) was dissolved in 5 ml of methanol and 3 ml of 5 % sodium hydroxide and stirred for 1 hr under nitrogen . the reaction mixture was injected directly onto a preparative hplc column with conditions identical as in step b . pure fractions were pooled , evaporated , and the sample converted to the hydrochloride salt as before . lyophilization overnight afforded the title compound as a solid . 1 hnmr ( 300 mhz , cd 3 od ) δ8 . 88 ( 2h , s ), 7 . 87 ( 1h , s ), 7 . 75 ( 1h , d , j = 8 hz ), 7 . 55 ( 1h , s ), 7 . 50 ( 1h , d , j = 8 hz ), 7 . 42 ( 1h , t , j = 8 hz ), 4 . 78 ( 1h , q , j = 5 hz ), 3 . 88 ( 4h , s ), 3 . 77 ( 2h , s ), 2 . 63 ( 2h , m ), 2 . 25 ( 1h , m ), 2 . 15 ( 1h , m ), 2 . 13 ( 3h , s ). fab mass spectrum m / e 443 ( m + 1 ). analysis calculated for c 21 h 26 n 6 o 0 s . 5 . 4 hcl . 1 . 5 h 2 o : c , 37 . 91 ; h , 5 . 21 ; n , 12 . 63 . found : c , 37 . 97 ; h , 5 . 22 ; n , 12 . 37 . to a solution of triethylamine ( 11 . 0 ml ) in methanol ( 150 ml ) at 0 ° c . was added 3 - chloromethylbenzoyl chloride ( 5 . 0 g ) dropwise . after stirring at 20 ° c . for 0 . 5 h the solution was concentrated in vacuo . the residue was partitioned with 125 ml of water and 150 ml of ethyl acetate . the ethyl acetate layer was washed with 125 ml each of saturated sodium hydrogen carbonate , 2 % potassium hydrogen sulfate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ8 . 07 ( 1h , s ), 7 . 99 ( 1h , d , j = 8 hz ), 7 . 59 ( 1h , d , j = 8 hz ), 7 . 43 ( 1h , t , j = 8 hz ), 4 . 62 ( 2h , s ), 3 . 92 ( 3h , s ). starting with the product from step a the method used in step b of example 1 was used to prepare the title compound . starting with the product from step b the method used in step c of example 1 was used to prepare the title compound . to a solution of the product from step c ( 1 . 14 g ) in methylene chloride ( 50 ml ) was added triethylamine ( 2 . 90 ml ) and di - tert - butyl dicarbonate ( 1 . 67 g ) and the mixture was stirred 16 h . the solution was partitioned with water and methylene chloride . the methylene chloride layer was washed with saturated sodium hydrogen carbonate , 2 % potassium hydrogen sulfate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield 1 . 71 g of the crude product . chromotography on silica gel with hexane / ethyl acetate 9 / 1 yielded the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 95 ( 1h , s ), 7 . 93 ( 1h , d , j = 8 hz ), 7 . 49 ( 1h , d , j = 8 hz ), 7 . 41 ( 1h , t , j = 8 hz ), 4 . 90 ( 1h , b ), 4 . 37 ( 2h , d , j = 6 hz ), 3 . 92 ( 3h , s ), 1 . 45 ( 9h , s ). to a solution of the product from step e ( 1 . 42 g ) in dimethylformamide ( 30 ml ) at 0 ° c . was added sodium hydride ( 0 . 43 g , 60 % dispersion in minerol oil ). after stirring for 0 . 5 h methyl iodide ( 0 . 40 ml ) was added and the mixture was stirred 16 h at 20 ° c . the solution was concentrated in vacuo and the residue was partitioned between ethyl acetate and water . the ethyl acetate layer was washed with saturated sodium hydrogen carbonate , 2 % potassium hydrogen sulfate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the crude product . chromotography on silica gel with hexane / ethyl acetate 9 / 1 yielded 0 . 35 g of the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 93 ( 2h , m ), 7 . 42 ( 2h , m ), 4 . 45 ( 2h , s ), 3 . 92 ( 3h , s ), 2 . 83 ( 3h , d ), 1 . 47 ( 9h , s ). to a solution of the product from step e ( 0 . 35 g ) in methanol was added 5 % sodium hydroxide . after stirring for 2 h the methanol was evaporated and the aqueous layer was adjusted to ph 3 with 2 % potassium hydrogen sulfate . the aqueous layer was extracted with ethyl acetate several times . the ethyl acetate layer was washed with saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the title compound . to a solution of the product from step f ( 0 . 27 g ) in dimethylformamide ( 10 ml ) was added hydroxybenzotriazole ( 0 . 16 g ), edc ( 0 . 19 g ), n - methylmorpholine ( 0 . 40 ml ), and ( s ) methione methyl ester hydrochloride ( 0 . 203 mg ). after stirring for 2 h the solution was concentrated in vacuo and the residue was partitioned with water and ethyl acetate . the ethyl acetate layer was washed with saturated sodium hydrogen carbonate , 2 % potassium hydrogen sulfate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 70 ( 2h , s ), 7 . 40 ( 2h , m ), 6 . 95 ( 1h , d , j = 7 hz ), 4 . 94 ( 1h , q , j = 7 hz ), 4 . 45 ( 2h , s ), 3 . 81 ( 3h , s ), 2 . 82 ( 3h , d ), 2 . 59 ( 2h , m ), 2 . 30 ( 1h , m ), 2 . 13 ( 1h , m ), 2 . 12 ( 3h , s ), 1 . 46 ( 9h , s ). to a solution of the product from step g in methylene chloride was added trifluoroacetic acid ( 33 % by volume ). after stirring for 1 h the solution was concentrated in vacuo to yield the title compound . starting with the product from step h ( 0 . 18 g ) the method described in step d of example 1 was used to prepare the title compound . starting with the compound from step i ( 0 . 24 g ) the method described in step e of example 1 was used to prepare the title compound . fab mas spectrum m / e 391 ( m + 1 ). analysis for c 19 h 26 n 4 o 3 s . 5 . 0 hcl . 0 . 5 h 2 o : starting with the compound from step j ( 0 . 035 g ) the method described in step f of example 1 was used to prepare the above title compound . fab mas spectrum m / e 377 ( m + 1 ). analysis for c 18 h 24 n 4 o 3 s . 3 . 70 hcl . 0 . 2 h 2 o : starting with 4 - aminobenzoic acid ( 2 . 00 g ) dissolved in tetrahydrofuran ( 50 ml ) and 5 % sodium hydroxide ( 15 ml ) the method described in step d of example 3 was used to prepare the title compound . after extractive work up obtained the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ8 . 04 ( 2h , d , j = 9 hz ), 7 . 46 ( 2h , d , j = 9 hz ), 6 . 75 ( 1h , s ), 1 . 46 ( 9h , s ). to a solution of the product from step a ( 0 . 5 g ) in dimethylformamide ( 20 ml ) was added hydroxybenzotriazole ( 0 . 37 g ), edc ( 0 . 51 g ), n - methylmorpholine 0 . 8 ml ), and ( s ) methione methyl ester hydrochloride ( 0 . 49 g ). after stirring for 16 h the solution was concentrated in vacuo and the residue was partitioned with water and ethyl acetate . the ethyl acetate layer was washed with saturated sodium hydrogen carbonate , 2 % potassium hydrogen sulfate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the title compound . to a solution of the product from step b in methylene chloride was added trifluoroacetic acid ( 33 % by volume ). after stirring for 1 h the solution was concentrated in vacuo to yield the trifluoroacetate salt of the product ( 0 . 59 g ). this product was partioned between ethyl acetate and saturated sodium bicarbonate . the ethyl acetate layer was washed with saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 64 ( 2h , d , j = 8 hz ), 6 . 75 ( 1h , d , j = 8 hz ), 6 . 65 ( 2h , d , j = 8 hz ), 4 . 90 ( 1h , q , j = 5 hz ), 3 . 78 ( 3h , s ), 2 . 57 ( 2h , m ), 2 . 27 ( 1h , m ), 2 . 08 ( 4h , m ). starting with the product from step c ( 0 . 07 g ) the method described in step d of example 1 was used to prepare the title compound . starting with the product from step d ( 0 . 24 g ) the method described in step e of example 1 was used to prepare the title compound . fab mas spectrum m / e 363 ( m + 1 ). analysis for c 17 h 22 n 4 o 3 s . 2 . 8 hcl : starting with ( 5 ) ( 0 . 035 g ) the method described in step f of example 1 was used to prepare the title compound . fab mas spectrum m / e 349 ( m + 1 ). analysis for c 16 h 20 n 4 o 3 s . 3 . 10 hcl . 1 . 2 h 2 o : using the appropriate starting materials the methods described above for example 4 were used to prepare examples 5 - 7 . analysis for c 16 h 20 n 4 o 3 s . 3 . 2 hcl : analysis for c 19 h 26 n 4 o 3 s . 2 . 4 hcl . 1 . 3 h 2 o : analysis for c 18 h 24 n 4 o 3 s . 3 . 0 hcl . 0 . 5 h 2 o : n -( 1 ( s )- carbomethoxy - 3 - methylthiopropyl )- 3 - aminomethylbenzamide ( 0 . 104 g , 0 . 352 mmol ) was dissolved in dichloroethane ( 5 ml ). crushed molecular sieves ( 0 . 209 g ) and sodium triacetoxyborohydride ( 0 . 186 g , 0 . 881 mmol ). the ph was about 7 . 5 . 4 - nitrobenzaldehyde ( 0 . 0533 g , 0 . 352 mmol ) was added plus 0 . 5 drop of acetic acid to bring the ph to about 7 . the reaction was stirred 2 h under nitrogen at 20 ° c . 1 - triphenylmethylimidazolyly - 4 - carboxaldehyde ( 0 . 119 g , 0 . 352 mmol ) was added to the reaction mixture with additional sodium triacetoxyborohydride and dichloroethane ( 2 ml ). triethylamine ( 5 drops ) brought the ph to about 7 . the reaction continued to stir at 20 ° c . under nitrogen overnight . the reaction was quenched with saturated sodium bicarbonate solution and let stir 20 min . it was then removed to a separatory funnel with copious amounts of ethyl acetate . the aqueous layer was removed and the organic phase was washed with saturated brine and dried over magnesium sulfate . the crude product was chromatographed on silica gel with 50 % ethyl acetate in hexane . this chromatographed product was dissolved in dichloromethane ( 7 ml ); triethylsilane ( 0 . 5 ml , 3 . 13 mmol ) was added and then trifluoroacetic acid ( 3 . 5 ml ). after 0 . 5 h at 20 ° c ., the solvent was evaporated and the residue partitioned between hexane and water . the aqueous solution was purified by preparative reverse phase hplc using a 100 mm waters preppak ® reverse phase column ( deltapak ™ c18 , 50 μm , 100 å ) and pure product isolated by gradient elution using 80 % 0 . 1 % trifluoroacetic acid in water ( solvent a ) and 20 % 0 . 1 % trifluoroacetic acid in acetonitrile ( solvent b ) to 55 % solvent a and 45 % solvent b . the pure fractions were combined and the solvent evaporated , and the pure product was dissolved in water and lyophilized to give the title compound as a clear , pale yellow solid . 1 hnmr ( cd 3 od , 400 mhz ) δ8 . 78 ( 1h , br s ), 8 . 18 ( 2h , d , j = 8 . 6 hz ), 7 . 86 ( 1h br s ), 7 . 74 ( 1h , br d , j = 8 hz ), 7 . 64 ( 2h , d , j = 8 . 6 hz ), 7 . 56 ( 1h , br d , j = 8 hz ), 7 . 46 ( 1h , br s ), 7 . 44 ( 1h , dd j = 8 , 8 hz ), 4 . 8 ( 1h , m ), 3 . 74 to 3 . 79 ( 9h , m ), 2 . 58 to 2 . 66 ( 2h , m ), 2 . 23 ( 1h , m ), 2 . 12 ( 1h , m ), 2 . 10 ( 3h , s ). fab ms ( m + 1 ) 512 . anal . calc . for c 25 h 29 n 5 o 5 s . 0 . 70 h 2 o . 3 . 30 tfa . found : c , 42 . 12 ; h , 3 . 75 , n , 7 . 91 . the product from step a ( 0 . 045 g , 0 . 0608 mmol ) was dissolved in methanol ( 4 ml ) and 0 . 5 ml of 10 % naoh solution was added to take ph to about 12 . water ( 4 ml ) was added . at 3 h reaction was purified and lyophilized according to the procedure described in step a to the title compound as a white solid . 1 hnmr ( cd 3 od , 400 mhz ) δ8 . 78 ( 1h , br s ), 8 . 18 ( 2h , d , j = 8 . 6 hz ), 7 . 88 ( 1h , br s ), 7 . 75 ( 1h , br d , j = 8 hz ), 7 . 65 ( 2h , d , j = 8 . 6 hz ), 7 . 55 ( 1h , br d , j = 8 hz ), 7 . 46 ( 1h , br s ), 7 . 43 ( 1h , dd , j = 8 , 8 hz ), 4 . 8 ( 1h , m ), 3 . 80 ( 4h , br s ), 3 . 75 ( 2h , br s ), 2 . 58 to 2 . 68 ( 2h , m ), 2 . 27 ( 1h , m ), 2 . 13 ( 1h , m ), 2 . 11 ( 3h , s ). fab ms ( m + 1 ) 498 , anal calc . for c 24 h 27 n 5 o 5 s . 1 . 40 h 2 o + 3 . 20 tfa . found : c , 41 . 16 ; h , 3 . 72 ; n , 8 . 11 . the product from example 1 , step 3 ( 0 . 100 g , 0 . 337 mmol ) was dissolved in dichloroethane ( 5 ml ). p - nitrobenzaldehyde , sodium triacetoxyborohydride ( 0 . 214 g , 1 . 01 mmol ) and crushed molecular sieves were added , and the ph adjusted to 5 . 5 with acetic acid and triethylamine . the reaction was stirred at 20 ° c . overnight , quenched with saturated sodium bicarbonate , and partitioned between ethyl acetate and saturated sodium bicarbonate . the organic phase was washed with 2 % potassium hydrogen sulfate , saturated sodium bicarbonate , saturated brine , and dried over magnesium sulfate . the crude product was purified by silica gel chromatography using 40 % ethyl acetate in hexane . this product was further purified by preparative reverse phase hplc using a gradient elution from 85 % water , 15 % acetonitrile to 20 % water over a period of 40 min . ( solvents contained 0 . 1 % trifluoroacetic acid ). 1 hnmr ( 300 mhz , cdcl 3 ) d 8 . 25 ( 4h , d , j = 8 . 5 hz ), 7 . 92 ( 1h , s ), 7 . 80 ( 1h , d , j = 7 . 6 hz ), 7 . 63 ( 4h , d , j = 8 . 5 hz ). 7 . 53 ( m , 2h ), 7 . 35 ( 1h , d , j = 7 . 3 hz ), 4 . 94 ( 1h , bq , j = 6 . 2 hz ), 3 . 98 ( 4h , s ), 3 . 95 ( 2h , s ), 3 . 82 ( 3h , s ), 2 . 61 ( 2h , t , j = 7 . 3 hz ), 2 . 30 ( 1h , m ), 2 . 19 ( 1h , dt , j = 15 , 7 . 5 hz ), 2 . 11 ( 3h , s ). analysis calculated for c 28 h 30 n 4 o 7 s . 2 . 1 cf 3 co 2 h . 0 . 5 h 2 o : c , 47 . 45 ; h , 4 . 09 ; n , 6 . 87 . found : c , 47 . 44 ; h , 4 . 01 ; n , 6 . 91 . the product from step 1 ( 0 . 025 g ) was hydrolyzed to the acid according to the procedure described in example 1 , step 6 . the title compound was obtained after purification by preparative reverse phase hplc . fab ms m / e ( m + 1 ) 553 ). analysis calculated for c 27 h 28 n 4 o 7 s . 1 . 6 cf 3 co 2 h . 0 . 2 h 2 o : c , 49 . 11 ; h , 4 . 09 ; n , 7 . 59 . found : c , 49 . 10 ; h , 3 . 93 ; n , 7 . 55 . assays of farnesyl - protein transferase . partially purified bovine fptase and ras peptides ( ras - cvls , ras - cvim and ras - cail ) were prepared as described by schaber et al ., j . biol . chem . 265 : 14701 ∞ 14704 ( 1990 ), pompliano , et al ., biochemistry 3l : 800 ( 1992 ) and gibbs et al ., pnas u . s . a . 86 : 6630 - 6634 ( 1989 ), respectively . bovine fptase was assayed in a volume of 100 μl containing 100 mm n -( 2 - hydroxy ethyl ) piperazine - n &# 39 ;-( 2 - ethane sulfonic acid ) ( hepes ), ph 7 . 4 , 5 mm mgcl 2 , 5 mm dithiothreitol ( dtt ), 100 mm [ 3 h ]- farnesyl diphosphate ([ 3h ]- fpp ; 740 cbq / mmol , new england nuclear ), 650 nm ras - cvls and 10 μg / ml fptase at 31 ° c . for 60 min . reactions were initiated with fptase and stopped with 1 ml of 1 . 0m hcl in ethanol . precipitates were collected onto filter - mats using a tomtec mach ii cell harvestor , washed with 100 % ethanol , dried and counted in an lkb [ β - plate counter . the assay was linear with respect to both substrates , fptase levels and time ; less than 10 % of the [ 3 h ]- fpp was utilized during the reaction period . purified compounds were dissolved in 100 % dimethyl sulfoxide ( dmso ) and were diluted 20 - fold into the assay . percentage inhibition is measured by the amount of incorporation of radioactivity in the presence of the test compound when compared to the amount of incorporation in the absence of the test compound . human fptase was prepared as described by omer et al ., biochemistry 32 : 5167 - 5176 ( 1993 ). human fptase activity was assayed as described above with the exception that 0 . 1 % ( w / v ) polyethylene glycol 20 , 000 , 10 μm zncl 2 and 100 nm ras - cvim were added to the reaction mixture . reactions were performed for 30 min ., stopped with 100 μl of 30 % ( v / v ) trichloroacetic acid ( tca ) in ethanol and processed as described above for the bovine enzyme . the compounds of the instant invention were tested for inhibitory activity against human fptase by the assay described above and were found to have ic 50 of & lt ; 100 μm . the cell line used in this assay is a v - ras line derived from either rat1 or nih3t3 cells , which expressed viral ha - ras p21 . the assay is performed essentially as described in declue , j . e . et al ., cancer research 51 : 712 - 717 , ( 1991 ). cells in 10 cm dishes at 50 - 75 % confluency are treated with the test compound ( final concentration of solvent , methanol or dimethyl sulfoxide , is 0 . 1 %). after 4 hours at 37 ° c ., the cells are labelled in 3 ml methionine - free dmem supple - meted with 10 % regular dmem , 2 % fetal bovine serum and 400 mci [ 35 s ] methionine ( 1000 ci / mmol ). after an additional 20 hours , the cells are lysed in 1 ml lysis buffer ( 1 % np40 / 20 mm hepes , ph 7 . 5 / 5 mm mgcl 2 / 1 mm dtt / 10 mg / ml aprotinen / 2 mg / ml leupeptin / 2 mg / ml antipain / 0 . 5 mm pmsf ) and the lysates cleared by centrifugation at 100 , 000 x g for 45 min . aliquots of lysates containing equal numbers of acid - precipitable counts are bought to 1 ml with ip buffer ( lysis buffer lacking dtt ) and immunoprecipitated with the ras - specific monoclonal antibody y 13 - 259 ( furth , m . e . et al ., j . virol . 43 : 294 - 304 , ( 1982 )). following a 2 hour antibody incubation at 4 ° c ., 200 ml of a 25 % suspension of protein a - sepharose coated with rabbit anti rat igg is added for 45 min . the immunoprecipitates are washed four times with ip buffer ( 20 nm hepes , ph 7 . 5 / 1 mm edta / 1 % triton x - 100 . 0 . 5 % deoxycholate / 0 . 1 %/ sds / 0 . 1m nacl ) boiled in sds - page sample buffer and loaded on 13 % acrylamide gels . when the dye front reached the bottom , the gel is fixed , soaked in enlightening , dried and autoradiographed . the intensities of the bands corresponding to farnesylated and nonfarnesylated ras proteins are compared to determine the percent inhibition of farnesyl transfer to protein . to determine the biological consequences of fptase inhibition , the effect of the compounds of the instant invention on the anchorage - independent growth of ratl cells transformed with either a v - ras , v - raf , or v - mos oncogene is tested . cells transformed by v - raf and v - mos maybe included in the analysis to evaluate the specificity of instant compounds for ras - induced cell transformation . rat 1 cells transformed with either v - ras , v - raf , or v - mos are seeded at a density of 1 × 10 4 cells per plate ( 35 mm in diameter ) in a 0 . 3 % top agarose layer in medium a ( duibecco &# 39 ; s modified eagle &# 39 ; s medium supplemented with 10 % fetal bovine serum ) over a bottom agarose layer ( 0 . 6 %). both layers contain 0 . 1 % methanol or an appropriate concentration of the instant compound ( dissolved in methanol at 1000 times the final concentration used in the assay ). the cells are fed twice weekly with 0 . 5 ml of medium a containing 0 . 1 % methanol or the concentration of the instant compound . photomicrographs are taken 16 days after the cultures are seeded and comparisons are made .	2
a preferred embodiment of the present invention will be described with reference to fig3 . the moving optical component ( henceforth referred to as “ lens ”) 1 , is suitably affixed inside the bore of a precisely machined tubular member 2 ( henceforth called “ tube ”). the tube 2 , is suspended from the main support 4 , using stacks 3 , of flat circular flexures 3 a . normally , two stacks 3 , of flexures 3 a , separated by a suitable distance are used . an lvdt ( linear variable differential transducer ) 7 , consisting of a stationary coil assembly 7 a , and a moving ferromagnetic core 7 b , is used as a position sensor . any other sensor such as a capacitive , inductive or optical sensor may be suitably used in place of the lvdt . two views of a flexure stack 3 , are shown in fig4 a and 4 b , and its constituent parts are shown in fig4 c , 4 d and 4 e . two views of another flexure stack 3 , are shown in fig5 a and 5 b , and its constituent parts are shown in fig5 c , 5 d and 5 e . each stack 3 , consists of one or more flexures 3 a , interspersed with spacers 5 , 6 . each rim spacer 5 , is shaped to cover that part of the flexure 3 a , meant to be stationary . it has holes 5 a , which are used to mount the stacks 3 , on the main housing , 4 . each central spacer 6 , has a hole 6 a , which mates with the moving tube 2 . it is shaped to cover that portion of the flexure 3 a , which moves but does not flex . those portions 3 b , ( henceforth called “ flex - arms ”), of the flexure disc 3 a , that are not covered by any of the spacers 5 , 6 , can flex to yield the desired axial motion . the mutual coupling of the flex - arms 3 b , within a flexure 3 a , and also within different flexures 3 a , in the stacks 3 , imparts a very high radial stiffness to the entire assembly , while keeping the axial stiffness relatively low . referring back to fig3 the flexure stacks are spaced apart by the coil mount 8 , of the voice coil 9 , in the moving section and by the main support 4 , in the stationary section . the moving core 7 b , of the lvdt 7 , is then mounted on the moving tube 1 , via core mount 7 c , and the whole moving sub - assembly is clamped tight using nut , 10 . the lvdt core 7 b , is ensured to be nominally co - axial with the lvdt coil assembly 7 a . an axially magnetized permanent magnet 11 , in the shape of a ring is glued into the main housing 4 . the permanent magnet 11 , is made of a high energy density material such as neodymium ferrous boron . a ring shaped pole piece 12 , of magnetically permeable iron alloy , is glued on the magnet . the main housing 4 , which is also made from magnetically permeable iron alloy , acts as the outer pole . thus the annular air gap 13 , between the inner pole piece 12 , and the main housing 4 , contains a radial magnetic field . when the coil 9 , appropriately positioned in the magnetic air gap 13 , is energized by an electrical current , an axial force is induced on it . when the direction of the current is reversed , the force on the coil is also reversed . the above described voice coil motor is thus used to move and position the tube 2 , and the lens 1 , contained in the tube 2 . alternative topologies of a voice coil motor or a multiphase linear motor may be used in place of the voice coil motor described above another lens 14 , meant to be stationary , is affixed inside a precisely machined bore of the lens mount 15 . the bore of the lens mount 15 , is accurately sized such that when assembled properly , the moving tube 2 , enters inside it without touching it . in other words , there exists a very small annular gap 16 , of the order of 10 - 20 micrometers , between the outer cylindrical surface of the moving tube 2 , and the inner cylindrical surface of the bore in the stationary lens mount 15 . firstly , this ensures that the stationary lens 14 , is adequately co - axial with the moving lens 1 , thus facilitating proper optical function . secondly , this simple arrangement also introduces desired damping in the system as follows . when the moving tube 2 , moves towards the stationary lens 14 , the air trapped in between the two lenses 1 and 14 , is compressed . the rise in air pressure above ambient , drives out the air through the narrow annular gap between the moving tube 2 , and the stationary lens mount 15 . the friction generated during the passage of air leads to damping . when the moving tube 2 , moves away from the stationary lens 14 , the air trapped in between the two lenses 1 and 14 , is expanded leading to reduced pressure . this forces air from the ambient into the space between the lenses 1 and 14 , leading to friction damping as explained above . thus any motion of the moving tube leads to flow of air either into or away from the space enclosed between the lenses 1 and 14 , leading to friction damping in proportion to the velocity of the tube . this helps in speeding up the attenuation of the vibration at the end of each stroke , reducing the settling time and speeding up overall operation . it will thus be seen that , at least in its preferred forms , the present invention provides a mechanism for moving an optical component such as a lens using flexure bearings , for use in a wire bonding machine in particular and also in other machines in general . the mechanism is intended to achieve straight line motion of a lens relative to another co - axial lens thus yielding a means whereby the focus of the optical assembly can be altered without manual intervention . the moving part of the mechanism is actuated by a voice coil motor in such a way , that the effective actuating force is nominally co - axial with the moving lens . another object of the present invention is to provide a simple method of damping down undesirable vibrations of the mechanism at the end of its stroke thus facilitating faster operation . the principle features of the present invention may be employed in various embodiments not covered herein , without departing from the scope of the invention .	6
as can be seen in fig1 and 2 , the hanger 1 consists of a monolithic structure of an item made from plastic suitable for its purpose including a body 2 , equipped at the two ends with a clip structure 2 . 1 , suitable for holding one or more lingerie , underwear and similar clothing items , and a hook 3 , which extends upwards from the mid - point of the body 2 and with a lower portion 3 . 1 oriented with an angle to the body 2 which is less than 90 °. the hook 3 has a rear portion which is smooth and coplanar with the rear part of the body 2 and a front part where there is a channel - shaped groove 4 , which extends for the entire longitudinal length of the hook 3 . the groove also extends for the entire length of the body 2 . a tab 5 in the form of an integral protrusion is disposed in the groove 4 at the inclined portion 3 . 1 . the tab 5 extends across the entire width of the channel - shaped groove 4 and is positioned parallel to the body 1 with a lower wall 5 . 1 and , possibly also an upper wall 5 . 2 flat ( see fig7 ). a sizer 10 is fitted onto the hook 2 and blocks itself on the body 1 being kept in position by the tab 5 , in a manner described hereafter . as can be seen in fig5 , the sizer 10 comprises a peripheral wall which defines an open base “ b 1 ” in the lower part and a further open base “ b 2 ” in the upper part to allow the hook 3 of the hanger 1 to pass inside the sizer 10 . the peripheral wall of the sizer 10 is defined by two preferably trapezium - shaped longitudinal walls 11 and by two rectangle - shaped transverse walls 12 , the longitudinal walls 11 having a greater height than the two transverse walls 12 , so as to define a recess 13 suitable for receiving the body 2 of the hanger 1 through lock coupling , when the sizer is positioned . the sizer 10 is equipped with two protrusion bosses 14 and 15 protruding inside the two longitudinal walls 11 which are in contact with the tab 5 of the hook 2 , when the sizer 10 is in position , ensuring , in such a way , that the sizer 10 is blocked onto the hanger . the two protruding bosses 14 and 15 are on the upper part of the two longitudinal walls 11 and are arranged opposite one another and symmetrically with respect to the mid - point “ k ” ( fig6 ) of the upper opening “ b 2 ”. each of the two bosses 14 and 15 has a profile which is tapered towards the lower base “ b 1 ” in order to facilitate the sliding of the sizer 10 over the sides of the hook 3 into the groove 4 as well as over the tab 5 of the hook 2 during the movement towards the body 2 of the sizer 10 . in order to mount the sizer 10 onto the hanger 1 , the open lower base “ b 1 ” of the sizer is positioned above the free tapered part 3 . 2 ( fig3 ) of the hook 3 , which has a thickness which is less than the distance between the projections of the two bosses 14 and 15 of the sizer , which is thus free to move sideways . once a boss 14 of the sizer 10 is positioned inside the channel - shaped groove 4 of the hook 3 , the sizer 10 is guided by the channel - shaped groove 4 . with the continuous movement along the hook 3 , the sizer 10 comes into contact , slides and snaps under the tab 5 , which crosses the channel - shaped groove 4 . in such a final position , the upper surface 14 . 1 of the boss 14 of the sizer is positioned below the lower wall 5 . 1 of the tab 5 of the hook ; in such a way the sizer 10 cannot be moved backwards any longer due to the presence of the tab 5 , which is in the groove 4 and which blocks any upward movement of the sizer 10 . moreover , when the sizer 10 has been snapped into its location , as indicated in fig4 , the body 1 of the hanger is arranged inside the recess 13 , i . e ., the sizer 10 is locked or mounted “ astride ” over the body 1 thus impeding any twisting and / or rotation relative to the aforementioned body 1 . referring to fig8 to 17 , in a second embodiment , the sizer 20 is constructed so as to be slid over the hook 3 of a hanger 1 and then slid laterally into a blocked condition on the hanger . referring to fig1 , the sizer 20 is made up of a peripheral wall defined by two , preferably trapezium - shaped longitudinal walls 21 , and two , rectangular - shaped transverse walls 22 , the two transverse walls 22 having a shorter height than the two longitudinal walls 21 , so as to define a lower recess 23 . 1 , suitable for receiving through lock coupling the body 2 , as shown in fig8 , and an upper recess 23 . 2 , to allow the inclined portion 3 . 1 of the hook 3 to come off , as shown in fig8 , all whilst the sizer 20 is snapped into position . referring to fig8 to 10 , the sizer 20 is equipped with two bosses 24 and 25 protruding inside the two longitudinal walls 21 . when the sizer 20 is in position , one or the other of the two protruding bosses 24 , 25 is in contact with the underside of the tab 5 of the hook 2 , as shown in fig1 , ensuring in such a way that the sizer 20 is blocked onto the hanger body 2 . the two protruding bosses 24 and 25 are on the upper part and at the ends of the two longitudinal walls 21 and are arranged opposite one another and symmetrically with respect to the mid - point “ k ” of the upper opening “ b 2 ” ( see fig1 ). as indicated in fig8 , the protrusion bosses 24 and 25 are spaced apart at a greater distance than the width of the hook 3 of the hanger so that when the sizer 20 is initially slid over the hook 3 , the protrusion bosses 24 and 25 are each disposed outside of the hook as indicated in fig1 . each of the two bosses 24 and 25 has a profile which is tapered in opposite directions to facilitate the sliding on the side of the hook 3 during the side movement of the sizer 20 . as can be seen in fig1 to 17 , in order to mount the sizer 20 onto the hanger 1 , the free end of the hook 3 is fitted onto the sizer , between the two bosses 24 and 25 ; for such a purpose the inner distance between the two longitudinal walls 21 is slightly greater than the thickness of the hook 3 , for which reason the sizer is guided during its sliding along the hook . with the continuous movement along the hook 3 , the sizer 20 comes into contact and locks into the recess 23 . 1 on the body 1 ( fig1 and 16a ) and this prevents any twisting and / or rotation relative to the aforementioned body 1 . with the subsequent horizontal sliding along the body 1 , the sizer 20 slides along the hook 2 and snaps into the tab 5 , which crosses the channel - shaped groove 4 ( fig1 and 17a ). in such a final position , the boss 24 is contained inside the channel - shaped groove 4 and its upper surface is positioned below the lower wall 5 . 1 of the tab 5 of the hook . in this way , the sizer 10 can no longer slide , due to the presence of the tab 5 , which blocks the sizer 20 from above and due to the channel - shaped groove 4 , which blocks the sizer 20 sideways . referring to fig1 , in another embodiment , the sizer 30 sizer is constructed so as to be slid onto a hook of a hanger and blocked in place as in the first embodiment or to be slid onto a hook of a hanger and laterally moved into place as in the second embodiment . as illustrated , the sizer 30 is made up of a peripheral wall defined by two , preferably trapezium - shaped longitudinal walls 31 and made up of two , rectangle - shaped transverse walls 32 , the transverse walls 32 having a shorter height than the two longitudinal walls 31 , so as to define a lower recess 33 . 1 and an upper recess 33 . 2 . the sizer 30 is also equipped with two bosses 34 and 35 that protrude inside the two longitudinal walls 31 and that have a tapered profile 36 towards the lower base and a further tapered profile 37 with a reciprocally opposite direction to facilitate the sliding of the sizer 30 respectively , over the tab 5 of the hook 2 , during movement downward and on the side of the hook 2 , during lateral movement . the invention thus provides a sizer with the preferably trapezium - shaped longitudinal walls 11 , 21 or 31 that have a substantial width and therefore provide a surface that allows indicia thereon to show clearly the size of the garment hanging on the hanger . the sizer 10 , 20 or 30 can be made from any suitable material , preferably from plastic material and the thickness of the longitudinal walls 11 , 21 and 31 , in particular at the bosses 14 , 15 and 24 , 25 as well as 34 , 35 is such as to allow the walls to flex outwards , to allow the bosses to slide over the tab 5 or over the hook 2 , respectively , to snap into the channel - shaped groove 4 of the hook . moreover , since the sizer 10 , 20 , 30 has the bosses 14 , 15 and 24 , 25 , as well as 34 , 35 , opposite each other , the sizer is able to slide above the portion 3 . 1 of the hook 3 which extends angularly from the body 1 , at an angle less than 90 ° and , can be positioned on a hook in either of the two possible positions for display purposes . finally , from what has been described thus far it should be understood that once the sizer 10 , 20 , 30 , has been snapped into its foreseen position , the sizer cannot be easily removed from the hanger . in order to do so , a tool must be inserted inside the sizer , in order to allow the bosses 14 , 15 and 24 , 25 , as well as 34 , 35 of the sizer itself to come out of the groove 4 of the hook 2 . the sizer 10 , 20 , 30 is illustrated and described with respect to a lingerie or underwear hanger ; however , the plastic hanger can be of any suitable construction for various types of garments . the invention further provides a sizer that can easily be mounted on any type of hook or “ nail ”, which extends and takes on its form angularly from any plastic hanger body .	0
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . fig4 illustrates a graph showing an lev 8 opening pulse value vs . compressor starting time period in an lev 8 controlling method for an air conditioner with two compressors 2 , and 4 in accordance with a preferred embodiment of the present invention . in a case of an air conditioner system with two compressors 2 , and 4 , the initial pulse value of the lev 8 in an initial starting of the compressors 2 , and 4 is selected such that the introduction of liquid refrigerant into the compressors 2 , and 4 is minimized , and a target value of the lev pulse to be reached at completion of the initial starting control of the system , and a time period required for reaching to the target value are fixed according to designed . referring to fig4 in a first step 100 when a compressor operation time period reaches to ts - a after the compressors are put into operation , the pulse value of the lev is changed from the initial value to p 1 , where ts denotes a value obtained by multiplying a capacity ratio of the small compressor to a total capacity to a time period t 1 required for reaching to the target value , and ‘ a ’ denotes a time period the pulse of the lev is changed from the initial value to the p 1 . p 1 is a value obtained by multiplying the capacity ratio of the small compressor to a total capacity to the target value of the lev , and adding the initial value thereto . in a second step 200 when the compressor operation time period reaches to tm - b , the pulse value of the lev is changed from p 1 to p 2 , where tm denotes a value obtained by multiplying a capacity ratio of the large compressor to a total capacity to a time period t 1 required for reaching to the target value , and ‘ b ’ denotes a time period the pulse of the lev is changed from the p 1 to p 2 . p 2 is a value obtained by multiplying the capacity ratio of the large compressor to a total capacity to the target value of the lev , and adding the initial value thereto . in a third step 300 when the compressor operation time period reaches to t 1 - c , the pulse value of the lev is changed from p 2 to the target value , where ‘ c ’ denotes a time period the pulse of the lev is changed from p 2 to the target value . in a fourth step 400 , when a preset time period is passed after the pulse value of the lev reaches to the target value , the starting control is ended , and a superheat control is started , to control the pulse of the lev . as has been explained , the method for controlling a linear expansion valve in an air conditioner with two compressors of the present invention requires only two steps of pulse changes during the pulse reaches from the initial value to the target value by controlling the lev by using compressor capacity ratios . variation of compressor suction pressure vs . time in an air conditioner system controlled according to the method of the present invention is illustrated in a solid line in fig3 . it can be known from fig3 that the method of the present invention shows a smaller initial suction pressure drop than the related art , to permit the suction pressure to reach to a proper suction pressure faster than the related art after the compressors are started . thus , the method for controlling a linear expansion valve in an air conditioner with two compressors of the present invention can prevent drop of the suction pressure , and reduction of cooling performance during starting because opening of an lev is varied from an initial value to a target value according to an operation time period of the compressors with reference to capacity ratios of the small compressor , and the large compressor . moreover , as the system can reach to a stable state within a short period after the starting , a system efficiency can be enhanced . it will be apparent to those skilled in the art that various modifications and variations can be made in the method for controlling a linear expansion valve in an air conditioner with two compressors of the present invention without departing from the spirit or scope of the invention . thus , it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents .	5
a device and a method for switching processes selectable by keys on a human interface device ( hid ) are described hereinafter for addressing the foregoing problems . for purposes of brevity and clarity , the description of the invention is limited hereinafter to applications related to switching processes selectable by keys on hids ( or key function switching ). this however does not preclude various embodiments of the invention from other applications that require similar operating performance . the fundamental operational and functional principles of the embodiments of the invention are common throughout the various embodiments . exemplary embodiments of the invention described hereinafter are in accordance with fig1 to 7 of the drawings , in which like elements are numbered with like reference numerals . according to an embodiment of the invention , a system for switching processes of a software application executing in a computing device , for instance a personal computer is disclosed hereinafter . the processes are selectable through keys on human interface devices ( hids ) or input devices such as a keyboard 100 shown in fig1 and a mouse 200 shown in fig2 is described hereinafter . the keyboard 100 comprises any key 102 . a user ( not shown ) then uses a switch incorporated on the mouse 200 , such as a switch 202 , to switch the key 102 from a first function to a second function for switching from a first process to a second process of the software application . the first and second functions are preferably already pre - defined and pre - configured to the key 102 . additionally , the first and second functions may be pre - determined by the user before being configured to the key 102 . the keyboard 100 is one of wired and wireless types . a wired keyboard 100 preferably couples and communicates to a computer system ( not shown ) via a communication interface being one of ps / 2 and universal - serial - bus ( usb ). on the other hand , a wireless keyboard 100 preferably couples and communicates to the computer system via a communication interface being one of bluetooth , infrared ( ir ), radio - frequency ( rf ) and wireless usb . further , the keyboard 100 is preferably an ibm - compatible keyboard with a qwerty keyboard layout design . as shown in fig2 , the switch 202 is preferably ergonomically located on the mouse 200 so as to be easily accessible by the user , such as along a side portion of the mouse 200 . alternatively , other usable hids include a trackball , touchpad , digitizing pen , gamepad , graphics tablet and joystick . additionally , the mouse 200 is one of type wired and wireless . a wired mouse 200 preferably couples and communicates to the computer system via a communication interface being one of ps / 2 and universal - serial - bus ( usb ). a wireless mouse 200 however preferably couples and communicates to the computer system via a communication interface being one of bluetooth , infrared ( ir ), radio - frequency ( rf ) and wireless usb . alternatively , the mouse 200 may be coupled directly to the keyboard 100 via one of the wired and wireless means . further , the switch 202 is preferably operable on any computer systems without having to install additional software drivers for the operating systems ( os ) installed on the computer systems . the os is preferably one of microsoft windows , linux , unix and mac osx . typically , different primary functions of the keys 102 arc already pre - associated with different primary processes of a pc game . according to the embodiment of the invention , the user initially uses a software application ( not shown ) for pre - defining and configuring secondary functions corresponding to secondary processes of the pc game to any one of the keys 102 . the user then switches to the secondary functions of the keys 102 whenever required by actuating the switch 202 . hence , the secondary functions of the keys 102 are selected instead when the user actuates the keys 102 . to switch the keys 102 back to the primary functions , the user actuates the switch 202 . alternatively , the secondary functions of the keys 102 are selected when the switch 202 is actuated together with the keys 102 . when the switch 202 is released , the keys 102 revert to the primary functions . additionally , the switch 202 is preferably and alternatively usable in conjunction with any processor - based devices ( not shown ) that have buttons or keys . processor - based devices include gamepads , video gaming consoles , joysticks and the like . the switch 202 then enables functions switching ( from primary functions to secondary functions ) of the buttons or keys of the computer peripheral devices to be achieved by actuating the switch 202 together with the buttons or keys . alternatively , functions switching of the buttons or keys of the processor - based devices are achievable by actuating the switch 202 once to switch to the secondary functions . subsequently , when the primary functions are required again , the switch 202 is then actuated to switch the buttons or keys back to the primary functions . an example illustrating the usage of the switch 202 with the keyboard 100 is as shown in fig3 . in a typical pc game , in - game processes such as shoot , jump , crouch , cast - spell - a , cast - spell - b and cast - spell - c are configurable to any keys 102 of the keyboard 100 . hence , the user may configure the aforementioned six in - game processes to key - one 302 , key - two 304 , key - three 306 , key - four 308 , key - five 310 and key - six 312 , respectively . however , during play of the pc game , key - four 308 , key - five 310 and key - six 312 are not easily accessible by the user . according to the embodiment of the invention , the user can however use the software application to configure shoot , jump and crouch as primary processes and cast - spell - a , cast - spell - b and cast - spell - c as secondary processes to key - one 302 , key - two 304 and key - three 306 , respectively . thus , when the user is playing the pc game , the user simply actuates key - one 302 , key - two 304 and key - three 306 for selecting the shoot , jump and crouch processes , respectively . by actuating the switch 202 , the user then activates the secondary functions of key - one 302 , key - two 304 and key - three 306 . as a result , when the user presses key - one 302 , key - two 304 and key - three 306 during play of the pc game , the cast - spell - a , cast - spell - b and cast - spell - c processes are now respectively selected instead of the shoot , jump and crouch processes . the primary functions of key - one 302 , key - two 304 and key - three 306 may be reverted by actuating the switch 202 again . alternatively , the cast - spell - a , cast - spell - b and cast - spell - c processes arc selectable by actuating the switch 202 together with one of key - one 302 , key - two 304 and key - three 306 , respectively . thus for example , when the switch 202 is actuated together with key - one 302 , the cast - spell - a process is now selected instead of the shoot process . however , when the switch 202 is released , key - one 302 then selects the shoot process again . additionally , the switch 202 also allows alternative processes to be provided to at least one button of the mouse 200 . the alternative processes are preferably programmable by the user . fig4 shows a left button 400 , a scroll button 402 and a right button 404 of the mouse 200 . for example , in a typical pc game , the user is able to configure in - game processes such as attack , jump , cast - spell - a and cast - spell - b to buttons of the mouse 200 . however , due to the lack of buttons available on the mouse 200 , only two of the aforementioned in - game processes are configurable to the buttons of the mouse 200 . according to the embodiment of the invention , the user can however use the software application to configure all four of the aforementioned in - game processes to the buttons of the mouse 200 , in which the four in - game processes are used in conjunction with the switch 202 . the user then configures attack and jump as primary processes to the left button 400 and right button 404 , respectively and cast - spell - a and cast - spell - b as secondary processes to the left button 400 and right button 404 , respectively . by default , when the user actuates the left button 400 or right button 404 on the mouse 200 , the attack or jump process is selected respectively . however , when the user actuates the switch 202 , the secondary processes associated with the left button 400 and right button 404 respectively are selected instead . thus , the cast - spell - a or cast - spell - b process is respectively selected when the user either actuates the left button 400 or right button 404 . yet alternatively , the cast - spell - a and cast - spell - b processes are selectable by actuating the switch 202 together with either the left button 400 or right button 404 , respectively . thus for example , when the switch 202 is actuated together with the left button 400 , the cast - spell - a process is now selected instead of the attack process . however , when the switch 202 is released , the left button then selects the attack process again . fig5 shows another keyboard 500 of the conventional type . the keyboard 500 is an enhanced version of the keyboard 100 of fig1 in which the keyboard 500 is incorporated with multimedia function buttons 502 such as volume buttons , a play button , a fast - forward button and a reverse button , in addition to the available conventional keys 504 . typically , a conventional keyboard such as the keyboard 500 is pre - built with modifier keys such as “ ctrl ”, “ alt ” and “ shift ” keys 506 . the switch 202 of the mouse 200 is programmable and configurable to take on functionality of one of the “ ctrl ”, “ alt ” and “ shift ” keys 506 . hence , when the user actuates the switch 202 on the mouse 200 , the switch 202 now emulates the functionality of one of the “ ctrl ”, “ alt ” and “ shift ” keys 506 . the switch 202 is then usable in combination with the keys 504 to form shortcut keys for accessing different pre - defined in - game processes . configuring the shortcut keys allows the user quicker access to the in - game processes without having to position their hands in a non - ergonomic manner on the keyboard 500 during game play . in addition , due to the ergonomic positioning of the shortcut keys , the user is less likely to incur computer - related injuries resulting from prolong usage of the computer system such as carpal tunnel syndrome ( cts ). alternatively , the switch 202 is usable in combination with the keys 504 to form shortcut keys for accessing different pre - defined in - program processes of a computer animation application . examples of the in - program processes are drawing , colouring , animating and sound effects features of the computer animation application . in this manner , the in - program processes are configured such that each of the in - program processes is activated through actuating a corresponding pre - defined key 504 on the keyboard 500 in conjunction with the switch 202 . additionally , the switch 202 is also programmable using a software application 600 as shown in fig6 . the software application 600 enables the configuration of the switch 202 together with keys of a hid such as the keyboard 500 of fig5 . hence , a unique code corresponding to the configuration of actuating at least one of the keys 504 in conjunction with the switch 202 is pre - definable by the user . the unique code is then stored in a “ shortcut - key ” profile on the computer system . alternatively , the “ shortcutkey ” profile is stored on the mouse 200 . additionally , the unique code is also associated with a software application . whenever the computer system detects an activation corresponding to the unique code , the software application is then activated by the computer system . the unique code is activatable by the keyboard 500 whenever the user actuates the switch 202 in conjunction with a pre - defined key selected from one of the keys 504 . the software application 600 comprises the respective options : a key , a launch - application and a load -“ shortcut - key ”- profile respectively . the key option specifies one of the keys 504 . the launch - application option allows the user to define a software application to be activated upon detection of the unique code corresponding to the usage of the shortcut keys . lastly , the load -“ shortcut - key ”- profile option allows the user to decide whether the “ shortcut ” profile is to be loaded into computer memory by the computer system upon system startup . according to another embodiment of the invention , a hardware implementation 700 for the mouse 200 is shown in fig7 . the hardware implementation 700 comprises a signal detector 702 , a first controller 704 , memory 706 , a microprocessor 708 , a second controller 710 and a signal transmitter 712 . the signal detector 702 contains sensing circuitry to detect if the mouse 200 receives any input signals . the received input signals are then forwarded to the first controller 704 , which processes requests of sending and storing of received input signals into the memory 706 . the memory 706 serves as a storage space to temporarily store the received input signals before subjecting the received input signals to further processing by the microprocessor 708 . the memory 706 is preferably one of semiconductor memory devices such as static and dynamic random access memory ( ram ) and flash devices . the microprocessor 708 is responsible for processing the received input signals to derive digital information such as coordinates of current position of the mouse 200 . subsequently , the microprocessor 708 sends the digital information to the second controller 710 , which processes organization of the digital information before transmitting the digital information as output signals . lastly , the signal transmitter 712 transmits the digital information to the computer system via the communication interface to which the mouse 200 couples and communicates . in the foregoing manner , a system and a method for switching processes selectable by keys on human interface devices are described according to embodiments of the invention for addressing at least one of the foregoing disadvantages . although a few embodiments of the invention are disclosed , it will be apparent to one skilled in the art in view of this disclosure that numerous changes and / or modification can be made without departing from the scope and spirit of the invention . example 1 is a method for switching processes performable by the computing device in a human interface device communicable with a computing device , the method comprising the steps of : detecting actuation of a switch on the human interface device ; and communicating with the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch , wherein each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key . in example 2 , the subject matter of example 1 can optionally include that the step of detecting actuation of the switch on the human interface device comprises the step of detecting actuation of a switch on an input device . in example 3 , the subject matter of example 2 can optionally include that the step of detecting actuation of the switch on the input device comprises the step of detecting actuation of a switch on a mouse . in example 4 , the subject matter of example 1 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key of an input device . in example 5 , the subject matter of example 4 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key of a keyboard . in example 6 , the subject matter of example 1 can optionally include the step of detecting deactuation of the switch . in example 7 , the subject matter of example 6 can optionally the step of communicating with the computing device for switching from the second process selectably performable by the computing device to the first process selectably performable by the computing device in response to the deactuation of the switch . in example 8 , the subject matter of example 1 can optionally include that the step of communicating with the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch comprises the step of communicating with the computing device for switching from a first in - game process selectably performable by the computing device to a second in - game process selectably performable by the computing device in response to the actuation of the switch . in example 9 , the subject matter of example 8 can optionally include the step of detecting deactuation of the switch . in example 10 , the subject matter of example 9 can optionally include the step of communicating with the computing device for switching from the second in - game process selectably performable by the computing device to the first in - game process selectably performable by the computing device in response to the deactuation of the switch . in example 11 , the subject matter of example 1 can optionally include that the switch is disposed on a mouse and the at least one process selection key is disposed on a keyboard . in example 12 , the subject matter of example 11 can optionally include that the first and second processes selectably performable by the computing device are switchable by actuation of one of shift ( shift ), alternate ( alt ) and control ( ctrl ) keys disposed on the keyboard and selectable by actuation of the at least one process selection key . in example 13 , the subject matter of example 1 can optionally include the step of communicating with the computing device for configuring at least one of the first and second processes selectably performable by the computing device for selection by actuation of the at least one process selection key , wherein an association between the at least one of the first and second processes and the at least one process selection key is definable in a configuration profile storable on at least one of the human interface device and the computing device . example 14 is a human interface device communicable with a computing device , the human interface device comprising : a switch actuable by a user of the human interface device ; and a communication interface for communicating with the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch , wherein each of the first and second processes selectably performable by the computing device is configurably selectable by at least one process selection key actuable by the user of the human interface device . in example 15 , the subject matter of example 14 can optionally include that the human interface device is an input device . in example 16 , the subject matter of example 15 can optionally include that the input device is a mouse . in example 17 , the subject matter of example 14 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by at least one process selection key of an input device actuable by the user of the human interface device . in example 18 , the subject matter of example 17 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by at least one process selection key of a keyboard actuable by the user of the human interface device . in example 19 , the subject matter of example 14 can optionally include that the switch is deactuable by the user of the human interface device . in example 20 , the subject matter of example 19 can optionally include that the communication interface is for communicating with the computer device for switching from the second process selectably performable by the computing device to the first process selectably performable by the computing device in response to the deactuation of the switch . in example 21 , the subject matter of example 14 can optionally include that the communication interface for communicating with the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch is for communicating with the computing device for switching from a first in - game process function selectably performable by the computing device to a second in - game process selectably performable by the computing device in response to the actuation of the switch . in example 22 , the subject matter of example 21 can optionally include that the switch is deactuable by the user of the human interface device . in example 23 , the subject matter of example 22 can optionally include that the communication interface is for communicating with the computing device for switching from the second in - game process selectably performable by the computing device to the first in - game process selectably performable by the computing device in response to the deactuation of the switch . in example 24 , the subject matter of example 14 can optionally include that the switch is disposed on a mouse and the at least one process selection key is disposed on a keyboard . in example 25 , the subject matter of example 24 can optionally include that the first and second processes selectably performable by the computing device are switchable by actuation of one of shift ( shift ), alternate ( alt ) and control ( ctrl ) keys disposed on the keyboard and selectable by actuation of the at least one process selection key . in example 26 , the subject matter of example 14 can optionally include that the communication interface communicates with the computing device providing a software interface for configuring at least one of the first and second processes selectably performable by the computing device for selection by actuation of the at least one process selection key , wherein an association between the at least one of the first and second processes and the at least one process selection key is definable in a configuration profile storable on at least one of the human interface device and the computing device . example 27 is a method for switching processes performable by the computing device , in a computing system comprising a computing device communicatively couplable to a human interface device , the method comprising the steps of : detecting actuation of a switch on the human interface device ; and providing communication between the human interface device and the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch , wherein each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key . in example 28 , the subject matter of example 27 can optionally include that the step of detecting actuation of the switch on the human interface device comprises the step of detecting actuation of a switch on an input device . in example 29 , the subject matter of example 28 can optionally include that the step of detecting actuation of the switch on the input device comprises the step of detecting actuation of a switch on a mouse . in example 30 , the subject matter of example 27 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key of an input device . in example 31 , the subject matter of example 30 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key of a keyboard . in example 32 , the subject matter of example 27 can optionally include that the method for switching processes performable by the computing device further comprises the step of detecting deactuation of the switch . in example 33 , the subject matter of example 32 can optionally include that the method for switching processes performable by the computing device further comprises the step of communicating with the computing device for switching from the second process selectably performable by the computing device to the first process selectably performable by the computing device in response to the deactuation of the switch . in example 34 , the subject matter of example 27 can optionally include that the method for switching processes performable by the computing device having the step of communicating with the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch comprises the step of communicating with the computing device for switching from a first in - game process selectably performable by the computing device to a second in - game process selectably performable by the computing device in response to the actuation of the switch . in example 35 , the subject matter of example 34 can optionally include that the method for switching processes performable by the computing device further comprises the step of detecting deactuation of the switch . in example 36 , the subject matter of example 35 can optionally include that the method for switching processes performable by the computing device further comprises the step of communicating with the computing device for switching from the second in - game process selectably performable by the computing device to the first in - game process selectably performable by the computing device in response to the deactuation of the switch . in example 37 , the subject matter of example 27 can optionally include that the switch is disposed on a mouse and the at least one process selection key is disposed on a keyboard . in example 38 , the subject matter of example 37 can optionally include that the first and second processes selectably performable by the computing device are switchable by actuation of one of shift ( shift ), alternate ( alt ) and control ( ctrl ) keys disposed on the keyboard and selectable by actuation of the at least one process selection key . in example 39 , the subject matter of example 27 can optionally include that the method for switching processes performable by the computing device further comprises the step of communicating with the computing device for configuring at least one of the first and second processes selectably performable by the computing device for selection by actuation of the at least one process selection key , wherein an association between the at least one of the first and second processes and the at least one process selection key is definable in a configuration profile storable on at least one of the human interface device and the computing device . example 40 is a machine readable medium having stored therein a plurality of programming instructions , which when executed , the instructions cause a computing device to perform the step of : detecting actuation of a switch on a human interface device communicable with the computing device ; and providing communication between the human interface device and the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch , wherein each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key . in example 41 , the subject matter of example 40 can optionally include that the instructions cause the computing device to perform the step of detecting actuation of the switch on the human interface device comprises the step of detecting actuation of a switch on an input device . in example 42 , the subject matter of example 41 can optionally include that the instructions cause the computing device to perform the step of detecting actuation of the switch on the input device comprises the step of detecting actuation of a switch on a mouse . in example 43 , the subject matter of example 40 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key of an input device . in example 44 , the subject matter of example 43 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key of a keyboard . in example 45 , the subject matter of example 40 can optionally include that the instructions cause the computing device to further perform the step of detecting deactuation of the switch . in example 46 , the subject matter of example 45 can optionally include that the instructions cause the computing device to further perform the step of communicating with the computing device for switching from the second process selectably performable by the computing device to the first process selectably performable by the computing device in response to the deactuation of the switch . in example 47 , the subject matter of example 40 can optionally include that the instructions cause the computing device to perform the step of communicating with the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch comprises the step of communicating with the computing device for switching from a first in - game process selectably performable by the computing device to a second in - game process selectably performable by the computing device in response to the actuation of the switch . in example 48 , the subject matter of example 47 can optionally include that the instructions cause the computing device to further perform the step of detecting deactuation of the switch . in example 49 , the subject matter of example 48 can optionally include that the instructions cause the computing device to further perform the step of communicating with the computing device for switching from the second in - game process selectably performable by the computing device to the first in - game process selectably performable by the computing device in response to the deactuation of the switch . in example 50 , the subject matter of example 40 can optionally include that the switch is disposed on a mouse and the at least one process selection key is disposed on a keyboard . in example 51 , the subject matter of example 50 can optionally include that the first and second processes selectably performable by the computing device are switchable by actuation of one of shift ( shift ), alternate ( alt ) and control ( ctrl ) keys disposed on the keyboard and selectable by actuation of the at least one process selection key . in example 52 , the subject matter of example 40 can optionally include that the instructions cause the computing device to further perform the step of communicating with the computing device for configuring at least one of the first and second processes selectably performable by the computing device for selection by actuation of the at least one process selection key , wherein an association between the at least one of the first and second processes and the at least one process selection key is definable in a configuration profile storable on at least one of the human interface device and the computing device .	6
the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which some examples of the embodiments of the inventions are shown . indeed , these inventions may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided by way of example to better describe the present invention . “ vibrato device ” as used herein refers to a device that may be used to change the tension of strings in a musical instrument . in some embodiments of the present invention , the vibrato device can include a pivoting bridge element and a mounting plate that may be attached to the flat surface of a telecaster style guitar . “ whammy bar ” as used herein refers to a device component of a vibrato device that can facilitate the application of force to pivoting bridge mechanical element of said vibrato device . for example , it can include a protruding bar that is conveniently located in proximity to the playing surface of the musical instrument . in some embodiments , the whammy bar may incorporate electrical components or additional mechanical components , such as an electrical switch that can act as a locking mechanism or a tune / pitch control . for example , an electrical strain gage that could electrically change the tone of the guitar . referring now to fig1 , an exemplary vibrato device of the present invention is illustrated 101 . at 102 , the mounting of said exemplary vibrato device is depicted . preferably , the mounting plate can be a metal piece , carbon fiber or composite that can be attached to the existing holes of a generally flat surface of the instrument using a plurality of screws as depicted in fig2 . fig1 shows pivot bolts may include one or more jacking pivot axis bolts that allow for the mounting and / or adjustment of a pivoting bridge element 103 ( further described in fig2 and 5 ) of the vibrato device . further , the bolts depicted may be inserted in holes 108 in the mounting plate 102 which are aligned with existing holes in some musical instruments so that no permanent modification to the instrument is required . in other embodiments , the four mounting screws for the telecaster can be hidden under the bridge . at 104 , one or a plurality of saddles used to attach the individual strings of the instrument is depicted . in the exemplary embodiment , traditional saddles that can allow for individual height adjustments and intonation adjustments are depicted being attached to the pivoting bridge element . however , they may be attached to another piece that can accommodate the individual saddles and additionally be easily fixed to the pivoting bridge element . this would facilitate the replacement or the pivoting bridge element for another that has different a different tension and affects pitch differently , as it may be desired . at 111 , a plurality screws are depicted . the screws can function in some embodiments as tension spring adjustment screws . the tension spring adjustment screws can attach the fixed portion , in relation to the metal plate , of the pivoting bridge element to the mounting plate . additionally , by fastening the screws at a different level , the degree of pivoting and “ whammy ” tension may be controlled to a certain degree . for example , each saddle can support an individual string centered in each saddle utilizing a shallow notch , preferably 1 mm . said saddle can include means for adjusting its height above said bridge element . this feature can be two or more threaded holes through the surface perpendicular to the musical instrument &# 39 ; s mounting surface , to receive the threaded fasteners allowing individual height adjustment of the said saddles . the said spring tension adjustment screws are fastened to the said springs in the said mounting plates through the clearance holes of the said pivoting bridge element . these screws adjust the tension of the said tension springs , counteracting the musical instrument &# 39 ; s strings tension . the head of the fastener can be an adjustment feature such as a socket head , slot or phillips screw head allows for spring tension adjustment . attached to a pivoting element within the pivoting bridge element of the vibrato system , at 107 a whammy bar is depicted . the whammy bar can include any desired feature , such as the geometric shape depicted at 106 , to enable or facilitate the use of the whammy bar while playing the musical instrument . in some embodiments , the whammy bar may be metal or any rigid material . the whammy bar may be inserted into a tension bushing feature . this bushing feature can be utilized for mechanically changing the pitch of the said pivoting bridge element . therefore changing the pitch , tune or note of the all of the said strings of the musical instrument . when the whammy bar is released the said tension springs return the said pivoting bridge element to it &# 39 ; s original position . thus bringing the musical instrument back into tune . referring now to fig2 , the underside of a pivoting bridge element is depicted . at 205 , two flush tension springs are depicted in the exemplary embodiment . however , the pivoting bridge element may include one , or three or more to provide a desired tension . the tension may also be varied by the thickness or material used for the pivoting bridge element springs . at 209 and 210 , two pivot bolts are depicted with threaded apertures next to them for existing wood screws of the guitar . the apertures may go through both the mounting plate and pivoting bridge element or only in the mounting plate depending on the configuration desired . referring now to fig3 , a cross section side view of the exemplary device of fig1 is depicted . at 315 , intonation holes are depicted . said intonation holes can be threaded in the saddle and adjusted by a screw or bolt from the back of the bridge or as the exemplary embodiment depicts a threaded hole in the bridge and with each saddle has a clearance hole and a button head socket screw inside the saddle which adjust the intonation . additionally , in some embodiments one of the holes in the saddle may have a small pin going through it so when the bridge is rotated forward , the string can stay seated . a tension spring that can also help intonation going through the pivoting bridge element 303 is depicted at 311 . the pivoting bridge element includes a saddle 304 supporting an individual string centered and utilizing a shallow notch . also depicted in the cross section , at holes in the plate 308 can accommodate said bolts in fig1 at 108 wherein a feature , such as the v - cut depicted , can allow the pivoting element to move with minimal friction in relation to the fixed mounting plate . one or more other holes may also be designed to receive the said friction bushing which is non - rigidly attached to constrains the whammy bar in rotation from the holes axis and in translation from the holes axis allowing rotation around an axis . this one or more holes are located on the surface perpendicular to the musical instrument &# 39 ; s mounting surface with a threaded hole intersecting the said friction bushing hole from aft surface perpendicular to the orientation of the strings . the forward edge of the said pivoting bridge element which contacts the said jacking pivot axis bolts , can utilize two notched knife edge features to allow minimal friction and a single degree of freedom for a pivotal motion . the said pivoting bridge element is designed to utilize side walls parallel the orientation of the said strings to prevent lateral motion of the said saddles . further , the saddles can be used as a string suspension system and are attached to the said pivoting bridge element constrained by the said intonation and / or mounting screws and said flush tension spring ( s ). the said saddle allows enough clearance to use a standard tool to adjust the axial saddle position parallel with the string . the said saddle is designed to receive the spool end of a musical instrument &# 39 ; s string . this can be accomplished by a double notch feature for said string ends . as a result , this vibrato device can eliminate the threading of strings through the musical instrument &# 39 ; s body . referring to fig4 , in one exemplary embodiment , the mounting plate 405 comprises a rearward walled section and a forward open center section . the rear walled section can assist in the positioning of the pivoting bridge element to prevent it from snapping out of place . in some embodiments , it may be required that the forward section of the mounting plate does not include the side wall feature to prevent it from interfering with the strings ( not depicted ) which are positioned right above it from the pivoting bridge element 401 . additionally , as it will be apparent to a person in the ordinary skill in the art , the whammy bar 415 and the saddles 410 may include many already commercially available parts as they may be easily removed in some embodiments . further , it will also be apparent to a person of the ordinary skill in the art , that in some embodiments of the present invention it may just be a plate holding the pivot bolts , mounting screws and springs allowing it to be a one piece device which may be desirable for some stringed musical instruments . however , in the preferred embodiments , the vibrato system device can include the two piece device system depicted in fig4 or one with more pieces as it may be desired , to provide a bendable part and a rigid spring piece . referring now to fig5 , an exemplary embodiment of the pivoting bridge element , 505 and 510 , of the vibrato device is depicted separated from the mounting plate 501 . at 510 a fixed plate is depicted . in this particular exemplary embodiment the fixed plate can be glued or fixed to a spring plate 505 . however , one plate may comprise both the fixed plate and the spring plate as depicted in fig5 a at 500 a . other variations can include separate plates which may be attached , screwed , glued or welded . for example , other separate plate configurations that may be used can include configurations depicted in fig5 b and 5c at 500 b and 500 c respectively . referring back to fig5 , the exemplary two piece component can allow the apparatus to pivot on the said jacking pivot axis bolts allowing the musical instrument &# 39 ; s strings to change tune or pitch . the said pivoting bridge element is equipped with clearance holes through the aft surface parallel to the orientation of the said string through the surface parallel to the musical instrument &# 39 ; s mounting surface . these holes can allow for the attachment of the spring tension adjustment screws to the pivoting bridge element . also in some embodiments , another set of threaded holes through the aft surface perpendicular to the orientation of the said string with the said hole axis being parallel to the axis of the said string may be included . these holes can be designed to receive intonation / mounting screws and said compression springs to constrain the said saddles in the axis being parallel to the axis of the said string . on a surface parallel to the musical instrument &# 39 ; s mounting surface there may be clearance holes to allow the said wood screws clearance for head protrusion .	6
detailed descriptions of the preferred embodiment are provided herein . it is to be understood , however , that the present invention may be embodied in various forms . therefore , specific details disclosed herein are not to be interpreted as limiting , but rather as a basis for the claims and as a representative basis for teaching one skilled in the art to employ the present invention in virtually any appropriately detailed system , structure or manner . turning first to fig1 there is shown a typical chlorosilane production reactor , 100 , which produces an effluent , 101 , comprising a mixture of solids and gases including , but not limited to , powdered silicon and other solids , chlorosilanes , hydrogen , hydrogen chloride , aluminum chloride and other metal chlorides . this stream , 101 , enters a solid removal means , 102 , such as a cyclone or filter system , from which most of the solids are discharged in a stream , 103 . however , sufficient solids , which serve as an external source of seeds , remain in a cleaned gas stream , 104 . the cleaned gas , 104 , is then cooled by a heat removal means , 105 , such as a heat exchanger or cooling system , wherein a portion of the cleaned gas stream , 104 , is condensed to form a stream , 106 , which contains solids , liquids and gases . this stream , 106 , then enters an initial gas separator / crystallizer , 107 . a gas stream , 112 , is cooled in a heat removal system , 113 , which has a coolant supply , 118 , and a return , 119 . the gas stream , 112 , now comprising mostly hydrogen and hydrogen chloride , leaves the initial gas separator / crystallizer , 107 , to be recycled . the liquids and solids are collected in the bottom of the initial gas separator / crystallizer , 107 , where they are mixed by an agitator , 108 , to keep the solids suspended in the liquid and to mix in a possible recycle stream , 152 , which can provide additional seed if needed . the mixture of liquid and solids in a stream , 120 , exits the initial gas separator / crystallizer 107 and enters a further heat removal means , 121 , such as a heat exchanger or cooling system , resulting in the formation of a supersaturated solution , 122 , and further crystallization on the seeds suspended in the solution , 122 . the supersaturated solution , 122 , then passes through a control valve , 123 , and exits as a lower pressure stream , 124 , which enters a second gas separator / crystallizer , 125 . any released gas and vapor , 128 , goes overhead , and then through a control valve , 129 , which maintains the pressure in the second gas separator / crystallizer , 125 . a reduced pressure gas stream , 170 , then enters a first chlorosilane distillation column , 160 . the liquids and solids entering the second gas separator / crystallizer , 125 , are retained in its bottom section and mixed with an agitator , 126 . a slurry , 127 , leaves the second gas separator / crystallizer , 125 , and enters a first solids separation means , such as a liquid cyclone or filter , 130 . the majority of the solids exit in a solids stream , 131 , together with some liquid chlorosilanes . this stream is then further processed in a second solids separation means , such as a liquid cyclone or filter , 132 , to further concentrate the solids in a high solids stream , 140 , and additional useful chlorosilanes are recovered in a primarily liquid stream , 133 . the high solids stream , 140 , is discharged through a valve , 141 , directly into a waste tank , 142 , which is agitated by an agitator , 143 , and heated by a jacket , 147 , which in turn has a heating supply , 148 , and a return stream , 149 . a liquid and solids stream , 144 , is sent for disposal or further treatment . a vapor stream , 145 , can also be sent for disposal or further treatment . an additional waste stream , 146 , is shown entering the tank from elsewhere in the facility . a recovered liquid chlorosilanes with reduced solids stream , 136 , exits the first solid separation means , 130 , and passes through a control valve , 137 , to form a lower pressure stream , 138 . the recovered liquid chlorosilanes with reduced solids stream , 133 , exits the second solid separation means , 132 , and passes through a control valve , 134 , to form a lower pressure stream , 135 . both streams merge to form a liquid feed stream , 139 , for the distillation column , 160 , which typically operates at 2 - 10 bar . the purified trichlorosilane , with a typical aluminum concentration of less than 1 ppb , exits in a stream 161 , the remaining alcl 3 exits in a bottoms stream , 162 , with a typical concentration of 30 - 100 ppm . the feed stream , 139 , may be heated by an optional feed heater , 163 , to form a heated stream , 159 , prior to entry into the column , 160 , as is common distillation practice . it is also possible to recycle some of the slurry from the second gas separator / crystallizer , 125 , by the provision of an additional suction line , 150 , a pump , 151 , and a discharge line , 152 . further modifications are possible to serve the same purposes . for example , a compressor , 164 , may be used to reduce the pressure in the second gas separator / crystallizer , 125 , and thus cause cooling as the liquid is evaporated ; this would also require the use of a pump ( not shown ) to pressurize the slurry stream , 127 . the control valve , 123 , may be located in front of the cooling means , 121 . in an example of the application of the process according to fig1 , there is shown a mass balance in table 1 . the reactor , 100 , operates at 30 bar and the solid removal means , 102 , is a cyclone with an efficiency of 96 % which produces 0 . 03 kg / hr of seed in the effluent . the mixture of gas and seed is cooled in a shell and tube heat exchanger , 105 , which recovers heat for the process and then enters the initial degasser / crystallizer , 107 , which is a pressure vessel with one hour residence time with a magnetic drive agitator , 108 . the outlet liquid stream , 120 , typically contains impurities in concentrations as shown in table 2 in addition to the chlorosilanes and methyl chlorosilanes . the heat removal means , 121 , is a shell and tube heat exchanger with internally polished or teflon coated tubes to reduce sticking . the outlet temperature is preferably maintained between 40 - 60 ° c . to ensure it is below the melting point of the alcl 3 . ph 3 adduct , which is 83 ° c . the second degasser / crystallizer , 125 , is a pressure vessel also of one hour residence time with a lower pressure of 10 bar and is agitated with a similar magnetic drive agitator , 126 . it should be noted that both agitators also generate seed by causing impact of the existing seed crystals with the agitator blade , the vessel wall and the seeds themselves . the crystal size distribution can thus be controlled within the preferred size range of 5 to 200 microns . the slurry , 127 , is fed to the first solids removal device , 130 , which is a liquid cyclone or hydroclone , which uses the liquid pressure to spin the liquid and remove the solids in a manner analogous to the more common gas cyclones . in order to achieve the high efficiency of about 98 %, four 1 inch diameter liquid cyclones are manifolded together in a common pressure vessel . operation is continuous and controlled by the control valves 137 and 134 which adjust the pressure differential and hence the flow splits . erosion in the cyclones is reduced by use of very hard alumina ceramics on the walls and / or the exit nozzles and provision of easily replaceable wear parts . the second solids removal device , 132 , is also a hydroclone but has only one liquid cyclone of ½ inch diameter and a solids accumulator which allows the build up of a high solids concentration ( typically 40 % by weight ) with periodic discharge of the solids , typically every 4 - 16 hours . the liquid discharge is still continuous even during solids discharge . the waste tank , 142 , receives some other waste , 146 , which is low in solids but has other impurities such as titanium tetrachloride and boron trichloride . the jacket , 147 , is heated by 150 psig steam , 148 , and there is a condensate stream , 149 . a vapor stream , 145 , and liquid / solids stream , 144 , are sent for further processing . the waste tank , 142 , isolates the solids which can contain the phosphorus adducts and prevents the return of phosphorus to the system even if some phosphorus is released . it can be seen from table 1 that the solids stream , 140 , has only 1 kg / hr of solids . therefore , even if the hydroclone , 132 , is only emptied at the maximum discharge time period , once every 16 hours , the maximum solids content is only 16 kg ; thus the chance of a significant phosphorus spike is minimized . turning to fig2 it can be seen that the solubilities of aluminum chloride , alcl 3 , are fairly linear when the log of the mole fraction is plotted against the reciprocal absolute temperature . it is of importance that the solubility in trichlorosilane ( tcs ) is one - third to one - quarter of the solubility in silicon tetrachloride ( stc ). thus the solubility of alcl 3 is dependent on the temperature and the mole fractions of tcs and stc in the mixture of chlorosilanes . it is important to establish that the alcl 3 stays in solution throughout the distillation column , 160 , when fed with the calculated feed concentration of alcl 3 . a convenient way to do this is to first use a stage by stage distillation column program , with standard properties for chlorosilane and aluminum chloride based on the assumption that the alcl 3 is dissolved , in order to establish the ideal alcl 3 , tcs and stc concentrations at every stage . second , confirm that the alcl 3 concentration remains below the solubility limit based on temperature and composition . it is important to note that the solid phase alcl 3 exerts its full vapor pressure while the dissolved alcl 3 exerts its vapor pressure based on its concentration multiplied by the full vapor pressure of the liquid alcl 3 . a simple check is to ensure that the bottoms stream 162 , which contains essentially all the alcl 3 in the column , can keep it in solution . from stream 159 the amount of alcl 3 is 1 . 35e − 3 kg moles and the stc is 28 . 8 kg moles . this is a concentration of 4 . 69e − 5 . the minimum temperature , from the equations in fig2 , is as follows . therefore , the minimum temperature of the bottoms stream , 162 , is 73 . 8 ° c . thus the tower operating pressure can be set to ensure the bottoms temperature is above this minimum temperature . the pressure in this example is 8 bar and the bottom temperature would be between 140 - 150 ° c . which is well above the required temperature . the minimum required pressure would be 1 . 6 bar assuming 100 % stc in the bottoms stream , 162 . it will be obvious to one skilled in the art that similar calculations can be performed for other column designs , such as using side draws . a further step is to check that the incoming feed stream , 159 , is free of suspended solids . at the feed stream temperature of 81 . 7 ° c . ( 354 . 85 k ) the solubility , from the equations in fig2 , is as follows . the further step is to multiply the respective molar solubility by the number of moles of stc and tcs ( see table 1 , stream 139 ), then sum those results to obtain the maximum number of moles of alcl 3 that can be dissolved in the stream . kg moles alcl3 dissolved in stc = 5 . 14 e − 5 * 28 . 8 = 1 . 48 e − 3 kg moles alcl3 dissolved in tcs = 1 . 43 e − 5 * 10 . 8 = 1 . 54 e − 4 turning to table 1 , stream 139 , there is a suspended alcl 3 content of 2 . 28 e − 4 kg moles and a dissolved alcl 3 content of 1 . 12e − 3 kg moles for a total alcl 3 content of 1 . 348 e − 3 kg moles . the ratio of the maximum alcl 3 dissolved content for composition of stream 139 at 81 . 7 ° c ., 1 . 634e − 3 kg moles , to actual alcl 3 content in stream 139 , 1 . 348 e − 3 kg moles , is 1 . 21 which provides sufficient driving force to dissolve the very fine particles which have carried through the solids separation devices within the residence time provided by the heater , 163 and the connecting piping to the distillation column , 160 . lower driving forces may be sufficient with longer residence times and vice versa . while the invention has been described in connection with a preferred embodiment , it is not intended to limit the scope of the invention to the particular form set forth , but on the contrary , it is intended to cover such alternatives , modifications , and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims . ** these may be present in the copper catalyst which is usually added to the metallurgical grade silicon , in which case the concentrations could be higher .	2
advantages of the present invention will become more apparent from the detailed description given hereinafter . however , it should be understood that the detailed description and specific examples , while indicating preferred embodiments of the invention , are given by way of illustration only , since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description . the invention provides a process for production and purification of rubusoside . in one embodiment of present invention , the process of the isolation and purification begins with providing stevioside derived from stevia rebaudiana extract , containing 90 - 100 %, preferably 95 - 99 % ( on dry basis ) stevioside . stevioside is dissolved in water to obtain a solution with 1 - 50 %, preferably 5 - 30 %, more preferably 8 - 10 % ( wt / vol ) concentration . the ph of the solution is adjusted to ph 3 . 0 - 8 . 0 preferably ph 4 . 5 - 6 . 5 and the temperature is maintained at 28 - 50 ° c ., preferably 35 - 45 ° c . an enzyme with glycosyl hydrolase activity is added to solution to make reaction mixture . non - limiting examples of enzymes include , rhamnosidase , β - glucosidase , hesperidinase , naringinase , pectinase , cellulase , and others , in free or immobilized forms . the reaction mixture is maintained at ph 3 . 0 - 8 . 0 preferably ph 4 . 5 - 6 . 5 and the temperature is maintained at 28 - 50 ° c ., preferably 35 - 45 ° c ., for about 12 - 24 hours , or long enough to allow the desired degree of conversion of stevioside to rubusoside occur . upon completion the reaction mixture is boiled at 100 ° c . for 10 - 30 min to inactivate the enzyme and then filtered with activated carbon and spray dried . alternatively the mixture can be additionally treated with ion exchange resins , purified by macroporous adsorption resins , membranes etc . the spray dried reaction mixture can be used “ as - is ” or subjected to further purification to prepare high purity rubusoside . for further purification the spray dried reaction mixture is admixed with a first aqueous alcoholic solution containing 70 - 100 %, more preferably 75 - 99 % alcohol to obtain a first mixture . the ratio ( wt / vol ) of spray dried reaction mixture to aqueous alcohol is 1 : 1 to 1 : 5 , more preferably 1 : 2 to 1 : 4 . the alcohol is selected from the group comprising ethanol , methanol , 1 - propanol , 2 - propanol or combinations thereof , more preferably ethanol and methanol . in another embodiment the first mixture is incubated at a temperature 10 - 100 ° c . more preferably 30 - 80 ° c . for 0 . 5 - 30 min more preferably for 1 - 10 min . in another embodiment the first mixture is then cooled to 0 - 40 ° c . preferably 10 - 20 ° c . at a rate of 8 - 11 ° c . per hour , and incubated at final temperature for 1 - 72 hours , preferably 1 - 24 hours to facilitate the crystallization of rubusoside . in another embodiment the crystallized rubusoside is separated from first mixture to become a first precipitate , and the remaining solution becomes a first filtrate . in another embodiment the first precipitate has 75 - 99 %, preferably 90 - 95 % ( on dry basis ) rubusoside content . in another embodiment the first precipitate is admixed with a second aqueous alcoholic solution containing 60 - 100 %, more preferably 70 - 90 % alcohol to obtain a second mixture . the ratio ( wt / vol ) of first precipitate to aqueous alcohol is 1 : 1 to 1 : 5 , more preferably 1 : 2 to 1 : 4 . the alcohol is selected from the group comprising ethanol , methanol , 1 - propanol , 2 - propanol or combinations thereof , more preferably ethanol and methanol . in another embodiment the second mixture is heated till full dissolution of first precipitate and 1 - 5 %, preferably 1 - 2 % of activated carbon is added and the mixture is incubated for 20 min at 60 - 70 ° c . subsequently the activated carbon is removed by means of press filter to obtain decolorized second mixture . in another embodiment the decolorized second mixture is incubated at a temperature 10 - 100 ° c . more preferably 30 - 80 ° c . for 0 . 5 - 30 min more preferably for 1 - 10 min . in another embodiment the decolorized second mixture is then cooled to 0 - 40 ° c . preferably 10 - 20 ° c . at a rate of 8 - 11 ° c . per hour , and incubated at final temperature for 1 - 72 hours , preferably 1 - 24 hours to facilitate the crystallization of rubusoside . in another embodiment the crystallized rubusoside is separated from decolorized second mixture to become a second precipitate , and the remaining solution becomes a second filtrate . in another embodiment the second precipitate has 90 - 100 %, preferably 95 - 100 % ( on dry basis ) rubusoside content . in another embodiment the second precipitate is further suspended in a third aqueous alcoholic solution containing 70 - 100 %, more preferably 90 - 99 % alcohol to obtain a third mixture . the ratio ( vol / vol ) of second filtrate to aqueous alcohol is 1 : 0 to 1 : 5 , more preferably 1 : 0 to 1 : 2 . the alcohol is selected from the group comprising ethanol , methanol , 1 - propanol , 2 - propanol or combinations thereof , more preferably ethanol and methanol . in another embodiment the third mixture is then incubated at 0 - 40 ° c . preferably 10 - 30 ° c . for 1 - 144 hours , preferably 24 - 72 hours . in another embodiment the third mixture is separated into a third precipitate and a third filtrate , where the third precipitate has & gt ; 98 % rubusoside content ( on dry basis ). in another embodiment the third precipitate is dried by any means known to art to provide dry crystalline powder . the hplc analysis of steviol glycosides was carried out as described in fao jecfa monographs 10 ( 2010 ), using an agilent technologies ( usa ) “ 1200 series ” chromatograph , equipped with luna c18 ( 2 ) 100 a ( phenomenex , usa ) column ( 4 . 6 × 250 mm , 5 μm ), using 32 : 68 ( v / v ) mixture of acetonitrile and 10 mmol / l sodium phosphate buffer ( ph 2 . 6 ) as mobile phase , and uv detector at 210 nm . the obtained rubusoside preparations can be used as sweetness enhancer , flavor enhancer and sweetener in various food and beverage products . non - limiting examples of food and beverage products include carbonated soft drinks , ready to drink beverages , energy drinks , isotonic drinks , low - calorie drinks , zero - calorie drinks , sports drinks , teas , fruit and vegetable juices , juice drinks , dairy drinks , yoghurt drinks , alcohol beverages , powdered beverages , bakery products , cookies , biscuits , baking mixes , cereals , confectioneries , candies , toffees , chewing gum , dairy products , flavored milk , yoghurts , flavored yoghurts , cultured milk , soy sauce and other soy base products , salad dressings , mayonnaise , vinegar , frozen - desserts , meat products , fish - meat products , bottled and canned foods , tabletop sweeteners , fruits and vegetables . additionally the highly purified rubusoside preparations can be used in drug or pharmaceutical preparations and cosmetics , including but not limited to toothpaste , mouthwash , cough syrup , chewable tablets , lozenges , vitamin preparations , and the like . the highly purified rubusoside preparations can be used “ as - is ” or in combination with other sweeteners , flavors and food ingredients . non - limiting examples of sweeteners include steviol glycosides , stevioside , rebaudioside a , rebaudioside b , rebaudioside c , rebaudioside d , rebaudioside e , rebaudioside f , dulcoside a , steviolbioside , as well as other steviol glycosides found in stevia rebaudiana bertoni plant and mixtures thereof , stevia extract , luo han guo extract , mogrosides , high - fructose corn syrup , corn syrup , invert sugar , fructooligosaccharides , inulin , inulooligosaccharides , coupling sugar , maltooligosaccharides , maltodextins , corn syrup solids , glucose , maltose , sucrose , lactose , aspartame , saccharin , sucralose , sugar alcohols . non - limiting examples of flavors include lemon , orange , fruity , banana , grape , pear , pineapple , bitter almond , cola , cinnamon , sugar , cotton candy , vanilla flavors . non - limiting examples of other food ingredients include flavors , acidulants , organic and amino acids , coloring agents , bulking agents , modified starches , gums , texturizers , preservatives , antioxidants , emulsifiers , stabilisers , thickeners , gelling agents . 20 g of stevioside extract produced by “ purecircle sdn bhd ” ( malaysia ), containing 98 . 1 % ( on dry basis ) stevioside , and 1 . 2 % rebaudioside a was dissolved in 200 ml of water and mixture was heated to 80 ° c . and maintained for 10 min until complete dissolution . then the mixture was cooled to 37 ° c . and the ph was adjusted to ph 5 . 0 . 20 units ( about 6 g ) of “ hesperidinase from aspergillus niger ” ( sigma - aldrich pn h8137 ) was added and the reaction mixture was incubated at 37 ° c . under continuous agitation . after 24 hrs the hplc analysis of reaction mixture sample , showed 98 % of stevioside conversion to rubusoside . the reaction mixture was boiled at 100 ° c . for 15 min and then cooled down to 80 ° c . 2 g of activated carbon was added and the reaction mixture was incubated for 30 min at 80 ° c . and then the carbon was separated by filtration . the obtained filtrate was evaporated under vacuum to about 30 % total solids and spray dried to produce about 24 g powder containing about 59 . 9 % rubusoside ( dry basis ). 10 g of spray dried reaction mixture prepared as per example 1 and containing 59 . 9 % rubusoside was dissolved in 200 ml of water and the solution was passed through a column packed with 200 ml amberlite xad 7 hp macroporous adsorbent . the column was washed with 3 bv of water and the adsorbed rubusoside was eluted with 300 ml 70 % ethanol . the ethanol was evaporated and the obtained aqueous solution was dried to yield about 6 g of dry matter with 96 . 3 % rubusoside content ( dry basis ). 10 g of spray dried reaction mixture prepared as per example 1 and containing 59 . 9 % rubusoside , was dissolved in 30 ml of 98 % methanol and the mixture was heated to 60 ° c . and maintained for 10 min . then the mixture was cooled to 10 ° c . at a rate of 10 ° c . per hour . during the cooling the mixture was subjected to continuous moderate agitation . starting from about 15 ° c . fine crystals were formed . the amount of crystals subsequently increased . the mixture was incubated at 10 ° c . during 24 hrs . the crystals were separated by filtration and washed on the filter by pure methanol preliminarily chilled to 4 ° c . the obtained crystals were dried under vacuum at 80 ° c . to yield about 6 . 1 g crystals with 94 . 5 % rubusoside content ( dry basis ). 5 g of rubusoside prepared as per example 3 was suspended in 1000 ml of 92 % methanol at room temperature . the mixture was heated and maintained at 30 ° c . during 48 hours . the crystals were separated by filtration and washed on the filter by pure methanol . the obtained crystals were dried under vacuum at 80 ° c . to yield about 4 . 1 g crystals with 98 . 5 % rubusoside content ( dry basis ).	0
tone mapping is a process of taking a hdr image with a high dynamic range and with typically 16 bit or 32 bit , and converting such an image into an image that has contrast that was optimally adjusted for the screen or for a printer . the simplest class is called monotonic tone mapping , defined as in equation 1 , j is the tone mapped image , i . e ., the image the contrast of which as adjusted for screen or print , i is the original hdr image , and t is a function that is strictly monotonic increasing . this means that if pixel j xy is darker than pixel j x ′ y ′ in the contrast adjusted image , the piece of surface in the original scenario corresponding to ( x , y ) was also darker than the piece of surface corresponding to ( x ′, y ′). hence , the name monotonic . a preferred class of tone mapping functions , called adaptive tone mappings , is as it can be seen , t is dependent from i and the current location , so that the contrast change of a pixel can be dependent on the surrounding image structure . this is done to lighten up structures in dark areas more than structures in bright areas . imagine a person photographed against a bright sky , then all pixels in the face in i will be darker than most pixels in the sky in i . however , if t is adaptive , some pixels in the face in j may be brighter than some pixels in the sky in j . this enables better viewing . however , local contrast should be kept , so that j xy & gt ; j x ′ y ′ i xy & gt ; i x ′ y ′ if ( x ′, y ′) is spatially close to ( x ′, y ′). this condition is called “ locally monotonic mapping ”, and while this condition may be violated in a small percentage of pixels in an image , it is an important condition to ensure that the resulting image contains meaningful details . j xy = t ( i , x , y , p xy1 , p xy2 . . . p xyn ) [ equation 03 ] p xyn are n different local parameters . for instance , ashikmin suggests a tone mapping that is based upon a kernel of variable size , where the size of the kernel is based upon the local image contrast ( parameter “ s ” in [ ash02 ]). this can be written as : where s is the radius of the convolution kernel used at the location x , y . alternatively , this can be written as : where p is a matrix that resulted in convolving i with a variable radius . note that [ ahs02 ] processes p not by processing different convolution radii for every pixel , but by blending differently convolved images into one another based on a local parameter , which results in the same effect . there is a major difference between equations 04 and 05 : to compute t ( i , x , y , s xy ) with given parameters , a kernel needs to be convolved with i at every location ( x , y ), but computing j xy = t ( i , x , y , p xy ), where the matrix p is provided as an input parameter , will require much less computing power , once p is given . this is an important observation , since tone mapping is a computational time - intense process . in the following sections we will disclose how to enhance the process of converting a matrix i of hdr data into an enhanced resulting image j . in the following sections well introduce some general forms of the algorithms first for a better understanding , and then fill in additional variations later and point out where the advantages of the suggested algorithms lie . receive hdr image i , so that min ( i ) = 0 . 0 and max ( i ) = 1 . 0 calculate p 1 , p 2 , ... based on data in i approaching a hdr conversion in this sense provides an attack point for an acceleration . as said earlier , computing p out of i ( for instance by applying a convolution kernel on i , or a local contrast detection on i ) may be computing intense and calculating j in line 40 may be a lot faster , depending on the actual hdr conversion . one way of accelerating the procedure is to calculate p ( when we say p we mean p 1 , p 2 , p 3 , . . . ) at a lower resolution , e . g ., sub - sampling the p matrix . if i and j have dimensions of 1000 × 1000 pixels , p might be sub - sampled to a resolution of 100 × 100 pixels . then the function t in line 40 would need to up - scale p to a size of 1000 × 1000 pixels for calculating j out of i and p . however , this is a non - time - consuming process , particularly if a nearest - neighbor interpolation is used . fig1 shows the relation of the matrixes i , p , j mentioned in [ routine 1 ] and [ equation 5 ]. fig2 shows the same matrixes where a lower resolution of p is illustrated . fig3 shows four images : fig3 . 1 represents a matrix i containing unmapped hdr data . fig3 . 2 shows an image j derived from i using a routine as in [ routine 01 ] where a full resolution matrix p was used . fig3 . 3 shows an image j derived from i using a routine like routine 01 , where p was used at a very low resolution . fig3 . 4 shows an image j derived from i using a routine like routine 01 where all matrixes j , p , and i were kept at a low resolution . as it can be seen by comparing fig3 . 3 and fig3 . 4 , downsizing only p leads to much less loss in quality than downsizing all data i . of course , fig3 . 3 and fig3 . 4 are exaggerated ; in the real world , the blocking should be much less visible . a method embodying this technique comprises starting a processing thread by calculating p at a very low resolution , and then allowing for fast display of the image , so that the user can see a result very quickly . when the thread is finished calculating p at a very low resolution , another thread can be started to calculate p at a finer resolution and so forth until p is calculated at a sufficiently high resolution . this allows for a conversion that is extremely responsive , where the user sees first results extremely quickly and where calculating the full resolution image will take place shortly later . this can be extended to a system where the user can influence the tone mapping locally . local adjustment of tone mapping is feasible using the invention disclosed since we have a system that allows for a speedy feedback of changes to the user via a quick preview . fig4 shows an overview over such an enhanced workflow , featuring sets of matrixes c , u and p . note that when we say p , we always refer to a set of matrices p 1 , p 2 , p 3 . . . , same for c and u . each set of matrices can consist of one or more matrices . in fig4 , i refers to the hdr data , c refers to data derived from the image i , such as a i convolved with a kernel , a calculated convolution kernel radius , wavelet coefficients , an edge - detection and the like . z refers to data that the user has input . this can be for instance brush stroke information , such as note : the variable “ effect ” is described later in this disclosure . please note also that depending on the implementation , the brush stroke receiving routine may be implemented in a way that produces a matrix of data instead of single brush stroke coordinates . also , please note that z may contain other selective user input , such as a gradient effect , a “ magic wand ” selection connected with an effect , an irp or an irr ( with reference to u . s . pat . no 7 , 031 , 547 , u . s . pat . no . 6 , 865 , 300 , and u . s . pat . no . 6 , 728 , 421 , which are incorporated herein ). as it can be seen in fig4 , u ( id est : u 1 , u 2 . . . ) is derived both from z and from i . this is one aspect of this invention . this is explained in the following sections . first , to define u : u is a matrix or matrices that contain adapted data based on a user input and adapted to the image , providing information to succeeding algorithms on what the user wants where to which intensity on a pixel - by - pixel - basis . for instance , assume that in an image containing a sky a user has drawn a brush stroke extending from the top left to the top right . then z contains the brush stroke coordinates , i contains hdr data representing an image with said sky , and u could be calculated as follows : set pixels at the coordinates provided in z to 1 . 0 in r find all pixels neighboring values of 1 . 0 in r , store those in r ′ delete those pixels in r ′ corresponding to a detected edge of i ( see in other words , routine 02 finds a matrix of pixels u that contain a value of j for all those pixels in i ( respectively j ) where the user appears to desire a certain effect . note that the advantage in routine 02 is that the data z are adapted to the image using hdr values of i . remember that hdr values have a very high dynamic range . so for instance , imagine an image containing ( a ) shadows , ( b ) dark objects , ( c ) bright objects , ( d ) a bright sky , ( e ) white clouds , and ( f ) a light source . then i will due to its nature show strong luminance differences between a and b , b and c , c and d , d and e and e and f . in a tone - mapped / compressed image j , these differences cannot be present to the same extent due to the nature of tone - compressed images . therefore the data in i will be much more suitable to be used for an adaptive routine like routine 02 than any other non - hdr data , for instance because detail differences , colour differences and edges are a lot stronger in i . please note that parallel to routine 02 , there are other techniques that can take user input and adapt / refine the area of user input based on the image data , such as the smart eraser tool in photoshop ®, irp &# 39 ; s described in u . s . pat . no . 7 , 031 , 547 , u . s . pat . no . 6 , 865 , 300 , and u . s . pat . no . 6 , 728 , 421 ; irr &# 39 ; s described in “ user definable image reference regions ” u . s . application ser . no . 11 / 832 , 599 , incorporated herein ; and “ self - adaptive brush for digital images ” u . s . application ser . no . 11 / 674 , 080 , incorporated herein . all of these adaptive routines will benefit in their selectivity if the reference image has a high differentiation of its details . fig4 further shows that the adapted data provided in u and the hdr - related data in c are merged to a matrix / matrices p . for instance , let us assume for now that the data in c contain a suggested luminosity adaptation factor , for instance so that : would be a simple tone mapping , where i is any constant . this states simply that multiplying the pixels in i with the ( scalar ) factors in c yields in an adapted , tone - compressed version of j . the multiplication symbol “” here refers to a scalar multiplication . which means that p can be calculated by simply adding c and u , or in other words : the function f is a simple addition . note that more complex implementations of f are possible and will be discussed later . note that the tone mapping is here just a multiplication of i with a value in p . speaking in imaging terms , this means that through input z the user can provide ( adapted ) input to the system to further define where the brightness adaptation of the tone mapping should be increased or decreased to his or her desire . note that the effect of p need not be limited to brightness changes only , p ( respectively p 1 , p 2 . . . ) can also represent other parameter ( s ) of the tone mapping that are suitable to be separated from the process and stored in a matrix , the user may desire having influence over , or affect the visual appearance of the result . the process depicted in fig4 is also shown in routine 03 : receive hdr image i , so that min ( i ) = 0 . 0 and max ( i ) = 1 . 0 note that i would typically be a 16 bit or 32 bit image . i can be derived from merging a variety of input images of different exposures into one image , or it can be simply a 8 bit , 12 bit or 16 bit image coming from a camera with a good dynamic range , which includes good digital cameras , scientific , or medical cameras . the function a ( ) can be a function that derives pre - calculated data from the hdr image i . for instance , if the herein disclosed implementation is based upon the algorithm suggested by [ ash02 ], a xy , 1 ( i ) can represent a suggested radius for each coordinate in i , or a xy , 2 ( i ) can represent the value obtained by convolving i at the coordinate ( x , y ) with a suitable kernel . or , in a more general case , a xy ( i ) can provide a suggested brightness - adjustment value derived from the image i . keep in mind that the luminosity component of all tone mapping routines can be brought to the form j xy = c xy i xy , where c xy is a brightness adjustment factor for the luminosity . b ( ) is a function that calculates u out of z and i in a suitably fashion , and examples for how to do this were given in [ routine 02 ] and in the section following routine 02 . f ( ) is a function that combines u and c into p . imagine that if p represents radii for all x , y for a convolution kernel to be used for the tone mapping in t ( ), then c could contain radii of a convolution kernel suggested by an algorithm , and u could contain data where the user would wish a radius increase or decrease . terms as “ brightness ”, “ contrast ”, “ halo - protection ”, “ detail sensitivity ”, may be more user - friendly terms for internal parameters . t ( ) was already discussed , see equations 03 , 04 and 05 . fig5 represents in an abbreviated graphical form the desired hdr conversion details that the user may communicate to the disclosed system . as shown , there are general hdr conversion parameters that the user may chose for the whole image , and there are local hdr conversion parameters provided to the system . fig6 displays a graphical user interface (“ ui ”) of a system using one embodiment of the invention . as shown , it features brushes with which the user can influence the hdr conversion parameters . note that in the concept depicted in fig6 the user has a radio button where he can select whether to edit the main tone mapping parameters or the tone mapping parameters of a currently selected region . depending on the setting of that radio button the user can adjust the settings of that according area via the control sliders to the bottom right of the interface . additionally the user is offered to use brushes to increase or decrease a certain effect . note that the selection line displays a region that the user has selected , the boundaries of which could be stored in z . also note that there is a striped area around the selected region , indicating the area of “ image adaptation .” in other words , z represents only the selected region , while u represents an area as large as the striped area and the selected region together . it is a design choice whether the effect of the brushes is supposed to override the adjustments that the user has made within a region or vice versa . in this case , for better handling , editing of certain parameters via brushes and editing of unrelated parameters via regions was allowed . fig7 displays different matrices . fig7 . 1 represents a ( un - mapped ) hdr image , id est where no details were adapted to the dynamic range of a computer screen or printer . fig7 . 2 shows an image as it could result from an hdr tone mapping process , and fig7 . 3 shows such a tone - mapped image where the user has taken some selective control over the tone mapping process . here , the user has desired to keep the sky dark while rendering the house bright . fig7 . 4 represents two matrices as they may occur in c , fig7 . 5 may represent the matrix u , and 7 . 6 may represent the matrix p . as you can see , the user input represented in matrix u , fig7 . 5 , has influenced the matrix p . note that the white pixels in fig7 . 5 may represent “ zero ” or “ nil ” or “ transparent ”, depending on how the function f is designed . those skilled in the art may know that many methods are possible to ensure that the areas in u where the user wishes to not influence the given results do not affect p . for instance , if f follows the principle of p = c + u , then areas of no user influence can be represented with zeros . if values in u are meant to overwrite c , then u should have transparency data ( an “ alpha channel ”) ensuring that u does not overwrite c everywhere . in general , any such tone mapping parameter that would in the end of the process be stored in p ( p 1 , p 2 , . . . ) could refer to , e . g ., the brightness of the resulting pixels in j , the contrast of the resulting pixels in j , the haloing strength in a region in j , the detail retention in a region in j , a color temperature adjustment of resulting pixels in j , a color brilliance adjustment of resulting pixels in j , a sharpness of resulting pixels in j , or a number representing which tone mapping algorithm is preferred in what area in j . it will be evident to those skilled in the art that various implementations of z , u and f can be programmed that allow the user for instance to increase or to decrease any such parameter in an image region , or it can be forced to a fixed value . as an example for now , let us focus on brightness changes . if a system is implemented as discussed in this disclosure , the user might initially see an image j as shown in fig7 . 2 . the user could then communicate to the system using for instance a pointing device such parameters z that are suitable to communicate to the system that the user wishes a darker sky . such a system could be for instance a brush engine , or an irp system or an irr system or a lasso - like selection or anything the like . then this user input is converted into u , then u and c are merged into p , and p is used to display a new version j of the image on the screen , as shown in fig7 . 3 , allowing the user to either accept the result or to refine it further . in another embodiment , the user may not only be allowed to take influence over parameters that are necessarily required for tone mapping , but also other parameters such as color change , noise reduction , and unsharp mask sharpening , etc . if these parameters are also stored in p , the suggested system ( for instance as shown in fig4 ) can allow for both a tone - mapping and other local adjustments in a fashion where the user has influence over all important image parameters , and where the user has the benefit that selection precision is enhanced since the original hdr data can be used to automatically adapt user input to the image , for example , function b . if the hdr conversion function t that is supposed to be implemented does not provide support for additional color or detail changing parameters , such function can easily be constructed as t = t 1 ∘ t 2 = t 1 ( t 2 ) where either t 1 or t 2 is the original tone mapping and the other is an image change function supporting additional color and detail changes . in another embodiment , i may not be a perfectly merged hdr image . it is common to create hdr images out of a series of images with different exposure , shot on a tripod . if this process was done poorly , or with a bad tripod , or without a tripod , the resulting image may show poor overlays in j . in such case the system provided herein may keep the hdr data as a series of 8 bit or 16 bit images ( the original images ) and only merge them by the time the function t is executed , overlaying them either using a so - called image registration technique , or allowing the user to overlay the images manually , or to first overlay the images using an image registration technique and to further allow the user to further register the images himself . in any case , it may be advisable to allow the user to provide registration input via z , so that some matrixes u n , u n + 1 . . . may contain spatial offset information used to adapt source images to one another to enhance the rendered image . fig8 shows how a poor image registration might not match two details , leading to some sort of “ double vision ” effect in j . here the user can place two marks on the details to communicate to the system what objects need to be overlaid . note that the user may have difficulties in communicating to the system which detail of which source image he is referring to . therefore , the system may not receive information from the user which of the two marks refers to which original image — which means that the two marks define the required correction vector , but the signature of this vector will be unknown . in this case , the correction vector should be used that leads locally to a better match , id est within a radius r ≈ 10 . . . 30 pixels . in another embodiment , the scene may contain moving objects such as people or vehicles . if that is the case , the hdr data matrix i will contain details that do not entirely match . in this case , there is a benefit from a system where i is kept as individual images i 1 , i 2 . . . and where they are merged into one image later in the process , which is when t is applied . as will be known to one of ordinary skill in the art , it is possible to register images , even if they have different brightnesses , so that it such functionality can be added into t . fig9 illustrates a system where the user can take influence over image details . if the user spots an object that moved or changed while the series of images were being taken , the user may point in a system to that object with his pointing device cursor ( see fig9 , 9 . 1 ), and the system can then analyse which two or more images i n , i n + 1 . . . out of the series of original images i 1 , i 2 . . . contributed to the detail in this area . then a second user interface area can be shown to the user ( 9 . 2 ) where the user can select which of the images i n , i n + 1 . . . contains the optimal detail . once the user has provided this information , the system can allow the user to brush in the wanted detail ( respectively : the “ desired version ” of a face / an object ). this information can then be stored in u and be fed into function f , so that t can then render the final result , fig9 . 3 , based upon what detail the user wanted at the given location . in order to build a system that supports the feature named above , the system needs to be able to assign weights ω 1 , ω 2 , . . . to the pixels in i 1 , i 2 . . . . it is known in the art to implement weights as a function of the brightness of pixels in the images i 1 , i 2 . . . , so that the extremely dark and bright pixels contribute less to the result . it would be possible to enable the user to further influence these weights in certain areas , so that certain elements of an individual source image i i do not contribute to the final result . with relation to fig9 , the user would select a preferred “ face version ”, id est a preferred in , and then perform some brush strokes in the desired area . the algorithm would then set ω n for that area to 1 . 0 and all other ω to zero . of course , the system needs to ensure that no pixel exists that is assigned with zero weights in all i 1 , i 2 . . . . an image response function can be calculated as a function of zij . it is feasible to calculate the image response function based upon only those zij the related weights of which were not influenced by the user . ( with relation to fig9 , this means that the image response function is calculated based on the pixels that the user has not applied a brush stroke to , id est all pixels that don &# 39 ; t belong to the face ). the precision of calculation of such an image response function will benefit if the user excludes pixels via weights ω 1 , ω 2 , . . . belonging to objects that moved while the series of images was taken . note that the image response function can be calculated based on a subset of pixels of the image , and once the image response function is calculated , a 32 bit hdr image can be constructed from all given pixels and their assigned weights . currently , it is common to create hdr shoots with a camera mounted onto a steady tripod . however , since image registration is a widely known technique in image processing , it is technically feasible to allow for hdr shooting without a tripod and with registering the images automatically . registration means to calculate offsets between images based on their contents , so that images can be overlaid so that same image details match . fig1 shows a series of registered images . as can be seen , the user has shaken the camera significantly between the shots . as it can also be seen , a cloud has moved while the series of images was taken . fig1 . 4 illustrates in its gray area the portion of pixels that can be kept . this is a considerably small area . fig1 . 1 illustrates with numbers ( 1 , 2 , 3 ) how many pixels from i 1 , i 2 , i 3 are available to reconstruct the merged , tone - mapped image j at each location . if via the weighting system introduced above a hdr merging and tone mapping system is implemented that is capable of processing input images i 1 , i 2 . . . that feature weights ω n = 0 for certain pixels , the reconstructed image area can be larger than the area covered by all three images by assigning a weight ω = 0 . 0 to nonexistent pixels . essentially , the input images are padded so that they have the same dimensions after registration , and the pixels added during padding are assigned zero weight . as illustrated in fig1 . 5 , the image area may increase dramatically if the final image can now be reconstructed from the area where pixels from only two out of three images were available . many routines exist that are capable of registering images that were not only shifted , but also rotated and enlarged ( zoomed ) in relation to one another , so that the system shown herein works also if the user has rotated or moved the camera between the shoots or changed the zoom or moved his own position . fig1 . 1 shows what a result would look like without the padding and weighting system introduced herein , and fig1 . 2 shows how the total image area can increase and how the cloud can benefit if said padding and weighting system is implemented . it is possible to combine the manual weighting with area maximization . note the oval marked “ 1 ” in illustration 10 . 1 , indicating that the user has assigned a weight of 1 . 0 to one of the images within that oval and weights of 0 . 0 to the other images , ensuring that no inferences of various clouds occur in the result . this relates to the feature depicted in fig9 . in another embodiment , a color filter can be applied to the tone - mapped image j that receives as an input the corresponding brightness in the original scenario , id est in i . for instance , imagine an image taken within a room with low - temperature illumination of around 3000 ° k . the image also contains an outdoor scene seen through a window , illuminated by 6800 ° k . while fixing this solely based on a tone - mapped image j is possible using conventional adaptive color filters , it may be easier to apply a color correction filter to j as a function of values in i — id est before the tone mapping was applied . in other words : color - correcting those pixels in j that relate to dark pixels in i , as opposed to color - correcting the pixels that are dark in j . in other words , even after the tone mapping was applied and the image j is created , further image processing routines may benefit in their selectivity if the values of i are provided as input parameters for color filters , sharpness filters , or selectivity filters . as an almost equal alternative , pre - processing of the images i 1 , i 2 , . . . is possible , which leads to the same effect . if the darkest image i 1 contains colors mainly illuminated with 3000 ° k , and if the brightest image i v contains colors mainly illuminated with 6800 ° k , the color temperature of all i v , 1 & lt ;= v & lt ;= v , can be fixed as a function of v . note that for optimal results this colour change in i 1 , i 2 , . . . , i v should take place after an image response function has been calculated ( to not introduce errors through the color correction ), but before merging and tone - mapping the images i 1 , i 2 , . . . , i v into j . fig1 illustrates a hard drive , a system memory , and a display device . it is illustrated that at the beginning of a retouching session of a user , there may be an “. exr ” file on the hard drive which contains ( by its very definition ) hdr data , typically in 32 bit . current systems allow the user to either modify the hdr data and save it back , or to tone - map the hdr data and save a jpg , tiff or the like . in fig1 it is illustrated that this invention disclosed herein allows for fast displaying of a tone - mapped image j on a screen to the user , while receiving refined tone - mapping related input from the user via z , so that a process can save back i , u , c , z , etc . to a file , as illustrated . if , for instance , the system would allow the user to save back i , c , u , and z ( c and u possibly in low resolutions ), the user would be able to open the file later , maybe even on a different computer , and see the edited on - screen - result j in fast time , while still working on the original hdr data i . alternatively , it may be sufficient to store i and z on the hard drive , since the invention disclosed herein allows for calculating first results of j on the screen very quickly . alternatively , the system may store i and z , plus any of the matrices u , i , p at whatever resolution they were present in memory by the time of saving data to the hard drive , or any lower resolution of u , i , p may be stored for saving hard drive space . all features disclosed in the specification , and all the steps in any method or process disclosed , may be combined in any combination , except combinations where at least some of such features or steps are mutually exclusive . each feature disclosed in the specification , including the claims , abstract , and drawings , can be replaced by alternative features serving the same , equivalent or similar purpose , unless expressly stated otherwise . thus , unless expressly stated otherwise , each feature disclosed is one example only of a generic series of equivalent or similar features . this invention is not limited to particular hardware described herein , and any hardware presently existing or developed in the future that permits processing of digital images using the method disclosed can be used , including for example , a digital camera system . a computer readable medium is provided having contents for causing a computer - based information handling system to perform the steps described herein . the term memory block refers to any possible computer - related image storage structure known to those skilled in the art , including but not limited to ram , processor cache , hard drive , or combinations of those , including dynamic memory structures . preferably , the methods and application program interface disclosed will be embodied in a computer program ( not shown ) either by coding in a high level language . any currently existing or future developed computer readable medium suitable for storing data can be used to store the programs embodying the afore - described interface , methods and algorithms , including , but not limited to hard drives , floppy disks , digital tape , flash cards , compact discs , and dvd &# 39 ; s . the computer readable medium can comprise more than one device , such as two linked hard drives . this invention is not limited to the particular hardware used herein , and any hardware presently existing or developed in the future that permits image processing can be used . any currently existing or future developed computer readable medium suitable for storing data can be used , including , but not limited to hard drives , floppy disks , digital tape , flash cards , compact discs , and dvd &# 39 ; s . the computer readable medium can comprise more than one device , such as two linked hard drives , in communication with the processor .	6
in the description of the present invention , it should be noticed , orientation or position relation indicated by terms such as “ at the center of ,” “ on ,” “ below ,” “ in front of ,” “ behind ,” “ at the left of ,” “ at the right of ” are orientation or position relation in connection with the figures . these terms are used to simplify the description of the present invention , and are not intended to indicate or suggest a specific configuration or orientation in operation for the device or element being described . therefore , these terms cannot be construed as limitations to the present invention . in addition , terms such as “ first ” and “ second ” are used for descriptive purpose and shall not be construed as indicating or suggesting an element is more significant than another . in the description of the present invention , it should be noticed , unless otherwise specified , terms such as “ mounted ,” “ joined ,” and “ connected ” should be construed in their broad sense . for example , “ connected ” includes “ fixedly connected ,” “ detachably connected ,” or “ integrally connected ”; it also includes “ mechanically connected ” or “ electrically connected ”; it further includes “ directly connected ,” “ connected via an intermediate element ,” or implies the inner connection of two elements . the meaning of each of these terms in the present invention shall be construed by the persons having ordinary skills in the art based on the specific context . in addition , unless otherwise specified , in the description of the present invention , “ a plurality of ,” or “ several ” means two or more than two . fig1 to fig6 disclose a first embodiment of a large current female connector for high - speed transmission . referring to fig1 to fig3 first , the insulating body includes an upper insulating body 21 , a middle insulating body 23 , a lower insulating body 22 , an upper terminal group 31 disposed on the upper insulating body 21 , and a lower terminal group 32 disposed on the lower insulating body 22 . the corresponding two power terminals in the upper terminal group 31 and the lower terminal group 32 are connected to form a big power terminal 4 . insulating body trenches 5 are disposed respectively on the upper insulating body 21 , the middle insulating body 23 , and the lower insulating body 22 . when the upper terminal group 31 is disposed on the upper insulating body 21 and the lower terminal group 32 is disposed on the lower insulating body 22 , the big power terminals 4 are disposed correspondingly in the insulating body trench 5 on the upper insulating body 21 and in the insulating body trench 5 on the lower insulating body 22 . when the upper insulating body 21 and the lower insulating body 22 are engaged with the middle insulating body 23 , the big power terminal 4 should be correspondingly disposed in the insulating body trench 5 formed from the middle insulating body 23 . then the upper insulating body 21 , the middle insulating body 23 , and the lower insulating body 22 are engaged tightly to form an integrated device . then the integrated device is mounted in the case 1 . a rib 11 is disposed on the case 1 . the rib 11 makes the case 1 more robust , preventing the dovetail connection from being popped out . the case 1 further includes a welding foot 12 so as to mount the connector on a pcb . therefore , as the corresponding two power terminals in the upper terminal group 31 and the lower terminal group 32 are connected together , the current capacity of the big power terminal 4 combining two power terminals increases significantly . a large current carrying connector can thus be realized . the charging speed of a battery with high electrical capacity can thus be accelerated . to achieve the high frequency transmission of the terminal group , the upper terminal group 31 and / or the lower terminal group 32 at least includes a high frequency terminal pair 312 . the thickness of the contact portion 3121 of the high frequency terminal pair 312 is smaller than the thickness of the portion 3122 adjacent to the contact portion 3121 ( as shown in fig4 to fig6 ). to reduce the signal interference between the upper and lower terminal groups , a shielding sheet 7 is further included . a shielding sheet trench 6 for accommodating the big power terminal 4 is disposed on the shielding sheet 7 . the shielding sheet 7 is disposed in the middle insulating body 23 . when the upper insulating body 21 and the lower insulating body 22 are engaged with the middle insulating body 23 , the big power terminal 4 is correspondingly disposed in the insulating body trenches 5 and simultaneously disposed in the corresponding shielding sheet trench 6 . to improve the shielding effect of the shielding sheet , the shielding sheet 7 includes an upper spring plate 71 and a lower spring plate 72 . the upper spring plate 71 is physically and electrically connected to the upper ground terminal 311 disposed on the upper insulating body 21 . the lower spring plate 72 is physically and electrically connected to the lower ground terminal 321 disposed on the lower insulating body 22 . to improve the engagement between the upper insulating body 21 and the lower insulating body 22 , a first shielding engaging case 81 and a second shielding engaging case 82 are further included . a first hook 811 is disposed on the first shielding engaging case 81 . a second hook 821 is disposed on the second shielding engaging case 82 . meanwhile , a first hooking portion 231 and a second hooking portion 232 are disposed on the upper surface and the lower surface of the middle insulating body 23 , respectively . the first shielding engaging case 81 is engaged with the upper surface of the middle insulating body 23 , wherein the first hook 811 is interlocked with the corresponding second hooking portion 232 on the middle insulating body . then , the second shielding engaging case 82 is engaged with the lower surface of the middle insulating body 23 , wherein the second hook 821 is interlocked with the corresponding first hooking portion 231 on the middle insulating body 23 . the present invention can be implemented as a second embodiment ( not shown in the figures ). the second embodiment is essentially the same as the first embodiment , except that the insulating body includes an upper insulating body and a lower insulating body , in which the upper terminal group is disposed on the upper insulating body , and the lower terminal group is disposed on the lower insulating body . insulating body trenches are disposed respectively on the upper insulating body and the lower insulating body . when the upper terminal group is disposed on the upper insulating body and the lower terminal group is disposed on the lower insulating body , the big power terminal is disposed correspondingly in the insulating body trench on the upper insulating body and in the insulating body trench on the lower insulating body . the upper insulating body and the lower insulating body are engaged with each other to form an integrated device . to reduce the signal interference between the upper and lower terminal groups , a shielding sheet is further included . a shielding sheet trench for accommodating the big power terminal is disposed on the shielding sheet . the shielding sheet is disposed between the upper insulating body and the lower insulating body . when the upper terminal group is disposed on the upper insulating body and the lower terminal group is disposed on the lower insulating body , the big power terminal is correspondingly disposed in the insulating body trenches and simultaneously disposed in the corresponding shielding sheet trench . the present invention can be implemented as a third embodiment ( not shown in the figures ). the third embodiment is essentially the same as the first embodiment , except that the insulating body is integrally formed . the upper terminal group and the lower terminal group are disposed on the insulating body . an insulating body trench for accommodating the big power terminal is disposed on the insulating body . when the upper terminal group and the lower terminal group are disposed in the insulating body , the big power terminal is disposed correspondingly in the insulating body trench . the insulating body is then disposed into the case . to reduce the signal interference between the terminal groups , a shielding sheet is further included . the shielding sheet is inserted in the insulating body in advance . a shielding sheet trench for accommodating the big power terminal is disposed on the shielding sheet . when the upper terminal group and the lower terminal group are disposed in the insulating body , the big power terminal is correspondingly disposed in the insulating body trench and simultaneously disposed in the corresponding shielding sheet trench . to improve the shielding effect of the shielding sheet , the shielding sheet includes an upper spring plate and a lower spring plate . the upper spring plate is physically and electrically connected to the upper ground terminal located at an upper layer of the insulating body , and the lower spring plate is physically and electrically connected to the lower ground terminal located at a lower layer of the insulating body .	7
an embodiment for barrel - binding and packaging articles by the use of packaging film , which embodies a method and a device according to the present invention , will now be described with reference to the drawings . referring to a fixed - side seal cutting assembly 1 shown in fig1 and 2 which is standing in the initial state of operation , a fixed seal plate 3 equipped with a heater is secured on the under side of a fixed base 2 , and the point of the seal plate 3 facing a packaging station 101 forms a pinching portion 3a . a pair of arms 5 is supported by supporting portions 4 projecting on the laterally - spaced sides of the fixed base 2 via support shafts 6 so as to tilt vertically above the fixed seal plate 3 , a fixed - side pinching roller 7 is supported between the points of the two arms 5 via a one - way clutch 8 so as to rotate only in the direction of the arrow 201 of fig1 and coupling rollers 9 are supported on the respective outsides of the arms 5 . leaf springs 10 are secured to the laterally - spaced sides of the fixed base 2 and engaged with a coupling lever 11 stretched between the two arms 5 at a position between the fixed base 2 and the pinching roller 7 . by the urging force of leaf springs 10 against the coupling lever 11 , the pinching roller 7 is always in contact with the pinching portion 3a of the fixed seal plate 3 . a slide plate 12 is placed on the fixed seal plate 3 between it and the pinching roller 7 , and a saw blade 13 attached to the slide plate 12 along the pinching roller 7 is confronted with an abutting station between the fixed plate 3 and the pinching roller 7 . both laterally - spaced ends of the slide plate 12 project outward beyond the respective arms 5 , each end having a hole 12a . a rotary shaft 14 stretched above the pinching roller 7 has rods 15 extending downward on the respective outsides of the arms 5 as shown in fig2 and 8 , and an angle lever 16 secured to each rod 15 is fitted in the hole 12a of the corresponding slide plate 12 . as the rods 15 tilt in response to rotation of the rotary shaft 14 as shown in fig1 , 12 , and 14 , the slide plate 12 and the saw blade 13 move on the fixed seal plate 3 via the angle levers 16 so as to approach and separate from the pinching roller 7 . referring to a movable - side seal cutting assembly 17 shown in fig1 and 2 which is standing in the initial state of operation , a base plate 20 is secured via brackets 19 to the upper ends of laterally - spaced movable levers 18 of a pair , the point of the base plate 20 facing the packaging station 101 forms a pushing - in portion 21 , and this pushing - in portion 21 has a laterally - extending cutting groove 21a . a movable seal plate 22 is supported in a lower accommodation chamber 20a of the base plate 20 and urged by a compression coil spring 23 so as to move toward the packaging station 101 , and the point of the movable seal plate 22 adjacent to the pushing - in portion 21 of the base plate 20 forms a pinching portion 22a . a supporting plate 24 is supported in an upper accommodation chamber 20b of the base plate 20 and urged by a compression coil spring 25 so as to move toward the packaging station 101 , and the point of the supporting plate 24 adjacent to the pushing - in portion 21 of the base plate 20 supports a movable - side pinching roller 26 . as will be seen , the pinching portion 22a of the movable seal plate 22 projects toward the packaging station 101 far more than either the pushing - in portion 21 of the base plate 20 or the movable - side pinching roller 26 . guide levers 27 are provided on the laterally - spaced sides of the base plate 20 projecting toward the packaging station 101 , and as shown in fig8 the point of each guide lever 27 adjacent to the pushing - in portion 21 of the base plate 20 has an inclined coupling surface 27a . the laterally - spaced sides of the movable seal plate 22 have respective coupling pins 28 projecting closely to the pinching portion 22a . between the movable - side seal cutting assembly 17 and the fixed - side seal cutting assembly 1 thus configured , a pair of supporting levers 30 is secured with some inclination toward the packaging station 101 to the upper ends of laterally - spaced movable levers 29 of a pair disposed below the movable - side seal cutting assembly 17 standing in the initial state of operation shown in fig1 and a guide roller 31 is stretched between the upper ends of both supporting levers 30 above the movable - side seal cutting assembly 17 . an angular presser plate 33 is supported pivotably by a support shaft 32 stretched between the supporting levers 30 below the movable - side seal cutting assembly 17 , and urged by a spring ( not shown ) in the direction of the arrow 202 of fig1 so that it is close to the movable - side seal cutting assembly 17 . a film take - up roll 35 is attached to an attaching shaft 34 stretched oblique above the movable - side seal cutting assembly 17 , and a pulley 36 secured to the attaching shaft 34 is interlinked through a belt 37 with a reversible electric motor 38 . a packaging film 102 pulled out from the take - up roll 35 is guided by an intermediate roller 39 and the guide roller 31 so as to pass above the movable - side seal cutting assembly 17 in the initial state of operation shown in fig1 and its one end 103 is held in the fixed - side seal cutting assembly 1 , or between the pinching portion 3a of the fixed seal plate 3 and the fixed - side pinching roller 7 . since this fixed - side pinching roller 7 is supported by means of the one - way clutch 8 , it cannot rotate in the direction of the film end 103 being pulled out ( in the direction opposite to that of the arrow 201 ) and the end 103 is surely held . a receiving plate 41 is supported by a rotary shaft 40 stretched below the packaging station 101 and tilted upward above an ejecting plate 42 in the initial position of operation shown in fig1 . and , this receiving plate 41 tilts upward and downward in response to rotation of the rotary shaft 40 as shown in fig1 and 14 . the two sets of movable levers 18 and 29 are interlinked at their lower ends with a disc cam ( not shown ) and can come close to the fixed - side seal cutting assembly 1 until either the movable levers 29 abut on stoppers 129 or the movable levers 18 abut on stoppers 118 , and thereafter , they can again move back up to the respective initial positions of operation shown in fig1 . the rotary shaft 14 of the fixed - side seal cutting assembly 1 and the rotary shaft 40 of the receiving plate 41 are also rotatable in interlinked relation with the disc cam . the electric motor 38 is energized so as to rotate forward and backward by means of limit switches ( not shown ) which are changed over in response to rotation of the disc cam . in the initial state of operation shown in fig1 first , the electric motor 38 is energized so as to rotate forward for a time interval set in a timer , as a result , a desired length of packaging film 102 compatible with articles 104 is pulled out from the take - up roll 35 . the packaging film 102 hangs down between the fixed - side seal cutting assembly 1 and the guide roller 31 into the form of a concavity , and then the articles 104 are thrown into this concave section . then , as both the movable levers 18 and 19 move so as to approach the fixed - side seal cutting assembly 1 as shown in fig3 the movable - side seal cutting assembly 17 , guide roller 31 , and presser plate 33 also move . as both the movable levers 18 and 29 move further , one set of movable levers 29 only abut on the stoppers 129 as shown in fig4 so that the guide roller 31 and the presser plate 33 come close to the fixed - side pinching roller 7 of the fixed - side seal cutting assembly 1 and stop there . since the other set of movable levers 18 only move further without interruption , the presser plate 33 is pushed downward ( in the direction opposite to that of the arrow 202 ) by the movable seal plate 22 of the movable - side seal cutting assembly 17 in opposition to the urging force applied thereto and comes into contact with the packaging film 102 as shown in fig5 . in synchronization with the above action the electric motor 38 is energized so as to rotate backward , the packaging film 102 is pulled back onto the take - up roll 35 , and the articles 104 bound by the packaging film 102 is lifted up . on the other hand , the movable seal plate 22 of the movable - side seal cutting assembly 17 is moving continuously while passing over the presser plate 33 , and the presser plate 33 is tilted further downward to press the articles 104 ; thus , the articles 104 are prevented from moving upward . at this time , since the electric motor 38 is rotating continuously backward , the packaging film 102 is pulled backward to bind tightly the articles 104 . then , as the movable seal plate 22 of the movable - side seal cutting assembly 17 abuts on the fixed seal plate 3 of the fixed - side seal cutting assembly 1 as shown in fig6 through 8 , one end 103 and the other coupling end 105 of the packaging film 102 are pinched together by the pinching portions 3a and 22a of these plates . up to the time of this pinching action , the electric motor 38 is rotated reversely , the action of pulling back the packaging film 102 is continued , and binding tightly the articles 104 takes place . as the movable levers 18 move further , while keeping the contacted state with the fixed seal plate 3 of the fixed - side seal cutting assembly 1 the movable seal plate 22 of the movable - side seal cutting assembly 17 plunges into the accommodation chamber 20a in opposition to the urging force of the compression coil spring 23 , and with a little delay from the abutment between the fixed seal plate 3 and the movable seal plate 22 , the movable - side pinching roller 26 of the movable - side seal cutting assembly 17 comes into abutment on the fixed - side pinching roller 7 of the fixed - side seal cutting assembly 1 in opposition to the urging force applied thereto , as a result , between these rollers is pinched the coupling end 105 of the packaging film 102 . in synchronization with this pinching action , the inclined coupling surfaces 27a of both guide levers 27 of the movable - side seal cutting assembly 17 abut on the corresponding coupling rollers 9 of the fixed - side seal cutting assembly 1 , as a result , both the guide levers 27 lift up both the coupling rollers 9 as well as the fixed - side pinching roller 7 in opposition to the urging force of the leaf springs 10 , the pushing - in portion 21 of the movable - side seal cutting assembly 17 eats into between the pinching portion 3a of the fixed seal plate 3 and the fixed - side pinching roller 7 , and the movable - side seal cutting assembly 17 stops when the movable levers 18 abut on the stoppers 118 . in the thus attained state , the coupling end 105 of the packaging film 102 is bent by the pushing - in portion 21 into the shape of a &# 34 ; u &# 34 ;, one end 103 and the coupling end 105 of the packaging film 102 are interposed in the mutually - piled state with some looseness between the pinching portion 3a of the fixed seal plate 3 and the pushing - in portion 21 , and the coupling end 105 of the packaging film 102 is pinched between the fixed - side pinching roller 7 and the pushing - in portion 21 . one end 103 and the coupling end 105 of the packaging film 102 pinched in the mutually - piled state between the pinching portion 3a of the fixed seal plate 3 and the pinching portion 22a of the movable seal plate 22 are fusion - bonded together under the pinched condition by means of the heat of the fixed seal plate 3 equipped with the heater . then , as shown in fig1 and 12 , in response to rotation of the rotary shaft 14 , the rods 15 tilt and the slide plate 12 comes close to the pushing - in portion 21 , so that the saw blade 13 is inserted in the cutting groove 21a of the pushing - in portion 21 and the coupling end 105 of the packaging film 102 is cut off thereat . before this cutting action , the receiving plate 41 has been tilted down to realize continuity with the ejecting plate 42 . at the time of cutting , the lower end of each rod 15 abuts on the corresponding coupling pin 28 of the movable seal plate 22 , the movable seal plate 22 plunges into the accommodation chamber 20a in opposition to the urging force of the compression coil spring 23 , the pinching portion 22a of the movable seal plate 22 separates a little from the pinching portion 3a of the fixed seal plate 3 , and as shown in fig1 , the articles 104 thus barrel - bound and packaged fall onto the ejecting plate 42 owing to its own weight . after completion of packaging , both the movable levers 18 and 29 move in the manner completely reverse to the foregoing manner of operation , and the movable - side seal cutting assembly 17 , guide roller 31 , and presser plate 33 return to their respective initial states of operation shown in fig1 . although the packaging film is used in the embodiment described above , the present invention can be applied to a system utilizing a tape in lieu of the film . in this case , either and portion of the articles is bound by the tape . further , the saw blade 13 of the foregoing embodiment may be made movable with respect to the fixed seal plate 3 and the cutting groove 21a of the pushing - in portion 21 may be made to be pressed against this saw blade 13 . as many different modifications may be made without departing from the spirit and scope of the present invention , it is not intended to have the present invention limited to the specific embodiment thereof , except as defined in the appended claims .	1
with reference to fig5 , in accordance with an embodiment of the present invention a method of non - coherent ultrawideband communication is provided , the method including the steps of , receiving an ultrawideband signal comprising a plurality of transmitted symbols at a plurality of parallel correlators , the signal having a predetermined pulse - to - pulse duration 50 , correlating the ultrawideband signal with a delayed version of the ultrawideband signal using the plurality of parallel correlators 60 , integrating the correlated signal utilizing a plurality of parallel integrators to establish a plurality of integrator outputs , each of the plurality of parallel integrators having an predetermined adaptable integration interval 70 , sampling the integrator outputs and averaging the sampled outputs to provide a plurality of power estimates of the signal 80 , estimating a noise power of the ultrawideband channel from the power estimates of the signal 90 , estimating a maximum excess delay of the ultrawideband channel from the power estimates of the signal 100 and combining the sampled integrator outputs based upon the estimated maximum excess delay and the estimated noise power of the channel to identify the transmitted symbols 110 . the output of a single integrator is not sufficient to estimate maximum excess delay of channel and noise variance . in accordance with the present invention , multiple parallel integrators ( with shorter integration times ) can be employed to estimate the maximum excess delay of the channel and the noise variance . the integrators are adapted to cover different parts of the multipath delays . also , an integrator is allowed to cover beyond the maximum excess delay of the channel ( mainly for noise variance estimation ). from these integrator outputs , decision is made about the maximum excess delay of the channel and noise variance . note that these decisions are specific to the receiver type . for example , the decision will be different for tr - based scheme than the energy detector . however , the idea can be applied to various types of non - coherent receivers . to make a decision on maximum access delay of the channel , the sampled outputs of the parallel integrators are averaged over several pulses and possible symbols . the averaging will reduce the effect of noise and the integrator outputs will have distributions ( different distribution depending on the receiver implementation ) with different means ( nonzero means ). the means are identified by averaging . the mean values provide information about the energy / power of the signal over the parallel integrators . these power / energy estimates are then used to make a decision on noise variance and maximum excess delay estimate . for noise power estimation , two possible embodiments are provided in accordance with the present invention . in one approach , illustrated in fig6 , where the maximum excess delay of the channel is always less than the pulse - to - pulse duration , an integrator is used that integrates the signal power from the maximal excess delay ( at the point where the signal is no longer exists ) to the beginning of the next pulse 91 . this way , only the noise power is integrated . it is necessary to average this over many pulses and for many symbols to obtain a more reliable estimate of the noise power 92 . in a second approach for estimating the noise power , illustrated in fig7 , if the pulse - to - pulse duration is adapted and on - off keying modulation is used at the transmitter , then regularly inserted training symbols of zero ( off ) can be inserted to the transmitted signal 95 . when the transmitter is off ( i . e . transmitting zero ), then the outputs of the integrators over this symbol time can be used to estimate the noise power 96 . once the noise power is determined , this information can also be used to help the calculation of the maximum excess delay of the channel . the maximum excess delay can be determined based solely from all the integrator outputs without the knowledge of the noise power estimate . however , a more reliable decision can be made if the noise power estimation is also used in the decision . once a decision on maximum excess delay of the channel is made , the performance and data rate of the transceiver can be improved by adapting the pulse - to - pulse duration . if the pulse - to - pulse duration is shorter than the maximum excess delay of the channel ipi ( inter - pulse interference ) will be observed . if it is too large , then the maximal data rate for a user will not be high . adaptive design will make sure that high data rates are obtained while keeping the ipi at a minimum . the symbol decisions will be based on the combination of these integrator outputs . note that since digital samples are being used for the combining , optimal combining techniques can be employed , such as maximal ratio combining , interference rejection combining , etc . the power differences at the correlator outputs will be used for efficient combining . note that as well as the total power , the noise power over all these correlator outputs can be estimated by using 00k modulation and the second noise variance estimation technique mentioned above . this way , the signal - to - noise - ratio in each correlator output can be estimated and maximal ratio combining can be employed efficiently . taking this one step further , the noise correlation can be estimated across the parallel correlator outputs if the noise also includes interference . the noise correlation can be used for interference rejection combining . the present invention also provides for the tracking of the timing position using the parallel integrator approach . the single integrator approach does not allow for tracking of the timing position . however , a parallel integration approach that includes additional short time integrations beyond the multipath components of the received signal period ( i . e . the total combined integration time is larger than the maximum excess delay of channel ) will be able to track the fine timing position . note that additional integrators “ early ” ( before the estimated first multipath component ) and “ late ” ( after the last multipath component ) are required for efficient tracking . in accordance with the present invention , adaptation is inherent on the collection of multipath components . the multiple energy components , due to the integration of the multipath , are combined adaptively depending on the energy on each of these components and also depending upon the noise as well as the interference power . in general terms , instead of having a single correlator and integrator for the whole maximum excess delay of the channel , the present invention provides for multiple correlators and integrators . each of these correlator / integrators will try to capture part of the signal that is being received . then , the multiple signal contributions are coherently combined to arrive at the decision result . in addition , the present invention also adapts the maximum excess delay of the channel . the overall integration is adapted and with the present invention even if the location where the energy block starts and ends in the received signal is unknown , the proposed method in accordance with the present invention automatically adjusts the location . as such , the proposed method also automatically synchronizes with the signal . also , the interference rejection combining of the integrator outputs provides additional benefits . interference rejection combining has been applied to multiple antenna systems . the outputs of the integrators are interpreted as antenna elements ( which is a very realistic assumption ), similar approaches can be implemented here as well . as a result , multiple access interference and narrowband interference capabilities can be introduced . it will be seen that the advantages set forth above , and those made apparent from the foregoing description , are efficiently attained and since certain changes may be made in the above construction without departing from the scope of the invention , it is intended that all matters contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described , and all statements of the scope of the invention which , as a matter of language , might be said to fall there between .	7
as shown in the exemplary drawings for the purposes of illustration , an embodiment of an integrated system made in accordance with the principals of the present invention , referred to generally by the reference numeral 10 , is provided for simplified setup and operation of an electrophysiology amplifying and switching system during an electrophysiology procedure . more specifically , as shown in fig1 the front panel of the system 10 of the present invention includes a standard twelve lead ecg input terminal 11 which allows attachment of any well known ecg lead cable through which leads extend from electrodes attached to the chest of a patient in a well known manner for transferring ecg signals into the system 10 . similarly , intracardiac input terminals 12 are positioned on the front panel , and include intervention / input terminals 13 which can be used as intracardiac input terminals or intervention ( stimulation ) terminals . the intervention / input terminals 13 are hard wired to corresponding intervention / output terminals 17 ( as shown in fig2 ). the intracardiac input terminals 12 are adapted to receive leads from the intracardiac catheters which have been placed within the patient &# 39 ; s heart to sense the electrical signals passing therethrough . the intervention / input terminals 13 are designed to pass electrical stimulation signals ( originating from an electrical stimulator , not shown ) through the system 10 into the intracardiac catheters . the intervention / input terminals 13 are also designed to receive electrical signals ( originating in the heart ) from the intracardiac catheters in the same manner as the input terminals 12 . also included on the front panel are four pressure channel input terminals 14 which are designed for receipt of pressure sensor leads which have been attached to pressure sensors positioned at desired points on or within the patient &# 39 ; s body from which blood pressure information is desired . the dominant feature of the front panel of the system 10 is an operator interactive &# 34 ; touch &# 34 ; display 15 which is programmed by an onboard microprocessor 27 ( see fig6 ) to operate as a labelling area for the input terminals 11 , 12 , 13 , 14 , and the auxiliary input terminals 16 ( see fig2 ). the display 15 is also configured by the microprocessor 27 to define touch areas thereon as &# 34 ; soft keys &# 34 ; for use in initiating setup and operation commands as will be explained below , and also to display messages related to setup and operation of the system 10 . further , the display 15 is driven by a microprocessor 27 ( see fig7 ) to display assignments of the output channels 17 ( see fig2 ) and the labels , poles , gains , filter , and clamp settings through which each channel of entering data must pass when entered into the system 10 . the display 15 is designed to simplify setup and operation of the system 10 as will be explained momentarily . software preprogrammed into the onboard microprocessor 27 , such as by a rom , is directly responsible for the operation of the display 15 and input &# 34 ; soft keys &# 34 ; thereof . the display 15 is preferably a single 640 × 480 pixel pressure responsive display commonly referred to as a &# 34 ; touch screen &# 34 ;. although the present invention is not limited to the following , it is intended that the preferred embodiment of the present invention include the ability to receive twelve leads of ecg signals as input into the input terminal 11 . further , it is preferred that sixteen or thirty - two intracardiac input terminals 12 and eight intervention or intracardiac input terminals 13 be included in the system 10 . further , it is preferred that four pressure channel input terminals 14 be included with four auxiliary input channels 16 ( see fig2 ). the display 15 is used to specify and setup labels associated with each input terminal 12 , 13 , 14 , and 16 . to describe the labeling process it is first necessary to define some terms . a label 28 ( see fig4 ( b )) is the alphanumeric assigned to an input terminal to identify the catheter or sensor and the lead attached thereto . a catheter group , or simply &# 34 ; group &# 34 ; is a group of labels 28 that have the same prefix letters but different numbers . an example of a catheter group would be : &# 34 ; rva1 , rva2 , rva3 , rva4 &# 34 ; ( see fig4 ( c )), where the prefix letters &# 34 ; rva &# 34 ;, are common to each label 28 . any intracardiac or intervention labels 28 with the same base letters , regardless of their location on the display 15 , belong to the same group . a field 29 ( see fig4 ( a )) is a label location on the display 15 . there are two basic screens which can be called to the display 15 by the operator to assist in arranging the setup configuration of the system 10 . the first is the &# 34 ; catheter placement screen &# 34 ; 43 as shown in fig4 ( a ). the second is the &# 34 ; signals screen &# 34 ; as shown in fig5 ( a ). once the electrophysiology catheters have been placed in the patient , setup of the system 10 only requires the steps of : 1 ) specifying the signal inputs by producing a label 28 for each one , and then 2 ) specifying the desired signal output parameters . the first step is accomplished through the use of the catheter placement screen 43 , the second step is accomplished with the assistance of the signals screen 44 . referring to fig4 ( a ), the catheter placement screen 43 is programmed to preferably form the following soft keys : a twelve lead key 31 , a restore key 34 , a catheter key 32 , a signals key 33 , a mark key 35 , a channels key 36 , a calibrate key 37 , a chart key 38 , an intervention key 39 , an intracardiac key 40 , an auxiliary key 41 , and a pressure key 42 . briefly , to specify an input , the operator need only touch the key describing the input type , such as the intracardiac key 40 , the auxiliary key 41 , or the pressure key 42 , then use the resulting directory 30 ( see fig4 ( b ) to assign each label 28 to the field 29 that corresponds to the correct lead input connector 12 , 13 , 14 , or 16 . to quickly assign a multiple of fields 29 to a single label 28 , the operator touches the desired label 28 in the directory 30 , then touches as many fields 29 as desired . operating in this fashion to assign labels is hereafter referred to as the batch edit mode of operation . to make a single assignment of a label 28 to a field 29 , the operator first touches the desired field 29 and then touches the desired label 28 in the directory 30 . assigning a single label 28 at a time in this fashion is referred to hereafter as the single edit mode of operation . in batch edit mode , when the user chooses which field or fields 29 to apply the label 28 to by touching in succession each desired field 29 , the plural leads of the catheter or sensor will be automatically numbered appropriately . the operator can continue in this way indefinitely . if a field 29 was empty prior to this operation , the field 29 will be filled in appropriately . however , if there was already a label 28 present in the field 29 , all associated labels 28 will be updated with the new label 28 and each lead connector will be numbered appropriately . when the operator is finished with one label 28 , another label 28 may be chosen . when all desired labels 28 are assigned , the operator chooses &# 34 ; done &# 34 ; from the touch screen , in which case the directory will disappear . if the operator selects a field 29 which cannot possibly be assigned ( such as choosing a pressure field while entering the title &# 34 ; intracardiacs &# 34 ;) an error message will be presented . if the operator chooses an empty field 29 directly from the catheter placement screen 43 , the directory 30 will appear , immediately placing the operator in the single select mode of the setup operation . when the operator then makes a label selection , the locations directory 30 disappears and the new information is displayed in the previously empty field 29 . to move a catheter label 28 in the single edit mode , the operator chooses any one of the fields 29 containing the name of the catheter to be moved . all lead names of the catheter will then be highlighted , and the directory 30 will appear . the operator can then choose the new field 29 for the catheter , after which the directory 30 will disappear and the fields 29 will automatically be updated to show the new label 28 . to remove a particular catheter in batch edit mode , the user selects &# 34 ; delete &# 34 ; from the directory 30 and then selects a field 29 associated with the particular catheter to be removed . as shown in fig4 ( c ), a popup containing the question &# 34 ; delete xxxx catheter ?&# 34 ; will appear . if the operator selects &# 34 ; yes &# 34 ;, all leads of the associated catheter will be removed . if the operator selects an invalid field 29 , such as an empty field or fields 29 from pressure or auxiliary input terminals 14 or 16 , an error message will appear . in single select mode , the operator will have first chosen the field 29 of interest , which will cause all similar fields 29 to be highlighted , then will choose &# 34 ; delete &# 34 ; from the directory 30 . all leads of the catheter will then be removed as well as the confirmation question and the directory 30 . as shown in fig4 ( d ), the softkey &# 34 ; new &# 34 ; is available under the auxiliary and pressure directory 30 when in the batch edit mode . when the &# 34 ; new &# 34 ; key is touched , it will be highlighted , and the directory 30 containing a keyboard popup will be presented . the operator may then type in the desired new label 28 and touch &# 34 ; done &# 34 ; to save the entry to the directory 30 . the operator may then select this label 28 for use as input channel label . while working with the auxiliary or pressure channels , the softkey &# 34 ; delete &# 34 ; will also remove a label 28 from the directory 30 to do so , the operator selects &# 34 ; delete &# 34 ;, which will be highlighted , and then chooses the desired label 28 from the directory 30 . a question confirming the operator &# 39 ; s intent will appear and the label 28 will be removed if the operator answers &# 34 ; yes &# 34 ; to the confirming question . zeroing of the pressure channels 14 will also be available to the operator under the pressure directory 30 . the system 10 will zero a pressure channel 14 upon request from the user . if in the single edit mode , the pressure sensor will be open to atmosphere prior to touching the &# 34 ; zero &# 34 ; softkey . the system 10 will then record the pressure signal for one second after the &# 34 ; zero &# 34 ; key is touched and compute an offset value to be used to calibrate the channel . while zeroing is taking place the softkey will be highlighted . in the batch edit mode , the operator chooses the &# 34 ; zero &# 34 ; key and then choose the desired input to be zeroed . the field 29 will then be highlighted while zeroing is taking place . after completion , in either batch or single edit mode , the letter &# 34 ; z &# 34 ; will appear to indicate that the channel has been zeroed as shown in fig4 ( e ). calibration is available while setting up the pressure channels . the &# 34 ; cal &# 34 ; key acts in a similar fashion as the &# 34 ; zero &# 34 ; key as explained above . once &# 34 ; cal &# 34 ; has been touched , a numeric keypad directory 30 as shown in fig4 ( f ) will appear . the directory 30 will preferably contain four preprogrammed &# 34 ; fast cal &# 34 ; keys 45 . the user then applies the calibrating pressure to the transducer and either enters the desired value or choose one of the &# 34 ; fast cal &# 34 ; keys 45 . once calibrated , a &# 34 ; c &# 34 ; will appear in the box beside the label 28 corresponding to the calibrated channel as shown in fig4 ( g ). to select the desired output parameters to be associated with each channel label 28 , the operator selects the &# 34 ; signals &# 34 ; softkey . at this point as shown in fig5 ( a ), the second of the two basic screens called the &# 34 ; signals screen &# 34 ; 44 will appear . the signal screen 44 contains a list of all assigned channels , their pole pairs , gains , filters , limiter level , and the output name of the channel which is to be used by the system 10 for display purposes . the signals screen 44 will behave in a manner similar to the catheter placement screen 43 described above . the signals screen 44 is preferably preprogrammed with the following soft keys : channel key 47 , leads key 48 , gain key 49 , filter key 50 , limiter key 51 , and name key 52 . also , the twelve lead key 31 , catheters key 32 , signals key 33 and restore key 34 are preprogrammed on the signals screen 44 in the identical manner as the catheter placement screen 43 . when a soft key is chosen , the operator is immediately placed in the batch edit mode of the setup operation . as shown in fig5 ( b ), a small &# 34 ; items &# 34 ; popup 46 , displaying information relative to the chosen soft key will appear . the operator must then choose the particular item 53 or label 28 from the popup 46 desired to be used and then choose which field or fields 29 to apply it to . the operator can continue in this way indefinitely . when the operator is finished , &# 34 ; done &# 34 ; can be chosen from the screen and the items popup 46 will disappear . alternatively , if the operator chooses one of the fields 29 directly , the field 29 will be highlighted , and the items popup 46 will appear and place the setup operation into the single edit mode . once the operator selects the desired item 53 , the items popup 46 disappears . at any time the operator can choose the &# 34 ; catheters &# 34 ; key 32 from the signals screen 44 and return to the catheter placement screen 43 , if desired . similarly , at any time in the catheter placement screen 43 , the operator can choose the &# 34 ; signals &# 34 ; key 33 and return to the signals screen 44 . to begin filling out the desired combination of leads for output from the system 10 , the operator first touches the leads key 48 . the items popup 46 for leads will appear as shown in fig5 ( b ) and contain a list of all available ecg , intracardiac , pressure and auxiliary channels . additionally , the ground leads &# 34 ; wct &# 34 ; and &# 34 ; rl &# 34 ; will appear along with the softkeys &# 34 ; delete &# 34 ; and &# 34 ; done &# 34 ;. in single edit mode the user will have previously chosen the desired field 29 to edit and can now choose the label 28 to use to complete an output channel . by touching the desired label 28 , the label 28 will appear in the highlighted field 29 previously selected ( ie . &# 34 ; rva 1 &# 34 ;). the operator &# 39 ; s next touch will complete the lead pair and the label 28 therefore . if the completing pair is of similar type , then the label 28 will be automatically abbreviated to appear as a single prefix and a pair of lead numbers , such as &# 34 ; rva 1 - 2 &# 34 ;. otherwise the second half of the pair will just be appended and the label 28 will appear such as &# 34 ; rva1 - hra1 &# 34 ;. when the operator selects an ecg , auxiliary or pressure channel , the label 28 will appear instantly . once a pairing has been completed , the settings as previously indicated on the signals screen 44 associated with particular cardiac locations will be applied to the gain , filter , and limiter settings . to edit the lead pair in single edit mode , the operator touches the desired field 29 ( which will be highlighted ) and the items popup 46 immediately appears . the operator then touches the desired new labels 28 from the items popup 46 . of course , both labels 28 must be chosen again to complete the new lead pair . to remove a label 28 in batch edit mode , the operator chooses the softkey &# 34 ; delete &# 34 ; from the items popup 46 . this will be highlighted and the operator then chooses the desired label 28 . the label 28 will be removed from the screen as well as all other information for that channel . &# 34 ; delete &# 34 ; will unhighlight after being used once . in single edit mode the desired label 28 will already be highlighted and will be removed once &# 34 ; delete &# 34 ; has been touched . the gains and filters are pre - set to default values which can be changed by the operator if desired . to change the default gains or filters , the operator touches the desired gain key 49 or filter key 50 , and an items popup 46 appears as shown in fig5 ( c ) with all available gains or filter settings respectively . in single edit mode , the operator will have previously chosen the field 29 to be edited and can now select the new item 53 from the presented list . the item popup 46 will then disappear . in batch edit mode the operator first selects the item 53 desired from the item popup 46 and then selects all fields 29 it is desired to apply it to . the operator may continue in this manner until &# 34 ; done &# 34 ; is finally selected . while adjusting filter settings , more than one item 53 may be chosen by the operator . these items 53 include high , low and notch filter settings . each item 53 is highlighted as it is touched to indicate which items 53 have been chosen . if more than one item 53 in a particular section is touched , the highlight moves to the new item 53 . as shown in fig5 ( d ), the limiter setting items popup 46 presents a sliding scale to indicate the relative amount of limiting . to adjust the limiter setting , the operator touches the direction arrows 54 to choose the desired amount . the numbers placed in the appropriate filed 29 on the signals screen 44 corresponding to the limiter reflect percentages of full scale . in single edit mode there is a &# 34 ; done &# 34 ; key on the popup 46 for the operator to indicate when the current level is correct . in batch edit mode , the operator selects the amount of limiting and then applies it to the desired field or fields 29 . &# 34 ; done &# 34 ; is used to indicate when the operator has finished applying new limiting levels to all the desired channels . limiting is applied in a bipolar fashion and is a ± limit . every channel preferably includes a name . the name fields are filled out with predetermined default names as the lead pairs are formed , the default name being the same as the label 28 . however , the user can edit the name using the keyboard presented in the name selection popup 46 , as shown in fig5 ( e ). once completed , the operator can select &# 34 ; done &# 34 ; and the keyboard popup 46 will disappear . in batch edit mode , the operator types in the desired name and then chooses the desired field 29 . whatever is in the keyboard buffer 55 at the time the operator touches the desired field 29 will be used as the name . the operator then touches &# 34 ; done &# 34 ; to remove the popup 46 and exit batch edit mode . single edit mode is operated in a similar manner according to the general format explained above for single edit mode operation . channel editing will only take place in single edit mode . as shown in fig5 ( f ) the operator selects the desired channel number to edit and the items popup 46 appears with all the channels and their names , and the selected channel number is highlighted . upon choosing a new channel which is not already in use , the popup 46 will disappear and the channel will be moved to it &# 39 ; s new position . the old position is initialized to an unused channel . if the operator selects a channel position from the popup 46 which is already occupied , the popup 46 will disappear , and the two channels will swap their configurations . to remove a channel the operator selects &# 34 ; delete &# 34 ; from the popup 46 and the previously selected channel will be removed . an example of a completed signals screen 44 is shown in fig5 ( g ). referring again to the catheter placement screen 43 , as shown in fig6 ( a ), the &# 34 ; catheter placement name &# 34 ; area 56 not only displays the currently invoked catheter placement name but is also active to the touch . once the operator has completed preparations of the system 10 for an electrophysiological procedure , the entire setup may be saved for recall later . to do this the operator simply touches the &# 34 ; catheter placement name &# 34 ; area 56 . if there is already a setup invoked , that setups &# 39 ; name will be present in the area 56 , otherwise the word &# 34 ; setup &# 34 ; will appear . the operator is then presented with the directory 30 containing a list of all available preset catheter setups as well as the softkeys &# 34 ; new &# 34 ;, &# 34 ; delete &# 34 ;, &# 34 ; save &# 34 ;, and &# 34 ; done &# 34 ;. upon selecting &# 34 ; save &# 34 ; the operator is presented with the keyboard directory 30 as shown in fig6 ( b ) and is prompted to fill in the name of the current setup . if a previous catheter placement had been invoked , the operator is prompted to overwrite the old one or to create a new name . &# 34 ; save &# 34 ; will be highlighted while active . the catheter placement setup will be saved both to the system 10 memory and the computer processing unit if attached . to finish saving the operator selects &# 34 ; done &# 34 ; from the keyboard directory 30 . to invoke an old catheter placement the user touches the &# 34 ; catheter placement name &# 34 ; area 56 and is presented with the directory 30 containing the list of currently stored catheter setups as again shown in fig6 ( a ). the operator then chooses the desired catheter setup by touching the desired name on the directory 30 . the catheter placement screen 43 will then be filled with that catheter setups &# 39 ; configuration such as shown in fig6 ( c ). if this is the correct catheter setup , the operator selects &# 34 ; done &# 34 ; and the directory 30 disappears and the hardware is automatically reset with the new catheter setup configuration . to remove a catheter setup configuration , the operator again initiates the catheter placement directory 30 and chooses &# 34 ; delete &# 34 ;. the operator then selects the setup to be removed , and the system 10 asks for confirmation . upon answering &# 34 ; yes &# 34 ;, the setup is removed to return to normal operation the operator selects &# 34 ; done &# 34 ;. to initialize the catheter placement screen 43 , the user selects &# 34 ; new &# 34 ; which will clear all inputs and uninvoke the current catheter setup . the &# 34 ; twelve lead &# 34 ; softkey 31 , and the &# 34 ; restore &# 34 ; softkey 34 are preferably located on opposite sides of the catheter placement name area 56 on the catheter placement screen 43 as shown in fig6 ( a ). by touching the &# 34 ; twelve lead &# 34 ; softkey 31 the operator can toggle the first twelve outputs of the output terminals 17 to receive all twelve ecg leads attached at the input ecg terminal 11 . a directory 30 indicating that the twelve lead ecg is being acquired will appear . the directory 30 contains a softkey containing the previous catheter placements name . to return to the previous placement the operator touches this softkey . if the placement has not yet been named , the softkey will contain &# 34 ; return &# 34 ;. the &# 34 ; restore &# 34 ; softkey 34 is used in the case that signals have drifted off of the computer display monitor on the chart recorder , either from movement of the patient or from a defibrillation , and the operator wishes to remove the dc offset and place the signals back into the middle of the monitor . the restore key 34 will be highlighted for appropriately one second to indicate that the signal placement is automatically being done . the &# 34 ; mark &# 34 ; key 35 is used to mark specific events in time during an electrophysiology procedure . &# 34 ; mark &# 34 ; will be highlighted for appropriately one second after it is pressed to indicate to the operator that the mark is automatically being placed in the time record . the &# 34 ; calibrate &# 34 ; key 37 is used to send a square wave of 1 mv . 5 hz ( rtt ) to all channels . once pressed the key will be highlighted . to stop the calibration pulse the operator presses calibrate key 37 again and the calibration stops . the highlight will also be removed . the &# 34 ; record &# 34 ; key 57 is used to initiate storage of data . recording will start from five seconds previous to when the record key 57 is touched , and storage thereafter is continuous . the operator will be able to stop storage by touching the record key 57 again . the &# 34 ; chart &# 34 ; key 38 delivers a ttl level to the chart recorder if attached to the system . while active , the &# 34 ; chart &# 34 ; key 38 will remain highlighted . to stop the chart recorder , the operator simply presses chart key 38 again . referring now to fig7 if the gain or phase response of the front - end amplifiers 18 are not identical , then the digital signal processor ( dsp ) 22 will not eliminate all of the common mode signal during the common mode signal rejection operation . therefor , an automatic calibration system is included in the system 10 of the present invention to automatically digitally calibrate the front - end amplifiers 18 prior to the initial use of the system 10 in order to correct for any nonuniform phase or gain performance between the front - end amplifiers 18 . the automatic calibration is performed by attaching a cable ( not shown ) from the output channels 17 to all of the intracardiac input channels 12 in parallel . the operator then enters the &# 34 ; calibration mode &# 34 ; of the system 10 and the dsp 22 automatically enters a known signal at each input channel 12 through the attached cable . the dsp 22 then samples the gain and phase of the signal it receives from each of the front - end amplifiers 18 . the difference between the gain and phase value of the known signal and the gain and phase value of the signal as received by the dsp 22 after passing through each front - end amplifier 18 is then digitally stored by the system 10 in a table . thereafter , during normal ( non - calibration mode ) operation of the system 10 , each signal received by the dsp 22 from the front - end amplifiers 18 is corrected by the stored digital value corresponding to the difference between the known calibration mode signal and the received signal of each front - end amplifier 18 . in this manner , any common mode signal received into the dsp 22 will be completely rejected regardless of which inputs 12 are used . since the automatic calibration values are stored digitally in a table in the system 10 , they do not experience any significant drift over the normal life of the system 10 . calibration of the front - end amplifiers 18 therefore is intended to be necessary only as an initial calibration , i . e . one time calibration before initial use of the system 10 . since this automatic calibration need be performed only once , it can be performed by the manufacturer of the system 10 and the subsequent operator will have no need to be concerned with it during normal use . the block diagram of fig7 shows the architecture of the most important internal electronics of the present invention . up to sixty - four electrical inputs from the input terminals of the system 10 are passed through front - end amplifiers 18 and directly into a multiplexer 19 . the signals are multiplexed into four output channels carrying sixteen input channels each and passed through a / d converters 20 and fiberoptics links 21 into the dsp switching board 22 . the dsp 22 operates as a switching matrix , such as in the manner of prior art analog switching matrixes , except that instead of switching analog signals electronically into differential amplifiers , the dsp 22 of the present invention switches digital signals and operates itself as a &# 34 ; differential amplifier &# 34 ;. this is done by electronically combining the digital representations of each signal , such as by subtraction , which results in sixteen output channels ( or thirty - two output channels if desired ) which pass directly into a dsp processing board 23 ( or two dsp processing boards in the case of thirty - two channel outputs from the dsp switching board 22 ). as is readily evident , the dsp switching board 22 of the present invention has been configured for operation to eliminate common mode signals from raw , digitized analog input signals . in this manner , the present invention is distinguished from any prior art use of digital signal processors since common mode signal noise is removed by prior art systems before any digital signal processors are utilized . the prior art use of digital signal processors has been simply to process signals which have previously been passed through an analog switching matrix . in these prior art systems , the common mode rejection function on the analog signals has already been performed through known techniques using differential amplifiers . in the present invention however , the dsp switching board 22 itself operates as a differential amplifier to perform the signal switching operation and to do common mode rejection on the raw digital signals . the signals received by the dsp processing board 23 are processed for gain , signal limiting and the application of a plurality of filters thereto . each dsp processing board 23 ( one in the case of sixteen output channels from the dsp switching board 22 , and two in the case of thirty - two output channels from the dsp switching board 22 ) outputs a single multiplexed channel to a d / a converter 24 which is then passed through a de - multiplexer 25 to restore sixteen channels . these are then passed through an analog filter 26 to the output 17 of the system 10 . the dsp switching board 22 and dsp processing board or boards 23 are driven by an onboard microprocessor 27 which is also operationally attached to the display 15 . in constructing the system 10 of the present invention using the dsp switching board 22 , a large amount of bulk is eliminated therefrom , thus allowing the system 10 to be significantly reduced in size compared to prior art hardware . also , the utilization of the dsp processing board 23 for filter , limiter , and gain application significantly aids in downsizing the overall physical dimensions of the system 10 by allowing elimination of the prior art type filter blocks which commonly include five different capacitors and an analog switch for each signal channel . the result is a system 10 which is significantly smaller than prior art hardware and which is therefore conveniently positionable directly at the patient &# 39 ; s bedside to allow bedside control of the system 10 by the operator during setup and electrophysiology procedures . the system 10 of the present invention can be attached through its output ports 17 by a cable to a computer processing unit , analog monitor , and / or chart recorder . an example of a computer processing unit usable with the system 10 of the present invention is manufactured by quinton electrophysiology corp . of markham , ontario , canada , and is presently being marketing under the trademark &# 34 ; eplab &# 34 ;. since the dsp switching board 22 is used for common mode rejection , it is very advantageous in the present invention to employ a / d converters having very high resolution , such as sixteen bit resolution . the preferred gain ranges for the system 10 include gain ranges of 100 to 5000 for ecg , intracardiac and pressure channels , and gain ranges between 1 and 5000 for the auxiliary channels . the system 10 employs three different filters , including high pass filters in the range of dc , 0 . 05 hz , 1 . 0 hz , 10 hz , and 30 hz , low pass filters in the range of 40 hz , 100 hz , 200 hz , and 400 hz , and notch filters in the range of 50 or 60 hz . the common mode rejection level is preferably set at greater than 100 db . it will be apparent from the foregoing that , while particular embodiments of the invention have been illustrated and described , various modifications can be made thereto without departing from the spirit and scope of the invention . accordingly , it is not intended that the invention be limited , except as by the append claims .	0
fig1 and 2 show an hydraulic fastener 10 which engages a screw threaded bolt 20 . fastener 10 has a body 11 with a screw threaded bore 12 which engages threads 21 on bolt 20 . body 11 has six flat faces 13 to provide purchase for a tensioning tool . the external profile of body 11 can be varied to suit the different types of tensioning tools available . annular recess 14 is formed in body 11 and opens outwards to end face 15 and inwards to bore 12 of body 11 . the lower portion of body 11 has a peripheral skirt 16 which surrounds annular recess 14 . a thrust member 17 in the form of an annular washer fits into annular recess 14 and has a curved upper face 18 . an annular chamber 30 is defined by annular recess 14 in body 11 , thrust washer 17 and the outer thread of bolt 20 . nipple 40 has a one - way valve 41 and screws into peripheral skirt 16 of body 11 and is connected to annular chamber 30 by passage 31 . nipple 40 can be connected to a source of charging medium 50 such as a particulate solid which is injected under pressure through nipple 40 into annular chamber 30 to expand the working volume of annular chamber 30 . connector body 11 moves in a direction opposite to thrust washer 17 to apply tension to bolt 20 . when the required tension has been applied to bolt 20 , the source of charging medium 50 is disconnected from nipple 40 and backflow is prevented by one - way valve 41 . charging medium 50 may also be a viscous paste which cures to become solid , a suspended solid in a self - setting compound , or a particulate solid which behaves as a fluid . if the source of the charging medium incorporates a media exchanger , solid injectable media such as graphite may also be used . particulate solids of a granular nature such as lead , copper or steel balls may also be used as charging materials . charging medium 50 sets and forms a solid block which prevents movement of body 11 relative to thrust washer 17 , an so prevents any reduction of the tension applied by hydraulic fastener 10 to bolt 20 . by using any of the above charging media , the need for seals between thrust washer 17 and the adjacent contact wall of annular recess 14 in body 11 is removed . accordingly any reduction of the tension applied to bolt 20 due to seal deterioration is avoided . fig2 to 6 show a second hydraulic tensioning device 110 used to join pipe flanges pf 1 and pf 2 of respective pipes p 1 and p 2 at a flange joint . for ease of manufacture , hydraulic tensioning device 110 has a device body in the shape of a ring formed of upper and lower annular discs 111 , 112 . upper disc 111 has a plurality of downwardly convergent bores 113 through it to receive bolts 120 which extend above pipe flange pf 1 . each conical bore 113 is shaped to receive a trifurcated nut cone 122 which engages screw threads 121 on bolt 120 . cone 122 is prevented from escaping from conical bore 113 by spring clip 123 . lower disc 112 has bores of larger diameter than bore 113 through it which form , with upper disc 111 , annular recess 114 which house thrust washers 117 so that upper 111 and lower 112 discs , thrust washer 117 and bolt 120 form an annular chamber 130 to receive charging medium 150 . each annular chamber 130 surrounding bolt 120 is interconnected by distribution galleries 151 extending around upper 111 and lower 112 discs . by manufacturing the connector body as two discs , distribution galleries 151 can be machined and upper 111 and lower 112 discs can be locked together by a plurality of joining bolts 119 . as illustrated in fig6 , charging medium 150 is injected under high pressure using media exchanger 160 which is screwed into passage 131 connecting to distribution gallery 151 . passage 131 contains non return valve 141 which operates the same way as non return valve 41 in nipple 40 in fig1 and 2 . media exchanger 160 has a body 161 which is connected to a source of hydraulic oil 162 via a hydraulic line 163 . hydraulic oil 162 is forced into media exchanger 160 under pressure to cause separator piston 164 to move in body 161 of media exchanger 160 thus causing expelling medium 150 from media exchanger 160 . this increases the effective volume of annular chambers 130 and discs 111 and 112 move relative to thrust washers 117 to tension bolts 120 to the required amount . when the required tension has been achieved in bolts 120 , media exchanger 160 is disconnected from passage 131 and non - return valve 141 prevents the release of charging medium 150 from device 110 . as described above charging medium 150 sets to prevent movement of discs 111 and 112 relative to thrust washers 117 thereby preventing any reduction in tension applied to bolts 120 . it will be apparent to the skilled addressee that manufacture of hydraulic tensioning device 110 is relatively simple and inexpensive since no complex machining operations nor tooling is required . the upper and lower discs 111 and 112 of the connector body are bolted together by bolts 119 to enclose distributor gallery 151 and so no intricate drilling operations are required . each trifurcated nut 122 is inserted in its conical bore 113 and retained with spring clip 123 which provides both retaining and closing forces for the nut 122 assembly . to install , hydraulic tensioning device 110 is fitted over bolts 120 protruding from pipe flange pf 1 as shown in fig4 . the action of pushing hydraulic tensioning device 110 over bolts 120 allows cone nuts 122 to ratchet over the bolt threads , and eliminates the need to screw the nuts into place . as described above , charging medium 150 flows to each annular chamber 130 via distributor gallery 151 forcing thrust washers 117 to react against adjacent pipe flange pf 1 . this creates tensile forces which are evenly and simultaneously distributed to each bolt 120 . one way valve 141 automatically activates and the pressure pumping apparatus is removed with full pressure remaining in the assembly . where setting paste is used as the charging medium it will cure rapidly preventing any leakage and subsequent loss of tensile load on bolts 120 . when a particulate solid is used as the charging medium it will retain the tensile load indefinitely as it is already at a high density . fig7 illustrates a third embodiment of the present invention where a standard form of hydraulic nut 210 is charged with charging medium 250 using media exchanger 260 in the same manner described with reference to fig3 to 7 . in this case , the pressure of the charging medium is not required to be maintained since the force generated is maintained by locking ring 216 which is screwed into nut 211 and engaged with piston 217 which cooperates with nut 211 to form annular chamber 230 . when this type of hydraulic nut needs to be removed intact at a later time , the charging medium used will be of a fluid nature in order to assist with re - pressurisation for loosening lock ring 216 . owing to the nature of the charge medium used , the sealing capacity of fasteners 10 , 210 of tensioning devices 110 need only be rudimentary . as illustrated in fig8 and 9 the leading edges of components and sliding engagement may be altered in order to enhance the sealing ability when viscous materials are used as the charging media . the use of charging media 50 , 150 , 250 , and in particular , the use of solid injectable media such as graphite and of particulate solids of a granular nature such as steel balls will allow the hydraulic tensioning fasteners and hydraulic tensioning devices of the present invention to be used in high temperature applications . in these situations it may be desirable to use the hydraulic nut of fig7 to 9 which has a locking ring 216 to retain the required toad . removal of fastener 210 would require injection of charging medium 250 to loosen locking ring 216 and to release the pressure to allow device 210 to be unscrewed from bolt 220 . it will be realized that the foregoing has been given by way of illustrative example only and that all other modifications and variations as would be apparent to persons skilled in the art are deemed to fall within the broad scope and ambit of the invention as herein set forth . throughout the description and claims to this specification the word “ comprise ” and variation of that word such as “ comprises ” and “ comprising ” are not intended to exclude other additives components integers or steps .	8
fig1 - 10 illustrate details of a cooking table 10 according to an embodiment of the disclosure . the cooking table 10 is in essence a mobile cooking station . according to the depicted embodiment , the cooking table 10 includes a table top 12 supported by a suitable supporting base including a plurality of legs 22 . in one arrangement , the base , including the legs 22 , is made of aluminum for lightness and strength . as can be seen in the figures , the bottom of the legs 22 include wheels 24 to enable the cooking table 10 to be wheeled to suitable locations for cooking , eating , and / or storage . electric power is delivered to the cooking table 10 via power cord 29 for cooking and for height adjustment as is described hereinafter . as shown in fig1 - 3 , the table top 12 may be substantially planar . one part of the table top 12 includes a cooking device . the cooking device is preferably an hob 42 and may be made from a glass ceramic surface for easy cleaning . in one embodiment , the hob 42 is an induction hob with three cooking zones 44 a , 44 b , and 44 c . the induction system is beneficial because it is a low - energy consumption system . additionally , it minimizes heat retained on the surface which is beneficial should the user want to utilize the cooking table 10 for a surface for dining or serving shortly after cooking . however , alternative cooking devices may be used in lieu of the induction system . the table top 12 also includes a food warming zone 45 at the corner edge of the surface . this can be used to keep food at the right temperature after cooking . this warming zone 45 may be created by any low heat emitting device . for example , it could be formed by an electric heating system or it can be part of the induction based system . the table top 12 also includes a control interface region 48 with smart touch sensitive controls 49 . the controls 49 can be configured in any desirable arrangement to control the cooking areas 44 a , 44 b , and 44 c and the warming zone 45 . it is recognized that the controls 49 may be mapped within the region 48 to correspond to the configuration of the heating elements 44 a , 44 b , 44 c , and 45 with respect to each other . the controls 49 may also be labeled with suitable indicia associating the controls 49 with the heating elements 44 a , 44 b , 44 c , and 45 . the table top 12 further includes a tray or cutting board 50 on the side of the table opposite the hob 42 . as shown in fig4 , the cutting board 50 has an upper planar surface and is removable from the table 10 . the tray or cutting board 50 can be supported to be part of the table top 12 in any desirable way . for example , the cutting board 10 may sit inside and on a portion of a frame 20 . the supporting surface , not shown , for the cutting board 50 may extend across and span the entire area within the frame . this enables the user to place items on that surface with the cutting board removed . in one embodiment , the removable cutting board 50 is heat and / or bacteria resistant . further , the removable cutting board 50 may be highly durable and may be made from a high - density polyethylene . in one arrangement , the table top 12 may be 900 mm ( 35 . 4 inches ) long and 550 mm ( 21 . 7 inches ) wide . however , it is recognized that the table top 12 may be of other dimensions and configurations . as is evident from fig5 - 7 , the table 10 is of adjustable height so that the table top 12 can be moved to the desired height for food preparation , food cooking , and for eating regardless of whether the user chooses to eat on a couch , chair , or stool . in one arrangement , the table top 12 is adjustable in height between the range of first height ( h 1 ) ( shown in solid lines ) of 550 mm ( 21 . 7 inches ) to a second height ( h 2 ) ( shown in dashed lines ) of 800 mm ( 31 . 5 inches ). accordingly , the table top 12 is vertically adjustable within a range of 250 mm ( 9 . 84 inches ) to accommodate different cooking , eating , and serving activities and preferences and can be fully adjusted within that range . the vertical adjustability of the table top 12 can be provided by any desirable arrangement . in one arrangement , the table 10 includes jacks ( not shown ) integrated in the legs 22 . the jacks may be electrically operable . this arrangement is schematically shown in fig7 . in such an arrangement , the legs 22 include an upper portion 22 a and a lower portion 22 b . the lower portion 22 b is telescopically movable relative to upper portion 22 a . the jacks cause the effective height of the legs 22 to change , which also causes the height of the table top 12 to change relative to the supporting surface on which the wheels 24 rest . the height adjustability can be controlled by any suitable user - operable switch , such as a toggle switch , operative coupled to the jacks to raise the height of the table top 12 . in one arrangement , as schematically shown in fig8 , a switch 27 can be provided on the underside of the table top 12 to enable the user to adjust the height of the table and the switch 12 may be a toggle switch . as previously described , the table 10 is connected to an electronic power source by an external power cord 29 . more specifically , the power cord 29 may be coupled to one of the wheels 24 of the cooking table 10 . such an arrangement is depicted in fig9 - 10 . in this arrangement , the wheels 24 include a rotating portion 25 a which can roll on a supporting surface , and a stationary portion 25 b . as shown , there may also be a rotating portion 25 a on the opposite side of the stationary portion 25 b . the end of the power cord 29 is coupled to a plug 28 . the plug 28 also includes coupling prongs 30 . the exterior of the wheels 24 includes a socket , not shown , with forgiving receptacles that substantially match the shape of the prongs 30 . additionally , a portion the plug 28 is magnetic so as to create a magnetic coupling between the plug 28 and the wheel 24 in lieu of a friction fit coupling of a typical power connection . one advantage of the magnetic coupling between the plug 28 and the wheel 24 is that should a person accidently trip on or pull the wire 29 , the plug 28 will easily disconnect from the socket on the wheel 28 . this minimizes the possibility of disrupting cooking utensils on the hob 42 that may be in the process of cooking . additionally , when connected , a portion of each of the prongs 30 preferably fits in the stationary portion 25 b of the wheel 24 but an extended portion fits into an aligned annular opening in the rotating part of the wheel 25 a . this , prevents the rotation of the rotating portion 25 a of the wheel 24 relative to the stationary portion 25 a , and serves as a wheel lock to keep the cooking table 10 safe . accordingly , the mobile cooking table 10 has dimensions , features , and / or characteristics that make it desirable in the interior environment . it is highly adaptive and mobile and becomes an extension of the dinner table , coffee table , desk , etc according to the situation . it also allows the user to cook and eat at the same place , alone or with guests . it also provided the user with more flexibility to eat what they want , when they want , and where they want . it also provided convenience and comfort to enjoy cooking for themselves or their guests . the induction hob maintains little residual head after the cooking process , so the table top can quickly be converted from a cooking surface to a serving and / or eating surface . the height adjustability enables use of it as an eating surface when the user is sitting on the floor or a chair , and enables the user to use it while standing during food preparation . the power attachment coupling to a wheel provides additional benefits for use in living quarters . while the present invention has been described with reference to exemplary embodiments , it will be understood by those of ordinary skill in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the scope thereof . therefore , it is intended that the invention not be limited to the particular embodiments disclosed , but that the invention will include all embodiments falling within the scope of the appended claims .	5
a method for manufacturing a substrate of erbium - doped optical fibers using the mcvd method will now be described in conjunction with fig1 and 2 . in accordance with the mcvd method , a connecting tube 22 is first clamped at one end thereof on a clamping chuck 24 of a lathe ( not shown ), as shown in fig2 . a quartz tube 10 , which is called &# 34 ; a supporting tube &# 34 ;, is connected at the other end of connecting tube 22 . quartz tube 10 is used to manufacture an erbium - doped optical fiber substrate . thereafter , raw material 38 such as sicl 4 or gecl 4 transported from a raw supply system ( not shown ) by a flow of oxygen is supplied to the interior of quartz tube 10 . subsequently , quartz tube 10 is heated by an external heating source 26 ( for example , an oxygen / hydrogen burner ) while rotating . during the heating process , an oxidation reaction occurs in the interior of quartz tube 10 . the oxidation reaction is expressed by the following formula : in accordance with the oxidation reaction , particles of quartz - based oxides containing impurities are produced . the oxide particles exist in the form of a deposition 32 on the inner surface of quartz tube 10 . as the heating process is further carried out while heating source 26 reciprocates in a longitudinal direction on quartz tube 10 , particulate deposition 32 is sintered on the inner surface of quartz tube 10 while being transparentized . as a result , a thin glass layer is formed on the inner surface of quartz tube 10 . thereafter , the above procedure is repeated until the glass layer on the inner surface of quartz tube 10 has a desired thickness . during the formation of the glass layer , a portion of the glass layer corresponding to a clad layer 14 is first formed , and a portion of the glass layer corresponding to a core layer 16 is then formed . in order to manufacture erbium - doped optical fibers capable of directly amplifying optical signals to a desired high level without requiring a complicated signal processing by use of quartz tube 10 formed with clad layer 14 and core layer 16 , quartz tube 10 is separated from clamping chuck 24 after being closed at its one end . thereafter , a solution containing erbium and other additive elements is injected into the interior of quartz tube 10 closed at one end thereof . quartz tube 10 is then maintained in the above - mentioned condition for a desired period of time so as to allow erbium 18 to be absorbed in core layer 16 to a desired amount . after a desired period of time elapses , the solution is removed from quartz tube 10 . at this time , core layer 16 has absorbed the solution containing erbium 18 and other additive elements . subsequently , quartz tube 10 is clamped again on clamping chuck 24 , and its closed end is then opened . clamping chuck 24 then rotates to rotate quartz tube 10 so as to prevent the solution absorbed in core layer 16 from being sporadically concentrated in core layer 16 , as shown in fig2 . thereafter , quartz tube 10 is maintained for a long period of time as it is , so that the solution absorbed in quartz tube 10 can be air - dried . after the erbium absorbed in quartz tube 10 is completely dried in the above process , quartz tube 10 is heated again at a high temperature using heating source 26 , so that it is softened . thereafter , both ends of quartz tube 10 are completely sealed . thus , an erbium - doped optical fiber substrate having a hollow cylindrical structure is obtained . however , the above - mentioned method involving the step of drying the solution containing erbium 18 and other additive elements absorbed in quartz tube 10 is problematic in that a long period of time is required to carry out the drying step because the drying step is processed in a natural air - dried state . this results in a lengthened manufacturing time of erbium - doped optical fiber substrates . as a result , the manufacturing productivity of erbium - doped optical fiber substrates is degraded . furthermore , the costs of erbium - doped optical fiber substrates increase . in addition , a sporadic undrying phenomenon may occur because quartz tube 10 is dried in a natural air - dried state . such a sporadic undrying phenomenon results in a non - uniform refractivity distribution . another method for manufacturing a substrate of erbium - doped optical fibers using the mcvd method will now be described in conjunction with fig1 and 3 . in fig3 elements respectively corresponding to those in fig2 are denoted by the same reference numerals . in accordance with this conventional method using the mcvd method , a connecting tube 22 is first clamped at one end thereof on a clamping chuck 24 , as shown in fig3 . a quartz tube 10 , which is called &# 34 ; a supporting tube &# 34 ;, is connected at the other end of connecting tube 22 . quartz tube 10 is used to manufacture an erbium - doped optical fiber substrate . thereafter , raw material 38 such as sicl 4 or gecl 4 transported from a raw supply system by a flow of oxygen is supplied to the interior of quartz tube 10 . subsequently , quartz tube 10 is heated by an external heating source 26 ( for example , an oxygen / hydrogen burner ) while rotating . during the heating process , an oxidation reaction occurs in the interior of quartz tube 10 . the oxidation reaction is expressed by the following formula : in accordance with the oxidation reaction , particles of quartz - based oxides containing impurities are produced . the oxide particles exist in the form of a deposition 32 on the inner surface of quartz tube 10 . as the heating process is further carried out while heating source 26 reciprocates in a longitudinal direction on quartz tube 10 , particle deposition 32 is sintered on the inner surface of quartz tube 10 while being transparentized . as a result , a thin glass layer is formed on the inner surface of quartz tube 10 . thereafter , the above procedure is repeated until the glass layer on the inner surface of quartz tube 10 has a desired thickness . during the formation of the glass layer , a portion of the glass layer corresponding to a clad layer 14 is first formed , and a portion of the glass layer corresponding to a core layer 16 is then formed . in order to manufacture erbium - doped optical fibers capable of directly amplifying optical signals to a desired high level without requiring a complicated signal processing by use of quartz tube 10 formed with clad layer 14 and core layer 16 , quartz tube 10 is separated from clamping chuck 24 after being closed at its one end . thereafter , a solution containing erbium and other additive elements is injected into the interior of quartz tube 10 closed at one end thereof . quartz tube 10 is then maintained in the above - mentioned condition for a desired period of time so as to allow erbium 18 to be absorbed in core layer 16 to a desired amount . after a desired period of time elapses , the solution is removed from quartz tube 10 . at this time , core layer 16 has absorbed the solution containing erbium 18 and other additive elements . subsequently , quartz tube 10 is clamped again on clamping chuck 24 , and its closed end is then opened . clamping chuck 24 then rotates to rotate quartz tube 10 so as to prevent the solution absorbed in core layer 16 from being sporadically concentrated in core layer 16 , as shown in fig3 . during the rotation of quartz tube 10 , the outer surface of quartz tube 10 is slowly heated by a heater 30 at a low temperature while heater 30 reciprocates in a longitudinal direction on quartz tube 10 , thereby causing the solution absorbed in quartz tube 10 to be slowly dried . after the erbium absorbed in quartz tube 10 is completely dried in accordance with the above process , quartz tube 10 is heated again by a heating source 26 at a high temperature , so that it is softened . thereafter , both ends of quartz tube 10 are completely sealed . thus , an erbium - doped optical fiber substrate having a hollow cylindrical structure is obtained . where the solution containing erbium 18 and other additive elements absorbed in quartz tube 10 is dried in accordance with the above - mentioned method shown in fig3 it is possible to greatly reduce the drying time , as compared to the method of fig2 using the natural air - drying process . this is because the outer surface of quartz tube 10 is slowly heated by heater 30 at a warm temperature while heater 30 reciprocates in a longitudinal direction on quartz tube 10 , thereby causing the solution absorbed in quartz tube 10 to be dried . even in this case , however , several hours are required to dry quartz tube 10 . as a result , this method is also problematic in that a long period of time is taken to manufacture erbium - doped optical fiber substrates . as a result , the manufacturing productivity of erbium - doped optical fiber substrates is degraded . furthermore , the costs of erbium - doped optical fiber substrates increase . in addition , a sporadic undrying phenomenon may occur because quartz tube 10 is dried using heat generated by heater 30 . such a sporadic undrying phenomenon results in a non - uniform refractivity distribution . since heater 30 is used to dry quartz tube 10 , additional time and costs are required to install heater 30 . moreover , an erroneous installation of heater 30 may cause errors in the manufacture of erbium - doped optical fiber substrates . referring now to fig4 an apparatus for manufacturing erbium - doped optical fibers in accordance with an embodiment of the present invention is illustrated . in fig4 elements respectively corresponding to those in fig2 and 3 are denoted by the same reference numerals . in particular , the apparatus is used to dry a solution containing erbium and other additive elements absorbed in a quartz tube in the manufacture of an erbium optical fiber substrate using the mcvd method in accordance with the present invention . as shown in fig1 and 4 , the apparatus includes a chuck 24 which serves to fix a quartz tube 10 deposited with a clad layer 14 and a core layer 16 in accordance with the mcvd method and to rotate the fixed quartz tube 10 . a connecting tube 22 is fixedly mounted to one end of chuck 24 . connecting tube 22 serves to connect quartz tube 10 to chuck 24 . beneath connecting tube 22 , a heating source 26 is disposed to generate heat for slowly drying quartz tube 10 which is absorbed with a solution containing erbium 18 and other additive elements . in quartz tube 10 , a desired amount of gas from gas source 20 is also introduced . in order to increase the efficiency in drying the interior of quartz tube 10 , oxygen is used as the gas . for heating source 26 , an oxygen / hydrogen burner is used which is supplied only with hydrogen during ignition , and a mixture of hydrogen and oxygen during a heating process . now , a method for fabricating erbium - doped optical fibers using the above - mentioned apparatus in accordance with the present invention will be described in detail in conjunction with fig1 and 4 and flow diagram fig5 . in accordance with the method of the present invention using the mcvd process , quartz tube 10 , which is used to manufacture an erbium - doped optical fiber substrate , is first connected to connecting tube 22 ( step 510 ). this connecting tube 22 is then clamped on clamping chuck 24 ( step 520 ), as shown in fig4 . thereafter , raw material 38 such as a sicl 4 gas or a gecl 4 gas transported from a raw supply system by a flow of oxygen o 2 is supplied to the interior of quartz tube 10 , such that the flow rate of the oxygen controls the feeding of the raw material into quartz tube 10 . additionally , the sicl 4 gas may be doped with a gecl 4 gas and transported by the o 2 carrier . subsequently , quartz tube 10 is heated by external heating source 26 , namely , the oxygen / hydrogen burner , while rotating it by clamping chuck 24 . during the heating process , an oxidation reaction occurs in the interior of quartz tube 10 . the oxidation reaction is expressed by the following formula : in accordance with the oxidation reaction , particles of quartz - based oxides containing impurities are produced . the oxide particles exist in the form of a deposition 32 on the inner surface of quartz tube 10 . as the heating process is further carried out while heating source 26 reciprocates in a longitudinal direction on quartz tube 10 , particle deposition 32 is sintered on the inner surface of quartz tube 10 while being transparentized . as a result , a thin glass layer is formed on the inner surface of quartz tube 10 . thereafter , the above procedure is repeated until the glass layer on the inner surface of quartz tube 10 has a desired thickness . during the formation of the glass layer , a portion of the glass layer corresponding to a clad layer 14 is first formed ( step 530 ), and a portion of the glass layer corresponding to a core layer 16 is then formed ( step 540 ). the formation of core layer 16 is achieved by varying the amount of raw material 38 from that used in the formation of clad layer 14 . additionally , the amount of raw material used to form the core layer can be varied as each layer of the core layer is varied . in order to manufacture erbium - doped optical fibers capable of directly amplifying optical signals to a desired high level without requiring a complicated signal processing by use of quartz tube 10 formed with clad layer 14 and core layer 16 , quartz tube 10 is first closed at its one end ( step 550 ). the reason why quartz tube 10 is closed at its one end is because when a solution containing erbium 18 and other additive elements is injected into the interior of quartz tube 10 , the solution and erbium 18 may leak from the interior of quartz tube 10 . quartz tube 10 is then separated from clamping chuck 24 ( step 555 ). thereafter , a solution containing erbium and other additive elements is injected into the interior of quartz tube 10 closed at one end thereof ( step 560 ). quartz tube 10 is then maintained in the above - mentioned condition for a desired period of time so as to allow the erbium 18 to be absorbed in core layer 16 to a desired amount . at this time , core layer 16 has particles of an incomplete glass structure in order to allow the solution containing erbium 18 and other additive elements to penetrate easily therein . after a desired period of time elapses , the solution is removed from quartz tube 10 ( step 565 ). at this time , core layer 16 has absorbed the solution containing erbium 18 and other additive elements . subsequently , quartz tube 10 is clamped on clamping chuck 24 ( step 570 ), and its closed end is then opened ( step 575 ). a large amount of gas from gas source 20 is then fed into the interior of quartz tube 10 , as shown in fig4 and using heating source 26 , connecting tube 22 is uniformly heated at a temperature equal to or lower than the volatilization point of nitric acid . oxygen is used as the gas to increase the drying efficiency . during the heating , clamping chuck 24 rotates to rotate quartz tube 10 so as to uniformly heat connecting tube 22 to uniformly heat the gas , namely , oxygen , while preventing the solution absorbed in core layer 16 from being sporadically concentrated in core layer 16 ( step 580 ). by this heating , the solution containing erbium 18 and other additive elements is slowly dried . after the erbium absorbed in quartz tube 10 is completely dried in the above process , quartz tube 10 is heated again at a high temperature using heating source 26 , so that it is softened . thereafter , quartz tube 10 may be collapsed ( step 585 ) into a condensed erbium - doped optical fiber preform , or both ends of quartz tube 10 may be completely sealed to form an erbium - doped optical fiber preform having a hollow cylindrical structure . in accordance with the above - mentioned method and apparatus of the present invention , it is possible to greatly reduce the time taken to manufacture erbium - doped optical fibers for optical amplifiers . in the manufacture of erbium - doped optical fibers using a solution adding method , the time taken to dry the solution is dependent on the condition of the core layer . where it is assumed that the same core layers are formed using the same erbium - containing solutions , respectively , the method of fig2 using a heater can reduce the drying time to about 1 / 5 of the drying time taken in the natural air - drying method of fig2 . in accordance with the present invention , it is possible to reduce the drying time to about 1 / 2 of the drying time taken in the method of fig3 using a heater . accordingly , the present invention provides an effect of reducing the time taken to manufacture an erbium - doped optical fiber substrate . this results in a greatly reduced manufacturing time of erbium - doped optical fiber substrates . as a result , the manufacturing productivity of erbium - doped optical fiber substrates is improved . furthermore , the costs of erbium - doped optical fiber substrates are greatly reduced . since oxygen is supplied to the interior of the quartz tube and heated at an appropriate temperature , the erbium solution absorbed in the quartz tube can be uniformly dried in the rotation direction of the quartz tube and in the longitudinal direction of the quartz tube . accordingly , it is possible to prevent a sporadic undrying phenomenon from occurring in the interior of the quartz tube . in addition , it is not required to use any additional heating device such as a heater because the interior of the quartz tube is dried by the heating source used for the deposition of the clad and core layers . accordingly , it is possible to eliminate a loss of time and process errors resulting from the installation of a separate heating device . although the preferred embodiments of the invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims .	2
referring to fig5 the memory device comprises a power level detector 120 , an internal voltage converter ( ivc ) 600 and internal circuits 60 . the internal circuits 60 will be understood to be the same as those of fig1 . upon power up , a power level detector 120 generates a power - up signal pdt . the signal pdt activates the ivc 600 to produce internal supply voltage vint . the ivc 600 provides the required internal supply voltage vint to internal circuits 60 . power - up is used broadly herein to refer to any intended ramping up of power from a nominal zero volts to a nominal supply voltage , whether such occurs at initial power - up or start - up , for example , of a hand - held , flash memory - based device such as a digital camera or after initial start - up but after a dormant ( or so - called sleep ) period wherein the power supplied to the device &# 39 ; s internal circuits has been either diminished ( e . g . to a standby level ) or removed . [ 0031 ] fig6 is a block diagram illustrating a first embodiment of this invention . fig6 comprises a power level detector 120 , a ce buffer 140 , a cmd register 160 , a voltage regulator 400 and an ivc 600 . in accordance with the prior art , the active ivc controller 650 is activated only when the ce buffer . 140 or the cmd register 160 is enabled . the ce buffer 140 provides chip enable information and the cmd register 160 provides read , program , and erase information . the power - up signal pdt of the power level detector 120 does not input to the ivc controller 650 but inputs instead to the cmd register 160 and internal circuits 60 only for resetting the memory device . in contrast to the prior art teachings by which no power up signal pdt inputs to the ivc controller 650 , in accordance with the present invention , the signal pdt inputs to the ivc controller 650 during the power up period . in other words , novel ivc controller 650 is activated whenever one of the three signals , the chip enable signal from ce buffer 140 , the chip busy signal from cmd register 160 or the power up signal from power level detector 120 , is active . the power level detector 120 of the present invention is shown in fig7 . there are many types of power level detectors . although other power level detectors are contemplated as being within the spirit and scope of the invention , the featured power level detector 120 has a p - mos and an n - mos depletion transistor that are serially connected to each other , in accordance with the present invention . the gates of the two transistors are connected in common to ground . the source of the p - mos transistor mp 3 is connected to the external voltage vext , and the drain thereof is connected to node n 1 and to the drain of the n - mos transistor mn 3 . an n - type well which is used for the bulk of the p - mos transistor mp 3 is connected to the external supply voltage vext having high potential . the source of the n - mos transistor mn 3 is connected to ground . the n - mos transistor mn 3 connected between the node n 1 and ground is a depletion type and has a long channel , thus providing high resistance . as shown in fig7 and 8 , the level of node ni is ground level because of an n - mos depletion transistor mn 3 . when the external supply voltage vext reaches to the threshold voltage vth of p - mos transistor mp 3 , the p - mos transistor mp 3 turns on at t 1 . after time t 1 , the node n 1 ramps up from ground to the external supply voltage but does not reach the voltage vext because of the n - mos depletion transistor mn 3 . at the same time , the power up signal pdt ramps up from ground to the voltage vext and reaches the voltage vext in a short time because n - mos transistor ( not shown ) of inverter inv 1 is turned off . when the gate - to - source voltage vgs of n - mos and p - mos transistor ( not shown ) in the inverter inv 1 are the same , the power up signal pdt goes down toward ground level . in other words , when the node n 1 level reaches a certain trip - point level va at t 2 , the pdt goes logical low level . in general , the pdt is logical high level before t 2 and logical low level after t 2 . as a result , the power up period is finished after time t 2 . during the power - up period , the power - up signal pdt goes high and inputs to the ivc controller . the ivc ( 600 in fig6 )— which comprises an active ivc controller ( 650 ), active ivc drivers ( 300 ) and standby ivc driver ( 200 )— receives the power - up signal pdt from power level detector ( 120 ). as shown in fig5 and 9 , the active ivc controller 650 ( see fig9 ) receives the power - up signal pdt which is a logic high . the active ivc controller 650 generates an active ivc enable signal aivcen . the active ivc controller 650 comprises control logic 800 ( coupled to the internal supply voltage vint ) and a level shifter 850 . the control logic 800 includes a nor gate 101 and an inverter 103 . the nor gate 101 receives a power - up signal pdt , a chip enable signal chipenable and chip busy signal chipbusy . according to this invention , because the power level detector ( 120 in fig5 ) generates a power - up signal pdt at a logic high , the output of the nor gate 101 goes to a logic low . the level of the gate of the n - mos transistor 106 is a logic high , which turns on the transistor 106 when the output of the inverter 103 goes high . so the node n 4 goes low and turns on the p - mos transistor 107 . as a result , the external supply voltage vext is provide to the node n 5 . specifically , the output of the control logic 800 is shifted to the other level vext , the same as the level of the active ivc enable signal aivcen through the level shifter 850 . there are many types of level shifters 850 . in this invention , the level shifter uses an external voltage vext as a voltage source . namely , the active ivc enable signal aivcen is raised to the level of vext . those of skill in the art will appreciate that , within the spirit and scope of the invention , other types may be used . when the active ivc enable signal aivcen ( which is the output of the active ivc controller 650 ) inputs to the active ivc drivers ( 300 in fig6 ), the drivers ( 300 ) generate an internal voltage vint at node n 7 . a representative one of the active ivc drivers is shown in fig1 . there are many types of active ivc drivers . in this invention , two such driver types will be described . those of skill in the art will appreciate that , within the spirit and scope of the invention , other types may be used . one of the active ivc drivers is shown in fig1 and the other is shown in fig1 . the active ivc driver 310 of fig1 operates as follows . the external supply voltage vext is supplied to the node n 7 as an internal supply voltage vint through the p - mos transistor p 1 . similarly , the external supply voltage vext is supplied to node n 7 in active ivc driver 320 of fig1 as an internal supply voltage vint through the n - mos transistor m 1 . each of the two active ivc drivers ( 310 of fig1 , 320 of fig1 ) receives and is controlled by the active ivc enable signal aivcen . in both cases , the driver ( 310 , 320 ) receives a reference voltage signal vref as well as the active ivc enable signal aivcen . the reference voltage signal is generated by a voltage regulator 400 , as illustrated in fig1 . because any one of many known voltage regulators 400 can be used in this invention , it will not be further explained . referring next to fig1 , it will be appreciated that the active ivc driver ( 310 of fig1 , 320 of fig1 ) has a high charge driving capability compared with the standby ivc driver ( 200 in fig6 ). accordingly , when the internal supply voltage vint passes the external supply voltage vext by way of the active ivc driver , the slope of the internal supply voltage vint is greater than that of the standby ivc driver ( 200 ). moreover , the slope of the internal supply voltage vint is nearly as great as that of the external supply voltage vext . it is possible to use several active ivc drivers ( 300 in fig6 ) to provide the internal supply voltage to the node n 7 . preferably , plural active ivc drivers ( 300 ) are used to provide the internal supply voltage vint . this increases the internal supply voltage ramping - up speed ( slope ) and minimizes the speed difference between the external supply voltage vext and the internal supply voltage vint . thus , the internal supply voltage vint can be provided to the internal circuits within the required shorter time in the newer and more demanding hand - held systems . indeed , the invention makes it possible to achieve power - up voltage ramp slopes up to at least two orders of magnitude higher than has been conventionally possible , rendering memory device turn - on times far less than the required 1 μs maximum . this permits use of the invention in the most demanding digital camera applications , which may require as low as 1 microsecond power - up timing , rather than the several microsecond to millisecond ramp - up timing that conventional standby power techniques provided . in fig6 and 13 , during the power - up operation , the power level detector ( 120 in fig6 and 7 ) generates the power - up signal pdt of a logic high . according to the level of the power level detector , the ivc generates the internal supply voltage . the internal supply voltage vint ramps up quickly , closely following the ramp of the external supply voltage vext , until the internal supply voltage reaches the minimum operating voltage vdet , as shown in fig1 . as a result , the internal supply voltage rapidly goes to the vdet level . after the power level detector ( 120 of fig7 ) generates a logic low and the level of the node ni of fig7 exceeds the va level , the ivc driver ( 310 of fig1 , 320 of fig1 ) stops providing the internal supply voltage vint to the node n 7 . thereafter , the internal supply voltage connected to the node n 7 is supplied only the external supply voltage vext from the standby ivc driver . as shown in fig1 , after passing the time t 1 when the level of vdet is reached , the slope of supplied voltage is equal to the slope of the internal supply voltage vint from the standby ivc driver ( 200 of fig6 ). even though the slope of the internal supply voltage vint after time t 1 follows that of the standby ivc driver , because the internal supply voltage vint already has achieved the minimum operating voltage vdet within the required time , the system operates properly and without errors . in contrast , the active ivc driver of the prior art operates only when the memory device receives the chip enable signal or chip busy signal ( see fig1 ). moreover , the standby ivc driver ( 200 of fig1 ) provides only an internal voltage to the internal circuits during the power - up period . so , it is impossible to provide the internal supply voltage to the internal circuits within 1 μs , which is the required time in recent systems . in this embodiment , the ivc 600 further comprises a vint / vext short circuit 130 . the power - up signal pdt of the power level detector 120 does not input to the active ivc controller 650 but it does input to the vint / vext short circuit 130 . the active ivc controller is activated by the ce buffer 140 and cmd register 160 , as in the prior art . but , in important contrast , the internal supply voltage vint is supplied to the node n 7 by way of the vint / vext short circuit controlled by the power - up signal pdt . the vint / vext short circuit is shown in fig1 . as may be seen from fig1 , the power - up signal powerup ( pdt ) inputs to an inverter inv 2 to turn on p - mos transistor mp 4 , effectively shorting vext to vint . ( during the power - up period , the power - up signal powerup ( pdt ) goes to a logic high . the gate of the p - mos transistor goes to logic low via an inverter inv 2 . the p - mos transistor mp 4 turns on and the external supply voltage vext is connected to the internal supply voltage vint via the on transistor , effectively shorting vext to vint . ). within the spirit and scope of the invention , the p - mos transistor mp 4 may change to an n - mos transistor ( depletion or enhancement type .) the beneficial result of electrically shorting the two voltages vext and vint is illustrated in fig1 . during the power up , the internal supply voltage vint ramps up and precisely tracks the external supply voltage vext until time t 1 . at that time , the internal supply voltage reaches the minimum operating voltage vdet . after the power - up signal pdt goes to a logic low , as described above in connection with the first embodiment of invention , the slope of the internal supply voltage vint tracks that of the standby ivc driver ( 200 of fig1 ). as a result , it is possible to provide a quickly ramped - up internal supply voltage vint within the system required time . [ 0052 ] fig1 is a third embodiment of the present invention . in this figure , the power - up signal pdt of the power - up detector 120 inputs to the active wvc controller and vext / vint short circuit 130 . according as the power - up signal pdt concurrently inputs to the active ivc controller and vext / vint short circuit 130 , the internal supply voltage vint generated from the external supply voltage vext ramps up more rapidly . in this hybrid embodiment , active ivc controller 650 has three inputs , powerup , chipenable and chipbusy , as shown in fig9 and as described above . a person skilled in the art will be able to practice the present invention in view of the description present in this document , which is to be taken as a whole . numerous details have been set forth in order to provide a more thorough understanding of the invention . in other instances , well - known features have not been described in detail in order not to obscure unnecessarily the invention . while the invention has been disclosed in its preferred embodiments , the specific embodiments as disclosed and illustrated herein are not to be considered in a limiting sense . indeed , it should be readily apparent to those skilled in the art in view of the present description that the invention may be modified in numerous ways . the inventor regards the subject matter of the invention to include all combinations and sub - combinations of the various elements , features , functions and / or properties disclosed herein . the following claims define certain combinations and sub - combinations , which are regarded as novel and non - obvious . additional claims for other combinations and sub - combinations of features , functions , elements and / or properties may be presented in this or a related document .	6
the following description of the preferred embodiments is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . for example , the present invention is hereafter described in the context of a fuel cell fueled by reformed gasoline . however , it is to be understood that the principles embodied herein are equally applicable to fuel cells fueled by other reformable fuels . furthermore , the present invention hereafter described in the context of a self contained fuel cell system having a reforming system and a fuel cell system . however , it is to be understood that the principles embodied herein are equally applicable to a reforming system only . referring to fig1 , a fuel processor system , generally indicated as 10 , according to a first embodiment of the present invention is illustrated , which provides rapid startup capabilities . fuel processor system 10 generally includes a fuel processor 12 , a fuel cell stack 14 , a catalytic combustor reactor 16 , and a vaporizer reactor 18 . fuel processor 12 would typically include a primary reactor 12 . 2 such as a steam reformer or an autothermal reformer , a water gas shift ( wgs ) reactor 12 . 4 and a preferential oxidation ( prox ) reactor 12 . 6 . fuel processor system 10 is arranged such that a first fuel inlet stream 20 and a first water inlet stream 22 are introduced into fuel processor 12 to produce a reformate stream 24 according to conventional principles . during a startup cycle , an anode bypass valve 26 directs reformate stream 24 to an anode bypass passage 28 . it is necessary to initially bypass fuel cell stack 14 until “ stack grade ” ( having co content less than about 100 ppm ) reformate is produced . in order to produce such stack grade reformate , it is necessary to heat the various components of fuel processor system 10 to their respective operating temperatures . recirculated reformate in passage 30 from anode bypass passage 28 is drawn into a recirculation compressor 32 together with a first inlet air stream 34 . first fuel inlet stream 20 is then introduced into fuel processor 12 . reactions may be initiated in fuel processor 12 via a spark lit burner or by an electrically heated catalyst section ( not shown ). heat produced by the reaction of first fuel inlet stream 20 and first inlet air stream 34 warms fuel processor 12 . first fuel inlet stream 20 and first inlet air stream 34 are introduced in proportions slightly rich of stoichiometric . this ensures that there is no excess oxygen , which could damage the catalysts within fuel processor 12 . ordinarily , reactions near stoichiometric conditions produce damagingly high temperatures ; however , with a large excess of recirculated reformate 30 acting as a diluent , the gas temperature within fuel processor 12 is maintained at an appropriate level . a portion , generally indicated at 36 , of the flow through anode bypass passage 28 is exhausted to catalytic combustor reactor 16 . under steady flow , this exhausted reformate 36 is equal to the total mass flow of first fuel inlet stream 20 , first inlet air stream 34 , first water inlet stream 22 and vaporizer steam 38 that passes through fuel processor 12 . this exhausted reformate 36 is reacted with a second inlet air stream 40 in catalytic combustor reactor 16 . second inlet air stream 40 is directed to catalytic combustor reactor 16 via a stack air compressor 42 , a cathode bypass valve 44 , a cathode bypass passage 46 , and an exhaust passage 48 . second inlet air stream 40 is bypassed around fuel cell stack 14 during startup to prevent drying of the membranes within fuel cell stack 14 . heat from the reaction in catalytic combustor reactor 16 is integrated back into fuel processor 12 by vaporizing second water inlet stream 50 in vaporizer reactor 18 to produce vaporizer steam 38 , which typically is delivered to the prox - vaporizer or steam lines within fuel processor 12 . exhaust gases from combustor 16 exits vaporizer reactor 18 through exhaust outlet 66 . during the startup cycle , the fuel and air are completely consumed ( stoichiometric conditions ) for maximum heat release within fuel processor system 12 for rapid heating without excessively high temperatures . however , it is important to note that the temperature within the prox 12 . 6 may initially be relatively high at about 357 ° c . however , once the prox is heated , normal operation is such that cooling of the prox according to conventional methods can be used . referring again to fig1 , once the various reactors within fuel processor 12 are warmed to their operating temperature , anode bypass valve 26 routes reformate stream 24 to fuel cell stack 14 via passage 52 . second inlet air stream 40 is then directed by cathode bypass valve 44 to the cathode side of fuel cell stack 14 via passage 54 . the hydrogen from reformate stream 24 reacts with the oxygen from second air inlet stream 40 across a membrane electrode assembly within fuel cell stack 14 to produce electricity . anode exhaust or stack effluent 56 from the anode side of fuel cell stack 14 includes a portion of hydrogen that is directed back to catalytic combustor reactor 16 to provide heat recovered in vaporizer 18 . cathode exhaust 58 from the cathode side of fuel cell stack 14 includes oxygen also for use in catalytic combustor reactor 16 . anode exhaust 56 and cathode exhaust 58 are combined in exhaust passage 48 and react in catalytic combustor reactor 16 . vaporizer reactor 18 continues to provide vaporizer steam 38 to fuel processor 12 . note that the prox air , within fuel processor 12 , is drawn from recirculation compressor 32 which contains only first inlet air stream 34 when anode bypass valve 26 directs reformate stream 24 to fuel cell stack 14 . preferably , a reformate check valve 60 is disposed in exhausted reformate passage 36 to ensure that anode exhaust 56 and cathode exhaust 58 in exhaust passage 48 are not drawn into fuel processor 12 by recirculation compressor 32 . as is well known in the art , catalysts , such as that which is often used in water gas shift reactors ( i . e . cuzn ), are often sensitive to oxygen and condensed water . therefore , this is particularly important after shut down when the fuel processor cools and any water vapor condenses . that is , the reformate gases within fuel processors often have a very high water ( steam ) content ( typically 30 %), which condense when the fuel processor cools after shut down . additionally , as the fuel processor cools the condensation of water and the cooling of gases within the fuel processor may cause a reduction in gas pressure sufficient to pull a vacuum even if valves at the inlet and exit seal a fuel processor . at this point , any leaks present in the various valves , fittings , or flanges may allow air into the fuel processor and potentially damage the water gas shift catalyst . therefore , additional features are illustrated in fig2 to address these shut down issues . the fuel processor system 10 ′, shown in fig2 , is the same as that described in reference to fig1 , where like reference numerals are used to indicate like components . referring to fig2 , a recirculation valve 102 is positioned in recirculated reformate passage 30 and an exhaust valve 104 is positioned in exhaust reformate passage 36 . recirculation valve 102 and exhaust valve 104 are used in conjunction to control the recirculation ratio ( i . e ., the ratio of recirculated reformate stream to the total reformate stream ). that is , by opening recirculation valve 102 the flow of recirculated reformate 30 is increased , while opening exhaust valve 104 the flow of recirculated reformate 30 is decreased . furthermore , opening both valves 102 , 104 decreases the pressure within fuel processor 12 . recirculation valve 102 and / or exhaust valve 104 may be closed to prevent anode exhaust 56 and cathode exhaust 58 from being drawn into fuel processor 12 by recirculation compressor 32 . the transition to normal operation for fuel processor system 10 ′, shown in fig2 , is the same as described in reference to fig1 . fuel processor system 10 ′, shown in fig2 , further provide a means to shut down fuel processor 12 without water condensation or air ingestion . for shut down , reformate stream 24 is circulated to anode bypass passage 28 via anode bypass valve 26 . exhaust valve 104 remains closed to cause higher pressures within fuel processor 12 . recirculation valve 102 is then slightly opened to maximize pressure within the capacity of recirculation compressor 32 . during shut down , water is condensed and separated from reformate stream 24 in a condenser 106 , which is connected to the system coolant loop ( not shown ). in normal operation , condenser 106 is used as an anode pre - cooler before fuel cell stack 14 . to further increase the pressure within fuel processor 12 during shut down , recirculation compressor 32 draws in first inlet air stream 34 . preferably , the inlet to recirculation compressor 32 and the downstream side of circulation valve 102 are small in volume such that after recirculation compressor 32 is stopped , the pressure will remain high . subsequently , the oxygen within first inlet air stream 34 will react with the hydrogen in recirculated reformate 30 within fuel processor 12 to produce additional heat , thereby increasing the pressure within fuel processor 12 . however , if necessary , additional fuel from first fuel inlet stream 20 may be added during shut down to consume the oxygen in first inlet air stream 34 in order to provide sufficient reactants ( h 2 and co ) within fuel processor 12 . an oxygen sensor 108 is used in the fuel processor 12 as feedback to ensure that excess oxygen is not present . if the pressure within fuel processor 12 is higher than a predetermined level , exhaust valve 104 may be opened to reduce such pressure . once the water has been condensed from reformate stream 24 and a high pressure condition has been achieved within fuel processor 12 , fuel processor air mass flow controller 62 is closed to seal the inlet , anode bypass valve 26 remains in the bypass position , and exhaust valve 104 remains closed to seal the exit . recirculation compressor 32 is then stopped . the resident gases within fuel processor 12 are dry and at an elevated pressure , which is desired for shut down condition , particularly with a cuzn water gas shift catalyst . during the shut down cycle , the fuel and air are completely consumed ( stoichiometric conditions ) without water injection and without excessively high reactor temperatures to allow the gases to be dried by condenser 106 . as is well known in the art , conventional fuel processors suffer from various disadvantages when operating at reduce power and reduced flow , such as auto - ignition in the inlet , reverse water gas shift in the prox , cell reversal in the fuel cell stack , and water collection in the fuel cell stack . furthermore , the transition between power levels are often slow to react due to the time necessary to pressurize or vent reactor volumes so as to achieve steady flow conditions at the new power level . within the primary reactor temperatures in the inlet region increase such that there is a limited amount of time before undesirable auto - ignition of the fuel will occur . as the flow through the fuel processor is reduced at low power , the residence time within the inlet is increased . thus , the rate of reduction in flow and power is limited by the auto - ignition condition in the inlet . within the prox reactor , after the oxygen is consumed , reformate that is exposed to catalyst will undergo reverse water gas shift reactions , thereby consuming desirable h 2 and creating undesirable co . at reduced flow , the oxygen is consumed earlier in the prox reactor , thereby leaving a larger section of catalyst and a longer residence time for reverse water gas shift reactions to occur . within the fuel cell stack , the current flow through each fuel cell is limited by the fuel cell provided the lowest quantity of h 2 . that is , the fuel cell with the lowest h 2 flow limits the current through all of the remaining fuel cells . therefore , a portion of the available quantity of h 2 ( typically 10 to 20 %) leaves the fuel cell stack unused . at reduced flows , the portion of h 2 leaving the fuel cell stack needs to be higher for stable operation , which is likely the result of less uniform flow distribution at reduced flows . also contributing to the minimum flow for stable fuel cell stack operation is the need to clear condensed water to prevent it from collecting in and blocking passages within the gas distribution plates . in conventional systems , the flow rate through the fuel processor system varies with power level , thus the associated pressure drop necessitates a change in reactor pressure between power levels . however , a change in reactor pressure requires time for flow to fill or vent to the downstream reactors in order to achieve the steady pressure at the new power level . the numerous aforementioned disadvantages are overcome in the present invention by maintaining a higher flow rate , even during low power operation , by recirculating gases through the fuel processor and stack . fuel processor system 10 ″, shown in fig3 , illustrates a system having reformate circulation through the fuel processor for startup , means for water condensation and pressurization for shut down , and circulation through the fuel processor and anode for turn down and transients . the fuel processor system 10 ″, shown in fig3 , is the same as that described in reference to fig1 and 2 , where like reference numerals are used to indicate like components . more particularly , for startup , anode bypass valve 26 directs reformate stream 24 to anode bypass passage 28 . first fuel inlet stream 20 is introduced into fuel processor 12 . first inlet air stream 34 is delivered to fuel processor 12 by a fuel processor air compressor 202 . fig3 shows first inlet air stream 34 being delivered to three locations in fuel processor 12 in the form of pox air stream 204 , start air stream 206 and prox air stream 208 . pox and prox air streams 204 , 208 would normally be part of fuel processor 12 . heat produced by the reactions of fuel inlet stream 20 and inlet air stream 34 warms fuel processor 12 . by staging the inlet air to provide multiple heating locations , the startup time is reduced by improving heat distribution within fuel processor 12 . to initiate reactions in each of these locations , a spark lit burner or an electrically heated catalyst section ( not shown ) is used . the overall oxygen to carbon ( o / c ) ratio ( i . e . ratio of first inlet air stream 34 to first fuel inlet stream 20 ) is introduced in proportions slightly rich of stoichiometric to ensure that no excess oxygen is present , which could damage the catalyst within fuel processor 12 . the recirculated reformate 30 acts as a diluent so that all the available first inlet air stream 34 is reacted without excessively high temperatures within fuel processor 12 . exhaust reformate passage 36 is employed to exhaust excess reformate to catalytic combustor reactor 16 . under steady flow , this exhausted reformate in passage 36 is equal to the total mass flow of first fuel inlet stream 20 , first inlet air stream 34 , first water inlet stream 22 and vaporizer steam 38 that passes through fuel processor 12 . this exhausted reformate in passage 36 is reacted with second inlet air stream 40 in catalytic combustor reactor 16 . second inlet air stream 40 is directed to catalytic combustor reactor 16 via stack air compressor 42 , cathode bypass valve 44 , cathode bypass passage 46 , and exhaust passage 48 . second inlet air stream 40 is bypassed around fuel cell stack 14 during startup to prevent drying of the membranes within fuel cell stack 14 . heat from the reaction in catalytic combustor reactor 16 is integrated back into fuel processor 12 by vaporizing second water inlet stream 50 in vaporizer reactor 18 to produce vaporizer steam 38 , which typically is delivered to the prox - vaporizer or steam lines within fuel processor 12 . an anode check valve 210 and a cathode check valve 212 are shown to prevent back flow of reformate exhaust 48 into fuel cell stack 14 . preferably , a reformate check valve 60 is also disposed in exhausted reformate passage 36 to ensure that anode exhaust 56 and cathode exhaust 58 in exhaust passage 48 are not drawn into fuel processor 12 by recirculation compressor 32 . once the various reactors within fuel processor 12 are warmed to their operating temperature , anode bypass valve 26 routes reformate stream 24 to fuel cell stack 14 via anode inlet passage 52 . second inlet air stream 40 is then directed by cathode bypass valve 44 to the cathode side of fuel cell stack 14 via cathode inlet passage 54 . the hydrogen from reformate stream 24 reacts with the oxygen from second air inlet stream 40 across a membrane electrode assembly within fuel cell stack 14 to produce electricity . anode exhaust or stack effluent 56 from the anode side of fuel cell stack 14 includes a portion of hydrogen that is directed back to catalytic combustor reactor 16 where it is oxidized to provide heat . cathode exhaust 58 from the cathode side of fuel cell stack 14 includes oxygen which may also be used in catalytic combustor reactor 16 . anode exhaust 56 and cathode exhaust 58 are combined in exhaust passage 48 and react in catalytic combustor reactor 16 . vaporizer reactor 18 continues to provide vaporizer steam 38 to fuel processor 12 . a back pressure regulator 214 is used to set the pressure within fuel processor system 10 ″, while recirculation compressor 32 determines the amount of reformate recirculated . as additional flow from first fuel inlet stream 20 , first inlet air stream 34 , first water inlet stream 22 , and vaporizer steam 38 is added to fuel processor 12 , additional reformate flow will split to exhausted reformate passage 36 to maintain the system pressure . therefore , at high power , the system 10 ″ operates at a low recirculation ratio , whereby a larger portion of reformate stream 24 is “ fresh ” having a relatively high h 2 content . at low power , the system 10 ″ operates at a high recirculation ratio , whereby a larger portion of reformate stream 24 is re - circulated and having a relatively low h 2 content . it is important to note that recirculation compressor 32 according to the present embodiment need only overcome the pressure drop through fuel processor 12 and fuel cell stack 14 during normal operation , unlike the system shown in fig2 where the pressure would drop to atmospheric pressure downstream of recirculation valve 102 to allow first inlet air stream 34 to be drawn in . to this end , fuel processor system 10 ″ illustrated in fig3 requires an additional fuel processor air compressor 202 . alternatively , stack air compressor 42 can be used to deliver air to fuel processor 12 . as best seen in fig3 , fuel processor system 10 ″ maintains a flow rate that is approximately equal to a fuel processor system operating at an optimum power level . this higher flow rate helps overcome many of the disadvantages described above . during the shut down cycle of fuel processor system 10 ″, anode bypass valve 26 routes reformate stream 24 to anode bypass passage 28 . second inlet air stream 40 is then directed by cathode bypass valve 44 through cathode bypass passage 46 to catalytic combustor reactor 16 . this will provide air to catalytic combustor reactor 16 to react with any exhausted reformate in passage 36 from the recirculation loop . backpressure regulator 214 is adjusted to indirectly produce the highest possible pressure within the capacity of recirculation compressor 32 . as reformate stream 24 recirculates through fuel processor 12 , water is condensed and separated in condenser 106 . to further increase the pressure within fuel processor 12 prior to shut down , fuel processor air compressor 202 draws in first inlet air stream 34 . subsequently , the oxygen within first inlet air stream 34 will react with the hydrogen in circulated reformate 30 within fuel processor 12 to produce additional heat , thereby increasing the pressure within fuel processor 12 . however , if necessary , additional fuel from first fuel inlet stream 20 may be added during shut down to consume the oxygen in first inlet air stream 34 in order to provide sufficient reactants ( h 2 and co ) within fuel processor 12 . an o 2 sensor 108 is used in fuel processor 12 as feedback to ensure that excess oxygen is not present . once the water has been condensed from reformate stream 24 and a high pressure condition has been achieved within fuel processor 12 , fuel processor air mass flow controllers 216 , 218 , 220 and stack air mass flow controller 64 are closed to seal the inlets , anode bypass valve 26 and cathode bypass valve 44 remain in the bypass position , and back pressure regulator 214 remains closed to seal the exit . recirculation compressor 32 , fuel processor air compressor 202 , and stack air compressor 42 are stopped . the resident gases within fuel processor 12 are dry and at an elevated pressure , which is desired for shut down condition , particularly with a cuzn water gas shift catalyst . yet another alternative system is illustrated in fig4 wherein a compressor may be eliminated from the fuel processor system , generally indicated at 10 ′″. fuel processor system 10 ′″ is operated at sub - atmospheric pressures such that potential for air ingestion exists . otherwise , the startup , shut down , turn down and transient operation are similar to fuel processor system 10 ″ illustrated in fig3 . an additional benefit of fuel processor system 10 ′″ is that a recirculated exhaust 302 can be made inert by providing just enough cathode exhaust 58 to catalytic combustor reactor 16 using a combustor air mass flow controller 304 for stoichiometric operation in catalytic combustor reactor 16 . a cathode back pressure regulator 306 is needed to match the pressure set by a back pressure regulator 308 downstream of catalytic combustor reactor 16 to ensure cathode exhaust 58 can be directed to catalytic combustor reactor 16 . an o 2 sensor 310 may be used in exhaust 312 to ensure stoichiometric operation . a unique capability of the aforementioned systems is the potential to operate without water addition . this is an advantage for a system that is to be started in ambient temperatures below o ° c ., where water is not available . because the system 10 ′″ operates at a high recirculation , this mode of operation is relatively inefficient at about 62 %, however it may be used for short duration . it should be understood that features of the fuel processor systems illustrated in fig1 - 4 can be combined as needed for system requirements . for example , prox air 208 may preferably be delivered from stack air compressor 42 . that is , various combinations of the various systems described herein might be made depending upon the specific application . as should be appreciated from the foregoing discussion , the fuel processor systems of the present invention all include recirculation of fuel processor gases , such as reformate , anode exhaust , or combustor exhaust . this feature provides numerous advantages that are not present in conventional fuel processor systems . for example , the fuel processor systems of the present invention are capable of providing a large mass flow rate through the fuel processor to aid in heating the fuel processor components to the proper operating temperatures during startup . moreover , during shut down , the fuel processor systems of the present invention enable the fuel processor to run dry and condense water from the reformate to avoid condensation on the catalysts and subsequently be shut down at an elevated pressure to prevent air ingestion upon cooling of the fuel processor . still further , during turn down , the fuel processor systems of the present invention enable higher flow rates through the fuel processor and fuel cell stack to avoid auto - ignition in the inlet , reverse water gas shift in the prox , cell reversal in the fuel cell stack , and water collection in the fuel cell stack , all of which occur at reduced flow rates . during transient response , the fuel processor systems of the present invention , by circulating gases , enables the flow rate and pressure in the fuel processor to remain nearly constant , thereby minimizing the lag in transient response associated with filling or venting volumes in the fuel processor system . the ability to use recirculated gases , which contain water vapor as a product of reaction , enables the fuel processor to run without water injection . the fuel processor systems of the present invention enable rapid thermal start of the fuel processor without the complexity of multiple stages or risk of oxygen exposure . the description of the invention is merely exemplary in nature and , thus , variations that do not depart from the gist of the invention are intended to be within the scope of the invention . such variations are not to be regarded as a departure from the spirit and scope of the invention .	2
in fig1 an up / down counter generally designated as 10 has two up count inputs or increment inputs having leads 12 and 14 connected thereto and being supplied with positive pulse ( pp ) and bias 1 frequency pulses respectively . up / down counter 10 additionally has two decrement or down inputs with leads 16 and 18 connected thereto . lead 16 has negative sets of pulses applied thereto while lead 18 has the feedback pulses applied thereto . an output 20 of the up / down counter 10 provides apparatus digital high - pass output words to further circuitry as well as to a low - pass filter 22 . filter 22 provides an output on a lead 24 to a summing means 26 having a bias 2 input 28 . the summing means 26 and the bias 2 signal in one embodiment of the invention was designed into the low - pass filter function of block 22 . an output of summing means 26 is supplied on a lead 30 to a digitally controlled oscillator or divider or counter 32 . counter 32 receives a clock or reference frequency input on a lead 34 and has a feedback output previously labeled as 18 . in one embodiment of the invention , the reference frequency on lead 34 was 51 . 84 megahertz while the frequency of the bias signal on lead 14 was four kilohertz . the bias signal on lead 28 was 4d60 hex which equates to a decimal number of 12 , 959 . in a stable or non - input state , the counter 32 would count from 12 , 959 to 32 , 767 and output a pulse fb . it would then load a new digital word which would again be 12 , 959 as modified by any outputs from low - pass filter 22 and count to its maximum limit of 32 , 767 before outputting a further feedback pulse . in fig2 an or gate 41 receives bias 1 and positive ( pp ) signals on leads 43 and 45 . leads 43 and 45 correspond to 14 and 12 in fig1 . a further or gate 47 receives negative ( np ) pulses and feedback ( fb ) pulses on leads 49 and 51 respectively . these signals correspond to similarly labeled leads in fig1 . an output of or gate 41 is applied to an input of an and gate 53 and to an inverting input of a further and gate 55 . an output of or gate 47 is supplied to an inverting input of and gate 53 and to an input of and gate 55 . an output of and gate 53 is supplied to a d input a flip - flop generally designated as 57 while an output of and gate 55 is supplied to d input of a further flip - flop 59 . a clock input is supplid on a lead 61 to the clock ( ck ) inputs to both flip - flops 57 and 59 . an output of flip - flop 57 is shown in lead 63 and would be an increment signal supplied to the counter portion of counter 10 while an output of flip - flop 59 is labeled 65 and would be supplied to a decrement input of up / down counter 10 . although a preferred embodiment utilized nand gates and nor gates for cost effectiveness , it was believed that the circuit illustrated in fig2 would be simpler to explain and functionally performs the identical function to that utilized in the circuit reduced to practice . the combinational circuit of fig2 is designed to provde an increment output when there is either a bias 1 or pp input signal and there is neither an np or fb signal . on the other hand , a decrement output is provided on lead 65 when there is either an np or fb signal and there is not a bias 1 or pp signal . the waveform of fig3 shows an output representative of that appearing on lead 20 of fig1 in response to a single isolated input on lead 12 . a single set of inputs causes the output to reach some maximum value designated as 70 . at a time 72 the output drops to a value 74 . the time between 70 and 72 is shorter than the time between 72 and a next time 76 . at time 76 , the output drops to a value 78 . further times 80 , 82 , 84 , 86 , and 88 are illustrated . each of the values 90 , 92 , 94 , and 96 remain at their given levels for a longer time period . the digital output representation is equivalent to and representative of the analog waveform produced by r - at . such a curve is commonly referred to as an rc time constant curve . a value substantially equivalent to e - 3 would produce a digital word zero output since at that point the output would be equal to or less than 5 % of the initial value . since one embodiment of the inventive concept utilized eight discrete steps from any given maximum to a minimum , eight levels are shown in fig3 . in fig4 a waveform illustrative of the pp signal on lead 12 of fig1 is provided as waveform 100 . a logic &# 34 ; 1 &# 34 ; is designated as 102 , and in one embodiment of the invention , comprises eight clock periods . the waveform 100 contains several segments 104 , 106 , 108 , and 110 to illustrate time compression . the separate segments are broken but are intended to illustrate that the pp sets of pulses cannot occur any more often than once every fourth bias 1 pulse . the bias 1 pulses are shown on waveform representation 112 and illustrates pulses 114 , 116 , 118 , 120 , and 122 . one embodiment of the inventive concept divided a 51 . 84 megahertz signal by 32767 - 12959 to produce the bias 1 signal . the eight pp pulses 102 are thus representative of the time for eight 51 . 84 megahertz clock signals to occur . it should also be noted that the logic is designed such that the pp pulses and the bias 1 pulses cannot occur at the same time . the breaks between the various segments of the waveforms of fig4 is due to the fact that there are 12 , 959 clocks between adjacent bias 1 pulses such as 114 and 116 . fig5 illustrates a waveform pp with pulses 130 , 132 , 134 , 136 , and 138 . each one of these is a logic &# 34 ; 1 &# 34 ; for a period of eight clock pulses . a further waveform np is shown with a single negative pulse 140 which also is representative of being a logic &# 34 ; 1 &# 34 ; for eight clock pulses . a final waveform designated as 20 &# 39 ; starts at ground potential and has a first peak 142 responsive to pp pulse 130 , a second peak 144 responsive to pp pulse 132 , a third peak 146 responsive to pp pulse 136 , a fourth peak 148 responsive to pp pulse 136 and a final positive peak 150 responsive to pp pulse 138 . after point 150 , the output declines to a point coincident with pulse 140 at which time the output decreases to a negative value designated as 152 . the waveform 20 &# 39 ; is a series of step functions similar to that shown in fig3 . the very basic concept of the high - pass filter should be somewhat obvious to anyone skilled in the art from the information contained in the background and detailed description . as will be realized , the up / down counter 10 in a stable apparatus condition where no inputs have been received on leads 12 or 16 for a long period of time , will have an output digital word at lead 20 which is effectively or substantially zero . thus , the output of low - pass filter 22 will be a digital zero and the signal on lead 30 going into divider 32 will be identical to the bias 2 word appearing on leading 28 . since the digitally controlled oscillator or divider 32 is , in actuality , in one embodiment of the invention , merely a further counting device , the clock signals appearing on lead 34 continuously increment counter 32 . each time the counter 32 reaches a limit such as 32 , 767 as it did in one embodiment of the invention , an output pulse is supplied on the feedback line 18 . if the clock or reference frequency on lead 34 is 51 . 84 megahertz and the digital word on lead 28 is equivalent to 12 , 959 , the frequency of occurrence of pulses on lead 18 would be exactly four kilohertz . thus , if the signal on lead 14 is also a four kilohertz pulse , the system will remain in a stable condition with no outputs appearing on lead 20 . even if the signals on leads 28 and 34 are such that the signal on lead 18 is not exacty the same as that on lead 14 , the apparatus of fig1 will still provide an output on lead 20 which has an average value of zero for the long term . if , when the apparatus of fig1 is in a stable condition , a signal if supplied on lead 12 as is shown by 102 in fig4 a new digital word will appear on lead 20 . if the signal 102 remains in a logic &# 34 ; 1 &# 34 ; condition for a period of eight clock pulses of counter 10 , an output digital word of the equivalent of eight will appear on output 20 . the low - pass filter 22 will pass the integral of this signal to output 24 so that the summation digital word at output 30 will change and will used as the starting count point by divider 32 after the issuance of the next feedback pulse . thus , a period of time from 70 to 72 in fig3 is required before there is enough difference in the frequency of signals on lead 18 as compared to that on lead 14 to reduce the output of counter 10 to the level shown as 74 in fig3 . during this time , the output of low - pass filter 22 is increasing in steps if it is a digital low - pass filter , and is continuously increasing if it is in analog - type filter . it should be mentioned that although this concept is being described as being a completely digital high - pass filter including all of its components , the apparatus can be a hybrid assembly of analog and digital circuits if there is a desire to have a hybrid system . in such a case , the device 32 may be a controlled oscillator and the filter 22 may be an analog rc - type filter while the bias 2 on lead 28 may be a stable reference voltage . in any event , the output of filter 22 continues to provide an output until the system again stabilizes . if further pulses are received on either leads 12 or 16 , then a signal such as shown as 20 &# 39 ; in fig5 may result , assuming the input pulses on leads 12 and 16 are as shown by waveforms pp and np in fig5 . the waveforms of fig4 are shown to reference the fact that as designed , the system was restricted from having more than one set of pulses or logic &# 34 ; 1 &# 34 ; values on either 12 or 16 any more often than every four occurrences of the lead 14 logic &# 34 ; 1 &# 34 ; condition . while this is merely a design parameter , it was believed that any more frequent occurrences of the negative or positive position pulses would require undue digital number size and thus , commercially , costly component complexity and substrate area .	7
in fig1 the aligned antenna is represented by three sensors c 1 , c 2 and c 3 and the misaligned antenna is shown by the sensors c 1 , c 2 and c 2 , the position of the sensor c 2 resulting from a translation of the central sensor c 2 of the aligned antenna along a vector of misalignment ε having its ends identical with the positions of the sensor c 2 and of the sensor c 2 p . according to this configuration , the vector ε may occupy any direction of the space around the ideal position of the sensor c 2 , its modulus remaining relatively small compared with the distance l between two consecutive sensors c 1 , c 2 or c 2 , c 3 of the aligned antenna . in considering only what happens with an aligned antenna , the distance r between the central sensor c 2 and the target and the relative bearing θ of the target with respect to the direction of alignment of the sensors c 1 , c 2 and c 3 are obtained simply from the differences of propagation times τ 12 and τ 23 or time difference of each wave front coming from the target and reaching the sensors c 1 - c 2 and c 2 - c 3 . these time differences are defined by the relationships : ## equ1 ## where r 1 and r 3 are the respective distances between the sensors c 1 and the target , and c is the velocity of propagation of sound in the medium in which the antenna is submerged . taking only second order terms , θ and r are defined as a function of the differences in propagation times τ 12 and τ 23 by the relationships ## equ2 ## naturally , in the presence of a misaligned antenna , the differences in propagation times obtained are no longer equal to the time differences τ 12 and τ 13 . taking only terms of the first order in ## equ3 ## the distance r p between the sensor c 2 p and the target is then defined by an expression of the form : where u represents the standardized vector of the direction of the target and & lt ;,& gt ; symbolizes the scalar product . the differences in propagation times τ 12 p and τ 23 of the sound wave coming from the target between , respectively , sensors c 1 - c 2 p and c 2 p - c 3 are defined by relationships of the form : the relationships 6 and 7 show that the misalignment of the sensors on the antenna has an effect on the propagation times measured by the sensors and that , consequently , it should have an effect also on the computation of the position of the target . in particular , the appreciation of the distance r should be considered to be biased by the value : ## equ4 ## if both the alignment fault ε and the direction u are perfectly known , the biased value of the distance can be perfectly determined by the relationship 8 . however , in practice , only ε can be perfectly determined , and there always remains an error of appreciation of the direction u of the target . if we consider an orthonormal reference ( o , x , y , z ), the relationship 8 should be considered as a resultant of the sum of a distance biased in the horizontal plane ( o , x , y ) and a distance biased in a vertical direction oz normal to this plane such that : ## equ5 ## when the target is localized in the horizontal plane , the components of the vector u in this plane u x and u y can be estimated properly . the errors δu x and δu y are very close to 0 , and the bias on the distance is above all determined by the uncertainty on δu z . the bias ( r ) is expressed as a function of the bias of 1 according to the relationship : ## equ6 ## by way of indication , a vertical misalignment of 10 cm , for a target depth of 400 meters , may give rise to a bias on the distance of about 11 %. the result of the foregoing is that it is indispensable to take the depth of the target into account , to determine a precise tracking of these targets when the antennas used are not perfectly linear . according to the invention , the depth of the target is either determined by a computation or , again , measured by a sonar antenna that is directional in elevation . in the following computations , it is assumed that the target shifts at constant velocity v in a horizontal plane of submersion z . according to the first method , the angle of elevation is estimated on the basis of all the measurements of the differences in the trajectory times . the coordinates are all given in a geographic cartesian reference system of any origin . the target is determined at each instant by a state vector x such that : where x ( t ) and y ( t ) define the components of distance of the vector in a horizontal plane and v x and v y determine its components of velocity in this same plane . this vector naturally relates to the instant of estimation t * and is used to reconstruct the trajectory x t , y t of the target by integration . at any instant , the time difference between the sensors c k and c 1 , for example , is determined by a relationship of the form : ## equ7 ## the distance r k ( t ) between the target and the sensor c k is given by a relationship of the form : ## equ8 ## where d k which represents the horizontal distance of the target from the sensor , is defined by : the submersion term is computed by making the submersion of the central sensor c 2 take place at the instant t . it is defined by the relationship : ## equ9 ## the foregoing formulae ( 14 ) to ( 17 ) enable the prediction of the time differences τ ( x ) as a function of the state vector x to be estimated . the estimation algorithm is defined in the manner shown in fig2 . it consists , at the step 1 , in making a prediction , by means of the relationships ( 14 ), of the time differences as a function of each state vector x and then in making a computation , at the step 2 , of the residues of estimation between the values of time differences measured between each sensor and the predicted time differences . these computations use likelihood maximum and least square estimators in a known way . these likelihood maximum and least square estimators give an estimated value x of the state vector x when the values of the measured and predicted time differences τ ( x ) are minimum . this minimizing is achieved , for example , by using a known iterative algorithm of the gauss newton type , shown in the steps 3 and 4 . according to this algorithm , the estimated value x i + 1 of the state vector obtained at the i + 1th iteration is defined on the basis of the estimated value xi obtained at the i th by a relationship of the form : where d i is a value of descent obtained by resolving a least squares problem which minimizes the criterion such that : ## equ10 ## where j i is the jacobian matrix of the function τ ( x ) evaluated at each estimated vector x i . γ is a scalar between - 1 and + 1 chosen at each iteration so as to minimize the criterion . the iterations stop when the criterion no longer decreases significantly . in the method that has just been described , the gauss newton algorithm is initialized by a pseudo - linear estimator derived from the method of trajectography by azimuths described , for example , in s . c . nardone , a . g . lindgren and k . f . gong , &# 34 ; fundamental properties and performance of conventional bearings - only motion analysis &# 34 ; in ieee transactions on automatic control , vol . ac - 29 , no . 9 , september 1984 . this method consists , in a first step , in computing the value of the angle ak made by the direction of a meridian of the terrestrial geoid with the half - line joining the middle of the space between the sensors c k and c 1 and the target . according to a second step , the value of the azimuth is put into an equation according to the relationship : ## equ12 ## and , finally , in a third step , the three pairs of sensors and the n measuring instants are considered to resolve a linear system obtained from the previous relationship , the resolution of which is done by the least squares method , weighted by σ - 1 . this pseudo - linear estimation enables the initializing of the gauss - newton algorithm in position and velocity , the initial elevation being arbitrarily chosen as zero . the method that has just been described may also , if necessary , be adapted to the situations in which the elevation can be measured by an independent sonar antenna . for , if in addition to the antenna device that has just been described , a sonar , at each instant , delivers a measurement taken of the elevation of the target , it may be judicious to use these items of data to compute the trajectography of the target . in this case , the method of computation uses a method very similar to the previous one . in then referencing the elevation values in relation to the central sensor , the equation of prediction of the elevation values is then : ## equ13 ## the predicted elevations then have to be included in the vector of the time differences τ ( x ) while the elevations measured have to be included in the vector of time differences measured . to initialize the gauss newton algorithm , the elevation that is taken into account is equal to the mean of the elevation values obtained , giving : ## equ14 ## this elevation value is then taken into account for the computation of the azimuths according to the relationship : ## equ15 ## the implementation of the method of the invention could advantageously be done by means of one or more suitably programmed signal processing microprocessors . this implementation is within the scope of those skilled in the art .	6
the following description refers to the accompanying drawings . among the various drawings the same reference numbers may be used to identify the same or similar elements . while the following description provides a thorough understanding of the various aspects of the claimed invention by setting forth specific details such as particular structures , architectures , interfaces , and techniques , such details are provided for purposes of explanation and should not be viewed as limiting . moreover , those of skill in the art will , in light of the present disclosure , appreciate that various aspects of the invention claimed may be practiced in other examples or implementations that depart from these specific details . at certain junctures in the following disclosure descriptions of well known devices , circuits , and methods have been omitted to avoid clouding the description of the present invention with unnecessary detail . fig4 a is a partial top view of an active device array substrate of a liquid crystal display panel according to an embodiment of the present invention . fig4 b is a cross - sectional view of a partial structure of the liquid crystal display panel according to an embodiment of the present invention . the cross - sectional view of the active device array substrate in fig4 b is taken along the sectional lines a - a ′ and b - b ′ in fig4 a . referring to fig4 a and 4b together , the liquid crystal display panel 400 is , for example , but not limited to , an mva lcd . the liquid crystal display panel 400 may include a plurality of pixel units 410 arranged in an array . each pixel unit 410 may have a plurality of sub - pixel regions 411 and includes a plurality of active devices 413 , a plurality of liquid crystal capacitors 415 , and a plurality of storage capacitors 417 . one of the active devices 413 may be disposed in one of the sub - pixel regions 411 and electrically connected to a scan line 420 and a data line 430 . the liquid crystal capacitors 415 are respectively disposed in the sub - pixel regions 411 , and each liquid crystal capacitor 415 is electrically connected to the corresponding active device 413 . the storage capacitors 417 are respectively disposed in the sub - pixel regions 411 , and each storage capacitor 417 is electrically connected to the corresponding active device 413 . in the same pixel unit 410 , the ratio of the capacitance of the storage capacitor 417 to that of the liquid crystal capacitor 415 of any sub - pixel region 411 is unequal to the ratio of the capacitance of the storage capacitor 417 to that of the liquid crystal capacitor 415 of any other sub - pixel regions 411 . for the convenience of illustrating the structure of the liquid crystal display panel 400 , in this embodiment , each pixel unit 410 only has two sub - pixel regions 411 a and 411 b , and only includes two active devices 413 a and 413 b , two liquid crystal capacitors 415 a and 415 b , and two storage capacitors 417 a and 417 b in one embodiment of the invention . other embodiments of the invention may include more or fewer of any or all of these devices . the active device 413 a is disposed in the sub - pixel region 411 a , the active device 413 b is disposed in the sub - pixel region 411 b , and both the active device 413 a and the active device 413 b are electrically connected to the same scan line 420 and the same data line 430 . the liquid crystal capacitor 415 a is disposed in the sub - pixel region 411 a and electrically connected to the active device 413 a , and the liquid crystal capacitor 415 b is disposed in the sub - pixel region 411 b and electrically connected to the active device 413 b . the storage capacitor 417 a is disposed in the sub - pixel region 411 a and electrically connected to the active device 413 a , and the storage capacitor 417 b is disposed in the sub - pixel region 411 b and electrically connected to the active device 413 b . the ratio of the capacitance of the storage capacitor 417 a to that of the liquid crystal capacitor 415 a of sub - pixel region 411 a is unequal to the ratio of the capacitance of the storage capacitor 417 b to that of the liquid crystal capacitor 415 b of the sub - pixel region 411 b . each pixel unit 410 further includes two pixel electrodes 419 a and 419 b in one embodiment of the invention . more or fewer electrodes may be included in other embodiments of the invention . the pixel electrodes 419 a and 419 b are disposed in the sub - pixel region 411 a and 411 b respectively . the part of each of the pixel electrodes 419 a , 419 b that extends to a storage capacitor line 440 serves as storage capacitor opposite electrode 419 c , 419 d respectively . the storage capacitor opposite electrodes 419 c , 419 d are respectively coupled with the storage capacitor line 440 to form the storage capacitor 417 a and the storage capacitor 417 b respectively . the pixel electrodes 419 a , 419 b further have a plurality of main slits l for defining four alignment domains i , ii , iii , iv respectively . for example , a plurality of protrusions p 10 is disposed above the pixel electrodes 419 a , 419 b . when the pixel unit 410 is not driven , the liquid crystal molecules in the liquid crystal layer 450 are arranged vertically . when the pixel unit 410 is driven , the liquid crystal molecules in the liquid crystal layer 450 are inclined towards the horizontal direction . particularly , in one of the specific alignment domains i , ii , iii , iv , the inclined directions of the liquid crystal molecules are consistent . however , in different alignment domains i , ii , iii , iv , the inclined direction of the liquid crystal molecules are different from one another . by means of making the liquid crystals inclined towards different directions , the liquid crystal molecules in different alignment domains can compensate for the optical effects generated by a change of viewing angles , such that the liquid crystal display panel 400 has a wider viewing area . in view of the above , the active devices 413 a , 413 b are , for example , tfts , switching elements with three terminals or another suitable switch element ( e . g ., diode ). the storage capacitor line 440 may be parallel to the scan line 420 and arranged between two adjacent scan lines ( e . g ., 420 ). furthermore , pixel electrode 419 a , liquid crystal layer 450 , and common electrode 460 help form a liquid crystal capacitor 415 a , and pixel electrode 419 b , liquid crystal layer 450 , and common electrode 460 help form liquid crystal capacitor 415 b . fig4 c is an equivalent circuit diagram of a liquid crystal display panel according to an embodiment of the present invention . referring to fig4 a and 4c , in each pixel unit 410 the active device 413 a has a parasitic capacitor 414 a of a capacitance c gd ( a ), and the active device 413 b has a parasitic capacitor 414 b of a capacitance c gd ( b ). the capacitance c gd ( a ) may be equal to or different from the capacitance c gd ( b ). it should be mentioned that in the liquid crystal display panel 400 of this embodiment , each pixel unit 410 includes two sub - pixel regions 411 a and 411 b and the ratio of the storage capacitance c st ( a ) to the liquid crystal capacitance c lc ( a ) of the sub - pixel region 411 a is unequal to the ratio of the storage capacitance c st ( b ) to the liquid crystal capacitance c lc ( b ) of the sub - pixel region 411 b , i . e ., c st ( a )/ c lc ( a )≠ c st ( b )/ c lc ( b ). other embodiments of the invention may include more or fewer subpixel regions . if the characteristic that the ratio of the capacitance of the sub - pixel region 411 a is unequal to that of the sub - pixel region 411 b is utilized together with an appropriate driving method , the voltage v a on the pixel electrode 419 a can be adjusted to be different from the voltage v b on the pixel electrode 419 b . if the pixel electrode voltage v a and the pixel electrode voltage v b are different , the voltage difference at both ends of the liquid crystal capacitor 415 a may be different from that at both ends of the liquid crystal capacitor 415 b . therefore , the liquid crystal molecules in the sub - pixel region 411 a and that in the sub - pixel region 411 b may be inclined to different extents . in other words , the liquid crystal molecules in a same pixel unit 410 may have , for example , eight inclining angles based on the number of different alignment domains . consequently , the light transmittances of the sub - pixel region 411 a and the sub - pixel region 411 b may be different ( e . g ., 411 a has a high gray level and 411 b has a low gray level ), and the liquid crystal molecules in two sub - pixel regions 411 a , 411 b can compensate the optical effects ( e . g ., form a middle gray level ), thereby eliminating or reducing the color shift phenomenon of the liquid crystal display panel 400 . in order to achieve c st ( a )/ c lc ( a )≠ c st ( b )/ c lc ( b ), in one embodiment , the storage capacitance c st ( a ) of the storage capacitor 417 a is different from the storage capacitance c st ( b ) of the storage capacitor 417 b . the method of achieving c st ( a )/ c lc ( a )≠ c st ( b )/ c lc ( b ), however , is not limited to the above method . in another embodiment , the liquid crystal capacitance c lc ( a ) of the liquid crystal capacitor 415 a may be unequal to the liquid crystal capacitance c lc ( b ) of the liquid crystal capacitor 415 b , so as to achieve c st ( a )/ c lc ( a )≠ c st ( b )/ c lc ( b ). there are various methods for making the liquid crystal capacitance c lc ( a ) unequal to the liquid crystal capacitance c lc ( b ). for example , the layout of the mask may be changed to make the pixel electrode 419 a and the pixel electrode 419 b have different areas . furthermore , an insulating layer ( not shown ) may be formed below the pixel electrode 419 a or the pixel electrode 419 b , such that the sub - pixel region 411 a and the sub - pixel region 411 b have different cell gaps . in other embodiments , c st ( a )/ c lc ( a )≠ c st ( b )/ c lc ( b ) may be obtained by having c st ( a )≠ c st ( b ) and c lc ( a )≠ c lc ( b ). hereinafter , the driving method for the liquid crystal display panel 400 is described . fig4 d is a schematic view of a drive waveform in a certain time sequence of the liquid crystal display panel in fig4 c . referring to fig4 c and 4d , in the driving method , firstly , a scan signal v s is applied to the scan line 420 . then , a data signal v d is applied to the data line 430 . after that , a compensation signal v st remains applied to the storage capacitor line 440 . furthermore , a common voltage v com is applied to the common electrode 460 , and the high level voltage of the data signal v d is greater than the value of the common voltage v com . fig4 d further shows a relation curve between the pixel electrode voltage v a of the pixel electrode 419 a and the pixel electrode voltage v b of the pixel electrode 419 b . the relation curve is shown below the drive waveform and does not share , for example , a y axis ( v ) with the drive waveform plot . it can be seen from fig4 d that when the scan signal v s is switched from a high level to a low level , the compensation signal v st is switched to a high level . specifically , when the scan signal v s is switched from the high level to the low level , the pixel electrode voltage v a and the pixel electrode voltage v b are slightly dropped due to a feed - through effect of the parasitic capacitor 414 a and the parasitic capacitor 414 b . however , after the compensation signal v st is switched from a low level to a high level , the pixel electrode voltage v a and the pixel electrode voltage v b rises due to the feed - through effects . also , since c st ( a )/ c lc ( a )≠ c st ( b )/ c lc ( b ), the amounts of rising respectively for the pixel electrode voltage v a and the pixel electrode voltage v b due to the feed - through effect caused by the variation of the compensation signal v st are different , and the magnitude of the rising voltage δv ( i . e ., “ feedthrough voltage ”) for either δv a or δv b is expressed by the following equation : where v sth is a high level voltage of the compensation signal , v stl is a low level voltage of the compensation signal . it can be seen from equation 1 that as the storage capacitance c st ( a ) and the storage capacitance c st ( b ) are different , the extent of rising ( e . g ., δv a , δv b ) of the pixel electrode voltage v a and the pixel electrode voltage v b respectively in different sub - pixel regions is different . therefore , the voltage difference at two ends of the liquid crystal capacitor 415 a is different from that at two ends of the liquid crystal capacitor 415 b , such that the liquid crystal molecules in the sub - pixel region 411 a and the sub - pixel region 411 b are inclined to different extents . as a result , the light transmittance of the sub - pixel region 411 a is different from that of the sub - pixel region 411 b . if the above driving method is used to adjust the pixel electrode voltage v a and the pixel electrode voltage v b to change the light transmittances of the sub - pixel region 411 a and the sub - pixel region 411 b , the color shift phenomenon of the liquid crystal display panel 400 can be eliminated or reduced . it should be noted that the above driving method is suitable for the circumstance when the value of the high level voltage of the data signal v d is greater than the value of the common voltage v com . however , if the value of the high level voltage of the data signal v d is smaller than the common voltage v com , the switching of the compensation signal v st may be different , in one embodiment of the invention , from that described above . for example , fig4 e is a schematic view of a drive waveform of the liquid crystal display panel in fig4 c under another circumstance . when the value of the high level voltage of the data signal v d is smaller than the value of the common voltage v com and after the scan signal v s is switched from the high level to the low level , the pixel electrode voltage v a and the pixel electrode voltage v b are dropped due to the feed - through effect of the parasitic capacitor 414 a and the parasitic capacitor 414 b . then , the compensation signal v st is switched to the low level , and the pixel electrode voltage v a and the pixel electrode voltage v b are dropped again , instead of rising . the dropping extents of the pixel electrode voltage v a and the pixel electrode voltage v b are different , so that the light transmittance of the sub - pixel region 411 a is different from that of the sub - pixel region 411 b , which further eliminates the color shift phenomenon of the liquid crystal display panel 400 . however , when taking the frame with a positive polarity ( e . g ., fig4 d ) and the frame with a negative polarity ( e . g ., fig4 e ) into account , if the feedthrough voltage is different in different sub - pixel regions due to the parasitic capacitor ( i . e ., parasitic capacitance ), the sub - pixel regions cannot have the same common voltage v com . in each sub - pixel region , the feedthrough voltage equation caused by the parasitic capacitor is expressed by equation 1 . in one embodiment of the present invention , the capacitance c gd ( a ) and the capacitance c gd ( b ) may be adjusted to be different according to the above equation 1 , such that the pixel electrode voltage v a and the pixel electrode voltage v b respectively located in different sub - pixel regions have the same feedthrough voltage regardless of whether the frame has a positive polarity ( e . g ., fig4 d ) or a negative polarity ( e . g ., fig4 e ). that is , δv a1 ( positive frame ) is equal to δv a2 ( negative frame ), and δv b1 ( positive frame ) is equal to δv b2 ( negative frame , as shown in fig4 f ), thereby making each of the sub - pixel regions have the same common voltage v com . if a frame with a low gray level is displayed in the liquid crystal display , the frame with a low gray level must be ensured to have a minimum dark - state brightness , so as to achieve a frame with a high contrast . fig4 g is a schematic view of a drive waveform of the liquid crystal display panel in fig4 c according to another embodiment of the present invention . in a frame with a low gray level , the data signal v d with a low gray level of a positive polarity can be adjusted to be smaller than the value of the common voltage v com . as the compensation signal v st is switched from a low level to a high level , the pixel electrode voltage v a and the pixel electrode voltage v b can be increased such that the pixel electrode voltage v a is greater than the common voltage v com , and the pixel electrode voltage v b is still smaller than the common voltage v com . therefore , the average visual effect may be equal to the original low gray level display of a positive polarity and thereby achieve a low color shift effect . fig4 h is a schematic view of a drive waveform of the liquid crystal display panel in fig4 c according to still another embodiment of the present invention . in the low gray level display of a negative polarity , the low gray level data signal v d of a negative polarity can be adjusted to be greater than the value of the common voltage v com . the compensation signal v st may be switched from a high level to a low level and the pixel electrode voltage v a and the pixel electrode voltage v b may be dropped as a result , the pixel electrode voltage v a may be lower than the common voltage v com and the pixel electrode voltage v b may still be higher than the common voltage v com . therefore , the average visual effect is equal to the original low gray level display of a negative polarity , thereby achieving a low color shift effect . the above liquid crystal display panel 400 can be used to assemble a liquid crystal display . fig5 is a schematic structural view of an lcd according to an embodiment of the present invention . referring to fig5 , the liquid crystal display 600 may include a liquid crystal display panel 400 , a backlight module 510 , and an optical film 520 . the backlight module 510 may be a cold cathode fluorescence lamp ( ccfl ) backlight module , and may include a back frame 512 , a reflector 514 , a plurality of cold cathode fluorescence lamps ( ccfls ) 516 , and a diffuser 518 . the diffuser 518 may be disposed above the back frame 512 , the ccfls 516 may be disposed between the diffuser 518 and the back frame 512 , and the reflector 514 may be disposed between the ccfls 516 and the back frame 512 . similarly , the liquid crystal display panel 400 may be disposed above the backlight module 510 . the optical film 520 may be disposed between the liquid crystal display panel 400 and the backlight module 510 . in this embodiment , the backlight module 510 is a ccfl backlight module , but in another embodiment , the backlight module 510 can also be a light emitting diode ( led ) backlight module or another suitable backlight source . since the liquid crystal display 600 is assembled using the liquid crystal display panel 400 , the liquid crystal display 600 not only has a relatively large viewing angle , but the color shift phenomenon can also be eliminated . in one embodiment of the invention , the liquid crystal display panel may employ a row inversion driving method . in other words , in the same frame time data signals applied to the pixel units 410 in the same row have the same polarity and data signals applied to the pixel units 410 in two adjacent rows have opposite polarities . in a liquid crystal display panel 400 adopting a driving method of row inversion , the storage capacitor line 440 may be parallel to the scan line 420 and arranged between two adjacent scan lines 420 in one embodiment of the invention . in other words , pixel units 410 sharing the same common scan line 420 may also share the same common storage capacitor line ( s ) 440 . particularly , any two adjacent pixel units 410 in the same row may share the same common storage capacitor line ( s ) 440 . thus , as for two adjacent pixel units 410 , the compensation signals v st may have the same value , and the writing voltage of the two pixel units 410 may have the same polarity . the storage capacitor line 440 is not limited to the shape as shown in fig4 b . for example , in another embodiment of the invention ( fig6 ), the driving method of the liquid crystal display panel may also be the row inversion mode . the storage capacitor line 440 may extend on the liquid crystal display panel in a direction substantially the same as that of the data line 430 . also , the storage capacitor line 440 may further have a plurality of extension lines 440 a ′ disposed along the main slit l of the pixel electrode 410 . since the area above the main slit l is a “ no effect ” area and the extension line 440 a ′ is made of an opaque material , the aperture ratio of the pixel unit 410 may not be reduced after the extension line 440 a ′ is disposed along the main slit l of the pixel electrodes 419 a , 419 b . also , the driving method is not limited to the row inversion mode , but can also be , for example but without limitation , column inversion , pixel inversion , dot inversion mode or “ many dot ” inversion mode . specifically , the liquid crystal display panel of fig6 can adopt the driving method of dot inversion . in this embodiment of the invention , the compensation signals v st can be different since the pixel units 410 in any two adjacent columns use different storage capacitor lines 440 . therefore , the writing voltages of two pixel units 410 can have opposite polarities . in addition , the liquid crystal display panel 400 may be a normally dark display apparatus . that is , when no voltage is applied to the liquid crystal capacitor 415 a and the liquid crystal capacitor 415 b , the display is normally dark . when the pixel unit 410 is lightened abnormally , one can weld the pixel electrode 419 a ( or the pixel electrode 419 b ) and the storage capacitor line 440 together by means of , for example , a laser . considering the characteristic that the average compensation signal v st of the storage capacitor line 440 equals the common voltage v com , coupling the storage capacitor or line to the pixel electrode 419 a , 419 b may make the lightened pixel unit 410 become a dark dot so as to reduce the sensation of human eyes to dead spots and thereby enhance the display quality . the process for manufacturing the aforementioned liquid crystal display panel and the liquid crystal display of the present invention is compatible with the current manufacturing processes in this field , without requiring additional manufacturing equipments . also , the driving method of the present invention is not limited to be applied to the mva lcd , but can also be applied to other kinds of liquid crystal displays , for example , twisted nematic ( tn ) lcd , in - plane switching ( ips ) lcd , optically compensated bend ( ocb ) lcd , etc . while the present invention has been described with respect to a limited number of embodiments , those skilled in the art will appreciate numerous modifications and variations therefrom . it is intended that the appended claims cover all such modifications and variations as fall within the true spirit and scope of this present invention .	6
the low dielectric constant materials of the present invention are prepared by subjecting a borazine derivative as a starting material , i . e ., an inorganic or organic compound containing a borazine skeleton structure of the formula ( 1 - 1 ) in its molecule or a substituted borazine ( 1 - 2 ), to a condensation reaction to produce an oligomer or polymer containing the borazine skeleton structure . the preparation of the low dielectric constant materials is carried out , for example , according to the procedures as described in yoshiharu kimura , senni - to - kogyo ( fiber and industry ), vol . 52 , no . 8 , 341 - 346 ( 1996 ); paine & amp ; sneddon , recent developments in borazine - based polymers , “ inorganic and organometallic polymers ”, american chemical society , 358 - 374 ( 1994 ); and fazen et al ., chem . mater ., vol . 7 , p1942 ( 1995 ). that is , the low dielectric constant materials can be obtained by heating a borazine derivative as the starting material to undergo a condensation reaction , or by firstly synthesizing a prepolymer in such a manner and then polymerizing it . in general , the condensation reaction is carried out by heating the starting material in an organic solvent at a temperature of 50 to 400 ° c ., preferably 70 to 180 ° c . for 1 to 240 hours , preferably in an inert gas atmosphere such as argon . in the preparation of low dielectric constant materials is used an organic solvent which can homogeniously disperse or dissolve borazine , borazine derivatives as mentioned above or borazine - based prepolymers , e . g ., an alcohol such as methanol , ethanol , propanol or butanol , acetone , benzene , toluene , xylene , glyme and others . an example of the substituted borazine ( 1 - 2 ) is b - triethylaminoborazine . b - triethylaminoborazine can be prepared , for example , by reacting b - trichloroborazine with ethylamine in toluene at an elevated temperature , e . g ., 70 ° c ., for several hours , e . g ., 4 hours , and removing ethylamine hydrochloride and the solvent . in the inorganic or organic compound containing a borazine skeleton structure of the formula ( 1 - 1 ) in its molecule , the inorganic compound to which the substituted borazine ( 1 - 2 ) is bound includes , for instance , silicate , silazane , silsequioxane , siloxane , silane and the like . the organic compound to which the substituted borazine ( 1 - 2 ) is bound includes , for instance , poly ( aryl ether ), parylene , polyphenylene , polyphenylenevinylene , polybenzocyclobutene , polyimide , polyester , polystyrene , polymethylstyrene , polymethyl acrylate , polymethyl methacrylate , polycarbonate , adamantane , norbornene , and the like . the low dielectric constant materials of the present invention can also be obtained by a chemical vapor deposition method , as described after , using a boron source , a nitrogen source and a carbon or the like source such as methane , a chemical vapor deposition method using a substituted borazine such as methylborazine or ethylborazine , or by methods as disclosed in c . k . narula et al ., j . am . chem . soc ., vol . 109 , p5556 ( 1987 ) and y . kimura et al ., composites science and technology , vol . 51 , p173 ( 1994 ). the low dielectric constant materials of the present invention prepared from the inorganic or organic compound containing in its molecule the borazine skeleton structure shown by the formula ( 1 - 1 ) are inorganic or organic oligomers or polymers containing a borazine skeleton structure shown by the formula ( 2 ), ( 3 ) or ( 4 ) in the molecule thereof . these oligomers and polymers have a lower dielectric constant than silicon oxide and fluorine - containing silicon oxide , and an excellent water resistance . they are composed of , as a main component , boron nitride which has a copper diffusion preventing function and accordingly can prevent diffusion of copper . examples of the borazine skeleton structures included in the oligomers or polymers are those having the formulas ( 5 ) to ( 116 ) shown below . the low dielectric constant materials according to another embodiment of the present invention are condensates of the substituted borazine ( 1 - 2 ), in other words , compounds having a third borazine skeleton - based structure formed by bonding a first borazine skeleton structure represented by any one of the formulas ( 2 ) to ( 4 ) with a second borazine skeleton structure represented by any one of the formulas ( 2 ) to ( 4 ) with elimination of hydrogen atoms from each of the molecules of a substituted borazine to form the third borazine skeleton structure . examples of the condensates are , for instance , compounds having borazine skeletone structures shown by the above formulas ( 25 ) to ( 28 ). the reason why the low dielectric constant material of the present invention can achieve a low dielectric constant is considered that the electronic polarization is decreased by an ionic electronic structure of the borazine skeleton . also , a high heat resistance can be achieved by the low dielectric constant materials of the present invention , since inorganic polymeric materials which have of course a higher heat resistance than organic polymeric materials are used . further , the reason why the low dielectric constant materials of the present invention have a high water resistance is considered that if r 1 to r 4 is substituents other than hydrogen atom in the formulas ( 2 ) to ( 4 ), they firmly bond to boron atom or nitrogen atom in the borazine skeleton and are prevented from reacting with water . since a hydrogen atom bonding to a boron atom or a nitrogen atom is easily hydrolyzed , it is necessary that in the low dielectric constant material of the present invention , at least one of r 1 to r 4 in the formulas ( 2 ) to ( 4 ) is not a hydrogen atom , but a substituent . in particular , since a hydrogen atom bonding to a boron atom causes a hydrolysis reaction more easily as compared with that bonding to a nitrogen atom , it is preferable that a substituent is bonded to a boron atom . as to the degree of substitution , preferred from the viewpoint of water resistance , of hydrogen atoms on the borazine skeletons included in a molecule which constitutes the low dielectric constant material , assuming that the degree of substitution is 100 % if all hydrogen atoms on the borazine skeletons are substituted by a substitutent or substituents shown in the formulas ( 2 ) to ( 4 ), water resistance equivalent to that for a degree of substitution of 100 % is obtained when 30 to 40 % of all hydrogen atoms are substituted by a substitutent or substituents shown in the formulas ( 2 ) to ( 4 ), namely when the degree of substitution is 30 to 40 %. the dielectric constant can be further lowered by introducing fluorine atom ( f ) into boron nitride . thus , an insulation layer having a lower dielectric constant can be obtained thereby . the insulating films of the present invention are obtained by forming the low dielectric constant materials of the present invention into thin films . the insulating films of the present invention are applicable as an interlayer insulating film of semiconductor devices , whereby excellent semiconductor devices can be obtained . in case of using the low dielectric constant materials in the form of a film , for example , as an interlayer insulating film for semiconductor devices , the film can be formed by coating a solution or dispersion of the low dielectric constant material in a solvent . in that case , the low dielectric constant material may be used in combination with other materials such as other insulating materials which are used preferably in an amount of at most 20 % by weight based on the total weight of the low dielectric constant material of the present invention and other materials . examples of the other materials are , for instance , a known interlayer insulating material for semiconductor devices such as silicate , silazane , silsequioxane , siloxane , silane , polyaryl ether , parylene or polybenzocyclobutadiene , a general insulating material such as adamantane , norbornene , polyimide , polyester , polystyrene , polymethylstyrene , polymethyl acrylate , polymethyl methacrylate or polycarbonate , an amine such as cyclohexylamine , aniline or ethylamine , a surface active agent , and the like . the coating to a substrate can be conducted by spray coating , dip coating , spin coating or other known coating methods . the solvent or dispersing medium includes , for instance , acetone , benzene , glyme , tetrahydrofuran , chloroform and other organic solvents capable of dissolving or dispersing the low dielectric constant materials . the concentration is preferably from 10 to 30 % by weight . preferably , after drying the coated film , the dried film is further heat - treated to cure the film at a temperature of 300 to 450 ° c ., preferably 350 to 400 ° c . the thickness of the insulating film is preferably from 0 . 3 to 0 . 8 μm . in case of using the low dielectric constant materials as a film such as an interlayer insulating film for semiconductor devices , thin films can also be formed according to procedures as described for example in s . v . nguyen , t . nguyen , h . treichel and o . spindler , j . electrochem . soc ., vol . 141 , no . 6 , 1633 - 1638 ( 1994 ); w . f . kane , s . a . cohen , j . p . hummel and b . luther , j . electrochem . soc ., vol . 144 , no . 2 , 658 - 663 ( 1997 ); and m . maeda and t . makino , japanese journal of applied physics , vol . 26 , no . 5 , 660 - 665 ( 1987 ). for example , the insulating film or layer can be obtained by subjecting a mixture of diborane ( b 2 h 6 ), ammonia ( nh 3 ) and methane or a mixture of borazine ( b 3 h 3 n 6 ), nitrogen ( n 2 ) and methane as a raw material a chemical vapor deposition method ( cvd method ), thereby causing a condensation reaction . in case that the low dielectric constant materials are used in the form of a bulk body as a low dielectric constant substrate , the materials are molded by casting into a mold and heat - treating the resulting molded article . the low dielectric constant material to be cast may be used in combination with other materials as mentioned above . the content of other materials is at most 20 % by weight . the insulating films of the present invention applicable to various electronic parts as an interlayer insulating film for semiconductor devices , as a barrier metal layer or etch stopper layer , is and as an ic substrate . thus , the present invention provides semiconductor devices including an insulating layer or film made of the low dielectric constant materials of the present invention . in an embodiment of the semiconductor devices according to the present invention , a first insulating layer having a first copper conductive layer disposed to form a lower wiring and a third insulating layer having a third copper conductive layer disposed to form an upper wiring are stacked on the surface of a semiconductor substrate through a second insulating layer interposed therebetween and having a second copper conductive layer communicating with both the first copper conductive layer and the third copper conductive layer so as to electrically connect the lower wiring with the upper wiring . in this embodiment , at least one of the first , second and third insulating layers is made of an insulating material containing the low dielectric constant material of the present invention . in another embodiment of the semiconductor devices according to the present invention , a first insulating layer having a first copper conductive layer disposed to form a lower wiring and a second insulating layer having a third copper conductive layer disposed to form an upper wiring and having a second copper conductive layer communicating with both the first copper conductive layer and the third copper conductive layer so as to electrically connect the lower wiring with the upper wiring are stacked on the surface of a semiconductor substrate through an insulating film interposed therebetween , the second copper conductive layer also extending through the insulating film . in this embodiment , the insulating film interposed between the first and second insulating layers is made of an insulating material containing the low dielectric constant material of the present invention . since the insulating layer or film made of an insulating material containing the low dielectric constant material of the present invention is used in the above semiconductor devices instead of conventional built - up films of silicon oxide and silicon nitride , the wiring capacitance can be reduced . also , since the insulating layer or film is made of an insulating material containing the low dielectric constant material of the present invention which has a copper diffusion preventing function , it is not needed to use a barrier metal layer at connecting hole portions and , therefore , a low resistant wiring can be obtained and it is possible to operate the semiconductor devices at high speed . in the above embodiments , the first , second and third conductive layers are made of copper and , therefore , the wiring delay can be decreased as compared with the use of aluminum , but the materials of the conductive layers are not limited copper . an example of the wiring structure of semiconductor devices according to the present invention is shown in fig1 . in the figure , numeral 1 denotes a semiconductor substrate made of silicon , and numeral 19 denotes an insulating layer made of silicon oxide . on the silicon oxide insulating layer 19 is formed an insulating layer 20 having a thickness of 0 . 3 μm and made of a crosslinked poly ( b - methylaminoborazine ) which is a low dielectric constant material according to the present invention . the insulating layers 19 and 20 constitute the first insulating layer . in the insulating layer 20 is formed a first trench 3 having a width of 0 . 2 μm and a depth of 0 . 2 μm in the pattern of a first wiring . a first copper conductive layer 5 is filled in the trench 3 . a second insulating layer 21 having a thickness of 0 . 5 μm made of the crosslinked poly ( b - methylaminoborazine ) is formed on the insulating layer 20 and the first copper conductive layer 5 . in the second insulating layer 21 is formed a hole 8 having a diameter of 0 . 15 μm and extending to the first copper conductive layer 5 , and the hole 8 is filled with copper to form a second copper conductive layer 10 so as to contact the first copper conductive layer 5 . on the insulating layer 21 is formed a third insulating layer 22 having a thickness of 0 . 2 μm made of the crosslinked poly ( b - methylaminoborazine ). in the third insulating layer 22 is formed a second trench 12 having a depth of 0 . 2 μm in the pattern of a second wiring . the bottom of the trench 12 extends to the insulating layer 21 , and copper is filled in the trench 12 to form a third copper conductive layer 13 . an insulating film 23 made of the crosslinked poly ( b - methylaminoborazine ) is formed on the insulating layer 22 and the third copper conductive layer 13 . in semiconductor devices having such a structure , all copper conductive layers , that is , the first copper conductive layer 5 , the second copper conductive layer 10 and the third copper conductive layer 13 , are in contact with the insulating layers 20 , 21 and 22 and film 23 made of an insulating material comprising the low dielectric constant material of the present invention . thus , copper diffusion from the conductive layers can be prevented from occurring . furthermore , since the insulating layers 20 , 21 , 22 and 23 have a dielectric constant of 2 . 2 and also do not require a barrier metal layer , the wiring capacitance can be reduced as compared with conventional wiring structure shown in fig6 whereby high speed operation of semiconductor devices can be ensured . [ 0073 ] fig2 is a sectional view of a semiconductor device showing a further embodiment of the present invention . an insulating layer 19 made of silicon oxide is formed on a silicon semiconductor substrate 1 . on the silicon oxide insulating layer 19 is formed an insulating layer 20 a having a thickness of 0 . 3 μm and made of an amorphous crosslinked poly ( b - methylaminoborazine ) which is a low dielectric constant material according to the present invention . the insulating layers 19 and 20 a constitute the first insulating layer . in the insulating layer 20 a is formed a first trench 3 having a width of 0 . 2 μm and a depth of 0 . 2 μm in the pattern of a first wiring . a first copper conductive layer 5 is filled in the trench 3 . a second insulating layer 21 b having a thickness of 0 . 5 μm made of a mixture of microcrystalline and amorphous crosslinked poly ( b - methylaminoborazine ) is formed on the insulating layer 20 a and the first copper conductive layer 5 . in the second insulating layer 21 b is formed a hole 8 having a diameter of 0 . 15 μm and extending to the first copper conductive layer 5 , and the hole 8 is filled with copper to form a second copper conductive layer 10 so as to contact the first copper conductive layer 5 . on the insulating layer 21 b is formed a third insulating layer 22 a having a thickness of 0 . 2 μm made of the same material as the insulating layer 20 a , namely amorphous crosslinked poly ( b - methylaminoborazine ). in the third insulating layer 22 a is formed a second trench 12 having a depth of 0 . 2 μm in the pattern of a second wiring . the bottom of the trench 12 extends to the insulating layer 21 b , and copper is filled in the trench 12 to form a third copper conductive layer 13 . an insulating film 23 b made of the same material as the insulating layer 21 b is formed on the insulating layer 22 a and the third copper conductive layer 13 . in semiconductor devices having such a structure , all copper conductive layers , that is , the first copper conductive layer 5 , the second copper conductive layer 10 and the third copper conductive layer 13 , are in contact with the insulating layers 20 , 21 and 22 and film 23 made of an insulating material comprising the low dielectric constant material of the present invention . thus , copper diffusion from the conductive layers can be prevented from occurring . furthermore , since the insulating layers 20 , 21 , 22 and 23 have a dielectric constant of 2 . 3 and also do not require a barrier metal layer , the wiring capacitance can be reduced as compared with conventional wiring structure shown in fig6 whereby high speed operation of semiconductor devices can be ensured . [ 0077 ] fig3 is a sectional view of a semiconductor device showing another embodiment of the present invention . an insulating layer 19 made of silicon oxide is formed on a silicon semiconductor substrate 1 . on the silicon oxide insulating layer 19 is formed an insulating layer 25 having a thickness of 0 . 2 μm and made of a poly ( aryl ether ). the insulating layers 19 and 25 constitute the first insulating layer . in the insulating layer 25 is formed a first trench 3 having a width of 0 . 2 μm and a depth of 0 . 2 μm in the pattern of a first wiring . a first copper conductive layer 5 is filled in the trench 3 . a first conductive film ( barrier metal film ) 4 having a diffusion preventive function is formed so as to cover the surface of the trench 3 . the barrier metal film 4 is made of tantalum nitride and has a thickness within the range of 10 to 20 nm . copper is filled in the trench 3 covered with the barrier metal film 4 to form a first copper conductive layer 5 . a second insulating layer 21 b having a thickness of 0 . 5 μm made of a mixture of microcrystalline and amorphous crosslinked poly ( b - methylaminoborazine ), which is the low dielectric constant material of the present invention , is formed on the insulating layer 25 and the first copper conductive layer 5 . in the second insulating layer 21 b is formed a hole 8 having a diameter of 0 . 15 μm and extending to the first copper conductive layer 5 , and the hole 8 is filled with copper to form a second copper conductive layer 10 so as to contact the first copper conductive layer 5 . on the insulating layer 21 b is formed a third insulating layer 27 made of the same material as that of the insulating layer 25 , i . e ., poly ( aryl ether ), and having a thickness of 0 . 2 μm . in the third insulating layer 27 is formed a second trench 12 having a depth of 0 . 2 μm in the pattern of a second wiring . the bottom of the trench 12 extends to the insulating layer 21 b . a second conductive film ( barrier metal film ) 11 having a diffusion preventive function against copper is formed so as to cover the inner surface of the trench 12 . the barrier metal film 11 has the same composition and the same thickness as those of the barrier metal film 4 . copper is filled in the trench 12 covered with the barrier metal film 11 to form a third copper conductive layer 13 . an insulating film 23 b made of the same material as the insulating layer 21 b is formed on the insulating layer 27 and the third copper conductive layer 13 . in semiconductor devices having such a structure , the first copper conductive layer 5 is in contact with the barrier metal film 4 and the insulating layer 21 b , and the third copper layer 13 is in contact with the barrier metal film 11 and the insulating layer 23 b . further , the second copper conductive layer 10 is in contact with the barrier metal 11 and the insulating layer 21 b . because of having such a structure , diffusion of copper from the conductive layers can be prevented . moreover , since the insulating layers 25 and 27 made of poly ( aryl ether ) have a dielectric constant of 2 . 8 and the insulating layers 21 b and 23 b made of crosslinked poly ( b - methylaminoborazine ) have a dielectric constant of 2 . 2 , the wiring capacitance can be reduced to a level lower than that achieved by a conventional wiring structure shown in fig6 whereby a high speed operation of semiconductor devices is made possible . further , since the insulating layers 25 and 27 are made of poly ( aryl ether ) and the insulating layers 21 b and 23 b are made of crosslinked poly ( b - methylaminoborazine ), the etching selective ratio is high and accordingly it is possible to form wiring having a good shape . in this embodiment , the layer in which second copper conductive layer 10 is provided , i . e ., insulating layer 21 b , is formed from a crosslinked poly ( b - methylaminoborazine ). substantially the same effect can be obtained also when the layer provided with the first or third copper conductive layer 5 or 13 , i . e ., insulating layer 25 or 27 , is formed from the crosslinked poly ( b - methylaminoborazine ). another example of the wiring structure of semiconductor devices using the low dielectric constant material of the present invention as an insulating film or layer is shown in fig4 . a first insulating layer 29 made of silicon oxide is formed on a silicon semiconductor substrate 1 . in the insulating layer 29 is formed a trench 3 having a width of 0 . 2 μm and a depth of 0 . 2 μm in the pattern of a first wiring . a first conductive film ( barrier metal film ) 4 having a diffusion preventive function is formed so as to cover the surface of the trench 3 . the barrier metal film 4 is made of tantalum nitride and has a thickness within the range of 10 to 20 nm . copper is filled in the trench 3 covered with the barrier metal film 4 to form a first copper conductive layer 5 . an insulating layer 30 b having a thickness of 0 . 05 μm made of a mixture of microcrystalline and amorphous crosslinked poly ( b - methylaminoborazine ), in other words , microcrystals - containing amorphous crosslinked poly ( b - methylaminoborazine ), which is the low dielectric constant material of the present invention , is formed on the insulating layer 29 and the first copper conductive layer 5 . on the insulating layer 30 b is formed a second insulating layer 31 made of silicon oxide . in the second insulating layer 31 are formed a hole 8 having a diameter of 0 . 15 μm and a trench 12 having a depth of 0 . 2 μm and a second wiring pattern . the hole 8 extends from the first conductive layer 5 to the trench 12 formed in the surface region of the insulating layer 31 through the insulating layer 30 b and the insulating layer 31 . second and third conductive films ( barrier metal films ) 9 and 11 made of tantalum nitride having a diffusion preventive function are formed so as to cover the surfaces of the hole 8 and the trench 12 . copper is filled in the hole 8 and the trench 12 to form second copper conductive layer 10 and third copper conductive layer 13 , respectively . the barrier metal film is also formed at the interface between the first copper conductive layer 5 and the second copper conductive layer . an insulating film 23 b made of the same material as the insulating layer 30 b is formed on the insulating layer 31 and the third copper conductive layer 13 . in semiconductor devices having such a structure , the first , second and third copper conductive layers 5 , 10 and 13 are in contact with the barrier metal films 4 , 9 and 11 and the insulating layers 23 b and 30 b . thus , diffusion of copper from the conductive layers 5 , 10 and 13 can be prevented . moreover , since the insulating layers 23 b and 30 b have a dielectric constant of 2 . 2 and the insulating layers 29 and 31 have a dielectric constant of 4 . 2 , the wiring capacitance can be reduced to a level lower than that achieved by a conventional wiring structure shown in fig6 whereby a high speed operation of semiconductor devices is made possible . the present invention is more specifically described and explained by means of the following examples . soluble poly ( b - trimethylborazilene ) was synthesized according to fazen et al &# 39 ; s method disclosed in fazen et al ., chem . mater ., vol . 7 , p1942 , 1995 . tetraglyme was used as a solvent , and b - trimethylborazine was heated in an ar gas at 220 ° c . for two weeks with stirring and degassing to give a highly viscous liquid . the liquid was evaporated to give a white powder of a low dielectric constant material according to the present invention . this material had a chemical structure shown by the following formula ( 117 ): the obtained low dielectric constant material was dissolved in acetone and coated by spin coating method onto a quartz plate on which gold was deposited to form a counter electrode . the coated film was then dried at 100 ° c . for 10 minutes and heated at 400 ° c . for 10 minutes to give an insulating film according to the present invention . the thus heat - treated film was made of a partially crosslinked poly ( b - methylboradine ). gold was deposited onto the obtained insulating film as a main electrode . synthesis of soluble poly ( b - triethylborzilene ) was carried out in the same manner as example 1 . tetraglyme was used as a solvent , and b - triethylborazine was heated in an ar gas at 220 ° c . for two weeks with stirring and degassing to give a highly viscous liquid . the liquid was evaporated to give a white powder of a low dielectric constant material according to the present invention . this material had a chemical structure shown by the following formula ( 118 ): an insulating film was formed from the obtained low dielectric constant material by conducting the spin coating in the same manner as in example 1 and drying at 100 ° c . for 10 minutes . gold was then deposited onto the insulating film as a main electrode . a white powder of poly ( methylborazinylamine ) was prepared according to narula et al &# 39 ; s method disclosed in c . k . narula , r . schaeffer , r . t . paine , a . k . datye and w . f . hammetter , j . am . chem . soc ., vol . 109 , p5556 ( 1987 ). the thus obtained low dielectric constant material was dispersed into acetone , and the dispersion was coated by spin coating and dried at 100 ° c . for 10 minutes in the same manner as in example 1 to give an insulating film . gold was then deposited thereon as a main electrode . a white powder of poly ( b - methylaminoborazine ) was prepared according to kimura et al &# 39 ; s method disclosed in y . kimura et al ., composites science and technology , vol . 51 , p173 ( 1994 ). the thus obtained low dielectric constant material was dispersed into acetone , and the dispersion was coated by spin coating and dried at 100 ° c . for 10 minutes in the same manner as in example 1 to give an insulating film . gold was then deposited thereon as a main electrode . dielectric constants of the insulating films obtained in examples 1 to 4 were measured at 25 ° c . and 1 mhz by using an impedance analyzer ( model 4191a made by hewlett packard ). in order to evaluate the water resistance , the dielectric constant was also measured with the lapse of time . an insulating film was formed from polyboradilene in the same manner as in example 1 , and the dielectric constant thereof was measured . the result is shown in table 1 . the insulating films obtained in examples 1 to 4 have a dielectric constant of at most 2 . 4 . from these results , it is understood that a substrate having a low dielectric constant can be obtained . also , these polymeric borazine compounds can be graphitized by heating at a temperature of 1 , 000 to 1 , 200 ° c . ( application view of inorganic polymer , p70 , 1990 , supervised by naruyuki kajiwara ). thus , these insulating films have a thermal resistance of at least 450 ° c . further , as apparent from the results shown in table 1 , the films obtained in examples 1 to 4 show no or little change in dielectric constant with the lapse of time . thus , it is understood that these films have an excellent water resistance .	7
the present invention ( hereinafter “ system ”) aims to monitor the cattle breeding season , under extensive livestock farming conditions , through the bull activity . the system allows knowing whether the said bull has performed mounting activities , and which cows it has mounted , date and time the said mountings happened and their effectiveness ( i . e ., whether there was ejaculation or not ). since the system is based on placing electronic devices on each animal of the herd , in order to be applicable in extensive livestock farming , the device placed on the cow must be simple , cheap , easy to install , comfortable for the animal and cannot require maintenance of any kind ( not even changing batteries ). on the other hand , the device placed on the bull has more freedom ( since there are 30 times less bulls than cows ). therefore , it can be more complex , be subject to sporadic maintenance routines , and it does not need to be so cheap , provided that the average cost per animal is within acceptable limits . the system provides the veterinarian and the rancher , in a centralized , systematic and friendly manner , the necessary information for controlling the activity of all bulls and cows during the breeding season , accounting for the herd evolution . by way of example , if the system informs that a cow was never mounted after a certain period of time ( that can be set ) it is to be expected that there is a problem in its ovulation process , which needs to be studied and treated . if the cow is still breastfeeding , this can surely be solved by temporarily or definitively suspending breastfeeding . in other cases , this can be corrected by changing her diet . should the problem be more serious , it can even be determined that the cow leave the herd and go to the slaughterhouse . on the contrary , if the cow was mounted several times and then stopped being mounted , it could be an indication of pregnancy . another example is when the system informs about a bull that has not mounted any cow after a certain period of time ( that can be set ). this situation can be indicative of the bull having a physiological problem ( for example , an injured leg ) or that another bull assumed a dominant behavior in the herd and does not allow the first bull to mount cows . in this sense , the system allows an accurate determination of the relationships within the herd , for example , it allows the easy detection of a bull always mounting the same cow ( phenomenon known as “ dominant cow ”). in these instances , the problem is solved by removing the dominant bull and / or cow from the herd . the system provides real - time information allowing taking preventive and corrective actions on the herd , both on cows and bulls . the rancher and / or the veterinarian have information that allows them to make better decisions in time , which translates to an increase of the breeding season productivity . fig1 shows that the system is characterized by placing an electronic device 3 ( hereinafter “ device ”) in each bull 1 , by a radio - frequency identification tag 4 ( hereinafter “ tag ”) placed on each cow 2 and having a number that uniquely identifies the cow having it , and a central system 6 ( hereinafter “ cs ”) that concentrates and manages information while functioning as the user interface server . the device 3 reports the information to the cs 6 in order to allow the user 7 ( hereinafter “ user ”) to monitor the herd activity on a mobile device ( e . g ., laptop , cellphone or tablet ) or on a personal computer via links 104 and 106 within the network 105 ( hereinafter “ network ”). the information the device 3 reports to the cs 6 will pass through the network 105 and can send it directly via link 101 and link 104 , or through a hand - held electronic device 5 ( hereinafter “ hand - held ”) via link 102 and links 103 and 104 . each animal will have a unique identification number , which will be stored in the corresponding tag 4 , for cows , and it will be stored in the corresponding device 3 for bulls . as can be appreciated in fig2 , device 3 is comprised by a low - cost microcontroller or standard microprocessor 8 ( hereinafter “ microcontroller ”), having internal peripherals : memories , timers , analog - to - digital converters , etc . ; and it controls a set of external peripherals : a real - time clock rtc 9 , an acceleration sensor 10 ( hereinafter “ sensor ”), a device 11 for tag 4 reading ( hereinafter “ reader ”), a long - range wireless communication interface 12 to communicate with cs 6 , and a short - range wired or wireless communication interface 13 to communicate with hand - held 5 . all circuits of device 3 are powered by a battery 14 which can be charged with a charger 15 . in addition , the microcontroller 8 can have an external memory 16 . microcontroller 8 is in charge of generating the information of each mounting that will be transmitted . in the first place , it has the algorithms that allow to recognize , from the signal acquired by sensor 10 , mounting and ejaculation patterns . secondly , through the reader 11 and link 100 , it obtains the identification number of the mounted cow 2 . in third place , it obtains the date and hour of the mounting through the rtc 9 . through communication interfaces 12 and 13 , and the corresponding links 101 and 102 , parameters of device 3 can be read , written and configured , and information regarding the state of the herd is reported to cs 6 . collected information can be reported from device 3 to cs 6 directly through a long - range wireless communication technology ( link 101 ) such as , for example : mobile phone , wifi , wimax , satellite link , etc . at the same time , it can be performed using a public data network ( such as , for example , internet ) or though a private data network ( for example , using rf links and repeater radios ), both options are depicted by network 105 . on the other hand , device 3 can report the collected information indirectly via hand - held 5 . communication between device 3 and hand - held 5 can be made through a short - range wireless communication technology , such as nfc , bluetooth , wifi , etc . ; or using a wired communication technology , such as usb , i2c , spi , ethernet , etc . data from sensor 10 are sampled at a rate that can be configured . mounting is detected when this information indicates that the position of the animal has sufficiently changed with respect to predefined and configurable thresholds . fig3 shows the mounting moment , where it can be appreciated that gravity acceleration 200 ( hereinafter g ) has a component in the direction parallel to the bull &# 39 ; s back 201 ( hereinafter g h ). however , in fig1 , where the bull is in normal position , it can be appreciated that the component of g 200 in the direction parallel to the bull &# 39 ; s back g h 201 is null or substantially null . therefore , by comparing g h 201 to a certain threshold , the presence of a mounting can be inferred . once the mounting is detected , the sample rate is increased and the data stream is saved for further analysis . the ejaculation detection algorithm is applied to the saved data stream . this algorithm is based on the detection of sudden movements made by the animal during the ejaculation , referred to as “ ejaculatory thrust ”. mounting and ejaculation detection algorithms are based on well - known pattern recognition techniques : comparison with a predefined threshold , comparison with a signal power threshold , comparison against a well - known waveform ( template matching ), principal component analysis ( pca ), among others . in cases where there is a need of high savings of battery and / or data traffic , the device 3 will report to cs 6 for each mounting : date , hour , bull identification number , cow identification number , and an ejaculation presence indicator . eventually , it could also inform about characteristic data of the acceleration curves : peak - to - peak amplitude , width , maximum , minimum , among others . in the cases where battery duration or the data traffic are not limiting , the device could report : date , hour , bull identification number , cow identification number , and all data stream , in order to perform the analysis in a centralized manner in cs 6 . communication between reader 11 and tag 4 can be made in two different manners . on the one hand , tag 4 can transmit the identification number on demand , each time it is requested by the reader 11 . on the other hand , it can transmit the identification number each time the cow is mounted , with no need for the reader 11 to request it . in this latter case , transmission can be made a predetermined number of times or during a predetermined period of time . since animals within the herd can be located relatively close , it is possible that , during a mounting , another cow ( and , therefore , its tag 4 ) is close to the cow - bull couple that performed the mounting . in order to avoid incorrect or multiple readings by reader 11 , the present invention is characterized by all cow tags 4 being disabled for reading by default , being enabled solely by the action of the bull during mounting . for example , in fig3 it can be seen how the mounting of bull 1 involves direct physical contact with tag 4 , which enables the reading . the above mentioned enabling lasts for a short period of time ( a few seconds ). in this way , it assures that the only read tag corresponds to the mounted cow . tag 4 comprises a microcontroller , a data reception and transmission system having an antenna , a power supply system ( which , for example , can be based on the same antenna , thus obtaining energy from the electromagnetic field from the reader , based on a battery and / or harvest energy from the environment ). these elements configure what is normally known as radio - frequency identification tag ( hereinafter rfidtag , identified with number 24 in fig5 and 6 ). moreover , tag 4 is characterized by having a system 25 ( hereinafter inhibsys ) that avoids incorrect or multiple tag readings , based on detecting the mounting moment in order to enable the rfidtag 24 reading of cow 2 mounted during a determined period of time after completion of the said mounting . including inhibsys system 25 is crucial in the present invention since this is what allows the identification of the cow that was mounted , with a negligible error margin . implementation of the said system can be mechanical and / or electronic . fig5 shows an example of implementation 4 . 1 of tag 4 , wherein rfidtag 24 . 1 is active , i . e ., it is powered from system 26 . in this example , inhibsys system 25 . 1 is characterized by having a switch 27 that enables the power supply from system 26 to rfidtag 24 . 1 , in order for it to be read as of the start of the mounting and during a certain period of time after its completion . system 26 can be , for example , a battery or a system that harvest energy from the environment . fig6 shows another example of implementation 4 . 2 of tag 4 , wherein rfidtag 24 . 2 can be active , passive or semi - passive ( the system that powers the rfidtag 24 . 2 is not shown in the figure ) and it has the characteristic of having an input signal 28 that enables or disables its operation . inhibsys system 25 . 2 is an electronic or electromechanical circuit that detects the mounting via a switch , accelerometer or vibration detector , and generates signal 28 , thus enabling the operation of rfidtag 24 . 2 as of the start of the mounting and during a certain period of time after its completion . another way of implementation of disabling and enabling tag 4 reading can be made through the modification of the distance where rfidtag 24 can be read . in this scheme , disabling is achieved by forcing that the reading can be made if the reader is less than a few centimeters away , and enabling implies that the reading can be made a few meters away . even though , in this case , rfidtag 24 is not disabled by default for reading from a literal point of view ( it is always possible to read it from a short distance ), for practical purposes it will be disabled , since device 3 is usually located at a considerable greater distance than the maximum allowed for reading . then , as of the start of the mounting and for a certain period of time , the maximum distance from which rfidtag 24 can be read shall be several meters , therefore the corresponding device 3 will be able to perform the reading . this could be electrically implemented by modifying , for example , some parameter of the rfidtag 24 antenna . it could also be mechanically implemented , for example : disabling could be obtained by placing a metallic plate in front of rfidtag 24 in such a manner that the electromagnetic waves are strongly absorbed by it ; and the enabling would consist of removing this plate with the purpose of allowing a rfidtag 24 reading from a significantly greater distance . tag 4 is placed ( even though not exclusively ) in the tail of cow 2 ( see fig4 ), or near it , so that bull 1 always is in direct physical contact with tag 4 during the mounting . as tag 4 is not inside the animal &# 39 ; s body , it is possible to harvest energy from the bull &# 39 ; s movements , and reading is facilitated since there are no animal tissues between the said device and reader 11 . on the other hand , device 3 attachment could be made , even though not exclusively , by placing device 3 within a housing or wrapping attached by glue to the back of the animal , near its kidneys . it is an area that has a direct view to the tail of the cow when the bull comes down after mounting and where the greatest acceleration with the “ ejaculatory thrust ”, caused by ejaculation , is registered . should long - range communication fail to work ( for example , for lack of suitable mobile phone coverage ), the system proposes to use a hand - held that can read information stored on device 3 through link 102 ( which can be wired or wireless ) and functions as a hub of the said information for all bulls in the ranch . accordingly , hand - held 5 sends the collected information to the cs 6 via network 105 through links 103 and 104 . by hand - held 5 and link 102 , it is possible to write and configure device 3 . hand - held 5 can be a mobile phone , a tablet , or an electronic device based on a microcontroller 17 having an interface 18 to communicate with device 3 via link 102 , a user interface 19 that can include , for example , a keyboard and a display , and a plurality of interfaces to communicate with cs 6 ( for example , directly via a mobile phone modem , or indirectly via a usb cable plugged to a pc connected to network 105 ), all these options are summarized in block 20 . as it is a mobile device , it shall have a battery 22 . additionally , it may have an additional memory 23 . finally , hand - held 5 has suitable means for reading , writing and configuring tags 4 via interface 21 using link 107 . cs 6 comprises a set of computers , an energy system , communication elements ( routers , firewall , etc .) and human resources for managing and control . cs 6 has a server application capable of managing and processing information received by device 3 and hand - held 5 . the collected information is stored on a database . an interface for users to have access to information , via a web browser or an application , is implemented through a web server . this interface has a user access privileges management system in order to select information each user can visualize ( for example , ranchers have access only to information of their ranch , but veterinarians can have access to information of all ranches they work for ). moreover , via commands sent by cs 6 , it is possible to configure device 3 . system deployment in a ranch involves installing a tag 4 in each cow , and a device 3 in each bull . moreover , each device must be configured based on operation parameters ( animal identification , veterinarian identification , ranch identification , starting date and time , etc .) these parameters are programmed with hand - held 5 . unlike other inventions in the state of the art , our invention is capable of providing information necessary for monitoring the breeding season ; i . e ., if the bull has performed mountings , and which cows have been mounted , date and time and the effectiveness ( i . e ., if there was or not ejaculation ). this is achieved thanks to the possibility of identifying , with no error margin ( or with a negligible error margin ), the mounted cow , through a system that avoids incorrect or multiple tag readings ; as well as through determining the presence of ejaculation based on a detection algorithm of the “ ejaculatory thrust ”. in addition to monitoring the breeding season , the system can be used for other applications . on the basis of having no better estrus detector than the bull itself , the system can be applied for estrus detection in the case of artificial insemination . indeed , using the above mentioned system in androgenized and neutered bulls , which are capable of mounting but not impregnating , information regarding which cows are in heat is directly obtained . this cannot be guaranteed by other systems that cannot identify the cow without error margin . another application of the present invention would be using the system to determine the animals “ pedigree ”. nowadays , in general , parents are not known and / or registered . having this information would serve for enhancing a traceability system , easily allowing the addition of the father and mother identification to the available information . as a result , genetic enhancement , avoidance of genetic diseases , etc ., could be explored . this function cannot be provided by other systems that cannot determine the presence of ejaculation . another example would be using the system as substitution for the “ blockey test ”. blockey test is a test that allows the assessment of the number of cows that a bull is capable of mounting in a determined period of time ( referred as “ service capacity ”). the above mentioned test is performed in such an invasive manner that does not respect animal welfare : the cow is restrained , and the number of times the bull can mount it are counted . by the present system , the actual service capacity of a bull can be determined in a natural way , respecting animals and their welfare . this cannot be provided by other systems that cannot determine the presence of ejaculation . although in the foregoing description reference is made to cows and bulls , all the points claimed in the present patent can apply to any animal species whose reproductive process involves characteristic movements that can be related to a mounting and an ejaculation .	0
the liquid - crystalline alignment layers preferably comprise liquid - crystalline main - chain polymers , liquid - crystalline side - chain polymers , a combination of the two , liquid - crystalline networks , guest - host systems or mixtures of the above with one another and / or with low - molecular - weight liquid crystals . it is possible to use thermotropic , lyotropic and amphotropic ( i . e . thermotropic + lyotropic ) liquid - crystalline materials . examples of suitable materials are described in ep - a 348 873 , ep - a 322 703 , ep - a 310 081 , ep - a 300 752 and ep - a 297 554 . preference is given to the use of lcps having a glass transition temperature of & gt ; 150 ° c ., for which purpose liquid - crystalline thermotropic main - chain polymers , in particular , are suitable . these are preferably on the one hand soluble in n - methylpyrrolidone or similar solvents , but on the other hand insoluble in the low - molecular - weight or polymeric liquid - crystalline compounds used as the switchable medium . particularly suitable are polyester - based main - chain polymers , in particular polyesters comprising aromatic diols and aromatic diesters , optionally with a hydroxycarboxylic acid as a further component . particular preference is given to a thermotropic polymer based on p - hydroxybenzoic acid , isophthalic acid and hydroquinone . liquid - crystalline polymers of this type are preferably used as a material for alignment layers which contain a nematic phase . it is also possible to use polymers having , for example , smectic phases . the liquid - crystalline polymer employed as the alignment layer is aligned by a process which completely or substantially avoids the generation of electrostatic charges and which avoids contamination of the alignment layer by abraded and dust particles . said polyester - based polymeric liquid - crystalline compounds may , in addition , also be aligned by known processes ( such as , for example , by rubbing , brushing or application of electrical or magnetic fields ). the polyester - based alignment layers produced in this way can , due to their favorable properties ( high homogeneity , strongly aligning effect , etc ), advantageously be employed as components in lc displays , in particular for flc displays . in particular , however , they can be aligned by the process described below . the process according to the invention is based on the use of gas or liquid flow over the layer comprising the liquid - crystalline polymer . the temperature of the gas flow is preferably in the range from 100 ° to 400 ° c ., in particular from 150 ° to 350 ° c . the temperature is particularly preferably higher than the glass transition temperature of the material to be aligned . in a preferred embodiment , the gas is purified beforehand via a filter in order to avoid dust particles . in the case of liquid flow for aligning the lcps , a wide range of liquids can be used , preferably those in which the material of the aligned layer is neither readily soluble nor completely insoluble . examples which may be mentioned of liquids which can be employed even at room temperature are the organic solvents γ - butyrolactone , n - methylpyrrolidone , methyl ethyl ketone , cyclohexanone and diglyme . at temperatures above the glass transition temperature of the polymer , preferred heat transfer media are water , glycerol or appropriate polar liquids . in order to align the polymer layer by means of a gas stream , the gas should be passed over the polymer layer for a period of , preferably , at least 2 minutes . a process duration of from 5 to 60 minutes , in particular from 10 to 40 minutes , generally results in particularly good alignment of the liquid - crystalline , polymeric material . an excessively long alignment process by means of gas flow is less advantageous , if only for economic reasons . in a preferred embodiment , the alignment is achieved by a gas stream in which the gas has a temperature in the range of the liquid - crystalline phase , in particular the nematic phase , of the polymeric material . in a further embodiment , a stream of air is passed onto the polymeric material at an angle of incidence ( α ) of from 0 . 5 ° to 10 °, in particular from 1 ° to 5 °, which allows particularly good alignment to be achieved . after treatment of the liquid - crystalline , polymeric material with a gas or liquid flow , the changes in structure and properties caused by this process are frozen by removing the liquid and / or reducing the temperature to below the glass transition temperature of the polymer . the polymeric alignment layers described can advantageously be employed in liquid - crystal displays , inter alia since they do not have the disadvantages described at the outset of rubbed alignment layers . the liquid - crystalline polymer used was a thermotropic main - chain polymer based on p - hydroxybenzoic acid , isophthalic acid and hydroquinone which has a glass transition temperature of 155 ° c . and a nematic phase in the range from 312 ° to 336 ° c . ( modification of the commercially available polymer ® vectra , registered trademark of hoechst celanese corporation , see also &# 34 ; vectra - polymere werkstoffe , hoechst high chem &# 34 ; [ vectra - polymeric materials , hoechst high chem ] magazine , september 1989 , frankfurt am main ). a solution of this polymer in n - methylpyrrolidone ( 3 % by weight ) was spin - coated onto the surface of a ( previously cleaned ) glass substrate . the film was cured for one hour at a temperature of 200 ° c ., so that the solvent had completely evaporated . the substrate treated in this way has a dry , hard polymer film with a thickness of 50 μm . ( the thickness can be adjusted via the rotation speed during the spin - coating process ). substrates produced in this way were then mounted on a holder in or in front of a long nozzle of various shape and variable cross - section . fig1 shows a diagrammatic view of this arrangement ( dimensions : 200 × 25 × 10 mm ). the rectangular parallelepiped ( 1 ) represents a nozzle having a rectangular cross - section into which the sample holder ( 2 ) has been introduced . on the sample holder ( 2 ) is the glass substrate ( 3 ), which is covered by a layer of the liquid - crystalline polymer ( 4 ). on the left - hand side of the nozzle , two arrows indicate the flow direction of the gas stream . the sample holder ( 2 ) holds the glass substrate ( 3 ) at the angle of incidence ( α ) with respect to the direction of flow of the gas . the nozzle ( 1 ) was coupled to a heat flux unit whose gas throughput rate and gas temperature were adjustable . in the case of the present measurements , the gas throughput was in each case 400 l / min . the liquid - crystalline , polymeric layer was treated with a unidirectional gas stream at various temperatures and at various tilt angles to the air stream with varying process durations . after the alignment process , the substrates ( glass substrate + alignment layer ) were bonded plane - parallel with an antiparallel alignment at a separation of 4 μm using spacers . the measurement cells produced in this way were filled with a liquid - crystalline broad - range mixture having a nematic phase ( for example with &# 34 ; zli 1565 &# 34 ; from e . merck , darmstadt ). the contrast of the test cell was measured as follows : the measurement cell was adjusted under crossed polarizers under a polarizing microscope , and the maximum light transmission and minimum light transmission were determined by means of a photodiode . in order to limit the effect of the spectral sensitivity of the diode on the initial voltage ( u ), a green filter is employed for the measurement . the measurement cells are characterized by the contrast ratio ( cr ), which is defined by the following equation : ## equ1 ## the values determined in this way were compared with values obtained using commercially available measurement cells of the same thickness , but using rubbed polyimide as the alignment layer ( measurement cells from ehc , tokyo ). to ease comparison , the contrast ratio of the ehc cells is defined as 100 . the dependence of the alignment of the liquid - crystalline , polymeric layer on the cross - section and the shape of the nozzle and on the angle of incidence of the stream of air was investigated . the results are shown in fig4 where various nozzle shapes are listed under z , and α describes the angle of incidence of the sample . in the case of nozzle shape ( 1 ), the sample holder was outside the nozzle . it is apparent that simply directing the air flow at the liquid - crystalline polymer layer only results in a small degree of alignment . in the case of nozzle shapes ( 2 ) and ( 3 ), the substrate was positioned inside the nozzle , as indicated in fig1 . it is apparent that significantly greater alignment can be achieved in this way . the numerical values given in table 1 relate to the maximum contrast ratio ( cr ). in the experiments , the temperature of the gas stream was 200 °- 360 ° c ., and in the specifically mentioned samples ( fig4 ) the gas had a temperature of 320 °- 330 ° c ., and the gas used was air . as can be clearly seen from fig4 the use of a nozzle having a rectangular cross - section ( 3 ) results in significantly better alignment , presumably attributable to a more favorable ( laminar ) air flow . comparison of the measurements at various angles of incidence ( α ) with the sample shows that an angle of incidence of 3 ° results in significantly improved results . the dependence of the alignment of the liquid - crystalline , polymeric layer on the temperature of the gas stream and on the duration was investigated . substrates were produced as described in example 1 and mounted in a nozzle having a rectangular cross - section of dimensions 200 × 25 × 10 mm at an angle of incidence ( α ) of 3 °. as can be seen from fig2 the alignment effect of the air stream on the liquid - crystalline , polymeric layer is the greatest when the air stream has a temperature in the range of the nematic phase of the thermotropic polymer . in fig2 the contrast ratio ( cr ) of the test cell is plotted against the temperature ( in ° c .). the process lasted 20 minutes ( i . e . the polymer layer was exposed to said air stream in the nozzle for 20 minutes ). in the present example , an optimum contrast ratio was achieved at a temperature of 326 ° c . the test cells aligned at this temperature had a contrast of up to 80 %, compared with the contrast of the commercially available ehc cells . fig3 shows the effect of the process duration ( t pr ) on the contrast ratio ( cr ). the measurements were carried out at a gas stream temperature of 326 ° c . it was apparent that the alignment effect of the air stream on the liquid - crystalline , polymeric material does not become visible until a treatment duration of some minutes . optimum alignment is achieved after a treatment time of from 15 to 25 minutes . the polyester layer applied to a glass substrate as in example 1 may likewise be aligned by rubbing ( for example with velour ), and the alignment layer produced in this way can advantageously be employed as a component in a measurement cell or in an lc display .	8
referring to fig1 a processor power delivery system 10 enables a dc - to - dc converter 12 to be assembled to a processor carrier 18 in the z - axis . the z - axis ( indicated by an arrow in fig1 ) is the direction that is transverse to the surface of a motherboard 28 and transverse to the lengths of the converter 12 and the processor carrier 18 . the processor carrier 18 may be plugged into a socket 50 that in turn plugs into a motherboard 28 , all in the z - axis direction . a processor 52 may be attached on the carrier 18 , for example using surface mount solder balls 20 , to a connection layer 21 . thereafter , the converter 12 , including components 54 , may plugged atop the processor carrier 18 also in the z - axis direction . this greatly facilitates the connection of the two units . the converter 12 includes contacts 16 on its lower surface 14 to make direct surface to surface contact with the processor carrier 18 . the contacts 16 communicate with the converter 12 components 54 through vias ( not shown ). the processor carrier 18 includes contacts 22 on its upper surface that mate with the contacts 16 when the carrier 18 and converter 12 are edge combined . the contacts 22 eventually electrically connect to power supply pins ( not shown ) on the processor 52 through connection layer 21 . in one embodiment , the contacts 16 and 22 may each be formed of a copper land pattern . a pair of upstanding alignment pins 24 a and 24 b on the processor carrier 18 pass through holes ( not shown in fig1 ) in the converter 12 . this pin / hole connection aligns the contacts 16 and 22 and facilitates the clamping engagement between the converter 12 and the processor carrier 18 . thus , referring to fig2 the pins 24 a and 24 b pass completely through the converter 12 in one embodiment of the present invention . this engagement aligns the contacts 16 and 22 with respect to one another as the converter 12 is pressed down into firm engagement with the processor carrier 18 in the z - axis direction . referring to fig4 the converter 12 laps over an edge and electrically engages , in direct surface to surface contact , the processor carrier 18 . the converter 12 and processor carrier 18 may be clamped together using clamping devices 38 and clamping housing 58 . in one embodiment of the present invention , the pins 24 may be threaded and may be secured using threaded fasteners . however , other clamping devices may be utilized to maintain an even clamping force along the length of the contacts 16 and 22 . referring to fig3 the contacts 16 of the converter 12 include a first set of planar interdigitated contacts 16 a that may provide a power supply ( vcc ) connection . a second set of planar interdigitated contacts 16 b may provide the ground ( vss ) or return power connection . the interdigitation may be achieved through fingers 40 , in one embodiment of the present invention . the interdigitation of the fingers 40 reduces the inductance of the power contacts 16 a and the ground contacts 16 b since mutual inductance is cancelled out by the interdigitated arrangement . power control signals ( such as a pwrgood signal ) may also pass through the contacts 16 from the contacts 22 . for example , a plurality of isolated power signal vias 34 may extend through the contacts 16 . similarly , vias 36 may pass through the process planar power contacts 22 . the arrangement of the signal vias 34 and 36 is subject to considerable variation . alignment holes 26 are provided on the converter 12 for engagement with the alignment pins 24 on the processor carrier 18 . the arrangement of the contacts 22 may be identical to that shown in fig3 with the exception that the contacts 22 may include vias 36 to an internal copper land pattern ( not shown ) and may further include the vias 34 which extend through the contacts 16 for conduction of other signals . the processor power delivery system 10 may include a plurality of components that may be resiliently clamped together between the housing 58 and the motherboard 28 as shown in fig5 . the housing 58 may include an upper surface with a plurality of reinforcing ribs 62 and a body 60 . formed in the body 60 is a corrugated spring 64 . the ends 66 of the spring 64 may be held within the body 60 for example by molding the spring 64 into the body 60 . when the body 60 is pressed against the converter 12 , the spring 64 vees are compressed , applying a uniform force through the body 60 to the converter 12 . in one embodiment , the spring 64 may be formed of beryllium copper . it may be shaped in a corrugated shape with a plurality of vees extending into the spring 64 from above and below . each of the vees may form a v - shaped compression spring pressed against either the body 60 or the converter 12 . the arrangement of the corrugated spring 64 serves to make more uniform the forces applied through the body 60 . ideally , the housing 58 supplies a substantially constant pressure over the life of the system 10 . the spring 64 may be defined with the cold flow properties of the related substrates over time in mind . the housing 58 may be formed of extruded aluminum or plastic as two examples . in one embodiment , the housing 58 may be hinged and latched to clear the contact region and to allow for z - axis assembly or replacement of components while providing a registration feature to align the underlying substrates . sandwiched between the converter 12 and the processor carrier 18 is a relatively low profile conductive polymer interconnect 68 including a polymer film 70 having captured therein conductive polymer contacts 72 . in one embodiment of the present invention , the film 70 may be formed of kapton and the polymer contacts 72 may be formed of a polymer that has been made conductive for example by doping it with conductive particles such as silver particles or oriented metallic wires . in each case , the polymer contacts 72 may be formed of a plastic material that is relatively resilient so that the material may be compressed between the converter 12 and the carrier 18 . the polymer contacts 72 produce a conductive contact between the converter 12 and the carrier 18 . moreover , because of the resilient nature of the interconnect 68 , surface irregularities may be accounted for and more reliable interconnection may be achieved in some cases . in some embodiments , the conductive polymer contacts 72 may be substantially thicker than the film 70 . for example , in one embodiment , the contacts 72 may have a thickness four times that of the film 70 . as shown in fig6 the interconnect 68 includes a pair of openings 74 to receive and pass the alignment pins 24 a and 24 b . the alignment pins 24 a and 24 b also act to precisely position the contacts 72 with respect to the converter 12 and the carrier 18 . the pins 24 a and 24 b may extend upwardly through the interconnect 68 and the converter 12 and in one embodiment through the housing 58 for securement by securement devices 38 shown in fig4 . in other cases , as mentioned previously , a hinged clamping device may be positioned for selectively applying a clamping force to the converter 12 and carrier 18 through the body 60 and the spring 64 . the contacts 16 and 22 may be brought into direct , planar surface to surface contact with one another . the contacts 16 and 22 may be brought into direct engagement in the z - axis direction , with the converter 12 atop the processor carrier 18 . with the application of a compression force across the converter 12 and the processor carrier 18 , good electrical contact may be obtained . the pins 56 on the socket 50 provide electrical communication with the motherboard 28 . because the converter 12 and the processor carrier 18 may both be assembled in the z - axis direction , the assembly of the processor power delivery system 10 is facilitated . of course , it is not necessary that either the converter 12 or the processor carrier 18 be rigorously moved through the z - axis direction . instead , either or both of the converter 12 and the processor carrier 18 may be moved so as to have a component of displacement in the z - axis direction relative to the plane of the motherboard 28 . since the contacts 16 and 22 meet along a common plane , the converter 12 may be moved onto the processor carrier 18 at any angle between the z - axis and the plane of the motherboard 28 . the electrical performance may be optimized in some embodiments by modifying the patterning of the contacts 16 and 22 without re - tooling converter 12 or carrier 18 assemblies . some embodiments may achieve a mechanical benefit from having a single axis of assembly . while an embodiment is illustrated in fig1 through 6 using planar contacts , embodiments of the present invention may be applied to other designs as well . the combination of the spring 64 and the interconnect 68 may be particularly desirable because the pressure applied by the spring 64 may result in more even pressure applied to the conductive contacts 72 in some embodiments . in an embodiment using conductive polymer contacts captured in a kapton film , the film may be formed by molding the conductive contacts into a previously formed film , as one example . another way of forming the interconnect 68 includes shaking conductive contacts into holes in the film and then bonding the contacts in place . generally , pressure may be applied to the contacts to increase their conductivity . while the present invention has been described with respect to a limited number of embodiments , those skilled in the art will appreciate numerous modifications and variations therefrom . it is intended that the appended claims cover all such modifications and variations as fall within the true spirit and scope of this present invention .	7
although the following description of the present invention teaches a hand tool powered by a removable battery it is to be understood that the hand tool may also be powered by a corded ac electric motor in place of the battery powered dc motor described herein . fig1 illustrates a hand held nailing machine 10 generally comprising a main body 12 including and a gripping handle 14 . attached to the end of handle 14 is removable , rechargeable battery 19 for providing the necessary electrical energy to operate the nailing machine power drive mechanism . also included in handle 14 is trigger 16 for operating nailing machine 10 . a fastener supplying magazine assembly 18 is typically attached to main body 12 and handle 14 , as illustrated , for supplying a strip of fasteners to nose assembly 20 . fig2 , 4 , and 5 illustrate top , left side , bottom and rear views of fastener drive assembly 40 as positioned within housing 12 of nailing machine 10 illustrated in fig1 . fig2 , and 5 have electrical control module 25 removed for clarity . the structural details and operation of control module 25 is completely described within the two copending patent applications identified in the “ related patent applications ” section above and are incorporated herein by reference . as illustrated in fig6 the primary operational elements of fastener drive assembly 40 comprise a flywheel 45 for providing kinetic energy , for driving a fastener into a work piece , energized by an electric motor 42 . flywheel 45 is free wheeling upon fixed shaft 32 . upon achieving the required revolutions per minute ( rpm ), drive clutch assembly 30 ( see fig7 and 9 ) causes engagement of clutch 35 and flywheel 45 thereby transferring a portion of the kinetic energy of flywheel 45 to a linearly moving driver 106 for driving a fastener into a work piece . referring now to fig2 through 9 , the elements and operation of the flywheel drive assembly 40 will be discussed . the flywheel drive assembly comprises clutch drive assembly 30 and flywheel 45 gear driven by electric motor 42 . although a gear drive between motor 42 and flywheel 45 is primarily illustrated herein , it is understood that a belt drive may also be used between motor 42 and flywheel 45 or any other suitable drive mechanism . as an alternative to having the motor axis of rotation parallel to the axis of rotation of flywheel 45 , as illustrated herein , it may be preferable to position motor 42 such that its axis of rotation is perpendicular to the axis of rotation of flywheel 45 and shaft 32 , thereby employing a bevel gear drive between the motor output shaft and the flywheel periphery . referring particularly to fig9 and additionally to fig6 through 8 the mechanical structure of flywheel 45 and clutch drive assembly 30 will be operationally described . clutch drive assembly 30 and flywheel 45 are axially aligned upon central shaft 32 as best illustrated in fig9 . central shaft 32 is threadingly affixed to end plate 52 which in turn is rigidly attached to frame 48 by an integral boss 51 extending axially from endplate 52 and received within slotted groove 47 such that end plate 52 and central shaft 32 are non - rotatable . the opposite end of central shaft 32 is received within supporting groove 49 in frame 48 . flywheel 45 is rotatingly positioned at the end of central shaft 32 , as best illustrated in fig9 upon deep groove ball bearing 46 , whereby flywheel 45 freely rotates about central shaft 32 when energized by motor 42 . flywheel 45 includes a conical cavity 44 for receiving therein conical friction surface 36 of conical clutch plate 35 . clutch plate 35 and activation plate 58 , although they are separable members , are geared to drum 34 by interlocking projections 28 and 26 respectively , whereby clutch plate 35 , activation plate 58 and drum 34 rotate freely about shaft 32 as a single unitary assembly . roller bearings 38 a and 38 b , positioned on the inside diameter of drum 34 , are provided to assure the free rotational characteristic of activation plate 58 , drum 34 and clutch plate 35 as a unitary assembly . adjacent activation plate 58 is fixed plate 56 . fixed plate 56 and activation plate 58 are connected to one another by three equally spaced axially expandable ball ramps 66 a , 66 b , 66 c , 66 a ′, 66 b ′ and 66 c ′ as illustrated in fig1 . the operation of the ball ramps 66 between fixed plate 56 and activation plate 58 is described in greater detail below . fixed plate 56 is fixed to housing 48 such that fixed plate 56 is free to move axially upon central shaft 32 , but not free to rotate about shaft 32 by anti - rotation tang 53 slidably received within axially aligned slot 43 within frame 48 . see fig1 . fixed plate 56 includes circular projection 61 receiving thereon freely rotatable thrust bearing 62 positioned between fixed plate 56 and retarder plate 64 . a pair of nested , parallel acting , bellville springs 72 are positioned , as illustrated in fig9 between retarder plate 64 and solenoid plate 54 the function of which is described in greater detail below . axially expandable ball ramps 68 a , 68 b , 68 c , 68 a ′, 68 b ′ and 68 c ′, see fig1 , connect end plate 52 and solenoid plate 54 the function of which is also described in greater detail below . positioned upon central shaft 32 , between clutch 35 and flywheel 45 is compression spring assembly 37 comprising washers 73 and 74 having coil spring 75 therebetween the function of which is described in further detail below . upon start of the fastener work , or driving , cycle , control microprocessor 25 causes motor 42 to “ spin up ” flywheel 45 , in the counter clockwise direction as indicated by arrow a in fig7 to a predetermined rpm . upon flywheel 45 achieving its desired rpm , or kinetic energy state , the control microprocessor 25 activates solenoid 80 which , through a flexible wire cable 84 extending from the solenoid plunger 82 and affixed to the periphery of solenoid plate 54 causes solenoid plate 54 to rotate clockwise , as indicated by arrow b in fig7 . as solenoid plate 54 rotates clockwise , solenoid plate 54 is caused to move axially away from end plate 52 by action of the corresponding ball ramps 68 in end plate 52 and solenoid plate 54 . see fig1 . as end plate 52 and solenoid plate 54 axially separate , the remaining elements of clutch drive assembly 30 are thereby caused to move axially toward flywheel 45 compressing coil spring 75 whereby clutch surface 36 preliminarily engages flywheel cavity 44 . engagement of clutch 35 with flywheel 45 causes counter clockwise rotation of clutch 35 , drum 34 and activation plate 58 , as an assembly . by action of corresponding ball ramps 66 , between fixed plate 56 and activation plate 58 , see fig1 , rotation of activation plate 58 causes axial separation of plates 53 and 58 . bellville springs 72 are thus compressed against solenoid plate 54 thereby providing an opposite axial force , forcing clutch 35 into tighter engagement with flywheel 45 . upon sensing an rpm drop of flywheel 45 , the control microprocessor 25 shuts off solenoid 80 , whereby solenoid plate 54 begins to return to its reset position by action of the axial force applied by the compressed belleville springs 72 . as solenoid plate 54 is urged to its start position the combined inertia of solenoid plate 54 , belleville springs 72 , compressed between solenoid plate 54 and retarder plate 64 , and retarder plate 64 prevent solenoid plate 54 from bouncing as it returns to its start position and engages the end of ball tracks 68 a , 68 b , and 68 c . by the presence and action of retarder plate 64 the system is prevented from oscillating and possibly re - engaging the clutch accidentally . as drum 34 rotates counter clockwise , cables 102 a and 102 b wrap about peripheral grooves 57 and 60 in drum 34 and clutch 35 respectively , thereby drawing piston assembly 111 downward , within cylinder 110 , in a power , or working , stroke whereby the attached fastener driver 106 is likewise driven downward , through guide block 108 , opening 41 within housing 48 , and into nose piece 20 thereby driving a selected fastener into a targeted workpiece . as piston assembly 111 is drawn downward through cylinder 110 a vacuum is created above piston assembly 111 which serves to draw piston assembly back to its start position upon completion of the work cycle thereby resetting the tool drive mechanism to its start position . assembly back to its start position upon completion of the work cycle thereby resetting the tool drive mechanism to its start position . fig1 a through 13c sequentially illustrate the action between fixed plate 56 and activation plate 58 as plate 58 rotates during the power stroke of clutch drive assembly 30 . although ball ramps 66 of fixed plate 56 and activation plate 58 are helical as illustrated in fig1 , ramps 66 are illustrated as being linear in fig1 a through 13c for simplicity of explanation . fig1 a illustrates fixed plate 56 and activation plate 58 at the beginning of the tool &# 39 ; s work cycle . as flywheel 45 drives activation plate 58 counter clockwise ( to the left in fig1 a ) balls 63 , following ramp profile 66 , cause a fast and sudden separation x , between activation plate 58 and fixed plate 56 as illustrated in fig1 b . separation x is maintained throughout the power stroke of driver 106 , as illustrated in fig1 b , thereby affecting the impartion of the kinetic energy , stored within flywheel 45 , to driver 106 as described above . at the end of the power stroke , as illustrated in fig1 c , plates 56 and 58 suddenly close together thereby causing the rapid disengagement of clutch 35 from flywheel 45 . with the solenoid plate 54 returned to its starting position and clutch 35 disengaged from flywheel 45 , activation plate 58 , drum 34 and clutch 35 , as an assembly , may be returned to their start position as described below . fig1 presents a representative graphical plot of the separation x between activation plate 58 and fixed plate 56 as a function of the angle of rotation of activation plate 58 . a combination driver guide and resilient stop block 108 is preferably positioned at the bottom of cylinder 110 to stop piston assembly 111 , within cylinder 110 , at the end of the power stroke . upon disengagement of clutch 35 from flywheel 45 , coil spring 75 urges all elements of clutch drive assembly 30 back toward end plate 52 whereby the vacuum formed above piston assembly 111 draws piston assembly back to its start position and thereby rotating activation plate 58 , drum 35 and clutch 34 by constructing the clutch drive assembly 30 , as taught hereinabove , clutch 35 disengages from flywheel 45 thereby allowing flywheel 45 to continue spinning after drive assembly 30 has reached the end of its power stroke . thus in the event it is desired to successively drive additional fasteners , the remaining kinetic energy is available for the subsequent operation thereby economizing battery power and saving the drive assembly elements and / or the frame 48 from having to absorb the impact that would otherwise occur by bringing flywheel 45 to a full stop immediately after the power stroke . this feature also permits “ dry firing ” of the tool . the clutch drive system as taught herein also provides for automatic compensation for clutch wear in that the expansion between end plate 52 and solenoid plate 54 will continue until clutch 35 engages flywheel 45 thereby allowing solenoid plate 54 to take up the difference at the start of every power drive . referring now to fig1 . vacuum return piston assembly 111 comprises piston 112 slidably received within cylinder 110 . spaced from the top of piston 112 is circumscribing groove 113 having positioned therein sealing o - ring 114 . positioned toward the bottom of piston 112 are two axial stabilizing bands 115 and 116 . the inside diameter d , of cylinder 110 , is flared outward to diameter d ′ at the top of cylinder 110 as illustrated in fig1 . diameter d ′ is slightly greater than the outside diameter of o - ring 114 thus creating an annular gap 117 between o - ring 114 and inside diameter d ′. as piston assembly 111 is drawn axially into cylinder 110 , during the power stroke of driver 106 , o - ring 114 slidingly engages the inside wall diameter d of cylinder 110 thereby forming a pneumatic seal between inside wall 118 of cylinder 110 and piston assembly 111 . as piston assembly 111 progresses into cylinder 110 , a vacuum is created , within the top portion of cylinder 110 , between advancing piston assembly 111 and the sealed end cap 119 . upon disengagement of friction clutch 35 from flywheel 45 , the vacuum created within the top portion of cylinder 110 draws piston assembly 111 back toward end cap 119 thereby resetting activation plate 58 , drum 34 , and clutch 35 , as an assembly , to their restart position . as o - ring 114 passes from inside diameter d to diameter d ′, on its return stroke , any air that may have by passed o - ring 114 , during the power stroke , is compressed and permitted to flow past o - ring 114 through annular gap 117 and to the atmosphere through cylinder 110 , thereby preventing an accumulation of entrapped air above piston assembly 111 . a resilient end stop 120 is preferably positioned within end cap to absorb any impact that may occur as piston assembly 111 returns to its start position at the top of cylinder 110 . as drum 34 returns to its start position tang 33 radially extending from drum 34 engages abutment block 31 affixed to housing 48 , see fig1 , thereby preventing over travel of drum 34 as it returns to its start position . fig1 a illustrates an alternate embodiment for preventing an accumulation of trapped air above piston assembly 111 . as illustrated in fig1 a piston 112 includes circumferential groove 132 receiving therein a generally rectangular shaped seal 134 having a v shaped groove 136 in one laterally positioned side thereof . one leg 133 of v groove 136 extends laterally outward beyond the outside diameter of piston 112 as illustrated in fig1 a . thus seal 134 acts as a check valve such that as piston 112 moves downward , during a power stroke , leg 133 sealing engages the inside wall 118 of cylinder 110 preventing the passage of air past piston 112 thereby creating the desired vacuum above piston 112 . in the event a small accumulation of air does accumulate above piston 112 , compression of that air accumulation upon return of piston 112 to its start position at the top of cylinder 110 will cause the air accumulation to flow past seal 134 thereby preventing a compressive air lock above piston 112 . although the two embodiments described immediately above are preferred embodiments to prevent the accumulation of entrapped air above piston assembly 111 , any other known suitable check valve mechanism may be used whereby entrapped air is permitted to escape to the atmosphere upon return of piston assembly 111 to its start position and wherein a vacuum is created during the power stroke of piston assembly 111 . for example see fig1 b wherein the check valve type of annular seal 134 , of fig1 a , has been replaced by a typical sealing o - ring 138 and a simple flap type check valve 130 which will permit entrapped air to be exhausted from orifice 131 during return of piston 112 to its start position . since the power stroke is relatively fast acting with a rapid return of piston assembly 111 to its start position , it is possible to eliminate check valve flap 130 and size orifice 131 such that the small amount of air that enters the cylinder during the power stroke does not sufficiently affect the resulting vacuum whereby sufficient vacuum remains to return piston assembly 111 to its start position and the air that has accumulated between piston assembly 111 and end cap 119 is exhausted through orifice 131 as piston assembly 111 returns to its start position . having shown and described the preferred embodiments of the present invention , further adaptation of the method and structure taught herein may be accomplished by appropriate modifications by one of ordinary skill in the art without departing from the scope of the present invention . accordingly , the scope of the present invention should be considered in terms of the following claims and is understood not to be limited to the specific structures and methods described in the specification and / or shown in the attached drawings .	1
the invention described herein is directed , in certain embodiments , to methods of treating a category of lip deformity characterized by excessive bulk to the upper and / or lower lip with excessive exposure of mucous membrane . this condition is referred to as hypervolemic lip deformity or lip ectropion . hypervolemic lip deformity can be perceived by the patient in the same vein as excessive prominence of the nose , jaw , forehead , eyebrows , or neck musculature . this condition can occur sporadically but occasionally is associated with specific populations . for example , african - americans and other dark - skinned populations frequently have excessive lip bulk which can be reduced by the methods described herein . sporadically , excessive lip bulk may be associated with jaw malocclusion or craniofacial abnormalities . surgery to debulk or reduce lip volume can be painful and disfiguring . consequently , few patients are interested in undergoing this ordeal . the present inventor has demonstrated using an animal model that shrinkage of large paraspinal muscles may be obtained upon administration of pharmaceutical preparations of botulinum toxin . this was observed using gross dissection and microscopic anatomy . this feature , combined with ease of injection of a botulinum toxin , provides a facile method to treat hypervolemic lip deformity without surgery by multiple injections within the orbicularis ori muscle creating muscle fiber atrophy and hence decreased lip bulk . additionally , decreased muscle tone associated with adjacent lip retractors functions to intort the lip ( i . e . rotate the lip inward ) further giving the impression of smaller lips . such retractors include mentalis , zygomaticu , risorius , nasal labialis , quadratus labii inferioris , and incisivus labii inferioris . in one embodiment of the methods of the present invention , a patient is identified with hypervolemic lips who is desirous of lip size reduction at rest and during dynamic facial movements . contraindications to the use of botulinum toxin ( wherein use of botulinum toxin would be ruled out ) include , for example , facial myopathy , myasthenia gravis and concurrent use of aminoglycoside antibiotics . in one embodiment , botulinum toxin in freeze - dried or liquid formulation is drawn into a syringe at a fixed dosage per 0 . 1 cc . other dose dilutions are possible . injections are made in multiple locations through the lip mucous membrane in at east 4 locations per lip . lip retractors are not directly injected but may be injected if lip size is not adequately reduced by injecting the lip structure directly . topical anesthetics such as 4 % lidocaine cream or cetacaine spray may be used to reduce the discomfort of the procedure . the effect does not occur immediately , but slowly over about 3 to about 5 weeks . repeated injections are necessary over about 3 to about 4 month intervals . asymmetry of mouth position during rest or dynamic movements may be addressed by “ touch - up ” injections after about 3 to about 5 weeks . the botulinum toxin , when injected in multiple locations provides a method of muscle shrinkage which reverses over a 3 - 4 month period . decreased resting muscle tone and contractility represent the muscular effect of botulinum toxin due to the partially denervated state . shrinkage of muscle fiber after point injection is seen in fiber after 4 weeks in table 1 . the invention described herein is also directed to methods for reducing facial muscle bulk and altering facial contour as well as methods of reducing facial volume . a . pharmaceutical compositions comprising botulinum toxin and a sequestration agent pharmaceutical compositions comprising botulinum neurotoxin and a sequestration agent are described in co - pending u . s . application ser . no . 10 / 740 , 755 filed dec . 22 , 2003 which is hereby incorporated by reference into the present application in its entirety . use of such pharmaceutical compositions comprising botulinum toxin and a sequestration agent is contemplated in the methods of the present invention , but is not required . as set forth in the co - pending &# 39 ; 755 application , in one embodiment , the sequestration agent is present in an amount between 550 and 550 , 000 μg sequestration agent per 100 ld 50 units botulinum toxin . in another embodiment , the sequestration agent is present in an amount between 550 and 5 , 500 μg sequestration agent per 100 ld 50 units botulinum toxin . in a further embodiment , the sequestration agent is present in an amount between 5 , 500 and 13 , 000 μg sequestration agent per 100 ld 50 units botulinum toxin . in a preferred embodiment , the sequestration agent is present in an amount between 13 , 000 and 50 , 500 μg sequestration agent per 100 ld 50 units botulinum toxin . in a more preferred embodiment , the sequestration agent is present in an amount between 50 , 500 and 505 , 000 μg sequestration agent per 100 ld 50 units botulinum toxin . in the most preferred embodiment , the sequestration agent is formulated as encapsulated microspheres in an amount between 50 , 500 and 90 , 500 μg sequestration agent per 100 ld 50 units botulinum toxin . in another embodiment , the methods may be practiced with a composition comprising botulinum toxin and a sequestration agent , wherein the sequestration agent is present in an amount between 550 and 900 , 500 μg sequestration agent per 100 ld 50 units botulinum toxin , wherein the albumin may be formulated as a solid albumin particle . the botulinum toxin of the present compositions may be selected from a variety of strains of clostridium botulinum . in a preferred embodiment , the compositions of the present invention comprises a botulinum toxin selected from the group consisting of botulinum toxin types a , b , c , d , e , f and g . in a preferred embodiment , the botulinum toxin is botulinum toxin type a . in a more preferred embodiment , the botulinum toxin is botulinum toxin type a from the hall strain of clostridium botulinum . in another embodiment , the compositions of the present invention comprise a botulinum toxin that consists essentially of fractionated - light - chain botulinum toxin . in yet another embodiment , the botulinum toxin consists essentially of a mixture of hybrid and chain - translocated forms of botulinum toxin . in a further embodiment , the botulinum toxin consists essentially of chimeric forms of botulinum toxin . although the present invention may utilize any botulinum toxin , botulinum toxin fragment that retains neurotoxic activity , botulinum toxin chimeras and hybrids , chemically - modified botulinum toxin , and specific activities well known to those of ordinary skill in the art , in one embodiment the botulinum toxin is purified to a specific activity greater than or equal to about 20 ld 50 units per nanogram botulinum toxin . in certain embodiments , the compositions of botulinum toxin and a sequestration agent are such that the ratio of ld 50 units of botulinum toxin to μg sequestration agent is less than or equal to about 0 . 2 for botulinum toxin type a and is less than or equal to about 10 for botulinum toxin type b . the compositions used in the methods of the present invention , in addition to comprising a botulinum toxin and optionally a sequestration agent , may further comprise a pharmaceutically acceptable carrier and / or zinc and / or a zinc salt . in one embodiment , the botulinum toxin is noncovalently bound to the a sequestration agent . in another embodiment , the botulinum toxin is covalently bound to the sequestration agent . the methods of the present invention may be practiced using compositions of a botulinum toxin and optionally , a sequestration agent , wherein the sequestration agent is selected from the group consisting of : proteins , lipids and carbohydrates . in a preferred embodiment , the sequestration agent is albumin , collagen , epinephrine or hyaluronate . in a more preferred embodiment , the sequestration agent is hyaluronate . in the most preferred embodiment , the sequestration agent is albumin . the methods of the present invention may also be practiced using compositions comprising a botulinum toxin and , optionally a sequestration agent , wherein the sequestration agent is an albumin , preferably human serum albumin . furthermore , in one embodiment , the albumin of the present compositions is recombinantly produced . in one embodiment , the albumin is present in an amount between 550 and 5 , 500 μg albumin per 100 ld 50 units botulinum toxin . in a further embodiment , albumin is present in an amount between 5 , 500 and 13 , 000 μg albumin per 100 ld 50 units botulinum toxin . in a preferred embodiment , albumin is present in an amount between 13 , 000 and 50 , 500 μg albumin per 100 ld 50 units botulinum toxin . in a more preferred embodiment , albumin is present in an amount between 50 , 500 and 505 , 000 μg albumin per 100 ld 50 units botulinum toxin . in a most preferred embodiment , albumin is formulated as encapsulated microspheres in an amount between 50 , 500 and 90 , 500 μg albumin per 100 ld 50 units botulinum toxin . in one embodiment of the present invention , the methods of the present invention may be practiced using compositions comprising a botulinum toxin and , optionally , at least one sequestration agent . in a preferred embodiment , the methods of the present invention may be practiced using compositions comprising a botulinum toxin and albumin and further comprising one or more additional sequestration agents . as used herein , “ effective amount ” is an amount sufficient to produce a therapeutic response . an effective amount may be determined with dose escalation studies in open - labeled clinical trials or bin studies with blinded trials . as used herein , a “ subject in need thereof ” is any patient suffering from a deformity arising from excessive tissue bulk or muscle bulk or tissue volume or muscle volume . as used herein , a “ deformity ” is any physical blemish , imperfection or distortion caused by or associated with excessive tissue bulk or muscle bulk or tissue volume or muscle volume , as perceived by the subject having the deformity . as used herein , one ld 50 unit of botulinum toxin is the dose necessary to kill 50 % of a population of about 20 gram to about 30 gram swiss - webster mice . as used herein , “ sequestration agent ” means an agent that enhances localization and / or retention of the botulinum toxin to the site of administration . the following examples are meant to illustrate the methods of the invention and are in no way intended to limit the scope of the invention . case description of reduction of hypervolemic lip size and volume using botulinum toxin ac is a 49 year old woman with a life - long history of excessive lip size . ac stated that she found this condition disfiguring and desired lip volume reduction . ac had worked as a psychologist and felt that this feature ( excessive lip size ) distorted her ability to communicate with patients and detracted from her personal appearance . the option of using botulinum toxin as a method to shrink the muscle fiber comprising a major component of her excessive lip volume was offered and she expressed the desire to proceed with this intervention . after explaining possible side effects including mouth movement asymmetry and possible temporary drooling , she wished to proceed . about 20 units of botulinum toxin type a were injected at four locations within the upper lip and about 20 units of botulinum toxin type a were injected into multiple locations in the lower lip . after about 3 weeks , the patient noted considerable reduction in lip size and less exposure of lip mucous membrane . the effect was noted to last for about 3 - 4 months . by shrinking muscle volume in ac &# 39 ; s lips by creating neurogenic atrophy induced by botulinum toxin , lip volume and contour were altered and disfigurement mitigated . influence of injection doses on muscle fiber size using botulinum toxin type a using doses of botulinum toxin type a varying from about 1 . 25 units per injection point to about 15 units per injection point , the influence of injection doses on muscle fiber size was examined and the results are shown in table 1 . the listed doses represent use of botulinum toxin type a . for botulinum toxin type b , 100 - 500 units are anticipated per injection point . other formulations can be selected for dose using regional denervation bioassays comparing the potency of the preparation with that of botulinum toxin type a formulated as botox ™ or purtox ( see table 1 ). in table 1 , average muscle fiber cross - sectional diameter is shown in microns ( with standard deviation ) at increasing distances from the point of injection for purtox dose escalations . comparable denervation results were obtained with botox ™ ( n = 100 , per biopsy location , bioquant ii fiber counter ). a patient is identified with increased muscle bulk below the eyelids . the patient is selected for treatment with botulinum toxin based on her desire to reduce the facial muscle bulk displayed below her eyelids . multifocal injections of about 20 units of botulinum type a in a pharmaceutical composition comprising a sequestration agent are administered to the patient . after about three weeks , the patient notes a decrease in facial muscle bulk below her eyelids which is accompanied by an altered facial contour manifested by a smoother , less prominent , appearance of the skin below the eyelids .	0
various apparatuses or methods will be described below to provide an example of an embodiment of each claimed invention . no embodiment described below limits any claimed invention and any claimed invention may cover apparatuses and methods that differ from those described below . the claimed inventions are not limited to apparatuses and methods having all of the features of any one apparatus or method described below , or to features common to multiple or all of the apparatuses or methods described below . it is possible that an apparatus or method described below is not an embodiment of any claimed invention . any invention disclosed in an apparatus or method described below that is not claimed in this document may be the subject matter of another protective instrument , for example , a continuing patent application , and the applicant ( s ), inventor ( s ) and / or owner ( s ) do not intend to abandon , disclaim or dedicate to the public any such invention by its disclosure in this document . the present disclosure relates to optimizing the material specification of alloy 800 to give reliable scc resistance in initiation and propagation during long term exposures , for example , to at least 80 years in canada deuterium uranium ( candu ) reactor and pwr primary systems . materials considered herein are modifications of alloy 800 with different concentrations of cr and ni . the measured scc growth rates were compared with rates obtained previously for alloys 690 ( 61 % ni ) and 316 ( 10 % ni ) in pwr primary water . furthermore , measured scc growth rates were compared with other test results of alloys with variations of nickel and chromium . firstly , the effects of nickel and chromium concentrations on intergranular stress corrosion cracking ( igscc ) was investigated . the following alloys with higher cr concentrations and cold - worked to 20 % ( 20 % cw ) were examined : 32 % ni - 27 % cr — fe ; 35 % ni - 25 % cr — fe ; and 25 % ni - 25 % cr — fe . secondly , the temperature dependence of scc growth of steam generator ( sg ) tubing in a range of operating temperatures was examined . the above - noted ni — cr — fe alloys with higher cr concentration were examined at 290 ° c ., 320 ° c ., 340 ° c . and 360 ° c . thirdly , the role of cavity formation on scc initiation of carbon steel for long terms at high temperatures was considered , and the rate of cavity formation was measured . then , the results were compared with results for alloy 690 to compare the scc initiation resistance of the ni — cr — fe alloys described herein , considering life beyond 60 years . an alloy of 20 % cw solution annealed 32 % ni - 25 % cr — fe ( 1075 ° c .× 1 h w . c .) was examined in the range of temperatures between 425 ° c . and 460 ° c . the results were compared with the results obtained previously to examine the effect of cr concentration and the effect of heat treatment on the rate of cavity formation in air . furthermore , a ni — cr — fe alloy specimen with fine grains was tested at 445 ° c . to confirm its reproducibility of the result obtained at 460 ° c ., and to examine the grain size effect considering steam generator tubing with fine grain size . for applications where increased resistance to corrosion ( scc in particular ) is required , such as in nuclear power plants or similar applications where material integrity is important , any increase in materials performance whilst remaining within specification limits , that are similar to the materials currently in use , is important , and hence useful . alloys of the present disclosure may provide significantly improved resistance to scc compared to alloy 800 alloys currently available . thus , the alloys of the present disclosure may be useful for applications where alloy 800 is currently used , and potentially other applications where ni — cr and austenitic stainless steels are used . alloys of the present disclosure may provide improved corrosion resistance , which becomes an economic benefit if the improved material reduces instances of component failure and results also in longer life of materials and components in service . thus , alloys of the present disclosure may have commercial benefits for manufacturers of ni — cr — fe alloys , and in particular for suppliers of materials to the nuclear industry , and potentially also to the suppliers of materials for all other applications that use alloy 800 or related materials . chemical compositions of test materials are summarized in table 1 . mechanical properties of test materials were measured at room temperature and 320 ° c . ; the results from annealed and ˜ 20 % cold rolled materials are summarized in tables 2 and 3 . specimens were machined as 0 . 5 t compact tension type ( 0 . 5 t ct ) with 12 . 5 mm thicknesses . specimens were prepared using ˜ 20 % cold rolled materials in the t - l orientation , i . e ., crack growth direction parallel to the rolling direction as shown in fig1 . a fatigue pre - crack of about 2 mm was produced using a load ratio ( r = k min / k max = 0 . 1 ) with 8 hz and at a k min below the stress intensity for testing . an example of the ct specimen with fatigue pre - crack before testing is shown in fig2 . rates of scc growth were measured in the range of temperatures between 290 ° c . and 360 ° c . in pwr primary water using 20 % cold rolled ct specimens . the specimens were broken after testing by fatigue in air . the fracture surfaces were analyzed using sem to determine the crack morphology and the depth of igscc . maximum igscc depths were determined using scc depth data that are measured from at least four points . scc crack growth rate was calculated by equation ( 1 ): tests were performed under constant load conditions without dynamic loading in the test environment at 360 ° c ., 340 ° c ., 320 ° c . and 290 ° c . the initial k value was 30 mpam 1 / 2 in all cases . rates of scc growth were measured in test facilities at 360 ° c ., 340 ° c ., 320 ° c . and 290 ° c . in typical pwr primary water , which contains boric acid ( h 3 bo 3 , 500 ppm as b ), lithium hydroxide ( lioh , 2 ppm as li ), and dissolved hydrogen ( dh , ˜ 30 cc / kg h 2 o ). the concentration of hydrogen was adjusted by bubbling an appropriate gas pressure through the solution in the storage tank at room temperature before the solution is pumped into the autoclaves ; hydrogen and oxygen were measured at ambient temperatures using a hydrogen and oxygen gas monitor . dissolved oxygen was controlled to less than 5 ppb through the testing . the depth of intergranular corrosion was measured by sem observation in cross sectional view using focussed ion beam ( fib ) of the bottom of ct specimens to characterize the cr concentration and temperature with peak . film analyses by aes were performed on specimens after testing in pwr primary water at 290 ° c ., 320 ° c ., 340 ° c . and 360 ° c . these measurements provided information on the cause of the measured temperature dependence . good correlations have been reported previously between rates of cavity formation and creep crack growth in gas with carbon steel as shown in fig3 a . similar correlations have also been performed on alloy 690 and alloy 600 as shown in fig3 b . then , the rate of cavity formation was assumed from the results of measured rates of creep crack growth in air considering the correlation between rates of creep crack growth and cavity formation shown in fig3 a and 3b . scc initiation caused by cavity formation was correlated with the rate of cavity formation . rates of creep crack growth were measured at 425 ° c ., 440 ° c . and 460 ° c . in air using ˜ 20 % cold rolled ct specimens of solution annealed 32 % ni - 25 % cr — fe alloy ( 1075 ° c .× 1 h w . c .). furthermore , 19 % cw 34 % ni - 22 % cr ( 1065 ° c .× 10 m a . c .) with fine grains was tested at 445 ° c . to confirm the reproducibility of the results at 460 ° c . to examine effects of grain size . tests were performed under constant load conditions without dynamic loading in the test environment . the initial k value was 40 mpam 1 / 2 in all cases . specimens were broken by fatigue in air after testing . the fracture surfaces were analyzed using sem to determine the crack morphology and the depth of creep crack . maximum creep crack depth was determined using creep crack depth data that are measured from at least four points . creep crack growth rate was calculated by equation ( 2 ): these results were compared with other data to assess effects of cr concentration and carbide precipitation on the rate of cavity formation . results were compared with those of alloy 690 to compare the scc initiation resistance caused by cavity formations between the ni — cr — fe alloys described herein and alloy 690 . test conditions of test 1 at 360 ° c . are summarized in fig4 a , 4b and 4c . test duration in test 1 was 5 , 233 h . water chemistries of the test environments were well controlled during testing . after testing , the specimens were broken by fatigue in air to determine the depth of scc and fracture morphologies . the observed results of the fracture surfaces of test specimens are shown in fig5 a , 5b , 6a , 6b , 7a and 7b . no trace of scc was observed in the test specimens of 35 % ni - 25 % cr — fe alloy and 32 % ni - 27 % cr — fe alloy after 5 , 233 h exposures in pwr primary water at 360 ° c ., as shown in fig5 a , 5b , 6a and 6b . these results show excellent scc growth resistance of these alloys at 360 ° c . in pwr primary water , for example , as compared with alloy 690 in the range of specification of ni concentration of alloy 800 currently available ( 32 to 35 % ni ). one very local and shallow igscc was observed in the 20 % cw 25 % ni - 25 % cr — fe alloy . the maximum rate of scc growth was ˜ 1 . 6 × 10 − 9 mm / s based on the destructive observations shown in fig7 b . test conditions of test 2 at 340 ° c . are summarized in fig8 a , 8b and 8c . test duration in test 2 was 5 , 233 h . water chemistries of the test environments were well controlled during the testing . after testing , the specimens were broken by fatigue in air to determine the depth of scc and the fracture morphologies . the observed results of the fracture surfaces of the specimens are shown in fig9 a , 9b , 10a , 10b , 11a and 11b . no trace of scc was observed in the test specimens after 5 , 233 h exposures in pwr primary water at 340 ° c ., as shown in fig9 a , 9b , 10a , 10b , 11a and 11b . these results show excellent scc growth resistance of the alloys . test conditions of test 3 at 320 ° c . are summarized in fig1 a , 12b and 12c . test duration in test 3 was 6 , 609 h . water chemistries of the test environments were well controlled during the testing . after testing , the specimens were broken by fatigue in air to determine the depth of scc and the fracture morphologies . the observed results of the fracture surfaces of test specimens are shown in fig1 a , 13b , 14a , 14b , 15a and 15b . no trace of scc was observed in the test specimens after 6 , 609 h exposures in pwr primary water at 320 ° c ., as shown in fig1 a , 13b , 14a , 14b , 15a and 15b . these results show excellent scc growth resistance of the alloys , for example , as compared with 20 % cw alloy 690 tt ( t - l ), also at 320 ° c . in pwr primary water . test conditions of test 4 at 290 ° c . are summarized in fig1 a , 16b and 16c . test duration in test 4 was 6 , 155 h . water chemistries of the test environments were well controlled during the testing . after testing , the specimens were broken by fatigue in air to determine the depth of scc and the fracture morphologies . the observed results of the fracture surfaces of test specimens are shown in fig1 a , 17b , 18a , 18b , 19a and 19b . no trace of scc was observed in all of the test specimens after 6 , 155 h in pwr primary water at 290 ° c ., as shown in fig1 a , 17b , 18a , 18b , 19a and 19b . these results show excellent scc growth resistance of the alloys also at 290 ° c . in pwr primary water . to consider mechanisms of scc growth in pwr primary water , film analyses were performed using alloy specimens after testing in pwr primary water at 290 ° c ., 320 ° c ., 340 ° c . and 360 ° c . surface oxidation behaviors after testing are shown in fig2 a , 20b and 20c . lntergranular corrosion was observed after testing at 290 ° c . and 320 ° c . in alloys with low cr concentrations less than 22 % cr , as shown in fig2 a , 20b and 20c . however , there was no trace of intergranular corrosion in alloys with cr concentrations more than 23 %. accordingly , sem observations and aes analyses of cross sectional views were performed to examine the temperature dependence with peak of igscc growth after sampling by fib , as shown in fig2 a , 21b , 21c , 21d , 21e , 21f , 21g , 21h , 21i and 21j . sem observations of cross sectional views were performed to assess the mechanisms of cr concentration dependence on scc growth resistance ; samples of alloys were used with different cr concentrations after tests at 290 ° c ., as shown in fig2 a , 22b and 22c . lntergranular corrosion was observed in alloys with low cr concentration less than 23 % tested at 320 ° c . and 290 ° c . no clear evidence of intergranular corrosion was observed in alloys tested at higher temperatures more than 340 ° c . no clear evidence of intergranular corrosion was observed in alloys with high cr concentration of more than 25 % after testing at 290 ° c ., 320 ° c ., 340 ° c ., and 360 ° c . to examine the effect of material characteristics on scc initiation caused by cavity formation , considering long term reliability more than 60 years in high temperature water , rates of cavity formation were measured from the results of creep crack growth using 20 % cw ct specimens of solution annealed 32 % ni - 25 % cr — fe alloy ( 1075 ° c .× 1 h w . c .) at 425 ° c ., 440 ° c . and 460 ° c . in air . then , the results were compared with results of 20 % cw alloy 690 tt to compare the crack initiation resistance caused by cavity formation . the reproducibility of 19 % cw 34 % ni - 22 % cr — fe alloy ( 1065 ° c .× 10 m a . c .) with fine grains was tested at 445 ° c . to examine the effects of grain size , for example , in steam generator tubing . test durations were between 4 , 030 h and 9 , 590 h . after testing , the specimens were broken by fatigue in air to determine the depth of creep cracking and the fracture morphologies . the results of observations on fracture surfaces are shown in fig2 a , 23b , 24a , 24b , 25a , 25b , 26a and 26b . lntergranular crack growth was observed in almost all specimens tested at 460 ° c ., 445 ° c ., and 440 ° c ., as shown in fig2 a , 23b , 24a , 24b , 26a and 26b . however , no crack growth was observed in solution annealed 32 % ni - 25 % cr — fe alloy tested at 425 ° c . after 9 , 590 h in air , as shown in fig2 a and 25b . measured maximum rates of creep crack growth of solution annealed 32 % ni - 25 % cr — fe alloy tested at 440 ° c . (˜ 1 . 6 × 10 − 8 mm / s ) was about 50 times slower than that of alloy 690 tt with the same grain size (˜ 100 μm ). about 10 times more rapid rate of creep crack growth was observed in 34 % ni - 22 % cr — fe alloy with fine grains (˜ 20 μm ) compared with solution annealed 32 % ni - 25 % cr — fe alloy with large grains (˜ 100 μm ). furthermore , more than 50 times rapid rate of creep crack growth was observed in carbide precipitated 32 % ni - 25 % cr — fe alloy than solution annealed 32 % ni - 25 % cr — fe alloy . the scc growth resistance of ni — cr — fe alloys described herein with cr concentrations more than 25 % in pwr primary water was measured . the results are summarized as a function of cr concentration in fig2 a , 27 b , 27 c , 27 d and 27 e , together with existing results for ni - 16 % cr — fe alloys and alloy 690 tt . the dependencies on temperature of scc growth are summarized in fig2 a and 28b , together with existing results for ni - 16 % cr — fe alloys and alloy 690 tt . there was no trace of scc observed in 32 % ni - 25 % cr — fe alloy , 32 % ni - 27 % cr — fe alloy , and 35 % ni - 25 % cr — fe alloy in the range of temperatures between 290 ° c . and 360 ° c . the results showed that temperature dependencies of scc growth with peak was not observed for cr concentrations more than 25 %. excellent scc growth resistance in ni — cr — fe alloys with more than 25 % cr concentrations were observed relative to alloy 690 tt in the range of temperatures between 290 ° c . and 360 ° c . in pwr primary water . the peak of the scc growth rate of the ni — cr — fe alloys seems to be in the range of temperatures between 320 ° c . and 290 ° c ., judging from results obtained for 32 % ni - 16 % cr — fe alloy , as shown in fig2 a . samples were examined with the sem after testing at 290 ° c . lntergranular corrosion was observed in 32 % ni — cr — fe alloys with 16 %, 20 %, 22 %, and 23 % cr after testing at 290 ° c . in pwr water without the application of stress , as shown in fig2 a and 29b . no trace of intergranular corrosion was observed in the 32 % ni - 25 % cr — fe and 32 % ni - 27 % cr — fe alloys . the thickness of the inner layer may be influenced by the cr concentrations in alloys . these results suggest that intergranular corrosion may produce some influence on igscc growth for ni — cr — fe alloys , judging from the similar trend of dependence of cr concentration both on scc growth and intergranular corrosion , as shown in fig2 a and 29b . samples were examined with the sem after testing at 290 ° c ., 320 ° c ., 340 ° c ., and 360 ° c . furthermore , aes analyses were performed to determine the dependence of temperature on film compositions . the results of these observations are shown in fig2 a , 21b , 21c , 21d , 21e , 21f , 21g , 21h , 21i , 21j , 22a , 22b and 22c . as shown , the thicknesses of inner oxide layers appear to be thicker after testing at high temperature than low temperatures . moreover , the thicknesses of specimens with high cr concentrations appear to be greater than specimens having lower cr concentrations , even at 290 ° c . the parabolic law constant was calculated according to equation ( 3 ) to confirm this trend more clearly . the results are summarized in fig3 a . thickness of inner layer ( mm )=( k p · time ) 1 / 2 ( 3 ) lntergranular corrosion appears to occur at low temperatures less than 320 ° c . in 32 % ni — cr — fe alloys with cr concentrations less than 23 %. furthermore , the susceptibility of the alloys to intergranular corrosion appears to decrease at temperatures higher than 340 ° c . moreover , significant dependencies of film compositions on temperature were not observed . the inner layer consisted mainly of cr - rich oxide . on the other hand , the outer layer mainly consisted of ni — and fe - rich oxides . dependencies on temperature with peak of the parabolic law constant were observed in alloys with low cr concentration in the range between 16 % and 23 %. this trend is similar to the temperature dependence of scc growth with peak of alloy 800 . furthermore , higher parabolic law constants were observed in alloys with higher cr concentrations , including 25 % at 290 ° c . this trend is also similar to the dependence of cr concentration on scc growth of alloy 800 at 290 ° c . these results suggest that intergranular corrosion may play a role in igscc growth , judging from the similar trend of dependence of temperature both on scc growth and intergranular corrosion . furthermore , measured temperature dependencies of intergranular corrosion susceptibilities with peak may be related to the kinetics of the inner oxide layer considering the similar dependence of temperature . scc initiation behavior caused by cavity formation of 20 % cw tt690 , ma600 and carbon steel was examined , as shown in fig3 b . the dependencies of several influences on rates of cavity formation of the alloys were examined to compare with alloy 690 tt . for this , the effects of the following characteristics were examined : comparison of rates of cavity formation with alloy 690 tt ; effect of carbide precipitation on rates of cavity formation ; effect of grain size on rate of cavity formation ; and effect of cr concentration on rates of cavity formation . as shown in fig3 a and 3b , a good correlation was observed between rate of creep crack growth and cavity formation because the rate limiting processes of creep cracking are assumed to be proportional to the rate of cavity formation . therefore , firstly , the measured rate of creep crack growth in solution treated ni — cr — fe alloy with 25 % cr was compared with the results for other alloy specimens with different cr concentrations . then , the effect of cr concentration on the rate of cavity formation could be determined . secondly , the measured rates of solution treated ni — cr — fe alloy were compared with the results of carbide precipitated alloy to determine the effect of carbide precipitation on the rate of cavity formation . thirdly , the measured rates in solution treated ni — cr — fe alloy with large grains (˜ 100 μm ) were compared with the results of solution treated 34ni - 22cr — fe alloys with fine grains (˜ 20 μm ) to determine the effect of grain size on the rate of cavity formation . finally , the measured rates of cavity formation were compared with the results for alloy 690 tt to understand the scc initiation resistance caused by cavity formation . all results are summarized in fig3 c . firstly , it should be appreciated that carbide precipitation may accelerate cavity formation , by providing nucleation sites for cavities , thereby enhancing the rate of cavity formation near the carbides . evidence for this correlation includes the rapid crack growth in carbide precipitated alloy in a double heat treatment at 1075 ° c .× 1 h + 900 ° c .× 1 h . in general , solution annealed alloy in a single high temperature heat treatment is better for the ni — cr — fe alloys described herein so as to not precipitate carbides . secondly , rapid cavity formation may occur in material with small grains , for example , sg tubing relative to thick components such as control rod drive mechanism ( crdm ) housings . an estimated crack initiation time for alloy 690 tt with large grains may be about 100 years at operating temperature ( 320 ° c . ), based on an extrapolated value in fig3 b . however , if the effect of grain size from the data is used to assess the scc initiation time of sg tubing with fine grains , the estimated time may decrease by a factor of ten . consequently , the estimated scc initiation time may be about 10 years . however , the degree of cold work may alter these influences . accordingly , the rate of intergranular crack growth may be about 100 times slower for solution annealed 32 % ni - 25 % cr — fe than for alloy 690 tt . furthermore , carbide precipitated 32 % ni - 25 % cr — fe alloy may be about 100 times faster than for solution annealed 32 % ni - 25 % cr — fe alloy . these results suggest that carbide precipitation strongly decreases the resistance of scc initiation caused by cavity formation in the ni — cr — fe alloys described herein . precipitated carbides may provide initiation sites for cavity formations . therefore , high temperature final heat treatments , such as 1075 ° c . followed by rapid cooling , to reduce carbide precipitation are desirable for scc initiation resistance caused by cavity formation . a ten times more rapid rate of intergranular crack growth ( rate of cavity formation ) was observed in solution annealed alloy with fine grain (˜ 20 μm ) than solution annealed alloy with large size of grain (˜ 100 μm ), as shown in fig3 c . the main cause of the effect of grain size may be the difference of the magnitude of discharged vacancies from small grains , judging from the calculated results shown in fig3 d . this suggests that about ten times shorter scc initiation time is produced by cavity formation with the smaller grains . the estimated scc initiation time caused by cavity formation of 20 % cw alloy 690 tt with large size of grains (˜ 100 μm ) is estimated to be about 100 years , based on the extrapolated value at 320 ° c ., as shown in fig3 b . taking into account the grain size effect described above , the estimated scc initiation time with fine grains may be assumed to be about ten years , although other effects , such as degree of cold work may be considered . no significant effect of cr concentration on the rate of cavity formation was observed in the range of cr concentration between 20 % and 25 %. in conclusion , measured scc growth rates of ni — cr — fe alloys with between 25 and 27 wt % cr were very slow at temperatures between 320 ° c . and 360 ° c ., compared with scc growth rates of alloy 690 . given that the results for alloys having 27 wt % cr were so clearly good , it is believed that alloys having up to 28 wt % cr , and possibly more , may also exhibit an improved resistance to stress corrosion cracking in nuclear environments . regarding the mechanism of dependence of cr concentration in igscc growth , intergranular corrosion may play a role on the susceptibility of igscc growth in pwr primary water . regarding the mechanism of dependence of temperature with peak on igscc growth for ni — cr — fe alloys , intergranular corrosion may play a role on the susceptibility of igscc growth for ni — cr — fe alloys in pwr primary water . furthermore , ni — cr — fe alloys described herein produced excellent crack initiation resistance relative to alloy 690 from the point of view of resistance of cavity formation . lower cavity formation rates may yield an initiation rate for ni — cr — fe alloys described herein that is about 100 times less than an initiation rate for alloy 690 . however , a significant increase in rates of cavity formation may occur with carbide precipitation and small grain sizes . therefore , a high temperature final heat treatment followed by rapid cooling may produce a low rate of cavity formation for the ni — cr — fe alloys described herein . the heat treatment of the ni — cr — fe alloys described herein may be carried out at a temperature of at least 1000 ° c ., for a minimum of 3 minutes , and followed by rapid water cooling . more particularly , the heat treatment may be carried out in the range of 1050 - 1100 ° c . the intent for the ni — cr — fe alloys is to avoid carbide precipitation , which may occur below 1050 ° c . there may be no specified maximum time because the total time may be determined by the thickness of the material , and thus how long it takes the material to get to temperature . once at temperature , a time of 3 minutes or possibly more may be required . for example , for sg tubing , a thin wall ( e . g ., 1 mm ) means that 3 minutes ( the time it takes to go through an annealing furnace ) may be appropriate . maximum times may depend on material thicknesses , initial conditions , etc ., and may be optimized according to product specifications , including grain size , surface cleanliness , hardness , etc . while the above description provides examples of one or more methods or apparatuses , it will be appreciated that other methods or apparatuses may be within the scope of the accompanying claims .	2
referring now to the drawings in greater detail wherein the figures are for the purpose of illustrating preferred embodiments of the present invention only and not for the purpose of limiting the same , a cross - sectional view of a typical piston / cylinder arrangement in an adiabatic diesel engine is illustrated in fig1 . piston 10 having piston rings or sliding seals 12 is housed in cylinder 14 of engine 16 . typically , piston rings 12 are compression loaded against inner cylinder wall 18 whereby the outer ring surface 20 slides along inner wall 18 during operation . ideally , there is no direct contact between the ring surface 20 and the wall 18 but rather a thin lubricant film separates the surface 20 and the wall 18 . during operation of engine 16 extremely high temperatures are generated within cylinder 14 often causing conventional lubricants to simply break down or vaporize . upon lubricant breakdown or vaporization ring surface 20 contacts wall 18 and detrimental wear is experienced on both the seal 12 and the wall 18 . it is to be understood that wall 18 could be a cylinder liner . fig2 a is a detailed illustration of seal 12 and wall 18 in a representative diesel exhaust environment of 7 . 8 % co 2 , 8 . 9 % o 2 , balance n 2 , at approximately 40 psi pressure , 800 ° c . temperature . in fig2 a , seal 12 is a nickelmolybdenum bonded titanium carbide cermet ( ni - mo - tic ) while wall or cylinder liner 18 is partially - stabilized zirconia . as ring 12 slides along wall 18 , molybdenum , mo , ions are released from rings 12 while oxygen , o , reacts with the ring materials to form titanium and nickel oxides , ti ( o ) and ni ( o ). these oxides transfer to wall 18 during operation of the engine , and it is believed function to form discontinuous , but relatively lubricious , films 50 . molybdenum ions do not transfer since at 800 ° c . mo rapidly volatilizes as moo 3 . likewise , fig2 b illustrates the formation of the discontinuous , lubricious film where the ring material is hot - pressed titanium carbide , tic , and the liner 18 is silicon nitride , si 3 n 4 . fig2 b shows the transfer of the titanium oxides to wall 18 to form lubricious film 52 . test results involving standard pin ( simulated ring 12 ) - on - disk ( simulated liner 18 ) experiments performed at 800 ° c ., 5 pounds normal force , and pin - ring relative velocities of 1 m / s , have shown that ceramic friction and wear couples , such as discussed above , which have not been ion - implanted , as hereinafter discussed , exhibit friction coefficients greater than 0 . 35 . the couples degrade by a variety of wear mechanisms , leaving a disk wear track of measurable ( using surface profilometry ) depth . however , when liner ceramics 18 have been ion - mixed with metal ions and oxidized at high oxidizing temperatures as described below , friction coefficients and wear resistance improve significantly . for example , in fig3 liner wall 18 of partially stabilized zirconia ( psz ) has been implanted with titanium , ti , and nickel , ni , mixed , and oxidized at high oxidizing temperatures to form a near surface gradient layer of oxides and the underlying psz . liner wall 18 could also be silicon nitride , si 3 n 4 , or other comparable ceramic composition . implantation is achieved by first depositing a thin film ( approximately 400 angstroms thick ) of a metal ion such as nickel , ni , upon the surface of the wall of ceramic composition of partially - stabilized zirconia . metal ions such as nickel , titanium , niobium , silver , zinc , copper , zirconium and yttrium are also suitable selections for deposition . tests have shown that molybdenum and chromium are not suitable . deposition may be accomplished by chemical vapor deposition ( cvd ), vacuum deposition ( vd ) or otherwise as is known in the art . next , the metal ion deposition is ion mixed or implanted using argon , ar , ions at an accelerating potential of approximately 140 kev . ion fluence is 1 × 10 17 ions / cm 2 , and the ion flux is 1 × 10 12 ions / cm 2 seconds . ion mixing is commonly known in the art . the ion mixing of the metal ion with the ceramic composition occurs within the outer 0 . 4 - 0 . 5 micrometer thick surface region of the ceramic composition . a second deposition is then conducted either with the same metal ion or a second metal ion such as a thin film of titanium being deposited by cvd , vd , or otherwise on the surface of the ceramic compositon which has already been implanted with the first metal ion , this second metal ion also being of the group discussed above . again , there is ion mixing and implantation of the second deposition with the first metal ion and the ceramic composition at the near surface region of the ceramic composition using argon ions at an accelerating potential of approximately 140 kev . the metal ions are mixed together well , but contain relatively little of the underlying ceramic composition . this composite is next oxidized to form a gradient coating . after mixing and implantation , wall 18 is subjected to approximately a thirty minute soak at approximately 600 °- 800 ° c . in moist air or in a representative diesel exhaust environment discussed above , thereby oxidizing the composite and forming the lubricious coating 60 . the thickness of the implanted oxide coating is approximately 0 . 4 - 0 . 5 micrometers . the mixed ions form a gradient of oxides throughout the near surface region ( 0 . 4 - 0 . 5 micrometers ) which allows for the gradual release of the oxide during operation of the wall liner at high operating temperatures . thus a tenacious film is formed on the underlying ceramic composition which is capable of being released and still providing a reservoir of oxide within the wall near surface region . as can be seen in fig3 the composite gradient coating 60 yields metal oxides , such as titanium oxide 70 and nickel oxide 72 , which transfer from wall 18 to seal 12 during operation of the engine ( greatly exaggerated in fig3 ). it is believed that the oxidizing of the implanted coating produces the stable lubricant 54 . with the ionimplanted ceramic composition obtained from the above process , low friction coefficients and high wear resistance at high operating temperatures are obtained . in particular , standard pin ( simulated ring ) - on - disk ( simulated liner ) test results on the implanted materials at 80 ° c ., 5 pounds normal force , and pin - ring relative velocities of 1 m / s , have shown that friction coefficients between 0 . 09 and 0 . 14 are obtained . for these coefficients of friction , pin and disk wear is unmeasurable using profilometry techniques . it has been found that the deposition , implantation , and oxidization of a single layer of cobalt ions using the above discussed procedures yields significantly reduced friction coefficients at operating temperatures from 800 ° c .- 1200 ° c . and above . while it has been shown , described and pointed out the fundamental novel features of the invention as applied to a preferred embodiment thereof , it will be understood that various omissions , substitutions and changes in the form and details of the device illustrated and in its operation may be made by those skilled in the art without departing from the spirit of the invention . it is the intention , therefore , to be limited only as indicated by the scope of the claims appended hereto .	2
the invention is based on the appropriate definition of regions of interest ( rois ), as will be explained briefly with reference to fig2 . in a 2 - d x - ray or angiography image 11 containing blood vessels 12 for example , what is understood quite generally by an roi is a user - defined section of the angiography image 11 . as a result of the preceding subtraction of the mask image in the case of dsa sequences the sum of the grayscale values of all pixels lying within the roi in each individual image of the sequence is directly proportional to the mass of the contrast agent that is contained in the 3 - d volume segment v roi defined by the roi . since no depth information at all is in fact contained in a 2 - d x - ray image 11 , present approaches consequently always acquire the 3 - d volume segment v roi which is “ excised ” by the roi defined in 2 - d and which extends over the entire object depth . it is important for the application of the approaches proposed here that an angulation of the angiography system is chosen which has the fewest possible overlays of the tissue region that is to be examined by blood vessels 12 lying spatially in front of or behind said tissue region . the greater the number of such overlays occurring , the more inaccurate will be the estimation of the relative perfusion parameters . defining suitable rois — either for the purpose of before / after comparisons ( e . g . in the case of tumor embolizations ) or for the purpose of left / right comparisons either in the brain or in paired organs such as the kidneys for example — enables results to be computed in relation to the mass ratio of the contrast agent associated with the respective time instant ( in left / right comparisons ) or with the respective two time instants ( in before / after comparisons ) ( and hence of the blood , provided an ideal mixture of blood and contrast agent is assumed ) within the volume segments v roi defined by the rois . meaningful determinations of the relative blood volume naturally demand here that in the case of before / after comparisons the acquisition parameters , such as in particular the angulation of the c - arm and the zoom factor used for example , and the injection protocol remain constant . any changes to the exposure parameters resulting from the automatic dose regulation by the angiography system must be calculated out of the image sequences accordingly in order to allow a meaningful comparison . in the case of left / right comparisons it is of course likewise necessary to choose a suitable injection protocol which prefers no half of the body per se . typically a stationary state is required for determining the blood volume in a tissue region . according to the theory ( see equation ( 5 ) in konstas et al .) the blood volume v in a volume segment can in fact also be calculated from dynamic data as follows : c tissue ( t ) denotes the average contrast agent concentration in the tissue region under examination , while c artery ( t ) denotes the sum of the average contrast agent concentrations in the supplying arteries . in this case the upper integration limit t should be suitably chosen to enable the transported contrast agent bolus to be recorded completely . however , the integration should only include the time in which the contrast agent bolus undertakes a first pass through the tissue so that distortions of the values caused by recirculation of the bolus are avoided . in before / after comparisons with constant injection protocol and constant acquisition parameters as well as in left / right comparisons with appropriately chosen injection protocol it may be assumed for simplicity that the arterial input left and right or , as the case may be , before and after is consistent , such that in the case of before / after comparisons the relation is obtained and in the case of left / right comparisons the analog relation is obtained . it should be noted that a change in the blood flow ( specified in ml / 100 g / min ) in the case of before / after comparisons or a different blood flow left / right in the case of left / right comparisons has no relevance , since the flow has already been eliminated in the course of the derivation of equation ( 1 ). equation ( 1 ) henceforth includes only the time - dependent contrast agent concentrations . taking into account that the concentration of the contrast agent is proportional to the mass of the contrast agent ( concentration = mass / volume ), and assuming that the volume segments being examined are present with at least approximately the same size ( both in before / after and in left / right comparisons ), the proportionality constants ( 1 / volume ) are omitted in the above formulae and the corresponding relative blood volumes can be expressed by means of the contrast agent masses . as already mentioned further above , the contrast agent masses are in turn proportional to the sums of the grayscale values of all pixels lying within the rois ( in each individual image of the sequence ). in the two previous formulae , therefore , the time integrals are placed over the roi - specific time / contrast curves in the numerator and in the denominator in each case . the general case of the calculation of the change in relative blood volume is explained in more detail with reference to fig3 to 6 . for the purpose of determining relative perfusion data according to the invention a perfusion measurement device 10 is provided in the system control unit 7 , as shown in fig1 . as output of the calculated perfusion data this also effects an insertion for example as a numeric value characteristic of the roi into the image on a display of the traffic - light monitor array 9 . fig3 shows a first time / contrast curve 13 i / t before the treatment and fig4 shows a second time / contrast curve 14 i / t after the treatment . the area auc ( area under the curve ) under the overall curves 13 and 14 is formed by the time integrals . their ratio expresses a change in relative blood volume . in order to calculate the change in relative blood volume the areas under the overall curves 13 and 14 can now be put into the ratio auc after / auc before . for simplicity the calculation of the integrals according to the examples explained with reference to fig3 and 4 can be dispensed with here and in each case the maximum of the associated time / contrast curve can be used instead , as is shown with reference to fig5 and 6 ( in this regard see also fig2 in konstas et al . “ theoretic basis and technical implementations of ct perfusion in acute ischemic stroke , part 1 : theoretic basis ”, ajnr am . j . neuroradiol . 30 , 2009 , pages 662 to 668 ). this simplification is based on the assumption that there are plateau - like maxima of the time / contrast curves at which a saturated state of the contrast agent concentration can be assumed . the advantage of this simplification consists in the fact that it is not necessary to integrate over a relatively long time period and therefore overlay effects caused by the contrast agent flow in draining veins , which could of course also be visible in the projection image , are avoided . however , this simplifying estimation of the relative blood volume requires a greater amount of contrast agent to be administered in order to achieve the stationary state , which is not always desirable or feasible . according to the invention the calculation can now be simplified in that , as shown in fig5 and 6 , the slopes 15 and the maxima 16 of the first simplified time / contrast curve before the treatment and the second simplified time / contrast curve after the treatment are assumed to be straight lines . the maximum intensity 17 i max , v before the treatment and the maximum intensity 18 i max , n after the treatment can then be ascertained in a simple manner . in order to calculate the simplified change in relative blood volume the two maximum intensities are now put into the ratio i max , after / i max , before . in the case of a tumor embolization the tumor can be characterized in the two dsa sequences ( pre - and post - treatment ( before / after )) by means of an roi in each case and then the ratio of the time integrals over the two time / contrast curves determined . according to the above consideration their quotient represents the ratio of the blood volumes before and after the intervention . ideally , no more contrast agent at all accumulates in the tumor after the embolization , thus yielding the ratio v after / v before ˜ 0 as result . as already mentioned , a suitable angulation must be chosen for an examination of said type to ensure that no large blood vessels run through the volume segment defined by means of the roi , since these would distort the result . the relative blood flow can be determined in a comparable way to the determining of the relative blood volume . in this case the so - called “ maximum slope method ” can be used , see equation ( 10 ) in konstas et al . in spite of simplifying assumptions this method is also employed in ct for the purpose of measuring the blood flow . this method provides a simple computing rule for determining the flow f which is assumed as constant over time : here , m ( t ) denotes the mass of contrast agent contained in the tissue volume under examination at the time instant t , and c artery ( t ) denotes the contrast agent concentration in the supplying artery at the time instant t . for the sake of simplicity it is assumed that no venous outflow takes place during the examination time period and that precisely one artery supplies the examined tissue volume . according to this relation the flow f can therefore be determined by dividing the maximum rise of the mass of contrast agent in the tissue by the maximum contrast agent concentration in the supplying artery . the general case of the calculation of the change in relative blood flow is explained in more detail with reference to fig7 and 8 . in this case fig7 shows a first time / contrast curve 19 before the treatment . a first maximum slope 20 is applied to the ascending branch of said first time / contrast curve 19 . fig8 shows a second time / contrast curve 21 after the treatment , to the ascending branch of which a second maximum slope 22 is applied . as also in the case of the determining of the relative blood volume from 2 - d angiography data , suitable rois should be defined in 2 - d at a suitable angulation of the c - arm , which rois then again characterize 3 - d volume segments that extend over the entire object depth . on the assumption that the arterial inflow left / right or before / after is the same , the relative blood flow can be approximated as follows in the case of left / right comparisons according to the formula this means that — owing to the direct proportionality of contrast agent mass and the attenuation along the x - ray beams — the quotients from the maximum slopes 20 and 22 of the time / contrast curves 19 and 21 must be formed in order to obtain the corresponding estimations of the relative blood flow . thus , as was already the case in the determining of the relative blood volumes , the “ trick ” consists in determining the relative flows ( left / right and / or after / before ), since then the proportionality constants , which are not known due to the absence of depth information , are omitted from the formation of the quotients . the simplified case of the calculation of the change in relative blood flow is explained in more detail below with reference to fig9 and 10 . instead of the maximum slopes 20 and 22 that were explained with reference to fig7 and 8 , alternative parameters for determining blood flow can also be chosen if a specific model of the time / contrast curves i / t is assumed for simplicity . in this simplified model it is assumed that a first time / contrast curve 23 rises linearly until saturation is reached , as revealed in fig9 and 10 . it is easy to show that the slope 24 of the first simplified time / contrast curve 23 in this rise phase is proportional to two other parameters . the first parameter is the intensity value i ′ v at a time instant t ′, which must chosen such that it lies before the maximum contrast is reached . the second parameter is the first integral 25 ( area under the curve ( auc )) of the first time / contrast curve 23 up to the time instant t ′. the same also applies to the after case shown in fig1 , in which a linear rise of a second simplified time / contrast curve 26 until saturation is reached is likewise assumed . here too it holds that the slope 27 of the second simplified time / contrast curve 26 in this rise phase is proportional to the intensity value i ′ n at the time instant t ′. the second integral 28 of the second simplified time / contrast curve 26 up to the time instant t ′ can also be drawn upon again here as the second parameter . since these two parameters are proportional to the maximum slope , they can likewise be used for calculating the relative flow by formation of the quotients of the values before and after a treatment ( or , of course , also referred to a left / right comparison ). the change in relative blood flow can therefore be calculated in a simplified manner as follows : where m is the maximum slope and auc is the area under the time / contrast curve i / t . it is important to bear in mind that this simplifying assumption of a linear rise together with the associated simplified estimation of the relative blood flow has nothing to do with the above - explained assumption of a stationary state which leads to a simplified estimation of the relative blood volume . the invention relates to an imaging method for calculating and deriving relative perfusion data , such as blood volume or blood flow for example , from 2 - d angiography data , for example 2 - d dsa sequences . to clarify : per se this perfusion data represents absolute values ( e . g . where ct perfusion is concerned ). in the case of a 2 - d image series this restriction to relative perfusion data must be applied , since no depth information at all is available . by waiving the requirement for absolute data and considering relative data by quotient formation it is possible to dispense with the depth information , which , of course , is not contained in the 2 - d image sequences . put more precisely , this dispenses with knowledge of the proportionality constant which relates the mass of the contrast agent along an x - ray beam to the concentration of the contrast agent along said x - ray beam .	0
all patents , patent applications , government publications , government regulations , and literature references cited in this specification are hereby incorporated herein by reference in their entirety . in case of conflict , the present description , including definitions , will control . thermotoga neapolitana xylose isomerase is described in u . s . pat . no . 7 , 198 , 933 to zeikus et al . hereby incorporated herein by reference in its entirety . thermotoga neapolitana xylose isomerase containing mutations v186t , l283p , and f187s is described in the &# 39 ; 933 patent . the strains thermotoga maritima dsm 3109 , the strains thermotoga elfii dsm 9442 and atcc 51869 , and the strains thermotoga neapolitana dsm 4359 and atcc 49049 are described in u . s . patent no . 5 , 935 , 837 to rasmussen hereby incorporated herein by reference in its entirety . rasmussen teaches thermotoga maritima xylose isomerase , useful for the electrochemical bioreactor system of the present invention . xylose isomerase also known as glucose isomerase is well known to those skilled in the art . the present invention provides a gene encoding thermostable mannitol dehydrogenase from thermotoga maritima and use of the enzyme in a bioreactor system to produce mannitol from glucose . the present invention replaces the current synthetic mannitol production process by the use of an enzyme catalyzed process . for this purpose , a thermostable mannitol dehydrogenase has been cloned and characterized which is used to produce mannitol from fructose or , from glucose in a bioelectrochemical reactor . used alone , this enzyme is able to produce mannitol from a fructose syrup . used in combination with a thermostable xylose isomerase ( glucose isomerase ), this enzyme would be able to produce mannitol directly from a glucose syrup . the t . maritima mannitol dehydrogenase gene was obtained by dna amplification using t . maritima ( msb8 ) genomic dna as the template and oligonucleotides 5 ′- cg catatg aaagtacttttgatag - 3 ′ ( where catatg creates an ndei site ) ( seq id no . 3 ) and 5 ′- ct ctcgag agaaaaaattcccttcatc - 3 ′ ( where ctcgag creates a xhol site ) ( seq id no . 4 ) as the primers . the pcr product has cloned into the ndel and xhol sites of pet24 ( a )+( novagen ) and transformed into escherichia coli bl21 ( de3 ) for protein expression . in this construct , the recombinant t . maritima mannitol dehydrogenase was expressed as a fusion protein with a c - terminal ( his ) 6 tag . the recombinant t . maritima mannitol dehydrogenase was routinely over expressed in e . coli by growing cultures in sb medium and inducing with iptg ( 0 . 6 mm ) when od 600 reaches 1 . 4 . expression was induced for sixteen ( 16 ) hours . after resuspension in 50 mm tris - hcl ph 8 . 5 containing 10 mm β - mercaptoethanol ( buffer a ), the bacteria were lysed using a french pressure cell , the crude extract was centrifuged for 40 min . at 25 , 000 × g , the supernatant was heat treated at 85 ° c . for 20 min . to denature most e . coli proteins , the heat - treated extract was centrifuged for 20 min . at 20 , 000 × g , and the supernatant was finally purified on a ni - nta affinity column . the recombinant t . maritima mannitol dehydrogenase expression and purification systems are currently acceptable for routine bench - top scale preparations , biochemical characterization , and testing in prototype bioelectrochemical reactors . activity levels on fructose as the substrate and with nadh as the cofactor can be increased by mutagenesis to make this enzyme even more performing for industrial mannitol production . in particular , the affinity for fructose relative to mannitol can be increased . since the three - dimensional structure of mannitol dehydrogenase is unknown , random mutagenesis can be used followed by screening for activity at room temperature to select for t . maritima mannitol dehydrogenase derivatives with increased activity levels . it is possible to convert 100 % fructose into 100 % mannitol using an immobilized enzyme system , as it is done today for fructose syrup ( 42 %) production in an immobilized glucose isomerase reactor . fructose is more expensive than glucose , though , and it is produced directly from glucose . since a large selection of thermostable glucose isomerases is available , one can also produce the mannitol dehydrogenase bioreactor . such a system with the robust thermostable mannitol dehydrogenase can be used with the pyrimidine nucleotide cofactor which can be easily recycled . by using electrochemical recycling , glucose can be converted stoichiometrically into mannitol in a single electrochemical reactor system at 60 ° c . containing both immobilized thermostable mannitol dehydrogenase ( mtdh ) and glucose isomerase . an nad - dependent thermostable mannitol dehydrogenase was cloned . t . maritima mannitol dehydrogenase is increasingly active up to 90 ° c . the enzyme shows four times higher affinity for nadh than for nadph . the optimum ph for fructose reduction is 6 . 0 and the optimum ph for mannitol oxidation is 8 . 3 . when co - immobilized on an electrochemical reactor &# 39 ; s electrode , this enzyme and a thermostable xylose isomerase are able to produce mannitol directly from glucose when the cofactor is recycled using electrons provided by an electrical current . while the present invention is described herein with reference to illustrated embodiments , it should be understood that the invention is not limited hereto . those having ordinary skill in the art and access to the teachings herein will recognize additional modifications and embodiments within the scope thereof . therefore , the present invention is limited only by the claims attached herein .	2
with reference to fig1 , a flat card , for example a tc 03 ( trademark ) flat card made by trützschler gmbh & amp ; co . kg of mönchengladbach , germany , has a feed roller 1 , feed table 2 , lickers - in 3 a , 3 b , 3 c , cylinder 4 , doffer 5 , stripper roller 6 , nip rollers 7 , 8 , web - guiding element 9 , web funnel 10 , draw - off rollers 11 , 12 , revolving card top 13 having card - top - deflecting rollers 13 a , 13 b and card top bars 14 , can 15 and can coiler 16 . curved arrows denote the directions of rotation of the rollers . reference letter m denotes the centre ( axis ) of the cylinder 4 . reference numeral 4 a denotes the clothing and reference numeral 4 b denotes the direction of rotation of the cylinder 4 . reference letter b denotes the direction of rotation of the revolving card top 13 at the carding location and reference letter c denotes the direction in which the card top bars 14 are moved on the reverse side . reference numerals 23 ′, 23 ″ denote stationary carding elements and reference numeral 39 denotes a cover underneath the cylinder 4 . arrow a denotes the work direction . referring to fig2 , on each side of the flat card , a flexible bend 17 having several adjustment screws is fixed laterally to the side screen 19 a , 19 b ( see fig4 ). the flexible bend 17 has a convex outer surface 17 a and an underside 17 b . on top of the flexible bend 17 there is a slideway 20 , for example made of low - friction plastics material , which has a convex outer surface 20 a and a concave inner surface 20 b . the concave inner surface 20 b rests on top of the convex outer surface 17 a and is able to slide thereon in the direction of arrows d , e . each card top bar 14 consists of a rear part 14 a and a carrying member 14 b . each card top bar 14 has , at each of its two ends , a card top head , each of which comprises two steel pins 14 1 , 14 2 . those portions of the steel pins 14 1 , 14 2 that extend out beyond the end faces of the carrying member 14 b slide on the convex outer surface 20 a of the slideway 20 in the direction of the arrow b . a clothing 18 is attached to the underside of the carrying member 14 b . reference numeral 21 denotes the circle of tips of the card top clothings 18 . the cylinder 4 has on its circumference a cylinder clothing 4 a , for example a sawtooth clothing . reference numeral 22 denotes the circle of the tips of the cylinder clothing 4 a . the spacing ( carding nip ) between the circle of tips 21 and the circle of tips 22 is denoted by reference letter a and is , for example , 3 / 1000 ″. the spacing between the convex outer surface 20 a and the circle of tips 22 is denoted by reference letter b . the spacing between the convex outer surface 20 a and the circle of tips 21 is denoted by reference letter c . the radius of the convex outer surface 20 a is denoted by reference letter r 1 and the radius of the circle of tips 22 is denoted by reference letter r 2 . the radii r 1 and r 2 intersect at the centre point m of the cylinder 4 . reference numeral 19 denotes the side screen . the high - speed roller shown in fig3 a , 3 b for a fibre - processing machine , for example a cylinder 4 of a flat card , consists of a hollow cylindrical roller body 30 and two roller ends 31 a , 31 b at the end faces . the roller ends 31 a , 31 b advantageously are made of metal , for example steel or aluminium . reference numeral 32 denotes a spoke , reference numeral 33 a hub and reference numeral 34 an end flange . the roller body 30 consists of an internal steel cylinder 35 and an external hardened cfrp sheath 36 . the cfrp sheath 36 has the shape of a thin - walled hollow cylinder . at operating temperature , in the biased state , compressive stresses are present in the circumferential direction in the wall region of the steel cylinder 35 and tensile stresses in the cylindrical cfrp sheath 36 . in use , because of the centrifugal force to which the steel cylinder 35 is subjected , the compressive stresses are reduced . the thermal expansion coefficient of the cylinder material is much greater than the thermal expansion coefficient of the carbon fibre reinforced plastics material in the direction of the reinforcement fibres ; for example , the thermal expansion coefficient α of steel is between 11 × 10 − 6 k − 1 and 17 × 10 − 6 k − 1 and that of cfrp in the fibre direction is about zero , especially between − 2 × 10 − 6 k − 1 and + 2 × 10 − 6 k − 1 . when subjected to heat in use , the internal diameter of the cfrp sheath 36 changes only very slightly , whereas the thermal expansion of the steel cylinder 35 is considerable . the thermal expansion of the cfrp - sheathed steel cylinder 35 is consequently less than the thermal expansion of a cylinder having an all - steel wall . the roller according to the invention , comprising a metal cylinder and a composite fibre sheath , especially a substantially circular cylindrical sheath , is lighter in comparison to an all - steel or all - aluminium roller , has a reduced mass inertia and exhibits linear thermal expansion which is adjustable ( down to negative values ) as a result of constructively arranged fibre orientation . the advantages of the roller according to the invention in use , which result from the properties of the material , are , for example , substantially improved braking values , savings in terms of drive units , energy savings , higher production rates , wider working widths and vibration - free running . the table that follows lists the density , modulus of elasticity and strength of the materials in comparison with one another : in the direction of the fibres , cfrp has considerable advantages compared to steel . the individual fibres made up into a tube in the course of a winding process determine the anisotropic ( directionally dependent ) behaviour of such a tube . fig4 shows part of the cylinder 4 together with the cylindrical surface 4 f of its wall 4 e and the cylinder ends 4 c , 4 d ( radial supporting elements ). the surface 4 f is provided with a clothing 4 a , which in this example is provided in the form of wire with sawteeth . the sawtooth wire is drawn onto the cylinder 4 , that is to say is wound around the cylinder 4 in tightly adjacent turns between side flanges ( not shown ), in order to form a cylindrical work surface provided with tips . fibres should be processed as evenly as possible on the work surface ( clothing ). the carding work is performed between the clothings 18 and 4 a located opposite one another and is substantially influenced by the position of one clothing with respect to the other and by the clothing spacing a between the tips of the teeth of the two clothings 18 and 4 a . the working width of the cylinder 4 is a determining factor for all other work elements of the flat card , especially for the revolving card tops 14 or stationary card tops 23 ′, 23 ″ ( fig1 ), which together with the cylinder 4 card the fibres evenly over the entire working width . in order to be able to perform even carding work over the entire working width , the settings of the work elements ( including those of additional elements ) must be maintained over that working width . the cylinder 4 itself can , however , be deformed as a result of the drawing - on of the clothing wire , as a result of centrifugal force or as a result of heat produced by the carding process . the shaft 25 of the cylinder 4 is mounted in positions ( not shown ) located on the stationary machine frame 24 a , 24 b . the diameter , for example 1250 mm , of the cylindrical surface 4 f , that is to say twice the radius r 3 , is an important dimension of the machine and becomes larger in use as a result of the heat of work . the side screens 19 a , 19 b are fastened to the two machine frames 24 a and 24 b , respectively . the flexible bends 17 a and 17 b are fastened to the side screens 19 a and 19 b , respectively . when heat is produced in use in the carding nip a between the clothings 18 ( or in the carding nip d between the clothings 23 ′) and the cylinder clothing 4 a as a result of carding work , especially in the case of a high production rate and / or the processing of synthetic fibres or of cotton / synthetic fibre blends , the cylinder wall 4 e undergoes expansion , that is to say the radius r 3 increases and the carding nip a decreases . the heat is directed via the cylinder wall 4 e into the radial carrying elements , the cylinder ends 4 c and 4 d . the cylinder ends 4 c , 4 d likewise undergo expansion as a result thereof , that is to say the radius increases . the cylinder 4 is almost entirely encased ( enclosed ) on all sides - in a radial direction by the elements 14 , 23 ′, 37 ( see fig1 and fig5 a ) and to the two sides of the flat card by the elements 17 a , 17 b , 19 a , 19 b , 24 a , 24 b . as a result , scarcely any heat is radiated from the cylinder 4 to the outside ( to the atmosphere ). nevertheless , the heat of the cylinder ends 4 c , 4 d of large surface area is especially conveyed by means of radiation to the side screens 19 a , 19 b of large surface area to a considerable extent , from where the heat is radiated out to the colder atmosphere . as a result of that radiation , the expansion of the side screens 19 a , 19 b is less than that of the cylinder ends 4 c , 4 d , which results in a reduction in the carding nip a ( fig2 a ) that ranges from undesirable ( in terms of the result of carding ) to hazardous . the carding elements ( card top bars 14 ) are mounted on the flexible bends 17 a , 17 b and the fixed carding - elements 23 ′, 23 ″ are mounted on the extension bends , which are in turn fixed to the side screens 19 a , 19 b . in the event of heating , for example in the case of a cylinder 4 of steel and aluminium card top bases 14 , the lifting of the flexible bends 17 a , 17 b - and , as a result , of the clothings 18 of the card top bars 14 - increases less , compared to the expansion of the radius r 3 of the cylinder wall 4 e - and , as a result , of the clothing 4 a of the cylinder 4 -, which results in narrowing of the carding nip a . the cylinder wall 4 e and the cylinder ends 4 c , 4 d are made of steel , for example st 37 , having a linear thermal expansion coefficient of 11 . 5 × 10 − 6 [ 1 /° k .]. in order then to compensate for the relative differences in the expansion of the cylinder ends 4 c , 4 d and the cylinder wall 4 e , on the one hand , and the side screens 19 a , 19 b , on the other hand ( as a result of impeded radiation into the atmosphere because of encasing of the cylinder 4 and free radiation into the atmosphere from the side screens ), the sheath 36 is made of carbon fibre reinforced plastics material ( cfrp ) whose thermal expansion coefficient has been negatively adjusted . by that means , the expansion of the cylinder 4 due to a lack of removal of heat as a result of encasing is reduced or avoided . as a result , undesirable reduction in the carding nip a due to thermal influences is avoided . the biasing method is shown in diagrammatic form in fig5 a , 5 b . the steel cylinder body 35 and the hardened cfrp sheath 36 are shown in these figures in simplified form as hollow cylinders . at room temperature , in accordance with fig5 a , the external diameter of the steel cylinder body 35 is larger than the internal diameter of the hardened cfrp sheath 36 . the excess dimension 37 is calculated on the basis of the desired biasing force in the steel cylinder body 35 and the joining gap 38 required for joining in accordance with fig5 b . from those two variables and the thermal expansion coefficients of the steel cylinder body 35 and the cfrp sheath 36 there is derived the temperature difference necessary for biasing . fig5 b shows the geometric relationships in the cooled state , which corresponds to the joining state . the joining gap 38 must be so dimensioned that the two parts 35 and 36 can be readily inserted one inside the other . the joining temperature is lower than room temperature . after joining , the two parts 35 and 36 are slowly reheated , whereupon the desired biasing takes place . fig3 a shows a roller at room temperature or operating temperature , which can be biased , for example , in accordance with fig5 a , 5 b . in accordance with fig6 , the pitches of the helical windings of the fibres ( 36 1 , see fig7 ) in the inner sheath 36 a and in the outer sheath 36 b are different . the pitch is shown in diagrammatic form by a winding angle of α 1 and α 2 ( see fig7 ). the winding angle of the inner sheath 36 a is small and is , for example , 85 °. the resistance of the cylinder 4 to radial widening under the action of heat and centrifugal force is dependent upon the arrangement of the fibres : the smaller the angle , the higher the resistance . the winding angle of the outer sheath 36 is large and is , for example , 10 °. the resistance of the cylinder 4 to sagging is likewise dependent on the arrangement of the fibres : the larger the angle , the lower the amount of sagging . the rollers of roller cards 51 and of roller card feeders 50 ( fig9 ) can have a length of 5 to 6 m , which requires a low degree of sagging . the combination of winding angles according to fig6 brings about a high degree of resistance both to widening and also to sagging . the affangement according to fig7 is advantageous when different properties are required for the roller in the edge regions , on the one hand , and in the middle region , on the other hand . the winding angle is accordingly steeper in the edge regions 36 ′ and 36 ′″ than in the middle region 36 ″. a single layer sheath having three regions arranged next to one another is shown . in accordance with fig8 , the fibre material ( arrow ) to be cleaned , which is especially cotton , is supplied in flock form to the cleaning apparatus arranged in an enclosed housing , for example a cl - c4 cleaning apparatus made by trützschler gmbh & amp ; co . kg . this is accomplished , for example , by a charging shaft ( not shown ), conveyor belt or the like . the material in wad form is supplied by two feed rollers 41 a , 41 b , with nipping therebetween , to a pin roller 42 , which is rotatably mounted in the housing and which revolves in an anti - clockwise direction ( arrow i ). downstream of the pin roller 42 is a clothed roller 43 , which is provided with a sawtooth clothing . the roller 42 has a circumferential speed of about 10 to 21 m / sec . the roller 43 has a circumferential speed of about 15 to 25 m / sec . the roller 44 has a circumferential speed greater than that of the roller 43 , and the roller 45 has a circumferential speed greater than that of the roller 44 . downstream of the roller 42 there is a succession of further sawtooth rollers 43 , 44 and 45 , the directions of rotation of which are indicated by reference numerals ii , iii and iv . the rollers 42 and 45 have a diameter of about from 150 to 300 mm . the rollers 42 to 45 are enclosed by the housing . associated with the sawtooth roller 45 are a stationary carding element , an adjustment guiding element , an air flow aperture , a separating blade and a pressure - measuring element . associated with the separating blade is a suction hood . reference letter a denotes the working direction of the cleaner . the rollers according to the invention comprising a metal cylinder 35 and a circular cylindrical sheath 36 surrounding the cylinder are used for at least one of rollers 42 to 45 . the cleaner can be constructed , for example , in accordance with de - a - 101 22 459 . in accordance with fig9 , a vertical reserve shaft 52 is provided upstream of a roller card 51 , which shaft is fed from the top with finely dispersed fibre material i . feeding can be accomplished , for example , by means of supply and distribution line 53 by way of a condenser . provided in the upper region of the reserve shaft 52 are air outlet apertures 54 , through which the transporting air ii passes into a venting device 55 after separation from the fibre flocks iii . the lower end of the reserve shaft 52 is closed by a feed roller 56 ( intake roller ), which co - operates with a feed trough 57 . the slow - speed feed roller 56 supplies the fibre material iii from the reserve shaft 52 to a high - speed opener roller 58 located below , which is provided with pins 58 b or sawtooth wire and is in communication at part of its circumference with a lower feed shaft 59 . the opener roller 58 , which revolves in the direction of arrow 58 a , conveys the fibre material iii that it picks up into the feed shaft 59 . the feed shaft 59 has , at its lower end , a take - off roller 60 , which revolves according to the arrow shown and which makes the fibre material available to the roller card 51 . this roller card feeder 50 can be , for example , a scanfeed tf 5000 roller card feeder from the company trützschler , mönchengladbach . the feed roller 56 rotates slowly in clockwise direction ( arrow 56 a ) and the opener roller 58 rotates at high speed in anti - clockwise direction ( arrow 58 b ) so that a contrary direction of rotation is brought about . by means of the revolving feed roller 56 and the revolving opener roller 58 , a specific amount of fibre material iii is continously conveyed per unit time into the feed shaft 59 and an equal amount of fibre material iv is conveyed out from the feed shaft 59 by the take - off roller 60 together with a feed trough 61 and is made available to the roller card 51 . the feed device of the roller card 51 , comprising the feed roller 60 and feed trough 61 , is the same as the take - off device 60 , 61 at the lower end of the feed shaft 59 . the feed roller 60 and the feed troughs 61 are followed in the work direction a of the roller card 51 by a first preliminary roller 62 , a second preliminary roller 63 , a preliminary cylinder 64 ( licker - in ), a transfer roller 65 , a main cylinder 66 , a doffer 67 and , as roller offtake , a stripper roller 68 . associated with the preliminary cylinder 64 ( licker - in ) and the main cylinder 66 are two and six , respectively , pairs of rollers , each pair consisting of a worker 71 and clearer 72 . downstream of the stripper roller 68 , immediately adjacent thereto and cooperating therewith , are two calendar rollers 73 , 74 . the directions of rotation of the rollers are indicated by curved arrows . the roller card 51 can , like the roller card feeder 50 arranged upstream thereof , have a width of , for example , 5 m or more . the rollers according to the invention comprising a metal cylinder 35 and a circular cylindrical sheath 36 surrounding the cylinder are used for at least one of rollers 56 and 58 of the roller card feeder 50 and rollers 60 to 74 of the roller card 51 . the flat card feeder 47 shown in fig1 substantially corresponds , in terms of construction and function , to the roller card feeder 50 according to fig9 . the flat card feeder 47 , like the flat card ( fig1 ), often has a width of 1 m to 1 . 5 m . the rollers according to the invention are used as rollers for at least one of the intake roller 48 and the high - speed opener roller 49 . the metal cylinder of the opener rollers 49 ( fig1 ) and 59 ( fig9 ) can be made of aluminium . although the foregoing invention has been described in detail by way of illustration and example for purposes of understanding , it will be obvious that changes and modifications may be practiced within the scope of the appended claims .	5
in the following description of various illustrative embodiments , reference is made to the accompanying drawings , which form a part hereof , and in which is shown , by way of illustration , various embodiments in which the invention may be practiced . it is to be understood that other embodiments may be utilized and structural and functional modifications may be made without departing from the scope of the present invention . fig1 illustrates a wind turbine 2 on a foundation 4 with a tower 6 supporting a nacelle 8 . one or more blades 10 are attached to a hub 12 via a bolt flange 14 . the hub 12 is connected to a drive train ( not shown ) within the nacelle 8 . the blades 10 may be variable length blades having a root portion 16 and a tip portion 18 . variable length blades may be configured to extend and retract given certain conditions . various modes for controlling a variable length blade may be used to optimize or otherwise increase the effectiveness of such blades and / or a turbine such as wind turbine 2 to which the blades are attached . fig2 illustrates a control mode for a wind turbine 200 having extendable rotor blades 205 that allow a turbine rotor to rotate without engaging drive train motors ( not shown ) and / or without any wind . to achieve such an effect , blades 205 a and 205 b on a first side of the rotor are extended while blade 205 c on a second side is retracted , thereby causing a slow rotation of the rotor . the first and second sides may be defined by an axis intersecting a center of the rotor . for example , in the configuration illustrated in fig2 , a vertical axis 210 is used to define a first side ( including blades 205 a and 205 b ) and a second side ( including blade 205 c ). other axes may be defined and used in controlling the extension and retraction of the rotor blades . although turbine 200 is illustrated as having a counter clockwise rotation , as indicated by arrow x , turbine 200 may also be configured to rotate clockwise . such a control mode may be useful in giving the appearance of an operating wind turbine when there is no wind . even more useful is using this rotation to clean the blades or to remove ice with minimal expenditure of energy and without requiring wind . rotation without wind can also lubricate and keep drive train components warm without using heaters or pumps . fig3 a and 3 b illustrate the clockwise rotation of extendable rotor blades 205 , between a first position and a second position . in the first position as illustrated in fig3 a , blade 205 a is oriented to the right side of the vertical axis 210 . in this position , the blade 205 a is extended and blades 205 b and 205 c are retracted . this causes a moment about the rotor axis 220 , due to the larger overhung weight of the extended blade 205 a , which imparts clockwise rotation to the rotor . in the second position , as illustrated in fig3 b , blade 205 a has rotated 180 degrees clockwise from the beginning position of fig3 a , and is now shown in a shortened length . the following blade 205 c is extended , continuing to impart a clockwise turning moment about the turbine axis 220 . in general , as blades 205 pass the vertical axis 210 , they are lengthened on the right side , and shortened on the left side of fig3 a and 3 b to create a clockwise rotation about the turbine axis 220 due to the differences in overhung weights of the blades 205 . fig3 c represents a position intermediate between the positions shown in fig3 a and 3 b . in this position it can be seen that blade 205 a has begun to be shortened , while the following blade 205 c , having passed the vertical axis 210 , is beginning to lengthen . this illustrates the concept that blades are moved between a shortest length , as depicted by blade 205 c in fig3 a , to a longest length , depicted by blade 205 c in fig3 b , passing through an intermediate length as depicted by blade 205 c in fig3 c . the maximum and minimum lengths are not necessarily defined as the maximum extendable length and the minimum retractable length , respectively . the maximum and minimum lengths may be defined as any length depending on various factors such as a speed of rotation desired , mass of a rotor blade 205 , the speed of extension and retraction of a rotor blade 205 , and the like . similar controls may be used for counterclockwise rotation of the rotor blades 205 . fig4 a and 4 b illustrate a cleaning method using an extension and retraction control mode as described above . fig4 a and 4 b illustrate an extendable portion 410 of blade 405 retracting into a root portion 415 of blade 405 . for example , during auto - rotation as described above , extendable portion 410 may be retracted as blade 405 is rotated . as extendable portion 410 is retracted , a cleaning element 425 of root portion 415 may scrape or dislodge debris 430 from the surface of extendable portion 410 , as shown in fig4 b . thus , if blade 405 has had ice accumulate while the blade 405 was extended , for example , this control mode may be employed to remove the undesired particles . cleaning element 425 may be inwardly biased ( i . e ., toward the extendable portion ) so that contact between cleaning element 425 and extendable portion 410 is maintained throughout retraction and extension . because blade 405 may be oriented downward ( i . e ., towards the ground ) during retraction , scraped or dislodged ice , bits of dirt or cleaning solution will fall away from the turbine ( i . e ., instead of falling on or toward the rotor , another blade or other portion of the turbine ). in this manner , water ice or debris does not sully or damage the exterior or interior surfaces of the turbine blades ( e . g ., blade 405 ). in one or more arrangements , the control mode may also be used with ice scrapers , ice melters , or cleaning brushes and solution mounted at the outward end of the root blade section to further enhance cleaning efficacy and efficiency . in addition to cleaning and providing self - rotation , various control modes may also be used to improve the performance of and reduce potential damage to turbines . for example , instead of or in addition to measuring power output and evaluating loads , other blade and turbine factors may be analyzed including turbulence , harmonic resonance , vibration , electrical current , market prices , wind speed , wind turbulence , mechanical attributes at the transition area between the inner and outer blades , and the like . the use of these additional or alternative control factors may increase turbine performance and reduce risks of damage . in one example , monitoring market prices and controlling extendable rotor blades based thereon may boost profits or minimize costs ( as described in detail below ). as discussed , measurements of turbulence can be used to control the length of a rotor blade . turbulence is generally defined by the formula i = a / u avg , where “ i ” corresponds to turbulence intensity , “ a ” corresponds to the standard deviation of wind speed variations about the mean wind speed and “ u avg ” corresponds to the mean wind speed , ( e . g ., taken over a 10 minute or one hour interval ). thus , analysis of wind data can produce a turbulence intensity value for various types of wind , which gives an indication of how variable the wind is , and how much gusts vary from the average wind speed . during highly turbulent conditions , it may be preferable to have a shorter blade than would otherwise be used to reduce risk of damage to the turbine . while power output ( or other control factors ) may be appropriate for controlling blade length under some conditions , peak loads on a wind turbine during high turbulence may significantly increase the likelihood of damage to the turbine regardless of the average power output . accordingly , a level of turbulence may be factored into the controls analysis to avoid such risks . conversely , if the wind is sufficiently steady ( e . g ., amount or magnitude of turbulence below a predefined level ) it may be possible to keep the blades a little longer to produce more power than would be prudent in less steady conditions . additionally or alternatively , control based on turbulence may also be applied to varying pitch in a variable pitch turbine or speed in a variable speed turbine , irrespective of whether the blades are of variable length . fig5 illustrates a wind turbine 501 having variable length rotor blades 505 , a turbine control system 510 and various sensors 515 such as wind speed sensor 515 a , torque sensor 515 b , rotor speed sensor 515 c , strain sensors 515 d , accelerometers 515 e and 515 f , sound meter 515 g , rotor position sensor 515 i and the like . in some instances , sensors may be located in a transition area 530 of a rotor blade 505 . alternatively or additionally , one or more sensors may be located in an extendable tip portion of rotor blades 505 . for example , in one configuration , all sensors may be placed in the extendable tip portions of rotor blades 505 . data from sensors 515 is sent to control system 510 so that control system 510 may determine appropriate operating characteristics for wind turbine 501 and adjust corresponding components in accordance therewith . for example , wind speed data from wind speed sensors 515 a may be used by control system 510 to determine an amount of turbulence turbine 510 is experiencing . based on the determined turbulence , the control system may adjust the turbine in various manners such as reducing blade length , pitching blades 505 , rotating the turbine 501 and / or combinations thereof to reduce the effects of turbulence or maximize power output . sensors may be connected to control system 510 and / or a power source ( not shown ) via wired , fiber optic , or wireless connections . another control factor of turbine and blade design is avoiding operation at frequencies that cause harmonic resonance with turbine components such as the rotor blades . variable speed turbines have an additional challenge in that varying rotor speeds represent another variable that can cause harmonic vibration . with a variable length blade the resonant frequency of that blade changes with length . this increases the challenge of designing the turbine such that the turbine or a component thereof does not experience harmonic resonance . accordingly , the length of rotor blades may be controlled to avoid harmonic resonance . this can be accomplished using accelerometers to measure vibration or with lookup tables based on a tested machine such that at specific rotational speeds , specific blade lengths are avoided . thus , in one example , the blade length may be extended or retracted upon detecting the turbine speed approaching or meeting a harmonic resonance frequency of a rotor blade at a current length . harmonic resonance occurs when an exciting force coincides in frequency with the natural vibrational frequency of an object . an example of harmonic resonance would be a rotor speed of 20 rpm ( 0 . 33 cycles / sec ) combined with a blade exhibiting an edgewise vibrational frequency of 1 . 33 vibrations / sec . since wind turbine blades exhibit little damping in edgewise vibrations , the blade will tend to have four vibrations for every rotation of the turbine rotor ( e . g ., 1 . 33 is four times 0 . 33 ). at this particular rotor speed , the blade vibration is excited once per revolution , which is once for every four cycles of the blade vibration . the excitation is simply the weight of the blade , which pushes on alternating sides of the blade as it rotates around the hub . since the excitation coincides with the natural frequency of the blade , blade vibrations can rapidly increase to dangerous levels . either changing the rotor speed or the length of the blades will change the frequency ratio to something different than 4 : 1 . if the ratio is not a whole number , the excitation forces will sometimes work in opposition to the natural frequency of the blade , and harmonic vibrations do not occur . since the vibrational modes of a blade can be calculated and verified by testing , it is possible to determine which combinations of speed and length are conducive to producing harmonic resonance . field tests can determine how much the system has to be changed from these harmonic conditions in order to prevent harmonic resonance . those factors can be used in look up tables that allow the controller to avoid dangerous combinations of length and rotor speed . referring again to fig5 , control system 510 may use accelerometer 515 e to measure vibrations in blades 505 or other components of turbine 501 . based on the measured vibrations , control system 510 may detect when harmonic resonance frequencies are being approached and make appropriate adjustments to avoid those frequencies . in one or more arrangements , turbine 501 or control system 510 may include memory that stores lookup tables or other data indicating operating characteristics that would produce harmonic resonance frequencies . the data may include rotational speeds , blade lengths or blade pitches . in one example , a lookup table may indicate that harmonic resonance frequencies would be reached / produced at rotor rotational speeds of 20 rpm and blade lengths of 75 ft . thus , control system 510 may use the lookup table instead of or in addition to using sensor data such as vibration measurements to provide control commands that would prevent the turbine from running at 20 rpm with a blade length of 75 feet to reduce potentially damaging harmonic vibrations . in some instances , as illustrated in fig5 , blades 505 of wind turbine 501 may need to be balanced with one another in order to avoid vibration due to poor balance . since the length of a variable length blade such as blades 505 may be modified at any time and in an individual manner , balancing may be conducted on - site using , for example , an accelerometer 515 f in the nacelle 503 or tower 500 to detect vibration . an accelerometer shows , by the sway of the tower 500 , which blade is heaviest : the heavier blade will ‘ pull ’ the tower 500 towards it during rotation . a shaft encoder , flags and inductive sensors , or other devices such as those used in robotics to create balance , can indicate which blade is in the position to have caused the sway . this blade would then be shortened , or the other blades lengthened until tower sway falls to an acceptable level . in one example , each of blades 505 would be lengthened or shortened slightly until balance was achieved . the process may be repeated for different degrees of extension such as fully retracted , half extended and full extension . once the relative positions of the tips for a balanced rotor are known , the lengths of rotor blades 505 at which balance is achieved may be stored in association with one another and / or with a predefined mode ( e . g ., full extension , half extension , etc .). subsequently , during normal operation of the turbine 501 control system 510 may adjust the length of each blade 505 based on the stored data . in this way , blades 505 do not need to be pre - matched and shipped in sets . instead , blades 505 can be interchanged among turbines without requiring replacement of the entire blade set , thereby making blade replacement simpler and less costly . other sensors that may be used for correcting imbalances may include strain gauges and vibration switches . another control technique for turbines such as turbine 501 is controlling for noise . in particular , turbine 501 may include a sound meter 515 g to detect a level of noise . noise controls may be used to avoid noise violations or complaints in more densely populated or residential areas . for example , during the daytime ( e . g ., between the hours of 9 am - 6 pm ), residents within the area might not be concerned with noise since many may be at work or performing other activities where noise is not an issue . at night , however , when residents may be sleeping or resting ( e . g ., watching television or listening to the radio ), noise may become a significant source of disruption . thus , at night , control system 510 may be used to reduce noise to tolerable levels while during the day , the noise level may be set higher . referring again to fig5 , based on the detected level of noise , control system 510 of turbine 501 may modify various components or characteristics of turbine 501 to adjust the level of noise to within acceptable levels . typical wind turbines have a tip speed of about 150 miles per hour . depending on blade 505 pitch , this speed can produce significant noise . either decreasing tip speed , or changing pitch can reduce noise levels . tip speed is reduced by slowing the rotor 525 or reducing the length of blades 505 . for example , a rotor 525 of turbine 501 can be controlled to adjust speed or blades 505 may be adjusted for pitch , both of which impact noise . additionally , control system 510 may adjust blade length to control the noise level since tip speed is directly related to noise and blade length is directly related to tip speed . for instance , on a constant speed turbine , tip speed increases linearly with blade length . accordingly , noise production may be used as an alternative or additional limiting factor for controlling blade length . instead of or in addition to detecting the level of noise using a sensor , control system 510 may include a database storing predefined noise data . for example , the database may identify certain conditions ( e . g ., blade lengths , vibrations , blade pitches , rotational speed , wind speeds , etc .) that correspond to particular levels of noise . thus , control system 510 may look up the conditions in the database to determine a corresponding level of noise , compare that level to a setpoint , and adjust turbine operations to reduce noise if the setpoint is exceeded . some wind projects have noise level limits as part of their operating permits . these noise level limits may vary over time , such as a requirement to run more quietly at night . controlling pitch , speed or blade 505 length , or any combination thereof , can allow turbines to operate over a wide range of wind speeds while complying with noise requirements . additionally or alternatively , while some current turbine control systems use power output as a control factor , it is also viable to use current as a control factor ( e . g ., for controlling the length of a variable length rotor blade , the pitch of a variable pitch turbine , the speed of a variable speed turbine , or any combination of length , pitch or speed .). because grid voltage does not tend to vary much in most locations , error associated with using current may be tolerable . further , it is current , not power , that determines heat loading of devices . accordingly , heat loading may be monitored and limited using current - based turbine controls . for example , in fig5 , control system 510 of turbine 501 may extend or retract rotor blades 505 , adjust rotor 525 speed , modify blade 505 pitch and the like based on current readings . using controls based on current instead of power output may eliminate the need for voltage transducers and signal processors to calculate power from voltage and current signals . such configurations may thus remove two sources of potential component failure . current may be measured using a variety of devices including current sense integrated circuits , multimeters , power supplies , current transformers , and the like . fig6 is a flowchart illustrating a method for adjusting blade or turbine characteristics based on various control factors . in step 600 , one or more attributes of a wind turbine ( e . g ., turbine 501 of fig5 ) may be determined by a turbine control system such as control system 510 ( fig5 ). the control system may determine attributes such as a level of turbulence , an electrical current , a noise level , vibrations , wind speed , wind turbulence , the presence of external commands from a central control system , and the like . in step 605 , the control system may compare each attribute to a corresponding attribute threshold to determine whether the attribute exceeds the threshold . for example , a level of turbulence may be compared with a turbulence threshold based on potential risk of damage to the turbine . in another example , a level of noise may be compared with predefined noise level thresholds ( e . g ., time - dependent noise levels ) to determine whether the noise is too high at that time . different thresholds may be defined for different operating characteristics such as different blade lengths , different pitches , different rotor rotational speeds , different central control system commands , and / or combinations thereof . continuing with fig6 , if the attribute exceeds the threshold , turbine and / or blade characteristics may be modified or otherwise adjusted to a predefined level or to a degree where the level of the attribute does not exceed the associated threshold in step 610 . the adjustments may include shortening or lengthening an extendable blade , pitching the blades , slowing rotation and the like . if , however , the attribute ( s ) do not exceed the threshold , turbine and / or blade characteristics may be maintained at a current setting in step 615 . alternatively or additionally , if the attributes are a predetermined level below the threshold , turbine and / or blade characteristics may be modified or otherwise adjusted to a degree where the level of the attributes approaches the threshold level , thereby increasing turbine productivity . from an economic perspective , energy sales prices may also be taken into consideration as an additional or alternative control factor . most wind turbine control points are set to ensure a long turbine life . however , it may be desirable at certain energy sales price points to sacrifice some of the turbine &# 39 ; s life for additional profit or income . a turbine controller could use energy sales price data as one of its inputs to either increase the turbine &# 39 ; s maximum power output , or more aggressively approach the ‘ knee ’ of its power curve or otherwise risk greater wear and tear in order to take advantage of high energy sales prices . in a turbine equipped with a variable length blade this would mean a control strategy where the blades are kept longer than they would be otherwise in order to produce additional energy with the option of increasing the maximum power output as well . in addition to blade length , pricing control strategies may also affect how blade pitch and turbine speed are controlled . one method of determining how much more load to apply to turbine components during periods of high energy prices would be to compare lifetime cost of operation to income . operating costs generally increase with increased loads , because increased loads directly affect component life . component life can be calculated using fatigue analysis , comparison with operational records , or other methods . as the result of a cost analysis such as this , a look up table can be created , which would allow a controller , such as control system 510 ( fig5 ), to use varying setpoints in response to varying sales prices of energy . this will generally result in operational setpoints that will vary at different times of the day , on different days of the week , and / or seasonally , based on utility rates . an example would be to reduce loads when energy sales prices are low since the small potential increase in income will not pay for additional maintenance due to increased loads . on the other hand , there may be energy sales prices that are so high that increased revenues will greatly exceed the projected cost of increased maintenance caused by pushing the turbine harder . this might occur for a few hours a day , when utilities pay dearly for power , such as at 6 pm on a summer weekday in a hot climate , when the workforce comes home , turns on the air conditioner and cooks dinner . this places a large demand on the power generation and transmission system , and the utility must find sources to meet that demand . during these periods of high energy sales prices , more aggressive setpoints may be instituted by the controller . according to another aspect , batteries are often an important part of wind turbine safety systems . for example , batteries may be used in some turbines to pitch the blades out of the wind if the power goes out . in a turbine using variable length blades , batteries may be used to pull the blades all the way into a retracted position in case of a power outage . in either case , it is important to have batteries with sufficient charge . thus , to insure that a battery has sufficient charge , a special battery test control mode may be used . in the battery test mode , a charger for the batteries is switched off and the pitching motors , blade retraction motors and / or other load is employed and the battery voltage is observed . if the battery fails to meet a set of requirements for voltage under a load of certain duration then a flag is set to notify wind farm operators that a new battery is needed . if the battery fails to meet a second set of criteria indicating that the turbine would be unsafe in the event of a power outage , ( i . e . : the batteries would be incapable of performing their function ), the turbine can be shut down . alternatively , battery voltage can be continuously monitored under normal operating loads , and these voltages can be compared to setpoints which indicate when a battery is becoming weak or non - functional , triggering associated alarms or turbine shutdowns . for example , a turbine or a portion thereof may be shutdown if the battery does not have sufficient charge . referring again to fig5 , an example of batteries that may be used in accordance with the above is illustrated . in particular , batteries 520 are located in the hub and may provide power to blade retraction / extension mechanisms , sensors , pitching mechanisms and the like . batteries 520 may be charged through another power source . as a fail safe or alternate mode , manual controls may be provided . manual controls may be used to adjust pitch or length of blades , rotor speed , or turbine direction among other characteristics in the event controllers or sensors fail or special circumstances call for different operating attributes . the inventions disclosed herein entail improvements to wind turbine controls and blade design , which may be applicable to a variable length blade turbine such as described in u . s . pat . no . 6 , 902 , 370 as well as to conventional wind turbine blades and other aerodynamic structures such as aircraft wings or helicopter blades . additionally , the methods and features recited herein may further be implemented through any number of computer readable mediums that are able to store computer readable instructions . examples of computer readable mediums that may be used include ram , rom , eeprom , flash memory or other memory technology , cd - rom , dvd or other optical disk storage , magnetic cassettes , magnetic tape , magnetic storage and the like . while illustrative systems and methods as described herein embodying various aspects of the present invention are shown , it will be understood by those skilled in the art , that the invention is not limited to these embodiments . modifications may be made by those skilled in the art , particularly in light of the foregoing teachings . for example , each of the elements of the aforementioned embodiments may be utilized alone or in combination or subcombination with elements of the other embodiments . it will also be appreciated and understood that modifications may be made without departing from the true spirit and scope of the present invention . the description is thus to be regarded as illustrative instead of restrictive on the present invention .	5
referring to the drawings in particular , the present invention pertains to a mounting technique for the side - by - side mounting of side doors ( 6 , 7 , 8 , 9 ) on a vehicle body ( 5 ). this pertains specifically to the mounting unit ( 1 ) provided herefor and , further , also to the 15 mounting process as well as the correct design of the vehicle parts , especially the vehicle body ( 5 ), the side doors ( 6 , 7 , 8 , 9 ) and the door hinges ( 34 ) for the mounting . in a schematic top view , fig1 shows a mounting unit ( 1 ) for vehicle bodies ( 5 ), which are fed on a conveyor ( 11 ) along a transfer line and are transported through a plurality of stations ( 2 , 3 , 4 ). the vehicle body ( 1 ) is a body shell of vehicles , which comprises at least side walls with cross connections via a roof part and / or an underbody . other body parts , such as crossrail for the rear shelf , the front wall and the rear wall of the body , etc ., may likewise be present . fig2 and 3 show schematic view of such a vehicle body ( 5 ). the vehicle body ( 5 ) is intended for an at least four - door vehicle , the side walls having on each side of the vehicle at least two door cutouts ( 30 , 31 ) for front and rear side doors ( 6 , 7 , 8 , 9 ). the embodiment being shown is that of usual limousine forms with two pairs of side doors on left and right . as an alternative , more than two side doors ( 6 , 7 , 8 , 9 ) may also be present on each side of the vehicle , which may be the case of , e . g ., stretch limos or other special vehicles . the subsequent description pertains to four - door vehicles and can correspondingly also be extrapolated to these special vehicles . the left and right side doors are mounted side by side and in pairs in the front and rear door cutouts ( 30 , 31 ) of the vehicle body ( 5 ), which cutouts are present on both sides , in two consecutive mounting stations ( 2 , 3 ). this is preferably the initial mounting , during which the side doors ( 6 , 7 , 8 , 9 ) are in the raw form and not yet fitted with all built - in parts . this initial mounting preferably takes place before the painting . after the general painting of the vehicle body ( 5 ) and the side doors ( 6 , 7 , 8 , 9 ), the side doors are again removed , and the door hinges ( 34 ), which will be described in more detail below , are separated , e . g ., by pulling out the hinge bolts from the joint ( 37 ). the side doors are subsequently fitted with added - on parts and finally mounted again , while the hinge halves are connected again via the inserted hinge bolts . the change in the weight of the finished side doors ( 6 , 7 , 8 , 9 ), which is due to the added - on parts mounted later , is taken into account at the time of the initial mounting , and it is also possible to take into account other changes of the doors at the time of the initial mounting as a precaution . in the variant of the mounting unit shown in fig1 , the two front and rear side doors ( 6 , 7 ) are mounted together on the left side of the vehicle , e . g ., in the first mounting station ( 2 ). the front and rear side doors ( 7 , 8 ) are mounted together on the right side of the vehicle in the next mounting station ( 3 ). the mounting stations ( 2 , 3 ) preferably join each other directly in the transfer line . the left / right sequence of mounting may be alternatively transposed . additional mounting operations , e . g ., the attachment of fenders , etc ., may take place in additional next stations ( 4 ). in a variant of the embodiment being shown , the two mounting stations ( 2 , 3 ) can be combined into a single mounting station , in which the front and rear side doors are mounted , one after another and again side by side , at first on one side and then on the other side of the vehicle . furthermore , it is possible to also mount other body parts , e . g ., the above - mentioned fenders , etc ., on the vehicle body ( 5 ) in the mounting station or mounting stations ( 2 , 3 ). according to fig1 , the making available and feeding of the front and rear side doors ( 6 , 7 , 8 , 9 ) and optionally also the preparation and especially the premounting of these side doors ( 6 , 7 , 8 , 9 ) can be performed on both sides of the transfer line . the prepared front and rear side doors ( 6 , 7 , 8 ) are brought together on the necessary side of the vehicle or the mounting side by means of a component feed ( 24 ) bridging over the transfer line . the side doors ( 6 , 7 , 8 , 9 ) are preferably fitted with door hinges ( 34 ) before the mounting on the vehicle body ( 5 ). this may be carried out in a premounting means ( 25 ), which may be arranged externally or within the mounting stations ( 2 , 3 ). the mounting of the hinges will be discussed in more detail later . a mounting means ( 12 ) is present in each mounting station ( 2 , 3 ) for the mounting of the side doors . this comprises a positioning means ( 13 ) each for guiding the side doors ( 6 , 7 , 8 , 9 ) and holding same in a correct position for mounting and a fixing means ( 19 ) for fixing the side doors ( 6 , 7 , 8 , 9 ) and especially the door hinges ( 34 ) on the vehicle body ( 5 ). the door hinges ( 34 ) are mounted now , e . g ., on the door pillars ( 27 , 28 , 29 ) and fixed . the vehicle body ( 5 ) has , on both sides , an a pillar ( 27 ), a middle b pillar ( 28 ) and a rear - side c pillar ( 29 ). the positioning means ( 13 ) and the fixing means ( 19 ) are arranged opposite each other at the transfer line and the vehicle body ( 5 ) in the embodiment being shown . the positioning means ( 13 ) holds the side door pairs ( 6 , 7 ) and ( 8 , 9 ) with a gripping tool ( 15 ) in a correctly fitting manner and in a correct position for mounting at the facing side of the vehicle body ( 5 ) and position them preferably in a centered and aligned position in the front and rear door cutouts ( 30 , 31 ). fixation is carried out preferably on the inner side of the vehicle and from the interior space ( 26 ) of the body . the fixing means ( 19 ) may be designed for this purpose with its one or more fixing tools ( 21 ) such that it can extend into the interior space ( 26 ) of the body and reach the door hinges ( 34 ) with its fixing tools . in the arrangement being shown , the fixing means ( 19 ) passes in the first mounting station ( 2 ) through the still open door cutouts ( 30 , 31 ) on its side and through the interior space ( 26 ) of the body . in the second mounting station ( 3 ), the fixing means ( 19 ), which is present there and is arranged on the other side of the vehicle , passes through the window cutouts of the side doors ( 6 , 7 ) already mounted on that side . the positioning means ( 13 ) comprises , e . g ., two positioning robots ( 14 ), which are preferably designed as multiaxial , especially six - axis articulated arm robots and have a multiaxial robot hand ( 23 ). the two positioning robots ( 14 ) arranged next to each other carry a gripping tool ( 15 ) each , which comprises a frame with controllable grippers arranged thereon corresponding to the geometry of the door . the positioning robots ( 14 ) can grip with their gripping tools ( 15 ) into the side doors ( 6 , 7 , 8 , 9 ) made ready in a predetermined position and move in a mutually coordinated manner . in a variant , not shown , it is possible to use an individual positioning robot ( 14 ) and a combination gripping tool , which can grip , with correspondingly designed gripping tools and with integrated additional axes , two front and rear side doors ( 6 , 7 ) and ( 8 , 9 ), respectively , together and move them relative to one another preferably multiaxially in a mutually coordinated manner . the positioning means ( 13 ) is equipped with a measuring and aligning device ( 17 ) for the correctly fitting positioning of the side doors ( 6 , 7 , 8 , 9 ). this comprises , e . g ., a plurality of sensors ( 18 ), which may be arranged in a flatly arranged pattern at the gripping tool ( 15 ). these may be , e . g ., sensors scanning edges and / or distance - measuring sensors , which operate in a contacting or contactless manner . for example , optical sensors , but also all other suitable sensor types described , e . g ., even imaging cameras , are possible . the sensors ( 18 ) are connected to a control , not shown , for analyzing the measurement results . the measuring and analysis device ( 17 ) is connected to the positioning robots ( 14 ) and the control thereof and makes possible the coordinated motion thereof for the correctly fitting mounting of the doors . optimized course of a gap and mutual optimized alignment of the front and rear side doors ( 6 , 7 ) and ( 7 , 8 ) can be achieved by means of this coordinated motion . in addition , the pairs of side doors can be aligned in an optimal manner in relation to the vehicle body ( 5 ) and especially the door cutouts ( 30 , 31 ). alignment in relation to design lines , e . g ., bent edges , at the side wall , is also possible now . in particular , efforts are made to optimize the gaps extending in the visible area on the top side as well as on the front side and the rear side of the side doors ( 6 , 7 , 8 , 9 ) in relation to the edges of the door cutouts ( 30 , 31 ) by the gaps being made of equal size and being kept as small as possible . the necessary tolerance compensation can take place on the underside of the door , where larger visible gaps are less conspicuous . flush positioning of the upper edges of the doors and the lower edges of the window cutouts ( 10 ) can also be taken into account during the mounting of the door . in particular , the side doors ( 6 , 7 , 8 , 9 ) can be centered in their door cutouts ( 30 , 31 ) and correspondingly displaced and aligned . transverse tilting of the side doors ( 6 , 7 , 8 , 9 ) by the correspondingly mobile positioning robot ( 14 ) may also take place to apply a possibly desired prestress to the door . in addition , an allowance may be taken into account at the time of the positioning of the door in order to preventively compensate the heavier weight of the door after the finishing of the door . possible changes in the shape of the side doors ( 6 , 7 , 8 , 9 ) as a consequence of the later outfitting with components can also be taken into account at the time of the initial mounting . on the one hand , the side doors ( 6 , 7 , 8 , 9 ) with their relevant parts and especially their contours can be measured in the outer outline and in the window cutout ( 10 ) with the sensors ( 18 ). for example , representative edges or other parts of the door are detected now and their actual position is measured . furthermore , the door cutouts ( 30 , 31 ) can be measured with the sensors ( 18 ) correspondingly in terms of their actual dimensions and their actual position in space . based on these measured values , the correctly fitting alignment of the door and centering can take place on the basis of these measured values . the positioning robots ( 14 ) hold with their gripping tools ( 15 ) the side door pairs ( 6 , 7 ) and ( 8 , 9 ), respectively , for fixation in a closed position that is correct for mounting in the door cutouts ( 30 , 31 ), and possible prestresses , allowances or the like can be taken into account in the above - mentioned manner . the gripping tools ( 15 ) may be supported for the subsequent fixation by mobile torque supports ( 16 ), e . g ., bottom - side support props extensible in a controlled manner , for relieving the robots and for absorbing the forces of reaction developing during the fixation . the actuation and positioning of the torque supports ( 16 ) takes place via the measuring and aligning device ( 17 ). as an alternative , the positioning robots ( 14 ) can perform controlled compensating motions to absorb the forces of reaction . the fixing means ( 19 ) comprises in the embodiment being shown two fixing robots ( 20 ), which are arranged next to each other on the other side of the vehicle opposite the positioning robots ( 14 ). the fixing robots ( 20 ) are likewise designed as multiaxial articulated arm robots with a robot hand ( 23 ) for the multiaxial guiding of the fixing tools ( 21 ) attached here . the fixing tools may be , e . g ., screwing tools or welding tools or the like . in a variant of the embodiment being shown , the fixing robots ( 24 ) may be arranged above the transfer line and designed , e . g ., as portal robots . the fixing robots ( 20 ) may also reach with their robot arms and the robot hand ( 23 ) into the interior space ( 26 ) of the body through the front - side and rear - side window cutout . in addition , it is also possible to arrange the fixing robots ( 20 ) provided with a corresponding range on the same side and next to the positioning robots ( 14 ), the access to the inner side of the vehicle being again granted via the front window and the rear window . the side doors ( 6 , 7 , 8 , 9 ) are positioned with premounted door hinges ( 34 ) aligned in a correct position for mounting and fixed during the mounting . the hinges are mounted here , e . g ., on the outer side ( 31 ) of the door pillars ( 27 , 28 , 29 ), the site of fixation in the interior space of the pillar being able to be reached via one or more passage openings ( 39 ) on the inner side ( 32 ) of the pillar . suitable fixing elements ( 38 ), e . g ., screws , can be introduced through these passage openings ( 39 ) with the fixing tools ( 21 ) or in another manner and activated . when fixing the hinges on the door pillar ( 27 , 28 , 29 ), any tolerances in the x and y directions can be compensated , as this is indicated , e . g ., in fig5 . for example , cage nuts , which are held biaxially movably in a sheet metal bracket at the door hinge ( 34 ) and are pulled and screwed into the correct screwing position with a centering pin , may be used as fixing elements for this . the fixing tool ( 21 ) may be designed for this purpose as a floating screwdriver . as an alternative , tolerance compensation can be brought about by means of the weld seam in case the door hinge ( 34 ) is welded . as is illustrated in fig5 and 6 , the door hinge ( 34 ) has a central joint ( 37 ) with the aforementioned hinge bolt and two hinge flanges ( 35 , 36 ), which are connected movably here . the hinge flanges ( 35 , 36 ) have a bent shape , and , e . g ., the door - side hinge flange ( 35 ) has a t - shaped cross section and has a flat flange plate with a connection web jutting out herefrom to the joint ( 37 ). the pillar - side hinge flange ( 36 ) is designed , e . g ., as a hinge plate bent in an l - shaped pattern in the cross section . for fixation to the door pillar ( 27 , 28 , 29 ) or another part of the door cutout ( 30 , 31 ), the pillar - side hinge flange ( 36 ) can be brought during premounting on the side door ( 6 , 7 , 8 , 9 ) into an angular position that is correct for mounting and temporarily fixed in a suitable manner . as is illustrated in fig5 and 6 , the hinge flanges ( 35 , 36 ) are essentially at right angles to one another in the closed position of the side doors ( 6 , 7 , 8 , 9 ). the side door ( 6 , 7 , 8 , 9 ) has a correspondingly shaped and sufficiently large door rabbet ( 40 ) for this . tolerances along the translatory x , y and z axes as well as optionally also along the rotatory axes are to be taken into account at the time of the mounting of the door . for example , the door - side hinge flange ( 35 ) has a flat design for the translatory tolerance compensation . the tolerance is compensated by elongated holes or the like in the y direction . these tolerances in the y direction can be determined during the premounting of the door hinge ( 14 ) and compensated at the time of the fastening of the hinge . the tolerances in the x and z directions are compensated in the above - mentioned manner by the fastening or fixation of the body - side hinge flange ( 36 ). for example , oversized holes can be used for this , e . g ., for a screw connection . by measuring the door during and after mounting , which is carried out , e . g ., with the measuring and aligning device ( 17 ) or in another manner , it can be determined whether the tolerances were compensated correctly and sufficiently during the mounting of the hinge . should there be , e . g ., any changes on the door pillar ( 27 , 28 , 29 ), which lead to a change in the mounting of the hinge in the y direction , this can be determined by calculation , evaluated , and compensated in the next doors in a preventive manner by a corresponding feedback and control of the premounting on the side door . statistical survey and analysis of the measurement results can be carried out for this in order to make it possible to detect possible trends in the changes in the shape of the vehicle body ( 5 ) in time and in a purposeful manner and compensate them correspondingly . various variants of the embodiments shown and described are possible . the door may be fixed , in case of a suitable design of the door , from the outside and without reaching into the interior space ( 26 ) of the body , and the cooperating positioning and fixing means ( 13 , 19 ) are arranged on the same side of the vehicle . all side doors ( 6 , 7 , 8 , 9 ) may also be mounted and fixed simultaneously . the inner fixation of the side doors ( 6 , 7 , 8 , 9 ) being claimed can also be carried out , on the other hand , with conventional mounting techniques and in case of individual mounting of the doors . thus , it has an independent inventive significance . furthermore , the design embodiment of the mounting means ( 12 ) and the components thereof , and , on the other hand , also the shape of the vehicle body ( 5 ) and parts thereof as well as of the door hinges ( 34 ) may be modified as well . the mounting unit ( 1 ) may otherwise have any desired and suitable design . while specific embodiments of the invention have been shown and described in detail to illustrate the application of the principles of the invention , it will be understood that the invention may be embodied otherwise without departing from such principles .	1
the following definitions and explanations provide background information pertaining to the technical field of the present invention , and are intended to facilitate the understanding of the present invention without limiting its scope : api : ( application program interface ) a language and message format used by an application program to communicate with the operating system or some other system or control program such as a database management system ( dbms ) or communications protocol . crawler : a program that automatically explores the world wide web by retrieving a document and recursively retrieving some or all the documents that are linked to it . gui ( graphical user interface ): a graphics - based user interface that incorporates icons , pull - down menus and a mouse . html ( hypertext markup language ): a standard language for attaching presentation and linking attributes to informational content within documents . during a document authoring stage , html “ tags ” are embedded within the informational content of the document . when the web document ( or “ html document ”) is subsequently transmitted by a web server to a web browser , the tags are interpreted by the browser and used to parse and display the document . in addition to specifying how the web browser is to display the document , html tags can be used to create hyperlinks to other web documents . http ( hypertext transport protocol ): the communications protocol used to connect to servers on the world wide web . its primary function is to establish a connection with a web server and transmit html pages to the client browser . internet : a collection of interconnected public and private computer networks that are linked together with routers by a set of standards protocols to form a global , distributed network . soap ( simple object access protocol ): a message - based protocol based on xml for accessing services on the web employing xml syntax to send text comma url ( uniform resource locator ): a unique address that fully specifies the location of a content object on the internet . the general format of a url is protocol :// server - address / path / filename . web browser : a software program that allows users to request and read hypertext documents . the browser gives some means of viewing the contents of web documents and of navigating from one document to another . web document or page : a collection of data available on the world wide web and identified by a url . in the simplest , most common case , a web page is a file written in html and stored on a web server . it is possible for the server to generate pages dynamically in response to a request from the user . a web page can be in any format that the browser or a helper application can display . the format is transmitted as part of the headers of the response as a mime type , e . g . “ text / html ”, “ image / gif ”. an html web page will typically refer to other web pages and internet resources by including hypertext links . web site : a database or other collection of inter - linked hypertext documents (“ web documents ” or “ web pages ”) and associated data entities , which is accessible via a computer network , and which forms part of a larger , distributed informational system such as the www . in general , a web site corresponds to a particular internet domain name , and includes the content of a particular organization . other types of web sites may include , for example , a hypertext database of a corporate “ intranet ” ( i . e ., an internal network which uses standard internet protocols ), or a site of a hypertext system that uses document retrieval protocols other than those of the www . world wide web ( www , also web ): an internet client — server hypertext distributed information retrieval system . xml : extensible markup language . a standard format used to describe semi - structured documents and data . during a document authoring stage , xml “ tags ” are embedded within the informational content of the document . when the xml document is subsequently transmitted between computer systems , the tags are used to parse and interpret the document by the receiving system . [ 0050 ] fig1 portrays an exemplary overall environment in which an automatic service interface creation system 10 and associated method for discovering and creating service descriptions according to the present invention may be used . system 10 includes a software programming code or computer program product that is typically embedded within , or installed on a host server 15 . alternatively , system 10 can be saved on a suitable storage medium such as a diskette , a cd , a hard drive , or like devices . while the system 10 will be described in connection with the www , the system 10 can be used with a stand - alone database of terms that may have been derived from the www and / or other sources . the cloud - like communication network 20 is comprised of communication lines and switches connecting computers such as servers 25 , 27 , to gateways such as gateway 30 . the servers 25 , 27 and the gateway 30 provide the communication access to the www or internet . users , such as remote internet users , are represented by a variety of computers such as computers 35 , 37 , 39 , and clients applications that can be incorporated on the network servers , such as server 27 , can query the host server 15 for desired information through the communication network 20 . computers 35 , 37 , 39 each include software that will allow the user to browse the internet and interface securely with the host server 15 . the host server 15 is connected to the network 20 via a communications link 42 such as a telephone , cable , or satellite link . the servers 25 , 27 can be connected via high - speed internet network lines 44 , 46 to other computers and gateways . the servers 25 , 27 provide access to stored information such as hypertext or web documents indicated generally at 50 , 55 , and 60 . the hypertext documents 50 , 55 , 60 most likely include embedded hypertext link to other locally stored pages , and hypertext links 70 , 72 , 74 , 76 to other webs sites or documents 55 , 60 that are stored by various web servers such as the server 27 the operation or use of system 10 comprises the following four phases that will be described later in more detail : the analysis phase , the publishing phase , the discovery and development phase , and the runtime phase . the web site analysis phase analyzes the web page of interest and generates a service description ( sd ) file for each form . the sd file contains all the information necessary for producing the ultimate output of the system : api description in the form of web services description language ( wsdl ) files , well - defined service ( wds ) files , and interface service deployment ( isd ) files . the analysis phase is illustrated in fig2 and by method 300 of fig3 . the analyzer 200 of system 10 is connected through a network 205 , such as the internet , to a crawler or toolkit 210 . the crawler 210 is one source of web pages 215 for the system 10 , and it can be any one of the many currently available crawlers . data extracted from the web pages 215 by the analyzer 200 are stored in the service database 220 . web pages 215 can also be accessed by a user toolkit 210 . the user toolkit 210 incorporates a graphical user interface ( gui ) through which the user instructs system 10 which pages or forms to analyze . one method for implementing the gui is to embed the toolkit 210 in a web browser . while the user is browsing the web sites , a panel next to the main viewing area provides buttons or links that allow the user to mark the current page or form for further analysis . pages or forms selected by the user are then transferred to the analyzer 200 . the user toolkit 210 also includes a data extraction feature that instructs a data extractor component how to extract data from pages returned to system 10 when the forms are submitted for analysis . with further reference to fig3 the crawler 210 sends a request in step 302 to the web site 215 , fetching via the internet or other network 205 one or more “ seed pages ” which are web sites 215 . these seed pages 215 contain hyperlinks , or urls . the urls are extracted and inserted into a url pool . the crawler 210 then iteratively fetches a url from the pool and fetches the corresponding document from the web site 215 in step 305 . for example , if the web page 215 is an html page , urls of the web site 215 are again extracted and inserted in the url pool . the crawler 210 is configured to crawl only to a certain “ depth ”; i . e ., it may only move a certain number of links away from the web pages 215 . the distance is measured in terms of the number of links followed , so if the depth is three , the crawler will not go farther than three links away from the web pages 215 . other parameters may control the speed and frequency with which web documents are accessed , and whether every link is followed or a filtering mechanism allows for only a subset of all possible links to be pursued . the crawler 210 passes each page 215 retrieved from the web to the page analyzer 200 in step 310 . the functions of the page analyzer 200 are shown in more detail in fig4 . the analyzer 200 is generally comprised of a page analyzer 405 , a service extractor 410 , an executable code generator 415 , and a standard service format producer 420 . the page analyzer 405 scans the code of a web page such as html page 425 and finds sections of that page that constitute a web form . one page may contain several forms . for example , a form is identified in html by a “& lt ; form & gt ;” tag and contains one or more data entry tags such as “& lt ; input & gt ;” and “& lt ; select & gt ;”. the service extractor 410 then translates these forms into service descriptions . the service extractor 410 analyzes a set of forms that originally resided on a single web page and prepares the data for subsequent output as a service description by the standard service format producer 420 . the service extractor 410 performs the following tasks : assigns a name to the service based on the title of the web page , the url , or an encoded value of either one . extracts the description ( metadata ) of the service from the & lt ; meta & gt ; tags of the web page . assigns a synthetic name to each form residing on the web page based on position number of the form . for example , form number 1 would be assigned the name “ method 1 ”. extracts the http access method used in each form ( get or post ). translates the name of each form variable ( variables listed in & lt ; input & gt ; and & lt ; select & gt ; tags ) into a variable name compatible with the executable code language . defines the data type of each form variable using the xml schema language . the service extractor packages the information it extracted into a service description ( sd ) file , and passes it on to the standard service format producer 420 and to the executable code generator 415 . the service description ( sd ) file is a composite file that contains all the information needed to invoke the web service . the service extractor 410 converts forms such as html page 425 into web services that can operate on a gateway ( or on the client or server computer ). the sd file comprises instructions for construction of the gateway . the sd file is typically written in xml . the executable code generator translates the sd file into an executable code 430 such as java that implements a soap interface wrapper . the executable code 430 is stored in the service database 220 . the standard service format producer 420 translates the sd file into standard web service format such as wsdl ( web services description language ), wds ( well defined service ) and isd ( invocation service description ). the wsdl , wds , and isd files are all stored in the service database 220 . the second phase of system 10 is the publishing phase , as illustrated by the high - level architecture of fig5 . the service publisher 505 gathers wsdl , wds , isd , and executable code files from the service database 220 and prepares them for deployment . the service publisher 505 first invokes an executable code compiler on each executable code file and gets executable code class files as a result . the service publisher 505 then deploys each service to a gateway at block 510 by uploading the executable code to the gateway , using the executable code class file and isd file . this process ( block 510 ) makes the web service available to the client . one method for adding web service files to the gateway at block 510 is by invoking the appropriate method in a soap service manager . the soap service manager “ hosts ” soap services on a gateway . it receives requests from a client application and invokes the appropriate executable code class file that implements the service . any existing soap service manager can be used . next , the service publisher 505 registers each service at a uddi ( universal description , discovery , and integration ) registry 515 by invoking the appropriate method in the uddi registry 515 and providing the wsdl and wds files as input . the uddi registry 515 is a registration service for web servers to advertise web services ; for system 10 , the uddi will list all services available in the soap service manager . a client application or programmer 520 can query the registry to find the soap addresses and other parameters of interesting services . any existing uddi registry can be used . the third phase of the operation of system 10 is the discovery and development phase . in phase 3 , the programmer 520 accesses the uddi registry 515 and develops client programs and applications that invoke the web server at the gateway in block 510 . in an alternative embodiment of system 10 , the latter can include the web service gateway code in the client &# 39 ; s software , thus obviating the need for the uddi registry 515 and the gateway at block 510 . the fourth phase of the operation of system 10 is the runtime phase , illustrated by the high - level architecture of fig6 . the client 605 accesses the web sites 610 through the gateway 615 via the network 620 . the client is comprised of an application code 625 developed by a programmer and a soap wrapper 630 created automatically from the wsdl file by standard software development tools . the client sends a request to the gateway , as shown by network link 635 . the gateway 615 then sends a request to web site 610 via network link 640 . the web site 610 returns to the gateway 615 a response to the request , as shown by network link 645 . the gateway 615 then transfers the response of web site 610 to the client 615 via link 650 . web sites such as web site 610 are designed for viewing by humans . the gateway 615 makes web sites such as web site 610 appear as a web service designed for program access . the client 605 never sees the original web site 610 form that is most likely written in html using the http protocol . the gateway 615 translates the human readable web site interface and presents to the client a machine readable interface most likely written in xml using the soap protocol . the runtime phase operation or method 700 is illustrated by the flowchart of fig7 a and 7b . the client 605 wishes to make a programmatic request of the web site 610 . this process is initiated when the application code 625 calls the wrapper function in step 705 . the soap wrapper 630 translates the host language structure , such as java , to soap . the request of the client 605 is transferred in step 710 to the gateway via network link 635 , using soap protocol . in step 715 , the gateway 615 translates the soap request to the format required by the web site 610 ; i . e ., http post . the gateway 615 submits the web form to the web site 610 in step 720 via network link 640 using , for example , http protocol . in step 725 , the web site 610 performs the action requested by the user in step 705 , i . e ., execute a database query . the web site 610 returns the response to the gateway 615 via the network link 645 in step 730 ; the data format for the response shown by network link 645 is typically html , using http protocol . in the preferred method of system 10 , the http response ( step 735 ) is translated by the gateway 615 to extract data in step 740 . the result of the data extraction is shown in step 745 as xml data . the xml data 745 is wrapped in a soap envelope by the gateway 615 in step 750 . the wrapped response is transmitted via network link 650 to the client 605 in step 755 . the protocol for network link 650 is soap with data format of xml . then , in step 760 the wrapped response to the original web site 550 request is received and translated to the host data structure ( e . g . java ) by the soap wrapper 630 . alternatively , the http response may not be translated to xml , but instead wrapped directly in a soap envelope as shown by optional path 765 . an alternative embodiment of the run - time phase of system 10 is shown in fig8 . in this embodiment , the functions of the gateway are included in the client 805 , allowing the client to directly communicate through the network 810 to the web site 815 . the client is comprised of an application code 820 developed by a programmer and an http wrapper 825 . the client sends a request to the web site 815 via network link 830 . the request is coded in html using http protocol . the web site 815 responds to the request in html using http protocol and transmits it back to the client via network link 835 . this format is recognized by the client 805 and translated as needed for the application code 820 . the runtime phase operation of the alternative embodiment is illustrated by the flowchart of fig9 . the client 805 wishes to make a programmatic request of the web site 815 . this process is initiated when the application code 820 calls the http wrapper function in step 905 . the wrapper function is generated by the executable code generator . the http wrapper 825 translates the host language structure , such as java , to http using the executable code that is stored in the service database . the request of the client 805 is submitted in step 910 to the web site 815 via network link 830 , using the http protocol . in step 915 , the web site 815 performs the action requested by the user in step 905 , i . e ., execute a database query . the web site 815 returns the response to the client 805 in step 920 ; the data format for the response shown by network link 835 is typically html , using http protocol . in a preferred method of system 10 , the http response ( step 925 ) is processed by the client 805 to extract data in step 930 . the result of the data extraction is shown in step 935 as xml data . in step 940 , the client application code 820 translates the xml data to the host language data structure such as java . alternatively , the http response is not translated to xml first , but is instead translated directly from http to the host language data structure in step 940 , as shown by optional link 945 . it is to be understood that the specific embodiments of the invention that have been described are merely illustrative of certain application of the principle of the present invention . numerous modifications may be made to the automatic service interface creation for web sites invention described herein without departing from the spirit and scope of the present invention . moreover , while the present invention is described for illustration purpose only in relation to the www , it should be clear that the invention is applicable as well to databases and other tables with indexed entries .	6
described below are various methods for synthesizing some of the polyorganofullerene derivatives via polynitrofullerenes or polycyclosulfated fullerenes described herein . polynitrofullerene derivatives , f --( no 2 ) n , which act as a reactive intermediate in this invention , can be prepared by one of the following methods : a ) a method for producing f --( no 2 ) n involve reacting fullerene , f , with nitrogen dioxide radicals , no 2 ., which are generated from sodium nitrite , nano 2 , and concentrated hno 3 . see chiang et al ., tetrahedron 1996 , 52 ( 14 ), 4963 . the structure of f --( no 2 ) n has been characterized to contain at least 4 nitro groups . b ) f --( no 2 ) n , wherein n is 4 , can also be prepared from reacting fullerene with dinitrogen tetraoxide , n 2 o 4 in carbon disulfide solution . see cataldo et al ., fullerene sci . & amp ; techno . 1997 , 5 ( 1 ), 257 . c ) yet another method for the preparation of f --( no 2 ) n can be done by reacting fullerene with nitrogen dioxide gas , which is generated from a mixture of nano 2 and feso 4 in aqueous h 2 so 4 . see sarkar et al ., j . chem . soc ., chem . commum . 1994 , 275 . d ) still another method for the preparation of f --( no 2 ) n can be done by reacting fullerene with fuming nitric acid . see hamwi et al ., fullerene sci . & amp ; techno . 1996 , 4 ( 5 ), 835 . polycyclosulfated fullerene derivatives , f --( so 4 ) n , which can also be employed as an effective intermediate in this invention , can be prepared by reacting fullerene and neat fuming sulfuric acid in the presence of an oxidant ( e . g ., p 2 o 5 , v 2 o 5 , or seo 2 ). the structure of the product has been characterized to consist at least 4 cyclosulfated units . polyorganofullerene derivatives , f --( e ) n , can be synthesized in general by reacting f --( no 2 ) n or f --( so 4 ) n with a nucleophilic agent , e -- h , ( e . g ., primary and secondary organoamino compound , alkoxide , organothiolate , organophenol compound , carbanion , organoamide anion , thiocarbamate ion , and the like ) in a non - reactive solvent , such as tetrahydrofuran . a base may be needed in some reactions ( see examples below ) to produce a nucleophilic anion of e -- h that is of enough strength to undergo the substitution reaction . some examples of such a base include 1 , 8 - diazabicyclo [ 5 . 4 . 0 ]- undec - 7 - ene ( dbu ), 1 , 5 - diazabiacyc [ 4 . 3 . 0 ] non - 5 - ene ( dbu ), and lithium diisopropyl - amine ( lda ). alternatively , f --( e ) n can be prepared by reacting f --( no 2 ) n or f --( so 4 ) n with a lithium salt of e -- h , which is generated by reacting e -- h with lithium triethylborohydride ( super - hydride ®) in tetrahydrofuran or other non - reactive solvents . examples of lithium salts of e -- h include , but are not limited to , lithium organoamino compounds , lithium organothiolate , lithium organophenol . a polyorganofullerene derivative from the reactions set forth above , f --( e ) n , can further react with a hydrolyzing agent to generate a polyhydroxyorganofullerene derivative , f --( e ) n ( oh ) m . for instance , sodium hydroxide is an effective hydrolyzing agent in this disclosure and tetrabutylammonium hydroxide can be used herein as a phase - transfer agent . note that the symbol , n , used in each term does not necessary have the same number as the same symbol used in another term in this disclosure . without further elaboration , it is believed that one skilled in the art can , based on the description herein , utilize the present invention to its fullest extent . the following specific examples are , therefore , to be construed as merely illustrative , and not limitative of the remainder of the disclosure in any way whatsoever . all publications recited herein , including patents , are hereby incorporated by reference in their entirety . a two - necked reaction flask a ( 50 ml ) was equipped with a vertical dropping funnel with a stopcock on one neck and a connecting gas bubbling tube on the other neck . the gas - bubbling tube was attached with a drying tube ( cacl 2 ) and inserted into the second two - necked reaction flask b . the other neck of flask b was attached with a bubbling tube which was extended into a trapping flask containing aqueous sodium hydroxide solution ( 2 n ). to minimize the back - flow of moisture from alkaline solution , a drying tube ( cacl 2 ) was installed in between the flask b and the trapping flask . a steady inert gas ( n 2 ) flow was allowed starting from the top of dropping funnel , through the reaction flasks a and b in sequence , into the alkaline solution in the trapping flask . the dropping funnel and the reaction flask a were charged with conc . hno 3 ( 10 ml ) and copper powder ( 10 g ), respectively . in the reaction flask b was placed a solution of [ 60 ] fullerene ( 500 mg ) in benzene ( 50 ml , dried over na ). the inert gas bubbling through the c 60 solution in the flask b was adjusted to a flow rate of 5 ml per min . the fullerene solution was deoxygenated for at least 5 min prior to the reaction . conc . hno 3 solution was then allowed to add dropwise into sodium nitrite solids in the flask a . brown fume was produced immediately upon the contact of conc . hno 3 with nano 2 . it was carried by the steady flow of n 2 and bubbled through the c 60 solution in the flask b . within 15 min of reaction , the purple solution of c 60 was changed to orange - red progressively . the mixture was stirred at ambient temperature for an additional 2 h to give a dark brown - red solution with suspended solids . at the end of reaction , excessive nitrogen dioxide ( no 2 ) was removed by n 2 bubbling and destroyed in the trapping solution . benzene was then evaporated from the product solution at a reduced pressure to give dark brown solids . the solids were suspended in anhydrous n - hexane , separated from n - hexane solution by the centrifuge technique and dried in vacuum at 40 ° c . to afford brown solids of polynitrofullerene derivatives , c 60 ( no 2 ) n ( n = 4 - 6 on average ) ( 650 mg ). irν max ( kbr ) 1572 [ s , ν as ( n -- o )], 1328 [ s , ν s ( n -- o )], 1085 , 1038 , 973 , 815 ( δ ) , 760 , 733 , 696 , 545 , and 466 cm - 1 . the product exhibits appreciable solubility in common organic solvents such as thf , dmf , ch 2 cl 2 , ch 3 oh and dmso . synthesis of polycyclosulfated fullerenes , c 60 ( so 4 ) n a reaction flask ( 50 ml ) charged with a fullerene mixture of c 60 ( 80 %) and c 70 ( 20 %) ( 1 . 0 g ), an oxidant , and fuming sulfuric acid ( 15 ml ) was stirred at 55 - 60 ° c . under n 2 for 5 min to 3 h to give a light brown solution with orange suspensions . the oxidant can be selected from either p 2 o 5 ( 6 . 0 g ), v 2 o 5 ( 150 mg ), or seo 2 ( 700 mg ). the resulting mixture was added dropwise into cold ice - water ( 200 ml ) to cause the precipitation of products . precipitates were separated from the aqueous solution by the centrifuge technique . they were then washed and centrifuged twice with cold ice - water and dried in vacuum at 40 ° c . to afford brown - orange solids of polycyclosulfated fullerenes , c 60 ( so 4 ) n , ( 1 . 4 g ) . the physical data of c 60 ( so 4 ) n are as follow : irν max ( kbr ) 2920 ( br ), 2400 ( br ), 1706 ( w ), 1654 ( w ), 1598 ( w ), 1427 ( s ), 1229 ( s ), 1168 , 1046 , 1002 ( s ), 981 , 953 ( s ), 855 , 826 ( s ), 783 , 641 , 530 , 485 ( w ), and 411 ( w ) cm - 1 ; 13 c nmr ( dmf - d 7 , peak center ) δ 148 . 0 , 77 . 0 , 71 . 0 ; 1 h nmr ( dmf - d 7 , peak center ) δ 14 . 6 ( w , oso 2 -- oh of a partially hydrolyzed product ). synthesis of polyaminofullerenes , c 60 ( nh 2 ) m -- method 1 a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 500 mg ) and tetrahydrofuran ( 40 ml ). the solution was slowly bubbled with a stream of nh 3 gas ( 5 ml per min ) at ambient temperature for 2 h with dry - ice / acetone filling in the cool - trap . at the end of reaction , the resulting solution was added methanol ( 60 ml ) to effect precipitation of brown solids . the solid precipitate was isolated by a centrifuge technique . it was then washed twice with methanol ( 20 ml each time ) and dried in vacuum at 40 ° c . to afford brown solid of the corresponding polyaminofullerene derivative c 60 ( nh 2 ) m ( m ≧ n ). increase of number of substituents is due to further nucleophilic additions of nh 3 on polyaminated fullerenes . the physical data of polyamino fullerenes are as follows : irν max ( kbr ) 3400 ( s , nh 2 ), 3246 ( s ), 1625 , 1556 , 1387 , 1347 , 1271 , 1058 , 742 , and 545 cm - 1 . synthesis of polyaminofullerenes , c 60 ( nh 2 ) m -- method 2 a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 500 mg ) and tetrahydrofuran ( 30 ml ). the solution was added nanh 2 ( 400 mg ) and stirred at ambient temperature for 3 h . at the end of reaction , the resulting solution was added methanol ( 60 ml ) to effect precipitation of brown solids . the solid precipitate was isolated by a centrifuge technique . it was then washed twice with methanol ( 20 ml each time ) and dried in vacuum at 40 ° c . to afford brown solid of the corresponding polyamino - fullerene derivatives , c 60 ( nh 2 ) m , ( m ≧ n ). increase of number of substituents is due to further nucleophilic additions of nh 3 on polyaminated fullerenes . the physical data of polyamino fullerenes are as follows : irν max ( kbr ) 3388 ( s , nh 2 ), 3269 ( s ), 1637 , 1557 , 1381 , 1346 , 1271 , 1060 , 669 , and 538 cm - 1 . a round - bottom reaction flask a ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and purged with n 2 . it was charged with c 60 ( no 2 ) n ( 500 mg ) and tetrahydrofuran ( 30 ml ). in a separated reaction flask b , benzamide ( 1 . 1 equiv . of halogen group in halogenated fullerene ) was allowed to react with sodium hydride ( 1 . 1 . equiv . of benzamide ) in tetrahydrofuran ( 20 ml , distilled over na ) at ambient temperatures to afford immediately the corresponding solution of sodium benzamide ( c 6 h 5 conhna ). the solution was added portionwise into the reaction flask a at 0 ° c . and the mixture was stirred further at that temperature for an additional 3 h . at the end of reaction , all solvents were removed from the resulting solution in vacuum to give brown solids . these solids were transferred into an aqueous solution of naoh ( 15 ml , 3 n ) and the mixture was stirred and heated at 90 ° c . for 16 h . it was cooled to ambient temperature and added methanol ( 60 ml ) to cause precipitation of dark brown solids . the solid precipitate was isolated by a centrifuge technique . it was then washed twice with methanol ( 20 ml each time ) and dried in vacuum at 40 ° c . to afford brown solids of the corresponding polyaminofullerene derivative , c 60 ( nh 2 ) n . synthesis of polyaminofullerenes , c 60 ( nh 2 ) m -- method 4 a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( so 4 ) n ( 500 mg ) and tetrahydrofuran ( 40 ml ). the solution was slowly bubbled with a stream of nh 3 gas ( 5 ml per min ) at ambient temperature for 2 h with dry - ice / acetone filling in the cool - trap . at the end of reaction , the resulting solution was added methanol ( 60 ml ) to effect precipitation of brown solids . the solid precipitate was isolated by the centrifuge technique . it was then washed twice with methanol ( 20 ml each time ) and dried in vacuum at 40 ° c . to afford brown solid of the corresponding polyamino fullerene derivative c 60 ( nh 2 ) m ( m ≧ n ). the physical data of polyamino fullerenes are as follows : irν max ( kbr ) 3400 ( s , nh 2 ), 3246 ( s ), 1625 , 1556 , 1387 , 1347 , 1271 , 1058 , 742 , and 545 cm - 1 . synthesis of poly ( diethanolamino ) fullerenes , c 60 [-- n ( ch 2 ch 2 oh ) 2 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 500 mg ) and acetone ( 30 ml ). the solution was added diethanolamine ( distilled , 900 mg ) in acetone ( 30 ml ) and stirred at ambient temperatures for 12 h . at the end of reaction , suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with acetone and tetrahydrofuran . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( diethanolamino ) fullerenes ( 535 mg ). the physical data of poly ( diethanolamino ) fullerenes are as follows : irν max ( kbr ) 3374 ( s , oh ), 2933 ( c -- h ), 1650 , 1565 , 1453 , 1387 , 1268 , 1070 , 669 , and 538 cm - 1 . 1 h nmr ( 300 mhz , dmso - d 6 ) δ 3 . 0 ( triplet , ch 2 ), 3 . 32 ( oh ), 3 . 63 ( triplet , ch 2 ), and 4 . 56 . synthesis of poly ( diethanolamino ) fullerenes , c 60 [-- n ( ch 2 ch 2 oh ) 2 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( so 4 ) n ( 500 mg ) and tetrahydrofuran ( 30 ml ). the solution was added diethanolamine ( distilled , 900 mg ) in tetrahydrofuran ( 30 ml ) and stirred at ambient temperatures for 5 h . at the end of reaction , suspended solids in the solution were separated by the centrifuge technique and repeatedly washed with acetone . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( diethanolamino ) fullerenes ( 520 mg ). the physical data of poly ( diethanolamino ) fullerenes are as follows : irν max ( kbr ) 3374 ( s , oh ), 2933 ( c -- h ), 1650 , 1565 , 1453 , 1387 , 1268 , 1070 , 669 , and 538 cm - 1 . 1 h nmr ( 300 mhz , dmso - d 6 ) δ 3 . 0 ( triplet , ch 2 ), 3 . 32 ( oh ), 3 . 63 ( triplet , ch 2 ), and 4 . 56 . synthesis of poly ( hydroxyethoxyethylamino ) fullerenes , c 60 (-- nhch 2 ch 2 och 2 ch 2 oh ) n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 500 mg ) and tetrahydrofuran ( 30 ml ). the solution was added tris ( hydroxymethyl )- methylamine ( 900 mg ) in tetrahydrofuran ( 30 ml ) and stirred at ambient temperatures for 16 h . at the end of reaction , suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with tetra - hydrofuran and acetone . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( hydroxy - ethoxyethylamino ) fullerenes ( 490 mg ). the physical data of poly ( hydroxyethoxyethylamino ) fullerenes are as follows : irν max ( kbr ) 3381 ( s , oh ), 2933 ( c -- h ), 2868 ( c -- h ), 1644 , 1565 , 1453 , 1354 , 1242 , 1117 ( s ), 1065 ( s ), and 531 cm 1 . 1 h nmr ( 300 mhz , dmso - d 6 ) δ 2 . 9 ( m , ch 2 ), 3 . 32 ( oh ), and 3 . 62 ( m , ch 2 ) synthesis of poly [ tris ( hydroxymethyl ) methylamino ] fullerenes , c 60 [-- nhc --( ch 2 oh ) 3 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 500 mg ) and tetrahydrofuran ( 30 ml ). the solution was added tris ( hydroxymethyl ) methylamine ( 900 mg ) in tetrahydrofuran ( 30 ml ) and stirred at ambient temperatures for 24 h . at the end of reaction , suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with tetrahydrofuran and acetone . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly [ tris ( hydroxymethyl ) methylamino ] fullerenes ( 570 mg ), which is soluble in dimethylformamide . the physical data of poly [ tris ( hydroxymethyl ) methylamino ] fullerenes are as follows : irν max ( kbr ) 3400 ( s , oh ), 2935 ( c -- h ), 2870 ( c -- h ), 1640 , 1565 , 1454 , 1354 , 1067 ( s ), and 582 cm - 1 . 1 h nmr ( 200 mhz , dmso - d 6 ) δ 2 . 91 ( ch 2 o ) and 3 . 75 ( oh ). synthesis of poly ( disuccinyloxyethylamino ) fullerenes , c 60 [-- n ( ch 2 ch 2 ococh 2 ch 2 co 2 h ) 2 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with succinic anhydride ( 250 mg ), p - toluenesulfonic acid ( 5 mg ), and benzene ( 25 ml ). the mixture was added poly ( diethanolamino ) fullerenes , c 60 [-- n ( ch 2 ch 2 oh ) 2 ] n , ( 200 mg ) and stirred at 75 ° c . for 2 h . at the end of reaction , suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with hot benzene . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( disuccinyloxyethyl - amino ) fullerenes , c 60 [-- n ( ch 2 ch 2 ococh 2 ch 2 co 2 h ) 2 ] n ( 210 mg ). the physical data of poly ( disuccinyloxyethylamino ) fullerenes are as follows : irν max ( kbr ) 3420 ( s ), 2933 ( c -- h ), 2644 , 2545 ( co 2 h ), 1729 ( s , c ═ o ), 1637 , 1413 , 1308 ,, 1209 , 1170 , 1078 , 1012 , 913 , 801 , 689 , 637 , and 564 cm - 1 . synthesis of poly ( p - methylphenylamino ) fullerenes , c 60 [-- nhc 6 h 5 ch 3 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 400 mg ) and tetrahydrofuran ( 30 ml ). the solution was added 4 - methylaniline ( 500 mg ) in tetrahydrofuran ( 10 ml ) and treated under sonication conditions for 25 min at ambient temperatures . at the end of reaction , all solvents in the solution were removed via vaccuo . the resulting semi - solids were redissolved in benzene , precipitated from hexane , and washed with hexane . these brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( p - methylphenylamino ) fullerenes , c 60 [-- nhc 6 h 5 ch 3 ] n , ( 450 mg ), which is soluble in benzene . the physical data of poly ( p - methylphenylamino ) fullerenes are as follows : irν max ( kbr ) 3347 , 3381 ( s ), 3039 ( c -- h ), 1604 ( s ), 1565 , 1499 ( s ), 1380 , 1341 , 1308 , 1249 , 1117 , 1058 , 1031 , 755 ( s ), 696 ( s ), and 505 cm - 1 . synthesis of poly ( n - phenyl - 1 , 4 - phenylenediamino ) fullerenes , c 60 [-- nhc 6 h 4 nhc 6 h 5 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 400 mg ) and tetrahydrofuran ( 30 ml ). the solution was added n - phenyl - 1 , 4 - phenylenediamine ( 500 mg , nh 2 c 6 h 4 nhc 6 h 5 ) in tetrahydrofuran ( 10 ml ) and treated under sonication conditions for 25 min at ambient temperatures . at the end of reaction , the resulting precipitates were separated by filtration and washed repeatedly with methylene chloride . the solids were redissolved in dimethylformamide , precipitated from a mixture of acetone and hexane , and washed with acetone . the light green solids were then dried in vacuum at 40 ° c . to afford the corresponding poly ( n - phenyl - 1 , 4 - phenylenediamino ) fullerenes , c 60 [-- nhc 6 h 4 nhc 6 h 5 ] n , ( 380 mg ). the physical data of poly ( n - phenyl - 1 , 4 - phenylenediamino ) fullerenes are as follows : irν max ( kbr ) 3394 ( n -- h ), 3045 , 2914 , 1598 , 1571 ( s ), 1512 ( s ), 1495 ( s ), 1453 ( w ), 1328 ( s ), 1249 ( w ), 1170 , 1117 , 1071 , 808 , 748 , 689 , and 498 cm - 1 . synthesis of poly ( phenylamino ) fullerenes , c 60 [-- nhc 6 h 5 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n or c 60 ( so 4 ) n ( 400 mg ) and tetrahydrofuran ( 30 ml ). the solution was added aniline or lithium aluminum anilinide ( lial ( hn -- c 6 h 5 ) 4 ) ( 500 mg ) in tetrahydrofuran ( 10 ml ) and treated under sonication conditions for 25 min at ambient temperatures . at the end of reaction , all solvents in the solution were removed via vaccuo . the resulting semi - solids were redissolved in benzene , precipitated from hexane , and washed with hexane . these brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( phenylamino ) fullerenes , c 60 [-- nhc 6 h 5 ] n , ( 445 mg ), which is soluble in benzene . the physical data of poly ( phenylamino ) fullerenes are as follows : irν max ( kbr ) 3447 , 3381 , 3039 , 1604 ( s ), 1565 , 1499 ( s ), 1380 , 1341 , 1308 , 1249 , 1117 , 1058 , 1032 , 894 , 755 ( s ), 696 ( s ), 545 , and 505 cm - 1 . synthesis of poly [ n , n &# 39 ;- bis ( 4 &# 39 ;- aminophenyl )- 1 , 4 - quinonenediimino ] fullerenes , c 60 [-- nh -- c 6 h 4 -- n ═ c 6 h 4 ═ n -- c 6 h 4 -- nh 2 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 400 mg ) and tetrahydrofuran ( 30 ml ). the solution was added n , n &# 39 ;- bis ( 4 &# 39 ;- aminophenyl )- 1 , 4 - quinonenediimine ( 500 mg , nh 2 -- c 6 h 4 -- n ═ c 6 h 4 ═ n -- c 6 h 4 -- nh 2 ) in tetrahydrofuran ( 10 ml ) with or without 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 500 mg ) and treated under sonication conditions for 25 min at ambient temperatures . at the end of reaction , the resulting precipitates were separated by filtration and washed repeatedly with methylene chloride . the solids were redissolved in dimethylformamide , precipitated from a mixture of acetone and hexane , and washed with acetone . the dark green solids were then dried in vacuum at 40 ° c . to afford the corresponding poly [ n , n &# 39 ;- bis ( 4 &# 39 ;- aminophenyl )- 1 , 4 - quinonene - diimino ] fullerenes , c 60 [-- nh -- c 6 h 4 -- n ═ c 6 h 4 ═ n -- c 6 h 4 -- nh 2 ] n , ( 380 mg ). the physical data of poly [ n , n &# 39 ;- bis ( 4 &# 39 ;- aminophenyl )- 1 , 4 - quinonenediimino ] fullerenes are as follows : irν max ( kbr ) 3434 , 2927 ( c -- h ), 2872 , 1604 ( s ) 1591 ( s ), 1501 ( s ), 1341 ( s ), 1150 ( s ), 1047 , 834 , 732 , 552 , and 464 cm - 1 . synthesis of 4 - aminobenzylphosphonic acid derivatives of c 60 , c 60 [-- nhc 6 h 4 ch 2 p (═ o ) ( oh ) 3 ] n a round - bottom reaction flask ( 25 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) ( 100 mg ) and tetrahydrofuran ( 15 ml ). the solution was added 4 - aminobenzylphosphonic acid ( 150 mg ) in tetrahydrofuran ( 5 ml ) and treated under sonication conditions for 30 min at ambient temperatures . at the end of reaction , suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with tetrahydrofuran and acetone . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding 4 - aminobenzylphosphonic acid derivatives of c 60 , c 60 [-- nhc 6 h 4 ch 2 p (═ o ) ( oh ) 3 ] n , ( 95 mg ) and 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 400 mg ). synthesis of amino acid derivatives of c 60 , poly ( l - tyrosinated ) fullerenes , c 60 [-- oc 6 h 4 ch 2 ch ( nh 2 ) co 2 h ] n to a solution of c 60 ( no 2 ) n ( 300 mg ) in tetrahydrofuran ( 50 ml ) in a round - bottom reaction flask was added l - tyrosine ( 500 mg , finely divided ) and 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 600 mg ). the mixture was stirred at 45 ° c . for a period of 16 h to give a dark reddish brown solid suspended solution . the suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with tetrahydrofuran , dimethylformamide , and acetone in sequence . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( l - tyrosinated ) fullerenes , c 60 [-- oc 6 h 4 ch 2 ch ( nh 2 ) co 2 h ] n , ( 410 mg ). the physical data of poly ( l - tyrosinated ) fullerenes are as follows : irν max ( kbr ) 3415 ( s ), 3200 , 2900 ( c -- h ), 2580 ( br , co 2 h ), 1592 ( s ), 1580 , 1557 , 1473 , 1400 , 1384 , 1326 , 1300 , 1202 , 1070 ( br , s ), 814 , 785 , 703 , 635 , 587 , and 514 cm - 1 . synthesis of 2 - hydroxymethylphenol derivatives of c 60 , c 60 [-- oc 6 h 4 ch 2 oh ] n to a solution of c 60 ( so 4 ) n ( 300 mg ) in tetrahydrofuran ( 50 ml ) in a round - bottom reaction flask was added 2 - hydroxymethylphenol ( 1 . 0 g ) with or without 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 400 mg ). the mixture was stirred at 50 ° c . for a period of 1 . 5 h to give a dark reddish brown solid suspended solution . the suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with water . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding 2 - hydroxymethylphenol derivatives of fullerene , c 60 [-- oc 6 h 4 ch 2 oh ] n , ( 410 mg ). the products are soluble in tetrahydrofuran . the physical data of 2 - hydroxymethylphenol derivatives of fullerene are as follows : irν max ( kbr ) 3375 ( s , broad ), 2928 ( c -- h ), 1649 , 1611 , 1593 , 1500 , 1455 , 1382 , 1228 , 1057 ( s ), 843 , 753 , and 526 cm - 1 . synthesis of poly ( 2 , 3 - dihydroxypropylmercapto ) fullerenes , c 60 (-- sch 2 ch ( oh ) ch 2 oh ) n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 350 mg ) and tetrahydrofuran ( 20 ml ). the solution was added 2 , 3 - dihydroxypropylthiol ( 500 mg ), 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 500 mg ), and triethylamine ( 1 g ) in methylene chloride ( 20 ml ) and stirred at 60 ° c . for 10 h . at the end of reaction , all solvents in the solution were removed via vaccuo to obtain gummy products . the resulting semi - solids were suspended in ethylacetate to yield brown solids , which were washed with ethylacetate . these brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( 2 , 3 - dihydroxypropylmercapto ) fullerenes , c 60 (-- sch 2 ch ( oh ) ch 2 oh ) n , ( 315 mg ). the physical data of poly ( 2 , 3 - dihydroxy - propylmercapto ) fullerenes are as follows : irν max ( kbr ) 3400 ( s , oh ), 2920 ( c -- h ), 2868 ( c -- h ), 1621 , 1400 , 1157 , 1046 , 1025 , 652 , 574 , and 511 cm - 1 . synthesis of mercaptosuccinic acid derivatives of fullerenes , c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 400 mg ), triethylamine ( 1 g ), and tetrahydrofuran ( 25 ml ). the solution was added 2 - mercaptosuccinic acid ( 550 mg ) and 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 600 mg ) in tetrahydrofuran ( 25 ml ) and stirred at 60 ° for 10 h . at the end of reaction , suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with tetrahydrofuran . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding mercaptosuccinic acid derivatives of fullerenes , c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n , ( 405 mg ). the physical data of these compounds are as follows : irν max ( kbr ) 3425 ( s , oh ), 2910 ( c -- h ), 2608 - 2534 ( co 2 h ), 1700 ( s ), 1623 , 1544 , 1392 , 1388 , 1307 , 1263 , 1202 , 1173 , 1056 , and 525 cm - 1 . synthesis of mercaptosuccinic acid derivatives of fullerenes , c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( so 4 ) n ( 400 mg ) and tetrahydrofuran ( 25 ml ). the solution was added 2 - mercaptosuccinic acid ( 550 mg ) in tetrahydrofuran ( 25 ml ) and 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 600 mg ) and stirred at 50 ° c . for 1 . 0 h . at the end of reaction , diethylether ( 30 ml ) was added to effect precipitation of solids which were separated by a centrifuge technique and repeatedly washed with a mixture of tetrahydrofuran and diethylether . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding mercaptosuccinic acid derivatives of fullerenes , c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n , ( 415 mg ) . the physical data of these compounds are as follows : irν max ( kbr ) 3425 ( s , oh ), 2910 ( c -- h ), 2608 - 2534 ( co 2 h ), 1700 ( s ) 1623 , 1544 , 1392 , 1388 , 1307 , 1263 , 1202 , 1173 , 1056 , and 525 cm - 1 . synthesis of poly ( hexylmercapto ) fullerenes , c 60 [-- sch 2 ch 2 ch 2 ch 2 ch 2 ch 3 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with sodium ( 100 mg ) and tetrahydrofuran ( 25 ml ). the mixture was added hexanethiol ( 420 mg ) and stirred for 1 h to afford a sodium hexylthiolate solution . the solution was then added c 60 ( no 2 ) n ( 400 mg ) in tetrahydrofuran ( 25 ml ) and stirred at ambient temperatures for an additional 2 h . at the end of reaction , all solvents in the solution were removed via vaccuo to obtain brown solid products , which were washed twice with water and acetone . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( hexylmercapto ) fullerenes , c 60 [-- sch 2 ch 2 ch 2 ch 2 ch 2 ch 3 ] n , ( 465 mg ). the physical data of these compounds are as follows : irν max ( kbr ) 2953 ( c -- h ), 2921 ( c -- h ), 2848 ( c -- h ), 1644 , 1459 , 1428 , 1384 , 1183 , 1045 , 793 , 729 , 577 , and 526 cm - 1 . synthesis of poly ( acetylacetonato ) fullerenes , c 60 [-- ch ( coch 3 ) 2 ] m a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with 2 , 4 - pentanedione ( 350 mg ) and tetrahydrofuran ( 20 ml ). the mixture was added lithium diisopropylamine in tetrahydrofuran ( 1 . 1 equiv of 2 , 4 - pentanedione ) and stirred for 1 h to afford the corresponding lithium acetylacetonate . the solution was then added c 60 ( no 2 ) n ( 400 mg ) in tetrahydrofuran ( 25 ml ) and stirred at ambient temperatures for an additional 2 h . at the end of reaction , the mixture was quenched with h 2 o to give precipitation of products , which were separated from the mother liquor by centrifuge . the solids were washed with diethylether ( 30 ml ), twice with benzene ( 20 ml each time ), twice with acetone ( 20 ml each time ), and dried in vacuum at 40 ° c . to afford brown solids of the corresponding poly ( acetyl - acetonato ) fullerenes ( 380 mg ), c 60 [-- ch ( coch 3 ) 2 ] m , where m ≧ n . the physical data of poly ( acetylacetonato ) fullerenes are as follows : irν max ( kbr ) 3401 ( s , oh ), 2979 ( c -- h ), 2927 ( c -- h ), 2881 ( c -- h ), 1702 , 1620 , 1426 , 1380 , 1361 , 1260 , 1183 , 1057 , 953 , and 532 cm - 1 . synthesis of poly [ bis ( 1 , 1 &# 39 ;- hydroxyaminoethyl ) methyl ] fullerenes , c 60 {-- ch [ c ( oh )( nh 2 ) ch 3 ] 2 } m a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with 2 , 4 - pentanedione ( 350 mg ) and tetrahydrofuran ( 20 ml ). the mixture was added lithium diisopropylamine in tetrahydrofuran ( 1 . 1 equiv of 2 , 4 - pentane - dione ) and stirred for 1 h to afford the corresponding lithium acetylacetonate . the solution was then added c 60 ( no 2 ) n ( 400 mg ) in tetrahydrofuran ( 25 ml ) and stirred at ambient temperatures for an additional 2 h . at the end of reaction , the mixture was quenched with ammonium iodide , nh 4 + i - , and stirred for 1 h . tetrahydrofuran was then removed from the solution to give semi - solid of products , which were washed repeatedly with water and acetone , and dried in vacuum at 40 ° c . to afford brown solids of the corresponding poly [ bis ( 1 , 1 &# 39 ;- hydroxyaminoethyl ) methyl ] fullerenes , c 60 {-- ch [ c ( oh )( nh 2 ) ch 3 ] 2 } m , where m ≧ n . the physical data of these compounds are as follows : irν max ( kbr ) 3400 ( s ), 3151 ( s ), 3043 , 2929 ( c -- h ), 2880 ( c -- h ), 1635 , 1401 , 1220 , 1035 , 773 , 630 , and 545 cm - 1 . synthesis of poly [ methoxyoligo ( ethyleneglycolated )] fullerenes , c 60 [-- o ( ch 2 -- ch 2 o ) 3 or 12 - 13 ch 3 ] m a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with polyethylene glycol monomethylether , ho ( ch 2 ch 2 o ) 3 ch 3 or ho ( ch 2 ch 2 o ) 12 - 13 ch 3 , ( 1 . 3 equiv of nitro groups in polynitro fullerene ) and tetrahydrofuran ( 20 ml ). the mixture was added sodium ( 1 . 2 equiv of -- oh ) and stirred for 1 h to afford the corresponding nao ( ch 2 ch 2 o ) p ch 3 . the solution was then added c 60 ( no 2 ) n ( 400 mg ) in tetra - hydrofuran ( 25 ml ) and stirred at ambient temperatures for an additional 2 h . at the end of reaction , water ( 0 . 2 ml ) was added and tetrahydrofuran was evaporated from the resulting solution to afford pale brown to brown solids . the solid was added into hexane ( 100 ml ) with stirring to give fine suspension of products . the solid precipitate was isolated by a centrifuge technique . it was then dissolved in tetrahydro - furan , filtered , and purified by chromatography ( sio 2 ) using ethylacetate as an eluent , where all unreacted polyethylene glycol monomethylether was removed ( r f = 0 . 85 ). solids in a brown band on the thin - layer chromatographic plate ( r f = 0 . 2 ) were recovered and dried in vacuum at 40 ° c . to afford pale brown to brown solids of the corresponding poly [ methoxy - oligo ( ethylene glycolated )] fullerenes , c 60 [-- o ( ch 2 ch 2 o ) 3 ch 3 ] m or c 60 [-- o ( ch 2 ch 2 o ) 12 - 13 ch 3 ] m , where m ≧ n . the physical data of c 60 [-- o ( ch 2 ch 2 o ) 12 - 13 ch 3 ] m are as follows : irν max ( kbr ) 3435 ( s ), 2920 ( c -- h ), 2874 ( c -- h ), 2835 , 1593 ( s ), 1453 , 1410 , 1367 , 1270 , 1105 ( s ), 949 , 776 , 623 , and 455 cm - 1 . 1 h nmr ( 300 mhz , dmso - d 6 ) δ 3 . 22 ( ch 3 ) and 3 . 40 ( ch 2 ). a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with either ho -- y 1 , h 2 n -- y 1 , hs -- y 1 , ho -- c 6 h 4 -- y 1 , hs -- cs -- y 1 , or h 2 n -- co -- y 1 ( 1 . 3 equiv of nitro groups in polynitro fullerene ) and tetrahydrofuran ( 20 ml ). the mixture was added superhydride ( 1 . 1 equiv of -- oh , -- nh 2 , or -- sh groups , 1 . 0 m in tetrahydrofuran ) and stirred for 1 h to afford the corresponding lithium salts of lio -- y 1 , linh -- y 1 , lis -- y 1 , lio -- c 6 h 4 -- y 1 , lis -- cs -- y 1 , or lihn -- co -- y 1 . the solution was then added c 60 ( no 2 ) n ( 400 mg ) in tetrahydrofuran ( 25 ml ) and stirred at ambient temperatures for an additional 2 h . at the end of reaction , tetra - hydrofuran was evaporated from the resulting solution to afford pale brown to brown solids . the solid was added into diethylether ( 100 ml ) with stirring to give fine suspension of products . the solid precipitate was isolated by a centrifuge technique . it was then washed twice with diethyl ether ( 20 ml each time ), twice with acetone ( 20 ml each time ), and dried in vacuum at 40 ° c . to afford pale brown to brown solids of the corresponding functionalized polyorgano fullerene derivatives , c 60 (-- a -- b -- z ) m , where m ≧ n , a , independently , is -- o --, -- nh --, -- s --, -- o -- c 6 h 4 --, -- hn -- co --; b , independently , is -- r -- o --[ si ( ch 3 ) 2 -- o --] 1 - 100 , c 1 - 200 alkyl , c 6 - 50 aryl , c 7 - 100 alkylaryl , c 7 - 100 arylalkyl , ( c 2 - 30 alkyl ether ) 1 - 100 , ( c 6 - 40 aryl ether ) 1 - 100 , ( c 7 - 60 alkylaryl ether ) 1 - 100 , ( c 7 - 60 arylalkyl ether ) 1 - 100 , ( c 2 - 30 alkyl thioether ) 1 - 100 , ( c 6 - 40 aryl thioether ) 1 - 100 , ( c 7 - 60 alkylaryl thioether ) 1 - 100 , ( c 7 - 60 arylalkyl thioether ) 1 - 100 , ( c 2 - 50 alkyl ester ) 1 - 100 , ( c 7 - 60 aryl ester ) 1 - 100 , ( c 8 - 70 alkylaryl ester ) 1 - 100 , ( c 8 - 70 arylalkyl ester ) 1 - 100 ; each z , independently , is -- c -- d --, wherein each c , independently , is -- r --, -- r -- ar --, -- ar -- r --, or -- ar --; and each d , independently , is -- h , -- o -- si ( ch 3 ) 3 , -- s -- ch 2 -- ar , -- so 3 - , -- co 2 - , -- o -- po 3 - 2 , -- o -- po ( o )-- o -- po 3 - 2 , or -- nr 1 r 2 , wherein each of r , r 1 , r 2 , r 3 is independently c 1 - 20 alkyl and each ar , independently , is aryl . synthesis of polyhydroxymercaptosuccinic acid derivatives of fullerenes ( fssa -- oh ), c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n ( oh ) m a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with mercaptosuccinic acid derivatives of fullerenes ( fssa , 200 mg ), c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n prepared by a method shown in example 13 , sodium hydroxide ( 2 . 5 g ), tetrabutylammonium hydroxide ( 1 . 0 ml , 2 . 0 m in h 2 o ), and h 2 o ( 20 ml ). the mixture was stirred at 40 ° c . for 4 h . at the end of reaction , the resulting solution was added methanol ( 200 ml ) to effect precipitation of brown solids . the precipitated solid was isolated by a centrifuge technique . it was then washed twice with methanol ( 20 ml each ) and dried in vacuum at 40 ° c . to afford the corresponding sodium salts of polyhydroxymercaptosuccinic acid derivatives of fullerene ( 215 mg ), c 60 [-- sch 2 ( co 2 na ) ch 2 co 2 na ] n --( oh ) m . the treatment of these sodium salts with an aqueous solution of hcl ( 1 . 0 n ) at ambient temperature for 0 . 5 h gave c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n ( oh ) m ( fssa -- oh ) in a quantitative yield . the physical data of c 60 [-- sch 2 ( co 2 na ) ch 2 co 2 na ] n --( oh ) m are as follows : irν max ( kbr ) 3450 ( broad , s ), 2925 ( w , c -- h ), 2870 ( w , c -- h ), 1623 ( s ), 1589 ( s ), 1392 , 1055 , and 690 ( broad ) cm - 1 . 1 h nmr ( 200 mhz , d 2 o ) δ 3 . 59 ( t , ch ), 2 . 82 ( broad , oh ), and 2 . 62 ( d , ch 2 ). from the above description , one skilled in the art can easily ascertain the essential characteristics of the present invention , and without departing from the spirit and scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions . thus , other embodiments are also within the claims .	2
referring now to fig1 - 6 , there is shown a coil form 10 in accordance with one form of the invention . the coil form 10 includes a generally cylindrical 12 having axially spaced circular side member or flanges 14 , 16 . a reference surface 12a is provided to cooperate with coil winding machinery and insure that the coil form 10 is positioned properly during winding . carried along the circular side flanges 14 , 16 are respectively rectangular plate shape members 18 , 20 . the members 18 , 20 are disposed in generally aligned relationship and is best seen in fig1 . ordinarily the coil form 10 will be manufactured of a synthetic material such as nylon . the material used may in some forms of the invention be a glass filled nylon material which is particularly suitable for high temperature applications . the plate shaped members 18 , 20 ordinarily will be molded in a manner which need not have the elasticity inherent in known plastic hinges . the molding process ordinarily will not require any special treatment to improve the hinge characteristics of the material and the coil form 10 ordinarily will be merely injection molded . instead , it is sufficient to have merely enough elasticity to enable folding of the plate shaped members 18 , 20 to the engaged position shown in fig6 . once folded to this position no further bending is required . the plate shaped member 18 includes upstanding side flanges 22 , 24 , and 26 . a gap 18 is disposed intermediate the flange 22 and the flange 24 . similarly , a gap 30 is disposed intermediate the flange 26 and the flange 24 . a reinforcing rib 32 is disposed on the inner face of the upstanding flange 26 as seen in fig1 . although not visible in fig1 a reinforcing rib is similarly positioned on the interface of the upstanding flange 22 . the plate shaped member 20 includes locking members 34 , 34 which have a generally wedge shaped cross section and which engage the slots 28 and 30 . ordinarily the slots 28 , 30 will have steps disposed adjacent to the open end thereof and the wedge shaped members 34 will also have steps as shown in fig1 . the cooperating steps are dimensioned and configured for locking engagement when the two plate shaped members 18 , 20 are moved to the positioned illustrated in fig6 . the shape of the steps in the slots 28 , 30 is visible in fig6 . the ribs 32 further insure locking cooperation of the slots 28 , 30 with the wedge shaped members 34 by insuring that little twisting occurs which might inadvertently disengage the cooperating surfaces . also disposed on the plate shaped member 20 are a plurality of generally wedge shaped bosses 36 which are disposed in a matrix of rows and columns . ordinarily the bosses 36 will be oriented so that the wedge shaped cross section has the elongated &# 34 ; peak &# 34 ; thereof disposed in generally aligned relationship with the axis of the cylindrical member 12 as well as with the elongated &# 34 ; peak &# 34 ; of the wedge shaped member 34 . the plate shaped members 18 , 20 will be respectively joined to the generally circular members 14 , 16 by tabs 19 , 21 . these tabs 19 , 20 are intended to bend at the generally tangential intersection with the generally circular members 14 , 16 . holes 19a are proved to insure that the generally l - shaped assemblies of the plate 19 and the tab 19a bend also at the generally tangential intersection with the generally circular member 14 . in a similar manner the tab 21a is also provided with similar holes to insure that the generally l - shaped sub - assembly of the plate member 20 and table 21 will bend along the line of intersection with the generally circular plate or end member 16 . as shown in fig2 automatic coil winding machinery is ordinarily used to position a bifilar coil of copper wire 40 intermediate the circular flanges 14 , 16 . the axial extremities of the copper windings are indentified by the numerals 42 , 44 , 46 , and 48 . ordinarily a portion of the coil is covered with tape 15 as shown in fig2 . ordinarily the upstanding bosses 36 will be disposed in four discrete area rows extending in a direction generally aligned with the axis of the cylindrical member 12 . the space is intermediate these rows are occupied by 3 terminations 54 , 56 and 58 as best shown in fig3 . it will be understood that it is normal practice to provide only three terminations 54 , 56 and 58 even though there are four axial extremities 42 , 44 , 46 and 48 of the windings 40 . this is possible , of course , since two of the axial extremities are connected to a single termination . as also seen in fig3 the axial extremity 42 - 48 are connected to the terminations 54 - 58 by twisting . thereafter , as shown in fig4 diagonal cutters 60 are utilized to cut the upstanding axial extremities 42 - 48 in the stripped ends of the terminations 54 - 58 to a suitable length . the utilization of discrete wedge shaped bosses 36 is ordinarily preferable to a single continuous channel for each termination wire 54 , 56 , and 58 because the discrete bosses 26 insure better gripping of the terminations 54 , 56 , and 58 and also make insertion of the terminations 54 , 56 , and 58 into the spaces intermediate the bosses 36 easier . thereafter as shown in fig5 the axial extremities 42 - 48 and the terminations and stripped ends of the terminations 54 - 58 are dipped into a reservoir 62 of molten solder . after this has been accomplished the generally plate shaped members are closed together in locking engagement as shown in fig6 . when so positioned the terminations 54 - 58 extend intermediate the free end of the plate shaped member 20 and the flange 24 of the member 18 . we see that the locking engagement of the wedge shaped members 34 , 34 with the spaces 28 , 30 insures a positive and permanent relationship between the plate shaped members 18 , 20 . it will be further seen that the apparatus in accordance with the invention results in a positive locking arrangement which has a pleasing appearance but which is highly durable , in addition the recited steps can be performed very rapidly with a minimum of material and labor costs .	7
porous pellets are prepared by compacting powder to form porous anode bodies ( fig5 ). the pellets may be made from any suitable conductive material . preferred materials include metals , conductive metal oxides or conductive metal nitrides . more preferably the anode comprises a valve metal , conductive valve metal oxide or a conductive metal nitride with preferred valve metals being tantalum , aluminum , niobium , hafnium , zirconium , titanium , tungsten and alloys of these elements . tantalum and niobium oxide are the preferred materials . tantalum is the most preferred material . many types of binders or lubricants , such as stearic acid , polypropylene carbonate , polyethylene carbonate , and n , n ′- ethylene distearylamide , polyalkylene carbonates and polyethyleneglycol , can be incorporated into the anodes and later removed either by soaking or thermal decomposition . a particularly preferred polyethylene carbonate is qpac 25 and a particularly preferred polypropylene carbonate is qpac 40 . a particularly preferred n , n ′- ethylene distearylamide is acrowax c . the compacted pellets may then be processed using an abrasive process , in which contact among the compacted pellets , or among pellets and grinding media ( sand , milling media such as metal / ceramic beads , sintered tantalum pellets , al 2 o 3 , sic , zr , synthetic plastic fragments , nut shells , ground hardwood , pressurized liquid , etc .) serves to break down the corners , edges , and surfaces of the pellets ( fig6 ). grinding media is a material , also referred to as milling media , which acts to abrade an item placed therein and moved . in general , the abrasive process employs the mechanical means , preferably but not limited to , tumbling a large volume of pellets in a cylindrical barrel shaped device made from lined or unlined metal , rigid plastic or ceramic rotating about its primary axis situated substantially horizontal . vibrating , blasting , and grinding with milling media may be employed to equivalently achieve abrasive results indicative of those processes . anode tumbling without added media , as described here , is the preferred method because the nature of the process dictates that material is removed from the anode bodies &# 39 ; corners , edges , and surfaces — in descending degree by nature of their geometric exposure . additionally , tumbling as described here is preferred because it achieves the desired results without the need to use any foreign material that could degrade the purity of the anode bodies such as by inclusion in the pores , nor needs additional processing to be removed or separated from the anode bodies . the pellets are then sintered to bond the compacted powder particles together into solid anode bodies that still possess their porous construction . the sintered pellet is then anodized using standard procedures , including but not limited to , those described in u . s . pat . no . 7 , 248 , 462 to form the oxide film which serves as the dielectric of the capacitor . the internal surfaces of the anodic oxide film are next coated with a primary cathode layer . manganese dioxide may be applied as a primary cathode layer by applying manganous nitrate solution and converting the nitrate to manganese dioxide via heating in a pyrolysis oven . typically the conversion step is carried out between 250 ° and 300 ° c . alternatively , an intrinsically conductive polymer can be employed as the primary cathode layer . the conductive polymer material is typically applied as a monomer using either a chemical oxidative process such as is described in u . s . pat . no . 6 , 001 , 281 or by applying a pre - formed polymer slurry preferably of polythiophene , polypyrrole or polyaniline such as is described in u . s . pat . no . 6 , 391 , 379 . in the case of a chemical oxidative process , byproducts of the reaction are removed by washing and typically multiple applications and washings are required prior to a reanodization process used to isolate the defect sites in the dielectric . the pellets are then placed in suitable electrolyte bath , for instance a dilute aqueous phosphoric acid solution with conductivity in the range 50 to 4000 micos / cm . voltage is applied to drive the process which causes isolation and healing of the dielectric flaw sites this process may not be required in the case of applying a preformed ( prepolymerized ) polymer slurry to the anodes . the process is repeated to insure complete coverage of the internal and external dielectric surfaces . the components are subsequently dipped in a carbon suspension to coat the external surfaces of the primary cathode material . a silver layer applied to the device with a commercial silver paint to form an external coating . fig1 depicts the manner in which a liquid or slurry pulls away from an edge or corner due to surface tension effects . especially in the case of capacitors coated with polymer slurry , the cathode failure site occurs predominantly on the corners of the anode which are poorly coated by the polymer slurry due to surface tension of the more viscous slurry . polymer slurries of intrinsically conductive polymers are an alternative coating methodology to the formation of polymer from a monomer and catalyst on the surface of the oxidized pellet . slurries may be applied using a cross - linking agent as disclosed in u . s . pat . no . 6 , 451 , 074 . the use of slurries reduces the number of coating steps when making the capacitor and reduces the loss of monomer due to contamination . u . s . published application no . 2006 / 0236531 discloses polythiophene particles with filler as a coating material of conductive polymer . any intrinsically conductive polymer may be used . polyaniline may be preferred due to ease of handling . coating thickness should be at least 0 . 25 micrometers , preferably at least 1 micrometer and optimally at least 3 micrometers to obtain complete coverage of all appropriate surfaces . the use of anode pellets exhibiting curvature where the primary surfaces meet , particularly at the end and / or sides away from the anode lead wire , allows reliable mechanical dipping into the slurry with minimal deposition of polymer on the anode lead . the capacitor precursor then may be coated with graphite and ag , a cathode lead attached and final assembly performed . it is preferred that the pellet be abraded until the edge sharpness is removed . the edge sharpness is considered removed herein when the pellet has a minimum radius of curvature of at least 0 . 0076 cm ( 0 . 003 inches ). more preferably the pellet has a minimum radius of curvature of at least 0 . 0127 cm ( 0 . 005 inches ) and most preferably at least 0 . 025 cm ( 0 . 010 inches ). a fluted anode is one which has surfaces which are not substantially flat . the variations in the surface may be , but are not necessarily , symmetrical or repeated in a pattern . examples of fluted anodes may be found in u . s . pat . nos . 7 , 154 , 742 ; 7 , 116 , 548 ; 6 , 191 , 936 ; and , 5 , 949 , 639 . the capacitors disclosed in these references are pressed to have substantially flat ends where anode lead projects and at the opposite end . most have flat sides except for the penetrations into the body of the anode . multiple sharp edges are present and present challenges when coatings are applied . modifications of the external surfaces to remove sharp corners and edges results in improved coating . internal surfaces , meaning those wholly within the interstices of the flutes ( i . e . at acute not obtuse angles ), need not be modified . in preferred embodiments , multiple flat wires are used as anode leads . fig1 depicts prior art in which the top edges of a surface mount capacitor were chamfered to reduce stress on those edges . fig1 is a depiction of an anode with chamfered top edges as described in u . s . pat . no . 5 , 959 , 831 ( maeda , et al .). fig1 depicts chamfering of bottom edges as depicted in us 2005 / 0231895 a1 . fig1 is a picture of capacitors following a breakdown test indicating the failures occurred on the corners of the anode . in a breakdown voltage test , a power supply , resistor , fuse , and capacitor are placed in series . the voltage applied to the capacitor is increased until the capacitor breaks down as indicated by the blown fuse . especially in the case of capacitors with polymer slurry cathode the failure site occurs predominantly on the corners of the anode which are poorly coated by the polymer slurry . fig2 shows a rectangular prism or a parallelopiped . the x , y , and z axes are defined with respect to origin “ o .” the exposed surfaces are labeled xy , xz , and yz . an edge is defined as the intersection of two surfaces . a corner ( or point ) is defined as the intersection of three surfaces or three edges . modification of an edge can be defined by reference to fig2 . fig2 represents an anode in perspective view . a surface xz with a length x ′ and width z ′ represents a first external surface of an anode . a surface yz with a length y ′ and width z ′ represents a second external surface of an anode . for conventional anodes xz and yz meet to form a right angle at an edge . in an edge modified design the first surface xz will deviate at point a and distance x ″ from the edge , e , which is the projected intersection of xz and yz . the second surface of the anode will deviate from yz at point b and distance y ″ from e . this deviation creates at least one additional surface , herein defined as a transition surface , ts . in one embodiment the deviation is a straight diagonal line between points a and b wherein the transition surface creates a chamfer . in another embodiment the transition surface is a non - linear , curved , or radiused edge . edge modified designs as defined here refers to any deviation of the external surface from xz and yz such that : the concept can be extended to a third dimension of a conventional rectangular prism . a corner , c , is defined by the projected intersection of three surfaces yz , xz and xy . the surface xz with a length x ′ and width z ′ representing an external surface of an anode . in a corner modified design the surface xz will also deviate at point d and distance z ″ from c . a corner modified design as defined herein refers to any deviation of the external surfaces such that : in a conventional smt the anode shape is a regular rectangular prism as illustrated in fig2 . the surfaces all intersect at right angles ( or approximations thereof ), providing six surfaces and twelve edges . according to this invention , most or all of the edges are modified to form transition surfaces . the transitions may be flat as in a traditional chamfer or bevel . alternately , the transition may form multiple chamfers including , in the limit , a curved surface such as would be obtained using a corner round router bit . when rounded edges intersect , a quarter of a hemisphere is formed which maybe regular , as when all radii of generation are equal or compound when the radii of the generating curves differ . referring again to fig2 , it is apparent that the size of a straight bevel or chamfer can be defined in terms of x ″, y ″, and / or z ″. since there are twelve edges and eight corners formed by six surfaces , a great variety of shapes can be formed when the lengths x , y and z differ from each other or when different edges are chamfered or when only corners are chamfered . depending upon the size of the anode - case size - different transition surface shapes and sizes are found to be preferred . as an example of a body having a transition surface , reference is made to fig1 . anode body 71 , having six planar sides 73 , 74 , 75 , 76 , 77 , and 78 and an anode lead 79 has been chamfered at each corner to provide transitional planar surfaces 81 , 82 , 83 , 84 , 85 , 86 , 87 , and 88 . this shape directly addresses the problem with corner coating as illustrated in fig1 a and fig1 b . this is a corner chamfer anode . when edges and corners are all curved , the result is an edgeless shape as shown in fig1 . three transitional surfaces are present , a short side curved transitioned surface 91 , a long side curved transitional surface 93 and a corner quarter hemisphere 95 . in the preferred embodiment , all radii of generation are equal but such is not necessary . for small case sizes a greater radius in the z direction may be preferred . when the curvature at the edges in the yz surface is expanded to become a continuous curve , the resultant figure is an obround prism as shown in fig1 . the yz surface has been replaced with a curved surface , such as semicircular in cross - section . in the preferred embodiment , the transition surfaces form the xy surface and from the semicircular side are radiused into the xz surface ( cf . 103 ) and the transition surface from the xy surface ( cf . 105 ) are radiused into the xz surface . such an anode has no sharp edges save for some flashing at the points of juncture of the dice employed . the xy surface of an oblong prism may be flat or curved . extrapolation of the edgeless obround shape of fig1 is the edgeless cylinder of fig1 . a cylindrical anode has traditional round sides 107 , but the transition surface 111 to the flat top 109 ( and bottom , not shown ) is chamfered or , in the drawing , rounded or curved to make a smooth transition from side to top . when the basic prism shape is obround , the edges and corners may have consistent or changing radii , but the chord for the curve is defined using the same criteria as for a chamfered surface . when the figure is a cylinder , the radius of the circle of origin becomes one length , and the height of the cylinder becomes the other length , i . e ., the intersection of planar surface and circumferential surface is characterized as 0 . 03 mm & lt ; r & lt ; r and 0 . 03 mm & lt ; h & lt ; h / 2 where r and h are the radius of the circle of origination and h the height of the cylinder . the edgeless cylinder has particular application in hermetically sealed leaded devices . failure site analysis reveals that the vast majority of failures , up to 95 %, will appear on the edges of the cylindrical anode . these edges are most susceptible to any outside forces applied to the case wall ( fig1 ). in between these edges , the pellet structure offers a strong resistive structure that will spread the force and absorb it . in between the edge and the sealed , top of the case , the case can compress to absorb the force . at the edges , the forces can create a fracturing force on the pellet . the relative stresses are in the order s 1 , & lt ; s 2 , & lt ; s 3 . the top edge ( nearest the anode seal ) is more susceptible than the bottom edge ( nearest the cathode lead ) as the closed end of the barrel adds stiffness here . in order to mitigate this failure mechanism the edges of the pellet can be rounded . by eliminating the sharp edge ( fig2 ), the amount of force required to fracture or chip the pellet increases tremendously . once the pellet is soldered in the case , the sharp edges would have been eliminated and replaced with a tapering solder thickness . the radiused or rounded elements nearest the outer diameter have capabilities of spreading blunt forces through the case . the radiused elements furthest from the outer diameter have thicker solder which creates additional buffering . it has been found that a second approach to enhancing coverage is surprisingly effective . an anode having cut - away portions at the corners — hereinafter a corner cut anode — is effective in collecting conductive polymer at the corners during the coating process . fig2 shows a preferred corner cut anode sintered body . at the juncture of three surfaces 73 , 75 and 78 , two cuts are made to create two additional transitional surfaces , 121 and 123 . this pattern is repeated at the other seven corners to form “ pockets .” the improvement may be seen in fig2 when contrasted with fig2 and fig2 . while not being bound by any theory , it is seemed that monomer , and subsequently polymer , accumulates on the surfaces of the transition surface 121 , 123 and compensates for the thin or incomplete layers found in standard rectangular parallelepiped shape for anodes . the corner cut anode seems particularly suitable for dipping in polymer slurries . polymer slurries of intrinsically conductive polymers are an alternative coating methodology to the formation of polymer from a monomer and catalyst on the surface of the oxidized pellet . slurries may be applied using a cross - linking agent as disclosed in u . s . pat . no . 6 , 451 , 074 . the use of slurries reduces the number of coating steps when making the capacitor and reduces the loss of monomer due to contamination . u . s . published application no . 2006 / 02336531 discloses polythiophene particles with filler as a coating material of conductive polymer . any intrinsically conductive polymer may be used . polyaniline is preferred due to ease of handling . coating thickness should be at least 0 . 25 micrometers , preferably at least 1 micrometer and optimally at least 3 micrometers to obtain complete coverage of all edges . the use of anode pellets with transition surfaces at the end and / or sides away from the anode lead allows reliable mechanical dipping into the slurry with minimal deposition of polymer on the anode lead . the capacitor precursor then may be coated with graphite and ag , a cathode lead attached and final assembly performed . a fluted anode is one which has surfaces which are not substantially flat . the variations in the surface may be , but are not necessarily symmetrical or repeated in a pattern . examples of fluted anodes may be found in u . s . pat . nos . 7 , 154 , 742 ; 7 , 116 , 548 ; 6 , 191 , 936 ; and , 5 , 949 , 639 . the capacitors disclosed in these references are pressed to have substantially flat ends where anode lead projects and at the opposite end . most have flat sides except for the penetrations into the body of the anode . multiple sharp edges are present and present challenges when coatings are applied . modifications of the external surfaces to remove sharp angles results in improved coating . the edges and / or corners may be chamfered or curved in the manner of fig1 and 16 to achieve a more uniform coating of the polymer . triangular corners as shown in fig1 and notched corners such as shown in fig2 are also preferred . internal surfaces , meaning those wholly within the interstices of the flutes need not be modified . in preferred embodiments , multiple flat wires are used as anode leads . commercial electronic grade 22 , 000 cv / g tantalum powder was pressed to form anodes to a density of 5 . 5 g / cc with dimensions 4 . 70 × 3 . 25 × 1 . 68 mm using a radial action press . the punches of the press were modified to create a notch or v - cut in each corner of the anode as depicted in fig2 . this modification to the corners is referred to as corner cut anode designs . the sintered anodes were anodized at 100 volts in an aqueous phosphoric acid electrolyte maintained at 80 ° c . the parts were subsequently dipped in liquid suspensions containing pre - polymerized polyethelyenedioxthiophene ( pedt ). photomicrographs were taken to determine the degree of polymer coverage on the corners of the anodes ( fig2 ). after application of a conductive polymer slurry the parts were dipped in a carbon suspension used for commercial tantalum conductive polymer capacitors . the anodes were dipped in an electronics grade silver paint prior to assembly and encapsulation to form surface mount tantalum capacitors . after encapsulation 25 volts was applied to the capacitors and leakage was read through a 1 k ohm resistor after allowing 60 seconds for the capacitors to charge . the results were plotted in fig2 . commercial electronic grade 13 , 000 cv / g tantalum powder was pressed to a density of 5 . 5 g / cc with dimensions 4 . 70 × 3 . 25 × 1 . 70 mm using a radial action press . conventional punches were used which created well defined corners typical of anodes used in the industry . the sintered anodes were anodized to 130 volts in an aqueous phosphoric acid electrolyte maintained at 80 ° c . the parts were subsequently dipped in liquid suspensions containing pre - polymerized polyethelyenedioxthiophene ( pedt ). photomicrographs were taken to determine the degree of polymer coverage on the corners of the anodes ( fig2 ). after application of the conductive polymer slurry the parts were dipped in a carbon suspension used for commercial tantalum conductive polymer capacitors . the anodes were dipped in an electronics grade silver paint prior to assembly and encapsulation to form surface mount tantalum capacitors . after encapsulation 25 volts was applied to the capacitors and leakage was read through a 1 k ohm resistor after allowing 60 seconds for the capacitors to charge . the results and comparison were plotted in fig2 wherein dcl is direct current leakage and pe is post - encapsulation . a comparison of the polymer coverage and leakage distributions after encapsulation demonstrates the improvements obtained with the corner cut anode design relative to prior art . commercial electronic grade 13 , 000 cv / g tantalum powder was pressed to a density of 5 . 5 g / cc with dimensions 4 . 57 × 3 . 10 × 1 . 63 mm using a pill style press . the lead wire is attached after pressing with this type of press . the action of this style press generates anodes with rounded corners on one side of the anode . the corners on the opposite side of the anode are sharp , well defined corners . the sintered anodes were anodized to 130 volts in an aqueous phosphoric acid electrolyte maintained at 80 ° c . the parts were subsequently dipped in liquid suspensions containing pre - polymerized polyethelyenedioxthiophene ( pedt ). photomicrographs were taken to determine the degree of polymer coverage on the rounded corners of the anodes ( fig2 ). photomicrographs taken of the opposite side of the anode demonstrates the poor polymer coverage on the sharp well defined corners of the anode ( fig2 ). these pictures clearly indicate the need to modify the corners of the anodes in order to obtain sufficient coverage using slurries or suspensions to apply cathode layers . in order to eliminate the corners completely an axial press was used to press obround anodes . commercial electronic grade 22 , 000 cv / g tantalum powder was pressed to an average density of 5 . 5 g / cc with dimensions 4 . 70 × 3 . 25 × 0 . 81 mm . an obround shaped die was used to press an anode without corners . the sintered anodes were anodized to 100 volts in an aqueous phosphoric acid electrolyte maintained at 80 ° c . the parts were subsequently dipped in liquid suspensions containing pre - polymerized polyethelyenedioxthiophene ( pedt ). photomicrographs were taken to determine the degree of polymer coverage on the anodes . polymer coverage at the top of the anode , where the density was less than 5 . 5 was acceptable ( fig2 ). however , at the bottom of the anode where the press density was greater than 5 . 5 the edges of the anode were not covered with polymer ( fig3 ). the density gradient observed in these anodes is characteristic of anodes produced on an axial press . in the process of preparing anodes 50 kcv / gram ta powder from h . c . starck was mixed with n , n ′ ethylene diamine distearamide and pressed to form a rectangular parallelepipeds such as shown in fig5 . the pressed anode bodies were put into a tantalum lined grinding jar and rolled for 60 minutes at 20 rpm . the anode bodies were removed from the grinding jar and cleaned with compressed air , followed by sintering for 15 minutes at 1520 ° c . in a vacuum oven . fig9 shows an anode body before tumbling . fig1 shows an anode body after tumbling . table 1 summarized the electrical results of ta capacitors after surface mounting . the polymer slurry coated anodes processed using the tumbling process show the noticeable reduction in electrical short failures . the invention has been disclosed in regard to preferred examples and embodiments which do not limit the scope of the invention disclosed . modifications apparent to those with skill in the art are subsumed within the scope and spirit of the invention . the disclosed invention provides a method of processing anode bodies that ultimately improves quality , reliability , and durability of capacitors in electronic devices .	8
fig1 is a diagram showing an overall structure of the fuel vapor processing system embodying the present invention , in which the parts corresponding to those of the prior art shown in fig6 are denoted with like numerals without repeating the description of such parts . referring to fig1 , a fuel tank 1 and a canister 2 are connected to each other via a fuel vapor passage 3 , which is branched into a pair of branch passages 3 a and 3 b at the end communicating with the fuel tank 1 . the first branch passage 3 a is selectively closed by a float valve 4 provided at the fuel tank end of the first branch passage 3 a , and the second branch passage 3 b is selectively closed by a cut valve 5 provided at the fuel tank end of the second branch passage 3 b . an intermediate part of the second branch passage 3 b is provided with a two - stage check valve 6 which comprises a high set - pressure valve 7 and a low set - pressure valve 8 incorporated in the high set - pressure valve 7 as shown in fig2 . the high set - pressure valve 7 comprises a valve chamber 7 a communicating with the canister end of the second branch passage 3 b , a port 7 b communicating with the fuel tank end of the second branch passage 3 b , a cup - shaped valve member 7 c axially slidably received in the valve chamber 7 a so as to selectively close the port 7 b , and a compression coil spring 7 d resiliently urging the valve member 7 c in the direction to close the port 7 b . the low set - pressure valve 8 comprises a cylindrical valve housing 8 a formed inside the valve member 7 c and integrally attached thereto , a port 8 b formed in the bottom wall of the valve member 7 c so as to communicate the valve housing 8 a with the fuel tank end of the second branch passage 3 b , a ball - shaped valve member 8 c received in the valve housing 8 a so as to selectively close the port 8 b , and a compression coil spring 8 d resiliently urging the valve member 8 c in the direction to close the port 8 b . the interior of the valve housing 8 a communicates with the valve chamber 7 a of the high set - pressure valve 7 . the first prescribed pressure p 1 at which the valve member 8 c is pushed open against the spring force of the compression coil spring 8 d is smaller than the second prescribed pressure p 2 at which the valve member 7 c is pushed open against the spring force of the compression coil spring 7 d ( p 1 & lt ; p 2 ). under normal condition or when the internal pressure of the fuel tank 1 is not higher than that of the canister 2 , the ports 7 b and 8 b of the check valve 6 are closed by the valve members 7 c and 8 c , respectively , as illustrated in fig2 . when the fuel tank 1 is filled full , the first branch passage 3 a is closed by the float valve 4 , and any additional filling of fuel causes the internal pressure of the fuel tank 1 to rise . the resilient biasing force of the compression coil spring 8 d is selected in such a manner that the pressure rise due to the filling of the fuel tank beyond the tank full state is enough to push open the valve member 8 c against the spring force of the compression coil spring 8 d . therefore , when the fuel tank is filled beyond the tank full state , the low set - pressure valve 8 opens ( see fig3 a ). thus , the fuel vapor which is displaced from the fuel tank 1 by the filling of fuel into the fuel tank 1 beyond the tank full state is allowed to be conducted to the canister 2 as indicated by the arrows in fig3 a , instead of the fuel fill pipe 9 so that the fuel vapor is successfully absorbed by the canister 2 and prevented from being released to the atmosphere from the fill pipe 9 . by reducing the opening area of the port 8 b , the flow rate of the fuel vapor directed to the canister 2 is controlled . therefore , a certain level of pressure rise can be preserved in the fuel tank 1 so that the froth of fuel is allowed to rise in the fill pipe 9 during the time of filling the tank beyond the tank full state , and the sensor equipped to the fuel fill nozzle g is enabled to detect the rise of the froth and shut off the supply of fuel without any problem . the internal pressure of the fuel tank 1 may rise to a significant level even when fuel is not being filled into the fuel tank 1 if the surrounding temperature is high . such an excessive pressure is desired to be removed as soon as possible , but it is not desirable to release fuel vapor to the atmosphere to remove the high pressure . such a pressure rise opens the low set - pressure valve 8 , but the flow rate is so limited that the pressure rise may continue . this problem is resolved by the high set - pressure valve 7 provided in the check valve 6 . when the internal pressure of the fuel tank 1 reaches a prescribed pressure p 2 higher than the set pressure p 1 of the low set - pressure valve 8 , this high set - pressure valve 7 opens . when the high set - pressure valve 7 opens , the vapor can flow across a relatively large sectional area surrounding the valve member 7 c and the check valve 6 can thereby accommodate a relatively large flow rate in addition to that effected by the open state of the low set - pressure valve 8 . as a result , even when the internal pressure of the fuel tank 1 rises for other reasons than filling fuel into the fuel tank beyond the tank full state , the high pressure can be released to the canister 2 via the fuel vapor passage 3 . the fuel vapor is absorbed by the canister 2 , and would not be released to the atmosphere . the check valve 6 that opens in two stages as described above was made particularly compact by incorporating the low set - pressure valve 8 into the high set - pressure valve 7 . therefore , the check valve 6 can be mounted without requiring no more space than the conventional counterpart , and can also be used in place of a conventional counterpart without requiring any substantial change to the existing design . in the check valve 6 of the illustrated embodiment , the low set - pressure valve 8 was incorporated into the high set - pressure valve 7 , but the check valve of the present invention is not limited to this example but may be designed in any other way possible as long as it combines a first valve that opens at a relatively low pressure and a second valve that opens at a relatively high pressure . fig4 shows another embodiment of the check valve 6 . in fig4 , the parts corresponding to those of the previous embodiment are denoted with like numerals without repeating the description of such parts . in this case , a low set - pressure valve 8 and high set - pressure valve 7 are arranged in parallel with each other . the bottom wall of the valve member 7 c of the high set - pressure valve 7 is closed . the ports 7 b and 8 b of these valves on the side of the fuel tank 1 are commonly connected to the fuel tank end of the second branch passage 3 b , and the valve chamber 7 a and valve housing 8 a of these valves on the side of the canister 2 are commonly connected to the canister end of the second branch passage 3 b . this also provides an action similar to that of the previous embodiment by opening the low set - pressure valve 8 upon the occurrence of a slight pressure rise resulting from the filling of the fuel tank to full and opening the high set - pressure valve 7 upon the occurrence of a substantial pressure rise resulting from a high temperature or a cause other than filling the tank full . according to this embodiment , because the two valves 7 and 8 can open independently from each other , the threshold pressures p 1 and p 2 can be set at a high precision , and the manufacturing process can be simplified . the low set - pressure valve 8 started opening at pressure p 1 and the high set - pressure valve 7 started opening at pressure p 2 in a step - wise fashion in the foregoing embodiment , but they may be adapted to open gradually so as to progressively increase the flow rate as the pressure rises as indicated by the graph of fig5 . in the graph , the abscissa corresponds to the pressure ( gauge pressure ) inside the fuel tank 1 , and the ordinate corresponds to the rate of flow that passes through the check valve 6 . as indicated by the graph , the high set - pressure valve 7 and low set - pressure valve 8 remain closed when the pressure is lower than the first threshold pressure p 1 . even in this state , there is a slight leak flow at the rate of q 1 . when the pressure has reached the first threshold pressure p 1 , only the low set - pressure valve 8 opens , and the fuel vapor passes through the check valve 6 at a flow rate which progressively increases with the rise in the pressure . the increase flow rate eventually diminishes as the pressure approaches the second threshold pressure p 2 . when the pressure has reached the second threshold pressure p 2 , the high set - pressure valve 7 also opens , and the fuel vapor passes through the check valve 6 at the flow rate q 2 . as the pressure rises further , the opening of the high set - pressure valve 7 progressive increases , and so does the flow rate . the second threshold pressure p 2 should be selected to be equal to that encountered when the tank is filled full or slightly higher . by thus progressively increasing the flow rate with the rise in pressure , the canister can be absorb the fuel vapor from an early stage of filling up the fuel tank 1 . also , because the high set - pressure valve 7 is adapted to accommodate a relatively large flow rate for a given rise in pressure , the pressure rise owing to a high temperature condition can be controlled in a relatively promptly . although the present invention has been described in terms of preferred embodiments thereof , it is obvious to a person skilled in the art that various alterations and modifications are possible without departing from the scope of the present invention which is set forth in the appended claims .	8
one version of a roller - belt conveyor embodying features of the invention is shown in fig1 . the conveyor 24 transports articles on a roller belt 12 , which forms an endless belt loop defining a belt path . the belt path can be considered to be divided into four segments : ( a ) an upper carryway segment 26 along which articles are conveyed in a conveying direction 16 ; ( b ) a lower returnway segment 28 ( shown in part ) below the carryway segment ; ( c ) a first reversing segment 30 at an upstream , or infeed , end 31 of the conveyor along which the roller belt transitions upward from the returnway to the carryway ; and ( d ) a second reversing segment 32 at a downstream , or exit , end 33 of the conveyor along which the roller belt transitions downward from the carryway to the returnway . a reversing wheel 36 , which may be a drive drum or a drive sprocket mounted on a shaft 38 and driven by a motor ( not shown ) to rotate in the direction of the arrow 38 , engages the underside of the belt loop in the second reversing segment to drive the belt and transition it to the returnway . alternatively , the roller belt may be driven in the returnway segment by a drum or sprocket . in that case , the reversing wheel at the exit end of the conveyor is an idle wheel with its shaft not coupled directly to a drive motor . the roller belt 12 includes a plurality of rollers 10 having salient portions that protrude past inner 40 and outer 41 sides of the belt . articles 42 are supported atop the salient portions of the rollers extending above the outer side of the belt along the carryway . the salient portions of the rollers extending past the inner side of the belt on the carryway ride along a planar carryway bearing surface 44 . as the belt advances , the rollers roll on the bearing surface and rotate in the direction of the arrows 18 . the rotation of the rollers propels articles in the direction of belt travel at twice the speed of the belt if the rollers don &# 39 ; t slip as they roll along the bearing surface . in this way , the conveyor increases the spacing between consecutive conveyed articles . at the downstream , or exit , end 33 of the conveyor , the planar bearing surface 44 terminates upstream of the reversing wheel to avoid interference . there is no reversing wheel at the upstream end 31 of the conveyor in this version . instead , the roller belt reverses around a stationary convex bearing surface 46 in the first reversing segment . in this version , the convex bearing surface is continuous with the planar bearing surface 44 . tension in the advancing roller belt conforms the belt to the convex bearing surface as the belt is pulled through the first reversing segment at the upstream end of the conveyor . by providing a bearing surface for the rollers in the first reversing segment , the convex bearing surface allows the rollers to rotate before they reach the carryway . because all the rollers at the upstream end of the conveyor are rotating at full speed before they enter the carryway , articles fed onto the conveyor at the upstream end are immediately pulled away by the rotating rollers . there is no delay due to non - rotating rollers at the infeed to the conveyor . one version of the bearing surfaces of fig1 is shown in fig2 . the bearing surfaces are formed on a sheet 48 that includes a planar portion 50 and a convex portion 51 . the sheet is continuous across the width of the conveyor in the carryway segment and in the first reversing segment . when viewed from the side edge 52 of the sheet , the convex portion is c - shaped with a slightly upturned lip 54 at its lower end to prevent the belt from snagging as it first encounters the convex bearing surface . the sheet may be made of metal , which may be coated with a synthetic material to enhance the rolling engagement of the rollers on the bearing surface , or of a synthetic material with desirable rolling properties . the sheet may be a single bent sheet forming one continuous bearing surface or may be made of two sections ( the planar portion and the convex portion ) separated by a small gap at the interface 56 between the two portions . fig3 shows an alternative embodiment of the bearing surface . in this version , the bearing surfaces are segmented across the width of the conveyor . parallel linear wearstrips 58 provide planar bearing surfaces along the carryway . c - shaped wearstrips 60 provide convex outer bearing surfaces 61 in the first reversing segment . the linear and convex wearstrips are shown separated by a small gap 62 at the interface between the first reversing segment and the carryway segment . of course , a continuous wearstrip bent to form the convex portion at one end could be used instead . further details of a roller belt and the planar portion of the wearstrips of fig3 along the carryway are shown in fig4 and 5 . the portion of the roller belt shown is a modular plastic belt 64 constructed of rows 66 , 67 of one or more belt modules , such as edge modules 68 and interior modules 69 , arranged side by side to form a row . hinge eyes 70 at the leading and trailing ends of each belt row are interleaved with corresponding hinge eyes of a consecutive row and connected together by a hinge rod 72 received in the lateral passageway formed by the aligned , interleaved hinge eyes . rollers 10 are mounted in cavities 74 formed in the interior of the modules . the rollers are arranged in parallel lanes . the linear wearstrips 58 are also arranged in parallel on spacings equal to the spacings of the lanes of belt rollers to provide planar bearing surfaces underlying each longitudinal lane of rollers . each roller has a diameter greater than the thickness of the belt so that salient portions of the rollers protrude past the inner 40 and outer 41 sides of the belt . the rollers in this version rotate on axles 76 spanning the cavities and supported at their ends in the interior of the belt modules . bores in the cylindrical rollers receive the axles . in this example , the axles are arranged perpendicular to the direction of belt travel so that the rollers rotate in the direction of belt travel as the belt advances . recesses 78 formed in the belt modules on the inner side of the belt loop include drive surfaces that are engaged by driving surfaces , such as teeth , on the reversing wheel . in another version of the conveyor shown in fig6 , reversing wheels 80 , or sprockets , mounted on a shaft 81 supported for rotation in bearing blocks 83 , are used in the first reversing segment . planar bearing surfaces 82 extend from the carryway segment 26 upstream into the first reversing segment 30 past the centerline 84 of the shaft . the extension of the linear bearing surface into the first reversing portion provides a bearing surface for the roller belt rollers to roll on at the upstream , infeed end of the conveyor . consequently , articles fed onto the roller - belt conveyor immediately encounter rotating rollers . thus , the various versions of roller - belt conveyors described provide immediate pull - away of articles transferred to the infeed end of a separation conveyor . although the invention has been described in detail with respect to a few preferred versions , other versions are possible . for example , the roller axles in the conveyor belt need not be oriented perpendicular to the direction of belt travel . they could instead be oriented oblique to the direction of belt travel to provide an additional lateral component of motion to conveyed articles . as another example , spherical roller balls without axles , rather than the generally cylindrical rollers described , could be used as belt rollers . as still another example , the convex bearing surface could alternatively be realized as the outer surface of a stationary drum or shoe . so , as these few examples suggest , the scope of the claims is not meant to be limited to the versions described in detail .	1
the method for preparing cyclic oligosiloxane according to the invention is by reacting an organopolysiloxane having the general formula ( 1 ) and / or an organopolysiloxane having the general formula ( 2 ) in the presence of a catalyst . herein r 1 is each independently hydrogen , hydroxyl or a substituted or unsubstituted monovalent hydrocarbon group , r 2 is each independently a substituted or unsubstituted monovalent hydrocarbon group , r 3 is hydrogen or a substituted or unsubstituted monovalent hydrocarbon group , and n is an integer of 2 to 10 , 000 . herein r 2 is each independently a substituted or unsubstituted monovalent hydrocarbon group , r 3 is hydrogen or a substituted or unsubstituted monovalent hydrocarbon group , and m is an integer of 4 to 15 . more particularly , r 1 which may be the same or different is a hydrogen atom , a hydroxyl group or a substituted or unsubstituted monovalent hydrocarbon group . suitable monovalent hydrocarbon groups include those of 1 to 12 carbon atoms , preferably 1 to 10 carbon atoms , for example , alkyl groups such as methyl , ethyl , n - propyl , isopropyl , n - butyl , isobutyl and t - butyl , cycloalkyl groups such as cyclohexyl , alkenyl groups such as vinyl , allyl and propenyl , aryl groups such as phenyl and tolyl , aralkyl groups such as benzyl and phenylethyl , and substituted forms of the foregoing groups in which one or more hydrogen atoms are substituted by halogen atoms or the like , such as 3 , 3 , 3 - trifluoropropyl . of these , hydrogen , methyl and phenyl are preferred , with the methyl and hydrogen being most preferred . methyl and hydrogen are preferred particularly when r 3 is hydrogen , and methyl is preferred particularly when r 3 is a monovalent hydrocarbon group . r 2 which may be the same or different is a substituted or unsubstituted monovalent hydrocarbon group , examples of which are the same as described for r 1 . inter alia , methyl and phenyl are preferred , with the methyl being most preferred . r 3 is a hydrogen atom or a substituted or unsubstituted monovalent hydrocarbon group , examples of which are the same as described for r 1 . inter alia , hydrogen , methyl and phenyl are preferred , with the hydrogen and methyl being most preferred . in formula ( 1 ), n is an integer of 2 to 10 , 000 , preferably 10 to 2 , 000 , more preferably 20 to 1 , 500 . in formula ( 2 ), m is an integer of 4 to 15 , preferably 4 to 10 . the method for preparing cyclic oligosiloxane according to the invention favors use of an organopolysiloxane having formula ( 1 ) as the starting reactant . in preparing the organopolysiloxane having formula ( 1 ), an organopolysiloxane having formula ( 2 ) can also be formed . the resulting organopolysiloxane mixture may be used without separation . in this mixture , the organopolysiloxane having formula ( 1 ) and the organopolysiloxane having formula ( 2 ) are present preferably in a ratio from 100 : 0 to 20 : 80 , and more preferably from 100 : 0 to 30 : 70 by weight . for reaction of the reactants , organopolysiloxanes having formula ( 1 ) and / or ( 2 ), a catalyst having the general formula ( 4 ) is used . herein m is a metal selected from among aluminum , titanium , zirconium , tin and zinc , p is the valence of the metal m , and r 4 is each independently a substituted or unsubstituted monovalent hydrocarbon group or a group of the formula ( 5 ). herein r 5 is each independently a substituted or unsubstituted monovalent hydrocarbon group . examples of monovalent hydrocarbon groups represented by r 5 are as will be described for r 4 , and are typically methyl , ethyl , propyl and phenyl , with methyl being most preferred . the subscript h is an integer of 0 to 100 , preferably 0 to 50 , and more preferably 0 to 20 . in formula ( 4 ), r 4 which may be the same or different is a substituted or unsubstituted monovalent hydrocarbon group , preferably of 1 to 12 carbon atoms , more preferably 1 to 10 carbon atoms . examples include alkyl groups such as methyl , ethyl , n - propyl , isopropyl , n - butyl , isobutyl and t - butyl , cycloalkyl groups such as cyclohexyl , alkenyl groups such as vinyl , allyl and propenyl , aryl groups such as phenyl and tolyl , aralkyl groups such as benzyl and phenylethyl , and substituted forms of the foregoing groups in which one or more hydrogen atoms are substituted by halogen atoms or the like , such as 3 , 3 , 3 - trifluoropropyl . of these , alkyl groups of 1 to 4 carbon atoms and phenyl are preferred , with methyl being most preferred . illustrative examples of the catalyst having formula ( 4 ) are given below . no particular limit is imposed on the technique of preparing the catalyst having formula ( 4 ). it may be prepared by the technique described in a . a . zhdanov , j . polymer sci ., 30 , 513 ( 1958 ), for example . an appropriate amount of the catalyst having formula ( 4 ) is 0 . 001 to 10 parts by weight , more preferably 0 . 01 to 5 parts by weight per 100 parts by weight of the reactants , organopolysiloxanes having formula ( 1 ) and / or ( 2 ). in the method of the invention , the reaction is preferably carried out at a temperature of room temperature to 250 ° c ., more preferably 130 ° c . to 200 ° c ., when r 3 is hydrogen , and at a temperature of 200 ° c . to 350 ° c ., more preferably 240 ° c . to 300 ° c ., when r 3 is a monovalent hydrocarbon group . also , the reaction may be carried out either under atmospheric pressure or under reduced pressure , preferably under a reduced pressure of up to 500 mmhg , more preferably 10 to 300 mmhg . if necessary , the reaction is followed by distillation . the disproportionation reaction according to the invention produces a cyclic oligosiloxane having the general formula ( 3 ): herein r 2 is each independently a substituted or unsubstituted monovalent hydrocarbon group , r 3 is hydrogen or a substituted or unsubstituted monovalent hydrocarbon group , k is an integer of 3 to 8 , preferably 4 to 6 , with the proviso that k & lt ; m when the organopolysiloxane of formula ( 2 ) is used . understandably , the cyclic oligosiloxane is generally produced as a mixture of cyclic oligosiloxanes having different degrees of polymerization . examples and comparative examples are given below for further illustrating the invention , but are not intended to limit the invention . a catalyst having formula ( i ) was synthesized according to the teaching of a . a . zhdanov , j . polymer sci ., 30 , 513 ( 1958 ). a 0 . 5 - l three - necked flask equipped with a stirrer and condenser was charged with 40 g of sodium trimethylsilanolate , after which 160 ml of benzene was added for dissolving the silanolate . at room temperature , a suspension of 12 . 4 g of aluminum chloride in 70 ml of benzene was added over one hour whereby the temperature increased from 20 ° c . to 40 ° c . at the end of the exothermic reaction , the reaction solution was filtered through a paper filter . the filtrate was added to a 1 - l flask which was heated in an oil bath , distilling off the benzene at atmospheric pressure . the solidified flask contents were purified by sublimation under vacuum , obtaining the target substance . its structure was identified by proton - nmr . a 1 - l four - necked flask equipped with a thermometer , stirrer , column packed with cylindrical glass of about 1 × 1 mm to a height of 500 mm , water - cooled condenser , outlet tube , and distillate receiver was connected to a vacuum pump . to the flask were fed 500 g of trimethylsilyl end - capped polymethylhydrogensiloxane having the formula : and 0 . 5 g of the catalyst ( i ) synthesized above , after which agitation was commenced . while the flask interior was kept under a reduced pressure of 50 mmhg , the flask was heated at 170 - 180 ° c . in an oil bath . a fraction that distilled out for 2 hours was collected ( 398 g ). the majority of this fraction was 1 , 3 , 5 , 7 - tetramethylcyclotetrasiloxane . the residue ( 40 g ) was a clear liquid . a 1 - l four - necked flask equipped with a thermometer , stirrer , column packed with cylindrical glass of about 1 × 1 mm to a height of 500 mm , water - cooled condenser , outlet tube , and distillate receiver was connected to a vacuum pump . to the flask were fed 500 g of trimethylsilyl end - capped polymethylhydrogensiloxane having the formula : and 0 . 1 g of the catalyst ( i ) synthesized above , after which agitation was commenced . while the flask interior was kept under a reduced pressure of 100 mmhg , the flask was heated at 160 - 170 ° c . in an oil bath . a fraction that distilled out for 2 hours was collected ( 356 g ). the majority of this fraction was 1 , 3 , 5 , 7 - tetramethylcyclotetrasiloxane . the residue ( 129 g ) was a clear liquid . a 1 - l four - necked flask equipped with a thermometer , stirrer , column packed with cylindrical glass of about 1 × 1 mm to a height of 500 mm , water - cooled condenser , outlet tube , and distillate receiver was connected to a vacuum pump . to the flask were fed 100 g of trimethylsiloxy end - capped dimethylpolysiloxane having a viscosity of 10 , 000 centistokes at 25 ° c . and 1 . 0 g of the catalyst ( i ) synthesized above , after which agitation was commenced . while the flask interior was kept under a reduced pressure of 50 mmhg , the flask was heated at 250 - 260 ° c . using a mantle heater . a fraction that distilled out for 14 hours was collected ( 45 g ). the residue ( 31 g ) was a clear liquid . a 1 - l four - necked flask equipped with a thermometer , stirrer , column packed with cylindrical glass of about 1 × 1 mm to a height of 500 mm , water - cooled condenser , outlet tube , and distillate receiver was connected to a vacuum pump . to the flask were fed 500 g of trimethylsilyl end - capped polymethylhydrogensiloxane having the formula : and 0 . 1 g of a catalyst al ( or ) 3 wherein r is isopropyl , after which agitation was commenced . while the flask interior was kept under a reduced pressure of 100 mmhg , the flask was heated at 160 - 170 ° c . in an oil bath . a fraction that distilled out for 2 hours was collected ( 460 g ). the majority of this fraction was 1 , 3 , 5 , 7 - tetramethylcyclotetrasiloxane . an analysis by gas chromatography revealed that by - products having added thereto an isopropoxide group originating from the catalyst , represented by the following formulae ( a ) and ( b ), formed in amounts of about 1 . 5 % and about 0 . 5 %, respectively . the residue ( 32 g ) was a clear liquid . in none of examples 1 to 3 , an alkoxy group bonded to si was detected on analysis of the fractions by gas chromatography . although some preferred embodiments have been described , many modifications and variations may be made thereto in light of the above teachings . it is therefore to be understood that the invention may be practiced otherwise than as specifically described without departing from the scope of the appended claims .	2
the invention is illustrated by way of example and not by way of limitation in the figures of the accompanying drawings in which like references indicate similar elements . references to embodiments in this disclosure are not necessarily to the same embodiment , and such references mean at least one . while specific implementations are discussed , it is understood that this is done for illustrative purposes only . a person skilled in the relevant art will recognize that other components and configurations may be used without departing from the scope and spirit of the invention . in the following description , numerous specific details are set forth to provide a thorough description of the invention . however , it will be apparent to one skilled in the art that the invention may be practiced without these specific details . in other instances , well - known features have not been described in detail so as not to obscure the invention . an application can depend on multiple components within different projects and each of those components may also have dependencies on other components within other projects . each component &# 39 ; s project may in turn have dependencies on other components &# 39 ; projects . this chain might end with the runtime library for the target computing system . in various embodiments , a dependency graph provides a way to determine how projects are interrelated . a simplified diagram is shown in fig1 . in this figure , the main project depends on a data access library and a business logic component . these , in turn , depend upon a system runtime library . systems and methods in accordance with embodiments of the present disclosure overcome the problems described above by efficiently tracking the relationships between a project and changes to source code for components upon which the project &# 39 ; s application depends . it will be appreciated by those of skill in the relevant art that the embodiments of the present disclosure are not dependent on or limited by the particular programming language ( s ) found in the source code . in various embodiments , a project dependency data structure can represent the dependencies of projects on components . in aspects of these embodiments , this data structure is a directed acyclic graph ( dag ) formed by references between class path level nodes ( cpls ). cpls model the ordered dependencies of a set of projects and the individual components and files within the projects . cpls are coupled with a dependency resolution mechanism that ensures dependent projects reflect the latest versions of components . fig2 provides an exemplary illustration of a project dependency data structure in accordance to various embodiments . in various embodiments and by way of illustration , each project has a cpl 200 . a cpl can hold a list of source files associated with a project and one or more binary paths . a binary - path is an ordered list that can include references to jar files 202 , locations of binary ( e . g ., “. class ”) files 204 , and references to other cpls 206 . the order of elements in the binary path has significance , since it establishes a search priority . a reference to a cpl in a binary path indicates that a project depends on the code in another project ( source code or binary code ). the project dependency data structure provides optimizations for commonly used components . many applications and components may depend upon one or more commonly used components and in the absence of the present invention copies of commonly used components are often stored inefficiently with every project that uses the component . for example , most or all components depend on the runtime library of the target computing system and a copy of this library may be included with every component project . however , the software analysis system can utilize the project dependency data structure to maintain a single copy of each common component used across all the projects . this saves space and reduces the time required to build the projects . as described in the previous paragraph , different projects might refer to the same resource . in conventional software development environments , when several projects are loaded simultaneously , it is common for a development environment to create duplicate in - memory representations for each resource that was referred to by multiple projects . this increased the memory and cpu utilization of the compilation system . the project dependency data structure also allows a compilation or other system to understand the common dependencies across projects and load a single version of each shared resource . the project dependency data structure also serves as a hierarchy for specifying the resources a project depends on . in conventional software development environments , projects specified the resources they depended on with a flat list . in cases where project a depended on project b , which depended on project c , project a was required to specify all resources required by projects a , b and c in a single list . project b was required to specify all resources required by projects b and c in a single list . therefore , any resource required by project c had to be duplicated in the flat lists associated with projects a , b and c . as changes occur to these separate projects , keeping these lists synchronized could be a challenge . a common problem was for projects a , b and c to end up referring to different , incompatible versions of the same resource . in various embodiments , the software analysis system can locate resources available to the project ( e . g ., files , directories , data types , etc .). in aspects of these embodiments , this is easily accomplished by searching a project dependency data structure . by way of illustration , suppose a process wants to find information about a type given its type name . type information is stored in a source file or an object file ( e . g ., a class ). if it exists , a source file is considered the most up - to - date version of type information and will be used instead of the class file . otherwise , the class file can be used . fig3 is an illustration of an exemplary recursive algorithm for searching a project dependency data structure for type information in accordance to various embodiments . although this figure depicts functional steps in a particular order for purposes of illustration , the process is not necessarily limited to any particular order or arrangement of steps . one skilled in the art will appreciate that the various steps portrayed in this figure can be omitted , rearranged , performed in parallel , combined and / or adapted in various ways . the benefit of this process is immediate visibility of source file changes in an external project , like that available for source files internal to the project . similar benefits can be derived by from the effect of a configuration change to the cpl hierarchy itself . that is , the cpl / project hierarchy can be altered ( e . g ., by the user or a process ) and the resulting impact determined on any cpls lower in the hierarchy from the point of change with performance similar to changes in their own source files . the first time this algorithm is invoked , the cpl searched is the project &# 39 ; s . subsequent recursive calls to the algorithm refer to the cpls of other projects . in step 300 , the source files of the cpl are searched for a matching type . if found , the information associated with the type is returned in step 304 . otherwise , a binary - path from the cpl selected in step 306 . in one embodiment , binary - paths are selected in order of dependency . next , an entry from the chosen binary - path is selected in step 308 . if the selected entry is not a directory or a java ® archive ( jar ) file , it is determined in step 312 whether the entry is for a cpl . if so , the algorithm is invoked recursively with the cpl for the entry . if not , the algorithm resumes at step 320 where it is determined if there are any remaining entries to be searched in the chosen binary - path . if the chosen entry is a directory or a jar file , the corresponding directory or file is searched for a matching type in step 314 . if found , the information associated with the type is returned in step 318 . if not , it is determined in step 320 if there are any remaining entries ( i . e ., yet to be searched ) in the chosen binary - path . if so , the process continues at step 308 with the selection of another entry . if not , it is determined in step 322 whether or not there are any remaining binary - paths to search in the current cpl . if so , the algorithm continues at step 306 by choosing another binary - path from the current cpl . if not , the process completes . fig4 is an exemplary illustration of a process for responding to changes in source code . although this figure depicts functional steps in a particular order for purposes of illustration , the process is not necessarily limited to any particular order or arrangement of steps . one skilled in the art will appreciate that the various steps portrayed in this figure can be omitted , rearranged , performed in parallel , combined and / or adapted in various ways . in various embodiments , the software analysis system monitors changes to the code registered for each project . in aspects of these embodiments , changes can be detected in step 400 when modified code is processed by the software analysis system . in one embodiment , processing code includes parsing and analyzing the code according to the syntax and semantics of a programming language and comparing the parsed representation to a previous parsed representation . in step 402 , the software analysis system traverses a project dependency data structure to determine which dependent source code is affected by the change . once the dependent code is identified , the software analysis system can reevaluate the dependent code in step 404 within the context of the modifications and provide notification ( s ) to the associated project in step 406 . a smart editor can then provide relevant information to the software developer , for example by highlighting a syntax error due to the modification of a method signature on a component . fig5 is an exemplary illustration of a system in accordance to various embodiments . although this diagram depicts components as logically separate , such depiction is merely for illustrative purposes . it will be apparent to those skilled in the art that the components portrayed in this figure can be combined or divided into separate software , firmware and / or hardware components . furthermore , it will also be apparent to those skilled in the art that such components , regardless of how they are combined or divided , can execute on the same computing device or can be distributed among different computing devices connected by one or more networks or other suitable communication means . in various embodiments , a compiler framework 506 provides communication between language modules ( 508 - 512 ) for compiling source code and clients of information about the source code , such as ides with “ smart ” editors 504 used by the software developer . the ide allows a software developer to create projects and specify dependencies between projects . the software analysis system 502 utilizes project dependency data structure 500 and causes code to be parsed and analyzed within a project , collects information about that code and presents that information to the ide so the ide can assist the software developer ( e . g ., in editor 504 by adding syntax coloring to the source code , statement completion , etc .). in aspects of these embodiments , the software analysis system maintains a list of locations where internal components may be found for each project . the system allows clients to specify dependencies between projects by inserting references to other software projects within this list . in one embodiment , software developers can specify this information via an ide . the ide can in turn utilize an api to communicate the list to the software analysis system . in one embodiment , a setbinarypaths api method allows the ide ( or other process ) to specify the list of locations where internal components and external projects this project depends on can be found . the ide may call this method passing a list of objects representing locations , which may include directory paths within the project , software libraries within the project or other objects implementing a cpl interface representing external projects . the objects representing external projects may contain similar lists of locations including additional objects representing the projects they depend upon . in one embodiment , the order of the objects provided to the setbinarypaths method is significant — the order defines the order in which the software analysis system searches internal components and external projects to find definitions of components used in the project . in one embodiment , the first definition of a component found in the locations on this list is used by the software analysis system and definitions from subsequent locations are ignored . one embodiment may be implemented using a conventional general purpose or a specialized digital computer or microprocessor ( s ) programmed according to the teachings of the present disclosure , as will be apparent to those skilled in the computer art . appropriate software coding can readily be prepared by skilled programmers based on the teachings of the present disclosure , as will be apparent to those skilled in the software art . the invention may also be implemented by the preparation of integrated circuits or by interconnecting an appropriate network of conventional component circuits , as will be readily apparent to those skilled in the art . one embodiment includes a computer program product which is a storage medium ( media ) having instructions stored thereon / in which can be used to program a computer to perform any of the features presented herein . the storage medium can include , but is not limited to , any type of disk including floppy disks , optical discs , dvd , cd - roms , microdrive , and magneto - optical disks , roms , rams , eproms , eeproms , drams , vrams , flash memory devices , magnetic or optical cards , nanosystems ( including molecular memory ics ), or any type of media or device suitable for storing instructions and / or data . stored on any one of the computer readable medium ( media ), the present invention includes software for controlling both the hardware of the general purpose / specialized computer or microprocessor , and for enabling the computer or microprocessor to interact with a human user or other mechanism utilizing the results of the present invention . such software may include , but is not limited to , device drivers , operating systems , execution environments / containers , and applications . the foregoing description of the preferred embodiments of the present invention has been provided for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise forms disclosed . many modifications and variations will be apparent to the practitioner skilled in the art . embodiments were chosen and described in order to best describe the principles of the invention and its practical application , thereby enabling others skilled in the art to understand the invention , the various embodiments and with various modifications that are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the following claims and their equivalents .	6
while this invention is susceptible of embodiment in many different forms , there are shown in the drawings , and will be described herein in detail , specific embodiments thereof with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not intended to limit the invention to the specific embodiments illustrated . u . s . provisional application 62 / 029 , 189 , filed jul . 25 , 2014 is herein incorporated by reference . a first embodiment is disclosed in fig1 - 8 . a second embodiment is disclosed in fig9 - 15c . fig9 - 15c illustrate a ball washing apparatus 10 according to a second embodiment of the invention . the ball washing apparatus 10 includes a ball washing body 12 connectable to a canopy support post of a golf cart utilizing a mounting apparatus 32 . the ball washing body 12 includes a cap - shaped cover 16 which is removably sealed to a cap - shaped reservoir 26 . the body 12 includes an actuator 36 for opening and closing the reservoir 26 with respect to the cover 16 . the actuator 36 includes a push rod 40 and a push knob 46 . the push rod 40 comprises a square cross - section . the push rod is guided through a square hole 40 a in a cover mount 12 a ( see fig1 a ) and is fixed by adhesive , set screw , press fitting , or the like , into a square hole 40 b in a reservoir mount 26 a ( see fig1 c ). the push knob 46 can be an actual golf ball fixed to the push rod . the golf ball can have indicia on it identifying the golf ball manufacturer or any other business . this is for novelty and advertising purposes . a power push button 48 exposed through a top of the cover 16 can be pushed down to commence the ball washing operation . the mounting apparatus 32 includes a stationary bracket 32 a mounted to the cover mount 16 a and an angle adjustable bracket 32 b that is mounted to the stationary bracket via a pivot bolt 32 c and a locking bolt 32 d . the angle adjustable bracket includes a curved slot 32 e . when the pivot bolt 32 c and the locking bolt 32 d are loosened , the angle adjustable bracket 32 b can be pivoted about the pivot bolt 32 c and the locking bolt relatively moves , although remaining stationary , through the curved slot as the curved slot moves with the pivoting of the angle adjustable bracket 32 b . once the angle is correctly adjusted the bolts 32 c , 32 d are tightened to lock the relative positions of the two brackets 32 a , 32 b . the bracket 32 b is fastened to a clamping bracket 32 f which tightly captures a canopy support post or the like on a golf cart or other structure . the ball washer can thus be adjusted in angle to be substantially vertical given an angled mounting post . fig1 illustrates in schematic form the push button 48 connected to a momentary switch which receives electric power from the golf cart battery or other power source or power generator . the switch is connected to a timer which delivers power for a pre - determined amount of time to an electric gearmotor 50 . the gearmotor 50 is mounted on a motor mount plate 54 by screws . a disc shaped brush 56 having downwardly directed bristles is mounted to an underside of the plate 54 . fig1 also illustrates the reservoir 26 is sealed along a top edge of the reservoir to the plate 54 by an o - ring or other flexible element 27 of the plate 54 . an annular shaped brush 66 having upper , radially inward directed bristles 68 extending from an outer base ring 69 and facing golf balls 67 a , 67 b to be washed ; and lower , radially inward directed bristles 70 extending from the outer base ring 69 is fit snugly within the reservoir 26 . the brush 66 is reversible for a prolonged useful life by removing and inverting the brush and making the bristles 70 now face the golf balls 67 a , 67 b . although only the left and right profiles of the bristles are shown it is to be understood that the bristles 68 , 70 can extend around the inside surface the base ring 69 for 360 degrees . the reservoir 26 is designed to sealingly hold a ball washing fluid , e . g ., water and soap . a ball cradle 80 is shown in fig1 a - 15c . the cradle 80 has the capacity to hold one or two golf balls 67 a , 67 b and is mounted to a downwardly extended rotary output motor shaft 84 of the motor 50 via a sleeve 85 . a set screw 84 a fixes the motor shaft 84 within the sleeve 85 and a pair of screws 96 a , 96 b fixes the sleeve 85 to a mount portion 96 of the ball cradle 80 via holes in the portion 96 and corresponding holes in the sleeve 85 . the ball cradle 80 includes a circular ball supporting plate 86 and semi - circular ball side guides 88 , 90 . in order to guide the downward movement of the reservoir with respect to the cap , two guide rods 102 , 104 are provided as shown in fig1 a , 11 and 12 . the guide rods are fixed to a top of the cover mounting assembly by adhesive or press fitting or other fixing means at points 102 a , 104 a respectively . the guide rods extend downward in parallel and are guided by guide holes 102 b , 104 b respectively in the reservoir mount . in order for the reservoir to return to its closed operational position , two coil springs 106 , 108 are provided as shown in fig1 , 10a and 11 . the springs 106 , 108 are fixed at bottom ends 106 a , 106 b respectively to a spring hook 110 mounted to the reservoir mount . top ends 106 b , 108 b respectively of the springs 106 , 108 are fixed to a spring support 114 that is fixed to a top of the cover mount . thus , when the reservoir is separated from the cap to load or unload golf balls as shown in fig1 a , the springs 106 , 108 are stretched and the reservoir is urged back up toward the cap . the plate 54 includes bosses 54 a for screw mounting the motor 50 on one side and bosses 54 b for screw mounting the brush 56 on the opposite side ( see fig1 a - 14d ). a threaded drain opening 26 c for receiving a plug 26 d is provided on the bottom of the reservoir ( see fig1 and 13c ). the cover 16 , the reservoir 26 , the motor mount plate 54 and ball carriage 80 can all be composed of black uv abs . hardware can be aluminum , stainless steel or the like . fig1 - 20 are views of an alternate embodiment ball washer 200 . some components are not shown to see underlying components . for example the cover 16 is not shown and the reservoir 326 is shown in fig2 . all the components of assembly of the ball washer 10 are included in the ball washer 200 and are identical and serve identical functions as in the ball washer 10 , except as noted . according to this embodiment , an alternate ball cradle 280 is used that is fixed to a shaft 290 via two roller pins 291 , 292 ( shown also in fig1 ). the shaft 290 is also coupled to a coupling 300 using a roller pin 301 ( shown also in fig1 ). the coupling includes a semi - circumferential slot 306 . the roller pin 301 is fixed into the shaft 290 and captured in the slot 306 . the slot allows a rotational lost motion between the shaft 290 and the shaft 330 of the motor 50 . thus after the wash cycle is complete , and the ball washer opened , the user can manually rotate the ball cradle in the opposite direction of the motor turning direction , within the angular limit of the slot , to facilitate removal of the golf balls . this is convenient in the case that the motor stops with one of the balls in the back of the washer . the coupling 300 is attached to a motor shaft 330 of the gearmotor 50 ( shown in fig1 ) by a set screw 331 in a tapped hole 332 ( shown also in fig1 ). the ball cradle 280 includes a top plate 281 , a central portion 282 for receiving the shaft 290 through a hole 283 , curved sidewalls 284 , 285 for guiding golf balls and bottom walls 286 , 287 for supporting golf balls . fig2 shows the reservoir 326 includes a brass bushing 327 fixed to the bottom of the reservoir that receives a bottom end of the shaft 290 when the reservoir is raised to the closed position for golf ball washing . the shaft extends 290 down into the bushing 327 to stabilize the rotation of the ball cradle from wobbling during the wash cycle . fig2 - 26 illustrate a ball washing apparatus 500 . the ball washing apparatus 500 includes a ball washing body 502 connectable to a canopy support post of a golf cart utilizing a mounting apparatus 507 . the ball washing body 502 includes a lid 506 which is hinged to a cap - shaped housing 512 . the body 502 includes a knob 526 for opening and closing the lid 506 with respect to the housing 512 . the knob 526 is fastened to the lid with a fastener . the knob 526 can be in the form of a golf ball , or an actual golf ball . the golf ball can have indicia on it identifying the golf ball manufacturer or any other business . this is for novelty and advertising purposes . the mounting apparatus 507 includes a stationary bracket 540 mounted to the housing 512 , by screws or other means , and an angle adjustable bracket 542 . the angle adjustable bracket 542 is comprised of two mirror image configured members 542 a , 542 b . the bracket 542 is mounted to the stationary bracket 540 via a pivot bolt 543 and nut passed through aligned pivot holes 544 through both brackets 540 , 542 , and a locking bolt 545 and nut that can be inserted through selectable holes 546 through both brackets 540 , 542 to set an angular orientation between the two brackets 540 , 542 . to adjust the angle between the brackets 540 , 542 , the bolt 543 is loose while the bolt 545 is not installed into the holes 546 . the bracket 542 can be pivoted with respect to the bracket 540 until a selectable hole grouping 546 is aligned to receive the bolt 545 which is passed through the selected holes 546 . once the angle is correctly adjusted , the bolts 543 , 545 and corresponding nuts are tightened to lock the relative positions of the two brackets 540 , 542 . unlike the previous embodiment , a curved slot is not used to adjust the angle , rather a plurality of holes 546 are used between the brackets 540 , 542 which align or register corresponding to incremental angular orientations of the bracket 542 with respect to the bracket 540 . the bracket 542 is clamped to a canopy support post or the like on a golf cart or other structure . the bracket 542 is clamped by two bolts and corresponding nuts ( not shown ) that span through upper holes 560 and lower holes 562 respectively and when tightened , clamps the canopy support post between the members 542 a , 542 b . the members 542 a , 542 b include inward facing ridges 566 that define , with inward facing walls 568 , a rectangular space for capturing the canopy support post in a confined clamped area that prevents angular tilting of the bracket 542 on the canopy support post . the ball washing apparatus can thus be attached at an angle to be substantially vertical given an angled mounting post . fig2 illustrates in schematic form the push button 580 connected to a momentary switch 582 which receives electric power from the golf cart battery or other power source or power generator . the switch is connected to a timer 586 which delivers power for a pre - determined amount of time to an electric gearmotor 590 . as an alternative to the push button 580 , the closing of the lid 506 can trigger the timer 586 . opening of the lid can automatically stop the motor . the gearmotor 590 is mounted to a bottom of the housing 512 by screws or other means . a cup shaped basin 604 has a cup shaped scrubbing pad 606 within . the basin is configured to hold cleaning fluid for washing the golf balls . the basin 604 includes a central pipe 610 . the pad 606 includes a central hole for allowing the pipe to extend therethrough so that the pad can be fit snugly down onto the bottom of the basin and rising up along the walls of the basin . a rubber gasket 613 seals the lid 506 to an upper rim of the basin 604 when the lid is closed . a ball paddle body 620 ( fig2 ) is mounted to a drive shaft 624 via a fastener 622 . the ball paddle body 620 includes four curved paddles 620 a curved toward each other in pairs to hold two golf balls , one golf ball between each pair of paddles that are curved toward each other . the drive shaft 624 is connected to the gearmotor 590 . the ball paddle body 620 fits snuggly between the pipe and the pad and is configured to receive two golf balls . the paddles 620 a have slots 620 b to allow cleaning fluid to pass through the paddles . the basin and pad are stationary with respect to the housing 512 while the gearmotor 590 and the drive shaft spin the paddles . during operation the golf balls spin revolve with the spinning paddle in the cleaning fluid and are cleaned by contact with the pad . the golf balls will also tend to spin during revolution of the golf balls about the spinning axis of the ball paddle body 620 . a cup shaped cover 650 is fastened to a bottom of the housing 512 and encloses the gearmotor 590 and electronics . the paddles 620 are removable through the top by opening the lid 506 and unfastening the fastener 622 . the pad 606 is then removable through the top , as is the basin 604 . the basin pipe 610 slides upward over the shaft 624 . the parts can be cleaned easily or replaced and reinstalled . the lid 506 , housing 512 and cover 650 are preferably impact and uv resistant plastic . in operation , the basin 604 is filled with cleaning fluid , the lid 506 is opened , two golf balls are inserted into the wash basin 604 onto the scrubbing pad 606 , each golf ball fit within two paddles 620 a . the lid 506 is closed and the start button 580 is activated to begin a 15 second wash cycle . the wash cycle shuts off after 15 seconds . from the foregoing , it will be observed that numerous variations and modifications may be effected without departing from the spirit and scope of the invention . it is to be understood that no limitation with respect to the specific apparatus illustrated herein is intended or should be inferred .	0
this description pertains in some specific embodiments to televisions with the capability to run java ( or similar ) applets and display output from the java applets to the television display . however , the invention is not limited to use with java applets or televisions . other embodiments of the invention may be used with any type of graphics plane or any type of display device . java is an object - oriented programming language originally developed by sun microsystems . one attractive feature of java is that it can be used to produce platform - independent “ applets ,” which are class files that are written in a higher level than machine code . accordingly , the applets can be downloaded to computers running different operating systems , i . e ., microsoft windows , unix , linux , apple os , etc ., and run from a java platform that is machine - specific . among other things , such applets can be embedded in html pages to provide interactive content on a user &# 39 ; s web browser . standard java does not support multi - plane graphics , which can be highly desirable in a television where multiple concurrently executing applets may be necessary and / or the system itself may need to create java output . the principles explained herein can also be applied to other java - enabled electronic devices such as pdas ( personal data assistants ), cellular phones , and gaming devices . as used herein , a television primarily functions to display video from one or more external video sources . the television embodiments described herein still retain this primary function , but have added capabilities to run applets that can create graphical output that overlays ( or supercedes ) a video source . as televisions generally do not possess the voluminous processing and storage resources of a computer , are expected to fit in a clean form factor similar in size to the display itself , and preferably are operable by persons with less technical expertise than computer users , using simpler interface devices , running applets on a television presents particular challenges that are addressed herein . in particular , newer lcd and plasma televisions tout their thinness and lightness as selling points , and thus have little room for the bulky heat - generating components of a fast computer . conventional televisions offer a fixed set of pre - loaded graphical applications , typically limited to configuration menus for the television . the embodiments below can include a richer set of pre - loaded applets / applications , for instance voice messaging , timers , media players / recorders / time shifters and media locator / selectors , etc . the embodiments also offer a viewer the capability to select other applets — not preloaded on the television — and run the applets on the television . in addition to new or upgraded applets developed specifically for the television platform (“ platform - aware ” applets ), the embodiments preferably also allow a viewer to run applets that are platform independent , such as games or other applets that are typically available to computer users . because platform - independent applets are currently developed without use by a television viewer as a primary consideration , the television embodiments herein preferably allow such applets to run as expected , while still allowing the television to function as expected . to allow a viewer to provide new applets to the television , the television in some embodiments contains a removable device port , which supports media , as well as other removable devices . in some embodiments , the removable device port comprises one or two pcmcia ( personal computer memory card international association ) pc card ports . the pc card and its ports are described in a series of standards dating back to the 1980s , for instance , pc card standard 8 . 0 release — april 2001 . the pc card interface was developed for laptop computers and other computers that do not provide the large internal card bays ( e . g ., for peripheral component interconnect cards ) of desktop and tower servers . pc cards manufactured today provide ethernet network interfaces , modems , wireless network interfaces ( e . g ., ieee 802 . 11x ), mass storage with micro disk drives or flash memory ( compactflash ), and compactflash adapters for other flash formats such as memory stick , multimedia card , secure digital , smartmedia , and xd . in some embodiments , applets can be provided to the television by loading the applets to a mass storage device , e . g ., from a computer , or purchasing a mass storage device with the applets preloaded , and then connecting the mass storage device to the pc card port . alternately , with a wireless network interface card inserted in the pcmcia port , applets stored on a personal computer on the same wireless network can be accessed at the television . additionally , the television may accept and support other pcmcia - compatible devices . fig1 contains a block diagram for a liquid crystal display ( lcd ) television capable of operating according to some embodiments of the present invention . television 100 contains an lcd panel 102 to display visual output to a viewer based on a display signal generated by an lcd panel driver 104 . lcd panel driver 104 accepts a primary digital video signal in ccir656 format ( eight bits per pixel yc b c r , in a “ 4 : 2 : 2 ” data ratio wherein two c b and two c r pixels are supplied for every four luminance pixels ) from a digital video / graphics processor 120 . a television processor 106 provides basic control functions and viewer input interfaces for television 100 . television processor 106 receives viewer commands , both from buttons located on the television itself ( tv controls ) and from a handheld remote control unit ( not shown ) through the ir port . based on the viewer commands , television processor 106 controls an analog tuner / input select section 108 , and also supplies user inputs to the digital video / graphics processor 120 over a universal asynchronous receiver / transmitter ( uart ) command channel . television processor 106 is also capable of generating basic on - screen display ( osd ) graphics , e . g ., indicating which input is selected , the current audio volume setting , etc . television processor 106 supplies these osd graphics , when activated , as a tv osd signal to lcd panel driver 104 for overlay on the display signal . analog tuner / input select section 108 allows television 100 to switch between various analog ( or possibly digital ) inputs for both video and audio . video inputs can include a radio frequency ( rf ) signal carrying standard broadcast television , digital television , and / or high - definition television signals , ntsc video , s - video , and / or rgb component video inputs , although various embodiments may not accept each of these signal types or may accept signals in other formats ( such as pal ). the selected video input is converted to a digital data stream , dv in , in ccir656 format and supplied to a media processor 110 . analog tuner / input select section 108 also selects an audio source , digitizes that source if necessary , and supplies that digitized source as digital audio in to an audio processor 114 and a multiplexer 130 . the audio source can be selected — independent of the current video source — as the audio channel ( s ) of a currently tuned rf television signal , stereophonic or monophonic audio connected to television 100 by audio jacks corresponding to a video input , or an internal microphone . media processor 110 and digital video / graphics processor 120 provide various digital feature capabilities for television 100 , as will be explained further in the specific embodiments below . in some embodiments , processors 110 and 120 can be tms320dm270 signal processors , available from texas instruments , inc ., dallas , tex . digital video / graphics processor 120 functions as a master processor , and media processor 110 functions as a slave processor . media processor 110 supplies digital video , either corresponding to dv in or to a decoded media stream from another source , to digital video / graphics processor 120 over a dv transfer bus . media processor 110 performs mpeg ( motion picture expert group ) coding and decoding of digital media streams for television 100 , as instructed by digital video / graphics processor 120 . a 32 - bit - wide data bus connects memory 112 , e . g ., two 16 - bit - wide × 1m synchronous dram devices connected in parallel , to processor 110 . an audio processor 114 also connects to this data bus to provide audio coding and decoding for media streams handled by media processor 110 . dotted line 116 divides the media processor subsystem from the host processor subsystem . media processor 110 cannot directly access the devices on the right ( host ) side of dotted line 116 . digital video / graphics processor 120 can access media processor 110 and memory 112 directly , however , and thus indirectly provides connectivity between media processor 110 and flash memory 126 or pcmcia cards 128 . digital video / graphics processor 120 coordinates ( and / or implements ) many of the digital features of television 100 . a 32 - bit - wide data bus connects memory 122 , e . g ., two 16 - bit - wide × 1m synchronous dram devices connected in parallel , to processor 120 . a 16 - bit - wide system bus connects processor 120 to media processor 110 , an audio processor 124 , flash memory 126 , and ports for removable pcmcia cards 128 . flash memory 126 stores boot code , configuration data , system executable code , and java code / class files for graphics applications and applets , etc . pcmcia cards 128 can provide extended media and / or application capability , such as the java applets explained herein . digital video / graphics processor 120 can pass data from the dv transfer bus to lcd panel driver 104 as is , but processor 120 can also supercede , modify , or superimpose the dv transfer signal with other content . for instance , processor 120 can generate java application / applet graphics that overlay or supercede the dv transfer signal , system graphics that display messages over all underlying content , or decode media from pcmcia cards 128 , e . g ., in a “ time - shifting ” mode where media processor 110 is coding a program to the pcmcia card and processor 120 decodes and displays a time - shifted version of the same program , allowing the viewer to pause , rewind , or skip through the program . multiplexer 130 provides audio output to the television amplifier and line outputs ( not shown ) from one of three sources . the first source is the current digital audio in stream from analog tuner / input select section 108 . the second and third sources are the digital audio outputs of audio processors 114 and 124 . these two outputs are tied to the same input of multiplexer 130 , since each audio processor is capable of tri - stating its output when it is not selected . in some embodiments , processors 114 and 124 can be tms320vc5416 signal processors , available from texas instruments , inc ., dallas , tex . at system powerup , digital video / graphics processor 120 creates an executable image for itself in memory 122 and for media processor 110 in memory 112 . flash memory 126 stores the elements of this image as default system code for processors 110 , 114 , 120 , and 124 . this code includes : a system manager , a java engine , which may contain any combination of a just - in - time java compiler , a java interpreter , or precompiled java code , and an application manager such as a java manager that manages java applets for processor 120 ; audio codecs for processors 114 and 124 ; and video codecs for processors 110 and 120 . the system manager provides low - level functions for communication with the other devices attached to processor 120 , and communicates system events to the java manager and other processes . the java engine interprets and executes java code for the java manager , and java applets when applets are loaded . referring to fig2 , processor 120 works at various times with up to three display planes : a system display plane 30 , an applet display plane 40 , and a video and still image plane 50 . the rearmost plane 50 can contain digital video received at the dv transfer port from processor 110 or decoded mpeg video or jpeg images , as well as images originally stored in other formats . the middle plane 40 is active when a java applet 95 has focus , or when the java manager displays graphics on the middle plane . the front plane 30 is used , typically infrequently , to display alert and status messages from the java manager . these messages can include message requests from a platform - aware java applet 90 that does not have focus . to create the digital video stream for the display , software mixer 200 and hardware mixer 70 combine information from display planes 30 , 40 , and 50 . software mixer 200 combines information from display planes 30 and 40 , as will be explained in further detail below . a look - up table ( lut ) is used in block 60 to convert the output of software mixer 200 to the yc b c r color space of video plane 50 . the output of lut color conversion block 60 is combined with video plane 50 in hardware mixer 70 . fig3 shows internal detail of software mixer 200 . applet plane graphics are rendered to applet display buffer 210 . system plane graphics are rendered to system display buffer 220 . although it is possible to merge graphics from these two planes in a fairly mindless fashion for each video frame , display artifacts would be visible to a viewer from time to time , and a significant percentage of available processing resources would be consumed merely to perform the merge . mixer 200 , however , takes advantage of the observations that system graphics are displayed a small percentage of the time and usually occupy a small region of the viewable area to provide visually acceptable mixing while consuming far less resources . the output of software mixer 200 is taken at a multiplexer 280 . multiplexer 280 can take input from one of three buffers : applet display buffer 210 , system display buffer 220 , or an anti - flicker display buffer 270 . the multiplexer select signal is generated by region manager 290 , and the select criteria will be explained below . to summarize , however , if only one of the applet and system display planes is active , mixing is bypassed to save resources , and two switches 240 and 245 remain open . only when both display planes are active are switches 240 and 245 closed to cause mixing to occur . further , even when both display planes 210 and 220 are active , mixing is only performed regionally as needed . region manager 290 tracks which regions of buffers 210 and 220 are being updated , and controls a mux control block 230 , a multiplexer 250 , and the addressing of a composite display buffer 260 and the anti - flicker display buffer 270 to mix only the updated regions . in order to intelligently control mixing , region manager 290 receives two types of notifications : system graphics section registration ( and unregistration ) notifications from the java manager ; and paint region notifications for both display buffers from the java engine . in other embodiments , the registration notifications and paint region notifications are received from other sources , such as an application manager . the region manager 290 can be implemented , wholly or partly , within the java engine . referring to fig4 , when the java manager 300 desires to paint system graphics to a region of the display , it calls a java engine api ( application programming interface ) to register a rectangular section of the display bounding the desired region ( the system graphics need not be rectangular , but the registered section is preferably rectangular for simplicity ). for instance , fig4 shows two registered section of the system display plane . section 1 is described by the parameters ( x 1 , y 1 , w 1 , h 1 ), which respectively specify the section &# 39 ; s left boundary with respect to the left edge of the display , the section &# 39 ; s upper boundary with respect to the top edge of the display , the section &# 39 ; s width , and the section &# 39 ; s height . section 2 is described by similar parameters ( x 2 , y 2 , w 2 , h 2 ). a second api allows the java manager to unregister a previously registered section . in some embodiments , region manager 290 maintains a linked list of registered system graphics areas , with the head of the list maintained by a pointer systemgraphics section head that is initially a null pointer . when the java manager requests registration of section 1 , a node is added to the linked list containing the parameters ( x 1 , y 1 , w 1 , h 1 ) and a next pointer that is initially null . when the java manager subsequently requests registration of section 2 , a second node is added to the linked list containing the parameters ( x 2 , y 2 , w 2 , h 2 ) and a next pointer that is initially null . the next pointer of the first node is modified to point to the second node to create the linked list shown in fig4 . when the java manager unregisters a region , the corresponding node is removed from the linked list . whenever systemgraphics section head is not null , region manager 290 assumes that system graphics are active . note that region manager 290 can in some embodiments choose to merge two linked list nodes to a single bounding rectangle node , particularly if the regions overlap . the second type of notification received by region manager 290 is a paint region notification . whenever an applet with focus or a component of the java manager calls a routine to draw to applet display buffer 210 , the draw or paint routine notifies region manager 290 that a rectangular bounding region for the routine has been modified . whenever the java manager draws to system display buffer 220 , the draw or paint routine sends a similar notification to region manager 290 . region manager 290 uses paint region notifications to create a second linked list similar to the system graphics section linked list . as shown in the flowcharts of fig5 - 7 , region manager 290 uses the paint region linked list to control mixing when both buffers 210 and 220 are active . returning briefly to fig3 , mux control 230 controls the mixing operation of multiplexer 250 . mux control 230 causes multiplexer 250 to operate on the portions of buffers 210 and 220 that are newly added to the paint region linked list . if a newly - painted section does not overlap a current system graphics section , switch 245 is kept open and the paint region is copied to the composite display buffer . when a system graphics section is overlapped , mixing is required . in that case , mux control 230 looks for a hard key in the pixel data coming out of system display buffer 220 : when the hard key is not set for a particular pixel , the current pixel in buffer 220 is copied to composite display buffer 260 ; when the hard key is set for a particular pixel , the current pixel in buffer 210 is copied to composite display buffer 260 . in some implementations , the hard key is a pixel value of zero , which indicates a transparent pixel . fig5 shows the high - level mixing control operation of region manager 290 . the output of mixer 280 depends on whether system graphics are enabled and whether an applet ( or the java manager ) has focus . when both of these conditions are false , region manager 290 disables hardware mixing and multiplexer 280 need not produce any output . when system graphics are disabled but an applet has focus , the applet display buffer 210 output is selected for hardware mixing with video . when system graphics are enabled and an applet does not have focus , the system display buffer 220 output is selected for hardware mixing with video . and when system graphics are enabled and an applet has focus , software mixing is required . when software mixing is required , region manager 290 determines whether the status of the system display or applet display has changed since the last time region manager 290 performed this analysis . in particular , if mixing was not performed on the immediately preceding frames , the anti - flicker display buffer 270 likely is not current and should be initialized before multiplexer 280 switches to accept output from buffer 270 . in this instance , region manager 290 sets the whole display area as an update region before initiating mixing . during software mixing , the output of buffers 210 and 220 is mixed to composite display buffer as shown in fig6 , and the anti - flicker display buffer is updated as shown in fig7 from the composite display buffer on a frame interrupt to prevent frame tearing . once the anti - flicker display buffer is stable , region manager 290 selects the anti - flicker display buffer for hardware mixing . fig6 shows the software mixing process . when no newly painted regions have been added to the paint region linked list since the last mixing operation , no software mixing is required and the routine returns . otherwise , the first region in the paint region linked list is selected . region manager 290 determines whether the paint region overlaps a system region in the system graphics section linked list : when the regions overlap , the output of buffers 210 and 220 are merged into composite display buffer 260 , as previously described , for the paint region ; when the paint region does not overlap any registered system region , the corresponding region of applet display buffer 210 is copied to composite display buffer 260 . once the composite display buffer has been updated for a paint region , the corresponding node in the paint region linked list is modified to indicate a status of “ mixed .” region manager 290 then traverses to the next node in the paint region linked list . when the next region is null , the end of the list has been reached and the software mixing routine exits . when the next paint region is not null and has not been mixed already , the software mixer loops back up and processes the new region as described for the first region . fig7 shows the anti - flicker display buffer update process . preferably , an anti - flicker display buffer update routine is called on frame interrupt so that updates are synchronized with the display sequencing . region manager 290 determines whether any paint regions in the paint region linked list have been marked as “ mixed .” when no newly mixed regions have been added to the paint region linked list since the last mixing operation , no anti - flicker display buffer updates are required and the routine returns . otherwise , the first region in the paint region linked list is selected . region manager 290 determines whether the first paint region has been mixed yet to the composite display buffer ; when it has , the region is copied from the composite display buffer to the anti - flicker display buffer and the region is removed from the paint region linked list . when the first paint region has not yet been mixed , processing is bypassed for that region . region manager 290 then traverses to the next node in the paint region linked list . when the next region is null , the end of the list has been reached and the anti - flicker display buffer routine exits . when the next paint region is not null , the routine loops back up and processes the new region as described for the first region . the java engine allows multiple java applets to run concurrently with each other and with the java manager . as just described , however , only one applet at a time can have the “ focus ” of the viewer &# 39 ; s remote control or other input device and perform updates to the applet display buffer . platform - aware applets can be written to understand what it means to receive and lose focus , but no such assumption can be made when the viewer is allowed to load platform - independent java applets from the pcmcia port . thus the television embodiments are designed to cope with two types of java applets : platform - aware applets , which are coded specifically to interoperate with the java manager and platform - specific apis , and platform - independent applets , which are not . generally , the applets that are factory - loaded into flash memory 126 are platform - aware applets , while applets accessible through pcmcia cards can be either platform - aware applets or platform - independent applets . platform - aware applets have access to platform - specific apis to perform such functions as channel and volume changes , picture - in - picture functions , jpeg and mpeg4 display , etc . the java manager includes a class ( the application manager ) that functions as a java applet browser / launcher . the application manager can be assigned to a specific key on the viewer &# 39 ; s remote control and / or can be activated from a menu . the application manager maintains a list of currently - available java applets that are available to the viewer . this list will typically include some of the java applets stored in flash memory 126 ( some may only be available to other java applets and not to the viewer ) and any applets found using pcmcia cards 128 . preferably , the application manager locates descriptor files and icons for each available applet and can then present the applets to a viewer in an easily - comprehended graphical format . note that if a pcmcia card 128 provides wireless connectivity to multiple “ shares ,” where a share is a shared resource located on a computer or other wireless device , applets available on each share can be arranged in the graphical format by share . assume for the following example that the application manager 310 is the described application manager and a platform - aware applet b 320 is an mp3 player . in addition , assume that the application manager has located two platform - independent applets , an applet c 330 and an applet d 340 , which could be for instance a solitaire game and a checkers game , respectively . fig8 a - 8h illustrate applet / manager function as a viewer navigates between the application manager , these various applets , and the video function of the television . an applet that is currently not loaded to memory 122 is depicted with a dashed border ; an applet that is loaded to memory 122 is depicted with a solid border ; and an applet that has focus is depicted with a bold solid border . in fig8 a , the viewer selects application manager 310 from a remote control . the java manager 300 is notified of the viewer selection and directs focus to the application manager class . the java engine is notified that the application manager class will now receive focus and receives a request to begin executing the class files for the application manager if they were not executing already . the application manager locates the applets available to the viewer in flash memory and through a pcmcia card and creates a browse / launch display in applet display buffer 210 . the viewer may then use remote control buttons to navigate and select one of the displayed applets , with the application manager modifying its display according to the navigation commands in order to interact with the viewer . when a user selects one of the displayed applets , the application manager notifies java manager 300 that the viewer has requested the launch of an applet . for instance , in fig8 b , the viewer selects applet b , the mp3 player . the java manager 300 calls the java engine to launch applet b . application manager 310 loses focus and can no longer paint to the applet display buffer . the java engine is notified that applet b will now receive focus and receives a request to begin executing the class files for the mp3 player . applet b may provide to the viewer , for instance , playlists or individual mp3 file lists for mp3 files accessible through the pcmcia cards 128 . the viewer may then use remote control buttons to navigate and select an mp3 file , files , or playlist and hit “ play ” to begin playing the selected mp3 media through audio processor 124 . although the application manager has now lost focus , it still runs in a background mode . when a new pcmcia card is inserted or removed from the television , or new shares appear or disappear from the wireless lan , the application manager can be programmed to notify the viewer that the list of available applets has changed . for instance , on pcmcia card removal , all running processes receive a broadcast message that the card has been removed . upon receiving this message , since the application manager does not have focus , it can signal another section of the java manager to request a transient system message , e . g ., “ some applets no longer available — press applets key to view current list ”. java manager 300 requests a system graphics section for the message and displays it to system display buffer 220 . referring now to fig8 c , the viewer now selects a video mode , causing applet b to lose focus . java manager 300 asks applet b whether it can be killed . in this example , applet b responds “ no ,” at which time applet b is notified that it has lost focus and can no longer paint to the applet display buffer . the java engine is notified that applet b has lost focus , but applet b can continue to play mp3 files in a background mode . like the application manager , applet b can use the java manager to display status messages , such as a song name when a new song starts , on the system display buffer . in fig8 d , the viewer presses a button to return focus to the application manager . the java engine is notified that the application manager now has focus , the application manager is notified that it has focus , and the application manager once again draws its applet browser display to applet display buffer 210 . in fig8 e , the viewer selects a platform - independent applet c ( the solitaire game ) and launches it , causing a series of events similar to those described for fig8 b . the solitaire game class files are loaded from the pcmcia card to memory 122 and applet c is launched . whereas applet b registered as a platform - aware applet when launched , applet c has no such registration function , and thus the java manager 300 and java engine know that applet c has no platform specific provisions for receiving and losing focus . applet c output is directed to the applet display buffer and the viewer can operate the applet using remote control buttons . since the applet display buffer requires no special api controls , platform - independent applets can write to it without problem . the java engine and software mixer allow the platform - independent applets to function in a manner that is compatible with the television platform . in fig8 f , the viewer once again selects the application manager to regain focus . applet c cannot continue to run because it does not have the ability to direct its output anywhere but the applet display buffer , and thus would interfere with the output of the application manager . applet c can either be killed or “ paused ,” i . e . remain in memory but not receive any calls , as a design choice . if paused , applet c can potentially be resumed by reselecting it from the application manager . the kill or pause decision can also be based on other criteria , such as memory usage . thus if memory usage is high , the oldest “ paused ” applets can be deleted from memory . fig8 g illustrates a case where the viewer selects a different platform - independent applet d to run . before applet d class files are loaded , applet c can be killed to free memory , and then applet d can be launched and run in similar fashion to applet c . finally , in fig8 h the viewer once again selects a video mode , causing the java manager to pause ( or optionally kill ) applet d . although optional , the application manager could allow other applet - related activities . for instance , applets could be copied from a network share to pcmcia mass memory . or , a “ favorite applet ” could be designated and saved to flash memory 126 . one of ordinary skill in the art will recognize that the concepts taught herein can be tailored to a particular application in many other advantageous ways . in particular , those skilled in the art will recognize that the illustrated embodiments are selected from many alternative implementations that will become apparent upon reading this disclosure . the particular functional block groupings used herein present one possible functional grouping , but functions can be subdivided and / or combined in many other combinations that fall within the scope of the appended claims . although java applets have been described , the described embodiments can be used with other object - oriented coding schemes . the removable device port can be a port other than a pcmcia port . for instance , a firewire ( ieee 1394 ) or usb ( universal serial bus ) 2 . 0 port can be used to connect a removable device . ports that directly accept memory stick , multimedia card , secure digital , smartmedia , and / or xd flash devices can also be used . two java buffers have been described , but more can exist and be integrated into the described mixing schemes . mixing with a single hard key has been described , but more complicated mixing schemes are possible . such minor modifications are encompassed within the embodiments of the invention , and are intended to fall within the scope of the claims . the preceding embodiments are exemplary . although the specification may refer to “ an ”, “ one ”, “ another ”, or “ some ” embodiment ( s ) in several locations , this does not necessarily mean that each such reference is to the same embodiment ( s ), or that the feature only applies to a single embodiment .	6
the present invention relates to a hydraulic load lifting system and , in particular , to a system including a hydraulic cylinder and means for preventing a load carried by said cylinders from moving should a leak occur in the hydraulic line to the cylinder . hydraulic systems , such as those found in excavators and the like , employ a hydraulic cylinder to raise and lower relatively heavy loads and at times to support such loads in an elevated position . when the cylinder is required to support the load in such an elevated position , it is normally desirable to isolate the relatively high load generated pressure in the load supporting end of the cylinder from the remainder of the system . this is to prevent the downward drifting of the load due to leakage past a valve spool of a conventional control valve normally used in such systems . the load pressure is also normally isolated to prevent the sudden dropping of the load in the event of a hydraulic line failure or the like . this isolation can be accomplished by the positioning of a load check valve in the hydraulic line leading from the control valve to the hydraulic cylinder . such a load check valve permits the free flow of fluid to the cylinder , but normally prevents the escape of fluid from the cylinder . the load check valve can be of the type which is vented behind the check valve spool , such that the check valve closes the hydraulic line when the venting line is blocked . when the venting line is opened , hydraulic fluid can flow from the cylinder to the control valve and from the control valve to the cylinder . the load check valve can be mounted directly to the hydraulic cylinder eliminating the need for a conduit to connect the cylinder to the check valve and thus eliminating the possibility of a break therein . however , there is always a possibility that a rupture might occur in the hydraulic line which connects the load check valve to the control valve . if such a rupture occurs and if the venting line from the load check valve is not closed , the load can fall until the operator of the hydraulic system realizes that the load is falling and acts to block the vent line , preventing the load from dropping still further . the present invention is directed to overcoming one or more of the problems as set forth above . in a hydrauluc system comprising a check valve having a main line and a vent line , the improvement includes a blocker means for closing said vent line when the pressure in said main line falls below a predetermined level . accordingly , should a break in the main line between the load check valve and the control valve occur , back pressure in said line would fall . the blocker means can sense this reduction in pressure and can automatically close the vent line preventing the check valve from allowing hydraulic fluid to flow from the cylinder . thus , the system automatically prevents the load from falling without the operator being required to sense the falling load and then act to close the vent line . in another aspect of the invention , the blocker means includes a blocker valve positioned in the vent line , the blocker valve actuated by a resolver means which selects the lowest pressure in the main line between two sensed positions in said main line . thus , if a break occured in one portion of the main line , the resolver means will immediately select the lower main line pressure occuring adjacent the break and communicate said pressure to the blocker valve of the main line to shut the vent line , preventing the load from falling . the figure shows an overall schematic circuit diagram of a hydraulic load lifting system which includes a blocker valve and a sectioned resolver valve embodiment of the present invention . the hydraulic load lifting system of the figure , except for the aforementioned blocker valve and the resolver valve , is described in u . s . pat . no . 4 , 000 , 683 issued on jan . 4 , 1977 to lawrence f . schexnayder . for purposes of brevity , only the main features of the hydraulic system are discussed hereinbelow . following the numbering of the above referenced patent , the hydraulic load lifting system 10 generally includes load supporting hydraulic motor means , such as a pair of hydraulic jacks 12 and a control circuit 13 operatively connected to control the extension of such jacks 12 for raising a load 14 and the retraction thereof for lowering the load 14 . the jacks each include a load supported or head end 16 and an opposite rod end 17 . the control circuit 13 includes a fluid reservoir 19 , a main pump 20 connected for drawing fluid from the reservoir 19 and a pilot - operated main control valve 21 . a pump line 23 connects pump 20 to the control valve 21 . the control valve 21 is selectively positioned between the depicted neutral or a hold position and either of two other operative positions . the control valve 21 communicates with the reservoir 19 by way of a tank line 24 and a cooler 26 . a relief valve 25 selectively controls communication between the pump line 23 and the tank line 24 to limit the maximum pressure in the control circuit between the pump 20 and the control valve 21 . the control valve 21 is further connected to the head end 16 and the opposite rod end 17 of the jacks 12 by main control lines 27 and 28 , respectively . a pair of main line relief valves 30 and 31 are connected to main control lines 27 and 28 , respectively , to limit the maximum pressure in the control circuit on the hydraulic jack side of the control valve . make up valves 32 and 35 are also connected to main control lines 27 and 28 , respectively , and to tank line 24 to provide fluid to the lines 27 and 28 whenever pressure in either of the lines fall below a predetermined level . this is accomplished as pump line 23 is connected to tank line 24 with main control valve 21 in the neutral position and as cooler 26 provides back pressure in the tank line 24 by restricting the flow therefrom to tank 19 . a pair of identical , vented load check valves 33 and 34 are disposed within the main motor line 27 to each of the head ends 16 of the hydraulic jacks 12 . the purpose of such load check valves , as will be apparent to those skilled in the art , is to avoid downward drifting of the load due to leakage through the main control valve 21 and to prevent the sudden dropping of the load in the event of a line failure or the like . for this reason , the load check valves are preferably disposed on their respective jacks . while the schematic drawing in figure shows such valves as being somewhat spaced from jacks 12 , they are preferably mounted directly on their respective jacks or integral therewith to alleviate the possibility of a line failure between the jacks and the load check valve . the control circuit 13 is provided with venting apparatus generally indicated at 47 for selectively venting the load check valves 33 , 34 . the apparatus 47 includes a pilot operated venting valve 48 . a pilot controlled system , indicated generally at 50 , is provided for selectively simultaneously controlling the operation of the main control valve 21 and the venting valve 48 . the pilot system includes a pilot pump 51 , connected for drawing fluid from the reservoir 19 , for supplying fluid to the pilot control valve 52 by a line 53 . the pilot control valve 52 communicates with the reservoir through a second line 54 . a relief valve 55 is disposed between lines 53 and 54 to limit the maximum pressure in the pilot system to a predetermined level . the pilot control valve is further communicated with the opposite ends of the main control valve 21 by way of pilot lines 56 and 57 . the pilot line 56 is also connected to the venting valve 48 to communicate pilot fluid thereto when pilot pressure is directed to the control valve 21 to shift the control valve to the jack lowering position . as is evident from the figure , pilot lines of the pilot pressure system are represented by dash lines . the pilot operated venting valve 48 is connected to the load check valves 33 amd 34 by way of a vent line 69 . the valve 48 is also connected to the main control line 27 by a connector line 71 . further , a tank line 68 communicates the valve 48 with the tank 19 . the preferred construction of the venting apparatus 47 includes a valve body 60 having a valve bore 61 therein for reciprocally mounting a valve spool 63 . the bore is provided with three axially spaced annuli 64 , 65 and 66 . the first annulus 64 is connected to the reservoir 19 by way of the tank line 68 . the second annulus 65 is connected to the load check valves 33 and 34 by way of vent line 69 . the third annulus 66 is connected by way of passage 70 in the valve body and connector line 71 to the main control line 27 connected to the head end 16 of the jack 12 . a check valve 73 is disposed within the passage 70 for freely admitting fluid to the connector line 71 but preventing flow in the opposite direction . the valve spool is normally biased to a first or vertical position , depicted in the figure , by a spring 74 . the valve body 60 has a pilot inlet port 75 which is connected to the pilot line 56 for communicating pilot pressure against one end of the valve spool to shift the spool toward the right . the valve spool 63 is provided with passage means including an angular passage 77 and a metering slot 78 for interconnecting the second annulus 65 with the first annulus 64 to permit the venting of the load check valves 33 and 34 to allow their opening . however , the valve spool is also provided with an intermediate position between the neutral and fully actuated position . the valve spool is provided with passage means including a pair of staggered angularly disposed passages 80 and 81 for interconnecting the second and third annuli when the spool is in its intermediate position . thus the fluid pressure in the vent line 69 is communicated to the main control line 27 through the connector line 71 and the passage 70 . the venting valve 48 is also provided with a passage 83 interconnecting the first and second annuli which passage is provided with a relief valve 84 and is designed to open at a pressure somewhat lower than the opening pressure of the main line relief valve 30 . the venting line 69 is provided with a pair of branch lines 86 and 87 for individually connecting the vent line with the load check valves 33 and 34 , respectively . each branch line is provided with a choke and check device 88 . each device 88 allows fluid to flow from the respective load check valve , but includes means for partially restricting the flow in the opposite direction . the present invention includes the incorporation of a blocker valve 100 in the vent line 69 . the blocker valve 100 has a closed position ( depicted in the figure ) and an open position and is normally biased by a lightweight spring 102 to the closed position , preventing fluid from flowing in vent line 69 . in a preferred embodiment blocker valve 100 is in fluid communication with and actuated by the fluid from a low pressure resolver valve 104 through conduit 106 . resolver valve 104 communicates with main control line 27 through conduit 108 at a point adjacent to the pilot operated main control valve 21 and through conduit 110 at points adjacent the vented load check valves 33 and 34 . lines 27 and 28 would always have same fluid pressure in them during normal operation due to the aforementioned back pressure in line 24 as a result of fluid flowing through cooler 26 . this back pressure will be transferred to line 27 and 28 through make up valves 32 and 35 . further it is to be appreciated that absent cooler 26 and make up valves 32 and 35 , there would still be back pressure in lines 27 and 28 . the low pressure resolver valve 104 includes a valve housing 112 which defines a central bore 114 having a first enlarged chamber 116 and a second enlarged chamber 118 . as can be seen in the figure , conduit 108 is provided in communication with central bore 114 adjacent to first enlarged chamber 116 and conduit 110 is provided in fluid communication with central bore 114 adjacent to second enlarged chamber 118 . an internal bore 120 provides fluid communication between a portion of central bore 114 intermediate first and second enlarged chambers 116 and 118 and conduit 106 which is provided in fluid communication with blocker valve 100 . disposed in central bore 114 is a slidable spool 122 . slidable spool 122 defines first spherical end 124 and second spherical end 126 . first spherical end 124 is restrainingly contained in first enlarge chamber 116 and second spherical end 126 is restrainingly contained in second enlarge chamber 118 . if the pressure in the conduit 108 is higher than the pressure in conduit 110 , first spherical end 124 is urged against the internal wall 128 of first enlarged chamber 116 , preventing any fluid from conduit 108 from flowing through central bore 114 to conduit 106 . concurrently , due to the length of slidable spool 122 , the second spherical end 126 is positioned substantially in the middle of second enlarged chamber 118 such that the lower pressure fluid in conduit 110 can flow through central bore 114 to conduit 106 . the above described position is depicted in the figure . should the pressure in line 110 be below the predetermined level , owing to a break in conduit 27 adjacent the check valves 33 and 34 , blocker valve 100 would automatically close due to reduced pressure in conduit 106 preventing the relief of pressure from said check valves 33 and 34 and thus preventing the load 14 from falling . conversely , if the pressure in conduit 108 is less than the pressure in conduit 110 , the second spherical end 126 will be urged against the internal wall 130 of the second enlarged chamber 118 blocking fluid communication from conduit 110 through central bore 114 end to conduit 106 . again the slidable spool 122 is of such a length that with the second spherical end 126 positioned against the internal wall 130 of the second enlarged chamber 118 , the first spherical end 124 is positioned in the middle of the first enlarged chamber 116 such that fluid communication is provided from conduit 108 through the central bore 114 to conduit 106 . again , if the hydraulic pressure in main control line 27 drops below a predetermined level , owing to a break in main control line 27 adjacent control valve 21 , the fluid pressure in line 108 would be insufficient to keep the spring 102 from closing the blocker valve 100 , and thereby closing the vent line , preventing the load from falling . it is to be understood that alternatively the low pressure resolver valve 104 can be eliminated from the hydraulic system and the blocker 110 can be connected directly to the main control line 27 by conduit 106 . in such case the blocker valve 100 would be actuated to an open position by the pressure at one point on main control line 27 instead of being actuated by the lowest of two pressures at two different points on main control line 27 . the overall operation of the hydraulic load lifting system is discussed in u . s . pat . no . 4 , 000 , 683 , discussed above and incorporated herein by reference . the operation of the improvement is as follows : with , for example , the pilot control valve 52 in the appropriate position for allowing the jack 12 to lower the load 14 , venting valve 48 opens venting line 69 so that fluid can be vented behind load check valves 33 and 34 thereby allowing the fluid from the head ends 16 of the jacks 12 to flow through the main control line 27 . as long as the return flow pressure in main control line 27 is at or above the normal operating level at the points where the conduit 108 and 110 communicate with said main control line , the resolver valve 104 will select the lowest of the pressures at the points and communicate that pressure to blocker valve 100 . valve 100 will be urged to an open position , keeping vent line 69 open so that the lowering of load 14 can continue as fluid is vented behind check valves 33 and 34 . if a break should occur in the main control line 27 so that the pressure at the intersection of either conduit 108 and main control line 27 or conduit 110 and main control line 27 is below the normal operating level , the lower pressure will be selected by low pressure resolver valve 104 and communicated through conduit 106 to blocker valve 100 . the lower pressure will be unable to overcome the spring 102 , and thus spring 102 will urge the blocker valve to the closed mode , preventing fluid from flowing through venting line 69 from the load check valves 33 and 34 . this will quickly cause load check valves 33 and 34 to close , thus preventing fluid from flowing from the jacks 12 through said load check valves 33 and 34 to the main control line 27 . as is obvious from the above description , the blocker valve and resolver valve 104 function automatically should a rupture occur in the main control line 27 . accordingly , for example , without the operator having to realize that the load 14 is descending at a higher rate than that selected , and in fact , before the rate of descent is noticably different from that selected , the resolver 104 and blocker valve 100 have prevented fluid from flowing in vent line 69 and thus the load from falling . in a prior device , upon seeing the load falling , the operator would have to immediately shift a pilot control , such as pilot control valve 52 , to a blocking position to prevent fluid from venting behind the load check valve 33 and 34 . further as the blocker valve 100 overrides the pilot control system 50 , the operator cannot inadvertently restart the jacks 12 in motion until the break in the main control line 27 is repaired and normal operating pressure is restored . it is to be understood that if desired a blocker valve ( not shown ) and a resolver valve ( not shown ) similar to valves 100 and 104 and with appropriate load check valves ( not shown ) could be incorporated into main control line 28 to prevent a load from falling should the jacks 12 be inverted . other aspects , objects , and advantages of this invention can be obtained from a study of the drawing , the disclosure , and the appended claims .	5
fig1 illustrates a shredder apparatus 10 having a full bin indicator 24 in accordance with an embodiment of the present invention . the apparatus 10 generally includes a shredder housing 20 , a bin 22 , and an indicator 24 . in the embodiment shown , the indicator 24 is a flap attached to the bin side ( underside ) of the shredder housing 20 and has an extended portion 25 . fig1 shows a view of the shredder housing 20 from the top . as shown , the shredder housing 20 is situated upon the bin 22 so that materials inserted into a shredder opening 32 will be shredded and deposited directly into the bin 22 . the shredder housing 20 may have a lip 46 or other structural arrangement that corresponds in size and shape with a top edge 48 of the bin 22 . in the embodiment shown , the shredder housing 20 and bin 22 are sized such that all but a portion 34 of the entire bin opening is covered by the shredder housing 20 . this opening 34 is a bin access opening that may be utilized to deposit articles ( e . g ., trash ) that are not desired to be shredded . the shredder housing 20 may optionally be provided with a cutout 42 that increases the size of the bin access opening 34 in order to accommodate larger articles . the bin 22 may optionally be provided with an extension portion 36 to likewise increase the size of the bin access opening 34 . naturally , at least one of a cutout 42 in the shredder housing 20 or an extension portion 36 in the bin 22 is preferred , so as to form the bin access opening 34 . alternatively , the bin 22 and the shredder housing 20 be may an integral component . in such a case , shredded materials within the bin portion of the apparatus may be removed via a door located on the bin portion and / or the shredder housing portion . all other features of an integral bin / housing configuration relevant to the present invention may be as described herein . the configuration of the bin access opening 34 and its location relative to the shredder input opening 32 ( also commonly referred to as the throat ) is not particularly critical , and the invention is not limited to the configuration disclosed . for example , the bin access opening need not be provided in part by the bin , and instead may be an opening through the shredder housing 20 itself . likewise , it may be entirely provided by an opening formed through the structure of the bin . furthermore , in some embodiments of the present invention there may be no bin access opening present . instead , the bin 22 and / or shredder housing 20 may be provided with a window through which the indicator 24 may be viewed . in other embodiments , the indicator 24 may be operably connected to or have a secondary element that is otherwise viewable from the exterior of the shredder apparatus 10 without requiring a bin access opening 34 or a window ( e . g ., a mechanical element that moves or otherwise changes its appearance that is connected to the indicator 24 through the shredder housing , or a mechanical gauge that is operably connected to the indicator 24 ). although the shredder housing 20 and bin 22 are shown as nesting in a complementary fashion , one of skill in the art will appreciate that such a complementary fit is not a requirement of the present invention . the present invention may be applied in apparatuses in which the shape of the shredder housing 20 greatly varies from that of the bin 22 ( e . g ., in cases where a shredder housing in accordance with the present invention is used with a pre - existing or generic receptacle ). the top of the shredder housing 20 may include a switch or plurality of switches to control operation of the shredder apparatus 10 . as shown in fig1 , a rocker switch is provided on the shredder housing that includes a power button portion 26 and a reverse button portion 28 . indicator lights 30 are also provided . the power button portion 26 turns the shredder apparatus 10 on and off . the reverse button portion 28 may be used to clear a jam when materials get stuck in the shredder machinery by reversing the feed direction . it is appreciated that any switches known in the art may be used for these purposes within the scope of the invention . the indicator lights 30 may indicate various operations and / or statuses associated with the shredder apparatus 10 . the shredder housing 20 may further be provided with a handle 50 to facilitate removal from and placement onto the bin 22 . the bin side ( underside ) of the shredder housing 20 is shown in fig2 . as is known in the art , the shredder machinery 42 , including blades configured to shred inserted materials , is configured to receive inserted materials and to feed them through the device and to eject or deposit the shredded pieces of the materials into the bin 22 . the shredding machinery 42 therefore has an input opening at 32 and an output opening 43 at the bottom of the housing , as shown in fig2 . the top of the shredder housing 20 having an opening for the shredding machinery input 32 may be considered an “ input side .” the bin side , or underside , of the shredder housing 20 may be considered an “ output side .” the shredder housing 20 and bin 22 may be designed for use together , or the shredder housing 20 may be designed to mount to pre - existing bins owned by a user , such as wastebaskets , trash cans , and the like . the particular construction is not intended to be limiting . in accordance with an embodiment of the present invention , a flap 24 is provided and is pivotally attached to the bin side ( underside ) of the shredder housing 20 between the output opening 43 of the shredder housing 20 and the bin access opening 34 . pivotal attachment may include a simple pivotal attachment about a pivot axis , or an attachment for compound movement that may include multiple axes or other types of movement ( such as linear movement ). such attachment may be implemented by means of hinges 38 and / or hook 40 . the flap 24 is configured to rotate freely about the hinges 38 and / or hook 40 when not impinged by any other forces . as such , when the shredder housing 20 is placed upon the bin 22 and the bin 22 is empty , the flap 24 is in a first position in which it hangs freely under gravity from the shredder housing 20 in a downward direction , as shown in fig4 . as the bin 22 becomes full of paper and / or other materials , the contents will begin to push against the flap 24 from the shredder side of the flap 24 and towards the bin access opening 34 ( or other viewable location ; e . g ., a window , as discussed above ). the accumulation of shredded materials will eventually be enough to push and rotate the flap 24 to a second position , shown in fig1 and 2 , which may be approximately ninety degrees from the first position ( fig4 ). in this position , at least a portion of the flap 24 becomes visible from the input side ( i . e ., exterior ) of the shredder housing 20 through the bin access opening 34 . the flap 24 may be provided with an extension 25 so as to increase visibility through the bin access opening 34 . the extension 25 or another part of the flap 24 visible through the bin access opening 34 may have indicia 27 thereon , such as the words “ bin full ” ( see fig4 – 5 ) or an easily noticeable color ( e . g ., red , yellow , or orange ), in order to alert a user that the bin 22 is full . the extension 25 may alternatively be sized to completely cover the bin access opening 34 in order to prevent the insertion of further articles when the bin 22 is full . in embodiments where no bin access opening 34 or viewing window is present , the extension 25 may be a flag or other element that is mechanically connected to the flap 24 and passes through a slot in the shredder housing 20 to become visible ( or alter its appearance ) to a user . as shown in fig2 – 3 , the output side of the shredder housing 20 may be provided with a recess 44 that is sized and shaped to correspond to the flap 24 and any extension 25 . the recess 44 is suitable for allowing the flap 24 to be flush with the shredder housing surface during storage and / or transport . if the flap 24 is positioned in proximity of the output opening 43 of the shredder machinery 42 and the recess 44 is positioned around the output 43 , the flap 24 may be pivoted into position in the recess 44 to provide suitable protection from and for the sharp components of the shredder machinery 42 , as shown in fig3 . accordingly , a completely mechanical ( with no electronic components aside from the shredding mechanism ) indicator is provided to notify a user when the contents of a shredder bin 22 should be emptied . failure by a user to recognize that a bin 22 is full may result in overfilling , jamming , a paper mess , or other hazardous condition . while specific embodiments have been described above , it will be appreciated that the subject of the present disclosure may be practiced otherwise than as described . the descriptions above are intended to be illustrative , not limiting . thus , it will be apparent to one skilled in the art that modifications may be made without departing from the scope of the claims set out below .	1
in fig1 an insulating perforated plate or perforation matrix 1 is made of quartz , glass , ceramic or a synthetic material having low vapor pressure , the matrix containing a plurality of regularly disposed holes 2 . about and between these holes on an upper side thereof there are , extending in rows in one direction , drive electrodes in the form of applied conductor paths 3 . these serve as anodes for the auxiliary gas discharge space . the conductor strips or paths 3 may be applied to the substrate 1 by printing , vapor deposition , or a photographic process . the conductor path 3 passes around each opening 2 , continuing from the opposite side thereof in a narrow conductor as shown . at the underside of the perforation matrix 1 , conductor paths 4 form individual image points or control electrodes , extending perpendicularly to the row electrodes 3 and being applied in the same fashion to the matrix 1 . a solid cathode 5 is spaced from the anodes 3 to serve as one of the two electrodes of gas discharge space between anode 3 and cathode 6 . a screen electrode 6 is spaced a shorter distance from the control electrodes 4 . when an individual row 3 is driven by raising its potential , a gas discharge occurs near the row and is initially maintained because the other row electrodes have a floating potential or are at cathode potential . from this narrow gas discharge strip the control electrodes 4 for the individual image points located at the side of the perforation matrix 1 , can extract electrons through the individual holes 2 . such extraction may occur either successively among the control electrodes 4 or simultaneously , depending upon whether the control signal itself is applied sequentially or simultaneously . an intermediate store in the fashion of a shift register sr may be employed to trigger simultaneously a whole control row 4 for the individual image point conductor paths , if the relevant control signals have a corresponding positive value . despite the high positive field strength , no gas discharge occurs in the space between electrodes 4 and 6 because the discharge space length is adequately small to avoid a paschen discharge . upon switching to a next row , the gas discharge again strikes , its new ignition being facilitated by the residual ionization near the preceding row . the gas discharge thus skips from row to row with the row driving frequency and remains confined to the gas discharge space . the image point grid arranged at the other side of the perforation matrix and likewise subdivided into parallel elements , thus functions as a control grid 4 , acting through the holes to control the intensity of the electrons extracted from the gas discharge by the high voltage on the screen electrode 6 . if the screen electrode 6 is negatively biased vis - a - vis the anode 3 , which itself is substantially at earth potential , the electron stream will be blocked . as those skilled in the art will realize , in accordance with the paschen law set out in fig2 where the discharge voltage is plotted on the ordinate gas pressure × electrode interval = p × d on the abscissa , it is possible at a given gas pressure and electrode spacing to read off the voltage below which ignition cannot occur and no gas discharge is possible . below a minimum value of this product for a particular gas the discharge voltage or minimum ignition voltage rises very steeply ; in the case for example of argon ( not shown ), this value is 0 . 9 mm hg × mm at 137v . at a low pressure , about 1 mm hg , and a distance between cathode 5 and anode 3 of about 1 cm , it is possible to strike or ignite and maintain a discharge in any of several gases at as little as a few hundred volts . in the electron acceleration space between electrodes 4 and 6 , because of the much smaller electrode distance , a much higher voltage , some few thousand , can be applied without causing a discharge to occur . thus , the ignition of a gas discharge is determined for given values of gas pressure and voltage by the distances between the electrodes in the gas . the electrons produced from the gas discharge , as from a large - area cathode , can , because of the high field strength prevailing in the acceleration space between a hole 2 and the electrode screen 6 and also because of the gas , strike a specific image point on the screen 6 in a concentrated beam without interfering with neighboring image points . with individual control of the individual electron beams through the holes 2 by control of anode row and control electrode column potentials , substantially the same conditions may be achieved as in a conventional cathode ray tube . the value of the mean acceleration potential , corresponding to a direct bias voltage on the control grid 4 , can also be employed to optimize beam focussing ; focussing in any event is not difficult because of the short distance between the bottom surface of the matrix 1 and the screen electrode 6 . the arrangement described corresponds somewhat to a large - area hot cathode . gases such as neon and argon are suitable since their striking voltages are very much lower than for example that of air . also , argon has little unwanted luminosity . to drive the image points of an anode of row 3 , individual signals such as video signals are applied in timed sequence to successive conductor paths of the control electrodes . thus electron streams from the discharge zone passing through the holes 2 impinge successively , point by point , on the screen electrode 6 , each for a very short time , i . e ., only for as long as the signal persists on an electrode 4 under the discharge conditions for an anode row 3 . because this time is very short , screen images produced in this manner are more or less dark as a whole . it is possible to brighten the image produced by preprocessing signals corresponding to the content of a complete anode row in a buffer or intermediate store in accordance with the operation of the series shift register sr to apply all control electrode signals for all points on an anode row 3 simultaneously to all the conductor paths 4 . the processing and reorganization of the relevant video signal to form a signal which is matched to the requirements of the matrix may take place in a series shift register sr with a corresponding number of parallel outputs , for example about 800 , after the manner of a 625 line television picture . in the series shift register sr , the video signal is shifted point by point until individual registers , consisting of semi - conductor stores , are filled . to achieve maximum brilliance in the discharge display device for a black and white picture , the discharge duration of an anode row 3 , of 64 microseconds , must be fully exploited for storage . the register sr , however , also requires this amount of time to become full so that accordingly two such stores can be arranged to operate alternately to process the signals , e . g ., one each for the even and odd rows . thus , based upon the normal line periodicity of 64 microseconds encountered in television pictures for example , a substantial brilliance can be achieved . if , however , the individual electron streams are to persist for a longer period of time , then the video signal must be stored individually with respect to each point in the matrix . to do this a matrix drive system is suitable , signal input being carried out using a three - terminal device , e . g . in the form of a transistor . an integrated system of 500 , 000 transistors is required over an area corresponding to that of a television screen . this problem can be met by a thin - film technique , employing field - effect transistors . an arrangement of the transistors in the discharge device has been shown schematically in fig3 . a control grid 14 for controlling the passing electrons is formed by a metal rim around each square hole 12 in an insulated perforation matrix 11 . the matrix wiring is arranged at the top side of the perforation matrix and consists of row electrodes 17 , marked s i for source or base , and of image point electrodes 18 , marked g i for gate or collector . each control electrode 14 , also marked d ik for drain or emitter , is divided into individual rings and is not connected to the other wiring . a metallic underside 13 of the perforation matrix serves as a perforated anode , and a capacitor with each of the control electrodes 14 . transistors 21 are each located near points of intersection 20 between the s and g lines , the g lines having extensions 19 from line 18 and parallel to line 17 . the intersection area is coated after assembly with an insulating layer to prevent chemical and mechanical changes in the transistors . when using sequential drive techniques , operating point by point , and individual storage for each image point , the video signal v or a signal processed in a series shift register sr is applied to the individual conductor paths 18 ( g i ). to drive a single row , a potential positive in relation to the cathode is applied to one of the row electrodes 17 ( s i ). because the control electrodes 14 ( d ik ) are initially at earth potential or at a negative potential , then depending upon the potential of the particular g i electrodes a current of varying intensity flows toward the row electrode 17 ; this flow charges the individual control electrodes 14 ( d ik ) to a positive potential peak . this potential peak then controls the actual electron flow from the gas discharge space ( below 13 , not shown ) to the screen electrode ( above 11 , not shown ), thus switching on an individual electron beam with a desired intensity . this electron stream continues to flow as long as the control electrode 14 ( d ik ) is sufficiently positively charged . during this control operation , the capacitor between the control electrode 14 ( d ik ) and the anode 13 is charged . accordingly , the capacitance serves as an individual store vis - a - vis each electron beam . the charge and therefore the control voltage of each capacitor can be reached by allowing for selected leakage currents ; however , should such currents be too weak the capacitors can also be shunted by a vaporised - on resistive layer connecting the electrodes 14 and 13 , so that a determinate time constant is produced . should leakage currents be too great , they can be reduced as by increasing the size of the holes 12 in the perforation matrix ll , i . e ., enlarging the control grid openings 14 in relation to the openings in the earthed auxiliary anode 13 at the back of the perforation matrix . by advancing the constant bias voltage on the conductor paths 17 ( s i ), one row after another may be driven in the same way . by advancing also the signals on the g i image point electrodes , the video signal is driven in a point by point sequence . however , it is better to use the procedure described above , in which the video signal is stored in a buffer store or intermediate store sr , i . e ., is prepared by a series shift register , and the signal for a complete row is simultaneously applied to all image point electrode lines 18 ( g i ) in that row . the prime advantage , among others , of this method is that the picture or image exhibits less flicker , in particular , however , time is gained for the charging up of all the capacitors , intersection points 20 , and conductors 17 ( s i ), to the full video signal . if the entire time interval , for example 64 microseconds in the case of television pictures , available for an individual row is used , a very bright image is achieved . the system is also suitable for purely static displays in lieu of moving images . the storage capacity of a device for a static display must be comparatively large and the leakage current from the control electrode 14 small in comparison to a device for a moving image display . the arrangement described is also suitable for color displays . three times the number of s i or g i conductor paths is needed ; to achieve the smallest possible switching capacitance , it is better to increase the number of row conductor paths s i . the individual color components signals must also be applied simultaneously to each color row . thus , for each of three color rows , only a third of the former time , about 21 microseconds , is available for electron flow . a weak video signal on the transistors can in some cases be compensated for by the use of a higher beam intensity or by an increased signal storage time . the principle of creation of a gas discharge current and electron stream in a space and the partial separation thereof from a second space having a shorter path length and higher field strength is in no way limited to the television - screen display device described here but is of quite general application . this principle is applicable to other display devices and tubes operating with gas discharge mechanisms , to achieve greater brilliance as well as the attainment of clear color production with bistable storage operation .	7
digital communication systems typically employ packet - switching systems that transmit blocks of data called packets . typically , data to be sent in a message is longer than the size of a packet and must be broken into a series of packets . each packet consists of a portion of the data being transmitted and control information in a header used to route the packet through the network to its destination . a typical packet switching system 100 a is shown in fig1 a . in the system 10 a , a transmitting server 110 a is connected through a communication pathway 115 a to a packet switching network 120 a . packet switching network 120 a is connected through a communication pathway 125 a to a destination server 130 a . the transmitting server 110 a sends a message as a series of packets to the destination server 130 a through the packet switching network 120 a . in the packet switching network 120 a , packets typically pass through a series of servers . as each packet arrives at a server , the server stores the packet briefly before transmitting the packet to the next server . the packets proceed through the network until they arrive at the destination server 130 a . the destination server 130 a contains memory partitions on one or more processing chips 135 and on one or more memory chips 140 a . the memory chips 140 a may use various memory technologies , including sdram . for illustrative purposes , a particular implementation of a packet switching system is described . for ease of description , a particular implementation in which a message may be any length , a packet may vary from 1 to 64k bytes , and the memory partition size is 64 bytes is used . many implementations may employ variable length packets having maximum packet sizes and memory partition sizes larger than 64 bytes . for example , maximum packet sizes of two kilobytes or four kilobytes may be used . packet switching systems may manage data traffic by maintaining a linked list of the packets . a linked list may include a series of packets stored in partitions in external memory , such that the data stored in one partition points to the partition that stores the next data in the linked list . as the data are stored in external memory , memory space may be wasted by using only a portion of a memory partition . the present design is directed toward efficient memory operation within such a packet switching system , either internal or external , and may also apply to computer , networking , or other hardware memories including , but not limited to , sdram memories . one typical hardware application employing sdram is a network switch that temporarily stores packet data . network switches are frequently used on ethernet networks to connect multiple sub - networks . a switch receives packet data from one sub - network and passes that packet data onto another sub - network . upon receiving a packet , a network switch may divide the packet data into multiple sub - packets or cells . each of the cells includes additional header data . as is well known in the art , ethernet packet data has a maximum size of approximately 1 . 5 kbytes . with the additional header data associated with the cells , a packet of data has a maximum size in the range of under 2 kbytes . after dividing the packet data into cells , the network switch may temporarily allocate a memory buffer in the sdram to store the packet before retransmission . the address and packet data are translated to the sdram , which may operate at a different clock rate than other hardware within the switch . the packet data is then stored in the memory buffer . for retransmission , the switch again accesses the sdram to retrieve the packet data . both the storage and retrieval of data from the sdram introduce access delays . in the present design , the memory employed may be partitioned into a variety of memory partitions for ease of storage and retrieval of the packet data . [ 0028 ] fig1 b is a block diagram illustrating an example of physical memory partitioning . typically , memory 100 is divided into equal fixed - size partitions with each of the partitions used as a fifo buffer and assigned to a flow . each flow may be associated with a device , such as an asynchronous transfer mode ( atm ) device . the size of the memory 100 may be 1 gbyte , for example , and the memory 100 may be divided into 256k partitions . each of the 256k partitions may be statically assigned to a flow ( e . g ., the partition 1 is assigned to the flow 1 , etc .) such that every flow is associated with at most one partition . no free partition exists . in this example , each partition is 4 kbytes long . this partitioning technique is referred to as complete partitioning . [ 0029 ] fig2 is a block diagram illustrating another example of a memory and its partitions , where memory 200 may be partitioned into multiple partitions . the number of partitions may be at least equal to the number of supported flows , and the partitions may be of the same size . for example , the size of the memory 200 may be 1 gb , and the memory 200 may be partitioned into 16m ( 16 × 1024 × 1024 ) equally sized partitions , even though there may only be 256k flows . in this design , partitions may be grouped into two virtual or logical groups , a dedicated group and a shared group . for example , referring to the example illustrated in fig2 a , there may be 4m partitions in the dedicated group 201 and 12m partitions in the shared group 202 . the grouping of partitions described here relates to the number of partitions in each group . the partitions 1 - 16m in the current example may not all be at contiguous addresses . each flow may be associated with a fifo buffer . each fifo buffer may span multiple partitions assigned to that flow . the multiple partitions may or may not be contiguous . the size of the fifo buffer may be dynamic . for example , the size of a fifo buffer may increase when more partitions are assigned to the flow . similarly , the size of the fifo buffer may decrease when the flow no longer needs the assigned partitions . the function of the fifo buffer is to transfer data to the partitioned memory in a first in , first out manner . [ 0032 ] fig2 b is a block diagram illustrating another example of a memory and its partitions . in this example , there are three flows 1 , 3 and 8 , each assigned at least one partition from the dedicated group 201 . these may be considered active ports because each has assigned partitions , and unread data may exist in these partitions . one or more inactive ports may exist , and no partitions are typically assigned to inactive ports . [ 0033 ] fig2 c is a block diagram illustrating an example of a partition . a partition may include a data section to store user data and a control section to store control information . for example , partition 290 may include a data section 225 that includes user data . unit zero ( 0 ) of the partition 290 may also include a control section 220 . the control information about the data may include , for example , start of packet , end of packet , error condition , etc . each partition may include a pointer that points to a next partition ( referred to as a next partition pointer ) in the fifo buffer . for example , the first data unit 225 of the partition 290 may include a next partition pointer . the next partition pointer may be used to link one partition to another partition when the fifo buffer includes more than one partition . when a partition is a last or only partition in the fifo buffer , the next partition pointer of that partition may have a null value . for one embodiment , the next partition pointer may be stored in a separate memory leaving more memory space in the partition 290 for storing data . unit 0 is the only unit in the foregoing example configuration containing control information or a pointer . as illustrated in fig2 c , units 1 through 7 are dedicated to 8 bytes of data each . [ 0036 ] fig2 d is a block diagram illustrating an example of a fifo buffer that includes more than one partition . fifo buffer 260 in this example includes three partitions , partition 290 , partition 290 + n , and partition 290 + m . these partitions may or may not be contiguous and may be in any physical order . the partition 290 is linked to the partition 290 + n using the next partition pointer 225 . the partition 290 + n is linked to the partition 290 + m using the next partition pointer 245 . the next partition pointer of the partition 290 + m may have a null value to indicate that there is no other partition in the fifo buffer 260 . the fifo buffer 260 may be associated with a head pointer 250 and a tail pointer 255 . the head pointer 250 may point to the beginning of the data , which in this example may be in the first partition 290 of the fifo buffer 260 . the tail pointer 255 may point to the end of the data , which in this example may be in the last partition 290 + m of the fifo buffer 260 . as the data is read from the fifo buffer 260 , the head pointer 250 may be updated accordingly . when the data is completely read from the partition 290 , the head pointer 250 may then be updated to point to the beginning of the data in the partition 290 + n . this may be done using the next partition pointer 225 to locate the partition 290 + n . the partition 290 may then be returned . from fig2 b , partitions in the dedicated group 201 and / or in the shared group 202 may not have been assigned to any flow . these partitions are considered free or available partitions and may logically be grouped together in a free pool . for example , when a flow returns a partition to either the shared group 202 or the dedicated group 201 , it may be logically be viewed as being returned to the free pool . one example of a previous memory management system used to manage memory , either partitioned or not partitioned , is illustrated in fig3 . for the system shown in fig3 memory management entails obtaining a pointer to a free partition every time a new cell or fragment of a packet is enqueued to a data buffer . the memory manager also returns a pointer to memory every time a partition is dequeued . as shown in fig3 chip 301 includes enqueuer 302 , dequeuer 303 , ddr sdram interface 304 , and ddr sdram 305 . external memory 306 resides off chip and holds free pointers , as the size of the ddr sdram 305 dictates that pointers cannot be held within ddr sdram 305 . the memory manager 307 , which has typically been on chip but may be off chip , receives an indication that a new cell has been received , obtains a pointer from external memory 306 , and provides the pointer to the enqueuer 302 which enqueues the pointer and new cell and places them in ddr sdram 305 in one partition . when dequeued , the dequeuer 303 obtains the pointer and the cell in the partition , provides the pointer to the external memory for recycling , and passes the cell for processing , which may include assembly into a packet . thus external memory is accessed every time that a cell is dequeued or enqueued , and the required reading and writing of pointers significantly decreases memory access efficiency because of the requisite access time to the external memory 305 . [ 0041 ] fig4 illustrates an on - chip implementation enabling improved access times to free pointers . fig4 presents a chip 401 having an enqueuer 402 , a dequeuer 403 , a ddr sdram interface 404 , and a ddr sdram 405 . the chip 401 further includes a free pointer pool fifo 406 located between the dequeuer 403 and the enqueuer 404 . the memory manager 407 receives an indication that a new cell has been received , obtains a pointer from the free pointer pool fifo 406 , and provides the pointer to the enqueuer 402 which enqueues the pointer and new cell and places them in ddr sdram 405 in one partition . when dequeued , the dequeuer 403 obtains the pointer and the cell in the partition within the ddr sdram , provides the pointer to the free pointer pool fifo 406 , and passes the cell for processing , which may include assembly into a packet . thus the free pointer pool fifo 406 acts as a balancing mechanism that operates to continuously recycle unused pointers located on the ddr sdram 405 . a certain quantity of unused pointers is located in the ddr sdram 405 , and those pointers may be freely transferred to and from free pointer pool fifo 406 . [ 0043 ] fig5 illustrates the composition of a sample ddr sdram 405 having n partitions , of any size but for purposes of this example having a size of 64 bytes . the free pointer pool 501 within the ddr sdram 405 occupies a certain subsection of the ddr sdram 405 , and various sizes may be employed depending on circumstances , such as the pointer size and ddr sdram or other memory size , such as 5 per cent of the entire memory . in this example , the free pointer pool 501 occupies n / 20 partitions and may store as many as n pointers . pointer size in this example is 25 bits . thus as shown in fig3 the ddr sdram 405 is divided into multiple partitions of 64 bytes each in this example . a subsection of the ddr sdram 405 includes the free pointer pool 501 , such as 5 per cent of the ddr sdram 405 , and the other 95 per cent is used to store data partitions used to build data buffers . the ddr sdram 405 memory segment including the free pointer pool 501 is also divided into partitions , such as 64 byte partitions , and in this example can store twenty 25 bit pointers to free data partitions . the 64 byte partitions can be accessed as a circular buffer . as may be appreciated by one skilled in the art , virtually all variables or elements described in connection with this example may be altered , namely increased in size or quantity or decreased in size or quantity , including but not limited to pointer size , partition number and size , free pointer pool size , and percentage of memory taken up by the free pointer pool . the example is meant by way of illustration and not limitation on the concepts disclosed herein . in one particular implementation in accordance with the foregoing example , 20 free partition pointers may be stored in the 64 byte partitions occupying 5 per cent of the ddr sdram 405 , as shown in fig6 a . if 128 bits memory data bus width is employed , the pointers may be stored as shown in fig6 b . the memory manager may communicate with the ddr sdram using a 128 bit bus interface as ddr sdram interface 404 . the 64 byte data partitions , such as each of the individual partitions illustrated in fig6 a and 6b , may be organized as eight words having eight bytes each . as shown in fig7 the first word of the data partition includes control information , including a 25 bit pointer to the next partition , and certain control bits , including but not limited to start of packet , end of packet , and so forth . the remaining seven words or 56 bytes include data . data cells or packets can be stored in different ways , typically depending on the type of data flow or the manner in which data is received . for a packet - to - packet flow , each partition may store the 56 bytes , a small segment of the data packet . the last partition may contain less than 56 bytes , and thus the number of bytes stored in the last partition of a packet is provided in the information stored in the control word . this control word makes up the first portion of the packet . in the event the memory operates with atm ( asynchronous transfer mode ) cells , either in cell - to - cell , packet - to - cell , or cell - to - packet transfers from the input flows , each partition stores one complete atm cell , typically having a 52 byte data width . in the event the packet is received as cells and converted to packets , one atm cell received makes up the partition , and the cells can be assembled into packets . thus in this example , the on chip free pointer the on chip free pointer pool fifo 406 is a 125 bit by 32 word memory . each 125 - bit entry in the free pointer pool fifo 406 is a free pointer : the memory address of an available ( or free ) 64 - byte partition located in the external sdram . the free pointer pool fifo 406 may take various forms , but typically it must offer functionality of providing for reading and writing , thus including two ports , and must be able to store an adequate quantity of pointer partitions . one implementation of the free pointer pool fifo 406 that can accommodate the foregoing example is a two port ram having the ability to store four pointer partitions , or 80 pointers . operation of the on - chip free pointer pool fifo 406 is as follows . when a cell or packet segment is enqueued , or stored in the ddr sdram 405 , the enqueuer 402 may obtain a pointer , the pointer indicating an unused data partition within ddr sdram 405 . the pointer is read from the on chip free pointer pool fifo 406 . when a cell or packet segment is dequeued , or read from the ddr sdram 405 , the dequeuer 403 returns or stores the pointer associated with the dequeued partition for future reuse . the pointer is written to the on chip free pointer pool fifo 406 . when the contents of the on chip free pointer pool fifo 406 is above a specified threshold , such as above 75 per cent of capacity , or above 60 pointers , the enqueuer 402 returns a block of 20 pointers , one 64 byte partition , to the free pointer pool in the ddr sdram 405 . when the contents of the on chip free pointer pool fifo 406 is below a specified threshold , such as below 25 per cent of capacity , or below 20 pointers , the dequeuer 403 reads a block of 20 pointers , one 64 byte partition , from the free pointer pool in the ddr sdram 405 . at initiation , a certain quantity of pointer may be loaded from ddr sdram 405 into the free pointer pool fifo 406 . for the aforementioned example , 40 pointers may be loaded into the free pointer pool . data received is enqueued using the enqueuer 402 , while data transmitted is dequeued from ddr sdram using the dequeuer 403 . in a balanced environment , a similar number of pointers will be needed and returned over a given period of time , and thus the free pointer pool fifo 406 may not require refilling or offloading to the ddr sdram 405 . the free pointer pool fifo 406 contents may exceed a threshold when certain write cell cycles are not used to enqueue data partitions . one write cell cycle is then used by the free pointer pool fifo 406 to write a certain number of pointers to the ddr sdram 405 external free pointer pool . the free pointer pool fifo 406 contents may fall below a threshold when certain read cell cycles are not used to dequeue data partitions . one read cell cycle is then used by the free pointer pool fifo 406 to read a certain number of pointers from the ddr sdram 405 external free pointer pool . in this manner , access to ddr sdram for the purpose of reading or writing pointers operates at a very low rate , such as only once every 20 cycles or more . the present design can be used by memory controllers supporting bank interleaving . for example , a memory controller implementing four bank interleaving may employ four on chip free pointer pool fifos 406 . this design may be employed on memories other than ddr sdram , including but not limited to sdr sdram , and rdram , or generally any memory having the ability to change partition size and fifo size . the present system may be implemented using alternate hardware , software , and / or firmware having the capability to function as described herein . one implementation is a processor having available queueing , parsing , and assembly capability , data memory , and possibly on chip storage , but other hardware , software , and / or firmware may be employed . it will be appreciated to those of skill in the art that the present design may be applied to other memory management systems that perform enqueueing and / or dequeueing , and is not restricted to the memory or memory management structures and processes described herein . further , while specific hardware elements , memory types , partitioning , control fields , flows , and related elements have been discussed herein , it is to be understood that more or less of each may be employed while still within the scope of the present invention . accordingly , any and all modifications , variations , or equivalent arrangements which may occur to those skilled in the art , should be considered to be within the scope of the present invention as defined in the appended claims .	6
referring to fig1 , a liquid crystal display 2 according to a first embodiment of the present invention is shown . the liquid crystal display 2 includes a liquid crystal panel 29 , and a direct - type backlight module 20 below the liquid crystal panel 29 . the backlight module 20 is configured to provide planar light for the liquid crystal panel 29 . the backlight module 20 includes a frame 25 , a plurality of light sources 24 , four fixing elements 26 , a diffusing plate 22 , and a bef 21 . the light sources 24 , the diffusing plate 22 , and the bef 21 are arranged in the frame 25 , in that order from bottom to top . each light source 24 includes a supporting strip 241 and a plurality of light - emitting elements 242 . the supporting strip 241 includes a circuit ( not shown ) formed thereon . the light - emitting elements 242 are mounted on the supporting strip 241 in a line . an external power source provides power to the light - emitting elements 242 via wires ( not shown ) and the circuit . light emitted from the light - emitting elements 242 transmits through the diffusing plate 22 and the bef 21 to illuminate the liquid crystal panel 29 . the light - emitting elements 242 can for example be light - emitting diodes ( leds ). the frame 25 includes a rectangular bottom plate 251 , and four side plates 250 upwardly extending from edges of the bottom plate 251 . the bottom plate 251 and the side plates 250 cooperatively define an accommodating space , which space accommodates the light sources 24 , the diffusing plate 22 , and the bef 21 therein . a plurality of elongated recesses 256 are formed in the bottom plate 251 of the frame 25 . the recesses 256 are arranged in a matrix pattern , which includes a plurality of rows and two columns . the light sources 24 are received in the recesses 256 respectively . the bottom plate 251 further includes a plurality of strip - shaped portions between the recesses 256 . a depth of the recesses 256 is less than a thickness of the supporting strips 241 of the light sources 24 . a pair of elastic elements 252 are formed at opposite ends of each strip - shaped portion , respectively . a pair of elastic elements 252 are also formed at the top of each column of the matrix , and at the bottom of each column of the matrix . that is , there are two elastic elements 252 between every two adjacent recesses 256 , two elastic elements 252 adjacent a top of the topmost strip - shaped portion of each column , and two elastic elements 252 adjacent a bottom of a bottommost strip - shaped portion of each column . each two elastic elements 252 between every two adjacent recesses 256 are adjacent to two end portions of each of the two adjacent recesses 256 , respectively . referring also to fig2 , the elastic elements 252 are inseparably integrated with the bottom plate 251 of the frame 25 . that is , the frame 25 including the elastic elements 252 is of a single body of material . in the illustrated embodiment , the elastic elements 252 are stamped from the bottom plate 251 , with each elastic element 252 being generally l - shaped . in particular , each elastic element 252 includes a bending portion 253 and an extending portion 254 . the bending portion 253 extends substantially upwardly from the bottom plate 251 . the extending portion 254 extends approximately perpendicularly from the bending portion 253 . in particular , the extending portion 254 extends slightly down , such that an angle between the bending portion 253 and the extending portion 254 is approximately 90 degrees or less . in the illustrated embodiment , the fixing elements 26 are four long cylindrical bars , each of which has a circular cross - section . two of the fixing elements 26 are positioned at two sides of one of the columns of the matrix , respectively . the other two fixing elements 26 are positioned at two sides of the other column of the matrix , respectively . each fixing element is elastically held in position below the extending portions 254 of the corresponding elastic elements 252 . thus , the light sources 24 can be fixedly mounted in the recesses 256 of the bottom plate 251 of the frame 25 by means of the fixing elements 26 , which are elastically maintained in position by the elastic elements 252 . referring also to fig3 , in assembly of the backlight module 20 , the light sources 24 are mounted to the bottom plate 251 of the frame 25 . first , the light sources 24 are placed in the recesses 256 of the bottom plate 251 . then , each of the fixing elements 26 is inserted between a corresponding column of elastic elements 252 and the bottom plate 251 . the elastic elements 252 resiliently exert downward force on the fixing elements 26 such that the fixing elements 26 downwardly press the supporting strips 241 of the light sources 24 . thus , the light sources 24 are fixedly mounted to the bottom plate 251 of the frame 25 . in summary , the backlight module 20 of the liquid crystal display 2 includes the elastic elements 252 and the fixing elements 26 which cooperatively fix the light sources 24 to the frame 25 . no matter how many light sources 24 are used , the assembly and disassembly of the backlight module 20 and the liquid crystal display 2 are simplified . referring to fig4 , a liquid crystal display according to a second embodiment of the present invention is similar to the liquid crystal display 2 of the first embodiment . however , in the second embodiment , a bottom plate 351 includes a plurality of strip - shaped portions between a plurality of recesses 356 . the bottom plate 351 further includes a plurality of pairs of first notches 357 , with each pair of first notches 357 located below a respective elastic element 352 . an extending portion 354 of each elastic element 352 includes a second notch 358 defined at a lower surface ( not labeled ) thereof . the first and second notches 357 , 358 cooperatively accommodate the fixing elements 36 . that is , the fixing elements 36 are snappingly received between the extending portions 354 of the elastic elements 352 and the strip - shaped portions of the bottom plate 351 . in the illustrated embodiment , each of the first and second notches 357 , 358 defines an arc - shaped profile . the arc - shaped profiles of each pair of first and second notches 357 , 358 are located approximately along the periphery of a same imaginary circular cylinder . referring to fig5 , a direct - type backlight module 40 of a liquid crystal display according to a third embodiment of the present invention is similar to the backlight module 20 of the first embodiment . however , the direct - type backlight module 40 includes eight fixing elements 46 . each column of light sources is fixed by four of the fixing elements 46 . further or alternative embodiments may include the following . in a first example , the recesses 26 can be arranged in other patterns . for example , a matrix pattern may include a plurality of rows and three columns . in a second example , the elastic elements 252 can be independent ( discretely formed ) elements , which are mounted to the bottom plate 251 of the frame 25 . in a third example , the fixing elements 26 can have other shapes , such as a bar shape with an elliptical cross - section . it is to be further understood that even though numerous characteristics and advantages of the present embodiments have been set out in the foregoing description , together with details of the structures and functions of the embodiments , the disclosure is illustrative only ; and that changes may be made in detail , especially in matters of shape , size and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .	6
there is schematically illustrated in fig1 a chamber 10 provided with a first conveying system 12 consisting of a conduit 14 having one end 16 near the bottom of the chamber 10 and a second end 18 directly exposed to the atmosphere . as will be apparent hereinafter , in its broader aspects the present invention is designed to create a partial vacuum or increase the pressure of the chamber in order to withdraw materials and objects 20 into the end 18 of the pipe 14 and downwardly through the pipe 14 for discharge into the chamber 10 through end 16 or to retain the collected materials and objects 20 within the chamber 10 and , when desired , to expel the materials and objects 20 up the pipe 14 through the opening 18 to the atmosphere . the reference numeral 22 designates generally a valve assembly which , as depicted , is arranged for rotational movement . the valve assembly 22 is provided with air passageways 24 , 26 and 28 , described hereinafter . the reference numeral 26 designates generally a second air passageway in the form of conduit structure for transporting air . the reference numeral 32 designates an oscillating air source for moving air along the second air passageway 26 . the reference numerals 34 and 36 designate one - way valves within the valve assembly 22 operatively connecting the second air passageway 26 and the oscillating air source 32 . when it is desired to collect materials or objects 20 and deposit same within the chamber 10 , the valve assembly 22 is moved to the position illustrated in fig3 a . as oscillating air source 32 increases the pressure in second passageway 26 air is expelled outwardly therefrom through the one - way valve 36 into the third air passageway 28 , through which the air is discharged to the atmosphere . the secondary action of the oscillating air source 32 then creates a partial vacuum in the second air passageway causing air to move through the one - way valve 34 creating a partial vacuum in the first air passageway 24 and the chamber 10 , causing the materials and objects 20 to be drawn into the conduit 14 for deposit within the chamber 10 . when it is desired to propel the materials and objects 20 from the chamber 10 to the atmosphere , the position of the valve assembly 22 is reversed to the position shown in fig3 b , by rotation of handle 50 and stem 52 . in this position , activation of the oscillating air source 32 causes air to be propelled through the one - way valve 36 into the first air passageway 24 and thereafter into the chamber 10 . the air pressure then moves the materials and objects upwardly into and through the conduit 14 , thus causing the materials and objects 20 to move out of the chamber 10 to the atmosphere . the secondary action of the oscillating air source 32 then creates a partial vacuum in the second air passageway 26 which is released by air entering through conduit 28 and valve 34 . application of the principles of the present invention to a kitchen implement will now be described with reference to fig2 . the kitchen implement performs as a baster , skimmer , separator , cooler / stock container , a portable , hot - liquid dispenser and a transporter . all of these functions may be performed with a single , simple - to - use implement adapted particularly for use in extracting fat from food preparations , including basting fluids , skimming fat from soups or other hot mixtures , making fat - reduced gravy , when browning or parboiling meats , and the like . the kitchen implement featuring the present invention provides for splatter and dribble free collection , transportation , storage , or dispensation of hot and cold liquids in measured quantities and , also , can be used to collect , mix and dispense or serve liquids in the manner of gravy boats , salad dressing crucibles , creamers and the like . as can be seen in fig2 the chamber 10 is defined by a jar 38 suitably provided with a rotatably mounted cover 40 . the conduit 16 is supported within a frame 46 , which may also attached to the cover 40 , such that one end 48 of the conduit is positioned near the bottom of the jar 38 while the other end 55 thereof is positioned to receive a distal extension piece ( not shown ). the oscillating air source , generally designed by the reference numeral 32 in fig2 includes an oscillating piston , a flexible bellows or the bulb - like member 51 ( shown ), which may be conveniently squeezed by the user . the oscillating air source may be driven manually , as shown , or by a mechanical , electrical or similar force . bulb 51 is operatively connected to the second air passageway 26 within the frame 46 . valve assembly 22 , handle 50 and stem 52 are sealed within the frame 46 by , for example , an end cap 56 which includes an air seal 54 . in this way , the second air passageway 26 is connected to the first and third passageways 24 , 28 through the valve assembly 22 . the structure of the valve assembly will now be discussed with reference to fig3 a , 3b , 4a , 4b , 5a , 5b , 5c , 5d , 6a , 6b , 6c and 6d . fig3 a is a schematic diagram of the valve assembly showing the positions of the one - way valves 36 and 34 for collecting materials or objects 20 and depositing same within the chamber 10 . when the oscillating air supply mechanism , for example a bulb , contracts air is forced out of the second air passageway 26 through valve 36 to the atmosphere through third air passageway 28 . when the bulb expands , valve 36 closes and valve 34 opens to allow air from the jar into the second air passageway 26 through the first air passageway . when it is desired to expel materials and objects 20 from the chamber 10 through conduit 16 to the atmosphere , the valve assembly is turned to the position shown in fig3 b . when the oscillating air supply , for example a bulb , contracts , air from the second air passageway 26 is forced through valve 36 through the first air passageway 24 and into the chamber 10 . when the bulb expands , valve 36 closes and valve 34 opens to allow air to pass from the atmosphere to the second air passageway 26 via third air passageway 28 . the one - way bladder valves are formed such that when the pressure on the rear side of the valve 35 exceeds the pressure on the front side of the valve 37 , the valve opens to allow the air pressure to equalize . however , when the air pressure on the front side of the valve 37 exceeds the air pressure on the back side of the valve 35 , the valve remains closed . the valve is closed when the pressures on the front side 37 and the rear side 35 are equal . fig4 a is a perspective view of the one - way bladder valve in the closed position . fig4 b is a perspective view of the one - way bladder valve in the open position . fig4 c is a perspective view of the rear side of the bladder valve . fig5 a - 5d show the valve assembly 22 which is received within frame 46 . fig5 a and 5b correspond to the valve positions shown in fig3 a . in fig5 a and 5b , a bladder valve 36 is operatively connected with third air passageway 28 to allow air forced through valve 36 to the atmosphere . valve 34 is operatively connected with the first air passageway 24 to allow air from the chamber 10 into the first air passageway 30 . the valves 34 , 36 are received within a rotational body 23 which is formed in the shape of a cylinder or a truncated cone to allow rotation within the frame 46 . fig5 c and 5d show the valve positions represented in fig3 b . in this position , one - way bladder valve 34 is operatively connected to third air passageway 28 to allow air in from the atmosphere and one - way bladder valve 36 is operatively connected to first air passageway 24 such that air is forced from the oscillating air source into the chamber 10 , thus forcing materials or objects 20 from the chamber 10 to the atmosphere . fig6 a - 6d are analogous to fig5 a - 5d ; however , the one - way valves used are ball bearing valves rather than the bladder valves of fig5 a - 5d . when it is desired to expel ( possibly ) fat - reduced material 20 from the jar 38 onto the food being cooked during the basting operation , the valve assembly 22 is moved to the position illustrated in fig3 b , from which it will be apparent that the oscillating air source 32 , such as a piston , bulb or bellows expels air therefrom into second air passageway 26 , after which the air is propelled into first air passageway 26 to pass into the reservoir of the jar 38 . the air exerts pressure on the liquid 20 contained therein propelling same upwardly along the conduit 16 eventually leaving the end 50 of the conduit 16 . during this operation , the oscillating air source 32 is connected to the atmosphere through the second and third air passageways 26 and 28 . when it is desired to move fatty material into the jar , the valve mechanism 22 is rotated to the opposite position ( see fig2 ), at which time the action of the oscillating air source 32 , for example , depression of the bulb 51 causes air to enter and move along the second air passageway 26 entering the third air passageway 28 and outwardly to atmosphere . subsequently , the expansion of the flexible bulb 51 draws a vacuum causing air within the second air passageway 26 to move into the bellows 51 , in turn pulling a vacuum on the inside of the jar 38 through valve 34 and first air passageway 24 . this action of creating a partial vacuum draws fatty substance 20 into the open end 50 of the tube 44 from which it moves downwardly and is deposited within the jar 38 . the second embodiment of the present invention is illustrated in fig7 . in the course of dispersing material and objects 20 from the jar 38 , there sometimes arises the need to expel material or objects that float to the top of the fluid in that they are the target or purpose for using the implement . to facilitate that end the first conveying means is provided with junction 87 midway in the conduit 16 inside the jar 38 mounted with a swing tube 89 jointed at both ends 88 to swivel up and down as the fluid level changes . the floating head 85 supports both the inlet tube 86 at the surface of the material and objects 20 and the swing tube 89 at the swing joint 88 thereby removing floating objects or lighter material from the top of fluid 20 from open end of inlet 86 through tube 89 to conduit 16 and out the open end 50 to atmosphere . although application of the present invention to a kitchen implement has been disclosed , it will be readily apparent that the principles of the present invention are equally applicable in collecting , retaining , mixing and dispensing a wide variety of materials in homes , garages , garden centers , shops , schools , laboratories , production facilities , and the like . wherever fluids are used the present invention simplifies the ability to move , mix , collect and dispense a range of problematic , unstable or dangerous fluids . while we have described a preferred embodiment of the present invention , it should be understood that various changes , adaptations and modifications will be made therein without departing from the spirit of the invention and the scope of the following claims .	0
reference will now be made in detail to embodiments of the invention , examples of which are illustrated in the figures . each embodiment is provided by way of explanation of the invention and not meant as a limitation of the invention . it is intended that the invention include modifications and variations to the embodiments described herein . as shown in fig1 , each spinning unit of an open - end spinning machine possesses a disintegrator with a disintegrator roll ( 1 ) enclosed in a housing ( not shown ), which is assembled from several disintegrator roll components , namely a roll body 10 and a fittings carrier 11 which bears the fittings 110 . the roll body 10 , by force fit , is placed on a drive shaft 2 . the drive shaft 2 receives its own rotational drive in the customary way by means of a circumferential shaft sheave 21 ( see fig8 ) which is disposed on the end of the drive shaft , remote from the roll body 10 . this sheave 21 accommodates a tangential or single drive belt ( not shown ). the drive shaft 2 is carried in conventional fashion on ball bearings 22 in a journal 20 . the roll body 10 of the disintegrator roll 1 possesses , where these ball bearings 22 are concerned , a clearance 23 , so that its rotation is not impaired by the non - rotating journal 20 . the set of fittings 110 is in accord with the embodiment shown in fig1 , which also demonstrates the interpositioning of a ring 111 , which encircles the outer circumferential surface of the fittings carrier 11 . however , as may be seen in fig1 , it is entirely possible to place the fitting 110 directly on the outer circumferential surface of the fittings carrier 11 . to assure the centering of the fittings carrier 11 , the roll body 10 possesses a ring groove 100 facing the fittings carrier 11 , into which the fittings carrier 11 with the fittings 110 carrying ring 111 partially penetrates . the connection of the fittings carrier 11 to the roll body 10 is subjected to no great axial forces , since , during the spinning operation , essentially only radial forces act upon the individual components of the disintegrator roll 1 . consequently , a clip type connector 3 suffices , which , in accord with the embodiment shown in fig1 , is comprised of a stud 30 as well as a stud receptor 31 . in this arrangement , the stud 30 ( or a similar boltlike element ) extends longitudinally in a radial direction toward the inside , that is , in the direction of the drive shaft 2 and is made as an integral part of a ring 300 , which is placed in a corresponding recess 112 of the fittings carrier , which recess extends circumferentially within the entire circumference of the fittings carrier 11 . the roll body 10 , also carries a ring 310 with the already mentioned stud receptor 31 . this receptor 31 is essentially in the shape of a open slot 311 , which , itself , is oriented essentially parallel to the disintegrator roll axis of drive shaft 2 . the slot 311 possesses on its open end , which is facing the length of the stud 30 , ( which is to enter therein ) a tapered entry 312 , which terminates in a narrow passage 313 ( see fig2 as well ). at this narrow passage 313 , the sidewalls of the said slot 311 exhibit a side to side distance a which is smaller than the diameter d 1 of the stud 30 . at this narrow passage 313 , is an adjacent enlargement 314 , which , in regard to shape and dimensioning , essentially fits the shape and the dimensioning of the stud 30 . fig2 shows the slot 311 continues on from this enlargement 314 , in a longitudinal stretch 315 of width b 1 which is less than the diameter of the said enlargement 314 . as can be seen in fig2 , running essentially parallel to the slot 311 is provided an additional slot 317 , which is so closely placed by the first slot 311 , that the relatively thin side wall 316 can yield when the stud 30 , passes through the said narrow passage 313 in its penetration movement . the wall 316 , conversely , returns to its original , narrow position when the stud has continued on and rests in its place within the complementary , slot enlargement 314 . to this end , the ring 310 , in the embodiment according to fig1 , is made of a resilient material , for instance , from an appropriate plastic . various fibers are feed materials for open - end spinning machines , especially natural fibers such as cotton , but also artificial substances such as polyacryl , polyester , viscose and mixtures of any of these . these varied fiber materials are not uniformly disentangled in optimum manner with fittings 110 of universal application , even if the speed of rotation of the disintegrator is adjusted to the individual fiber material . what is looked for as necessary is the achievement of optimal spinning results . to bring about such results , it is desirable to apply the best suited fittings 110 with appropriate distribution of teeth or tooth - shape or to employ fittings of optimum needle type . an exchange of the fittings 110 is introduced by bringing the disintegrator roll 1 to a standstill . then , in a conventional way , the disintegrator roll 1 is made accessible , so that the fittings carrier 11 can then be seized , and in the direction of the arrow f 1 pulled away from the roll body 10 . when the stud 30 leaves the stud receptor 31 , the sidewall 316 yields from the pressure exerted by the stud 30 , until the stud 30 has passed through the narrow passage 313 . during the withdrawal of the stud 30 out of the stud receptor 31 , the fittings carrier 11 along with the ring 111 and the fittings 110 simultaneously leave the ring groove 100 of the roll body 10 . the fittings carrier 11 , freed in this way from the roll body 10 , can now be completely taken out of the housing of the disintegrator . in a similar manner , subsequently an already prepared fittings carrier 11 with a different fitting 110 can be installed . after this has been properly positioned in respect to the roll body 10 , then the fittings carrier 11 , by means of an axially directed force can be connectingly pushed in the direction of the roll body 10 . as this is done , the ring shaped area of the fittings carrier 11 carrying the fittings 110 is centered in the annular groove 100 of the roll body 10 , while the stud 30 now enters the area of the tapered entry 312 , whereby the stud receptor 31 sets up an increasing resistance until the stud 30 has passed the narrowed passage 313 and snaps into the slot enlargement 314 . when the connection apparatus 3 once again takes up its holding position , then the position of the stud 30 is exactly defined in the stud receptor 31 , since the stud 30 cannot leave the slot enlargement 314 either in the direction of the entry tapering 312 nor in the opposite direction of the longitudinal extension 315 which is too narrow for its passage . if in such a case , as shown in the embodiment of fig1 , the connection device 3 is not installed coaxial to the drive shaft 2 , the recommendation would be to provide two or more connection apparatuses 3 of that kind . these would be arrayed in a circle concentric to the drive shaft 2 at equal circumferential distances from one another ( not shown ). with such an apportionment , unbalance would be avoided . the release of the connection apparatus 3 can be supported with the help of an ejection device 4 , which , in accord with the embodiment shown in fig1 , possesses an ejection plate 40 which can be inserted to be against a provided , internal ejector contact surface 41 on an end wall 113 of the fittings carrier 11 . this end wall 113 covers that side of the fittings carrier 11 adjacent to the end of the drive shaft 2 . the ejector contact surface 41 is to be found on that side of the end wall 113 proximal to the roll body 10 . for the sake of safety , in order to avoid a tilt of the fittings carrier 11 in relation to the roll body 10 during the withdrawal by the ejection plate 40 , in accord with the embodiment of fig1 , the contact surface 41 is placed concentric to the fittings carrier 11 . the ejection contact surface 41 surrounds a ejection plate access opening 42 ( fig1 , 3 ) which penetrates the said end wall 113 of the fittings carrier 11 . both this ejection plate access opening 42 and also the ejection plate 40 possess , respectively , a contour which deviates from the circular , so that the ejection plate 40 can be brought into a first turning position through this ejection plate access opening 42 on the side of the end wall 113 remote from the roll body 10 . in this way , the shape of the non - circular ejection plate access opening 42 and the ejection plate 40 , may assume , for example , the shape of a triangle , or a rectangle , an oval , or the like . in accord with the embodiment shown in fig3 , the ejection plate access opening 42 is comprised of a circular , open mid - area 420 as well as two diametrically opposite slots 421 and 422 , the widths b 2 of which are smaller than the diameter d 2 of the central section 420 . a similar contour is shown by the ejection plate 40 , wherein the diameter d 3 of its center section 400 is smaller than the diameter d 2 of the center section 420 of the ejection plate access opening 42 and the length l 2 and the width b 3 of its radial projections 401 and 402 are less than the corresponding dimensions of the center area length l 1 and width b 2 of the slots 421 and 422 . if the ejection plate 40 has passed through the ejection plate access opening 42 , then , the ejection device 4 would be brought by turning about its longitudinal axis into a second rotated position , in which , by withdrawing the ejection device 4 in the direction of the arrow f 1 , the radial projections 401 and 402 on the ejection plate contact surface 41 lie between the slots 421 and 422 and upon a further pulling action in said direction , the stud 30 moves out of the stud receptor 31 . in the same action , the ring 111 and the fittings 110 are released from the ring groove 100 , so that the now loosened fittings carrier 11 can be withdrawn from the roll body 10 . the object of the invention , within the framework of the invention , can be altered in many ways , especially by means of the exchange of individual or several features with equivalents , or by other combinations of the invented features or their equivalents . instead of the described arrangement , also a reversed placement of the stud 30 and the stud receptor 31 is possible , so that the stud 30 is carried by the roll body 10 and the stud receptor 31 is a component of the fittings carrier 11 . it is further possible , that the stud 30 be aligned parallel to the axis of rotation of the drive shaft , whereby the stud 30 would be provided with a thickened head ( not shown ). also , in such a design and orientation of the stud 30 ( also not shown ), the stud 30 can be introduced , again with its thickened head , into the tapered entry 312 and through the narrow passage 313 to come to rest in the widened opening 314 . in this case the bolt also carries out its function for the establishment of the connection between the roll body 10 and the fittings carrier 11 . the release of this lockup is done in an analogous manner as this has been explained in connection with a bolt 30 which has been installed in the radial direction . the stud receptor 31 , instead of being in the form of a slot 311 , can also be a boring , which possesses laterally situated elastic elements for the snap in of the stud 30 as it assumes its operational position . it is obvious that the stud 30 need not be carried by a ring 300 which is part of the fittings carrier 11 , but can be placed directly in a corresponding boring ( not shown ) of the fittings carrier 11 or the roll body 10 ( in an reverse design of the connection apparatus 3 ). instead of an elastic design of the sidewall 316 , an alternative provision could be , that the side wall 316 be made of a rigid material and parts of this sidewall 316 ( for example , at the area of the narrow passage 313 ) be subjected to the loading of an elastic element , for example a compression spring or the like , in order to make possible the required yielding motion . alternatively , provision can be made that the stud receptor 31 be made wholly rigid , and accordingly , the stud 30 would then possess the elastic characteristics . in this case , the stud , for example , on its free end or head area , would carry an elastic ring or the like ( not shown ). this elastic ring , during its introduction into the tapered entry 312 , would be pressed into a circumferential groove in the stud 30 , until this elastic element , upon reaching the expansion 314 could once again expand and hold the stud 30 in its desired position . instead of a clip type connection device 3 , a latch type connection apparatus 5 could be employed ( fig4 ). this possesses , essentially , a latching member hook 50 as well as a latch shoulder 51 and a release apparatus 52 . principally , no difference is made , in this case , as to whether the latch s 0 is mounted on the fittings carrier 11 and the recess 510 with the latch shoulder 51 is carried by the roll body 10 or whether the arrangement of these components is reversed . however , from the design standpoint , it is to be recommended as advantageous to place the release apparatus 52 in that same place where the latch shoulder 51 is located . in accord with fig4 , the latch hook 50 is firmly bound to the fittings carrier 11 and extends itself parallel to the axis of the drive shaft 2 in the direction of the roll body 10 . this roll body 10 possesses a recess 510 , which extends in the longitudinal direction of the latch hook 50 on a guide surface 54 , which recess 510 is bordered on its end proximal to the fittings carrier 11 by a latch shoulder 51 . the end of the said recess 510 , remote from the said latch shoulder 51 , is terminated by a detent 511 . the release apparatus 52 possesses , as an essential component , a sliding element 520 , which can move back and forth between the detent formed by the said latch shoulder 51 and the detent 511 . in this action , the sliding element 520 , by an appropriate , guide ( which is only schematically indicated ) is secured in the recess 510 . in the connection position shown in fig4 , the latch hook 50 is locked behind the latch shoulder 51 and is thus held in this position . in this case , an elastic construction of the latch hook 50 will suffice for this function . in order to increase the assurance of the retention power of said latch hook 50 , the fittings carrier 11 is loaded by a an elastic element , for example , two leaf springs 53 , in a direction toward the latch shoulder 51 so that the latch hook 50 is pressed against the latch shoulder 51 . this elastic element in the form of leaf springs 53 is placed independently of the connection apparatus 5 , whereby for this function , the said annular groove 100 of the roll body 10 suffices . in order to activate the release mechanism 52 for the lifting of the connection between the roll body 10 and the fittings carrier 11 , so that this is freed , the latch hook 50 is moved counter to the force of the leaf springs 53 in the longitudinal direction of the recess 510 . to this end , a pressure in the direction of the arrow f 2 is exerted against the fittings carrier 11 . when this is done , the latch hook 50 pushes the release element 520 before it until the release element reaches the detent 511 on the other end of the recess 510 . at this moment , the latch hook 50 slides over a lifting edge 521 , which is part of the release element 520 , reaching a guide surface 524 which is also part of the release element 520 , that element now being motionless , due to its abutting the detent 511 . because of the ending of the exertion of pressure on the fittings carrier 11 , the said leaf springs 53 force the fittings carrier 11 in the direction of the arrow f 1 and thereby away from the roll body 10 . the latch hook 50 is carried along , without leaving the guide surface 524 of the release element 520 , which element also follows this movement . now the release element 520 finally abuts the latch shoulder 51 and is thereby prevented from following the progressing return movement of the fittings carrier 11 . because of the abutment of the release element 520 against the said latch shoulder 51 , the latch hook 50 can not engage anew on the latch shoulder 51 , but slides off the guide surface 524 of the release element 520 and onto the unobstructed surface 54 . the fittings carrier 11 can now be removed from the roll body 10 . as may be seen from the above description , due to being lifted out of the recess 510 , the latch hook 50 comes into a movement track which circles the recess 510 , in which the latch hook 50 is conducted around the recess 510 . when this occurs , this movement path is formed essentially by means of the guide surface 524 of the release element 520 as well as the guide surface 54 . another fittings carrier 11 , equipped with such fittings as is desired , now can be installed in place of the removed fittings carrier 11 by being pushed onto the roll body 10 in the direction of the arrow f 2 . in this way , the latch hook 50 reaches the release element 520 and pushes this before it , until the latch hook 50 engages itself behind the latch shoulder 51 and thus secures the fittings carrier 11 in its position against the roll body 10 . in order to assure the security of the sliding , i . e ., the come - along of the release element 520 in the desired manner , provision can be made , that the release element 520 slightly exceeds the height the recess 510 . in order to ease the pushing of the latch hook 50 on to the release element 520 , the latch hook 50 can have a run - on ramp on its end proximal to the release element 520 , which enables the elastically designed or elastically held latch hook 50 to yield in such a manner , that it can slide onto the release element 520 . for this purpose , the lifting edge 521 proximal to the latch hook 50 can be provided , outside of the recess 510 , with a chamfer or a small ramp 522 . in an embodiment , not presented in a figure , in the case of the just described embodiment the release element 520 can be furnished without , or only with a short run - on ramp , and , on this account , the lifting edge 521 , upon contact of the release element 520 against the latch hook 51 , stands slightly above the latching shoulder 51 . thereby , the latch hook 50 springs over the latch shoulder 51 upon the withdrawal of the latch hook 50 . in accord with the variant shown in fig5 , 6 , the release apparatus 52 possesses a displacement means designed as an angled diversion 523 , which deflects the latch hook 50 to the side . upon pushing the fittings carrier 11 onto the roll body 10 , the elastically constructed , or the elastically secured latch hook 50 is diverted hereby from the straight movement path a into a deflected curved path b , in which the recess 510 is to be found , and where the latch hook 50 engages itself behind the latch shoulder . for the lifting of this latch connection , the latch hook 50 with its ramp 500 is caused to run on to a lift edge 513 on the other end of the recess 510 , and thereby , is completely lifted out of the recess 510 and out of the operational area of the diversion means 523 so that the sideways bending of the prestressed latch hook 50 reassumes its straight position once more and thus returns directly into the straight movement track a , which runs next to the curved track b . if now , the fittings carrier 11 is withdrawn from the roll body 10 , then , the latch hook 50 does not create any resistance to said withdrawal , because the latch hook 50 is no longer in the diverted path b of movement with the latch shoulder 51 . in accord with fig5 , the latch hook 50 is connected to a supporting surface 60 , which is movably placed in the fittings carrier 11 . the support surface 60 is held relatively large and serves as an operative element for the connection apparatus 6 . if several connection apparatuses 6 are placed equally apportioned about a circular line in the front wall 113 of the fittings carrier 11 , then the support surface 60 can also be ring shaped and be designed as a common operative element for a plurality of connection apparatuses 6 . the radial support surface 60 is loaded toward the latch shoulder 51 by a compression spring 115 , the other end of which abuts against a radial support wall 114 of the fittings carrier 11 . for the lifting of the latch connection between the fittings carrier 11 and the roll body 10 , the fittings carrier 11 must not be in motion , but a movement of the latch hook 50 suffices , which is attained by pressure on the support surface 60 . for the securement of the connection apparatus 6 in the fittings carrier 11 , a restraint 7 is provided , as a part of which , the latch hook 50 ( see fig5 ) possesses a second hook , which coacts with one of the independent safety detents 70 of the connection apparatus 6 . if the latch hook 50 , as a result of its release , leaves the area of the connection apparatus 6 , then it proceeds with its second hook 501 to contact this security detent 70 and would be held back in this position . the securement detent 70 is a part of the slider 71 which is movable transversely to the direction of motion of the latch hook 50 ( see double arrow f 3 ) and is operated by means of an activation device 72 , which in turn is loaded by a compression spring 73 and by means of a ( not shown ) detent — or the like — is prevented from being pushed outward over the surface of the end wall 113 . the activation apparatus 72 possesses a guide plate 74 , with which a bolt 75 carried by a slider 71 engages . the slider 71 is conducted in a radial direction with the aid of a guide ( not shown ), so that it can principally carry out radial movements . in the position shown in fig5 by dotted lines the slider 71 is found in its operational position , in which the latch hook 50 , after its release by the connection apparatus 6 comes into contact with the latch shoulder 70 . if now the activation apparatus 72 is activated , then the slider 71 , with the aid of the plate guide 74 is drawn out of the space of the latch hook 50 , which is hereby released . accordingly , provision may be made , that the connection apparatus 6 , in the connection on the guide surface 54 which is proximal to the fittings carrier 11 , can exhibit an incline 76 , so that the space between the support wall 114 and the roll body 10 is increased . if the hook 501 , after the withdrawal of the slider 71 , comes to lie adjacent with the support wall 114 , then , by an appropriate energizing of the activation element 72 the slider is pushed against the hook 501 , in order to slide this downward from the support wall 114 , so that the latch hook 50 , while making use of the space created by the incline 76 , releases the fittings carrier 11 . at the operational speed of rotation of the disintegrator roll 1 of 8000 or more rpm , severe centrifugal forces are present . in order to secure the latch hook 50 in its idle position against these centrifugal forces , the latch shoulder 51 can be designed with a back - cut 514 and the latch hook 50 which engages with latch shoulder 51 , can be provided with a recess 502 which is complementary to the back - cut 514 ( see fig7 ). if the latch hook 50 is directly , or indirectly loaded with the force of the leaf springs 53 or the like ( see fig4 ) or of a compression spring 115 ( see fig5 ), then the latch hook 50 is pressed even more securely into the backcut 514 , so that the latch hook 50 cannot undesirably leave the back - cut 514 . according to the arrangement of the latch shoulder , the back - cut 514 can be in an acute angle , relative to the guide surface 54 , or made to fit a stepped form of the latch shoulder 51 . instead of a lifting edge 521 or 513 , a lifting means can be activated by the motion of the latch hook 50 and can be provided ( not shown ). this would be , for instance , a kind of an angular lever , which is pivoted by means of the advance of the latch hook 50 and thereby , the latch hook 50 is lifted out of the recess 510 . fig8 shows an activator element 9 serving now as an ejection device 43 which is located in the drive shaft 2 , which is designed as a hollow shaft . the activator element 9 is pushed inside the drive shaft 2 in the longitudinal direction and abuts the contact surface 41 , so that the withdrawal of the fittings carrier 11 from the roll body 10 is supported . in case it is desired , and if space conditions allow , it is entirely possible that this ejector 43 can be inserted each time upon need , in the drive shaft 2 from its end distal from the disintegrator roll 1 or , in the reverse action , be once again withdrawn from the drive shaft 2 . it would be more simple to manipulate and , in consideration of the generally very close space conditions , also more advantageous , if this ejector 43 were to remain permanently in the drive shaft 2 of the disintegrator roll 1 . in this way , the connection apparatus 3 , 5 or 6 without the aid of tools , can be brought not only into its connection position but also into its release position . in order to prevent the ejector 43 from undesirably leaving the drive shaft 2 , that end of the ejector 43 which is proximal to the end wall 113 of the fittings carrier 11 is equipped with a striking plate 430 , which extends itself in a radial direction beyond the boring 24 which accepts push - out device 43 in the drive shaft 2 . in an analogous manner , also that end of the ejector 43 which is remote from the fittings carrier 11 is equipped with a manual push - plate 431 . in this way , the maximum thrust path of the ejector 43 , relative to the drive shaft , is a specified distance . so that the contact plate 430 does not undesirably come to rest on the face of the end wall 113 of the fittings carrier 11 , in accord with the depicted embodiment , between the plate 431 and the end 125 , which is proximal to this plate 431 , a compression spring 432 is installed , or another analogous elastic element is provided , which , for instance , holds the ejector 43 always in that end position , in which its contact plate 430 maintains a specified distance from the provided ejector contacting surface 41 which is on the front wall 113 of the fittings carrier 11 , or from a releasing position of the connection apparatuses 3 , 5 or 6 . to initiate the removal of the fittings carrier 11 from the roll body 10 , the assigned operator presses the ejector 43 counter to the force of the compression spring 432 against ejection surface 41 . after its release , the ejector 43 returns into its operative base position again because of the force of the compression spring 432 . for example , arrangements can be made to clean the covered , inner face surface of the housing ( not shown ) of the disintegrator roll 1 and to remove the disintegrator roll 1 in its entirety from the drive shaft 2 . so that the drive shaft 2 can remain in the machine , between the roll body 10 and the drive shaft 2 is provided a clearance 26 and for the connection of the roll body 10 with the drive shaft 2 a clip type 3 or a latch arrangement 8 is available . this is principally to fulfill the purpose of assuring that the roll body 10 remains in axial alignment on the drive shaft 2 . however , the components can also take on responsibility for the transmission of the rotation from the drive shaft 2 to the roll body 10 . the clip or latch type connection apparatus can be constructed in various manners . the following description limits itself to an embodiment example of the type shown in fig8 , in accord with which , for the transmission of the rotation from the drive shaft 2 to the roll body 10 , a latch type connection is provided . this has at least one sphere 80 , which is retained for one part , in a complementary recess 81 in the circumferential surface of the drive shaft 2 and for the other part , fits into a corresponding recess 82 in the inner circumferential surface of the roll body 10 . the sphere 80 is , in this installation , subjected to the force of a compression spring 83 by means of which the sphere 80 is pressed into the said recess 81 . in order to be able to withdraw the roll body 10 from the drive shaft 2 , principally , no additional measures or auxiliary means are required . however , the removal of the roll body 10 from the drive shaft 2 is eased , and also a later reverse action of replacing the roll body 10 on the drive shaft 11 are additionally eased by the already cited activation element 9 . in accord with the embodiment shown in fig8 , the ejector 43 is an integral component of this activation element 9 , however , the activation element 9 can be provided for the activation of the connection apparatus 8 independent as to whether an ejector 43 is provided or not . the activation element 9 is integral with a lifting device 90 acting in a radial direction , which , in the embodiment shown in fig8 , is constructed in the form of one or more cams 900 , which extend themselves in a radial direction and reach , essentially , to an imaginary extended outside surface line 29 of the drive shaft 2 . the depicted , at - least - one cam 900 , is guided into a slot shaped radial opening 27 of the drive shaft 2 . this slot 27 ends in the recess 81 . the slot 27 has such a length , in the direction of the activation element 9 in the axial boring 24 of the drive shaft 2 , that the cam 900 ( or a plurality thereof , in which case a sphere 80 for each must be provided )— if the sphere 80 is to enter its recess 81 — is withdrawn from that area of said recess 81 . the cam 900 is now available for the lifting of the connection between the drive shaft 2 and the roll body 10 of the connection apparatus 8 . accordingly , the cam 900 moves into the connection apparatus 8 in such a manner , that the sphere 80 is lifted up the cam ramp onto a surface 901 of the cam 900 . this surface is at the level of the circumferential surface of the drive shaft 2 . in this position of the sphere 80 , the axial movement of the roll body 10 is free of obstruction . instead of the sphere 80 and the recess 81 , it is also possible , for a corresponding result , to provide ( not shown ) a centering and locking rod moving in a radial direction with a centering boring . in an additional embodiment , the sphere 80 or the said centering rod can be provided on the drive shaft 2 and the recess 81 or the centering hole on the roll body . because of centrifugal force , the pressure of the sphere or the centering rod on the , recess or centering opening is greatly increased , which leads , during rotation , to a much stronger connection and centering effect . a corresponding connection can also be established between the roll body 10 and the fittings carrier 11 . the described sphere ( s ) 80 of the connection apparatus , as already mentioned , suffices for the rotational inclusion effect of the roll body 10 by the drive shaft 2 . in order that the rotational inclusion effect can be achieved independently of the connection apparatus 8 , in accord with fig8 , for example , both in the circumferential surface of the drive shaft , as well as that of the roll body 10 , a longitudinal groove 28 , or a groove 101 is provided , in which a spring 102 is inserted . the force fit connection between the drive shaft 2 and the roll body 10 in the direction of rotation can also be effected by a kind of toothed engagement , or yet in another manner .	3
turning now to the detailed description of the preferred arrangement or arrangements of the present invention , it should be understood that the inventive features and concepts may be manifested in other arrangements and that the scope of the invention is not limited to the embodiments described or illustrated . the scope of the invention is intended only to be limited by the scope of the claims that follow . fig1 shows the basic schematics of the two different grid geometries used in reservoir simulation and geomechanical finite element simulation over a same section . the data in reservoir grid are represented by block - centered values of 9 blocks in dashed lines labeled p 1 through p 9 . the blocks p 1 through p 9 in the model are determined to have a value that is , for simplicity , interpreted as uniform across each block . overlying the 9 blocks are 12 nodal values labeled l 1 through l 12 with subscript denoting the node number . the nodes present finite element geomechanical simulation data . in order to couple the reservoir flow simulation to the geomechanical simulation to investigate the mechanical deformation of reservoir and its impact on flow behavior of the hydrocarbons , mapping { p 1 , p 2 , . . . p 9 } to { l 1 , l 2 , . . . l 12 } is a prerequisite and is crucial . however , this mapping is also technically challenging since the node distribution in the geomechanical model is considerably random and irregular with respective to the geometry of block centers of the reservoir model . the present invention comprises a least squares finite element method along with a procedure to achieve accuracy and efficiency of this complex data mapping with ease . the data mapping procedure of the present invention consists of two major steps : the first is point - block geometry mapping and the second is the application of least squares finite element analysis method . the procedure described below gives an example of a 2d problem with a triangle element in geomechanical model . without loss of generality , the procedure can also be applied to quadrilateral elements in 2d and tetrahedral elements or hexahedral elements in 3d problem . the first step is to identify and locate the numerical integration points of each finite element . as shown in fig2 a , the integration points a , b and c of a triangular element are shown . in fig2 b , the integration points a , b , c and d of a tetrahedral element are shown . the next step is to identify which block each of these numerical integration points is located . in fig3 , the grid blocks are shown in dashed lines and the numerical integration points a , b and c are found in blocks p 1 , p 4 and p 2 , respectively . the next step is to equalize data value at numerical integration points to the block - center data value of their associated reservoir grid blocks found at previous step . reservoir data is grid - centered based , which means that all the points inside a grid block will have the same value of data , which is equal to value at the center . therefore , if a numerical integration point of finite elements is inside one reservoir grid block , it has the exactly same value of data as that reservoir grid block . for example , in fig4 , the grid blocks number p 1 , p 2 , p 4 have pressure value of 500 psi , 1000 psi and 2000 psi , respectively . known from fig3 , numerical integration points a , b , c are inside reservoir block numbers of p 1 , p 4 , p 2 respectively . as a result , pressure values at these points are equal to 500 psi , 2000 psi and 1000 psi , respectively . the next step is to perform a least squares finite element computation . setting up the computation , let us define p 0 ( x , y ) as the pressure function inferring from known value of each numerical integration point within each finite element , and also define p ( x , y ) as the other pressure function inferring from data value at each finite element node which we are seeking for . thus , there are two pressure distribution functions , p 0 ( x , y ) and p ( x , y ), defined over the same finite element model domain ( x , y ). the goal is to find the integral minimal differences between p ( x , y ) and p 0 ( x , y ) over any location within ( x , y ). this problem can be solved using least squares finite element method as described below . firstly , we define a least squares functional f ( p ) over the model domain v = v ( x , y ), i . e . by virtue of variational principle , finding the minimal of functional f ( p ) can be achieved by performing δf ( p )= 0 . so we can have where δp refers to the virtual increment of the data function p ( x , y ). then , equation ( 2 ) can be discretized using a galerkin finite element technique to easily solve for nodal solutions of finite elements in the following matrix forms , where p ={ p 1 p 2 . . . p n } referring to the nodal solution of finite elements , n is the total number of nodes in each element , and where ξ i is the triangular coordinate of a triangle element at point i shown in fig2 , which is also called the area coordinate , w i are gauss quadrature weight for each numerical integration point i , n gp is the number of gauss quadrature points , \| j \| e is the determinant of the jacobian matrix which relates the area in local coordinates to that in global coordinates for element e and n k is the shape function at node k , which will be explained later . as such , p 0 ( ξ i ) is the estimated solution of p 0 ( x , y ) at numerical integration point i of a triangle element . as shown in fig4 at step 2 , where p 1 is the block center value of block 1 in the reservoir model , in which integration point ξ i is inside . once we obtain p ={ p 1 p 2 . . . p n } after solving equation ( 3 ), we will finish mapping the reservoir block center - based solutions of { p 1 p 2 . . . p m } to finite element nodal solutions of { p 1 p 2 . . . p n } as shown in fig1 . the above method can be compared to other methods described as follows : equation 3 can be interpreted as solving for p 1 in the reservoir model ( the right hand side term in equation 3 ) by means of averaging nodal values p ={ p 1 p 2 . . . p n } in a geomechanical model with k k1 being the averaging coefficients . as known from equation ( 5 ), averaging coefficients k k1 are functions of a shape function for a triangle element . hence , this averaging can be called shape function based weighted averaging . shape function n k in equations 4 and 5 in a 2d triangle element is defined as equal to its area coordinate ( triangular coordinate ) or volume coordinate in 3d tetrahedral element . for example , where ( x i , y i ) denoting the global ( x , y ) coordinates of node i shown in fig2 a and 2b and x ij = x i − x j , y ij = y i − y j . continuing with the explanation , it is known from equations ( 8 ) and ( 9 ), this shape function weighted averaging can account for the geometrical relationship between data points of two different grid models and is very similar to distance weighted averaging method widely used by previous researchers in data mapping . however , the shape function weighted averaging method according the present invention is different and offers many advantages over other distance weighted averaging methods . a first advantage is that a distance weighted averaging method requires searching for all neighboring reservoir blocks for each node . the number of neighboring reservoir blocks for each node is likely to be at least 8 in 2d considerations as shown in fig1 , and will be as high as 25 or more in 3d considerations . a huge number of nodes and grid blocks in field scale reservoir simulation , along with irregular geometry and a random distribution of those nodes and block - centers will definitely make those approaches considerably tedious and prone to poor accuracy . in contrast , the proposed method in this invention only needs to locate only one reservoir block for each node as shown in step 1 of the procedure . so , by comparison , the inventive method is simple and efficient . a second advantage is that distance weighted averaging requires calculation of all the distances between each node and block center of all of its neighboring blocks as weight coefficients . this is time consuming and not efficient . in contrast , the averaging weight coefficient in proposed method is based on a shape function which is a basic concept in finite element simulation , which automatically accounts for geometric relationship between different data points . thus , there is no need to calculate the distances . and the averaging can be linear or quadratic , depending on which type of elements used in geomechanical model . as a result , this is believed to be more accurate . in addition , the proposed method will also employ the classical least squares curve fitting method to fit reservoir model data to geomechanical model data . this should improve the accuracy of data mapping . in summary , the proposed method in this invention has advantages of simplicity , efficiency and accuracy over other methods , such as distance weighted averaging method widely used by previous researchers . fig5 shows the grid geometry of a reservoir model in reservoir flow simulation with a close - up of the grid geometry at left bottom corner shown in fig6 . a hexahedral type of grid was used in this reservoir model of fig6 which is a quite regular geometry . in comparison , fig7 shows that a different grid ( tetrahedral type ) that was employed in a geomechanical model , where random and irregular distribution of nodes can be clearly observed in the close - up view as shown in fig8 . as mentioned before , the objective is to map block - centered pressure data in fig5 and 6 to nodal pressure data in fig7 and 8 and map them accurately . the distinction in two geometries will make data mapping between two models extremely complicated . fig9 shows the pressure distribution at a specific depth in the example reservoir in the reservoir model where high pressure areas are in the darker gray area 91 , lower pressure is in the lower gray area 92 . the mapped pressure distribution in the geomechanical model using the inventive method is presented in fig1 also shows higher pressure 101 and lower pressure area 102 . it is evident that the contour shape and values of pressure depicted in fig1 are in substantial agreement with those in original reservoir model shown in fig9 . this is especially notable along the left side of the figures where pressure is higher . this illustrates the accuracy of data mapping in two dimensions by the proposed inventive method for this horizontal plane . in order to validate the accuracy of data mapping in three dimensions , pressure comparisons at two more different depths are also examined from fig1 to 14 . fig1 and 12 compare the pressure distribution at a depth 100 above the plane shown in fig9 and 10 where fig1 shows original pressure data in the reservoir model with higher pressure area 111 and lower pressure area 112 and fig1 demonstrates the mapped pressure data from reservoir model to the geomechanical finite element model with higher pressure area 121 and lower pressure 122 . obviously , pressure solutions between two models at this depth are also in excellent agreement . the shape of pressure contour , especially at head ( on the left ) and tail ( on the right ) of the higher pressure area can be captured remarkably in fig1 . similarly , fig1 and 14 depict the contour and values of pressure at a depth of about 80 feet above the fig1 and 12 depth for the same reservoir where fig1 shows original pressure data in the reservoir model where higher pressure is in area 131 and lower pressure is in the area 132 and fig1 demonstrates the mapped pressure data from reservoir model to the geomechanical finite element model with higher pressure in area 141 and lower pressure in area 142 . it is readily observed that the pressure mapping from reservoir model shown in fig1 to geomechanical model shown in fig1 is also performed effectively . as described above , fig9 to 14 show pressure values over the three representative depths with the intervals of 100 feet and 80 feet , which encompass the most of reservoir production zone in this reservoir model . therefore , achievement of excellent pressure mapping results in three dimensions over these depth intervals will allow us to move forward to solve this engineering problem accurately and efficiently using simulation coupling study . it should also be recognized that these drawings are for explanation and that in practice , more granularity is available by using color coded diagrams where multiple levels of pressure or other parameters are used and easily shown . thus it can be seen that utilizing the proposed least squares finite element technique and procedure , efficient pressure mapping in three dimensions from corner - point grid in the reservoir simulation model to a finite element tetrahedral grid in a geomechanical simulation model has been successfully created . it allows the coupling of reservoir simulation with geomechanical simulation to estimate the mechanical deformation of reservoirs over production / injection period and its impact on production as a consequence . in closing , it should be noted that the discussion of any reference is not an admission that it is prior art to the present invention , especially any reference that may have a publication date after the priority date of this application . at the same time , each and every claim below is hereby incorporated into this detailed description or specification as an additional embodiment of the present invention . although the systems and processes described herein have been described in detail , it should be understood that various changes , substitutions , and alterations can be made without departing from the spirit and scope of the invention as defined by the following claims . those skilled in the art may be able to study the preferred embodiments and identify other ways to practice the invention that are not exactly as described herein . it is the intent of the inventors that variations and equivalents of the invention are within the scope of the claims while the description , abstract and drawings are not to be used to limit the scope of the invention . the invention is specifically intended to be as broad as the claims below and their equivalents .	6
fig1 to 7 show an oven chamber having first filling openings 1 , 3 and 5 and second filling openings 2 and 4 . further , a riser 6 is connected to the oven chamber . in the first step of the first portion of the process , which is represented in fig1 coal is filled through filling opening 5 positioned adjacent riser 6 . this filling operation produces a cone - shaped charge 7 . this first step is ended when the outer edge of the cone - shaped charge 7 is situated approximately perpendicularly or vertically below filling opening 4 . the coarser coal is gathered in the areas of the outer surface or jacket of cone - shaped charge 7 , especially in the lower portion thereof . the filling gases produced during the charging operation are removed directly through riser 6 . in the next step of the first portion of the process , which is represented in fig2 the oven chamber is charged simultaneously through filling openings 1 and 3 . this produces cone - shaped charges 8 and 9 . this filling operation is stopped when the bases of the cone - shaped charges almost contact each other . here also the coarser coal is again deposited on the outer surfaces of the cone - shaped charges . approximately 30 % of the coal to be introduced through each filling opening 1 , 3 and 5 is introduced through each of such filling openings during the above operations . the filling gases formed in the second step are passed through filling opening 2 and filling opening 4 into a manifold 10 , and then pass through filling opening 5 , which is adjacent to riser 6 , back into the oven chamber . from there , the filling gases are directly removed through riser 6 . the above described first portion of the process is followed by a second portion of the process ( see fig3 ). here , the coal is charged simultaneously through filling openings 2 and 4 . this produces cone - shaped charges 11 and 12 , that are respectively positioned between cone - shaped charges 7 and 8 and 8 and 9 . here also the coarser coal is gathered on the outer surfaces of the charges . the filling performed through openings 2 and 4 is stopped before the coal flows over the tops of cone - shaped charges 7 , 8 and 9 , so that additional coarse - grained coal from charges 11 and 12 is not gathered on the outer surface of cone - shaped charges 7 , 8 and 9 . there is introduced in this step of the process approximately 80 % of the total amount of coal to be introduced through openings 2 and 4 . the filling gases are led through openings 1 and 3 into manifold 10 . the gases return into the oven chamber through filling opening 5 and then pass from the chamber into riser 6 . the trajectory of the filling gases is indicated in fig1 to 7 in each case by means of dashed lines . keeping in mind the extension of the oven chamber in the direction perpendicular to the plane of the drawings in fig1 to 7 , the filling operation produces true cones each having a circular cross section or flattened cones at the walls of the oven chamber . the step of the process represented in fig4 is a repetition of the step described with reference to fig1 . the charge introduced in this operation is designated by numeral 13 . the step of the process represented in fig5 is likewise a repetition of the step described with reference to fig2 . the charges introduced in this operation are designated by numerals 14 and 15 . the total charge to be introduced into the oven chamber through filling openings 5 , 3 and 1 is brought into the oven chamber with charges 13 , 14 and 15 . fig6 shows an intermediate step of the process , wherein the filling gas is removed through openings 1 - 4 . a levelling or grading opening 40 in the side of the chamber is opened . through opening 40 can be introduced a levelling tool 15 which levels the tips of the fills ( see fig7 ). at the same time , and as a repetition of the step of fig3 the residual charge to be introduced through openings 2 and 4 is poured into the oven chamber through such openings . from the drawings it can be seen that the surfaces of the charges , whereat the coarser coal is necessarily gathered , extend diagonally in the oven chamber . this guarantees a uniform carbonization of the coal . further , from the drawings it can be seen that the filling openings which are not used for feeding coal are available for conducting the filling gases . during each of the steps described the charging truck communicates with selected of the filling openings 1 to 5 through corresponding charging connections . the total filling time amounts to about two minutes . fig8 illustrates a charging truck 16 which can be transported on rails 17 that are placed on a cover 18 of the oven . charging truck 16 has five filling units 19 - 23 , that are each associated with one of the filling openings 1 - 5 . fig9 shows one of the filling units more in detail . each filling unit includes a feeder hopper 24 which is open on its lower side . a conveying device is arranged at such position and may be , e . g . a dish wheel , a vibrating trough , or a screw conveyor 25 , which conveys the coal stored in hopper 24 as required to a charging connection 26 . connection 26 has at the lower end thereof a discharge pipe 27 that can be telescoped by means of hydraulic lifting cylinders 28 and piston rods 29 . the discharge pipe 27 can be also pivoted within certain limits , so that it can be adapted to the specific position of the filling opening . a branch pipe 30 opens into charging connection 26 above conveying device 25 . the branch pipe 30 can be closed with respect to charging connection 26 by means of a shutoff valve 31 . at the end thereof situated opposite charging connection 26 , the branch pipes 30 of each of filling unit 19 - 23 end in a common manifold 10 . the operation of shutoff valves 31 , conveying devices 25 and lifting cylinders 28 may be controlled through known hydraulic or electric means . when coal is to be supplied into the oven chamber from a feeder hopper 24 through the filling opening associated therewith , conveying device 25 is started , and the coal conveyed thereby drops through charging connection 26 and discharge pipe 27 into the oven chamber . shutoff valve 31 is closed during this operation . when the desired amount of coal is supplied into the oven chamber , which amount may be measured , e . g . by means of a level detector , or predetermined by setting the operation time of conveying device 25 , then conveying device 25 is switched off and shutoff valve 31 is opened . the level may be checked visually through sight holes . for example , if at a time when coal has been conveyed into the oven chamber from the feeder hoppers of filling devices 19 and 21 , and the conveying devices associated with such filling units are switched off and the shutoff valves associated therewith are opened , the filling gas formed during the subsequent filling of the oven chamber from filling units 20 and 22 , may flow through charging connections 26 of filling units 19 and 21 and corresponding branch pipes 30 into manifold 10 . from there the filling gas is led past the branch pipes 30 of filling units 20 and 22 , that are closed by the respective shutoff valves 31 thereof , to the branch pipe 30 of filling unit 23 and passes through corresponding charging connection 26 thereof back into the chamber and from there into riser 6 . it will be apparent that many modifications may be made to that described above without departing from the scope of the present invention .	2
the present inventors have unexpectedly discovered that due to the small molecular size of the fluoride , and its affinity for multiple cross - linking sites , the fluoride can produce cross - linkage in hair and cause temporary or permanent restructuring of the hair ; i . e . causes straightening , smoothing , defrizzing and / or curling of the hair fiber . more particularly , the use of sodium fluoride can be used in hair products for straightening , smoothing , defrizzing and / or curling . sodium fluoride has excellent water solubility . unexpectedly , the present inventors have discovered that the fluoride can be used to crosslink other molecules to the hair to provide long lasting conditioning or volume to the hair . it can also be used to bind hair dye molecules in the hair for longer lasting coloring of the hair . sodium fluoride is an alternative to conventional hair products using formaldehyde . our data show that compositions for hair treatment having about 0 . 1 to about 15 %, preferably about 0 . 1 to about 3 . 0 %, and more preferably about 0 . 60 to about 1 . 25 % sodium fluoride at ph 4 . 8 , along with a polysaccharide thickener ( such as amigel ®) has a perceptible effect on curl reduction , and that smoothening or better alignment of hair fibers is observed for all normal and porous hair types . fig1 to 7 show the effects of a sodium fluoride composition on several hair types , normal and porous hair including 20 volume color treated and bleached hair . the results from examples 1 to 7 below are shown in fig1 to 7 , respectively . in each of the following examples , the hair was treated as follows : the hair was shampooed and blotted dry . the hair was combed and the treatment composition was applied on the hair for 35 minutes at room temperature with a brush and then it was treated as in the directions below for each of examples 1 to 7 . for all hair samples marked “ a ”, the treatment composition was applied for 35 minutes and then the hair was rinsed with tap water . the hair was air - dried naturally . for all hair samples marked “ b ”, the treatment composition was applied for 35 minutes and then the hair was rinsed with tap water . the hair was blow dried to about 90 % and then flat ironed at 430 ° f . the hair was then rinsed with tap water . for all hair samples marked “ c ”, the treatment composition was applied for 35 minutes and then the hair blow dried at a medium setting to about 90 %, and then flat ironed at 430 ° f . the hair was then rinsed with tap water , and the hair was air - dried naturally . for example 1 , shown in fig1 , a composition of the present disclosure containing 1 % sodium fluoride at ph 4 . 8 was applied to very curly normal hair . for example 2 , shown in fig2 , a composition of the present disclosure containing 1 % sodium fluoride at ph 4 . 8 was applied to very curly 20 volume hair . for example 3 , shown in fig3 , a composition of the present disclosure containing 1 % sodium fluoride at ˜ ph 4 . 8 was applied to very curly 40 volume bleached hair . for example 4 , shown in fig4 , a composition of the present disclosure containing 1 % sodium fluoride at ˜ ph 4 . 8 was applied to wavy 20 volume hair . for example 5 , shown in fig5 , a composition of the present disclosure containing 2 % sodium fluoride at a ph of approximately 4 . 8 was applied to very curly normal hair . for example 6 , show in fig6 , a composition of the present disclosure containing 1 . 5 % sodium fluoride at a ph of approximately 4 . 8 was applied to 40 volume bleached hair . for example 7 , samples a , b , and c were treated as follows : the treatment composition was applied to the hair for 35 minutes . the hair was blow dried at medium heat setting to about 90 % dry , and then flat - ironed at 430 ° f . the hair was then rinsed with tap water , and the hair was air dried naturally . samples o and z were treated as follows : the treatment composition was applied to the hair for 35 minutes , and then the hair was blow dried at a medium heat setting to about 90 % dry . the hair was then flat - ironed at 430 ° f ., and then was rinsed with tap water . the hair was then air dried naturally . as used in this application , the word “ about ” for dimensions , weights , and other measures , means a range that is ± 10 % of the stated value , more preferably ± 5 % of the stated value , and most preferably ± 2 % of the stated value , including all sub ranges there between . in practice of the present disclosure one or more other extended cosmetic compositions can be included for their generally acceptable recognized purposes . these can include soothing agents , such as aloe or allantoin gelatin ; auxiliary emollients , such as squalene , mineral oil , argan oil , coconut oil , jojoba oil , walnut oil or liquid silicones ; fatty alcohol based thickeners , such as cetyl alcohol , cetearyl alcohol , or stearic acid ; low to no foaming cationic , nonionic or amphoteric emulsifiers ; or preservatives , such as phenoxyethanol , sorbitol , potassium sorbate , sodium sorbate , methyl paraben , propyl paraben , imidazolidynyl urea , or dmdm hydantoin . the composition may also contain a fragrance to neutralize any malodors of the composition . the hair swatches are shampooed with a clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i product was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and the hair is dried to about 95 % with a blow dryer at low heat followed with flat ironing @ 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours . the performance % curl reduction , shine and smoothness the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i product was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and hair was blow dried straight at high heat setting using a brush . the hair was rinsed after 48 hrs . the performance % curl reduction , the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i product was applied liberally to the hair with a brush and processed for 35 minutes . the excess product was towel blotted and air dried from the hair . the hair was rinsed after 48 hrs . the performance % curl reduction , shine and smoothness was evaluated . the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i was applied liberally to the hair with a brush and processed for 35 minutes . the hair was rinsed with luke warm water . the hair is dried to about 95 % with a blow dryer at low heat followed with flat ironing @ 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours . the tabulated data of table i above shows that the overall performance of curl reduction , shine and smoothness on hair depends on the ph of composition i and method of application . the performance appears to be dependent on the ph and independent of the type of ph adjustor . the optimum performance of composition i ph range on normal , color treated and bleached hair , appears to be between 4 - 5 . also , the performance effects are dependent on the method of application of composition i . application methods a and d are preferable over methods b and c . both methods a and d have high heat flat ironing greater than 400 f .° with composition i or rinsed off the hair . curl reduction , increase in smoothness and shine of 40 - 80 % have been observed on normal , color treated and bleached hair . the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i product was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and the hair is dried to about 95 % with a blow dryer at low heat followed with flat ironing @ 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours . the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i product was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and hair was blow dried and straightened at high heat setting using a brush . the hair was rinsed after 48 hrs . the performance % curl reduction , the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i product was applied liberally to the hair with a brush and processed for 35 minutes . the excess product was towel blotted and air dried from the hair . the hair was rinsed after 48 hrs . the performance % curl reduction , shine and smoothness was evaluated . the tabulated data on table ia shows that the optimum ph of composition i for maximum performance is about 4 . 50 . this is in agreement with the previous data of table i . exceptional curl reduction , smoothing and shine is observed on all hair types including normal , color treated and multi bleached hair . performance effects of 1 treatment , 1 wash , 5 wash , 10 wash and 2nd treatment with 0 . 75 % naf composition ii - b on very curly / frizzy hair ( normal , color treated and 2x bleached hair type ) process a : the hair swatches were shampooed with an alkaline shampoo ( ph = 8 . 10 ), towel blot and dried at medium heat with blow dryer . the composition ii - b product was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and the hair is dried to about 95 % with a blow dryer at low heat followed with flat ironing @ 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours . one of the swatch was rinsed and evaluated , the second swatch was washed 1 times and evaluated , the third swatch washed 5 times and evaluated , the fourth swatch was washed 10 times and evaluated and the fifth swatch was washed 10 times and 2nd treatment was repeated and after 48 hours the tabulated data on table ii shows that the performance longevity of a single treatment with composition ii - b can last multiple shampoos . in addition , the performance of repeat or double treatments increases significantly the performance in curl reduction , shine and smoothness . curl reduction study at higher ph range with 0 . 50 % naf composition ii - b on very curly / frizzy hair process a : the measurement of the initial length ( l0 ) and ( l100 ) of each swatch was taken . the hair swatches were shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition ii “ b ” with different ph range was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and the hair is dried to about 95 % with a blow dryer at high heat followed by flat ironing @ 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours and air dried . % curl reduction was calculated with the final length ( lt ) the data of table iii shows the performance of composition iib , 0 . 50 % naf above ph 8 . 05 shows no advantages . this is probably due to unfavorable crosslinking between unprotonated amino r ′— n — r ″ ( r ′═ h , c ═ o or r ″═ h , c ═ o ) peptide side terminals and the fluoride ion that occurs at high ph . whereas the ph decreases the protonation of the amino group and specifically the peptide side terminals of lysine , arginine r — nh3 + and will favor crosslinking with the fluoride ion . these side terminal crosslinks r — nh3f , — n — h2f , — n — hf or possible amide crosslinks f — n — c ═ o are more favorable at low ph . alternatively , favorable crosslinking may occur with the side oh side terminals of threonine and serine or indirect crosslinking followed by dehydration for threonine side terminal . the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition ii product was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and the hair is dried to about 95 % with a blow dryer at low heat followed with flat ironing @ 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours . the hair swatches are shampooed with shampoo , towel blot and dried at medium heat with blow dryer . the composition ii product was applied liberally to the hair with a brush and processed for 35 minutes . the hair was rinsed with luke warm water . the hair is dried to about 95 % with a blow dryer at low heat followed with flat ironing at 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours . the performance % curl reduction , shine and smoothness was evaluated . the tabulate data of table iv shows that the performance on normal hair is not affected greatly with the concentration increase of naf from 0 . 5 - 2 . 50 %. however , on porous hair 20 volume and twice 40 volume bleached hair , naf concentration effects are observed . the data shows equivalent performance to 0 . 5 % formaldehyde is obtained with 0 . 23 % f ( 0 . 50 % naf ). this observation can be explained due to the presence of larger number of ionic sites in hair which result in greater crosslinking and overall performance of curl reduction and smoothing effects . it also suggests that the crosslinking reactions of the fluoride and formaldehyde with hair may not entirely be the same . the specificity of crosslinking with the fluoride is greater than formaldehyde , thus more predictable results can be obtained . table v performance evaluation using treatment processes e , f and g ( normal , color treated and 2x bleached hair type ) composition ii - b naf 0 . 75 % amigel thickener 0 . 60 % glycerol 0 . 50 % phenoxyethanol 0 . 20 % 50 % phosphoric acid ph adjustment only qs di water qs . performance ph lo ( cm ) ls ( cm ) lt ( cm ) % curl reduction shine smoothness normal curly process e 4 . 49 13 . 0 20 . 0 14 . 5 21 . 43 % ++ ++ hair process f 4 . 49 13 . 0 20 . 0 15 . 0 28 . 57 % +++ +++ process g 4 . 49 13 . 0 20 . 0 15 . 0 28 . 57 % +++ +++ 20 vol / 6r process e 4 . 49 10 . 0 13 . 5 11 . 0 28 . 57 % ++ ++ color treated process f 4 . 49 10 . 0 13 . 5 11 . 0 28 . 57 % ++++ ++++ hair process g 4 . 49 13 . 0 20 . 0 15 . 0 28 . 57 % ++++ ++++ 2x bleached hair process e 4 . 49 14 . 0 18 . 0 16 . 0 50 . 00 % ++ ++ 40 vol process f 4 . 49 14 . 0 18 . 0 16 . 0 50 . 00 % ++++ ++++ process g 4 . 49 14 . 0 18 . 0 16 . 0 50 . 00 % ++++ ++++ different processes tested process e : wash hair with clarifying shampoo . towel blot excess water and blow dry in medium heat up to 95 % dry . apply the fluoride product thoroughly and comb hair through to ensure that all hair fibers are saturated with the product . process for 35 min . keep the hair straight during process time . rinse with luke warm water and towel blot excess water . apply a moisturizing leave - on conditioner and detangle the hair with the comb . blow dry hair in high heat . take thin sections and flat iron at approximately 430 ° f . with 7 - 8 passes , make sure that all the fibers are passed through the heat evenly . after 48 hours wash hair with sulfate free shampoo and conditioner . process f wash hair with clarifying shampoo . towel blot excess and blow dry in medium heat up to 95 % dry . apply the fluoride product thoroughly and comb hair through to ensure that all hair fibers are saturated with the product . process for 35 min . keep the hair straight during process time . towel blot excess product and apply a deep conditioning masque . comb through so that all the fibers are covered with masque . process for 10 min and rinse with luke warm water . towel blot excess water and blow dry in high heat . take thin sections and flat iron at approximately 430 ° f . with 7 - 8 passes , make sure that all the fibers are passed through the heat evenly . after 48 hours wash hair with sulfate free shampoo and conditioner . process g wash hair with clarifying shampoo . towel blot excess and blow dry in medium heat up to 95 % dry . apply the fluoride product thoroughly with a tint brush . comb hair through to ensure that all hair fibers are saturated with the product . process for 35 min . keep the hair straight during process time . towel blot excess product and apply a leave - on conditioner . comb through so that all the fibers are saturated . towel blot excess and blow dry up to 95 % dry . take very thin sections and flat iron at approximately 430 ° f . with 7 - 8 passes , make sure that all the fibers are passed through the heat evenly . section hair and apply the deep conditioning masque and process for 10 minutes . rinse with luke warm water and style as desired . % curl reduction evaluation : lo = initial length of curly hair ls = length of hair @ 100 % curl reduction lt = length of treated curly hair % ⁢ ⁢ curl ⁢ ⁢ reduction = lt - lo ls - lo ⨯ 100 shine and smoothness evaluation : grading 0 % ± 0 - 20 % + 20 - 40 % ++ 40 - 60 % +++ 60 - 80 % ++++ 80 - 100 % +++++ the data in table v shows the different methods of treatment application to enhance the conditioning effects with the fluoride treatment . all treatment methods e , f and g increase the conditioning and smoothing effects of hair . based on the results it appears that method g is the best where the fluoride is crosslinked first to the hair and the conditioning agents are further crosslinked by the fluoride . this multi - crosslinking effect of fluoride between the hair and the conditioning agent creates longer lasting effects between washes . comparative results with just hair conditioning treatments of masking or rinse off conditioners shows a temporary effect that does not last more than one or two shampoos . the fluoride crosslinked hair will have a strong affinity to bind different molecules , such as conditioning , antistatic , volumizing ingredients , keratin proteins and non - keratinous proteins . the crosslinking of fluoridated keratin reacts with functional groups of strong cationic character , such amino , mono or divalent cations forming strong ligand structures within the air . the formation of these additional structures will restructure hair and produce effects of increased softness , manageability and tensile strength . methods of sodium fluoride application on hair for maximum conditioning / smoothing effects wash the hair with clarifying shampoo . towel blot excess and blow dry in medium heat up to 95 % dry . apply the fluoride composition product on hair thoroughly . and comb through to ensure that all the fibers are saturated with the product . process for 35 min . keep the hair straight during process time . rinse with luke warm water and towel blot excess water . apply a leave - on conditioner and detangle the hair with the comb . blow dry with medium heat . take thin sections and iron hair with a preheated flat iron with a minimum of 7 - 8 passes , making sure that all the fibers are passed through evenly . after 48 hours wash hair with sulfate free shampoo and conditioner . wash the hair with clarifying shampoo . towel blot excess and blow dry in medium heat up to 95 % dry . apply the fluoride composition product on hair thoroughly and comb through to ensure that all the fibers are saturated with the product . process for 35 min . keep the hair straight during process time . towel blot excess product and apply a deep conditioner , reconstructor or conditioning masque with a tint brush . comb through so that all the fibers are covered with deep conditioner , reconstructor or conditioning masque . process for 10 min and rinse with luke warm water . towel blot excess water and blow dry with high heat . take thin sections and iron hair with a pre - heated flat iron with a minimum of 7 - 8 passes , making sure that all the fibers are passed through evenly . after 48 hours wash hair with sulfate free shampoo and conditioner . wash hair with clarifying shampoo . towel blot excess and blow dry hair in medium heat up to 95 % dy . apply the fluoride composition product on hair thoroughly and comb through to ensure that all the fibers are saturated with the product . process for 35 min . keep the hair straight during process time . towel blot excess product and apply a leave - on conditioner . comb through so that all the fibers are saturated . towel blot excess and blow dry up to 95 % dry . take very thin sections and iron hair with a pre heated flat iron with a minimum of 7 - 8 passes , making sure that all the fibers are passed through evenly . section hair and apply a deep conditioner , reconstructor or conditioning masque and process for 10 minutes . rinse with luke warm water and style as desired . detection of fluoride ion in normal , colored and bleached single treated hair fibers with composition ii , 0 . 75 % na f @ ph 4 . 51 analysis of fluoride ion in single treated hair initially and after hair type : normal , 20 vol / 6r color treated and 2x bleached hair . variations : 1 treatment ; 3 wash ; 5 wash ; 10 wash and 15 washes buffer solution : 25 ml . tisab ii + 25 ml . di h 2 o for immersing the hair sample for 48 hours . standards for calibration : 2 , 4 , 6 , 10 , 20 ( μg / ml ) fluoride ion all the hair swatches were washed with an alkaline shampoo at ph 8 . 09 . the controls and the samples to be treated were dried to 95 % with blow dryer , at medium heat setting . the hair swatches ( approximately 5 inch in width ) were treated with composition ii ( 0 . 75 % naf ) ph = 4 . 51 . processed for 35 min . towel blot excess . dried up to 95 % dry with blow dryer at medium heat followed with flat ironing small sections of hair at approximately 430 ° f . with 7 - 8 passes . after 48 hours the hair was rinsed with copious amounts of water and hair was dried at ambient conditions and cut into small 1 / 16 ″ sections . the hair was further equilibrated under ambient conditions for 8 hours and hair samples weighed about 0 . 5 grams and were immersed into 50 ml of buffer solutions 1 : 1 total ionic strength adjustment buffer ( tisab ii ): deionized water for 48 hours . direct analysis of the fluoride ion was carried out in the leached solutions using the fluoride ion selective electrode potentiometric method ( astm d 1179 - 72 ) approved by the american society of testing and materials . the hair swatches were washed 3x , 5x , 10x and 15 x , and the hair was dried with blow dryer between the washes . the multi washed hair samples were analyzed as above . the data in table vi shows that fluoride is detected in normal , colored and bleached hair treated hair . based on the assay results about 3 , 400 μmoles f / g hair is detected in water / buffer leaches of normal and color treated hair . this is compared to 1 , 800 μmoles f / g hair for bleached hair . this detection of fluoride in treated hair even after fifteen washes suggest that stable crosslinking has occurred and it is resistant to conventional shampooing and conditioning . the detection of fluoride in the buffer / water leaches is about 42 - 46 % after fifteen shampoos showing slow rate of depletion or leaching of fluoride from hair . based on these observations long lasting results of up to fifteen or more shampoos should be expected from a single treatment . procedure : hair for tensile testing was prepared with five bundles of twelve hair fibers ( total of 60 fibers ) of similar texture with normal , 20 volume , 2 × bleached hair . the bundles were immersed in water for 1 - 2 hours and the initial wet tensile strength of all the bundles was evaluated at 20 % extension using an instron model 1122c5054 at 0 . 5 inch / minute . the bundles after 24 hours were washed , blow dried with a paddle brush to about 95 % and the naf composition i at ph 4 . 50 was applied with the tint brush and processed for 35 minutes . after the excess product was towel blotted and blow dried to about 95 % with medium heat using a paddle brush , each bundle were flat ironed at approximately 430 ° c . with 7 - 8 passes . after 24 hours , the fibers were soaked in di water and after 45 minutes the tensile strength of bundles was determined under the identical conditions . the tensile strength of bundles was determined versus untreated fibers with composition i . the wet tensile strength of each bundle was calculated as 20 % index given below : the tensile strength studies showed that statistically a single treatment of normal , colored and bleached hair with the fluoride composition i statistically and significantly improved the tensile strength . the wet strength is attributed by adding support to the alpha helical crosslinks of cystine . this is not an expected effect for wet strength since all secondary bonds should be minimized in water . it is interesting that formaldehyde has significantly decreased the tensile strength of hair which suggests the weakening of these crosslinks . this supports our understanding that the crosslinking reactions and mechanism between the fluoride and formaldehyde is different . differential scanning calorimetry ( dsc ) techniques published earlier by cao ( j . cao , melting study of the α crystallites in human hair by dsc , thermody . acta , 335 ( 1999 ) and f . j . wortmann , ( f . j wortmann , c . springob , and g . sendlebach , investigations of cosmetically treated human hair by dsc in water , iffcc . ref 12 ( 2000 ) are used to study the structural changes of hair by measuring the thermal decomposition pattern or behavior . the thermal stability of hair is evaluated by measuring the amount of thermal energy required for denaturation or phase transition . the technique measures the amount of heat transferred into and out of a sample in a comparison to a reference . the heat transfer in ( endothermic ) and out ( exothermic ) is detected and recorded as a thermogram of heat flow versus temperature . the technique gives valuable information on the morphological components of hair of feughelman &# 39 ; s accepted two phase filament matrix model for hair ( m . feugelman , a two phase structure for keratin fibers , text . res . 1 , 29 , 223 - 228 , 1959 ). this two phase model includes the crystalline filaments ( alpha helical proteins ) or traditionally referred to as microfibrils which are embedded in an amorphous matrix . the dsc data technique yields thermogram data on the denaturation temperature t m and the denaturation enthalpy ( delta h ) of hair . it is concluded that the thermogram data of the denaturation temperature t m of hair is dependent on the crosslink density of the matrix in which surrounds the microfibrils or crystalline filaments . also , the denaturation enthalpy ( delta h ) depends on the strength of the crystalline filaments or microfibrils . it has been shown that cosmetic treatments , such as bleaching or perming , effect these morphological components selectively and differently at different rates causing changes in denaturation temperatures and in heat flow . dsc was use to analyze the effects of naf treatment on normal , 20 volume color treated and four times bleached hair . the treatment included process a using composition i at 1 % naf at ph 4 . 50 . the hair after 48 hours was rinsed and dried at ambient temperature conditions and relative humidity ( 20 c .°, 65 % rh ). the hair samples were cut into small pieces of about 2 mm in length and about 4 - 7 mg weighed into aluminum pans followed with capping . the hair samples were analyzed using perkin elmer diamond dsc instrument and a method of 50 c .° to 280 c .° at 20 c .°/ minute using an empty capped aluminum pan as reference . the obtained dsc thermograms for treated and untreated hair samples showed single endothermic ( absorbed thermal energy ) denaturation temperatures t m ranging from 178 to 189 c .° and delta h from 154 to 340 ( j / g ). the comparative tabulated data below for normal untreated and treated hair shows differences in the denaturation temperatures of 178 . 88 and 184 . 33 c .°, respectively , with no differences in the delta h . this is due to changes in the crosslink density of the matrix attributed by an increase in the crosslink density of the matrix proteins with naf . based on the delta h it is assumed that the intermediate filaments or alpha helical protein regions or microfilaments are not affected . the results for 20 volume color treated and untreated hair show significant statistically changes in the delta h ( p = 0 . 00019 ) of 226 . 53 and 270 . 01 ( j / g ) and no changes in the denaturation temperature . this observation suggests that the effects of naf on 20 volume color treated hair are primarily on the alpha helical protein regions with no effect on the matrix proteins . the multi bleached hair fibers show statistically differences in the denaturation temperatures 187 . 76 and 181 . 49 c .° and delta h 260 . 28 and 318 . 16 ( j / g ) between untreated and treated samples . this observation suggests that both the matrix proteins and the alpha - helical proteins are affected by the naf treatment . this data is in good agreement with previously reported data by humphries et al . jscc , 1972 on oxidized and colored dried hair showing higher denaturation temperatures and delta h . the explanation may be explained by an increase in crosslinked bridges between the polypeptide chains giving more structural support . this appears to be the same observation with the naf increasing the overall support for hair through crosslinking on the matrix proteins and alpha helical regions of the hair . it should be understood that the foregoing description is only illustrative of the present disclosure . various alternatives and modifications can be devised by those skilled in the art without departing from the disclosure . accordingly , the present disclosure is intended to embrace all such alternatives , modifications , and variances that fall within the scope of the disclosure .	0
a preferred embodiment of the present invention will now be described by way of example and with reference to the accompanying drawings . the pbx system 10 is connected to pstn 2 , pstn meaning public switched telephone network — this is the outside external telephone system . the pbx is connected to pstn by regular phone lines 12 . the onhold means 1 is responsible for answering the call , routing the call to a call center agent 3 , deciding and controlling the mode for each conversation , such as short or long queue status and queue waiting or free waiting possibilities . the onhold monitors conversations and also accepts commands from call center . the onhold may be within the pbx 10 which will be a new pbx system , or external , as illustrated , connected through channel 11 which can be implemented by any kind of data and / or control lines . thus , the new pbx system may be implemented by connecting onhold to a conventional pbx system . the call center 3 is consisted of human call center agents , which can answer calls and also control the mode of conversation and other parameters . connection lines 13 , are responsible for transferring : control parameters and controlling commands from call center to onhold , status of the pbx system to call center , status of the onhold system to call center , switching the call lines to the agents . fig2 illustrates possible implementation of the onhold 1 by two systems : the onhold manager 14 and the conversation manager 15 . the onhold manager is responsible for answering the call , routing the call to a call center agent 3 , deciding , controlling and asking caller for the mode of the conversation : short or long queue and queue waiting or free waiting . the onhold manager controls when and whether to put onhold or route to call center . the onhold manager manages fifos and queues , which keep the data regarding the callers . “ fifo ” or “ fifo ” here refers to a “ first in first out ” memory means as known in the art . the conversation manager connects calls to call center agents , notifies the onhold manager when a call ends , limits the call time when needed and record a call when needed . the conversation manager connects calls to call center agents through connections 13 . the conversation manager notifies the onhold manager when a call ends and transfers commands coming from call center through lines 16 . the conversation manager accepts commands and calls through lines 16 . the onhold manager and conversation manager may be within the pbx 10 which will be a new pbx system , or external , as in the figure , connected through 11 which can be implemented by any kind of data and / or control lines . fig3 describes internal parts of the conversation manager and the onhold manager . when a call is received on one of lines 11 , to the pbx , it is connected to a channel 142 , which is within the onhold manager 14 . there may be many channels at the pbx , each one can control the session in several ways : accept a conversation , answer the call and play a message or music , inform the system and the call center that a conversation has arrived , disconnect the conversation and any other operation . a decision engine 140 is managing the channels , through lines 141 , according to the information coming from the channels , through line 141 , and the status of the system such as parameters set by operators , and the status of fifos : 143 , 144 , 145 and 146 . a conversation engine 150 is monitoring the conversations , which are being answered , through call lines 161 , and can disconnect the conversation if it reaches a time limit set by the decision engine . the conversation engine may record the conversation if it is required , this can be set by defining criteria for recording , or by sending a command through lines 163 from the decision engine . the conversation engine informs the decision engine through 162 , when the call has ended , so that other conversation can be accessed . when a call is received and connected to a channel , the channel informs the decision engine through lines 141 , about the conversation . the decision engine then checks if there is a free line to the call center . in case there is a free line to call center , the line is switched through the conversation manager , on line 161 , to connect a human agent 31 at call center . in case there is not a free line to call center , the decision engine informs the channel , through line 141 , that there is no free line . the channel asks the user for the modes of conversation , such as short or long queue , queue waiting or free waiting possibilities . the channel informs the decision engine about the chosen mode of operation . the decision engine can then update the status of the user in the relevant fifo : if the user chooses long queue and queue waiting , data will be written to fifo 143 . if the user chooses short queue and queue waiting , data will be written to fifo 144 . if the user chooses long queue and free waiting , data will be written to fifo 145 . if the user chooses short queue and free waiting , data will be written to fifo 146 . the data will include details about the caller and the location in the relevant queue . in the free - waiting fifos , the details about each caller will include the phone number that the caller was requested to type as the phone number he / she can be reached at , when he / she had chosen the free waiting option . data will be written and read through lines 148 which connect between the fifos and the decision engine . the decision engine can also control future user &# 39 ; s requests and control music played by the channel . all of these operations are done through lines 141 . the onhold monitors conversations and also accepts commands from call center . a serviced queue fifo 147 keeps an updated list of users to serve . users are added by the decision engine , through line 148 . the type of service is also kept in this fifo , in order to let the conversation engine know how to monitor each channel ( recording , for example ). users are removed by the conversation engine , which also write for each channel the reason for which the conversation ended , for example : caller exceeded time limit or call hanged up the phone . these details are sent from conversation engine to the serviced queue fifo , through line 164 . the decision engine constantly calculates when is the turn of a new caller . when it is estimated that according to data in one of the free waiting fifos ( 145 , 146 ) there are 40 seconds ( or any other time , as configured by the user ) left before next user should be answered , the decision engine commands a channel to initiate a call to that user . if a call in a channel which is registered at one of the queue - waiting fifos ( 143 , 144 ) was hanged up , then the decision engine commands the channel to disconnect that conversation . the conversation engine is updated by the decision engine as well , so that a new caller may be connected instead . if a caller that was waiting in one of the queue - waiting fifos has disconnected the call before his turn to be serviced had arrived , then the decision engine will delete this caller from the fifo . fig4 describes a method for handling incoming telephone calls an incoming call 200 is arriving through a regular telephone line or through a pbx , a channel answers that call 210 , the function of the channel is as previously described . if there is a free human agent who can answer that phone call then it will be answered 225 . if there is no free human agent who can answer that phone call , then the caller will be told that waiting is required , and then caller will be put onhold . in this case , the caller will be asked to choose between two options 230 : waiting in the short queue , or waiting in the long queue . in both cases , the caller will be asked to choose between queue waiting and free waiting 240 , 250 . if the caller selected “ no ” in 240 or 250 , that is short or long queue waiting respectively , then the caller can choose while waiting , from interactive options 241 , 251 for short and long queue waiting , respectively . these options may include : changing and controlling music playing if at all , receiving information about estimated time to get the service , having quizzes and other games , choosing a radio station to listen to , etc . if the caller selected free waiting , short or long , that is “ yes ” in 240 or 250 respectively , then the caller will be asked to type the phone number where he / she can be reached , and then the caller may hang up the phone and be free to doing other things , picking up the phone only when his / her turn for accepting service has arrived or when it is soon to arrive . the specific decision , 245 for short line or 255 for long line , when to call the client can be based on algorithmic decision , time estimation and operator &# 39 ; s commands . in all of these possible choices the caller is advancing along in the queue , however each possibility has different queue . if the caller chooses a short / long queue waiting , then when the caller is first in the line he / she will access the agent at the call center . this is implemented by 242 , 252 for short or long queue waiting , respectively . a caller &# 39 ; s status and position may be monitored by the system at 241 , 242 , 244 , 245 and at 251 , 252 , 254 , 255 . in all such cases , time to service estimation is available . if the caller is in short queue , a more precise time to service estimation is available , since each caller has a limited time service . if the caller chooses a short / long free waiting , then when the caller is at a predefined position in the queue , and based on other parameters such as number of agents handling this queue , the system will initiate a phone call to that caller , so that only a reduced waiting time will remain . eventually , a conversation with human agent is made 243 , 246 , 253 , 256 . the conversation is monitored and can be recorded or disconnected by decision . the system and any of its functions and / or components may be implemented by software and / or by hardware means , as known in the art .	7
fig1 is a block diagram illustrating a configuration example of a call system 10 according to a first exemplary embodiment of the present invention . the call system 10 includes a calling - side device 100 , a called - side device 200 , a related contact destination device 300 , and a caller identification server 400 ( caller identification apparatus ). the calling - side device 100 , the called - side device 200 , and the related contact destination device 300 are connected to each other via a telephone network 20 . further , the telephone network 20 , the caller identification server 400 , the called - side device 200 , and the related contact destination device 300 are connected to each other via a predetermined data communication network 30 ( such as the internet ). the calling - side device 100 includes at least a telephone set ( not illustrated in fig1 ) operated by a caller . the called - side device 200 includes a telephone set 210 and an information terminal 220 . the telephone set 210 is a telephone set operated by a call recipient . the information terminal 220 is a terminal ( such as a personal computer ) for communicating with a device ( such as the caller identification server 400 ) connected to the data communication network 30 . the information terminal 220 has at least a function of communicating with the device connected to the data communication network 30 , and an expression function of visually displaying or phonetically displaying predetermined information . for example , the information terminal 220 receives a “ call type ” described below from the caller identification server 400 , and displays this call type on a screen . the related contact destination device 300 is capable of communicating with at least the caller identification server 400 via the data communication network 30 . herein , the related contact destination is for example , a family member of the call recipient , a service center operated by a business operator providing a telephone service , the police , or the like . fig2 is a block diagram illustrating a configuration example of the caller identification server 400 . the caller identification server 400 includes a storage unit 410 ( a storage means ) and a voice characteristic analysis unit 420 ( a voice characteristic analysis means ). in the present exemplary embodiment , description is made by exemplifying a case in which the voice characteristics are “ voiceprint ”. of course , the voice characteristics are not limited to the voiceprint only . the storage unit 410 stores a white list 430 and a black list 440 . in the white list 430 , voice characteristic information ( such as voiceprint information ) of a close relative ( such as a family member or a friend ) of a call recipient is recorded in advance . in the black list 440 , voiceprint information of a criminal such as a swindler , or of a person suspected of a crime is recorded in advance . the voice characteristic analysis unit 420 acquires voice data of a caller , from the telephone network 20 via the data communication network 30 . the voice characteristic analysis unit 420 extracts voiceprint information from the acquired voice data . the voice characteristic analysis unit 420 analyzes the extracted voiceprint information ( concretely , determines whether or not it coincides with the voiceprint recorded in each list , and determines whether or not one piece of the voice data includes voiceprints of a plurality of persons ). additionally , there is no particular limitation on a timing that the voice characteristic analysis unit 420 analyzes the extracted voiceprint information . for example , it may perform matching at predetermined intervals ( such as 5 - second intervals ) to determine whether or not a talking person can be distinguished , and when this determination cannot be made , the voice characteristic analysis unit 420 may perform the matching again . as another option , at the end of the call , it may collectively analyze the voiceprint information extracted during the call . the voice characteristic analysis unit 420 performs an appropriate process based on the analysis result ( call type ), as described below . fig3 is a flowchart illustrating an operation example of the caller identification server 400 . the voice characteristic analysis unit 420 acquires the voice data of the caller , from the telephone network 20 via the data communication network 30 ( step s 1 ). the voice characteristic analysis unit 420 extracts voiceprint information from the acquired voice data ( step s 2 ). the voice characteristic analysis unit 420 determines whether or not the extracted voiceprint information coincides with the voiceprint information recorded in the white list 430 ( step s 3 ). when the information coincides with the voiceprint information recorded in the white list 430 ( yes at the step s 3 ), the voice characteristic analysis unit 420 classifies a type of the call into “ a call type a ( a second determination result )” ( undoubtedly , the call from the close relative ) ( step s 4 ). when the information does not coincide with the voiceprint information recorded in the white list 430 ( no at the step s 3 ), the voice characteristic analysis unit 420 determines whether or not the extracted voiceprint information coincides with the voiceprint information recorded in the black list 440 ( step s 5 ). when the information coincides with the voiceprint information recorded in the black list 440 ( yes at the step s 5 ), the voice characteristic analysis unit 420 classifies a type of the call into “ a call type b ( a third determination result )” ( undoubtedly , the call from the swindler ) ( step s 6 ). when the information does not coincide with the voiceprint information recorded in the black list 440 ( no at the step s 5 ), the voice characteristic analysis unit 420 determines whether or not the extracted voiceprint information includes voiceprints of a plurality of persons ( step s 7 ). when the information includes voiceprints of a plurality of persons ( yes at the step s 7 ), the voice characteristic analysis unit 420 classifies a type of the call into “ a call type c ( a first determination result )” ( a call having a high possibility of being a call from a swindler ) ( step s 8 ). when the information does not include voiceprints of a plurality of persons ( no at the step s 7 ), the voice characteristic analysis unit 420 classifies a type of the call into “ a call type d ( a fourth determination result )” ( a call having a low possibility of being a call from a swindler ) ( step s 9 ). among frauds , there is sometimes a fraud in which a scenario is created in advance to carefully make determination about “ who says what at which timing .” in other words , when a plurality of persons appear in one call , the call has a high possibility of being a call from a fraud group . however , when all of those persons are not recorded in the black list , such a call is not determined as a call from a swindler by a method of making determination for a call simply on the basis of coincidence or non - coincidence with those in the black list . in view of it , according to the first exemplary embodiment , for a call that is classified into none of a close relative and a swindler , it is determined whether or not a plurality of pieces of voiceprint information exist ( i . e ., whether or not a plurality of persons appear ) so that a call type is classified in more detail . concretely , call types are classified into each one of four types of the above - described call types a to d . the voice characteristic analysis unit 420 transmits the call type ( one of the call types a to d ) of the call to the information terminal 220 via the data communication network 30 ( step s 10 ). the information terminal 220 displays the received call type on the screen . the voice characteristic analysis unit 420 determines whether or not a call type of the call is the call type b ( undoubtedly , a call from the swindler ) or the call type c ( a call having a high possibility of being a call from a swindler ) ( step s 11 ). when a call type is neither the call type b nor the call type c ( no at the step s 11 ), the present flow is ended . when a call type is the call type b or the call type c ( yes at the step s 11 ), the voice characteristic analysis unit 420 transmits a “ warning ” to the related contact destination device 300 ( step s 12 ). examples of a method of transmitting the warning may include an email , a telephone call , push notification to an application in a smart phone , and the like . further , the warning may be simultaneously transmitted to all of the transmission destinations ( the family member of the call recipient , the service center operated by the business operator providing a telephone service , the police , and the like ), or may be transmitted only to one or more specified transmission destinations . for example , the warning can be first of all transmitted only to the service center . in this case , in accordance with necessity , the service center mutually makes contact with the call recipient , the family member of the call recipient , the police , and the like to take appropriate measures for preventing a fraud . in the above - described first exemplary embodiment , for a call that is classified into none of the close relative and the swindler , it is determined whether or not a plurality of pieces of voiceprint information exist ( i . e ., whether or not a plurality of persons appear ) to classify a call type in more detail . concretely , classification into four types of the above - described call types a to d is performed . in other words , compared with a simple alternative determination method of making comparison only with a black list or only with a white list , the case of the present exemplary embodiment makes it difficult to cause a problem that a call from a swindler supposed to be detected is overlooked , or a person who is not a swindler is determined as a swindler , briefly , according to the present exemplary embodiment , a call from a swindler and a call from a non - swindler can be sharply distinguished from each other with higher accuracy . in addition , when a call type is the call type b or the call type c , the voice characteristic analysis unit 420 may transmit , to the information terminal 220 , action to be taken ( such as asking advice from a family member , asking advice from a person other than a family member , asking advice from the police , making a report to a call center , or the like ). further , for asking advice from or making a report to each of the above - described contact parties , a mechanism of click - to - dial can be used so that a call for asking advice can be easily made from the information terminal 220 . furthermore , instead of click - to - dial , various methods such as email , push notification to an application in a smart phone , or making connection to a web server of the call center to ask advice can be adopted . additionally , click - to - dial is a service in which an icon or a link displayed in a web page or the like is clicked to automatically make a call to a party . fig4 is a block diagram illustrating a configuration example of a call system 500 according to a second exemplary embodiment of the present invention . the call system 500 differs from the call system 10 ( fig1 ) in that the telephone set 210 and the information terminal 220 are connected to each other . the telephone set 210 transmits voice data of a caller to the caller identification server 400 via the information terminal 220 . thereby , it becomes unnecessary to forward the voice data from the telephone network 20 to the caller identification server 400 . when setting of the telephone network 20 is changed , significantly troublesome work , such as a request of cooperation of a telecommunication carrier who provides a telephone service , is necessary . in contrast , making a configuration as in the present exemplary embodiment enables the call type identification service to be provided more simply and easily . additionally , without description , it is apparent that the second exemplary embodiment attains the same advantageous effects as those in the first exemplary embodiment . further , a program for implementing functions of all or a part of each of the above - described exemplary embodiments may be recorded in a computer - readable recording medium , and a computer system may read and execute the program recorded in this recording medium to thereby perform the processes of the respective units . examples of the computer system may include a central processing unit ( cpu ). the “ computer - readable recording medium ” is a non - transitory storage device , for example . examples of the non - transitory storage device may include a portable medium such as a magneto - optical disk , a read only memory ( rom ), or a nonvolatile semiconductor memory , and a hard disk incorporated in the computer system . the “ computer - readable recording medium ” may be also a transitory storage device . examples of the transitory storage device may include a communication line in the case of transmitting the program via a network such as the internet or via a communication circuit such as a telephone circuit , or a volatile memory inside the computer system . besides , the above - described program may be one for implementing a part of the above - described functions , or further , may be one that can implement the above - described functions in combination with a program already recorded in the computer system . while the invention has been particularly shown and described with reference to exemplary embodiments thereof , the invention is not limited to these embodiments . it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the claims . this application is based upon and claims the benefit of priority from japanese patent application no . 2014 - 124446 , filed on jun . 17 , 2014 , the disclosure of which is incorporated herein in its entirety by reference .	7
referring jointly to fig1 and 2 , there is shown a 5 . 25 &# 34 ; magnetic data disk 10 which comprises a circular disk of thin high polymer material on which a coating of magnetic recording material is formed on both surfaces to which a recording / reproducing magnetic head ( not shown ) is to be brought in close proximity for write / read of data recorded in the media on concentric tracks 11 . a circular aperture or hub 12 formed in the center of the disk is adapted for reception of the drive spindle ( not shown ) of a disk drive system . in a conventional disk of this type , a circular reinforcing ring 13 is conventionally secured to the central hub 12 of disk 10 by suitable adhesive means to lengthen the reusable life of the disk by protecting the hub from prematurely wearing out in normal use . in accordance with a feature of the invention , hub ring 13 comprises the magnetic marker for surveillance control and for this purpose is preferably formed of an amorphous ferromagnetic material having a relatively low coercivity and a high magnetic permeability . in a preferred form of the invention , the coercivity , as measured in an external magnetic field changing its field strength and direction periodically with a frequency of 60 hz , should not exceed about 5 oersteds and most preferably should be less than 0 . 5 oersteds . correspondingly , the material should have relatively high magnetic permeability with a value preferably not lower than 20 , 000 and , most preferably , greater than 100 , 000 . suitable material for use as the hub ring marker 13 would be an amorphous ferromagnetic material such as is described in u . s . pat . no . 4 , 553 , 136 . a material of this type is sold under trademark &# 34 ; metglas &# 34 ; by allied corporation of morristown , n . j .. alternatively , a ferromagnetic material having a high barkhausen effect , such as described in u . s . pat . no . 4 , 660 , 025 , may also be used . hub ring marker 13 as shown in fig1 is an unbroken ring extending continuously about the aperture 12 of disk 10 . in order to enhance the field modifying effect of the ring , it may be desirable to provide one or more radially extending gaps in ring 13 such that ring 13 extends discontinuously about central aperture 12 . additionally , there is normally a significant band of unrecorded surface area on disk 10 extending radially outward from aperture 12 . this allows a degree of latitude in determining the radial dimension of hub ring marker 13 for a desired field modifying effect within the overall dimensional constraints of the disk format . further in accordance with an important aspect of the invention , hub ring marker 13 is formed integrally onto the polymer material of the disk by means of suitable adhesive material , preferably a high strength pressure sensitive adhesive , or by means of an ultrasonic bonding process , such that any attempt to remove the hub ring marker 13 would physically damage the disk by removing the means by which concentricity of the disk is determined thus making it virtually impossible to read the data on the disk in a disk drive . as a consequence , an attempt to remove the hub ring marker 13 to enable surreptitious removal of the disk from a secure area would result in protection of the data on the disk by making it no longer accessible even though the physical article itself , namely the disk , would be destroyed for all practical purposes . to enhance the concentricity determining aspect of the hub ring marker 13 , aperture 12 can be made slightly larger in diameter than the drive spindle of the disk drive and ring 13 made the correct diameter , as shown in fig2 . additionally , the centers of aperture 12 and ring 13 can be slightly offset so that even extremely careful removal of ring 13 would still eliminate the concentricity of the disk 10 vis - a - vis recorded tracks 11 . referring to fig3 and 4 , there is shown a standard 3 . 5 &# 34 ; format microfloppy disk 20 having a central drive hub 21 secured in conventional manner by an adhesive ring 22 to the center aperture 23 of the disk 20 . in accordance with the invention , adhesive ring 22 comprises the marker for disk 20 and , to this end , is formed of the amorphous ferromagnetic material described above in connection with fig1 and 2 . in a conventional 3 . 5 &# 34 ; microfloppy disk , central drive hub 21 is typically made from a ferromagnetic material , such as iron , to cooperate with a magnetic clamping arrangement on the drive spindle of the disk drive system . in order that the hub ring marker 22 of disk 20 be fully effective to modify the field pattern of an interrogation zone as described above or to insure that the field modifying effect of ring marker 22 is not easily overridden by magnetizing central drive hub 21 , it may be preferable that central drive hub 21 be formed of a non - ferromagnetic material , such as plastic . in this event , a modified form of disk drive apparatus may be required to maintain the disk on the drive spindle , for example by employing a compression spring clamping arrangement of suitable design . referring now to fig5 there is shown an article surveillance control system according to the invention which comprises a disk drive and write control means effective to ensure that sensitive data is written only onto protected disks of the type described in connection with fig1 - 4 . to this end , the system of fig5 includes a disk drive 30 adapted to receive and rotationally drive a 5 . 25 &# 34 ; or 3 . 5 &# 34 ; disk 31 while data is written onto or read from disk 31 by means of magnetic heads 32 in conventional manner . in all respects , the rotating drive mechanism of disk drive 30 , including drive motor 35 , drive spindle 33 and disk clamp 34 is of conventional construction except that drive spindle 33 and hub clamp 34 are preferably comprised of a non - ferromagnetic material , such as a suitable plastic . magnetic write / read heads 32 are coupled through a write control circuit 36 to a host computer 37 . write control circuit 36 comprises a gating circuit operative in response to a signal level on input line 38 to enable or inhibit the passage of data signals on line 39 from computer 37 through to output line 40 for application to write / read heads 32 . a magnetic field generating circuit 44 is included in the disk drive system of the invention to generate a low level periodically changing magnetic field via radiating antenna 43 positioned adjacent the spindle drive 33 and disk clamp 34 . an antenna 42 , similarly mounted adjacent the drive components 33 , 34 , is coupled to harmonic field detecting receiver circuit 41 to sense the presence of field patterns occurring at harmonics of the magnetic field applied by generating circuit 44 via radiating antenna 43 . the output of receiver circuit 41 is coupled by line 38 to write control circuit 36 to serve as the control signal which causes control circuit 36 to inhibit or enable the writing of data onto a disk inserted in the drive . in operation , with the computer in the &# 34 ; on &# 34 ; condition , a low level periodically changing magnetic field is generated by circuit 44 and radiating antenna 43 in the vicinity of the drive spindle of the disk drive system 30 . if a protected disk 31 of the type described above in relation to fig1 - 4 having a desired ferromagnetic marker 45 integrally formed about the hub of the disk 31 is in place in the drive , the applied magnetic field is disturbed by the marker and harmonic fields are generated . these harmonic fields are picked up by sensor antenna 42 and detected in receiver circuit 41 wherein an appropriate &# 34 ; enable &# 34 ; control signal level is produced and applied via line 38 to control circuit 36 to enable the writing of data onto disk 31 . if an unprotected disk is placed in the drive , the absence of a marker 45 results in no harmonic fields being generated . this , in turn , causes receiver circuit 41 to send an &# 34 ; inhibit &# 34 ; control signal level to control circuit 36 to inhibit the writing of data onto the unprotected disk . in this way , sensitive data created on the computer is assured of being &# 34 ; saved &# 34 ; or recorded only onto protected disks , the unauthorized removal of which from the secure area can be detected by conventional interrogation zone systems . moreover , data on a protected disk is prevented from being copied onto an unprotected disk by this system , since all such data must be enabled through the write control circuit 36 in order to be recorded on a disk . since all components of this surveillance control system are incorporated in the disk drive housing , conventional computers can be easily retrofitted to include this data protection capability thus avoiding the need to replace or retrofit entire computer systems . while the invention has been described in connection with use on recording disks in which write / read of data is performed entirely by magnetic means , it will be appreciated that a marker of the type described can also be integrally formed onto optical and thermo - magneto - optical disks in which an optical beam is employed in the write / read process . additionally , the effect of the marker on generating harmonic magnetic fields in the sensing zone can be enhanced by using an adhesive in which amorphous ferromagnetic powders have been dispersed during the formulation thereof . moreover , an adhesive formulated in this manner makes it possible to employ printing techniques to form the marker on the data disks , either in conjunction with use of the amorphous ferromagnetic ring or when used alone as a marker surface on the face of the disk . the invention has been described in detail with particular reference to a presently preferred embodiment , but it will be understood that variations and modifications can be effected within the spirit and scope of the invention .	6
fig1 a illustrates a signal generator 100 with pre - corrected digital inputs 181 and 183 according to an embodiment of the present invention . in a quadrature modulation block 101 , digital - to - analog converters ( dac ) 103 and 107 , respectively , receive digital inputs 181 and 183 and send analog signals corresponding thereto to anti - aliasing low - pass filters ( lpf ) 105 and 109 , respectively . digital input 181 is a pre - corrected in - phase input i c , whereas digital input 183 is a pre - corrected quadrature input q c . anti - aliasing low - pass filters 105 and 109 in turn output signals to multiplicative mixers (“ mixers ”) 111 and 113 , respectively . a 90 ° splitter 115 receives a synthesized frequency from a synthesizer 121 and outputs two signals which are 90 ° out of phase , with the signal to mixer 113 lagging 90 ° behind the signal to mixer 111 . the mixed outputs from mixer 111 and mixer 113 are input to a summing unit 117 . the output from quadrature modulation block 101 is input to a switch 133 a , which can be selectably switched to pass the direct output of quadrature modulation block 101 or the output of quadrature modulation block 101 mixed by a mixer 131 with a synthesized frequency from a synthesizer 123 . various embodiments of the invention feature switches configured in a manner similar to that of switch 133 a . certain embodiments of the invention provide that these switches be independently selectably switchable . independent switchability according to these embodiments of the invention not only provides versatility in configuring apparatus , but also provides benefits in calibration of the apparatus , as detailed below . quadrature modulation typically suffers from spurious image - frequency signal and from local oscillator feed - through . these imperfections can be significantly reduced by signal pre - compensation in the digital domain . the setting of the pre - compensation or pre - correction coefficients requires a feedback mechanism allowing the measurement of the above spurious signals . therefore , an embodiment of the present invention provides for pre - correction as follows . a numerically - controlled oscillator ( nco ) 141 receives a frequency signal 143 to set the frequency f of the oscillator , and an initial phase signal 143 to set the initial phase φ 0 . numerically - controlled oscillator 141 outputs two signals , a sine wave 147 sin ( f , φ 0 ) and a cosine wave 149 cos ( f , φ 0 ), which are input to a complex multiplier 151 , whose other inputs are an in - phase data stream 153 i data ( k ) and a quadrature data stream 155 q data ( k ). the complex product outputs of complex multiplier 151 are a desired in - phase data wave 157 i and a desired quadrature data wave 159 q . however , in order to compensate for effects such as amplitude imbalance of quadrature modulation to be performed by quadrature modulation block 101 , a pre - correction is needed , which is furnished by a matrix multiplier 161 , containing filters 163 , 165 , 167 and 169 for single sideband ( ssb ) rejection . in addition , matrix multiplier 161 also corrects for local oscillator leakage with direct current offsets i dc and q dc into summing mixers 177 and 175 , respectively . furthermore , in accordance with an embodiment of the present invention , digital filters 163 , 165 , 167 , and 169 feeding into summing mixers 171 and 173 , respectively , are incorporated into matrix multiplier 161 to compensate for the frequency - dependencies of anti - aliasing low pass filters 105 and 109 . the result , as previously noted , are pre - corrected in - phase input 181 i c and pre - corrected quadrature input 183 q c . fig1 b illustrates a sideband selector configuration switch 133 b according to a related embodiment of the present invention . sideband selector configuration switch 133 b selectively switches between the direct output of quadrature modulation block 101 and either the upper sideband of the output of quadrature modulation block 101 mixed via mixer 131 with the output of synthesizer 123 , or the lower sideband thereof , as passed by an upper sideband filter 135 or a lower sideband filter 137 , respectively . in the above descriptions , transmission signal generation is a hybrid configurable one / two conversion process as illustrated in fig1 a . the different states reached under the topology depend on the setting of switch 133 a and are as follows : direct conversion based on a frequency synthesizer 121 , which is directly modulated by wide - band quadrature modulator block 101 ; double conversion operation based on mixing between the output of quadrature modulator block 101 with synthesizer 123 . this architecture inherently features an extremely wide frequency coverage ( dc to 10s ghz ) while maintaining low spurious signal content . in certain cases the synthesizer frequency range is increased by digital dividers . in these cases , for noise minimization and stability , it may be of interest to have the synthesizers operate at different frequencies . digitally divided signals , however , typically have high spurious harmonic content . operation over a multi - octave frequency range normally requires complicated re - configurable filters and filter banks to suppress these spurious signals . by heterodyne down - conversion of the direct modulated signal , wide frequency coverage can be achieved with the spurious signals lying out - of - band . as the frequency coverage requirement widens , so does the coverage requirement from the synthesizers and direct modulators . employing both direct and double conversions may relax the above requirement . for example , a quadrature modulator covering the range 4 - 8 ghz may be mixed with an additional 8 - 12 ghz synthesizer in order to cover the dc - 4 ghz range , and with a 12 - 16 ghz synthesizer in order to cover the 8 - 12 ghz frequency range . higher frequencies may be covered by using up - conversion rather than down - conversion . another benefit provided by embodiments of the present invention is the capability of arbitrarily modulating a wide - band waveform ( as wide as the baseband ) at any frequency within the frequency coverage . this permits the use of modulation schemes such as chirp / pseudo - random bit sequence ( prbs ) for pulse compression in radar applications , communication constellations , and so forth . further use of the arbitrary digital modulation provided by embodiments of the present invention allows a fine - frequency offset in the digital domain . this permits coarser frequency steps in the synthesizers , improving their phase noise performance for the same frequency resolution requirement . another benefit provided by embodiments of the present invention is the ability to reach a certain output frequency via several different configurations . in a non - limiting example , by stepping the synthesizer to a higher frequency and correspondingly stepping the baseband frequency to a lower frequency the output frequency is unchanged . this is instrumental in producing a coherent frequency coverage across all synthesizer frequencies , even though it does not retain a specific phase over frequency change . fig2 illustrates a signal generator according to another embodiment of the present invention , where a second quadrature modulation block 203 is utilized to directly modulate synthesizer 123 to create the local oscillator for the second conversion . this enables a tradeoff of quadrature modulation imbalance versus phase noise to attain arbitrary frequency in generating the local oscillator for the conversion node . fig3 illustrates a multiple signal generator according to an embodiment of the present invention . frequency synthesizer 301 feeds quadrature modulation blocks 303 and 305 , and frequency synthesizer 351 feeds quadrature modulation blocks 353 and 355 . selector switches 311 , 331 , 361 , and 381 operate as previously described for selector switch 133 a ( fig1 a ), and selectably switch between the direct output of quadrature modulation blocks 303 , 305 , 353 , and 355 respectively , and outputs of mixers 313 , 333 , 363 , and 383 , respectively , all of which receive input from frequency synthesizer 391 . as previously noted , various embodiments of the present invention provide selector switches 311 , 331 , 361 , and 381 to be independently switchable . the arrangement illustrated in fig3 is useful in radar communication systems where there is a need for multiple microwave signals in parallel . non - limiting examples of such needs include : simultaneous generation of transmit signal and of a receive local oscillator signal ; generation of multiple transmit signals in multiple input - multiple output ( mimo ) and phased / true delay array systems ; and generation of sine and cosine local oscillator signals of quadrature down conversion . for example , by digitally modulating the transmit signal and the receive local oscillator signal in a short range frequency - modulated continuous wave ( fm - cw ) radar system one can introduce an intentional frequency offset so as to avoid handling near - dc signals ( see fig4 ). an inherent trait of this architecture is that several direct conversion blocks and heterodyne converters may be fed from the same synthesizers , thereby naturally meeting the aforementioned need . this allows phase tracking between different microwave signals , as well as tracking of the phase noise . another advantage of this architecture is the distribution of a generated signal among many nodes , such as transmission antennas / receivers etc . this enables applications such as “ multistatic radar ” ( see below ). further embodiments of the present invention provide multiple synthesizers ( as in fig3 ), some of which are modulated and some are not , so as to simultaneously generate multiple signals at arbitrarily spaced frequencies . fig4 illustrates a transceiver according to an embodiment of the present invention . a frequency synthesizer 401 feeds quadrature modulator blocks 403 and 405 having selector switches 411 and 431 respectively , which select between direct output from the quadrature modulator blocks and the outputs of mixers 413 and 433 , respectively , both of which receive input from a frequency synthesizer 407 . the output of selector switch 411 feeds into an amplifier 451 , which in turn feeds an antenna switch / circulator 453 to an antenna 455 for transmission . signals received from antenna 455 ( such as by reflections of the transmitted signal ) are fed to a mixer 457 , which receives input from switch 431 . output of mixer 457 feeds to an anti - aliasing low - pass filter 459 and thence to an analog - to - digital converter 461 ( adc ). by modulating quadrature modulation blocks 403 and 405 , fed by the same synthesizer 407 with a frequency shift , both the transmit signal and local oscillator drive for an arbitrary intermediate frequency ( if ) receiver are produced . the received signal is down - converted to an intermediate frequency corresponding to the offset of the modulation frequency between quadrature modulation blocks 403 and 405 . another example of arbitrary waveform modulation - based receiver local oscillator generation is a modulation with a pseudo - random binary sequence ( prbs ) modulation , for a spread - spectrum radar . a further example of an arbitrarily - configurable demodulation is multi - tone demodulating . such a configuration is useful in the simultaneous measurement of several spectral components , e . g . by down - converting them to distinct intermediate frequencies . both the amplitudes and phases of the spectral components may be measured . the above capability of the signal generator for attaining an output frequency in several configurations , enables relating measurements across the entire frequency range , i . e . including local oscillator and measured path phase . according to a related embodiment , this is achieved by overlapping measurements between different local oscillator frequencies , where the baseband frequencies are adjusted to account for the local oscillator frequency offset between the measurements . this phase - related measurement differs from the common practice in the art , where , as the local oscillator is tuned over the coverage range , unaccounted - for phase changes occur . retaining the relative phase according to this embodiment is instrumental in characterizing non - linear parameters in a vector network analyzer ( vna ) embodiment of the present invention . fig5 illustrates a quadrature receiver according to an embodiment of the present invention . a switch 511 and a switch 531 are ganged together by a common selector 533 , to generate a 0 ° local oscillator 541 and a 90 ° local oscillator 543 , which feed mixers 561 and 563 , respectively , to convert a signal received by an antenna 555 , which is amplified by an amplifier 551 . the two intermediate frequency signals are fed into anti - aliasing low - pass filters 571 and 575 , respectively , to be demodulated by analog - to - digital converters 573 and 577 , respectively . the configuration illustrated in fig5 allows the generation of a 90 ° split over a wide frequency range , as opposed to conventional analog techniques , and without introducing substantial spurious harmonic content , which occurs when using digital dividers . according to related embodiments of the invention , calibration techniques can be used to adjust the relative phase and amplitude between the quadrature channels . in non - limiting examples : measuring the phase and amplitude between the in - phase ( i ) and quadrature ( q ) components of the down - converted continuous wave signal ; simultaneously measuring the phase and amplitude on several signals ; and cross - correlation measurements between the i and q arms . fig6 illustrates a multistatic radar apparatus according to an embodiment of the present invention . in many cases it is desirable for a generated signal to be distributed among many nodes , such as transmission antennas / receivers , and so forth . fig7 illustrates a 3 - channel multiple input - multiple output ( mimo ) transceiver according to an embodiment of the present invention . in this embodiment , the above - described coherent arbitrary modulation topology is used in conjunction with parallelism ( i . e . all quadrature modulation blocks are fed by the same synthesizer and are coherent to each other ). this configuration enables active beamforming such as in the context of phased - array antennas . current implementations are usable principally in narrow - band arrays , where carrier frequencies reach the microwave regime and analog delay - induced phase shifts are used . this embodiment of the present invention provides true beam - forming by digital relative delay means . beam - forming is achieved by baseband modulation of coherent channels relative to each other , and does not hinder the broad band nature of the transceiver array . in addition , this embodiment provides ease of implementation with digital accuracy . steering resolution and phase coherence are very precise since the relative phase attainable at any baseband frequency is practically arbitrary , as it is limited principally by digital - to - analog converter resolution . calibration plays a significant role , where quadrature modulation imbalance , local oscillator leakage and the response of the receiver and transmitter paths comprise fundamental factors in attaining the required performance of a transceiver . quadrature modulation imbalance and local oscillator leakage calibrations are typically performed by a minimization of mixing products after passage through a broadband envelope detector . the quadrature modulator is subjected to modulation by complex sine wave at frequency f bb . at the output of the envelope detector , the detected power fluctuates at frequencies associated with the frequency offset between the desired signal and the spurious signals ( either 2 f bb for the quadrature modulation image or f bb for the local oscillator leakage ). the power fluctuations are typically measured by an analog - to - digital converter ( adc ). it is important to note that if a high f bb is used then a high speed adc is needed in order to capture and quantify the power fluctuations ( the adc bandwidth needs to be at least twice the baseband bandwidth in order to capture both spectral components ). current techniques suffer from inherent difficulties associated with spurious signals and mixing products which fall on the to - be - measured quantities . as an example , mixing products from 2f signal − 2f lo fall on the to - be - measured frequency associated with the quadrature - modulated image : f signal − f image . thus , the measurements are not independent . embodiments of the invention facilitate the calibration for quadrature modulation imbalance and local oscillator leakage , without increase in architectural complexity . the corrective action for compensation of quadrature modulation imbalance and local oscillator leakage are well known in the art . the quadrature modulation imbalance compensation involves pre - multiplying the i and q components by a matrix of correction coefficients . the compensation of local oscillator leakage typically involves adding dc coefficients to the i and q components . the difficult part of this procedure is determining which coefficients &# 39 ; values to use . this involves a feedback measurement of the strength of the image and spectral components of the local oscillator leakage . fig8 illustrates a spectral component measurement arrangement at the output of the signal generation block according to an embodiment of the present invention . here , two quadrature modulation blocks are fed by a single , common , synthesizer . a method of measuring the image or local oscillator leakage is by placing the second synthesizer — used to convert the signal to the baseband — at a frequency offset relative to the spectral component of interest . to measure the image , situated at f image = f sa − f iqa1 , placing the second synthesizer at f sb = f image − f if which will be , after f if conversion , linear in the original image magnitude . in order to reach the desired frequency at the output of the second synthesizer — driving the conversion of the output of the quadrature modulation block — fine frequency selection may be facilitated by either / or both the utilization of a fractional n synthesizer and an quadrature modulation of the synthesizer output . only a single channel ( one quadrature modulator , two synthesizers ) is needed for the above scheme . fig9 illustrates a receiver - assisted spectral component measurement arrangement according to an embodiment of the present invention . fig1 a illustrates a symmetrized receiver - assisted spectral component measurement arrangement for characterization of a first quadrature modulation block according to the present invention . fig1 b illustrates a symmetrized receiver - assisted spectral component measurement arrangement for characterization of a second quadrature modulation block according to the present invention . baseband filter characteristics may vary at production . in the case of integrated circuit implementation , the filter bandwidth and shape may depend on process , temperature and voltage . the characteristics of baseband filters in the transmit and receive chains may affect system performance regarding signal - to - noise ratio , inter - symbol interference , power flatness , mask conformity , and so forth . it is thus desirable to characterize the filters and compensate for their deviation from desired characteristics . examples of compensation include directly adjusting the filter and performing digital compensation . the hardware architecture of embodiments of the present invention facilitates measurement of filter characteristics without further increasing complexity . to characterize the transmit filter , the f bb is scanned throughout the range of interest . for each f bb the synthesizer &# 39 ; s frequencies ( f sa , f sb ) are adjusted such that the resulting intermediate frequency is constant ; thus avoiding the receive filter response variation ( when measuring at different intermediate frequencies per f bb ). the receiver can be tuned to a frequency corresponding to an aliased frequency ± f bb + n · f sample ( where f sample is the digital - to - analog converter sampling frequency ). by doing so , the low pass filter in the transmit path can be characterized beyond the nyquist frequency of the digital - to - analog converter . embodiments of the invention as described above and depicted in fig8 and fig1 a and 10b illustrate two similar schemes for scanning the baseband frequency as described above , by digitizing the output of the signal generation block . measuring the receiver filter is conceptually similar to the above schemes , but benefits from prior knowledge of the transmitter filter response : by knowing the response of the transmission filter , the quadrature modulation frequency can be tuned to scan the frequencies of the receiver filter . alternatively , it is possible to measure the receiver filter separately without first characterizing the transmission filter . to do so , the quadrature modulation is held at a constant frequency ( so as to not incur response variation ) and the receiver frequencies are scanned by tuning the synthesizer &# 39 ; s frequencies . the intermediate frequency can be tuned beyond the nyquist frequency of the analog - to - digital converter so that the receive anti - alias low - pass filter reacts to the input intermediate frequency , while the digitized output is at an aliased frequency ± f bb + n · f sample ( where f sample is the analog - to - digital converter sampling frequency . by doing so , the low pass filter in the receive path can be characterized beyond the nyquist frequency of the analog - to - digital converter . digitization of the first synthesizer , down converted by the second synthesizer , allows characterizing the relative phase noise between the two synthesizers . this measurement can be used for either self - test purposes or for performance optimizations , such as setting the phase - locked loop parameters so as to optimize the phase noise . an example of such parameter is the setting of the charge pump current in the phase detector . fig1 illustrates a multi - module referenced based scaling arrangement according to an embodiment of the present invention . fig1 is a flowchart 1200 of a method of calibrating a two - synthesizer signal generator according to an embodiment of the present invention . in a step 1201 the first frequency synthesizer is set to the desired test frequency . in a step 1203 an outer loop begins , in which the first numerically - controlled oscillator is set to the desired test frequency offset . in a step 1205 , the second frequency synthesizer and the second numerically - controlled oscillator are set to obtain the desired receiving intermediate frequency . in a step 1207 an inner loop begins for configuring a set of quadrature modulation imbalance correction coefficient values , and in a step 1209 an imbalance - related magnitude is measured . at a decision point 1211 , if the coefficient set is not exhausted , the method returns to step 1207 . otherwise , if the set is exhausted , the loop beginning in step 1207 exits and the method proceeds to a step 1213 , in which optimal correction coefficients are calculated . at a decision point 1215 , if the first numerically controlled oscillator frequencies are not exhausted , the method returns to step 1203 . otherwise , if the frequencies are exhausted , the loop beginning in step 1203 exits , and the method concludes with a step 1217 , in which the optimal frequency - dependent correction coefficients are calculated .	7
fig1 illustrates an airbag cover 1 , which , in this drawing , is opened and connected by a hinge 2 to a surrounding area 3 of the airbag cover . the surrounding area 3 is part of , for example , a dashboard , a headrest , an armrest of a motor vehicle seat , a column , vehicle interior trim paneling , etc . an undeployed airbag is stored behind the airbag cover 1 . the airbag itself is not shown in the drawings . when the airbag cover 1 opens , it swings about the hinge 2 into the interior space of the vehicle and opens up a path that allows the inflating airbag to expand into the interior of the vehicle . the hinge 2 absorbs a portion of the forces exerted on the airbag cover 1 , which prevents the cover from opening in an uncontrolled manner . this minimizes the risk that the airbag cover 1 will detach from the surrounding area 3 and put persons sitting in the vehicle at risk of injury from the cover 1 . fig2 is a cross - sectional view of the hinge portion of the airbag cover 1 . the airbag cover 1 in the area of the hinge 2 is constructed from a carrier 4 that may be made of a plastic material , particularly a thermoplastic material such as polypropylene . a coating of foam 5 is applied to the carrier 4 on the side facing the interior of the vehicle and a decorative covering 6 then applied to the surface of the foam , so as to fashion a visually attractive interior of the vehicle . in this embodiment , the illustration of the carrier 4 is interrupted , because the depth or thickness of the carrier 4 , preferably 2 - 3 mm , depends upon the respective size of the airbag cover 1 . in this embodiment , a layer 7 is provided on the side of the carrier 4 facing away from the decorative covering 6 . the layer can be constructed , for example , as a coating side . a two - dimensional textile element 8 is arranged on the side of the layer 7 facing away from the carrier 4 . in this embodiment , the two - dimensional textile element 8 is constructed as a knitted fabric . the layer 7 is provided as a flow - or penetration - inhibiting layer that limits the flow or penetration into the layer 7 of the molten thermoplastic material that forms the carrier 4 , i . e ., the layer 7 has a higher level of flow resistance than the two - dimensional textile element 8 , so that the penetration depth “ a ” of the two - dimensional textile element 8 to the thermoplastic material forming the carrier 4 can be precisely adjusted . in this embodiment , layer 7 is made of a fleece . after the thermoplastic material used in this embodiment is hardened , the two - dimensional textile element 8 is thus embedded across the area of the penetration depth a , that is , the penetration depth a characterizes the matrix 9 in which the two - dimensional textile element 8 is embedded . on the side of the matrix 9 facing away from the carrier 4 , there is a “ free area ” 10 of the two - dimensional textile element 8 . this free area 10 is not part of the embedded two - dimensional textile element 8 . instead of the fleece used in the embodiment according to fig2 ( which , for example , can be polyester ), a perforated film or other similar flow - resistant materials can be used as the coating materials , which achieve a uniform penetration depth when a curable mass penetrates the two - dimensional textile element . fig3 illustrates a carrier 4 , which is , on the other hand , covered with foam 5 , as well as a finishing decorative skin 6 , on the side facing the interior of a motor vehicle . in this embodiment , an additional layer 7 or coating side is not used . instead , the two - dimensional textile element 8 has an area 11 facing the carrier 4 that creates a higher flow resistance than a “ looser ” area 12 facing away from the carrier 4 , which has a lower flow resistance than area 11 . as shown in the embodiment according to fig2 , a non - embedded , free area 10 of the two - dimensional textile element 8 is also provided here . the area of the coated two - dimensional textile element 8 that is embedded into the matrix of the carrier 4 is designated by 9 . in an advantageous embodiment , due to the barrier effect of the coated two - dimensional textile element , for example , more than 50 % ( as shown in the vertical direction in the illustration ) of the thickness of the two - dimensional textile element 8 is included in the embedded area , and less than 50 % of the two - dimensional textile element 8 belongs to the “ free ”, non - embedded area 10 of the same . in an advantageous embodiment , approximately 70 to 80 % of the two - dimensional textile element is embedded . naturally , a corresponding variation of the ratio of embedded area to free area can be provided , depending upon the application , that is , upon the force that an expanding airbag exerts on the airbag cover , and , depending upon the weight and size of the airbag cover , as well as upon the length of the outward swing of the airbag cover . if a large portion of the two - dimensional textile element is embedded in the matrix of the carrier 4 , then a greater portion of the occurring forces can be absorbed by this hinge . in addition to the illustrated knitted fabrics , the two - dimensional textile element can also be constructed as woven fabric , whereby an advantageous adjustment of the free area that is not embedded can then be achieved , if the woven fabric has sufficient thickness , such as is customary , for example , for knitted fabrics . naturally , as described above , the woven fabric can also be coated . likewise , a two - dimensional textile element , such as , for example , a woven fabric that has a pleated construction can be used , so that , for example , the pleat areas adjacent the carrier 4 are embedded and the “ pleat crests ” facing away from the carrier are exposed , i . e ., not embedded . with reference to fig4 , the hinge area of an airbag cover is illustrated in an oversize illustration , that is , the airbag cover is swung in the direction of the arrow toward the motor vehicle interior . the number 14 designates a predetermined breaking point that represents a weakening and which is used to define the site of the swinging motion of the airbag cover 1 . the swinging open of the airbag cover 1 causes the carrier material 4 to break . the cover 1 swinging open even farther causes the two - dimensional textile element to detach , loosen , or stretch in a pre - defined manner , up into the inside of the carrier matrix 4 . a great portion of the occurring forces is thereby absorbed over the entire surface by the structural expansion and by the component strength of the carrier matrix . the area of the two - dimensional textile element in which the material for the carrier does not flow delaminates up into the inside of the adjacent carrier matrix . thus , the structural expansion over the entire surface of the two - dimensional textile element and its embedding into the carrier serve to absorb the occurring forces into the carrier matrix , and this results in an outward swinging motion of the airbag cover 1 . residual forces cause an additional swinging open of the airbag cover 1 , and these residual forces are initially received and absorbed over the entire surface by the textile expandability of the two - dimensional textile element , i . e ., particularly of a knitted fabric , so that , for one , the airbag cover opens in a controlled manner and is in no danger of being torn from its surrounding environment . one advantage of the proposed hinge is that a particularly lightweight two - dimensional textile element 8 can be used , so that the weight of the hinge 2 can be kept very low . because of this , it is not necessary that the hinge be a heavy metal hinge , for example , which is cost - intensive to produce . because the weight of the hinge 2 can be kept low , the forces that occur are also lower than would be the case with a heavier cover for the airbag . furthermore , the proposed hinge 2 for the airbag cover also enables a cost - effective manufacturing process , because the hinge 2 can be manufactured together with the airbag cover 1 . in other words , the two - dimensional textile element 8 of the hinge 2 can be embedded into the carrier matrix ( partially ), at the time the carrier is manufactured .	1

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.