text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
the preferred embodiments of the present invention all share one common feature . in each case , an electronic circuit structure is formed that includes at least two semiconductor transistors where one transistor has a gate formed on a first side of a channel region and a second transistor has a gate formed on a second , opposite side of the channel region . by clever use of this type of arrangement , very compact geometries of flip - flops or other multiple transistor structures , for example , can be achieved because the many contact areas and interconnect areas can be overlapped and cell sizes reduced . with reference to fig1 , a circuit schematic of a typical sram cell 10 is illustrated . the circuit schematic is conventional , however , the structure employed to implement the circuit is not and is constructed in accordance with a first preferred embodiment of the invention as will be illustrated in conjunction with fig2 - 4 . the sram cell 10 includes first and second access transistors 12 and 14 and a cross coupled inverter or flip - flop circuit 16 . the cross coupled inverter circuit is implemented with a group of four transistors 18 , 20 , 22 and 24 . a word line ( wl ) 26 is connected to each of the control gates 28 and 30 of the access transistors 12 and 14 , respectively . a first bit line ( bl ) 32 is connected to either the source or the drain 33 of the first access transistor 12 , while a second bit line (/ bl ) 34 that carries the complement signal of the first bit line 32 , is connected to either the source or the drain 35 of the second access transistor 14 . the gates 36 and 38 of the transistors 18 and 22 , respectively , are coupled together with a line 40 , while the gates 42 and 44 of the transistors 20 and 24 , respectively , are coupled together with a line 46 . in operation , a signal is applied to the word line 26 to enable reading from and / or writing to the sram cell 10 , depending on whether the first bit line 32 is high ( 1 ) or low ( 0 ). after data is written to the cell 10 , the data is held by the cross coupled inverter circuit 16 without any refreshing being necessary , which is why the sram cell is referred to as being โ static .โ with reference now to fig2 - 4 , a number of illustrations are shown which illustrate how the sram cell 10 of fig1 can be implemented with a structure constructed in accordance with the preferred embodiments of the present invention . fig2 and 3 are three dimensional simulations of the sram cell 10 and its various elements , but do not show the individual elements of the transistors in detail . rather , the figures are intended to illustrate the arrangement whereby the transistor gates are formed on opposite sides of the active or channel regions of the transistors . as illustrated , the sram cell 10 includes an active layer region that includes a plurality of n - doped and p - doped mos structures 50 and 52 , respectively that form the channel regions of the various transistors 12 , 14 , 18 , 20 , 22 and 24 . the key to the invention , however , is that the gates of the access transistors 12 and 14 are formed on the bottom sides of the channel or active regions , while the gates for the transistors 18 , 20 , 22 and 24 that form the cross coupled inverter 16 are formed in the top sides of the active regions . operationally , there is no difference between the sram cell 10 and a conventional sram cell having all interconnects and gates on one side of the active layer or regions . however , by dividing the gates between both sides of the active regions , the area occupied by the sram cell 10 on a wafer can be substantially reduced since the spacings between the various interconnects can be reduced . in another variation of the invention , as illustrated in fig5 , by providing a vertical transistor in the structure , the sram cell area can be further reduced by placing the access transistor of an sram cell directly on top of a node of the flip - flop . in this embodiment , the transistor channel is vertically disposed and the gate is disposed either on the left or the right side of the channel . in order to fabricate the sram cell 10 illustrated in fig2 - 5 , or any other multiple transistor structure in which gates are selectively formed on two opposite sides of the device channel region , a special process must be used . the steps of a first preferred fabrication process for doing so are illustrated in fig6 a - 6n . the process in question is basically similar to the fabrication process disclosed in the inventors &# 39 ; previous patent , u . s . pat . no . 6 , 534 , 819 , which issued on mar . 18 , 2003 . the first four steps , as illustrated in fig6 a - 6d , are conventional mos technology oxidation formation and isolation steps that are carried out in order to form a pattern of field oxide on the silicon substrate with a plurality ( two shown ) of apertures for formation of devices . in fig6 e , a thin layer of gate oxide or dielectric is formed in the aperture . then , a layer poly silicon is deposited , which will form the actual gate . the polysilicon is patterned using lithography . after etching , a gate is formed in the first aperture but not over the second aperture . silicon dioxide is next deposited over the entire surface as illustrated in fig6 g . next , the surface is planarized using chemical mechanical polishing as illustrated in fig6 h . h + or he is next implanted into the silicon wafer deep enough so that the wafer can be cleaved . the resulting structure is flipped over and bonded to another , host silicon wafer as illustrated in fig6 j . it should be noted that the back gate was on the left device and when flipped , it is now on the right side . as illustrated in fig6 k , an exfoliation step is carried out to remove the first silicon substrate down to the implant cutoff line . chemical mechanical polishing ( cmp ) is then employed once again to remove the remaining silicon down to the level of the file oxide as illustrated in fig6 l . the polishing of the silicon stops due to high selectivity of the chemical used in cmp process . now , gate oxide is grown for the top side followed by deposition of polysilicon . the top gate is then patterned using lithography . it should be noted that this time the left device has a top gate , but no bottom gate , whereas the right device has a bottom gate , but no top gate . other fabrication processes may also be employed to form the structures . for example , although the use of h + or he implantation , followed by exfoliation is preferred for removing the first silicon substrate because it is easier and less time consuming , other removal techniques , such as chemical mechanical polishing , could be employed to remove the first silicon substrate . it should also be noted that while the foregoing embodiment is directed specifically toward formation of an sram cell , the present invention is not limited to use with such structures . the inventive concepts can also be applied to any other multiple transistor structures . contacts take most of the space in a sram cell and hence designs / technology always try to push them far . soi technology offers the additional advantage of abutting p - well and n - well when they are at the same potential . also , the active area is partitioned into two separate parts only ( unlike many of commercial designs ) and hence saves space . bit lines and power supply are routed through metal - 1 . note that these ( bit and power ) lines can be routed on the same side using additional metal - 2 . deep submicron ( dsm ) mosis design rules are followed in the layout except for the silicide strap which connects polysilicon to active area ( a reasonable 4 lambda by 2 lambda rule is employed ). the present invention includes a number of advantages over conventional planar srams and devices having device gates and interconnects only on one side of the structures . as noted already , the resulting structures can be made more compact than conventional sram structures . in addition , the transistors on the backside can have different gate oxide and gate material from the ones of the front side . because of the compactness achieved through the back - gate , the sram cell is appropriate for dense memory as well as for programmability as in field - programmable gate arrays ( fpgas ). the limitations of srams arise from the limitations of the transistor , and from the use of six transistors with a complex interconnect structure . srams occupy a large area vis - ร - vis other memories such as dynamic memories , or floating - gate memories . however , they are the memory of choice because of their high speed and low stand - by power . the ability to make the thin silicon film conduct from top as well as the bottom surface allows the partitioning of the cell for significantly higher densities than are currently possible as have been recently found (ร 3 improvements over planar structures for similar dimensional rules ). thus , complementary transistor technology is maintained while achieving the memory . in order to reduce the resistance of the access transistor , either the word - line needs to be strapped or it can employ tungsten as an additional gate material as demonstrated in our earlier effort . fpgas are an attractive design vehicle for 3d integration because limitations to fpga performance introduced by 2d geometry can be eliminated using a 3d approach . the primary limitations to density of 2d fpgas are the interconnect area as well as the configuration memory area required per logic block . the memory limitation can be overcome by using the subject invention &# 39 ; s ultra - dense 3d sram architecture , and this can be placed in a layer below the logic tiles , allowing the fpga to contain overlapped configuration memory and computation . in addition , the interconnect can also be placed in a layer above the logic , to provide a 3d tiered implementation of a clockless fpga that has significantly higher density than a conventional fpga architecture . the enhanced density also leads to reduced interconnect lengths , enhancing performance . using a clockless approach also removes the dependence of the performance on the worst - case interconnect delay , which can be significant in an fpga architecture due to congestion in placement and routing of logic tiles . although the invention has been disclosed in terms of preferred embodiments and variations thereon , it will be understood that numerous other variations and modifications could be made thereto without departing from the scope of the invention as set forth in the following claims . | 7 |
now , one embodiment according to the present invention will be described with reference to the accompanying drawings . fig1 is a diagram of an entire structure of a printing system according to the embodiment of the present invention . the printing system includes a host device 1 for controlling a printer and the printer 2 for performing a printing operation on a printing medium by using a recording agent such as ink or toner . the host device 1 is generally a general - purpose computer such as a personal computer . the functions and structures provided in the host device 1 described hereinafter are respectively realized , for instance , by executing a predetermined installed computer program . for instance , in the host device 1 , a printer driver functioning as a print controller is realized . in the embodiment described below , the printer 2 jets ink to the printing medium such as a printing sheet to form an image . an ink jet printer capable of performing a color printing operation is described as an example , and the printing system according to the invention may be applied to a copying machine or a printing system in a copying system . as shown in fig1 , the host device 1 includes an interface part 11 to the printer , a printer driver 12 and an application program ( ap ) 13 . in fig1 , the host device 1 is connected to the printer 2 through the printer interface 11 . the printer interface 11 is connected to a host interface 21 of the printer 2 side through wire or wireless communication system . a communication is performed in accordance with a predetermined protocol . the printer interface 11 transmits print data to the printer 2 or receives various information concerning the printer such as an amount of use of ink or the remaining amount of ink from the printer 2 . the host device 1 performs the predetermined program so that the ap 13 is realized on the host device 1 . in the host device 1 , a plurality of aps 13 can be performed . the ap 13 supplies data such as an image or a text to the printer driver 12 to request for printing . the printer driver 12 transmits various kinds of commands to the printer 2 to control the printer . the printer driver 12 includes a print data generating part 15 and a print mode deciding section 16 . the print data generating part 15 generates print data on the basis of a print request from the ap 13 . the generated print data is transmitted to the printer 2 through the printer interface 11 to perform a printing operation . there is a case the print request from the ap 13 designates either a color printing for printing by using a color ink or a black - and - white printing for printing using only a black ink . when the color printing is designated by the print request from the ap 13 , the print data generating part 15 generates the color print data for performing the printing operation by using the color ink . when the black - and - white printing is designated , the print data generating part 15 generates the black - and - white print data for performing the printing operation using the black ink . the color print data is generated with reference to , for instance , a color printing lut ( a look up table ) to generate the color print data for forming the image or the text by the color inks including c ( cyan ), m ( magenta ), y ( yellow ), etc . for instance , when the print request for printing by using only the black ink is received , the black - and - white print data for forming the text or the image by the black ink is generated with reference to , for instance , a black - and - white printing lut . in principle , the print data generating part 15 generates the print data as designated by the print request as described above . this is called a normal mode . however , for instance , when the black - and - white printing is designated , if the black ink is insufficient , the host device 1 may allow the printer 2 to perform the printing operation by a color ( composite black ) near to black obtained by overprinting the color inks in place of the black ink . this is called a composite black mode . in composite black mode , when the black - and - white printing is designated by the print request , the print data generating part 15 generates the color print data for performing the printing operation by the composite black using the color inks on the basis of the data to be printed by using the black ink . for instance , when the printer 2 is provided with c , m and y as the color inks , the print data generating part 15 generates print data to be printed by overprinting c , m and y respectively for the data to be printed using the black ink . the print mode deciding section 16 decides whether the printing operation is performed under the normal mode or the printing operation is performed under the composite black mode . for instance , the print mode deciding section 16 carries out a decision in accordance with the remaining amount of ink included in an ink cartridge 40 mounted on the printer 2 to determine a print mode . for instance , the print mode deciding section 16 obtains the ink control information of the black ink and the color inks from the printer 2 and decides the print mode on the basis of the ink control information to specify the print mode . when the print mode is specified by deciding the print mode , the print data generating part 15 is informed of the specified print mode . the ink control information may be obtained and the print mode may be decided for each of the print requests ( a print job ). the detailed procedure of a deciding process for deciding the print mode is described below . the printer 2 is connected to the host device 1 through the host interface 21 . the printer 2 includes a printing mechanism 30 for actually performing a printing process and a printing mechanism controller 22 for controlling the printing mechanism . the printing mechanism controller 22 includes , for instances a processor ( not shown ) for performing various kinds of programs and a memory ( not shown ) for recording the programs and data . this memory may be , for instance , an eeprom and a ram or the like . the printing mechanism 30 includes , for instance , a recording head 32 , a sheet feed mechanism ( not shown ) and a control circuit ( not shown ) for controlling them . the printing mechanism 30 further includes amounting part 31 for detachably mounting the ink cartridge 40 in which the ink is contained . when the ink cartridge 40 is mounted on the mounting part 31 , the recording head 32 jets the ink supplied from the ink cartridge 40 to form an image on the printing medium . the ink cartridge 40 detachably attached to the mounting part 31 includes containers 41 ( 41 c , 41 m , 41 y , 41 k ) for respectively containing the inks , for instance , c ( cyan ), m ( magenta ), y ( yellow ) and k ( black ). each of the inks c , m and y may be generally called color ink . the containers 41 respectively include memory elements 42 ( 42 c , 42 m , 42 y , 42 k ). each of the memory elements 42 may be , for instance , a semiconductor element such as an ic ( an integrated circuit ) in each of the memory elements 42 , the ink control information showing , for instance , the model number of the ink cartridge 40 , the remaining amount of each of the color inks ( or an mount of use ) or the like is stored . the ink control information is stored in the memory elements 42 c , 42 m , 42 y , and 42 k respectively corresponding to the inks . the printing mechanism 30 further includes a reader / writer 33 ( 33 c , 33 m , 33 y , 33 k ) for reading data stored in each of the memory elements 42 and writing data when the ink cartridge 40 is mounted on the mounting part 31 . the readers / writers 33 c , 33 m , 33 y and 33 k read out or update the ink control information stored in the memory elements 42 c , 42 m , 42 y and 42 k respectively corresponding thereto . the ink cartridge 40 may be a four - cartridge type cartridge in which the containers 41 are respectively formed as separate bodies . the ink cartridge 40 may be one - cartridge type in which all the containers 41 are integrally formed , or a two - cartridge type in which the containers 41 c , 41 m and 41 y are formed integrally and the container 41 k is formed separately therefrom . further , one memory element 42 may be provided for one cartridge . that is , in the case of the one cartridge type , the memory elements 42 c , 42 m , 42 y and 42 k may be constituted by one memory element . in the case of the two - cartridge type , the memory elements 42 c , 42 m and 42 y may be constituted by one memory element , and the memory element 42 k may be constituted by one memory element . at this time , the readers / writers 33 may be provided so as to correspond to the memory elements 42 . in this embodiment , the remaining amount of ink of each container 41 can be recognized by referring to the ink control information . in addition thereto , for instance , a sensor for detecting the remaining amount of ink may be provided to detect the remaining amount of the ink . in this printer 2 , the ink in each of the containers 41 may be consumed even when the ink is not used for printing . this phenomenon occurs , because the printer 2 suitably ( for , example , periodically ) performs a cleaning operation of the recording head 32 in order to prevent an ink nozzle from clogging . the printer 2 automatically performs a cleaning operation of the recording head 32 for maintenance to maintain its normal operation . the recording head 32 is cleaned in such a way that for instance , a cleaning motor provided in the printing mechanism 30 , which is not shown in the drawings , sucks up the ink nozzles of all colors at the same time and sucks out inks from all the nozzles . accordingly , since a little ink is consumed by the cleaning operation , the ink cartridge always requires a certain degree or more of ink . now , an operation of the printing system having the above - described structure will be described below . the printer driver 12 transmits an ink control information obtaining request to the printer 2 through the printer interface 11 in order to grasp the remaining amount of the ink of each container 41 . the ink control information obtaining request may be made , for instance , every time the print request is received from the ap 13 , or for each page unit . in the printer 2 , when the printing mechanism controller 22 receives the control information obtaining request through the host interface 21 , the printing mechanism controller instructs each reader / writer 33 to read out ink control information from each memory element 42 . when the printing mechanism controller 22 obtains the ink control information of the ink of each color that each reader / writer 33 reads from each memory element 42 , the printing mechanism controller 22 transmits the ink control information to the host device 1 through the host interface 21 . when the printer driver 12 receives the ink control information of each color through the printer interface 11 , the print mode deciding section 16 decides the print mode . when the print mode deciding section 16 decides the print mode , the print mode deciding section checks the remaining amount of ink . since there are a plurality of types in threshold values used for checking the remaining amount of ink , these threshold values will be firstly described . the first threshold value represents a threshold value for deciding the end of ink or not . the end of ink is a lower limit of an amount of ink that the printer can use the ink of that color to perform a printing operation . accordingly , when the remaining amount of the ink is not higher than the end of ink , the printer 2 may be set so that the printer cannot perform the printing operation by using at least the ink or all the operations of the printer 2 may be stopped until the ink cartridge having the end of ink is replaced by a new ink cartridge . the second threshold value is a threshold value showing an amount of ink that is larger than the end of ink and is a near end showing that the remaining amount of ink comes near to the end . the near end may be set to an amount of ink by which the predetermined number of sheets can be printed , for instance , when an average printing operation is performed ( for instance , 40 sheets ). alternatively , the near end may be set to a remaining amount of ink of 5 % as much as the whole of the container or 10 % as much as the whole of the container . especially , since the capacity of the container of the black ink is ordinarily larger than the capacity of the container of the ink of each of c , m and y , the near end of the black ink may be set to 5 % and the near end of the ink of each of c , m and y may be set to 10 %. further , the printer driver 12 may dynamically determine the near end on the basis of the difference between the remaining amount of the black ink and the remaining amount of the color ink . a near end predetermined on the basis of the difference of the remaining amount of ink may be supplied to the printer driver 12 . for instance , when the difference between the remaining amount of the black ink and the maximum remaining amount of ink of the remaining amounts of the color inks is a predetermined amount or more , the near end of black is set to a . on the other hand , when the remaining amount of the black ink and the maximum remaining amount of the ink of the remaining amounts of the color inks is smaller than the predetermined amount , the near end of the black may be set to b smaller than a . the above - described end and the near end may be individually determined for each of the inks . now , a print mode decision carried out by the print mode deciding section 16 will be described by using a flowchart shown in fig2 . the print mode deciding section 16 grasps the remaining amount of ink of each of the inks on the basis of the ink control information of each ink . then , the print mode deciding section 16 decides whether or not the remaining amount of ink of the inks of c , m , y and k is not higher than the end of ink ( s 11 ). if one of the inks reaches the end of ink or lower ( s 11 : yes ), a procedure is completed without performing a printing operation . when there is no ink that reaches the end of ink or lower ( s 11 : no ), the print mode deciding section 16 decides whether or not a currently received print request is a black - and - white printing ( s 12 ). when the print request is not the black - and - white printing ( s 12 : o ), the print mode deciding section 16 decides the print mode to be a normal mode and informs the print data generating part 15 of it . then , the print data generating part 15 generates print data in the normal mode and transmits the formed print data to the printer 2 to perform the printing operation ( s 17 ). then , the print request is the black - and - white printing ( 12 : yes ), the print mode deciding section decides whether or not the black is reaches the near end or lower ( s 13 ). when the black ink does not reach the near end or lower ( s 13 : no ), the printing operation is carried out in the normal mode in accordance with the same procedure as described above ( s 17 ). when the black ink reaches the near end or lower ( s 13 : yes ), the print mode deciding section decides which of the color inks reaches the near end or lower ( s 14 ). when any one of the color inks reaches the near end or lower ( s 14 : yes ), the printing operation is carried out in the normal mode by the same procedure as described above ( s 17 ). the step s 14 may be omitted . when any of the color inks does not reach the near end or lower ( s 14 : no ), the host device 1 allows a window for inquiring a user about whether or not the printing operation is carried out by composite black on a display device not shown in the drawing ( s 15 ). an example of an inquiry window 100 is shown in fig3 . as shown in fig3 , on the inquiry window 100 , a message 150 for inquiring the user about whether or not the printing operation is carried out by the composite black and buttons 110 , 120 and 130 for receiving the desire of the user to the message are displayed . when the user desires to perform the printing operation by the composite black , the user presses the button 110 . when the user does not desire to perform the printing operation by the composite black , the user presses the button 120 . when the user does not completely desire to perform the printing operation by the composite black , the user presses the button 130 , respectively . referring to fig2 and 3 , when the user desires to perform the printing operation by the composite black , ( the host device 1 receives that the button 110 is pressed on the inquiry window 100 ), the print mode deciding section 16 decides the print mode to be a composite black mode and informs the print data generating part 15 of the decision . the print data generating part 15 forms the print data in the composite black mode and transmits the formed print data to the printer 2 to perform the printing operation ( s 16 ). on the other hand , when the user does not desire to perform the printing operation by the composite black ( the host device 1 receives that the button 120 or the button 130 is pressed on the inquiry window 100 ), the printing operation is carried out in the normal mode ( s 17 ). when the button 130 is pressed , the printing operation is set to be constantly carried out under the normal mode until the ink cartridge 40 is replaced by a new cartridge and processes after the step s 12 may be omitted . the flowchart shown in fig2 is summarized as described below . ( 1 ) when the remaining amount of the black ink is higher than the near end , the printing operation is carried out in the normal mode . ( 2 ) when the remaining amount of the black ink is not higher than the near end and the remaining amount of inks of all colors is higher than the near end , if the user desires , the printing operation is carried out in the composite black mode . ( 3 ) when the remaining amount of the black ink is not higher than the near end and the remaining amount of one or more color inks is not higher than the near end , the printing operation is carried out in the normal mode . in the state ( 1 ), the black ink is sufficiently contained in the ink cartridge 40 mounted in the mounting part 31 . when the printer 2 is continuously used from this state and the black ink is relatively decreased more than the color inks to become the state ( 2 ), if the user desires , the printing operation is carried out in the composite black mode . that is , at the time of the state of ( 2 ), the user himself or herself can select whether the printing operation is performed by using the black ink or the printing operation is performed by saving the black ink depending on his or her will . thus , the user can determine whether the printing operation is carried out in the composite black mode or the normal mode depending on whether or not there is a preliminary ink cartridge or what amount of data to be printed is left or the like . when the printing operation is carried out in the composite black mode , the black ink is not used and the color inks are consumed , so that the consumption of the black ink is saved . namely , in the state ( 2 ), it is detected that the black ink reaches the near end to save the consumption of the ink after that . thus , the amount of ink necessary for maintenance or the like can be assured and the stable operation of the printer can be ensured . at the same time , the printing operation can be continuously carried out by the composite black . when the printing operation is continuously carried out in the composite black mode under the state of ( 2 ), the remaining amount of the color inks is decreased to become a state of ( 3 ). under the state of ( 3 ), the printing operation is always carried out in the normal mode . that is , in this embodiment , even when the printing operation is temporarily performed in the composite black mode , if the printing operation is carried out in the composite black mode , the printing operation will be returned again to the printing in the ordinary print mode . when the printing state becomes the state of ( 3 ), since the color inks and the black ink are likewise decreased , only the black ink does not need to be specially saved . thus , the printing operation is performed in the normal mode . however , when the step s 14 shown in fig2 is omitted , if the user desires , the printing operation in the composite black mode will be continued . thus , the color inks are consumed faster than the black ink . the above - described embodiment of the present invention is illustrated for explaining the present invention and the scope of the present invention is not limited to the above - described embodiment . it is to be understood that a person with ordinary skill in the art can embody the present invention in other various forms without departing the gist of the present invention . in the above described embodiment , the printing mode is changed from the normal mode of the black - and white printing to the black composite mode when the remaining amount of the black ink is not higher than the near end and the remaining amount of inks of all colors is higher than the near end and if the user desires . however , in the case that the cartridge is the one - cartridge type , the inquiry whether or not whether or not the printing operation is carried out by composite black may be made when the minimum remaining amount of ink among each color is not higher than the near end . in the above described embodiment , the present invention is applied to the printing system in which the printer is connected to the host computer through the interface . the invention is not limited thereto . for example , the invention can also be applied to a standalone type printer which can directly receive the data stored in a memory card and a digital camera and performs printing . in this case , the inquiry window 100 may be displayed on an interface display such as liquid crystal display provided on the printer or a display of the digital cameral . in the above described embodiment , when the remaining amount of the black ink reaches the near end , the composite black is generated with the color inks to continue printing . however , the invention can be applied so that single color ink is used instead of the black ink to continue printing when the remaining amount of the black ink reaches the near end , that is , the invention can be applied to a monocolor printing . | 1 |
various user interfaces and embodiments will be described in detail with reference to the drawings , wherein like reference numerals represent like parts and assemblies throughout the several views . reference to various embodiments does not limit the scope of the claims attached hereto . additionally , any examples set forth in this specification are not intended to be limiting and merely set forth some of the many possible embodiments for the appended claims . it is understood that various omissions and substitutions of equivalents are contemplated as circumstances may suggest or render expedient , but these are intended to cover application or embodiments without departing from the spirit or scope of the claims attached hereto . also , it is to be understood that the phraseology and terminology used herein are for the purpose of description and should not be regarded as limiting . the following are a list of terms and their descriptions . they are meant to provide additional information regarding the present invention , but do not delimit the full scope of the invention . profile : a profile is a certain selection of assets that has a predetermined risk / return characteristic , such as low - risk , low return or high - risk , high return . an example used throughout this disclosure includes : profile 1 , which is 100 % cash ; profile 2 , which is 20 % equity , 80 % cash / bonds ( fixed ); profile 3 , which is 40 % equity , 60 % fixed ; profile 4 , which is 60 % equity , 40 % fixed ; profile 5 , which is 80 % equity , 20 % fixed ; and profile 6 , which is 100 % equity . profile allocation : how much of each profile we want in each account . for example , an account may hold 50 % profile 6 and 50 % profile 2 giving it overall 60 % equities and 40 % fixed assets . asset allocation : there are many widely - recognized asset types utilized in model portfolio theory , such as large cap growth , small cap value , real estate , cash , etc . asset allocation defines how much of each type of asset is contained within a certain portfolio or account . model schema : a model schema defines how profiles get converted into asset allocations . for example , profile 6 could be represented by a diversified asset allocation including large cap growth , large cap value , small caps , etc . alternatively , it could be represented by a less diversified set of assets , such as a simple s & amp ; p 500 etf . model schema can be defined by advisors . overall profile allocation : the profile allocation for the client &# 39 ; s full portfolio , which may be contained within several different accounts . overall asset allocation : the asset allocation for the client &# 39 ; s full portfolio , which may be contained within several different accounts . account : may be referred to as , for example , his ira , her ira , roth . user : the user of the disclosed system , usually a financial advisor ( sometimes referred to as โ advisor โ below ). client : individual ( s ) who owns the portfolio . often , but not always , a couple . fig1 is a flowchart illustrating the overall method of use of the trading algorithm disclosed herein according to one embodiment of the invention . a user can input an individual owner &# 39 ; s beginning profile or asset allocation , a target profile or asset allocation 106 , and various preferences 104 into the system . beginning profile or asset allocation is set by an owner &# 39 ; s current holdings , which are imported 110 into the disclosed system &# 39 ; s algorithm 102 . target profile or asset allocation 106 can be defined in a number of ways and is inputted 114 into the disclosed system &# 39 ; s algorithm 102 . the system then creates a trade , which is a set of asset or fund buy / sells that will change the current allocation to more closely match the intended target profile or asset allocation 106 . a trade is exported 112 by the system to an external trading platform 108 in the market . after having decided upon a target overall profile or asset allocation 106 for a client , a user , usually a financial advisor , will need to implement the overall profile or asset allocation within the client &# 39 ; s accounts using the process depicted in fig2 . for example , a user can input an individual owner &# 39 ; s current holdings from an external trading system 202 . then , the user can set preferences 204 , such as asset location and required minimum distributions ( rmds ), construct a flow network 206 , assign weights to flow network edges 208 , run a min - cost , max - flow algorithm 210 , get asset trades from appropriate flow network edges 212 , when necessary , assign asset trades to fund trades 214 , and export trades into an external trading system 216 . the summation of all of the client &# 39 ; s account allocations is equal to the overall profile or asset allocation . the accounts have a current target profile or asset allocation 106 that can be inputted into the disclosed system 114 . fig3 illustrates one example of how to set the current holdings of the portfolio 202 with each column containing information for a single account within the portfolio 202 . for example , a user can upload and import fund holdings by selecting a browse option 302 within the system and then selecting the upload button 304 . funds can be uploaded to specific internal 306 or external 308 accounts . an internal account 306 is one where a user can order - blast trades into specific funds and pull holdings automatically from a trading program used by financial advisors . an external account 308 is an account that a user cannot control or access directly , such as , but not limited to , a 401k sponsored by the client &# 39 ; s employer . when importing holdings , a user can key in each holding , asset by asset , into whichever account the holdings belong to . examples of assets that the system can support include , but are not limited to , cash , bonds ( high yield bonds , international bonds , domestic bonds , etc . ), and equities ( natural resources / commodities , real estate , emerging markets , international small cap , international large cap , small cap value , small cap growth , large cap value , large cap growth , etc .). a user can view all current accounts at once and can save any recently inputted assets or accounts by selecting a save button 310 . alternatively , a user can proceed without saving any recently inputted assets or accounts by selecting a cancel button 312 . the most simplistic way of calculating the target asset allocation of the accounts as a whole is to have each account hold the same proportional allocation as the overall portfolio . so , for example , if the overall portfolio is $ 1 million and needs $ 150k in cash , an account with $ 100k should have $ 15k in cash . in one embodiment of an overall asset allocation , as illustrated in fig4 , the difference in asset allocation before a trade and after a trade is illustrated graphically using an inner circle 402 and outer circle 404 , wherein each piece of the inner circle 402 represents the amount and percentage of that asset in the account before the trade and each piece of the outer circle 404 represents the amount and percentage of that asset in the account after the trade . in one embodiment of an overall asset allocation , also illustrated in fig4 , the updated value of asset allocation after a trade is illustrated by a chart . the chart can include information such as , but not limited to , asset type 406 , amount to be traded of each asset 408 , what the holdings will be for each asset after the trade 410 , and what percentage of the portfolio the asset will comprise after the trade 412 . however , advisors will often want to favor or disfavor certain asset classes within each account . this practice is known as asset location . for example , certain asset classes may not be available in an account , or an advisor may want to more heavily weight real estate in a tax - deferred or qualified account because reits ( real estate investment trusts ) create more dividends , which would result in an income tax liability for the client . locating the necessary reit holding within a tax - deferred account reduces current taxation and increases overall levels of wealth . in general it is desirable to place tax inefficient assets ( e . g . foreign bonds , reits , commodities ) into tax - sheltered accounts and place tax efficient assets ( e . g . index mutual funds , exchange traded funds [ efts ], growth orientated investments ) into brokerage or non - qualified accounts . the process of asset location can be computationally difficult . imagine , in the example above , that the advisor wanted to more heavily weight cash to $ 25k instead of $ 15k . the advisor would have to reduce the weighting of the other asset types in that account ( because that account still needs to hold $ 100k ), then reduce the weighting of cash in the other accounts ( so we still have $ 150k in cash total ), and then increase the weighting of the other asset classes in the other accounts so that their overall values are still correct . for example , below are two different possible ways of allocating two asset classes across three accounts : the complexity of determining how to develop the optimal asset mix increases geometrically as you add assets classes and accounts . it also increases as you add other considerations , such as minimizing the amount that is traded within each account or taking into account certain accounts that have required holdings of a certain asset class . the disclosed system allows advisors to give each asset within each account a high or low โ preference โ 502 . for example , an advisor can assign a number between zero and ten wherein a five is the default , a zero indicates that that asset is not available in that account , a one means to heavily disfavor that asset , and a ten means to heavily favor it . using these preferences , the system can create an asset allocation for each account such that the asset location preferences are followed , accounts hold the correct total value , and the overall asset allocation is correct . fig5 a and b illustrates one example of setting preferences for a single account . in one embodiment , as illustrated in fig5 a , the user can use a mapping 504 option . this option allows a user to allocate the proportion of an unavailable asset class to a separate proxy asset class . for example , if international bonds are not an available asset class option in a 401k plan , the user may move the proportion allocated to international bonds to domestic bonds . in one embodiment , as illustrated in fig5 b , the user can set up other account information such as , but not limited to , the account type , the date the account is available , the account number , the selected funds to make changes to , the fund or funds to ignore , whether there is a minimum cash requirement or preference , the tradability 506 , an amount , if any , for a required deposit 508 , and transfer to / close preferences 510 . tradability 506 refers to the extent to which the user will allow โ churn โ to occur within a certain account due to tax consequences of those trades . for example , a user may want to avoid trading within a taxable 401k , but would be fine with trading within a non - taxed roth and would therefore set tradability to be higher in the non - taxed roth and lower in the taxable 401k . buying and selling assets at the same time is called โ churn โ. when changing the overall asset allocation in an account , often there is no net liquidation of assets . for example , $ 10 , 000 of domestic bonds may need to be sold so that $ 10 , 000 of large cap growth can be bought . non - qualified accounts are taxed when funds within them are liquidated . therefore , in this situation , taxes might need to be paid on the domestic bonds , but there would be no net liquidation to cover these taxes . therefore , the disclosed system will attempt to not churn within non - qualified accounts to avoid unnecessary tax consequences for the client . it will instead try to make all churn trades within a tax - deferred or qualified account . the required deposit 508 function permits money to be added or removed from an account . for example , if there is a required minimum distribution ( rmd ) of $ 10 , 000 , the user can input $ 10 , 000 in the required deposit section . accounts often have an rmd when someone reaches a certain age , which indicates that a certain amount of money must be pulled out of an account . in one embodiment , the disclosed system will always execute an rmd before trying to satisfy other constraints . fig6 illustrates an example of a set of trades to be executed for two separate accounts . each trade displays the asset type 602 to be traded , the ticker 604 number , and the amount of the trade 606 . in one embodiment of the disclosed system , sets of trades can be exported into a spreadsheet form by clicking an export internal 608 button or they can be printed out by click a printout 610 button . the transfer to / close 510 selection refers to an action to take on the overall account . โ transfer to โ is used when rolling one account over into another . โ close โ is used when closing an account . the disclosed system will follow all of the above rules , attempting to create the โ best โ trade across all of the accounts , taking into consideration information such as , but not limited to , asset location preferences , rmds , and the tax status of the account . generally , the disclosed system formulates the above problems as a min - cost , max - flow network flow problem in a database . more specifically , instead of water flowing through pipes , money flows into different asset types in different accounts . as illustrated in fig7 - 9 , money starts at the leftmost node , which represents the โ source ,โ and it flows through a series of allocations and trades , which are determined by profile or asset location preferences and target allocation , to its final โ sink โ destination at the rightmost node . generally , nodes represent points within a database . as briefly mentioned above , the disclosed system can implement desired allocations based on account profiles or assets . fig7 illustrates one embodiment wherein the system focuses on asset allocation being spread out across accounts . fig8 illustrates a second embodiment wherein the system focuses on profile allocation , instead of asset allocation , being spread out across accounts . fig9 illustrates how the disclosed system determines the desired fund trades to accomplish desired asset holdings , as calculated by the system using the flow networks illustrated in fig7 and fig8 . more specifically , fig7 illustrates an example where a client has five asset classes and three accounts , although other graphs can have fewer or more asset classes and any number of accounts . the top set of nodes represents account 1 714 . each of the five nodes within account 1 714 represents one asset within account 1 714 , as illustrated by the smallest box surrounding the topmost row of nodes in fig7 . each row of nodes in the graph , thereafter , represents a separate account . in the top group , all five assets belong to account 1 714 . in the middle and bottom groups , the five assets in each belong to a second and third account , respectively . when the disclosed system is implemented for asset - specific allocations , money starts at the leftmost node 702 , which represents the โ source ,โ and it flows through a series of allocations 706 and trades 708 , which are determined by asset location preferences 710 and target asset allocation 712 , to its final โ sink โ destination at the rightmost node 704 . as illustrated in the network flow graphs in fig8 and 9 , the disclosed system can use profiles to take a desired asset allocation and convert a portfolio owner &# 39 ; s initial asset allocation into the desired asset allocation . as described above , a profile is a certain selection of assets that has a predetermined risk / return characteristic . for example , a cash - heavy profile will tend to have low risk in the short term , but also low return in the long term . an equity - heavy profile will have higher risk in the short term , but higher return in the long term . profiles are generally chosen based on upon when those assets need to be spent . for example , money that needs to be spent in one year will be allocated in a cash - heavy profile , where as money not needed for at least 30 years will be in an equity - heavy profile . in some embodiments , there are six profiles , wherein profile 1 is a cash - heavy profile , holding 0 % equities ; profile 2 holds 20 % equities ; profile 3 holds 40 % equities , profile 5 holds 60 % equities , and profile 6 is an equity - heavy profile holding 100 % equities . the rest of the holdings of each profile , except profile 6 , which is 100 % equities , are cash or bonds . in some embodiments , the system can use profile allocation to create a portfolio with various percentages of the above - described profiles ( account profile allocation is the profile allocation for one specific account ). for example , a portfolio having three accounts of similar values may have a profile allocation of 40 % profile 6 , 30 % profile 5 , and 30 % profile 2 , and account 1 may have an account profile allocation of 100 % profile 6 , thereby accounting for 33 % of the 40 % profile 6 allocation in the portfolio . the disclosed system can split out these profiles between different available accounts and convert the assets within the accounts into actual fund holdings . in some embodiments , the system can take into account when certain profiles need to be held in specific accounts . for example , if a portfolio owner plans to spend money before the age of 59 . 5 , the owner would want to spend that money from a non - qualified account in order to avoid penalties . therefore , the portfolio owner may be required to hold short - term money ( e . g ., profile 2 ) in a non - qualified account . in some embodiments , a model describes how a specific profile is represented as an asset allocation . the model used may depend on a variety of factors , including the tax status of an account and the size of an account . for example , a non - qualified account may not want to hold reits because they product large amounts of taxable income , while a qualified account could hold these without tax consequences . furthermore , to reduce trading costs of assets that will be traded , those assets may be held in a smaller account ( e . g ., $ 1 , 000 ), while the remaining assets may be held in a larger account ( e . g ., $ 1 , 000 , 000 ). once a profile allocation is determined , the profile can be run through a model schema within that account , which the advisor can use to express how the profiles should be represented in terms of assets , so that the account asset allocation can be determined . this asset allocation can represent a desired asset allocation for the specific account . fig8 illustrates an example trader network graph for a portfolio having nodes and edges connecting the categories of โ initial holdings ,โ โ profile allocation ,โ โ profile location preferences ,โ and โ target profile allocation .โ as illustrated in fig8 , one portfolio owner has five profiles that are applied to each of three accounts . for example , account 1 contains profile 1 , profile 2 , profile 3 , profile 4 , and profile 5 ; account 2 contains profile 1 , profile 2 , profile 3 , profile 4 , and profile 5 ; and account 3 contains profile 1 , profile 2 , profile 3 , profile 4 , and profile 5 . in some embodiments , the trader network graph can incorporate six profiles and a variable number of accounts . the capacity of the edges within the โ initial holdings โ category , in one embodiment , is set to the total initial holdings of each account . as illustrated in fig8 , the topmost edge in the โ initial holdings โ category represents the account 1 edge leading to the profile edges within account 1 . within the โ profile allocation โ category , the edges have no capacity , but their flow after running an algorithm will contain the profile allocation for each account . these edges connect into the โ initial holdings โ category for each account , ensuring that the overall profile allocation will add up to the overall account holdings . within the โ profile location preferences โ category , the edges are used to force certain accounts to hold more or less of a predetermined profile . for example , if $ 10 , 000 of profile 2 is required to be in a non - qualified account , the system can add an edge to the โ profile location preferences โ category with a capacity of 10 , 000 and a large negative cost . this setup can force the system to put 10 , 000 of profile 2 into the non - qualified account , possibly by pulling it out of other accounts and , if necessary , pushing the other profiles that are in the non - qualified account into other accounts . less stringent requirements can also be put on specific accounts . for example , if profile 6 is favored in a roth account , the system will put a lower cost on the profile 6 edge in the roth account . further , if profile 1 is disfavored in a roth account , the system will put a higher cost on the profile 1 edge for the roth account , thus making it easier for profile 6 assets to move into the roth account and more difficult for profile 1 assets to move into the roth account . within the โ target profile allocation โ category , the nodes associate with a specific profile and connect , via edges , to their profile &# 39 ; s nodes within each of the accounts . as illustrated in fig8 , the โ target profile allocation โ profile 1 node connects to profile 1 nodes within each of the three accounts . this setup ensures that the total holdings across all of the accounts of each profile equal the total amount desired . the capacities of these edges are set to the expected holdings of each profile across the entire portfolio ( i . e ., in all accounts ). fig9 illustrates an example fund trades network graph for a portfolio having nodes and edges connecting the categories of โ initial fund holdings ,โ โ fund trades ,โ โ final fund holdings ,โ โ asset holdings target ,โ and โ asset holdings preferences .โ as illustrated in fig9 , each of the funds in a portfolio can trade with other funds . in some embodiments , the fund trades network graph can incorporate any number of assets and funds . the capacity of the edges within the โ initial fund holdings โ category , in one embodiment , is set to the initial holdings of each fund . as illustrated in fig9 , the topmost edge in the โ initial fund holdings โ category represents the fund 1 edge leading to the fund 1 nodes of fund 1 . within the โ fund trades โ category , the edges affect the fund trades that can happen . for example , if the trading done within a fund needs to be limited , the system can apply a high cost to the edges connecting that fund to any other , which will push the system to keep holdings within the fund that the holdings originated in . if a fund cannot be purchased , no edges will connect it to the โ final fund holdings โ node . if a first fund cannot be sold , no edges will connect the first fund &# 39 ; s โ initial holdings โ node to any other fund &# 39 ; s โ final fund holdings โ node . within the โ final fund holdings โ category , the flow through the edges represents the final holdings of each fund after trading . within the โ asset holdings target โ category , the nodes are connected to their constituent funds . for example , ibm and microsoft may both be connected to a โ large cap value โ asset . this ensures that each asset holds what it should between the different funds that represent it . within the โ asset holdings preferences โ category , the system sets the capacity of the corresponding edges to ensure that the account matches its desired account asset allocation . however , โ overflow โ edges can be created that allow the allocation to be different than the desired allocation based upon preferences such as not being able to sell a certain fund based upon tax consequences . the costs on these overflow edges indicate how strictly the system should match the overall allocation . therefore , a higher cost encourages the allocation to match more closely to the desired allocation , and a lower cost allows the final allocation to stray further from its desired allocation . the max - flow part of the algorithm ensures that the entire portfolio can be allocated and it comes up with one possible allocation of the assets or profiles across the different accounts . certain setups are impossible to satisfy , such as one where every account has domestic bonds set as preference zero , but the overall portfolio requires some domestic bonds . the max flow part of the algorithm can detect this . the min - cost part of the algorithm is used to find the optimal way to allocate the assets or profiles . a higher preference number on an account - asset reduces the cost of its pipes , encouraging the system to allocate more toward that account - asset . similarly , rmds are represented by edges with an extremely negative weight , which forces the system to satisfy the rmd above all else . the ability to assign preferences to any particular asset class in any available account greatly increases the speed with which an advisor can determine the optimal portfolio from an asset location standpoint . with the algorithm and interface provided , advisors can determine the optimal location of each asset class while honoring the overall asset allocation between any number of accounts the client may own in seconds . the preferences and results of each trade are stored in the system for the full life of the portfolio so that they can be referred back to in order to track the history of the portfolio . the disclosed system interacts with the external trading system by importing and exporting spreadsheets ( csv files ). with this system , advisors are able to review all trades before they are actually implemented , which provides an additional security and quality benefit for the client . the disclosed invention involves technology that uses a computing system . fig1 is a schematic block diagram of an example computing system 1000 . the invention includes at least one computing device 1002 . in some embodiments the computing system further includes a communication network 1004 and one or more additional computing devices 1006 ( such as a server ). computing device 1002 can be , for example , located in a place of business or can be a computing device located in a user &# 39 ; s home or office . in some embodiments , computing device 1002 is a mobile device . computing device 1002 can be a stand - alone computing device or a networked computing device that communicates with one or more other computing devices 1006 across a network 1004 . the additional computing device ( s ) 1006 can be , for example , located remotely from the first computing device 1002 , but configured for data communication with the first computing device 1002 across a network 1004 . in some examples , the computing devices 1002 and 1006 include at least one processor or processing unit 1008 and system memory 1012 . the processor 1008 is a device configured to process a set of instructions . in some embodiments , system memory 1012 may be a component of processor 1008 ; in other embodiments system memory is separate from the processor . depending on the exact configuration and type of computing device , the system memory 1012 may be volatile ( such as ram ), non - volatile ( such as rom , flash memory , etc .) or some combination of the two . system memory 1012 typically includes an operating system 1018 suitable for controlling the operation of the computing device , such as the linux operating system . the system memory 1012 may also include one or more software applications 1014 and may include program data 1016 . the computing device may have additional features or functionality . for example , the device may also include additional data storage devices 1010 ( removable and / or non - removable ) such as , for example , magnetic disks , optical disks , or tape . computer storage media 1010 may include volatile and nonvolatile , removable and non - removable media implemented in any method or technology for storage of information , such as computer readable instructions , data structures , program modules , or other data . system memory , removable storage , and non - removable storage are all examples of computer storage media . computer storage media includes , but is not limited to , ram , rom , eeprom , flash memory or other memory technology , cd - rom , digital versatile disks ( dvd ) or other optical storage , magnetic cassettes , magnetic tape , magnetic disk storage or other magnetic storage devices , or any other medium which can be used to store the desired information and which can be accessed by the computing device . an example of computer storage media is non - transitory media . in some examples , one or more of the computing devices 1002 , 1006 can be located in a financial planner &# 39 ; s place of business . in other examples , the computing device can be a personal computing device that is networked to allow the user to access the present invention at a remote location , such as in a user &# 39 ; s home , office or other location . in some embodiments , the computing device 1002 is a smart phone , tablet , laptop computer , personal digital assistant , or other mobile computing device . in some embodiments the invention is stored as data instructions for a smart phone application . a network 1004 facilitates communication between the computing device 1002 and one or more servers , such as an additional computing device 1006 , that host the system . the network 1004 may be a wide variety of different types of electronic communication networks . for example , the network may be a wide - area network , such as the internet , a local - area network , a metropolitan - area network , or another type of electronic communication network . the network may include wired and / or wireless data links . a variety of communications protocols may be used in the network including , but not limited to , wi - fi , ethernet , transport control protocol ( tcp ), internet protocol ( ip ), hypertext transfer protocol ( http ), soap , remote procedure call protocols , and / or other types of communications protocols . in some examples , the additional computing device 1006 is a web server . in this example , the first computing device 1002 includes a web browser that communicates with the web server to request and retrieve data . the data is then displayed to the user , such as by using a web browser software application . in some embodiments , the various operations , methods , and rules disclosed herein are implemented by instructions stored in memory . when the instructions are executed by the processor of one or more of the computing devices 1002 and 1006 , the instructions cause the processor to perform one or more of the operations or methods disclosed herein . examples of operations include communication between or among users ; task list and order set management ; dashboard functions ; the storage of account information for multiple users ; and other operations . the various embodiments described above are provided by way of illustration only and should not be construed to limit the claims attached hereto . those skilled in the art will readily recognize various modifications and changes that may be made without following the example embodiments and applications illustrated and described herein and without departing from the true spirit and scope of the following claims . | 6 |
a description will be given of embodiments according to the present invention with reference to fig1 to 9 . 1 uses a yag solid laser etc ., serving as an excitation laser for exciting gasified , liquefied or atomized - gasified light - source material atoms into plasma for light emissions by irradiating a laser beam onto the light - source material . 2 is a light - source emitting part that maintains an internal vacuum . 2 a is a light source a of an actual emitting point of an exposure light source . 3 is a vacuum chamber that contains an exposure apparatus , and can maintain the vacuum state using a vacuum pump 4 . 5 is an exposure light introducing part for introducing exposure light from the light - source emitting part 2 , serving as an illumination optical system for illuminating the original form 6 a using illumination light from the light - source emitting part 2 . the exposure light introducing part includes mirrors a ( or 5 a ) to d ( or 5 d ), and shapes the exposure light for uniform illumination of the original form 6 a . the number of mirrors in the exposure light introducing part ( as an illumination optical system ) is not limited to four , and may be four to eight . mirrors more than eight would decrease the light intensity of the illumination light for illuminating the original form . 6 is a reticle stage , and its movable part of its reticle stage is mounted with a reflective original form 6 a that forms a pattern to be exposed . 7 is a reduction projection mirror optical system that reduces and projects an exposure pattern reflected from the original form 6 a . the reduction projection mirror optical system includes mirrors a ( or 7 a ) to e ( or e ), and reflects the light from the pattern through these mirrors a to e to reduce and project the pattern formed on the original form onto the wafer at a predefined reduction ratio . 7 f is a mirror barrel that holds the mirrors a to e . the number of mirrors in the exposure light introducing part is not limited to five , and may be four to eight or another number . 8 is a position - controlled wafer stage for positioning a wafer 8 a , as a si substrate , into a predetermined exposure position so that the wafer stage can be moved in six - axes directions , i . e ., moved in the xyz directions , tilted around the xy axes , and rotated around the z axis . the pattern on the original form 6 a is to be reflected , reduced and projected onto the wafer 8 a . 9 is a reticle stage support for supporting the reticle stage 5 on an apparatus installation floor . 10 is a projection optical system body for supporting the reduction projection mirror optical system 7 on the apparatus installation floor . 11 is a wafer stage support for supporting the wafer stage 8 on the apparatus installation floor . the reticle stage , the reduction projection mirror optical system , and the wafer stage , which are distinctly and independently supported by the reticle stage support , the projection optical system body and the wafer stage support , respectively . they include means ( not shown ) for measuring relative positions to continuously maintain their predetermined configuration . a mount ( not shown ) for violation isolation from the apparatus installation floor is provided on the reticle stage support , the projection system body , and the wafer stage . 12 is a reticle stocker that includes a storage container that temporarily stores , in an airtight condition , plural original forms as reticles supplied from the outside to the inside of the apparatus and suitable for different exposure conditions ( such as an illumination condition ) and patterns ( such as a pattern width and an aspect ratio ). 13 is a reticle changer for selecting and feeding a reticle from the reticle stocker 12 . 14 is a reticle alignment unit that includes a rotatable hand that can travel along the xyz directions and can rotate about the z axis . the reticle alignment unit 14 receives the original form 6 a from the reticle changer 13 , rotates it by 180 ยฐ, and feeds it to the reticle alignment scope 15 provided at the end of the reticle stage 6 for fine movements of the original form 6 a rotating about the xyz - axes and aligns the original form 6 a with the alignment mark 15 a provided on the reduction projection mirror optical system 7 . the aligned original form is chucked on the reticle stage 6 . 16 is a wafer stocker that includes a storage container for temporarily storing plural wafers 108 a from the outside to the inside of the apparatus . 17 is a wafer feed robot for selecting a wafer to be exposed , out of the wafer stocker 16 , and feeds it to a wafer mechanical pre - alignment temperature controller 18 . the wafer mechanical pre - alignment temperature controller 18 roughly adjusts feeding of the wafer in the rotational direction , and controls the wafer temperature within controlled temperature in the exposure apparatus . 19 is a wafer feed hand that feeds to the wafer stage 8 the wafer that has been aligned and temperature - controlled by the wafer mechanical pre - alignment temperature controller 18 . 20 and 21 are gate valves as a mechanism for opening and closing a gate for supplying the reticle and wafer from the outside of the apparatus . 22 is also a gate valve that uses a diaphragm to separates spaces among the wafer stocker 16 , the wafer mechanical pre - alignment temperature controller 18 , and the exposure in the apparatus . the gate valve 22 opens and closes only when feeding the wafer 8 a in and out of the apparatus . such a separation using the diaphragm can minimize a capacity to be temporarily released to the air when the wafer 8 a is fed in from the outside of and fed out of the apparatus , and form a vacuum equilibrium state . fig2 is a schematic view of a first embodiment , exemplifying mirrors c ( or 7 c ) and e ( or 7 e ) in the reduction projection mirror optical system 7 . the mirror 7 c includes a mirror holding element 25 d coupled to the mirror barrel , a mirror displacement measuring means 25 f provided on the mirror holding element 25 d , gravity compensation force generating means 25 g and z - thrust generating means 25 j for compensating gravity deformations in a mirror &# 39 ; s vertical direction and positions due to the gravity deformations , and horizontal position compensation thrust generating means 25 h for compensating horizontal positions ( in the xy directions ) of the mirror 7 c . members 25 g , 25 j and 25 h include a lorentz force generating means that includes a drive coil and a magnet . the force applied to the mirror by the gravity compensation force generating means is , but not limited to , one that reduces the amount of deformation due to gravity . depending upon the measurement result of the wave front aberration of the entire optical system that includes the mirror , the force can be one that increases the mirror &# 39 ; s gravity deformation . in other words , it is preferable that the gravity compensation force generating means forces the mirror to deform based on the measurement result of the wave front aberration so that the aberrational amount is smaller than a predetermined permissible value . the mirror 7 e includes the mirror holding element 26 d coupled to the mirror barrel , mirror displacement measuring means 26 f provided on the mirror holding element 26 d , gravity compensation force generating means 26 g and z - thrust generating means 26 j for compensating gravity deformations in the mirror &# 39 ; s vertical direction and positions due to the gravity deformation , and horizontal position compensation thrust generating means 26 h for compensating horizontal positions ( in the xy directions ) of the mirror 7 e . elements 26 g , 26 j and 26 h include a lorentz force generating means that includes a drive coil and a magnet . a description will now be given of the measurement method of an aberrational target value through total reflection mirrors in the projection optical system . while the reticle chuck slider 6 b of the reticle stage 6 ( i . e ., reticle stage slider ) retracts , as shown in fig3 , the measurement light supplied from a wave front measurement light source supply optical fiber 23 a ( i . e ., wave front measurement light supply fiber ) is emitted from a wave front measurement light source emission opening 23 . the measurement light is reflected on all the reflective surfaces on the mirrors in the projection optical system , and a wave front measurement light - receiving sensor 24 installed on the wafer stage 8 &# 39 ; s movable part receives the light . the wave front aberration of the projection optical system ( for all the mirrors ) is measured based on the detection result by the wave front measurement light - receiving sensor . next , a wave front measurement value arithmetic circuit 28 calculates the wave front aberration amount based on the wave front measurement value measured by the wave front measurement light - receiving sensor 24 . a mirror gravity compensation and vertical / horizontal compensation correction drive table arithmetic circuit 29 calculates corrective drive directions and drive amounts ( or applied power directions and applied power amounts ) of the mirrors a ( or 7 a ) to e ( or 7 e ) based on the wave front aberration value , and transmits them as target values to the mirror gravity compensation and horizontal / vertical compensation drive means 30 that includes 25 g , 25 j , 25 h , 26 g , 26 j , 26 h , etc . although it is preferable that each of the mirrors a to e includes position - measuring , position compensating and forcing means , only some of the mirrors may include them . simultaneously , the mirror system displacement measurement arithmetic circuit 27 collects signals that reflect position information of the mirrors a ( or 7 a ) to e ( or 7 e ) from the mirror displacement measurement means , such as 25 f and 26 f , and measures the mirror positions from the mirror barrel and the relative positions of the mirrors . after the mirror gravity compensation and horizontal / vertical compensation drive means 30 that includes 25 g , 25 j , 25 h , 26 g , 26 j , 26 h , etc . drives each mirror to the target position and relative positions between the mirrors and the mirror barrel are measured , the wave front is measured again . when the wave front aberration is equal to the specification or is below the predetermined amount , the corrections end . however , when the wave front aberration differs from the specification or is greater than the predetermined amount , the wave front measurement arithmetic circuit recalculates the residual wave front aberration amount to repeat the above correction and reduce the wave front aberration down to the target specification . the target wave front aberration amount is one generated in the apparatus when the projection optical system solely adjusts a mirror position initially , and reduces the aberration below the appropriate target amount . a position and shape of each mirror at this time are origins of the mirror position and mirror shape . of course , the target wave front aberration amount may use another value , and the origins for the mirror position and mirror shape may not be those which are obtained at the initial adjustment time . the target value is set only for the wave front aberration amount without introducing a concept of the origins for the mirror position and mirror shape . with respect to the origin of the mirror position , it is possible to reduce the aberration down to the target position by driving the mirror gravity compensation and horizontal / vertical compensation drive means 30 ( or mirror drive means ). a description will be given of the second embodiment with reference to fig4 . while the first embodiment uses the lorentz force for the gravity compensation force generating means , a method that uses a permanent magnet to apply a suction force is also applicable in addition to the lorentz force . the second embodiment is different from the first embodiment in using the permanent magnet . the gravity compensation force generating means 25 k and 26 k have a magnet and use this magnet to generate a force onto a mirror in a direction opposing the gravity force along an approximately central axis of the mirror . the cancellation between the magnet &# 39 ; s magnetic force and the mirror &# 39 ; s gravity can compensate ( and reduce ) the mirror &# 39 ; s deformation due to its own weight . in the gravity compensation that uses the permanent magnet as in the second embodiment , the magnet suction force is controlled by a gap adjustment unit ( not shown ) between the magnets ( i . e ., between the magnet attached to the mirror and the magnet attached to the mirror barrel or the magnet attached to the mirror holding element coupled to the mirror barrel ). a description will be given of the third embodiment with reference to fig5 . the gravity compensation force generating means can use a method that employs a permanent magnet to apply a suction force instead of the lorentz force . the third embodiment enables the gravity compensation force generating means 25 l and 26 l to use the electrostatic suction force to compensate ( and reduce ) the mirror &# 39 ; s deformation due to its own weight . this embodiment generates an electrostatic suction force in a direction opposing the gravity force along the approximately central axis of the mirror . the cancellation between the electrostatic suction force and the mirror &# 39 ; s gravity can reduce the mirror &# 39 ; s deformation amount due to its own weight . in compensating the mirror &# 39 ; s deformation due to its own weight using the electrostatic suction force as shown in the third embodiment , the applied potential should be controlled , for example , by an electrostatic chuck . a description will be given of the fourth embodiment with reference to fig6 . the first embodiment uses both the gravity compensation force generating means and the xyz position compensating means to hold and control positions of the mirrors in a non - contact manner . on the other hand , the fourth embodiment ( shown in fig6 ) compensates for only the gravity without the xyz positioning control . this embodiment configures the mirror displacement measurement means 25 f and the gravity compensation force generating means 25 m as in the first embodiment , and fixes the mirror c ( or 7 c ) onto the mirror holding element 25 d without the position displacement means etc . similarly , the mirror displacement measuring means 26 f and gravity compensation force generating means 26 m have structures similar to those in the first embodiment , and the mirror e ( or 7 e ) is fixed onto the mirror holding element 26 d without the position displacement means etc . thus , the mirror that includes only the gravity compensation means is used for one having a relatively low final correction precision or a relatively low position precision and surface shape precision . however , in precisely adjusting a distribution of the gravity compensation force on the mirror surface , fine adjustments of the mirror &# 39 ; s surface shapes and precise gravity compensations ( i . e ., precise compensations of the deformed mirror surface due to its own weight ) are available by properly dispersing plural gravity compensation force generating means 25 n on the mirror &# 39 ; s rear surface , as shown in fig7 . fig8 is a flowchart showing a workflow in the fourth embodiment . while the reticle chuck slider 6 b of the reticle stage 6 ( i . e ., reticle stage slider ) retracts , as illustrated , the measurement light supplied from a wave front measurement light source supply optical fiber 23 a is emitted from the wave front measurement light source emission opening 23 . the measurement light is reflected on the entire reflective surfaces on the mirror in the projection optical system , and the wave front aberration of the projection optical system ( for all the mirrors ) is measured based on the detection result by the wave front measurement light - receiving sensor 24 installed on the wafer stage 8 &# 39 ; s movable part receives the light . next , a wave front measurement value arithmetic circuit 28 calculates the wave front aberration amount based on the wave front measurement value measured by the wave front measurement light - receiving sensor 24 . a mirror gravity compensation correction drive table arithmetic circuit 31 calculates corrective drive directions , drive amounts and applied power amounts of mirrors a ( or 7 a ) to e ( or 7 e ) based on the wave front aberration amount ( or wave front measurement operation value ), and transmits them as target values to the mirror gravity compensation drive means 32 that includes 25 n , 26 n , etc . simultaneously , the mirror system displacement measurement arithmetic circuit 27 collects signals that reflect position information of the mirrors a ( or 7 a ) to e ( 7 e ) from the mirror displacement measurement means 25 f and 26 f , and measures the mirror positions from the mirror barrel and the relative positions among the mirrors . after the mirror gravity compensation drive means 30 that includes 25 n , 26 n , etc . drives each mirror to the target position , the wave front is measured again . when the wave front aberration meets the specification or is below the predetermined amount , the correction ends . however , when the wave front aberration diverts from the specification or is greater than the predetermined amount , the wave front measurement arithmetic circuit recalculates the residual wave front aberration amount to repeat the above correction and reduce the wave front aberration down to the target specification . the target wave front aberration amount is one generated in the apparatus when the projection optical system solely adjusts a mirror position initially , and reduces the aberration below the appropriate target amount . a position and shape of each mirror at this time are origins of the mirror position and mirror shape . of course , the target wave front aberration amount may use another value , and the origins for the mirror position and mirror shape may not be those which are obtained at the initial adjustment time . the target value is set only for the wave front aberration amount without introducing a concept of the origins for the mirror position and mirror shape . with respect to the origin of the mirror position , it is possible to reduce the aberration down to the target position by driving the mirror using the mirror gravity compensation drive means 30 having 25 n , 26 n , etc . a description will be given of the fifth embodiment with reference to fig9 . this embodiment has approximately the same structure as that of the fourth embodiment , but is different in using a permanent magnet , electrostatic force or the like for the gravity compensation force generating means 25 p and 26 p , as in the second and third embodiments . other than that , this embodiment is approximately similar to the fourth embodiment . while the first to fifth embodiments have been thus described , the present invention is not limited to these embodiments . for example , the mirror to be forced or displaced is not limited to the mirrors c and e , but may be any mirrors a to e . the number of mirrors is not limited to six . in addition , the mirror to be forced or displaced is not limited to one in the projection optical system , but can also be one in the illumination optical system . the instant embodiments address the wave front aberration , and force or displace the mirror based on the wave front aberration . however , the mirror may be forced or displaced based on another reference value , such as other aberration and specific mirror &# 39 ; s deformation amount , rather than a detection result of the wave front aberration . referring to fig1 and 13 , a description will now be given of an embodiment of a device fabricating method using the above exposure apparatus . fig1 is a flowchart for explaining a fabrication of devices ( i . e ., semiconductor chips such as ic and lsi , lcds , ccds , etc .). here , a description will be given of a fabrication of a semiconductor chip as an example . step 1 ( circuit design ) designs a semiconductor device circuit . step 2 ( mask fabrication ) forms a mask having a designed circuit pattern . step 3 ( wafer making ) manufactures a wafer using materials such as silicon . step 4 ( wafer process ), which is referred to as a pretreatment , forms actual circuitry on the wafer through photolithography using the mask and wafer . step 5 ( assembly ), which is also referred to as a post - treatment , transforms the wafer formed in step 4 into a semiconductor chip and includes an assembly step ( e . g ., dicing , bonding ), a packaging step ( chip sealing ), and the like . step 6 ( inspection ) performs various tests for the semiconductor device made in step 5 , such as a validity test and a durability test . through these steps , a semiconductor device is finished and shipped ( step 7 ). fig1 is a detailed flowchart of the wafer process in step 4 . step 11 ( oxidation ) oxidizes the wafer &# 39 ; s surface . step 12 ( cvd ) forms an insulating film on the wafer &# 39 ; s surface . step 13 ( electrode formation ) forms electrodes on the wafer by vapor disposition and the like . step 14 ( ion implantation ) implants ions into the wafer . step 15 ( resist process ) applies a photosensitive material onto the wafer . step 16 ( exposure ) uses the exposure apparatus to expose a circuit pattern on the mask onto the wafer . step 17 ( development ) develops the exposed wafer . step 18 ( etching ) etches parts other than a developed resist image . step 19 ( resist stripping ) removes disused resist after etching . these steps are repeated , and multilayer circuit patterns are formed on the wafer . the device fabrication method of this embodiment may manufacture higher quality devices than the conventional one . thus , the device fabrication method using the exposure apparatus , and the devices as finished goods also constitute one aspect of the present invention . according to the instant embodiment , the exposure apparatus can correct fine displacements and inclinations of the rotational axis in the in - plane translation shift direction and vertical direction , mirror &# 39 ; s deformations due to its own weight , and wave front aberration in the projection optical system mirrors , preventing the mirror surface precision , the optical aberration , and deteriorated imaging performance and lowered light intensity in the projection optical system . | 6 |
it is considered essential that , prior to the detailed disclosure of this invention , the aforementioned conventional pair of breakdown rolls be shown and described in some more detail , in order to make clear the features and advantages of the instant invention . fig1 shows the concave bottom roll 10 and convex top roll 12 heretofore used for curling the opposite longitudinal edge portions of a skelp , not shown in this figure , in processing such skelp into welded tubing . take , for example , the concave bottom roll 10 to consider the problems of the prior art . the working surface of this bottom roll 10 is composed of a pair of end portions ab each arched with a radius r , and a center portion bcb arched with a radius r . each end portion ab of the roll 10 is arched with a radius much less than that of the center portion bcb and coacts with the corresponding portion of the convex top roll 12 respectively to curl the edge portions of the skelp . in order to make the bottom roll end portions ab as wide as possible and hence to curl the correspondingly wide edge portions of the skelp , it becomes necessary for the end portions ab to rise steeply toward the opposite axial ends of the roll 10 . thus , a considerable distance d exists between the lowest point in the middle of the center portion bcb and the highest point at the outer end of each end portion ab , as measured in a radial direction of the roll 10 . in rolling the skelp between the two breakdown rolls 10 and 12 , the top roll 12 is forced down toward the bottom roll 10 in a direction normal to the roll axes , as indicated by the arrow f in fig1 . for curling the edge portions of the skelp , however , the end portions of the ab of the rolls 10 and 12 require forces f &# 39 ; at considerable angles to the direction of the force f . the components f &# 39 ; of the force f are usually insufficient to curl the edge portions of the skelp against any possibility of springback and of the development of wavy edges . an additional disadvantage is the substantial difference between the peripheral speeds of the end portions ab and center portion bcb of the bottom roll 10 . as has been mentioned , this results in the creation of roll marks on the skelp . the present invention provides a solution to all such problems of the prior art . as illustrated in perspective in fig2 the invention resides in the improved breakdown roll set comprising a dual concave bottom roll 14 and a dual convex top roll 16 . the two breakdown rolls 14 and 16 have their axes oriented parallel to each other and are slightly spaced from each other to define an undulatory path therebetween . traversing this path , a skelp s is bent into the corresponding cross sectional shape , as shown , such that its opposite longitudinal edge portions are curled to expedite the subsequent steps of rolling into a tubular shape , as will be later explained in more detail with reference to fig6 a - 6d . fig3 shows the dual concave bottom roll 14 on an enlarged scale to clearly reveal its structural features . the working surface 18 of this bottom roll 14 is composed of a convex midportion 20 , a pair of concave end portions 22 on opposite sides of the midportion , and a pair of uncurved or straight border portions 24 each interposed between the convex midportion and one of the concave end portions . the border portions 24 , however , constitute no essential feature of this invention taken in its broadest aspect . nevertheless , this feature is essential to the invention in its more narrow aspects . the convex midportion 20 of the bottom roll 14 is arched through an angle ฮธ and with a radius r 1 . in the illustrated embodiment including the pair of straight border portions 24 , the angle ฮธ ranges from about 16 ยฐ to about 40 ยฐ. the surface length of the convex midportion 20 occupies from about 38 % to 52 % of the length of the working surface 18 of the bottom roll 14 , as measured in a direction parallel to the axis of the roll 14 . if the angle ฮธ is less than about 16 ยฐ, the midportion 20 would become nearly straight , its transverse surface length being definitely proportioned in relation to that of the entire working surface 18 . then , it would become impossible to reduce the rise d r of the concave end portions 22 , which should be kept at a minimum for the reasons already set forth . if the angle ฮธ were more than about 40 ยฐ, on the other hand , then the midportion 20 would bulge out inordinately , again its transverse surface length being definitely proportioned in relation to that of the working surface 18 . such excessive bulging of the midportion 20 is objectionable because the resulting upward bulging of the center portion of the skelp s would make difficult the subsequent rolling of the skelp s into a tubular shape , giving rise to the possibility of the skelp s being damaged while being so rolled . the pair of concave end portions 22 of the bottom roll 14 are each arched through an angle ฮธ 1 and with a radius r 1 , less than the radius r 1 of arc of the convex midportion 20 . the combined surface length of these concave end portions 22 occupies from about 40 % to about 45 % of the length of the working surface 18 of the bottom roll 14 , as measured in a direction parallel to the roll axis . the combined surface length of the straight border portions 24 is from about 8 % to about 17 % of the length of the working surface 18 , also as measured in a direction parallel to the roll axis . the convex midportion 20 , the pair of concave end portions 22 and the pair of straight border portions 24 form a continuous surface , making up the dual concave contours of the working surface 18 . such being the construction of the bottom breakdown roll 14 , it will be seen that its concave end portions 22 can be made wider than those of the prior art roll 10 of fig1 with respect to a given axial dimension of the roll 14 , without causing any steep rise of the end portions 22 toward the axial ends of the roll 14 . further , the interposition of the straight border portions 24 between convex midportion 20 and concave end portions 22 serves to prevent the imprinting of roll marks or rubbed marks on the skelp s owing to the smooth change of the working surface 18 . other advantages accruing from these features of the improved bottom breakdown roll 14 will be apparent from the foregoing description of the invention and of the prior art . in fig4 there is shown the dual convex top roll 16 together with the dual concave bottom roll 14 in their relative working positions . the top roll 16 is shaped in complementary relation to the bottom roll 14 , having a working surface 26 composed of a concave midportion 28 , a pair of convex end portions 30 on opposite sides of the midportion 28 , and a pair of straight border portions 32 each interposed between the concave midportion 28 and one of the convex end portions 30 . thus , the working surfaces 18 and 26 of the two breakdown rolls 14 and 16 are substantially parallel to each other along their lines of contact with the skelps . the modifier &# 34 ; substantially &# 34 ; is used because the opposed lines of the two working surfaces 18 and 26 are intentionally made not exactly parallel to each other in accordance with an additional feature of the invention . the nonparallel relation arises as the spacing between each opposed pair of straight border portions 24 and 32 becomes progressively greater toward the midportions 20 and 28 of the rolls 14 and 16 , respectively . for the best results , the angle ฮธ 2 between each opposed pair of border portions , along their divergent lines of contact with the skelps , is from about 0 . 2 ยฐ to about 3 . 0 ยฐ, preferably from 0 . 5 ยฐ to 1 . 5 ยฐ. naturally , therefore , the spacings between the two opposed pairs of end portions 22 and 30 of the breakdown rolls 14 and 16 are slightly less than the spacing between the opposed pair of midportions 20 and 28 . this means that , for a given downward force of the top roll 16 , greater compressive forces are exerted on the longitudinal edge portions of the skelps by the two opposed pairs of roll end portions 22 and 30 . stated conversely , less compressive forces need be applied to the rolls 14 and 16 for curling the skelp edges . this advantage , combined with those previously pointed out , makes it possible to reduce the diameters of the breakdown rolls 14 and 16 and to make them lighter in weight . fig5 is an illustration of a bottom breakdown roll 14a of slightly modified design . the modification resides in the subdivision of each concave end portion of the bottom roll 14a into two segments 34 and 36 arched with different radii r 2 and r 3 . the radius r 2 of arc of the outer segment 34 is less than that of the inner segment 36 . alternatively each concave end portion of the bottom roll 14a may be subdivided into three or more such segments arched with different radii . in the latter case , the arc radii of each series of segments may be made progressively smaller from the inmost segment toward the outmost one . the modified bottom roll 14a is identical in the other respects with the roll 14 . the subdivision of each concave end portion of the bottom breakdown roll 14a into at least two segments 34 and 36 , as above , offers the advantage of controlling the curling of the skelp edge portions in accordance with the expected degree of its springback . the teachings of fig5 will be particularly useful in curling the edges of a strip of stainless steel , spring steel , titanium steel , or like material having a high degree of springback . illustrated in fig6 a through 6d by way of reference are four successive pairs of shaping rolls to be placed immediately after the improved pair of breakdown rolls 14 and 16 of this invention in processing the skelp s into a welded tube . after having its opposite longitudinal edge portions curled by the improved pair of breakdown rolls 14 and 16 as above , the skelp s passes between a pair of side rolls 38 pictured in fig6 a . these side rolls 38 act principally as guides , even though they impart some slight transverse stress to the skelps , so that its cross sectional shape remains nearly unchanged . a succeeding pair of top and bottom rolls 40 shown in fig6 b acts only on the center portion of the skelp s , bringing it into an approximately arcuate shape . the skelp s acquires a nearly semicircular shape as it subsequently passes between another pair of side rolls 42 of fig6 c . then a pair of top and bottom rolls 44 of fig6 d shapes the skelp s into an arc of a smaller radius by acting on its center portion only . thereafter , the skelps can be processed into a seam - welded tube by any apparatus and through the procedure , well known to those skilled in the art . a variety of modifications or changes in the details of the improved breakdown rolls of this invention will readily occur to the specialists to conform to specific requirements or considerations in the manufacture of seam - welded tubes of one type or another . it is therefore understood that the illustrated embodiments are illustrative only and not to be taken as a definition of the scope of the invention . | 1 |
referring first to fig1 and 2 , a band material indicated by n is moved continuously in the longitudinal direction indicated by the arrow f by pairs of rollers r and r &# 39 ; all or at least some of which are appropriately powered as indicated by the arrows f &# 39 ; and preferably in such a manner as to suitably stretch the band portion n &# 39 ; between the pairs of rollers . the punching device according to the invention operates on the band portion n &# 39 ; and comprises a pair of opposed parallel complementary dies 1 and 2 arranged transversely of the band one above and the other below the band . as shown in fig3 the upper die 1 carries female tools or matrixes 3 whereas the lower die 2 carries male tools or punches 4 arranged in a complementary fashion to the matrixes . the punches and matrixes are located in an ideal plane transversely of and perpendicularly to the band . to enable the dies 1 and 2 to act on the band moving continuously therethrough , they are provided with appropriate mounting and support means which will now be described . first of all , the dies are interconnected by slidable guide means to keep them always parallel to each other and with the tools mutually centered . this guide means comprises a pair of parallel guide rods 5 and 105 firmly connected perpendicularly to the ends of one of the dies , for example the lower one , and slidably mounted in conjugated seats 6 and 106 in the upper die 1 . the ends of the dies are rotatably mounted on crank pins 7 and 107 , and 8 and 108 , respectively , projecting from pairs of toothed wheels 9 and 109 having the same diameter , meshing with each other and rotatably mounted on support members 10 and 110 . the axle of one of the toothed wheels 109 is denoted by 11 and that of the corresponding opposed toothed wheel 9 by 11 &# 39 ;. these axles are so connected as to impart to the device a continuous rotation in the direction of the arrow f &# 34 ;. the crank pins 7 and 107 and 8 and 108 are eccentrically mounted on the associated toothed wheels 9 and 109 and the eccentricity of crank pins 7 , 107 is the same as that of crank pins 8 , 108 so that the punch and matrix portions intended to cooperate first with one another are located on ideal circumferences which are concentric with the toothed wheels 9 , 109 and tangent on the band n &# 39 ;, these tool portions being intended to rotate on circular paths at a peripheral speed corresponding to the speed of linear feeding of the band n &# 39 ;. as will be apparent from fig1 and 2 , due to the synchronous rotation of the toothed wheels 9 and 109 , the dies 1 and 2 cyclically move toward and away from each other and as they approach the band to cooperate therewith the dies move in the same direction and at the same speed as that of the band , preventing any undesired relative movment with respect to the band . the following mechanism is provided to ensure satisfactory operation of the described device even in case of slight play between the toothed wheels 9 and 109 and tolerances in the construction and mounting of the various parts forming the device . the punches 4 are formed of cylindrical rods or stems having a circular cross section and mounted for axial laterally sealed movement in seats or ducts provided in the die 2 . lateral sealing of the punches 4 is ensured by sealing rings 12 and 13 retained in position by plates 14 and 15 secured to the body of the die 2 . the lower ends of the punches or seats accommodating the punches communicate with a common chamber 16 provided in the body of the die 2 and sealingly closed by a plate 17 . the chamber 16 is completely filled with a liquid through an inlet hole 18 . a venthole 19 is provided in the chamber 16 to drain air therefrom and can also be closed by a suitable plug . the plate 17 is provided with a hole 20 receiving a piston 22 sealed laterally by a sealing gasket 21 . the extent of penetration of the piston 22 in the hole 20 can be adjusted by means of a setscrew 23 supported by a cap member 24 secured to the plate 17 . thus the punches 4 are interconnected by a hydrostatic connection which enables them to adapt themselves automatically to the female dies and permits them to operate simultaneously on the band to avoid excessive stress thereon and on the entire apparatus . the advantages obtained by this arrangement are obvious considering that the punches 4 are slightly shiftable transversely in their seats in which they have to move . in this manner the punches and matrixes do not have to be accurately aligned before starting operation . the device will correctly operate even if the punches 4 are of different lengths . this latter possibility simplifies the use of the device as variations in the length of the punches do not have to be considered when the punches have to be periodically sharpened . as the punches after sharpening would have their points removed from their ideal path of rotation , this removal can be compensated by adjusting the setscrew 23 to reduce the inner space of the chamber 16 . thus , in addition to the described punching device the invention also comprises a hydrostatic compensation device which is independent from the mechanism for moving the dies as the latter is independent from the hydrostatic compensation device . also numerous changes and modifications , particularly structural changes , obvious to one skilled in the art may be made in the described and illustrated preferred embodiment . as an alternative to or in combination with the hydrostatic compensation and connection device , a hydropneumatic connection device may be provided . also a layer of hard or compressed rubber may be used for direct engagement by the stems of the punches 4 with the interposition of the liquid and / or with the provision of a fluid generally . with these modifications the punching device would be provided with a damping system which would ensure reliable operation and a long service life of the device also with high rates of rotation of the die moving means . according to a further modification the toothed wheels 9 and 109 may be made by the conventional technique of compensation of meshing backlash or the toothed wheels may be replaced by equivalent members such as positive displacement gears . instead of connecting the dies by toothed wheels they may be connected by through cranks or crankshafts appropriately synchronized relative to one another . fig4 shows another modification according to which each die is driven by more than one crank gear , for example the crank gear pairs 109 and 109 &# 39 ;. this would permit the use of very long dies provided with a plurality of groups of tools and would relieve the cranks of some of the load to ensure a more balanced and parallel arrangement of the system . in dies of the type shown in fig4 each of the several groups of tools may be arranged to work on a portion of a predetermined set of indenting or punching operations . as the band n &# 39 ; moves through the dies 1 and 2 of fig4 the band portions corresponding to a complete revolution of the crank gears 109 and 109 &# 39 ; would subsequently be located adjacent the various groups of tools and would leave the dies with all the identations and perforations provided therein . this arrangement would afford the advantage of containing and spacing a number of tools in each operating station and simultaneously the possibility of providing a very close pattern of indentations or perforations which could not have been made within the overall dimensions of the tools if the latter had been arranged in a single operating station of only one pair of dies of the noncomposite type . fig5 shows another modification in which the die 2 is arranged to perform an eccentric movement whereas the die 1 is driven to perform a swinging movement . for this purpose the die 1 is supported by a pair of levers 25 and 25 &# 39 ; mounted for swinging movement on a common axis 26 extending parallel to the axis of rotation of the crank pins 108 on toothed gears 9 and 109 . for driving the toothed wheels or cranks , means different from those described may be provided and may be such as to act on both sets of wheels or crank gears . according to a further modification the punching device may be turned upside down with respect to the illustration in the drawings so that the die 2 carrying the punches would be located above the band . in this case the die 1 carrying the matrixes would be located below the band and this might facilitate the removal of scrap from the matrixes . alternatively the punches 4 may be of composite construction , i . e . they may be detachably connected to a stem portion operating in the die 2 . these stem portions may be permanently connected to the die 2 without removing the connection when it is necessary to remove the tools for sharpening . also different means may be provided for limiting axial shifting of the tools or to ensure lateral sealing thereof . for example , the seat for the sealing rings 12 and 13 may be provided directly on the stem portion of such movable tools . alternatively or in combination with the embodiment described above , also the matrixes 3 may be provided with a compensation device . for this purpose the matrixes may pass through the body of the die 1 and may be formed with a step within the hydrostatic and / or elastic compensation chamber . these and other modifications obvious to one skilled in the art are intended to be included within the scope of the invention as defined by the appended claims . | 8 |
in the following detailed description , reference is made to the accompanying drawings , which form a part of the description . in the drawings , similar symbols typically identify similar components , unless context dictates otherwise . furthermore , unless otherwise noted , the description of each successive drawing may reference features from one or more of the previous drawings to provide clearer context and a more substantive explanation of the current example embodiment . still , the example embodiments described in the detailed description , drawings , and claims are not meant to be limiting . other embodiments may be utilized , and other changes may be made , without departing from the spirit or scope of the subject matter presented herein . it will be readily understood that the aspects of the present disclosure , as generally described herein and illustrated in the drawings , may be arranged , substituted , combined , separated , and designed in a wide variety of different configurations , all of which are explicitly contemplated herein . fig1 shows an example configuration of an on - demand information network 100 , arranged in accordance with at least some embodiments described herein . as depicted , on - demand information network 100 includes , at least , a client device 104 with an instance of a client application 106 hosted thereon , a cloud - based platform 108 , and multiple subscribing devices 110 a , 110 b , . . . , 110 n . a user 102 is illustrated as an entity who exercises ownership or control of client device 104 . user 102 may be a person who desires to receive real - time data , information , and / or media files from subscribers to a service hosted by cloud - based platform 108 . alternatively , user 102 may represent organizations , entities , or communities that represent a common interest , therefore leading to a solicitation for one or more bids for services , as described herein . such examples are not intended to be limiting , and even further alternatives may be contemplated within the spirit and context of this description . more particularly , utilizing the infrastructure of configuration 100 , user 102 may solicit bids for , and subsequently receive services that may include , as examples only , on - demand data , information , and / or media files . non - limiting examples of the data , information , and / or media files pertaining to the requested services , as referenced throughout the present description , may include descriptive texts , photographs , and / or videos of , e . g ., street views of a particular address ; restaurant reviews , including real - time information regarding current capacity , daily specials , etc ., crowd views ; weather at a particular location ; etc . the menu of such potential requested services may be myriad , and may delve into the categorization of on - demand journalism , customized reporting , tailored data retrieval , etc . regardless of the requested service , user 102 and a service provider of cloud - based platform 108 , either singularly or in combination , may utilize on - demand information network 100 to facilitate a bidding system to procure on - demand , real - time data , information , and / or media files that are to be captured on terms specified by and for user 102 . client device 104 may refer to a processor - based electronic device on which an instance of client application 106 may be hosted to implement at least portions of an on - demand information network . further , client device 104 may be configured to transmit and receive data , information , and / or media files over a radio link to cloud - based platform 108 by further connecting to a mobile communications network provided by a wireless service provider ( not shown ). client device 104 may be implemented as a portable ( or mobile ) electronic device such as a mobile phone , cell phone , smartphone , personal data assistant ( pda ), a personal media player device , an application specific device , or a hybrid device that includes any of the above functions . client device 104 may also be implemented as a personal computer including tablet , laptop computer , and non - laptop computer configurations , which may be connected to the aforementioned mobile communications network or , alternatively , to a wired network . the aforementioned wireless service provider for implementing communications for client device 104 may also be known as a mobile network carrier , wireless carrier , or even cellular company . regardless of the alternate reference , the wireless service provider may provide services for mobile communications subscribers . client device 104 may be configured to communicate with any of cloud - based platform 108 and / or subscribers 110 a , 110 b , . . . , 110 n , who may similarly communicate with each other and / or cloud - based platform 108 . further , client device 104 may be configured to communicate with any of subscribers 110 a , 110 b , . . . , 110 n directly in a peer - to - peer networking environment . client application 106 may be hosted on , or otherwise associated with , client device 104 . client application 106 may facilitate user interaction with at least cloud - based platform 108 or another data center within the infrastructure of on - demand information network 108 for client device 104 . more particularly , client application 106 , in coordination with cloud - based platform 108 , may submit or configure conditions , preferences , or settings entered by user 102 for soliciting competing bids from multiple ones of subscribers 110 a , 110 b , . . . , 110 n for a requested service , i . e ., data , information , and / or media files . the conditions for the solicitation of bids for the requested services may include , as non - limiting examples , a requested form of data , information , and / or media files ; a location in which to capture the data , information , and / or media files ; a time frame in which to capture the data , information , and / or media files ; other forms of context for the requested data , information , and / or media files ; a price range willing to be paid for the requested data , information , and / or media files ; a time frame within which the solicited bids will be accepted , etc . cloud - based platform 108 may be regarded as a cloud - based storage and dissemination platform owned and / or operated by a third - party service provider . cloud - based platform may include a framework of hardware , software , firmware , or any combination thereof , to which digital data and information , including media files , may be stored or from which they may be shared with subscribers to the hosted service . more particularly , cloud - based platform 108 may be implemented as a web - based storage and sharing service to which user 102 , as well as subscribers 110 a , 110 b , . . . , 110 n ( i . e ., the people to which the respective devices belong ) register prior to use . such registration may include pre - configuration of user preferences or settings for soliciting or contributing data , information , and / or media files on digital storage platform 108 . the registration , including pre - configuration of user conditions , preferences , or settings , may be performed in coordination with the instance of client application 106 hosted on client device 104 . subscribers 110 a , 110 b , . . . , 110 n may refer to a processor - based electronic device configured to transmit and receive data , information , and / or media files over a radio link to cloud - based platform 108 by further connecting to a mobile communications network provided by a wireless service provider ( not shown ). similar to client device 104 , subscribers 110 a , 110 b , . . . , 110 n may be implemented as a portable ( or mobile ) electronic device such as a mobile phone , cell phone , smartphone , personal data assistant ( pda ), a personal media player device , an application specific device , or a hybrid device that includes any of the above functions . further , since subscribers 110 a , 110 b , . . . , 110 n may be utilized to provide requested services , e . g ., data , information , and / or media files to client device 104 via cloud - based platform 108 , subscribers 110 a , 110 b , . . . , 110 n may further be configured to include a camera , video recorder , and / or audio recorder . alternatively , subscribers 110 a , 110 b , . . . , 110 n may be configured with a port to have a separate camera , video recorder , and / or audio recorder communicatively coupled thereto . non - limiting examples of such ports may include a usb port , hdmi port , etc . further still , one or more of subscribers 110 a , 110 b , . . . , 110 n may also be implemented as a personal computer including tablet , laptop computer and non - laptop computer configurations , which may be connected to the aforementioned mobile communications network or , alternatively , to a wired network . subscribers 110 a , 110 b , . . . , 110 n may also be configured to transmit / receive data or information or otherwise share information utilizing non - cellular technologies such as conventional analog am or fm radio , wi - fitm , wireless local area network ( wlan or ieee 802 . 11 ), wimax โข ( worldwide interoperability for microwave access ), bluetooth โข, hard - wired connections , e . g ., cable , phone lines , and other analog and digital wireless voice and data transmission technologies . further still , client device 104 may be configured to communicate with any of subscribers 110 a , 110 b , . . . , 110 n directly in a peer - to - peer networking environment . communication link 112 may refer to a communication link enabled by a protocol utilized to transmit data , information , and / or media files between client application 106 , via client device 104 , and cloud - based platform 108 . such protocol may include any mobile communications technology , e . g ., gsm , cdma , etc ., depending upon the technologies supported by a particular wireless service provider to whose service client 104 is assigned or subscribed . further , communication link 112 may be implemented utilizing non - cellular technologies such as conventional analog am or fm radio , wi - fi โข, wireless local area network ( wlan or ieee 802 . 11 ), wimaxt โข, bluetooth โข, hard - wired connections , e . g ., cable , phone lines , and other analog and digital wireless voice and data transmission technologies . communication links 114 a , 114 b , . . . , 114 n may respectively refer to a communication link enabled by a protocol utilized to transmit data , information , and / or media files between cloud - based platform 108 and subscribers 110 a , 110 b , . . . , 110 n , respectively . further , communication links 114 a , 114 b , . . . , 114 n may be implemented utilizing one or more of the protocols described above regarding communication link 112 . communication links 116 a and 116 b may refer respectively to a communication link enabled by protocol utilized to transmit data , information , and / or media files between client application 106 , via client device 104 , and subscribers 110 a and 110 n , respectively . fig1 does not depict connection between client application 106 , via client device 104 , and subscriber 110 n in order to illustrate that the connection between client application 106 , via client device 104 , may be a peer - to - peer connection , and that a peer - to - peer network may be exclusive to some degree . regardless , communication links 116 a and 116 n may be implemented utilizing one or more of the protocols described above regarding communication link 112 and communication links 114 a , 114 b , . . . , 114 n . thus , fig1 shows example embodiments of components and communications there between of on - demand information network 100 . fig2 shows an example configuration 200 of a client device application 106 relative to an on - demand information network , arranged in accordance with at least some embodiments described herein . as depicted , an example configuration of client device application 106 , hosted on client device 104 , includes a user interface ( ui ) 202 , a transmitting component 204 , a queuing component 206 , and a receiving component 208 . in fig2 , client device 104 is depicted relative to cloud - based platform 108 and subscribing devices 110 a , 110 b , . . . , 110 n , as in fig1 ; however , this configuration is an example only , and is not intended to be limiting in any manner . user interface ( ui ) 202 may refer to a graphical component of client application 106 . ui 202 may be configured , designed , and / or programmed to receive , from user 102 , conditions for soliciting competing bids from one or more of subscribers 110 a , 110 b , . . . , 110 n . accordingly , in the current context , subscribers 110 a , 110 b , . . . , 110 n may be alternatively regarded as โ bidders .โ further , the conditions for the solicitation of bids for the requested services may include , as non - limiting examples , a requested form of data , information , and / or media files ; a location in which to capture the data , information , and / or media files ; a time frame in which to capture the data , information , and / or media files ; other forms of context for the requested data , information , and / or media files ; a price range willing to be paid for the requested data , information , and / or media files ; a time frame within which the solicited bids will be accepted , etc . ui 202 may further be configured , designed , and / or programmed to display bids for providing the requested services , as received from one or more of cloud - based platform 108 or subscribers 110 a , 110 b , . . . , 110 n . more particularly , bids responding to the solicitation from client application 106 via client device 104 may be filtered at cloud - based platform 108 ; subsequently , bids determined to meet or substantially meet the conditions set forth in the solicitation may be transmitted to client device 104 and displayed to user 102 via ui 202 corresponding to client application 106 . such communications may be facilitated by communication link 112 . alternatively , in a peer - to - peer network environment , client device 104 may receive solicited bids directly from one or more of subscribers 110 a and 110 b , which may then be displayed to user 102 via ui 202 corresponding to client application 106 . such communications may be facilitated by either of communication links 116 a and 116 b , with regard to the respective ones of subscribers 110 a and 110 b . ui 202 may further be configured , designed , and / or programmed to display data , information , and / or media files , received in accordance with the aforementioned bidding process from one or more of cloud - based platform 108 or subscribers 110 a , 110 b , . . . , 110 n . more particularly , after a bid from one or more of subscribers 110 a , 110 b , . . . , 110 b has been selected by user 102 or client application 106 to provide the requested service , the winning bidder may submit the requested data , information , and / or media files to cloud - based platform 108 . such communications may be facilitated by any of communication links 114 a , 114 b , . . . , 114 n , with regard to respective ones of subscribers 110 a , 110 b , . . . , 110 n . subsequently , at least previews of the submitted data , information , and / or media files may be transmitted from cloud - based server 108 to client device 104 and displayed to user via ui 202 corresponding to client application 106 . such communications may be facilitated by communication link 112 . alternatively , in a peer - to - peer network environment , client device 104 may receive at least previews of the requested data , information , and / or media files directly from one or more of subscribers 110 a and 110 b , which may then be displayed to user 102 via ui 202 corresponding to client application 106 . such communications may be facilitated by either of communication links 116 a and 116 b , with regard to the respective ones of subscribers 110 a and 110 b . as referenced above , the previews of the requested data , information , and / or media files may include portions of written text , thumbnails of photos , video screenshots , portions of an audio , etc . ui 202 may be still further configured , designed , and / or programmed to enter , for transmission to one or more of cloud - based platform 108 or subscribers 110 a , 110 b , . . . , 110 n , a rating of services provided by the winning bidder who has provided the requested data , information , and / or video files . the ratings may also be stored locally on client device 104 for future use by client application 106 . among multiple purposes , the ratings may be utilized by a filtering component on cloud - based platform 108 or by queuing component on client application 106 to filter future bids from any currently participating bidder . ui 202 may be configured , designed , and / or programmed as a software module that resides , at least in part , in a memory of client device 104 and which may be executed by one or more processors on client device 104 . transmitting component 204 may refer to an outbound communication component of client application 106 . transmitting component 204 may be configured , designed , and / or programmed to transmit to cloud - based platform 108 one or more solicitations for competing bids for the requested services from one or more of subscribers 110 a , 110 b , . . . , 110 n based on the input conditions from user 102 via ui 202 . more particularly , the transmission of the solicitation for competing bids may be submitted to cloud - based platform 108 from client application 106 , via client device 104 facilitated by communication link 112 . alternatively , in a peer - to - peer network environment , the transmission of the solicitation for bids may be transmitted directly to one or more of subscribers 110 a and 110 b facilitated by either of communication links 116 a and 116 n , with regard to the respective ones of subscribers 110 a and 110 b . transmitting component 204 may be configured , designed , and / or programmed as a software module that resides , at least in part , in the memory of client device 104 and which may be executed by one or more processors on client device 104 . queuing component 206 may refer to an interface component of client application 106 that interacts and interfaces with a storage component of client device 104 . accordingly , queuing component 206 may be configured , designed , and / or programmed as a software module that resides , at least in part , in a memory of client device 104 and which may be executed by one or more processors on client device 104 . in particular , queuing component 206 may be configured , designed , and / or programmed to store bids from bidders in response to a solicitation for bids for a requested service . the bids may be received from cloud - based platform 108 , via communication link 112 . alternatively , in a peer - to - peer networking environment , the bids may be received from one or more of subscribers 110 a and 110 b , via either of communication links 116 a and 116 b , with regard to the respective one of subscribers 110 a and 110 b . further , in at least one alternative embodiment , bids received at cloud - based platform 108 may be relayed directly to receiving component 208 , and filtering of the received bids may executed by queuing component 206 or some other component corresponding to client device 104 or client application 106 that is configured , designed , and / or programmed for that purpose . alternatively , in a peer - to - peer networking environment , receiving component 208 may receive bids from one or both of subscribers 110 a and 110 b and , in accordance with at least some embodiments , filtering of the received bids may executed by queuing component 206 or some other component corresponding to client device 104 or client application 106 that is configured , designed , and / or programmed for that purpose . receiving component 208 may refer to an inbound communication component of client application 106 . receiving component 208 may be configured , designed , and / or programmed to receive bids in response to a solicitation of bids for a requested service , from either of cloud - based platform 108 and either of subscribers 110 a and 110 bi and may be further configured , designed , and / or programmed to receive at least a preview of the requested data , information , and / or media files as one or more manifestations of the requested service , again , from either of cloud - based platform 108 and either of subscribers 110 a and 110 b . more particularly , receiving component 208 may receive , from cloud - based platform 108 , bids from one or more of subscribers 110 a , 110 b , . . . , 110 n that have been filtered in accordance with one or more of , e . g ., the respective bids &# 39 ; compliance with the conditions , preferences , or settings of the bid solicitation , the respective bids &# 39 ; competitiveness with each other relative to the conditions of the bid solicitation , ratings of the users respectively associated with subscribers 110 a , 110 b , . . . , 110 n based on past transactions with user 102 or other users that are subscribed to the service hosted by cloud - based platform 108 . further , receiving component 208 may receive , from cloud - based platform 108 , manifestations of the requested service in the form of , e . g ., data , information , and / or media files . however , to preserve the integrity of the transactional nature implemented by on - demand information network 100 , cloud - based platform 108 may transmit previews of the requested services in the form of portions of written text , thumbnails of photos , video screenshots , portions of an audio , etc . alternatively , in a peer - to - peer networking environment , receiving component 208 may receive , directly from at least one of subscribers 110 a and 110 b , the aforementioned previews of the manifestations of the requested services . receiving component may be configured , designed , and / or programmed as a software module that resides , at least in part , in a memory of client device 104 and which may be executed by one or more processors on client device 104 . thus , fig2 shows an example configuration of client application 106 , an instance of which is hosted on client device 104 , for which one or more embodiments of an on - demand information network may be implemented . fig3 shows an example configuration 300 of a cloud - based platform 108 relative to an on - demand information network , arranged in accordance with at least some embodiments described herein . as depicted , an example configuration of cloud - based platform 108 , hosted on server 305 , includes a filtering component 302 , a transceiving component 304 , and a transactional component 306 . in fig3 , cloud - based platform 108 hosted on server 305 is depicted relative to client device application 106 hosted on client device 104 as well as subscribing devices 110 a , 110 b , . . . , 110 n , as in fig1 ; however , this configuration is an example only , and is not intended to be limiting in any manner . cloud - based platform 108 , as described with reference to fig1 , may be regarded as a cloud - based storage and dissemination platform that may include a framework of hardware , software , firmware , or any combination thereof , to which digital data and information , including media files , may be stored or from which they may be shared . further , cloud - based platform 108 may be implemented by a third - party service provider for realizing a bidding process for the exchange of real - time information . cloud - based platform 108 may receive , from client application 106 via client device 104 , conditions , preferences or settings entered by user 102 for soliciting competing bids from multiple ones of subscribers 110 a , 110 b , . . . , 110 n for a requested service . the conditions for the solicitation of bids for the requested services may include , as non - limiting examples , a requested form of data , information , and / or media files ; a location in which to capture the data , information , and / or media files ; a time frame in which to capture the data , information , and / or media files ; other forms of context for the requested data , information , and / or media files ; a price range willing to be paid for the requested data , information , and / or media files ; a time frame within which the solicited bids will be accepted , etc . the reception of such data by cloud - based platform 108 may be facilitated by communication link 112 . filtering component 302 may refer to a component of cloud - based platform 108 that is configured , designed , and / or programmed to filter the respective bids &# 39 ; compliance with the conditions , preferences , or settings of the solicitation of bids ; the respective bids &# 39 ; relative competitiveness relative to the conditions , preferences , or settings of the solicitation of bids ; or ratings of the users respectively associated with subscribers 110 a , 110 b , . . . , 110 n based on past transactions with user 102 or any other user subscribed to the service hosted by cloud - based platform 108 . filtering component 302 may be configured , designed , and / or programmed as a software module that resides , at least in part , a memory of server 305 and which may be executed by one or more processors on server 305 . transceiving component 304 may refer to an inbound and outbound communication component of cloud - based platform 108 . transceiving component 304 may be configured , designed , and / or programmed to receive , from client application 106 via client device 104 , conditions , preferences , and / or settings for soliciting competing bids from multiples ones of subscribers 110 a , 110 b , . . . , 110 n . this reception of data may be facilitated by communication link 112 . further , transceiving component 304 may disseminate the solicitation of bids to one or more of subscribers 110 a , 110 b , . . . , 110 n ; and , in response , transceiving component 304 may receive , from one or more of the aforementioned subscribers , at least a preview of data , information , and / or media files as manifestations of the requested service from either of cloud - based platform 108 and any of subscribers 110 a , 110 b , . . . , 110 n . such communications may be facilitated by any one of communication links 114 a , 114 b , . . . , 114 n , with regard to the respective ones of subscribers 110 a , 110 b , . . . , 110 n . transceiving component 304 may be configured , designed , and / or programmed as a software module that resides , at least in part , on the memory of server 305 and which may be executed by one or more processors on server 305 . transactional component 306 may refer to a payment facilitating component of cloud - based platform 108 . transactional component 306 may be configured , designed , and / or programmed to implement payment to an appropriate one of subscribers 110 a , 110 b , . . . , 110 n that has provided an accepted bid and an accepted manifestation of at least previews the requested services to client application 106 via client device 104 . approval of the manifestation of the requested services may be communicated to transactional component 306 via communication link 112 ; and approval of payment , which may include providing direct payment or authorization for payment to a third - party payment service , may be communicated via any one of communication links 114 a , 114 b , . . . , 114 n , with regard to a respective one of subscribers 110 a , 110 b , . . . , 110 n . transactional component 306 may be implemented as a software module that resides , at least in part , on the memory of server 305 and which may be executed by one or more processors on server 305 . thus , fig3 shows an example configuration of meter 106 through which one or more embodiments of smart appliance registration may be implemented . fig4 shows an example configuration of a processing flow 400 of operations implemented by a client device application relative to an on - demand information network , in accordance with at least some embodiments described herein . processing flow 400 includes sub - processes executed by various components that are part of client device application 106 hosted on client device 104 . however , processing flow 400 is not limited to such components , as obvious modifications may be made by re - ordering two or more of the sub - processes described here , eliminating at least one of the sub - processes , adding further sub - processes , substituting components , or even having various components assuming sub - processing roles accorded to other components in the following description . processing flow 400 may include various operations , functions , or actions as illustrated by one or more of blocks 402 , 404 , 406 , 408 , and / or 410 . processing may begin at block 402 . block 402 ( submit settings for bid solicitation ) may refer to transmitting component 204 , in coordination with cloud - based platform 108 , submitting or configuring conditions , preferences , or settings entered by user 102 for soliciting competing bids from multiple ones of subscribers 110 a , 110 b , . . . , 110 n for a requested service . the conditions for the solicitation of bids for the requested services may include , as non - limiting examples , a requested form of data , information , and / or media files ; a location in which to capture the data , information , and / or media files ; a time frame in which to capture the data , information , and / or media files ; other forms of context for the requested data , information , and / or media files ; a price range willing to be paid for the requested data , information , and / or media files ; a time frame within which the solicited bids will be accepted , etc . such communication may be facilitated by communication link 112 . processing may continue from block 402 to block 404 . block 404 ( submit financial terms for bid solicitation ) may refer to transmitting component 204 , in coordination with cloud - based platform 108 , submitting or configuring financial parameters for a bid to be deemed successful , in response to the aforementioned solicitation of bids , by any one of subscribers 110 a , 110 b , . . . , 110 n for the requested service . operations associated with block 404 may be combined with those of block 402 , although implementation of either may be a matter of customization or preference in accordance with settings of client application 106 . such communication may be facilitated by communication link 112 . processing may continue from block 404 to block 406 . block 406 ( filter through received bids ) may refer to receiving component 208 receiving received bids that have been filtered at cloud - based platform 108 ; alternatively , in a peer - to - peer networking environment , block 406 may refer to receiving component 208 receiving bids directly from one or both of subscribers 110 a and 110 b and filtering those received bids locally . in at least one embodiment , upon the dissemination of the solicitation of bids from cloud - based platform 108 , one or more of subscribers 110 a , 110 b , . . . , 110 n may submit bids back to cloud - based platform 108 . such communication may be facilitated by one or more of communication links 114 a , 114 b , . . . , 114 n with regard to a respective one of subscribers 110 a , 110 b , . . . , 110 n . accordingly , filtering component 302 may filter the received bids in accordance with the conditions , preferences , or settings submitted with regard to block 402 . alternative embodiments may include filtering component 302 further filtering the received bids in accordance with ratings of the users respectively associated with subscribers 110 a , 110 b , . . . , 110 n based on past transactions with user 102 , client application 106 , or other users that are subscribed to the service hosted by cloud - based platform 108 . the filtering based on ratings may compliment filtering based on the conditions , preferences , or settings of the bid solicitation ; or the filtering based on ratings may replace filtering based on the conditions , preferences , or settings of the bid solicitation . such communication may be facilitated by communication link 112 . in at least one alternative embodiment , the bids received at cloud - based platform 108 may be relayed directly to client application 106 via client device 104 , and filtering of the received bids may executed by queuing component 206 or some other component corresponding to client device 104 or client application 106 in the same manner described above with regard to filtering component 302 . such communication may be facilitated by communication link 112 . alternatively , in a peer - to - peer networking environment , client application via client device 104 may receive bids from one or both of subscribers 110 a and 110 b and , filtering of the received bids may executed by queuing component 206 or some other component corresponding to client device 104 or client application 106 . such communication may be facilitated by one or more of communication links 116 a and 116 b , with regard to a respective one of subscribers 110 a and 110 b . processing may continue from block 406 to block 408 . block 408 ( order requested data from winning bidder ) may refer to transmitting component 204 transmitting a preference for one or more of subscribers 110 a , 110 b , . . . , 110 n that have been filtered as having best accommodated the conditions , preferences , or settings provided in the solicitation of bids . dissemination of the order to the winning or preferred bidder may be facilitated by one or more of communication links 114 a , 114 b , . . . , 114 n with regard to a respective one of subscribers 110 a , 110 b , . . . , 110 n . alternatively , in a peer - to - peer networking environment , the dissemination of the order to the winning or preferred bidder may facilitated by one or more of communication links 116 a and 116 b , with regard to a respective one of subscribers 110 a and 110 b . processing may continue from block 408 to block 410 . block 410 ( approve payment to winning bidder ) may refer to transmitting component 204 , in coordination with cloud - based platform 108 , communicating approval of the received manifestation of the requested services and approving payment therefore based on the financial terms set forth in the solicitation of bids . such communication may be facilitated by communication link 112 . alternatively , in a peer - to - peer networking environment , the acceptance of the received manifestation of the requested services may be facilitated by one or more of communication links 116 a and 116 b with regard to a respective one of subscriber 110 a and 110 b , though payment may be facilitated via a third - party payment service . thus , fig4 shows an example processing flow implemented by client application 106 , an instance of which is hosted on client device 104 , for implementing one or more embodiments of an on - demand information network . fig5 shows an example processing flow 500 of operations implemented by a cloud - based platform relative to an on - demand information network , in accordance with at least some embodiments described herein . processing flow 500 includes sub - processes executed by various components that are part of cloud - based platform 108 hosted on server 305 . however , processing flow 500 is not limited to such components , as obvious modifications may be made by re - ordering two or more of the sub - processes described here , eliminating at least one of the sub - processes , adding further sub - processes , substituting components , or even having various components assuming sub - processing roles accorded to other components in the following description . processing flow 500 may include various operations , functions , or actions as illustrated by one or more of blocks 502 , 504 , 506 , 508 , 510 , 512 , and / or 514 . processing may begin at block 502 . block 502 ( solicit bids ) may refer to transceiving component 304 disseminating a solicitation for bids to provide services requested by client application 106 via client device 104 to one or more of subscribers 110 a , 110 b , . . . , 110 n . such communication may be facilitated by one or more of communication links 114 a , 114 b , . . . , 114 n with regard to a respective one of subscribers 110 a , 110 b , . . . , 110 n . processing may continue from block 502 to block 504 . block 504 ( receive bids ) may refer to transceiving component 304 receiving the solicited bids from one or more of one or more of subscribers 110 a , 110 b , . . . , 110 n . such communication may be facilitated by one or more of communication links 114 a , 114 b , . . . , 114 n with regard to a respective one of subscribers 110 a , 110 b , . . . , 110 n . processing may continue from block 504 to block 506 . block 506 ( filter received bids ) may refer to filtering component 302 filtering through the received bids &# 39 ; compliance with the conditions , preferences , or settings of the solicitation of bids ; the respective bids &# 39 ; competitiveness relative to each other ; and / or ratings of the users respectively associated with subscribers 110 a , 110 b , . . . , 110 n based on past transactions with user 102 or other user subscribed to the service hosted by cloud - based platform 108 . in at least on alternative embodiment , though , cloud - based platform 108 may directly relay the received bids to client application 106 via client device 104 , facilitated by communication link 112 . in those alternative embodiments , block 506 may be bypassed . processing may continue from block 506 to block 508 . block 508 ( relay filtered bids to client ) may refer to transceiving component 304 transmitting the filtered bids to client application 106 via client device 104 , facilitated by communication link 112 . processing may continue from block 508 to block 510 . block 510 ( commission winning bids ) may refer to transceiving component 304 , upon receiving an appropriate communication from client application 106 via client device 104 , disseminating the order to the winning or preferred bidder , facilitated by one or more of communication links 114 a , 114 b , . . . , 114 n with regard to a respective one of subscribers 110 a , 110 b , . . . , 110 n . processing may continue from block 510 to block 512 . block 512 ( transmit preview ( s ) to client ) may refer to transceiving component 304 transmitting to client application 106 via client device 104 , facilitated by communication link 112 , at least previews of the requested data , information , and / or media files received from the one or more winning or preferred bidders . as referenced above , the previews of the requested data , information , and / or media files may include portions of written text , thumbnails of photos , video screenshots , portions of an audio , etc . processing may proceed from block 512 to block 514 . block 514 ( transmit approval / payment ) may refer to transactional component 306 , upon receiving approval from client application 106 via client device 104 , implementing payment to the winning or preferred bidder that has provided at least the preview of the manifestation of the requested services . approval of the manifestation of the requested services may be communicated to transactional component 306 via communication link 112 ; and approval of payment , which may include providing direct payment or authorization for payment to a third - party payment service , may be communicated via any one of communication links 114 a , 114 b , . . . , 114 n , in with regard to a respective one of subscribers 110 a , 110 b , . . . , 110 n . thus , fig5 shows an example processing flow implemented by cloud - based platform 108 for implementing one or more embodiments of an on - demand information network . fig6 shows a block diagram illustrating an example computing device 600 by which various example solutions described herein may be implemented , arranged in accordance with at least some embodiments described herein . more particularly , fig6 shows an illustrative computing embodiment , in which any of the processes and sub - processes described herein may be implemented as computer - readable instructions stored on a computer - readable medium . the computer - readable instructions may , for example , be executed by a processor of client device 104 , subscribers 110 a , 110 b , . . . , 110 n , or server 305 having a network element and / or any other computing device corresponding thereto , particularly as applicable to the applications and / or programs described above corresponding to the configuration 100 for implementing one or more embodiments of an on - demand information network . in a very basic configuration , a computing device 600 may typically include one or more processors 604 and a system memory 606 . a memory bus 608 may be used for communicating between processor 604 and system memory 606 . depending on the desired configuration , processor 604 may be of any type including but not limited to a microprocessor ( ฮผp ), a microcontroller ( ฮผc ), a digital signal processor ( dsp ), or any combination thereof . depending on the desired configuration , system memory 606 may be of any type including but not limited to volatile memory ( such as ram ), non - volatile memory ( such as rom , flash memory , etc .) or any combination thereof . system memory 606 may include an operating system 620 , one or more applications 622 , and program data 624 . application 622 may be configured to transmit or receive identification information pertaining to client device 104 , subscribers 110 a , 110 b , . . . , 110 n , or server 305 ; verify or validate such identifying data ; and transmit such information as described previously with respect to fig1 - 5 . program data 624 may include a table 650 , which may be useful for implementing actuation of appropriate components or modules as described herein . system memory 606 is an example of computer storage media . computer storage media may include , but not limited to , ram , rom , eeprom , flash memory or other memory technology , cd - rom , digital versatile disks ( dvd ) or other optical storage , magnetic cassettes , magnetic tape , magnetic disk storage or other magnetic storage devices , or any other medium which may be used to store the desired information and which may be accessed by computing device 600 . any such computer storage media may be part of computing device 600 . the network communication links 112 , 114 a , 114 b , . . . , 114 n , 116 a , and 116 b may be one example of a communication media . communication media may typically be embodied by computer readable instructions , data structures , program modules , or other data in a modulated data signal , such as a carrier wave or other transport mechanism , and may include any information delivery media . a โ modulated data signal โ may be a signal that has one or more of its characteristics set or changed in such a manner as to encode information in the signal . by way of example , and not limitation , communication media may include wired media such as a wired network or direct - wired connection , and wireless media such as acoustic , radio frequency ( rf ), microwave , infrared ( ir ) and other wireless media . the term computer readable media as used herein may include both storage media and communication media . there is little distinction left between hardware and software implementations of aspects of systems ; the use of hardware or software is generally ( but not always , in that in certain contexts the choice between hardware and software can become significant ) a design choice representing cost vs . efficiency tradeoffs . there are various vehicles by which processes and / or systems and / or other technologies described herein may be implemented , e . g ., hardware , software , and / or firmware , and that the preferred vehicle may vary with the context in which the processes and / or systems and / or other technologies are deployed . for example , if an implementer determines that speed and accuracy are paramount , the implementer may opt for a mainly hardware and / or firmware vehicle ; if flexibility is paramount , the implementer may opt for a mainly software implementation ; or , yet again alternatively , the implementer may opt for some combination of hardware , software , and / or firmware . the foregoing detailed description has set forth various embodiments of the devices and / or processes for system configuration 100 via the use of block diagrams , flowcharts , and / or examples . insofar as such block diagrams , flowcharts , and / or examples contain one or more functions and / or operations , it will be understood by those within the art that each function and / or operation within such block diagrams , flowcharts , or examples can be implemented , individually and / or collectively , by a wide range of hardware , software , firmware , or virtually any combination thereof . in one embodiment , several portions of the subject matter described herein may be implemented via application specific integrated circuits ( asics ), field programmable gate arrays ( fpgas ), digital signal processors ( dsps ), or other integrated formats . however , those skilled in the art will recognize that some aspects of the embodiments disclosed herein , in whole or in part , can be equivalently implemented in integrated circuits , as one or more computer programs running on one or more computers , e . g ., as one or more programs running on one or more computer systems , as one or more programs running on one or more processors , e . g ., as one or more programs running on one or more microprocessors , as firmware , or as virtually any combination thereof , and that designing the circuitry and / or writing the code for the software and or firmware would be well within the skill of one of skill in the art in light of this disclosure . in addition , those skilled in the art will appreciate that the mechanisms of the subject matter described herein are capable of being distributed as a program product in a variety of forms , and that an illustrative embodiment of the subject matter described herein applies regardless of the particular type of signal bearing medium used to actually carry out the distribution . examples of a signal bearing medium include , but are not limited to , the following : a recordable type medium such as a floppy disk , a hard disk drive , a cd , a dvd , a digital tape , a computer memory , etc . ; and a transmission type medium such as a digital and / or an analog communication medium ( e . g ., a fiber optic cable , a waveguide , a wired communications link , a wireless communication link , etc .). those skilled in the art will recognize that it is common within the art to describe devices and / or processes in the fashion set forth herein , and thereafter use engineering practices to integrate such described devices and / or processes into data processing systems . that is , at least a portion of the devices and / or processes described herein can be integrated into a data processing system via a reasonable amount of experimentation . those having skill in the art will recognize that a typical data processing system generally includes one or more of a system unit housing , a video display device , a memory such as volatile and non - volatile memory , processors such as microprocessors and digital signal processors , computational entities such as operating systems , drivers , graphical user interfaces , and applications programs , one or more interaction devices , such as a touch pad or screen , and / or control systems including feedback loops and control motors , e . g ., feedback for sensing position and / or velocity ; control motors for moving and / or adjusting components and / or quantities . a typical data processing system may be implemented utilizing any suitable commercially available components , such as those typically found in data computing / communication and / or network computing / communication systems . the herein described subject matter sometimes illustrates different components contained within , or connected with , different other components . it is to be understood that such depicted architectures are merely examples , and that in fact many other architectures can be implemented which achieve the same functionality . in a conceptual sense , any arrangement of components to achieve the same functionality is effectively โ associated โ such that the desired functionality is achieved . hence , any two components herein combined to achieve a particular functionality can be seen as โ associated with โ each other such that the desired functionality is achieved , irrespective of architectures or intermedial components . likewise , any two components so associated can also be viewed as being โ operably connected โ, or โ operably coupled โ, to each other to achieve the desired functionality , and any two components capable of being so associated can also be viewed as being โ operably couplable โ, to each other to achieve the desired functionality . specific examples of operably couplable include but are not limited to physically mateable and / or physically interacting components and / or wirelessly interactable and / or wirelessly interacting components and / or logically interacting and / or logically interactable components . lastly , with respect to the use of substantially any plural and / or singular terms herein , those having skill in the art can translate from the plural to the singular and / or from the singular to the plural as is appropriate to the context and / or application . the various singular / plural permutations may be expressly set forth herein for sake of clarity . it will be understood by those within the art that , in general , terms used herein , and especially in the appended claims , e . g ., bodies of the appended claims , are generally intended as โ open โ terms , e . g ., the term โ including โ should be interpreted as โ including but not limited to ,โ the term โ having โ should be interpreted as โ having at least ,โ the term โ includes โ should be interpreted as โ includes but is not limited to ,โ etc . it will be further understood by those within the art that if a specific number of an introduced claim recitation is intended , such an intent will be explicitly recited in the claim , and in the absence of such recitation no such intent is present . for example , as an aid to understanding , the following appended claims may contain usage of the introductory phrases โ at least one โ and โ one or more โ to introduce claim recitations . however , the use of such phrases should not be construed to imply that the introduction of a claim recitation by the indefinite articles โ a โ or โ an โ limits any particular claim containing such introduced claim recitation to embodiments containing only one such recitation , even when the same claim includes the introductory phrases โ one or more โ or โ at least one โ and indefinite articles such as โ a โ or โ an ,โ e . g ., โ a โ and / or โ an โ should be interpreted to mean โ at least one โ or โ one or more ;โ the same holds true for the use of definite articles used to introduce claim recitations . in addition , even if a specific number of an introduced claim recitation is explicitly recited , those skilled in the art will recognize that such recitation should be interpreted to mean at least the recited number , e . g ., the bare recitation of โ two recitations ,โ without other modifiers , means at least two recitations , or two or more recitations . furthermore , in those instances where a convention analogous to โ at least one of a , b , and c , etc .โ is used , in general such a construction is intended in the sense one having skill in the art would understand the convention , e . g ., โ a system having at least one of a , b , and c โ would include but not be limited to systems that have a alone , b alone , c alone , a and b together , a and c together , b and c together , and / or a , b , and c together , etc . in those instances where a convention analogous to โ at least one of a , b , or c , etc .โ is used , in general such a construction is intended in the sense one having skill in the art would understand the convention , e . g ., โ a system having at least one of a , b , or c โ would include but not be limited to systems that have a alone , b alone , c alone , a and b together , a and c together , b and c together , and / or a , b , and c together , etc . it will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms , whether in the description , claims , or drawings , should be understood to contemplate the possibilities of including one of the terms , either of the terms , or both terms . for example , the phrase โ a or b โ will be understood to include the possibilities of โ a โ or โ b โ or โ a and b .โ from the foregoing , it will be appreciated that various embodiments of the present disclosure have been described herein for purposes of illustration , and that various modifications may be made without departing from the scope and spirit of the present disclosure . accordingly , the various embodiments disclosed herein are not intended to be limiting , with the true scope and spirit being indicated by the following claims . | 7 |
my novel pipe grasping apparatus 20 , and my method for laying pipe sections , can easily be appreciated by review of fig1 . a lifting device 22 ( such as boom 24 and bucket 26 of a back hoe , as shown , or other convenient mobile equipment such as a track hoe ), used to suspend my pipe grasping apparatus 20 therefrom . suspension may be accomplished by convenient cables 28 or alternate devices such as hooks and chains 28 &# 39 ; ( see fig1 below ). in any event , a first frame f 1 of apparatus 20 is joined in a secure , stable , suspended working arrangement to lifting device 22 . also , the lifting device 22 is used to safely locate utility lines running to the grasping apparatus 20 , namely ( a ) a high pressure hydraulic fluid supply line 32 , ( b ) a low pressure hydraulic fluid return line 34 , and ( c ) an electrical power supply cable 36 . ideally , fluid hydraulic power is supplied in a conventional fashion by a high pressure pump ( not shown ) in or near the selected lifting device 20 or other selected mobile construction equipment . a control power cable 38 runs from grasping apparatus 20 to a hand held remote controller device 40 , which is held by workman 42 . the workman 42 stands on the ground 44 safely above grade level 46 , rather than at the bottom 48 of trench 50 . the lifting device 22 positions the grasping apparatus 20 to a preselected location in the trench 50 , i . e ., to a position with respect to the vertical or z axis , to a position with respect to the transverse or y axis , and position with respect to the longitudinal or x axis of the trench 50 , all as may be better identified with use of the key shown in fig1 a . ideally , the grasping apparatus 20 is moved to a preselected location where a pipe section 52 being grasped is fittingly close ( with respect longitudinal or x direction movement provided by grasping apparatus 20 , further described hereinbelow ) to an existing final pipe section 54 of a pipeline under construction . once in a preselected location , the lower or second frame 60 is translated longitudinally rearward in the direction of reference numeral 62 , so that the male end 64 of pipe section 52 may be inserted into female end 66 of pipe section 54 to be interfittingly positioned for sealing engagement therewith . during this interfitting process , the upper or first frame f 1 of grasping apparatus 20 is preferably maintained in a stable , stationary position . after pipe section 52 has been fitted up to pipe section 54 , the pipe grapplers 68a and 68b are disengaged from pipe section 52 , and the entire grasping apparatus 20 may be raised by lifting device 22 out of the trench 50 . then , a new pipe section 52 &# 39 ; ( see fig1 below ) can be straddled ( similar to the position indicated in fig1 below , but generally not in a trench ) and then closed to engage and securely grasp a new pipe section 52 &# 39 ;. as again can be appreciated from perusal of fig1 the obvious advantage of using my pipe grasping apparatus is that the laying and joining of pipe sections one to the other no longer requires that workmen 40 be located in a trench 50 . attention is now directed to fig2 where a partial exploded perspective view of my novel pipe grasping apparatus 20 is illustrated . first frame f 1 is rotatingly mounted from a first intermediate frame i 1 via use of bolts or other fasteners 70 of appropriate strength to securely engage rotatable rim portion 72 of gear 74 . i have found it advantageous to use a rotec type gear for gear 74 . the rotec brand gear 74 or equivalent preferably uses a combination radial and thrust bearing which enables substantial loads to be suspended between the rim portion 72 and inner ring 73 . gear 74 is affixed to the first intermediate frame i 1 and is driven by a pinion 76 that is preferably powered by a hydraulic motor 78 ( see fig3 b below ). thus , the first intermediate frame i 1 is angularly adjustable with respect to the first frame f 1 about a normally vertical axis of rotation z ( see reference numeral 79 in fig2 a ). as can be seen in fig9 below , the gear 74 provides angular rotation up to about 135 ยฐ in either direction from the resting or aligned position between first frame f 1 and first intermediate frame i 1 . the gear 74 , fasteners 70 , and similar fasteners 80 affixing the gear 74 to first interconnecting frame i 1 must be selected of sufficient strength to carry the load of a desired pipe section , as well as an appreciable portion of the weight of grasping apparatus 20 . a second intermediate frame i 2 is pivotally mounted between the first intermediate frame i 1 and the second frame f 2 in a manner which allows a pitching action ( see reference numeral 81 in fig2 a ) to be imparted therebetween . finally , the second frame f 2 is slidingly mounted to the second intermediate frame i 2 in a fashion which allows the second frame f 2 to be displaced linearly along the x - axis as depicted in the reference key shown in fig2 a . side shields , including left shield 82 , right shield 84 , front shield 86 , and back shield 87 are provided in flexible , wear resistant material in order to protect the grasping apparatus 20 from damage due to abrasive or interfering action of gravel particles which may be placed in the trench 50 to backfill under or along side of a pipeline being constructed . preferably , such shields 82 , 84 , 86 , and 87 are provided in a flexible , thick , rubber or plastic pad material in a generally parallelepiped shape . each of shields 82 , 84 , 86 , and 87 are affixed to their respective side of the first intermediate frame i 1 via a row of fasteners 88 . for grasping elongated objects such as pipe sections , grapplers 68a and 68b are provided . grapplers 68a and 68b are provided pivotally mounted at pivot pins p from second frame f 2 in opposing juxtaposition . grapplers 68a and 68b should extend below second frame f 2 a sufficient distance to preferably enable an elongated gripping portion 90a and 90b of grapplers 68a and 68b , respectively , to extend somewhat below the centerline of a selected pipe section which is to be grasped . see , for example , c 1 &# 39 ; in fig1 below . as a result , grapplers 68a and 68b can be moved in an arcuate , inward - outward , somewhat clam - shell type motion to grasp a selected pipe section . as seen in fig1 and fig2 for securely positioning a selected pipe section 52 &# 39 ;, positioning pads 92 are extend downward from the front end 94 of second frame f 2 of grasping apparatus 20 , and positioning pads 96 extend downward from the rear end 98 of second frame f 2 of grasping apparatus 20 . preferably , each of positioning pads 92 and 96 are adjustably secured via stop shaft 100 and locking pin 102 in a slidably interfitting tubular adjustment mechanism 104 . most preferably , a plurality of stop apertures 106 in a first member 108 of slidably interfitting tubular adjustment mechanism 104 are adapted to receive stop shafts 100 ; a locking aperture 110 in the complementary portion 112 of slidably interfitting tubular adjustment mechanism 104 allows the positioning pads 92 to be securely locked in place a desired distance d below the bottom 114 of second frame f 2 . turning now to fig3 a , 3b , 3c , and 3d , further structural details of my pipe grasping apparatus 20 will be described . in fig3 a , first frame f 1 is shown . a bottom plate 120 is provided , as well as right 122 and left side 124 longitudinal stiffeners . also , front 126 and rear 128 transverse stiffeners are provided . each of the bottom plate 120 and stiffeners 122 , 124 , 126 , and 128 are provided in sufficient thickness t ( see t 122 for thickness of longitudinal stiffener 122 , for example ) to enable a welded or otherwise assembled final frame f 1 to have sufficient strength to suspend therefrom the operating weight of grasping apparatus 20 and a selected pipe section , plus ample safety margin . housing 130 is provided for gear 74 and pinion 76 . housing 130 is mounted on base plate 132 , which is in turn affixed , preferably by welding , to first intermediate frame f 1 , as may be better appreciated in fig4 . returning to fig3 b , the first intermediate frame f 1 also has protective front end plate 136 and a protective rear end plate 138 , useful for keeping gravel and other debris out of the device , and particularly away from actuators as further described below . plates 136 and 138 , in cooperation with base plate 132 , preferably cover any apertures formed by the left 140 and right 142 longitudinal members and the front 144 and back 146 transverse members of the first intermediate frame i 1 . an attachment point such as the pair of ears 150 extends rearwardly from the front 144 of first intermediate frame f 1 for pivotal attachment of a first end 152 of a pitching actuator 154 , as seen in fig3 c . a complementary attachment point such as the pair of ears 156 on the front member 158 of second intermediate frame i 2 provides the means for pivotal attachment of a second end 160 of pitching actuator 154 . a downwardly extending left 162 and right 164 lug on first intermediate frame i 1 ( see fig3 b ) cooperate with upwardly extending left 166 and right 168 lugs on second intermediate frame i 2 ( see fig3 c ) and pivot pins 170 and 172 ( see fig1 ) to allow pivotal motion between frames i 1 and i 2 when directed by pivot actuator 154 . returning now to fig3 c , the second intermediate frame i 2 is illustrated . left 174 and right 176 longitudinal members , and front 158 and back 178 transverse members form frame i 2 . left side slide mount members 180 , 182 , and 184 accept and secure therein a generally cylindrical slide member 186 . right side slide mount members 188 , 190 , and 192 accept and secure therein elongate , preferably cylindrical slide members 194 and 196 , respectively . left side slide housing members 200 and 202 , and right side slide housing members 204 and 206 on the second frame f 2 are adapted to cooperate with slide members 194 and 196 ( see fig3 d and fig4 ) to allow sliding displacement of frame f 2 with respect to frame i 2 , as directed by slide actuator 210 . preferably , slide actuator 210 is pivotally connected to frame i 2 , at a first end 212 , at ear 214 on frame i 2 . slide actuator 210 is pivotally connected to frame f 2 at ear 218 , at a second end 216 . this arrangement allows linear translation along an x axis between frame i 2 and f 2 , as can be appreciated by comparison of fig7 and 8 . returning to fig3 d , second frame f 2 is shown with grapplers 68a and 68b in exploded perspective . second frame f 2 has left 220 and right 222 longitudinal members , and front 224 and back 226 transverse members . a vertical transverse stiffening plate 228 and a horizontal transverse stiffening plate 230 are provided to add strength . preferably a longitudinal stiffening plate 232 , connecting front 224 and vertical transverse stiffening place 228 , is used as a base from which to mount a vibrator 240 . grappler 68a is pivotally mounted from second frame f 2 at downwardly extending ears 242 and 244 via pivot pins p , which provide a centerline about which grappler 68a pivots , c p . similarly , grappler 68b is pivotally mounted from second frame f 2 at downwardly extending ears 246 and 248 via pivot pins p , which provide a centerline about which grappler 68b pivots . grappler 68a is actuated by grappler actuator 250a , which is pivotally mounted ( a ) at first end 252 at lug 254 on frame f 2 , and ( b ) second end 256 at lever arm 258 on grappler 68a . grappler 68b is actuated by grappler actuator 250b , which is pivotally mounted ( a ) at first end 260 at lug 262 on frame f 2 , and ( b ) second end 264 at lever arm 268 on grappler 68b . the various figures will now be used to further explain operation of my novel pipe grasping apparatus 20 . as first seen in fig1 an operator 42 may utilize remote control unit 40 to control the grasping apparatus 20 . the remote control unit 40 has a handle 300 and a switching head 310 which contains control switches , as well as an indicating light 312 . to start , power switch 314 is turned from the &# 34 ; off &# 34 ; position to the &# 34 ; on &# 34 ; position . when the unit is on , the indicating light 312 should be illuminated . to start the pipe laying process , the clamp switch 316 is moved to the &# 34 ; open &# 34 ; position where the grasping apparatus is moved , and then lowered to straddle a preselected pipe section which is desired to be moved . fig1 illustrates this concept , although normally the pipe section 52 &# 39 ; to be moved will be located above grade , rather than in a trench 50 . however , my grasping apparatus 20 is equally capable of removing pipe from a trench , and in any event , the process will be well understood by those of ordinary skill in the art and to which this disclosure is addressed by use of fig1 and fig1 for example . in fig1 , in solid lines , grapplers 68a and 68b are shown in the open position , straddling pipe 52 &# 39 ;. next , grapplers 68a and 68b are moved to their closed position , representationally shown in the broken lines 68a &# 39 ; and 68b &# 39 ; in fig1 , but with the understanding that in a fully closed position , elongate clamping surfaces 90a &# 39 ; and 90b &# 39 ; would be tightly against pipe 52 &# 39 ;. the movement of grapplers 68a and 68b from the open to the closed position is accomplished by moving the clamp switch 216 to the closed position and maintaining it in that position until a sufficient degree of clamping force is imparted against pipe 52 &# 39 ; so that grapplers 68a and 68b engage and securely grasp the pipe section 52 &# 39 ;. once a pipe 52 &# 39 ; has been securely grasped , the lifting device 22 is used to move my pipe grasping device to an selected position , such as that shown in fig1 . to accommodate the slope of trench 50 ( i . e ., the change in z direction as a function of the x direction ), the pipe section 52 as shown in fig1 can be pitched ( tilted ), so that the pipe pitches in a desired direction , by manipulating the tilt control 320 in an &# 34 ; up &# 34 ; or &# 34 ; down &# 34 ; direction . the range of action thus provided is noted in fig5 and fig6 where it can be seen that the pitch motion is achieved between the position of intermediate frames i 1 and i 2 . preferably , either the front end or the back end of grasping apparatus 20 can move up to an angle alpha 1 ( ฮฑ 1 ), or alpha 2 , ( ฮฑ 2 ) of about 4 . 5 degrees from the horizontal position , with the configuration illustrated . other somewhat different ranges of motion can easily be provided using the concept taught herein . as depicted in fig9 in order to align the a pipe section such as 52 or 52 &# 39 ; along a pipeline run centerline ( see fig1 for example ) the second frame f 2 of pipe grasping apparatus 20 can be rotated ( yaw motion ) in either direction from its normal x - axis centerline around a normally vertical axis z by an angle beta ( ฮฒ ) of approximately one hundred thirty five ( 135 ) degrees , to a location 20 &# 39 ; or 20 &# 34 ;. this is accomplished by manipulating the rotate switch 348 in the &# 34 ; ccw &# 34 ; or counterclockwise direction , or &# 34 ; cw &# 34 ; in the clockwise direction . also evident in fig9 is the location of hydraulic controllers 350 , 352 , 354 , and 356 which are utilized in conventional fashion for regulating the flow of high pressure hydraulic fluid to and from the various actuators , namely pitch actuator 154 , linear actuator 210 , and grapple actuators 250a and 250b . also , high pressure fluid flow is controlled to hydraulic drive 78 for pinion gear 76 , and to the hydraulic motor on vibrator 240 . next , to slide a male end 64 of a pipe section 52 into the female end 66 of a prior pipe section for sealing engagement therewith , as shown in fig1 the slide switch 360 is moved to the &# 34 ; in &# 34 ; position , until sufficient distance has been traversed along the x axis , or centerline of the pipe run . to complete installation of pipe 52 , gravel 370 may be dumped around pipe 52 &# 39 ; as depicted in fig1 , to backfill the trench 50 . ideally , the pipe 52 prime will be secured by grasping apparatus 20 while vibrator 240 is turned on at switch 362 for energizing the hydraulic vibrator to settle gravel 370 , so that the pipe section can be set securely at position 52 &# 34 ;, rather than at the uncompacted position 52 &# 39 ;, as seen in fig1 . finally , referring first to fig1 , for purposes of comparison of the present invention to apparatus and methods heretofore utilized , a prior art method and apparatus commonly used for placement of pipe is shown . specifically , a trench box apparatus 400 is provided to straddle a working zone in a trench 402 . pipe 404 is placed at the trench bottom 406 , and workers are placed into the trench between the trench box walls to physically move pipe 404 , or to guide the use of machinery with respect thereto . necessary trench box cross braces 408 will usually complicate the setting of elongated objects such as pipe 404 . trench boxes are usually long and heavy devices , and those familiar with the same and to whom this specification is addressed will thus appreciate the advance provided by the present invention in allowing a piping contractor to avoid the use of such trench boxes , where ground conditions permit . those skilled in the art will appreciate from the foregoing description that there has herein been disclosed an exemplary pipe grasping device which permits the simple and cost effective installation of pipe sections without the necessity of personnel getting into a trench . of course , those skilled in the art will appreciate that various modifications can be made to the exemplary grasping device and to the pipe installation method disclosed herein without departing from the spirit and scope of the invention as described herein . it will be understood that the present invention has herein been described in connection with &# 34 ; relative &# 34 ; movement between the workpiece pipe section being installed and the pipe grasping apparatus , and that in some instances the workpiece gear may be installed vertically , and consequently , the movement of the grasping device 20 required frame of reference will have to be shifted accordingly . also , the workpiece pipe section being installed may vary in weight , from lightweight plastic twenty ( 20 ) foot sewer pipe of about 375 pounds , to considerably heavier steel or iron pipes , by utilizing the same concept with heavier materials of construction , in which case the above described actions can by easily be conducted along workpiece sections of known length , with the same method to provide the results achieved by the approach described above . therefore , it will be understood that the foregoing description of representative embodiments of the invention have been presented only for purposes of illustration and description and for providing an understanding of the invention , and it is not intended to be exhaustive or restrictive , or to limit the invention to the precise forms disclosed . on the contrary , the intention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the invention as expressed in the appended claims . as such , the claims are intended to cover the structures described herein , and not only structural equivalents thereof , but also equivalent structures . thus , the scope of the invention , as indicated by the appended claims , is intended to include variations from the embodiments provided which are nevertheless described by the broad meaning and range properly afforded to the language of the claims , or to the equivalents thereof . | 5 |
the present invention is a pressure sensor which may be operated in a single port mode , or a differential ( two port ) mode for detecting a pressure difference . the invention may be used or adapted for any pressure measuring purpose , including oil or gas exploration , aerospace , or any known application requiring measurement of pressure . the invention has the additional advantage that series strings of sensors may be placed along a single fiber , and the responses may be individually and concurrently read using a wavelength interrogator , or the responses may be time division multiplexed ( tdm ) and read sequentially . fig3 shows a single - ended pressure transducer 300 according to the present invention . a pressure to be measured enters port 312 and into chamber 302 which is separated from a second chamber 304 optionally containing a reference pressure by a transducer substrate 308 which separates the two chambers . in the single ended case , a pressure to be measured is coupled into one of the chambers 302 with a reference pressure applied to the other chamber 304 opposite the substrate 308 . in the differential pressure sensing case , a first pressure and second pressure are provided to the chambers 302 and 304 on opposite sides of the substrate 308 . using the single - ended case of fig3 as an example , an increase of pressure causes a small deflection in substrate 308 . a wavelength interrogator 320 provides appropriate optical energies to first fiber 322 and second optical fiber 324 , then optical energies are reflected by a first fiber bragg grating located on first fiber 322 and also a second fiber bragg grating located on second fiber 324 , each fiber bragg grating on opposite surfaces of substrate 308 and located in region 310 . each fiber bragg grating is formed into the optical fiber over a finite extent known as a grating zone , or simply zone , here the grating zone is typically attached to the substrate &# 39 ; s measurement region as the grating zone has very high sensitivity to strain and translates that strain into a shift in reflected or transmitted wavelength . the first optical fiber 322 reflects a particular wavelength ฮป 1 back to wavelength interrogator 320 , and second optical fiber 324 similarly reflects a particular wavelength ฮป 2 back to interrogator 320 . the first and second fiber bragg gratings are positioned on opposite surfaces of a pressure substrate 308 , preferably over a region of maximum deflection , with the first grating and second grating positioned directly over and under each other , and oriented in the same direction . in this arrangement , the temperature coefficient of the first grating and second grating cause the reflected wavelengths of each grating to offset in the same direction , such that a similar directional offset in wavelength related to the temperature change occurs for both sensors . the fiber bragg gratings are attached to substrate 308 on opposite sides in any manner which minimizes hysteresis ( also known as deflection memory , or creep ). an optional temperature sensor ( shown as 812 of fig8 a , or 912 and 913 of fig9 a ) may be included in an unstressed zone of one or more of the fibers , or placed on a separate fiber , if desired , for a redundant temperature measurement . as will be described later , each of the sensors may have a transmission or reflection mode response which provides unique wavelength response regions , and provides for the estimation of both pressure and temperature . fig4 shows a detailed view of region 310 of fig3 . first fiber 322 is attached to one surface of substrate 308 , and second fiber 324 is attached to the opposite surface of substrate 308 and in the same region and grating orientation . first fiber bragg grating 402 is preferably placed over a centerline region 410 of the substrate , which is an area of maximum sensitivity , and second fiber bragg grating 404 is placed on the opposite surface and an equal distance from centerline 412 of the substrate 308 . the attachment of grating 402 and 404 to the substrate 308 may be achieved using any method which minimizes or eliminates hysteresis , and may include metallization of the exterior surface of the fibers 322 , 324 for subsequent metallic bonding to the substrate 308 using high temperature structural adhesives , or placing the fiber into a groove in the substrate 308 for mechanical attachment . any means of attachment of the grating zone of the fiber to the substrate which provides for coupling of the deflection of the substrate into a wavelength shift of the grating while minimizing creep would provide for satisfactory operation according to the objects of the invention . additionally , any prior art means for sealing the region 302 or 304 where fibers 322 and 324 penetrate enclosure 306 is required for satisfactory device operation . many such sealing techniques are available including a pressurized - side gasket fitting into a conical counterbore , where the seal is driven deeper into the conical counterbore surrounding the fiber by pressure in the enclosure 302 , and the sealed fiber exit port would be located in a region of the enclosure 306 which would not interfere with the operation of the substrate 308 . fig5 shows one embodiment of a separate sensor wavelength interrogator for use in the separate fiber sensor system of fig3 . during a first measurement interval of arbitrary time duration , a first broadband source src_ 1 504 is enabled with second broadband source src_ 2 502 disabled , and during the first measurement interval , src_ 1 couples optical energy through circulator 506 to the first fiber bragg grating strain sensor ( operative initially at ฮป 1 ), and narrowband reflected energy ( initially at ฮป 1 ) from the first sensor is coupled through circulator 506 to combiner 514 ( with no optical energy returned from circulator 508 as src_ 2 502 is not enabled during the interval that src_ 1 is enabled ), which couples optical energy into wavelength detector 515 which in one embodiment includes a splitter 516 and to a means for discriminating wavelength such as sine filter a 518 and sine filter b 520 , which are coupled to first detector det_a 522 and second detector det_b 524 , respectively . the output from the two detectors are fed to a pressure calculator 526 which computes the pressure from the amplitude responses ( the amplitudes presented to the detectors derived from the wavelength - dependent transfer function of the sine filter ), of the two detectors det_a 522 and det_b 524 . during a second measurement interval of arbitrary time duration following the first measurement interval , the first source src_ 1 504 is disabled and the second broadband source src_ 2 504 is enabled . during the second measurement interval , the second circulator 508 couples broadband optical energy to the second fiber bragg grating strain sensor ( operative initially at ฮป 2 ) through bidirectional port 512 , and narrowband optical energy ( initially at ฮป 2 ) reflected from the second sensor is coupled through circulator 508 , through combiner 514 , and to wavelength detector 515 , through splitter 516 , and to first sine filter 518 and second sine filter 520 , which generate optical outputs related to wavelength as will be described for fig6 , and the optical outputs of sine filters 518 and 520 are converted to an electrical signal by first detector 522 and second detector 524 , after which the electrical outputs of first and second detectors 522 and 524 are converted to a pressure measurement using pressure calculator 526 . the first time interval and second time interval are typically established from the time - of - flight interval for the reflected wavelength from the strain sensor fiber bragg grating to reach the interrogator , and for the detectors to respond thereafter . for a broadband source illuminating the fiber bragg gratings , it is possible for a wavelength interrogator separated from the measurement gratings by a 10 km fiber length , with an index of refraction of 1 . 48 for the fiber core ( resulting in a 97 us round - trip delay ), and a detector with a 2 us response , to therefore operate at a repetition rate of up to 10 , 000 unambiguous samples per second . in this manner , the repetition rate for any length of fiber and detector response time can be calculated . fig6 shows the characteristics of the first sine filter ( sine_a ) 604 ( of filter 518 of fig5 ) and second sine filter ( sine_b ) 606 ( of filter 520 of fig5 ), as well as the broadband source 602 ( of source 502 or 504 of fig5 ). a reflected optical signal from a fiber bragg grating sensor at a first wavelength ฮป 1 608 produces an output l 1 _deta at response point 612 with the first sine characteristic 604 and l 1 _detb 614 from the second sine characteristic 606 . an optical signal at a second wavelength ฮป 2 610 generates a first sine characteristic 604 output l 2 _deta 618 and second sine filter characteristic 606 output l 2 _detb 616 . fig1 shows a wavelength shift characteristics ( y axis ) of a fiber bragg grating having a strain applied ( x axis ). the wavelength shift is shown with reference to an unspecified starting wavelength associated with the unstressed fiber bragg grating after mounting into a surface such as the substrate 308 of fig4 . the relationship between wavelength shift and fiber bragg grating strain can be described as a linear equation , shown for fig1 as y = 0 . 7328x ( ignoring temperature effects for simplicity of illustration ). in a linear system , an increased pressure at port 312 of fig3 causes grating 404 of corresponding fig4 to stretch and grating 402 to compress . additionally , the two gratings are each responsive to a temperature , as expressed below : ideally , if the coefficient of temperature response k is matched between the two fibers such that k 1 = k 2 = k , and the coefficient of pressure response c is matched between the two fibers such that c 1 = c 2 = c , and first grating 402 has an unstressed or starting reflection wavelength of l 1 , and second grating 404 has an unstressed or starting reflection wavelength of l 2 , the system of equations which govern the system is : wherein the temperature dependence drops out . for a more typical case where k 1 โ k 2 and c 1 โ c 2 , the governing system of equations would be : p =({[ ฮป2 โ ฮป1 ]+[( k 1 โ k 2 )* t ]}+{ l 1 โ l 2 })/( c 2 + c 1 ) ( eq . 2 ) t =({[ ฮป2 โ ฮป1 ]โ[( c 1 + c 2 )* p ]}+{ l 1 โ l 2 })/( k 2 โ k 1 ) ( eq . 3 ) from the above relationships , it can be seen that the pressure and temperature can be derived from the two wavelength measurements , when coupled with independent constant temperature and constant pressure calibration profiles , respectively . in a preferred embodiment of the invention , the reflection wavelengths ฮป 1 and ฮป 2 are distinct and non - overlapping over the combinations of temperature and pressure , as shown in the x - axis of fig6 corresponding to a single cycle of sine filter response for uniqueness of y - axis response . this may be expressed as the following criteria : 1 ) ฮป 2 & gt ; ฮป 1 such that ( ฮป 2 โ ฮป 1 )=| ฮป 2 ฮป 1 | 2 ) ฮป 2 and ฮป 1 are always in non - overlapping ranges . there are several motivations for the best mode of non - overlapping ranges of wavelengths produced by the pair of fiber bragg gratings of a particular pressure transducer . one motivation is to provide a clear association between a particular response wavelength and a given sensor fbg , such that ฮป 1 and ฮป 2 are not indeterminate in the equations . another advantage of using separate wavelength response ranges is to prevent the โ shadowing โ of a downstream reflection - mode sensor or additive superposition of a downstream transmission - mode sensor , which would cause two sensors responses to appear as a single sensor response . while it is possible to operate the two sensors in overlapping ranges , a disadvantage is the inability of the wavelength discriminator to distinguish between a single sensor response caused by two separate sensors operating in the same wavelength and a failure in the fiber which interconnects the two fbg sensors , resulting in a single sensor reflection response . by tracking each sensor response for association to a particular sensor , and detection of same - wavelength sensor response , it is possible for the two sensors to operate in overlapping response ranges . fig7 shows a timing sequence diagram for the operation of the wavelength interrogator of fig5 . waveform 702 shows the sequence of first broadband source src_ 1 measurements during a first interval previously described interleaved with a second broadband source src_ 2 which is enabled during a second interval of time . each detector deta and detb generates part of the differential output which can be concurrently read and converted into a pair of values and converted thereafter by pressure calculator 526 into a pressure value 528 , such as the use of stored pre - deployment calibration data profiles which converts sensed pressure p as that of equations 1 or 2 into corrected pressure . fig8 a shows a single fiber pressure sensor having a pressure chamber 822 coupled to a pressure to be measured through aperture 824 which provides deflection of a substrate 814 having fiber bragg gratings applied on opposite sides in region 818 , as was shown for fig3 and 4 . the sensor of fig8 a has the top and bottom sensors tied together in series such that the two fiber bragg grating sensors are formed onto a single optical fiber 808 in conduit 806 which is also housing a support cable 804 tied to a support 802 on one end , and the pressure transducer enclosure 816 on the other end . the optical fiber 808 and support cable 804 may have any length , shown as 10 km , and the end of fiber 808 opposite to sensor region 818 is coupled at port 826 to a single fiber interrogator 800 . fig8 b shows an example embodiment of a single fiber interrogator 800 . a broadband source 852 , which may operate continuously , couples broadband optical power to circulator 850 , which couples broadband optical power to port 826 , and to the gratings in region 818 of fig8 a which reflect superimposed optical energy as ฮป 1 and ฮป 2 through circulator 850 and to filter 854 , which splits the wavelengths from each reflection grating into separate channels and provides each to wavelength detectors 515 a and 515 b which are each operative such as was described for 515 of fig5 , and which may operate according to the wavelength discrimination principles described in fig6 . the pressure calculator 864 which receives the detected wavelengths for each sensor may perform the pressure and temperature calculations based on equations 1 , 2 , or 3 , in combination with stored calibration data , or any other means for converting measured wavelengths into pressure and temperature . additional measurement channels may be added by placing additional sensors which are operative within unique wavelengths which also couple out of filter 854 and are coupled to additional wavelength detectors 515 c , 515 d , etc ( not shown ) operative at each unique wavelength to detect additional measurement phenomenon such as optional temperature sensor 812 of fig8 a . fig9 a shows a diagram for a double ended sensor , which may be operated in at least two configurations . a redundant configuration which protects against a fiber failure provides redundancy protection and is used with reflection gratings on opposite surfaces of substrate 914 in region 918 using the interrogator of fig9 b . an alternative use of the double ended sensor of fig9 a is a non - redundant configuration with transmission mode fiber bragg gratings on opposite substrate surfaces and located in region 918 and using the interrogator of fig9 c . for either mode of operation , the pressure transducer has a housing 916 with a sealed substrate 914 forming a pressure chamber coupled to a pressure source through aperture 924 , and the gratings are located in region 918 , as was described previously . fig9 b shows dual ended sensor interrogator 900 for redundancy operation , where the interrogator can recover from a break in one of the two optical fibers 908 and 909 which travel in the conduit 906 . broadband source 952 is coupled to either a first ( primary ) optical fiber 927 , or to a second ( secondary ) optical fiber 926 as selected by optical switch 970 . the first and second fibers of fig9 a are coupled to reflection mode fiber bragg gratings , which return optical energy at a first and second wavelength , respectively . the reflected optical energy is coupled through circulator 950 to wavelength filter 954 , which separates and delivers the response wavelengths to a first wavelength detector 515 a and second wavelength detector 515 b , which are coupled to pressure calculator 964 . wavelength detectors 515 a and 515 b also detect the absence of reflected optical energy from a first fiber 927 , such as from a fiber break , which causes optical switch 970 to deselect primary fiber 927 and select secondary fiber 926 for coupling to broadband source 952 and which also directs reflected optical energy through circulator 950 to filter 954 . as the order of the first grating or second grating along the fiber path does not affect the reflected optical energy , by virtue of their unique operating ranges , either the first optical fiber 927 , or second optical fiber 926 may be exclusively selected by optical switch 970 . fig9 c shows a double ended sensor interrogator operating with transmission fiber bragg gratings for use with the double ended sensor of fig9 a where gratings in region 918 are utilized in transmission mode with co - propagating fiber bragg grating wavelength signals . for this type of operation , a broadband optical source 982 is coupled to one of the optical fibers 927 , and the other optical fiber 926 contains a superposition of the wavelengths associated with the first and second gratings . as was described previously , the wavelength filter 972 separates them into two bands , which are resolved into particular wavelengths by wavelength detectors 515 a and 515 b , as was described previously , and fed to pressure calculator 984 to generate computed pressure 986 . in another embodiment shown in fig1 , a plurality of n pressure transducers 1004 , 1006 , . . . , 1008 , each functioning as previously described for fig3 and 4 , may be placed in a series configuration , with each pressure transducer generating respective optical responses ฮป 1 a and ฮป 1 b of sensor 1004 , ฮป 2 a and ฮป 2 b of sensor 1006 , and ฮปna and ฮปnb of sensor 1004 . filter 1020 separates the wavelength pairs associated with each particular pressure transducer , and applies this to a respective pressure / temperature computer 1010 , 1012 , and 1014 , each of which computes the pressure for a particular transducer . in this manner , the wavelengths of each of the pressure transducers are received by a single wavelength interrogator 1002 which separates the wavelengths associated with each sensor 1004 , 1006 , 1008 and computes for each pressure transducer a respective pressure and temperature measurement . the wavelength interrogator of fig1 shows the use of reflection fiber bragg gratings with a multi - channel interrogator , and it is possible to combine the series transducer configuration of fig1 with the double - ended multi - channel interrogator of fig9 b modified to provide multi - channel response by replacing the filter 954 and successive components of fig9 b with the filter 1020 and successive components of fig1 . in another embodiment , a plurality of pressure transducers are connected in series , with each pressure transducer having a pair of transmission fiber bragg gratings . the optical fibers on opposite ends of the series string of transducers can be coupled to a modified multi - channel sensor of fig9 c , where the filter 972 is replaced by the filter 1020 and following components , each of which is coupled to a pressure / transducer computer for each respective pressure transducer 1004 , 1006 , 1008 operative using transmission fiber bragg gratings . the examples provided herein are for illustration only , and are not intended to limit the invention to only the particular embodiments used for explanation . | 6 |
fig1 to which reference should now be made , illustrates a transmitter portion of a communications system that includes a radio transmitter 1 for transmitting data via an antenna 3 . the communication signal that is transmitted by the antenna 3 is provided by a transmit signal processor 5 which obtains , in the preferred embodiment , an audio signal from an input transducer such as a microphone 7 and applies the signal to a first gain control amplifier 9 and an amplitude assessor 11 . the audio signal that is applied to the amplitude assessor 11 as well as the first gain control amplifier 9 may be represented by the specturm waveform 21 . the amplitude assessor develops a control signal which is logarithmetically proportional to the amplitude of the audio input signal provided by the transducer 7 and includes a diode 13 , an lc filter circuit 15 and a logarithmic amplifier 17 . the control signal that is provided by the amplitude assessor 11 is applied to the first gain control amplifier 9 to vary the gain such that the output of the first gain control amplifier 9 is essentially a constant level signal which in the preferred embodiment is of the audio range and is represented in fig1 by the spectrum waveform 23 . the output of the amplitude assessor 11 is also applied to a first voltage - controlled oscillator 25 and a second voltage - controlled oscillator 27 . the control signal varies the frequencies of the first voltage - controlled oscillator 25 and the second voltage - controlled oscillator 27 in proportion to the logarithm of the input signal amplitude . in the preferred embodiment , the output frequency ( f1 ) of the first voltage - controlled oscillator 25 decreases with increasing amplitude of the communication signal that is provided by the input transducer 7 . also , in the preferred embodiment , f1 is equal of 1500 hz and f2 , the output frequency of the voltage - controlled oscillator 27 , is approximately equal to 2850 hz when there is zero amplitude information contained in the input signal . f2 in the preferred embodiment increases with increasing amplitude of the input signal . thus , the difference between the output frequency f1 of the first voltage - controlled oscillator 25 and the output frequency f2 of the second voltage - controlled oscillator 27 increases with increasing input signal amplitude and of course decreases with decreasing signal amplitude to obtain in the preferred embodiment , a minimal difference of 1350 hz . the compressed audio signal is passed through a first band reject filter 29 to provide a first fm control channel that is represented by notch 31 of a spectrum diagram 33 . the compressed audio signal is also passed through a lowpass filter 35 which removes the energy at or above the minimum frequency of f2 . f1 which is represented by the spectrum waveform 39 and f2 which is represented by the spectrum waveform 41 is combined by a combiner 37 , the spectrum of which is represented by waveform 43 . the output of the lowpass filter 35 as represented by the spectrum waveform 47 is applied to a combining circuit 45 for combining with the output of the combiner 37 . the overall combination is a composite communication system which in the preferred embodiment is an audio signal that is represented by the spectrum diagram 49 and is applied to the radio transmitter 1 for transmission via the antenna 3 . in fig2 to which reference should now be made , an antenna 3 receives a radio signal and applies it to a radio receiver 51 which demodulates the received signal into a composite signal that is represented by the spectrum waveform 53 and applies it to a receive signal processor 55 which recovers the original signal from the composite signal including restoration of the original amplitude information . the received composite signal is passed through a compression amplifier 57 ( which is in the preferred embodiment an agc audio amplifier and includes an amplifier 59 , a feedback loop that includes a diode 61 and rc filter 63 which develops a biased signal to a field effect transistor 65 which controls the level of the signal that is applied to the amplifier 59 , a constant gain amplifier ,) from the radio receiver 51 via the input resistor 67 . the compression amplifier removes any amplitude variations which may have been introduced by the communication link over which the received composite signal traveled . the composite signal is separated into the control tones 79 and 83 of waveform 53 and frequency components represented by peaks 85 and 87 of waveform 53 by filtering . a first band reject filter 86 and a second lowpass filter 88 remove the control tones 79 and 83 from the composite signals . this is represented graphically by waveforms 89 and 91 . the stripped composite signal is then passed through a second gain control amplifier 93 which restores the original signal amplitude to the composite signal to obtain a signal that is represented by the spectrum 95 and in the preferred embodiment is an audio signal which is applied to a speaker 97 . the second gain control amplifier 93 is controlled by a control signal derived from the control tones 79 and 83 . a first bandpass filter 12 separates the first tone 79 from the composite signal and a second bandpass filter 14 separates the second tone 83 from the composite signal . the first tone is demodulated by a first fm demodulator and signal detector 16 and applies the demodulated signal to the control signal processor 18 via conductor 20 and if the first tone 79 is present the fm demodulator and signal detector 16 also provide a logic signal level via conductor 22 to the control signal processor 18 indicating that the first control tone 79 is present . similarly , the second bandpass filter 14 separates the second control tone 83 from the composite signal that is represented in waveform 53 and applies the separated tones to a second fm demodulator and signal detector 24 which applies the demodulated second control tone 83 to the control signal processor 18 via conductor 26 and a logic indication that the second control tone 83 is present and is also applied to the control signal processor 18 via conductor 28 . the signal presence indication from the first and second fm discriminator and signal detector 16 and 24 indicates whether either or both the first control tone or the second control tone is being received . this present output is used by the control signal processor 18 to determine whether the amplifier gain is controlled by the first control tone 79 or the second control tone 83 or both tones . when both the first control tone 79 and the second control tone 83 are present , the control signal processor 18 utilizes the difference between the two fm demodulated outputs as a source of controlling the second gain control amplifier 93 . the control signal processor 18 also determines absolute control tone frequency offset caused by a communication link when both the first control tone have 79 and the second control tone 83 are present so that this information can be applied as a correction voltage when only one tone is used for control of the second gain control amplifier 93 as would happen during selective fading over a high frequency rf communication line . a simplified schematic diagram of the control signal processor 18 is provided in fig3 to which reference should now be made . the demodulated first signal tone 79 and the demodulated second signal tone 83 are applied to a difference amplifier 32 for application to the second gain control amplifier 93 via conductor 60 . the control of the output of the difference amplifier 32 is controlled by an fet switch 34 , the gate of which is enabled whenever both the first control tone 79 and the second control tone 83 are present and detected by the first fm demodulator and signal detector 16 of fig2 and the second fm demodulator and signal detector 24 also of fig2 . the logic indication of both of these signal present is applied to a and gate 40 and if both signals are present then the fet switch 34 is activated allowing the difference between the demodulated first control signal 79 and the second demodulated control signal 83 to be applied to the second gain control amplifier 93 . additionally , the output of the and 40 also causes switch 58 to conduct which causes capacitor 74 to integrate the output of the difference amplifier 38 which provides an absolute control tone frequency offset . the output of amplifier 38 is applied to the capacitor 74 via the fet switch 58 and resistors 72 . inverting amplifier 36 inverts the first demodulated control tone and applies it to amplifier 38 and , in particular , to the inverting terminal where it is compared with the second demodulated control tone which is applied to the noninverting terminal of the amplifier 38 . the output of the amplifier 38 provides the absolute control frequency which can be used as a correction voltage when only one tone is present for control of the second gain control amplifier 93 . in the event that only one tone should happen to be present such as the second control tone 83 , then conductor 28 will have an indication that this tone is present and apply this information to the and gate 44 . the output of the and gate 40 is a logic zero since there is no indication of the first control tone being present on conductor 22 . the inverter 42 provides a logic one indication to the and gate 44 and this logic one indication is used to activate the fet switch 54 which will allow the second control tone that is present on conductor 26 to be used as the means of controlling the second gain control amplifier 93 after being corrected for the absolute control tone frequency offset by the comparison made by the difference amplifier 48 between the voltage that is stored on capacitor 74 and the demodulated second control tone 83 . the results of this comparison is inverted by inverting amplifier 52 and applied to the second gain control amplifier 93 via conductor 60 and fet switch 54 . in the event that only the first control tone is present , then the and gate 46 will provide a logic one to the fet switch 56 which will conduct the output of the difference amplifier 50 which contains the difference between the first demodulated control tone and the voltage that is stored on capacitor 62 to the gain control amplifier 93 via fet switch 56 and conductor 60 . it should be pointed out that through the operation of the and gates 40 , 44 and 46 , only fet switch 34 conducts when both the first control tone 79 and the second control tone 83 are present , only fet switch 54 conducts when the second control tone 83 is present and only fet switch 56 conducts when the first control tone 79 is present . fig4 is an embodiment of the single processor according to the invention which incorporates microprocessor technology to implement the signal processing according to the invention . a lowpass filter and a / d converter 62 converts the audio information that is provided either from the microphone 7 or the radio receiver 51 and antenna 3 into digital information for application to a microcomputer 64 . if a push - to - talk key 68 is pressed indicating that the signal originates from the input transducer 7 , then the microcomputer 64 performs through algorithms contained therein the functions performed by the transmit signal processor 5 of fig1 and applies this information to a d / a converter and lowpass filter 66 for application to the radio transmitter 1 and antenna 3 via the push - to - talk key switch 70 . if the switch 68 is not closed , then the radio receiver 51 provides the audio signal to the lowpass filter and a / d converter 62 where the composite signal is converted into a digital signal and applied to a microcomputer 64 . under these conditions the microcomputer 64 implements the functions performed by the received signal processor 55 of fig2 and applies this information to the d / a converter and lowpass filter 66 for application to the output transducer or speaker 97 via the push - to - talk key switch 70 . many changes and modifications in the above described invention can , of course , be carried out without departing from the scope thereof . accordingly , the invention is intended to be limited only by the scope of the appended claims . | 7 |
[ 0020 ] fig1 is a schematic diagram of a fluid end 8 of a plunger pump with a tool 10 tool in accordance with the invention . the tool 10 is used to insert a pump plunger 12 through an aperture 14 in a packing 16 in the fluid end of the plunger pump 8 . the tool 10 includes a plunger guide 18 , connectors 20 , a load plate 22 , and a plunger insertion screw 24 . the operation of the tool 10 to insert the pump plunger 12 through the packing 16 is simple and easily and rapidly accomplished by one person . the plunger guide 18 is threaded into a plunger installation port 26 in the fluid end 8 of the plunger pump . the pump plunger 12 is inserted into an axial bore 28 in the plunger guide 18 until a driven end of the pump plunger 12 contacts the packing 16 . the axial bore 28 has a diameter that is only slightly larger than a diameter of the pump plunger 12 , so that the pump plunger is centered over the aperture 14 in the packing 16 and guided into the aperture 14 as it is inserted through the packing 16 . the load plate 22 is connected to the plunger guide 18 by the connectors 20 . bottom ends of the connectors 20 threadedly engage threaded bores in the plunger guide 18 and the upper ends are connected to the load plate 22 . when torque is applied to the plunger insertion screw 24 , which is threaded through a threaded bore 25 , plunger insertion screw 24 causes a drive force to be applied to the pump end of the pump plunger 12 . when a torque of sufficient magnitude and duration is applied to plunger insertion screw 24 , the pump plunger 12 is inserted through the aperture 14 in the packing 16 . since the pump plunger 12 is accurately aligned with the aperture 14 in the packing 16 , the pump plunger is easily inserted without damaging the packing 16 . [ 0022 ] fig2 is a side view of the plunger guide 18 which includes a threaded top end 32 that is screwed into the pump plunger installation port 26 ( fig1 ), and a bottom end 34 that extends the axial bore 28 to ensure that the pump plunger 12 is accurately guided as it is inserted through the packing 16 . [ 0023 ] fig3 is a top plan view of the plunger guide 18 , which includes the axial 28 for guiding the pump plunger 12 and two threaded bore 36 for receiving the connectors 20 . [ 0024 ] fig4 is a top plan view of one embodiment of the load plate 22 shown in fig1 . in this embodiment , the load plate 22 includes slots 38 in opposite side edges . the slots 38 receive top ends of the connectors 20 shown in fig1 . the top ends 37 of the connectors 20 are l - shaped . the shape of the slots is designed to receive the l - shaped ends 37 of the connectors to removably attach the load plate 22 to the plunger guide 18 . another embodiment of the load plate 22 is shown in fig5 . the load plate 22 b is attached to the plunger guide using bolts 40 or the like . the bolts are inserted through bores 46 in the load plate 22 b and screwed into the threaded bores 36 ( fig3 ) in the top end of the plunger guide 18 . the l - shaped connectors 20 shown in fig1 can also be used with the load plate 22 b . [ 0026 ] fig6 is a top plan view of yet another embodiment of the load plate 22 shown in fig1 . the load plate 22 c shown in fig6 includes a bore 46 in one end , and a slot 38 in the opposite end . the bore 46 receives , for example , an l - shaped connector 20 ( fig1 ) or a bolt 40 ( fig5 ). the slot 38 receives , for example , the l - shaped connector 20 . the load plate 22 c permits a pump plunger 12 ( fig1 ) to be inserted into the axial bore 28 of the plunger guide 18 without removing the load plate 22 c . to accomplish this , the load plate 22 c is rotated about the connector inserted through the bore 46 to expose to axial bore 28 in the plunger guide 18 , as will be understood by those skilled in the art . after a pump plunger 12 is inserted , the load plate is rotated back so that the other connector engages the slot 38 , and the pump plunger 12 is inserted through the aperture 14 in the packing 16 , as described above . this embodiment of the load plate 22 c permits the tool 10 to remain in an assembled condition at all times , so that parts are less likely to be disassociated and lost . [ 0027 ] fig7 illustrates an alternate embodiment of the plunger insertion screw 24 . a threaded screw 42 , adapted to threadedly engage the bore 25 of the load plate 22 , includes a handle 44 received in a radial bore through the threaded screw 42 . the handle 44 provides leverage to permit the threaded screw 42 to be turned to insert the pump plunger 12 through the aperture 14 . the tool in accordance with the invention greatly facilitates the insertion of pump plungers through new packings in plunger pumps . the job is easily performed by a single person in a very short period of time . since the pump plunger is accurately aligned with the aperture in the packing , regardless of an orientation of the pump , the pump plunger is consistently inserted without damage to the packing . furthermore , since the pump plunger is only subjected to a constant axial force , it is never damaged as can happen if it is driven through the packing using a hammer and punch . the embodiments of the invention described above are intended to be exemplary only . the scope of the invention is therefore intended to be limited solely by the scope of the appended claims . | 8 |
referring to fig1 it can be seen that it presents straight tie ( 21 ), which can be adjusted to a necessary wall thickness by means of the female part of straight tie ( 22 ), if necessary . the firm connection of parts ( 21 ) and ( 22 ) is accomplished by means of lateral teeth on male part ( 24 ) and the teeth on female part of the tie ( 25 ), ( 30 ) and ( 35 ). in fig4 the side view of the variable straight tie with the set lateral teeth can be seen . the tie carrier is dimensioned in such a way , that it might carry the weight of the mounting and that its lateral teeth ( 24 ) and ( 25 ) could endure all necessary tensile deformations , in accordance with this invention the variable ties can be used as the mounting carriers in the wall boarding , also the ribbed bars as well as the nets can be used . also , the setting of the vertical boarding on the corners of the object is easier and faster . distancing members ( 23 ) on the variable tie are placed on the regular distance from the wall and they are placed only on the variable straight tie . they serve exclusively to set the horizontal mounting on a regular distance between themselves and between the bars and the wall . it is important to mention that positions ( 20 ) on the variable tie and on the tie floor always make 6 cm , in order that they can enter into the insulation plate or the insulation lining . the little feet on the outer part of the variable tie and on the ties - floors ( 27 ) serve as the carriers of the plaster plates . those are fastened by means of the screw and the plaster plate to the little feet in the wall , hi such a way there is a saving in the installing works , in providing of carriers and in setting the carriers of the plaster plates . as it is presented in fig4 , it can be seen that a various thickness can be set by means of a female part . the male parts of variable ties ( fig2 , fig6 , fig9 ) can be made in two variants , the first variant is for the wall span of 14 to 36 cm and the second one for the wall span of 36 to 60 cm . this variant is usable at building the foundations as well as the underground and ground floor carrying walls . the span measures are presented on the upper part of the neck of tie ( 26 ). the female parts of variable ties ( 22 ), ( 30 ) and ( 35 ) are dimensioned in a way to endure the tensile deformations at the thickest walls . the investigations and the attestations of the ties are carried out on the civil engineering institute in zagreb . they have satisfied by its strength and carrying capacity , but also by the firm connection of the male and female part of the variable tie , figs . ( 1 ); ( 5 ); ( 8 ). fig5 presents the variable angular ties of 90 ยฐ that can also be set on a necessary distance . also , this is achieved by means of position ( 30 ), where the way of the firm connection of the male and female part can be seen . the neck of tie ( 32 ) enters into the reinforced part of angular female tie ( 31 ). the reinforced part on the female part is presented by position ( 31 ). the reinforcements on the male part of tie ( 28 ) prevent the bending of the neck of male tie ( 28 ). the measures of span ( 26 ) are also impressed on the male part of the angular tie . fig8 presents the variable angular tie of 135 ยฐ that can also be set on a necessary distance . the firm connection is accomplished by fixing male and female part ( 35 ) by means of the lateral teeth on them . the tie male parts ( 33 ) and the tie female parts ( 34 ) are reinforced . the measures of wall span ( 26 ) are situated on the neck of the male angular tie of 135 ยฐ. the position where insulation plates ( 20 ) enter and positions ( 27 ) that serve as the carriers of the plaster plates are presented . fig1 presents the cross tie for the formation of the t - shape wall . position ( 37 ) presents the positions on the cross tie , where the male angular ties of 90 ยฐ enter . position ( 38 ) presents the place where the male angular tie of 90 ยฐ is fixed . on position ( 39 ) the position on the cross tie is presented , where the male straight tie enters , and on ( 40 ) the fixing position for the cross tie is presented . there is the possibility of the formation of various wall thicknesses by means of the cross tie . the insulation lining is presented in fig1 , its outer surface on which the mounting is placed and the liquid concrete is filled in . position ( 46 ) presents the grooves on the insulation linings that serve for the firm connection of one along the other . this is accomplished by means of the ties - linings , fig1 , that enter on lateral wings ( 47 ) into grooves ( 46 ). in fig1 the inner view of the insulation lining with cavities ( 44 ) and with rounded ribs that reinforce the wall of insulation lining ( 45 ) can be seen . the insulation lining is constructed in such a way , that lateral wings ( 47 ) are the boarding for the ribbed carrier of the reinforced concrete plate . while the upper side of insulation lining serves as the boarding for the a7b plate . the tie - lining is presented in fig1 , and its characteristic appearance can be seen . position ( 41 ) shows the position where the insulation lining enters and is fixed to the tie - lining . position ( 42 ) presents the distancing member for setting the mounting of the carrier of the reinforced concrete plate on a regular distance . position ( 48 ) presents the anchors for fixing the ties - linings into the reinforced concrete plate . also , on the tie - lining positions ( 27 ) are presented , as well as the little feet of the plaster plates carrier . | 8 |
the manufacturing process used to develop the biomaterials in accordance with the present invention is based upon reverse phase polymerization . an exemplary process is described within u . s . pat . no . 4 , 000 , 218 to critchfield et al . issued dec . 28 , 1976 . reversed phase polymerization has been shown to produce polymers in particulate form and in high purity as required for use in medical devices . as part of the process , it is necessary to use and / or synthesize interfacial agents specifically suited for the system . the interfacial agent generally includes a diol terminated polymer chain having at least one reactive site within the chain . in accordance with a further aspect of the invention , the interfacial agent may be modified to incorporate a zwitterionic moiety such as an amino acid or phosporylcholine and derivatives thereof . an aliphatic species , preferably a saturated hydrocarbon , is chemically bonded to the reactive site . in this manner , the interfacial agent possesses a hydrophilic domain which may be incorporated within the bulk polyurethane base polymer while also having a hydrophobic tail extending outwardly from the base polymer . as a result , when the reaction materials ( i . e . the polyurethane precursors , such as methylene diphenyl diisocyanate and an organic diol , and the interfacial agent ) are placed within an aprotic solvent such as hexane , benzene or toluene , reverse micelles are formed . as a result , these interfacial agents serve a dual purpose : a ) to suspend particles in process in the aprotic solvent and b ) to modify the surface characteristics of the resultant polyurethane material . for example , as shown in fig1 , medical device 10 ( such as a urinary catheter ) is generally comprised of a base polymer 20 . in accordance with an aspect of the present invention , base polymer 20 is a polyurethane composed of polymerized diisocyanate / diol . the diisocyanate has a general formula o โ c โ n โ r โ n โ c โ o , where r is either an aliphatic chain , such as hexamethylene diisocyanate ( hdi ), or is aromatic such as toluene diisocyanate ( tdi ) or methylene diphenyl diisocyanate ( mdi ). the diol may be a siloxane diol or an organic diol , such as but not limited to polyethylene glycol ( peg ), tetraethylene glycol , 1 , 4 - butane diol , a lactone diol such as poly ( caprolactone ) diol or a polycarbonate diol . to monitor the progression of the polyurethane reaction , fourier transform infrared ( ftir ) spectroscopy may be used to interrogate isocyanate consumption . consumption of the isocyanate groups indicates extension of the polymer backbone and the attachment of graft pre - polymers ( discussed below ). the isocyanate may also be monitored since specific amounts of unreacted isocyanate groups may be desired to remain on the polymer in order to improve adhesion between the substrate ( i . e . medical device 10 ) and a coating later of the biomaterial of the present invention . alternatively , unreacted isocyanate groups may also be further derivatized following the polyurethane formation reaction by quenching the reaction with a solution containing one or more zwitter ions such as amino acids or amino acid analogs . in this manner , the polyurethane backbone may be modified to increase its biocompatibility and / or increase its functionality via the additional reaction site on the zwitter ion . an overlay of exemplary ftir spectra tracking polyurethane reaction progression is shown in fig2 . in accordance with an aspect of the present invention , partially embedded within base polymer 20 are one or more surface active agents 30 ( see also fig3 ). surface active agents 30 may be covalently bonded to the diol backbone of the polyurethane base polymer 20 . alternatively and / or additionally , surface active agents 30 may also be incorporated within the base polymer 20 via a graft pre - polymer 32 ( see also fig4 ) which will be discussed in greater detail below . in one aspect of the invention , surface active agents 30 are tailored to provide surface properties required for long term implants , such as catheters or other devices where long - term biocompatibility is desired . base polymer 20 exhibits the microstructure ( hard - soft segments 26 - 28 , fig3 ) well known in polyurethanes . this microstructure is arranged in such a way so as to induce a synergistic effect with the surface active agent 30 . the micro - domains present within the base polymer 20 play a role in both the mechanical and surface properties of the final devices . these domains are dictated by the feed composition in the polymer synthesis and manipulated by the thermal history and ultimate manufacturing technique employed when fabricating the polyurethane polymer . surface active agents 30 may be incorporated within the polyurethane base polymer 20 during polymerization of the polyurethane or may be later reactively added through suitable chemical reactions to functional groups located on the base polymer 20 . for example , u . s . pat . no . 3 , 383 , 351 to stamberger issued may 14 , 1968 , discloses a pre - polymer grafting polymerization pre - processing step before the polyurethane polymerization reaction . that is , in accordance with an aspect of the present invention , the diol grafted pre - polymer 32 employed within the polyurethane polymerization has been pre - processed so as to become derivatized to either include the surface active agent 30 or to include a reactive site for later functionalization of the polyurethane base polymer 20 ( see fig4 ). the grafted pre - polymer 32 also allows for compositional control of the polyurethane base polymer which further modifies both the base polymer 20 and the surface properties of the surface active agents 30 . with continued reference to fig3 , surface active agents 30 a - 30 c may be unsaturated monomers covalently integrated within backbone 34 of pre - polymer 32 . examples of such surface active agents may include charged monomers such as methacrylic acid 30 a and vinyl sulfonic acid 30 c , and an anti - adhesive fluorinated monomer 30 b such as 2 , 2 , 2 - trifluoroethyl methacrylate . additional surface active agents may include , without limitation , aliphatic methacrylates , fluoromethacrylates , sulfonium salts , vinyl monomers with phenol or benzoic acid , n - vinyl pyrrolidone , a zwitterionic monomer such as but not limited to an amino acid , phosphorycholine and the like , and functionalized aminoglucosides . the grafted pre - polymer creates a mixed - phase polymeric structure enabling the fine tuning of the surface properties of medical device 10 . in one aspect of the present invention wherein medical device 10 is fabricated directly from the mixed - phase biomaterial , the bulk properties of medical device 10 are dictated by the polyurethane structure of base polymer 20 and include both rheological properties and micro - domains within the polymer . tuning of the polyurethane reaction materials and synthesis produces bulk polymers suitable for melt processing into tubing and other shapes , as well as for the application of coatings from appropriate solvents . in a further aspect of the present invention , the mixed - phase biomaterial may be surface coated onto a pre - fabricated medical device , such as already commercially available urinary catheters . in either case , the local surface characteristics of the medical device may be modified according to the proposed end - use of the medical device and may include anti - adhesive and / or anti - microbial properties , or may include covalently bonded therapeutic agents for site specific and / or time released application . derivatization of the surface may be through complimentary functional groups on the polyurethane polymer main chain or through the grafted pre - polymers . for instance , antimicrobial polymers may be produced by attaching or inserting an active microbial agent onto either the polyurethane or a graft pre - polymer backbone via an alkyl or acetyl linker . in accordance with one aspect of the present invention , graft pre - polymer 32 is specifically chosen for its enhanced antimicrobial properties . examples of such antimicrobial moieties include , but are not limited to vinyl monomers with phenol or benzoic acid , functionalized aminoglucosides , charged monomers such as methacrylic acid , vinyl sulfonic acid , and sulfonium salts , and fluorinated monomers . in accordance with a further aspect of the present invention , the mixed - phase biomaterial may reduce bacterial adhesion due to the biomaterial &# 39 ; s non - uniform and self - adjusting surface which is non - conducive for bacterial attachment since bacteria prefer unchanging and predictable surfaces when forming biofilms . the polymers synthesized using an embodiment of the manufacturing process of the present invention have non - uniform and dynamic surface chemistries due to variation of the material &# 39 ; s surface composition from the graft pre - polymers 32 . graft pre - polymers 32 also create hydrophillic / hydrophobic and positively / negatively charged microdomains within the resultant biomaterial . the material &# 39 ; s composition and micro - domains are dictated by the feed composition , solvent , reaction conditions , and post - treatment procedures such as thermal annealing and washing . by way of example , x - ray photoelectron spectroscopy ( xps ), such as the results shown in fig5 for a mixed - phase material including graft pre - polymers having silicon and fluorine substituted methacrylates , may verify that heat treatment at 80 ยฐ c . for three hours can alter the surface chemistry so that the fluorine and silicon groups of the representative material no longer appear on the surface . the self - adjusting nature of the biomaterial surface may also be demonstrated by its ability to be dissolved in both hydrocarbon and aprotic polar solvents . limited solubility of the biomaterial is seen in alcohols and the biomaterial is not soluble in water , although slight surface hydration is seen because of the dynamic nature of the surface . information on miscibility and polymer - to - polymer interactions can be revealed through the use of differential scanning calorimetry ( dsc ). as seen in fig6 a , a representative biomaterial consists of multiple phases due to graft pre - polymer ( side - chain ) composition . the graft pre - polymer influences the biomaterial &# 39 ; s final properties . as can be seen in fig6 a , the representative biomaterial includes one or more components ( such as graft pre - polymers and / or surface active agents ) which are thermo - responsive and lead to multiple phase transitions . it can be seen that one phase transition is at or near body temperature ( 37 ยฐ c . ), which decreases the surface modulus and contributes to the biomaterial &# 39 ; s self - adjusting surface properties at a biologically relevant temperature . as a comparison , fig6 b shows an ungrafted polymer , which contains only a single phase transition . an example of the improved bacterial anti - adhesion properties of the biomaterials of the present invention over commercial catheters is shown in fig7 . commercial catheters , with and without biomaterial coatings , were placed into a suspension of staphylococcus aureus bacteria for 24 hours . after staining and removing the bacteria on the catheters , the bacteria were quantified using ultra - violet spectroscopy . the number of bacteria counted was averaged over 5 samples of each catheter type ( whether with or without a biomaterial coating ). fig7 shows that an exemplary biomaterial coating produced in accordance with the present invention exhibits a 33 % reduction in bacterial adhesion compared to an uncoated commercially available catheter . the following examples are illustrative of the present invention and not to be regarded as limitative thereto . in a reaction vessel , hydroxyethyl methacrylate , 1 . 0 g , caprolactone , 60 g , and 0 . 1 g stannous octoate were added and mixed until homogeneous . the solution was heated to 82 ยฐ c . overnight ( 16 - 24 hours ). this resulted in a waxy solid . in a reaction vessel , tetraethylene glycol , 1 . 0 g , caprolactone , 60 g and 0 . 1 g stannous octoate were added and mixed until homogeneous . the solution was heated to 82 ยฐ c . overnight ( 16 - 24 hours ). this resulted in a waxy solid . component amount ( g ) peg - 1000 150 n - vinyl pyrrolidone 1 . 0 methyl methacrylate 10 lauryl methacrylate 7 . 9 tris 2 . 1 benzoyl peroxide 0 . 12 the solution was heated from 70 ยฐ c . to 100 ยฐ c . while mixing with an overhead mechanical agitator . after 3 hours the solution was cooled and 20 g of dimethyl acetamide was added to decrease viscosity of the polymer solution . component amount ( g ) peg - 1000 90 n - vinyl pyrrolidone 2 . 8 methyl methacrylate 4 . 0 methacrylic acid 1 . 0 lauryl methacrylate 2 . 0 tris 3 . 1 benzoyl peroxide 0 . 04 the solution was heated at 70 ยฐ c . for 48 hours . a viscous solution was recovered . component amount ( g ) peg - 1000 90 n - vinyl pyrrolidone 1 . 0 methyl methacrylate 2 . 0 tetrafluoroethyl methacrylate 1 . 65 lauryl methacrylate 2 . 0 tris 5 . 0 aibn 0 . 024 the solution was heated at 70 ยฐ c . for 48 hours in a mechanical convection oven . a viscous solution was recovered which formed into a waxy solid at room temperature . component amount ( g ) peg - 1000 90 n - vinyl pyrrolidone 2 . 8 methyl methacrylate 1 . 0 isobornyl methacrylate 3 . 0 methacrylic acid 1 . 0 lauryl methacrylate 2 . 0 tris 3 . 1 benzoyl peroxide 0 . 04 the solution was heated at 70 ยฐ c . for 48 hours in a mechanical convection oven . a viscous solution was recovered which formed into a waxy solid at room temperature . the solution was heated at 70 ยฐ c . for 48 hours in a mechanical convection oven . a viscous solution was recovered . interfacial agent is used in polyurethane reactions where polycaprolactone diols are used in aprotic hydrocarbon solvent systems . the solution was heated at 70 ยฐ c . for 48 hours in a mechanical convection oven . a viscous solution was recovered . interfacial agent is used in polyurethane reactions where polycaprolactone diols are used in aprotic hydrocarbon solvent systems . toluene , 200 g was added to a jacketed reaction vessel equipped with overhead mechanical agitator . brij s100 strearyl 10 g was added and mixed thoroughly . once solubilized 26 . 2 g tetraethylene glycol , 3 . 3 g butane diol and 131 . 1 g of polymer graft from example 3 were added . methyl diphenyl diisocyanate ( mdi ) was melted and added to 30 g of toluene . the mdi solution was added to the reactor at room temperature under agitation and mixed until exotherm was exhausted . the solution was then heated to 80 ยฐ c . for 2 hours until the viscosity reached 25 cps @ 50 ยฐ c . as measured by a cone & amp ; plate brookfield viscometer . the material was recovered by precipitation into hexane . as shown in fig8 , the material exhibited multiple phase transitions as measured by differential scanning calorimetry . toluene , 130 g was added to a jacketed reaction vessel equipped with overhead mechanical agitator . brij s100 strearyl 7 . 2 g was added and mixed thoroughly . once solubilized , 2 . 4 g butane diol and 90 g of polymer graft from example 5 were added . methyl diphenyl diisocyanate ( mdi ) 30 g was melted and was added to the reactor at room temperature under agitation . it was mixed until exotherm was exhausted . the solution was then heated to 90 ยฐ c . for 2 hours until the viscosity reached 45 cps @ 50 ยฐ c . as measured by a cone & amp ; plate brookfield viscometer . the material was recovered by precipitation into hexane . in a reaction vessel , hydroxyethyl methacrylate , 1 . 0 g , dimethyl carbonate , 10 g tetraethylene glycol ( teg ), 10 g and 0 . 1 g potassium carbonate were added and mixed until homogeneous . the solution was heated to 85 ยฐ c . overnight ( 16 - 24 hours ) followed by 3 - 4 hours at 140 ยฐ c . at which point the polymer was recovered . the preferred molecular weight of the methacrylate end - capped polycarbonate polymer was in the range of 1000 to 5000 . alternately a peg of 1000 mw may be used instead of teg to obtain higher mw functionalized diols . in a reaction vessel , dimethyl carbonate , 10 g tetraethylene glycol ( teg ), 10 g and 0 . 1 g potassium carbonate were added and mixed until homogeneous . the solution was heated to 85 ยฐ c . overnight ( 16 - 24 hours ) followed by 3 - 4 hours at 140 ยฐ c . at which point the polymeric diol was recovered . the preferred molecular weight of the diol was in the range of 1000 to 5000 . alternately a peg of 1000 mw may be used instead of teg to obtain higher mw diols . toluene , 130 g was added to a jacketed reaction vessel equipped with overhead mechanical agitator . brij s100 strearyl 7 . 2 g was added and mixed thoroughly . once solubilized , 2 . 4 g butane diol and 90 g of diol from example 11 were added . methyl diphenyl diisocyanate ( mdi ) 30 g was melted and was added to the reactor at room temperature under agitation . it was mixed until exotherm was exhausted . the solution was then heated to 90 ยฐ c . for 2 hours until the viscosity was above 50 cps @ 50 ยฐ c . as measured by a cone & amp ; plate brookfield viscometer . the material was recovered by precipitation into hexane . although the invention has been described with reference to preferred embodiments thereof , it is understood that various modifications may be made thereto without departing from the full spirit and scope of the invention as defined by the claims which follow . | 0 |
referring to the drawings and in particular to fig1 represents a conventional dump truck having a bed 12 with two side walls 14 , a rear wall 16 and a front wall 18 . a cab shield 20 extends from the front wall 18 to partially cover the truck cab roof 22 . two hollow lateral support members 24 extend from the cab shield 20 along the top portion of the side walls 14 to the rear wall 16 . a plurality of slats 26 extends transversely between the lateral support members 24 . these are covered and attached to a flexible tarpaulin 28 by means of screws 30 extending through the tarpaulin 28 and into the slats 26 . ( see fig1 ) a plurality of l - shaped lateral tarpaulin supports 32 are attached to each end portion of each slat 26 by bolts 36 and extend downwardly over the edge of hollow lateral support members 24 . tarpaulin 28 is attached to the end portion of lateral tarpaulin supports 32 by means of lateral bolts 34 extending through both lateral tarpaulin support 32 and tarpaulin 28 . tarpaulin 28 also extends from the cab shield 20 to the rear wall 16 , supported by slats 26 positioned at about two foot intervals along the support members 24 . tarpaulin 28 is attached to cab shield 20 by clamp member 21 , as shown in fig1 , which extends the width of the cab shield 20 . clamp bolts 23 extend through tarpaulin 28 , clamp member 21 and into cab shield 20 to clamp tarpaulin 28 . thus in its extended phase , the tarpaulin 28 extends completely over the top of truck bed 12 and over the side of the side walls 14 to completely enclose the contents of bed 12 . as may be seen , l - shaped lateral tarpaulin supports 32 extend over the top of tarpaulin 28 , over the sides of hollow lateral support members 24 and are secured to slats 26 by means of bolts 36 . referring to fig1 and 13 , a channel member 27 welded to each side wall 14 , extends across the bed 12 . rear retaining member 31 ( usually wood ) is bolted to channel member 27 by bolts 29 . stationary tarpaulin cover 35 ( fig1 ) extends from retaining member 31 to the outer portion of rear wall 16 where it is bolted by rear wall bolts 41 which pass through a transverse rear retaining strip 43 and into rear wall 16 . the other end portion of stationary tarpaulin cover 35 is transversely bolted to retaining member 31 through a top retaining strip 45 which extends across the truck bed 12 . when the tarpaulin 28 is in its extended position , rear slat 60 and tarpaulin 28 extend over rear retaining member 31 and stationary tarpaulin cover 35 , thus sealing or shielding the rear portion of bed 12 from the outside . likewise the front portion of tarpaulin cover 28 is clamped to cab shield 20 sealing or shielding the front portion of bed 12 from the outside . hence , in its extended position tarpaulin 28 completely seals or encloses bed 12 on the front , rear and sides . the mechanism for extending and retracting the tarpaulin 28 is as follows : referring to fig2 , 7 , 8 and 9 , two forward pulleys 38 connected by a hollow shaft 40 are attached to lateral portions of cab shield 20 by means of forward pulley brackets 42 . forward pulleys 38 are attached to a short shaft 44 extending through a bearing 46 and attached to hollow shaft 40 by means of a shaft pin 48 which extends through hollow shaft 40 and short shaft 44 . as shown in fig3 , and 9 , rear pulleys 50 are attached to either side of the rear portion of hollow lateral support members 24 by means of brackets 52 . rear pulleys 50 are attached to rear brackets 52 by means of rear bearing bolt 56 extending through rear bearing 54 within rear pulley 50 . a looped cable 58 ( fig9 and 13 ) extends around forward pulleys 38 and rear pulleys 50 in a loop - like fashion and are attached to rear slats 60 by means of threaded rods 62 and nut 63 . threaded rods 62 are hollowed out , the ends of cable 58 inserted and sweat welded together . threaded rods 62 then extend through rear slat 60 . nut 63 is screwed on threaded rod 62 to bear against rear slat 60 and tighten cable 58 . the tensions on cable 58 ( fig1 ) may be varied by turning nuts 63 . the upper loop of cable 58 extends through each slat 26 around forward pulley 38 and rear pulley 50 and through hollow lateral support members 24 . as may be seen , the tension on the cables 58 may be adjusted by adjusting the nut 63 positioned on threaded rod 62 . it should be noted that forward pulleys 38 and rear pulleys 50 are fully contained within the lateral turck frame and do not extend laterally therefrom . this has distinct advantage in lessening damage to these pulleys and also contains the pulleys within the legal width of the truck which is regulated frequently by state law . pennsylvania state law requires the truck width to be no more than 96 inches . the forward and rearward movement of the tarpaulin 28 over the top of the truck bed 12 is controlled by a hand crank device 64 ( fig2 , 5 and 6 ), and is mounted upon the forward position of front wall 18 by means of mounting bracket 66 . a crank shaft 68 extends through two beaarings 70 which are attached to mounting bracket 66 . a chain sprocket 72 is positioned on crank shaft 68 between bearings 70 . removable hand crank 74 has a hollow tube portion 75 attached which slides easily over the end portion of crank shaft 68 . notches 77 in the end of tube portion 75 engage a permanent shaft pin 76 which extends outwardly from crank shaft 68 . thus the hand crank can be inserted on crank shaft 68 to engage shaft pin 76 and turn the crank shaft 68 . upon completion of use , the hand crank 74 is completely removed so as not to protrude laterally from the side of the truck 10 . as shown in fig2 and 6 , a looped chain 78 extends about the chain sprocket 72 and about an axle sprocket 80 positioned on short shaft 44 . as may be seen , when the hand crank 74 rotates chain sprocket 72 , chain 78 will rotate axle sprocket 80 and hollow shaft 40 . cables 58 will then cause rear slat 60 to extend or retract the tarpaulin 28 . alternatively , an electric motor 82 may be substituted for hand crank device 64 ( fig1 ). electric motor 82 is of a reversible type which may be activated by motor switches ( not shown ) to extend or retract the tarpaulin 28 as did the hand crank device 64 . electric motor 82 has a motor sprocket 84 and motor chain 86 connected to an auxiliary sprocket 88 upon crank shaft 68 . in operation either hand crank 74 or electric motor 82 may be used to rotate crank shaft 68 which in turn rotates shaft 40 . shaft 40 then rotates forward pulleys 38 which cause cables 58 to extend or retract attached rear slat 60 . rear slat 60 extends or retracts the tarpaulin 28 to cover or uncover the truck bed 12 . it should be noted that the upper sides of truck bed 12 are completely covered by the tarpaulin 28 extending over l - shaped lateral tarpaulin supports 32 . likewise the truck bed 12 is completely covered and sealed or shielded by tarpaulin 28 at the front portion of the truck by the attachment of the tarpaulin 28 to the cab shield 20 . the rear of the truck is likewise sealed or shielded and covered by stationary tarpaulin 35 which seals or shields the truck bed 12 in the rear portion . the truck bed 12 is thus completely sealed or shielded from the outside when the tarpaulin 28 has been extended completely over the truck bed 12 . no other known similar invention accomplishes this total sealing or shielding . total covering and sealing or shielding is important in covering such truck loads as asphalt or other volatile mixtures as well as sand , gravel and the like . some states ( pennsylvania ) require that the truck bed of asphalt containing trucks be completely covered and sealed or shielded from the outer atmosphere . truck bed sealing or shielding devices which do not create this total seal or shield may not legally operate in such states . further , the present invention is contained solely within the lateral limits of the truck bed 12 . no protruding devices extend laterally from the truck 10 , hence the legal width of the truck is not compromised nor are extending parts damaged . in operation hollow tube 75 of removable hand crank 74 is placed over crank shaft 68 allowing notches 77 to engage shaft pin 76 . assuming that the truck cover is in the open position , removable hand crank 74 is turned , turning shaft 68 and attached chain sprocket 72 , turning chain 78 which rotates short shaft 44 , hollow shaft 40 and forward pulleys 38 . attached cable 58 then moves pulling rear slat 60 and attached tarpaulin 28 toward the rear of the truck bed 12 . rear slat 60 and attached tarpaulin 28 pass over stationary tarpaulin cover 35 and abut rear pulleys 50 thus sealing or shielding the rear of bed 12 . l - shaped lateral tarpaulin supports 32 and attached tarpaulin 28 extend downwardly over the outer side walls 14 completely covering and sealing or shielding the interior of bed 12 from the outside . reversing the direction of the removable hand crank 74 will cause cable 58 to pull rear slat 60 and attached tarpaulin 28 toward the front wall 18 , thus exposing the interior of bed 12 . although the invention has been applied specifically to truck beds , it is contemplated that it may be used to cover other enclosures as well , such as bins , cans or containers , or used as roof covering for buildings , trailers or the like . the device has been described with certain specificity . it is understood , however , that numerous modifications may be made without departing from the spirit of the invention . referring now to fig1 a and 14 which illustrate a partial view in perspective of a side enclosing feature of the invention , there is shown tarpaulin 28 held against the interior surface of supports 32 by bolts 34 , and held close to the side wall support members 24 of the truck by lateral tarpaulin supports 32 . the ends of slats 26 extend only minimally beyond the outer edges of the truck side wall lateral support members 24 to create an operating clearance or gap 90 between the side portions of tarpaulin 28 , together with lateral tarpaulin supports 32 , and the truck side wall lateral support members 24 such that tarpaulin 28 may be easily extended or retracted over the truck bed 12 without a binding problem , that is , without the tarpaulin 28 becoming jammed as it is extended or retracted over the truck bed 12 . preferably , gap 90 is approximately one - half inch . as shown in fig1 , since the bolt head of each bolt 34 is countersunk into the corresponding lateral tarpaulin support 32 , the bolt head does not extend inwardly towards the truck side wall lateral support members 24 to an extent that it interferes with extension or retraction of the tarpaulin 28 over the truck bed 12 . since gap 90 is very small , the flow of air into or from the truck bed 12 through gap 90 is correspondingly small . accordingly , the sides of truck bed 12 are substantially enclosed or covered thereby limiting the passage of air into or from truck bed 12 . accordingly , when tarpaulin 28 is in a fully extended position , the truck bed 12 is substantially completely enclosed , and the contents of the truck bed are shielded from the atmosphere outside the truck bed . | 1 |
a fastening element 2 shown in fig1 is to be mounted to planar external surface 6 of a structural member 4 . the structural member 4 is a thin - walled member such as a housing of a mobile telephone ( cellular phone ). the structural member 4 is made of a material of a relatively small strength such as thermoplastic material or light metal . the fastening element 2 is made of a material of greater strength , in particular metal or a harder plastic material . therefore the fastening element 2 can perform a fastening function for the structural member 4 when the fastening element 2 has been integrally and rigidly connected to the structural member 4 . the fastening element 2 comprises a main body 8 and a joining flange 10 integral with the main body 8 and provided with three recesses 12 , 14 in the embodiment as shown . the external surface 6 of the structural member 4 has integral projections 16 and 18 matingly shaped with respect to the recesses 12 and , respectively , 14 . the joining flange 10 is a thin annular flange which , in the embodiment as shown , is of circular shape ; however , it could also be of another shape . as shown in the drawing , the recesses 12 are shaped as annular wall segments extending through the joining flange 10 while the recess 14 is a groove of generally semi - circular cross - section at the outer periphery of the joining flange 10 . the projections 16 and 18 at the external surface 6 of the structural member 4 are adapted to the recesses 12 and , respectively , 14 as to their cross - sectional shapes and relative positions , i . e . the projections 16 are shaped as annular wall segments , and the projection 18 is of cylindrical shape . the length of the projections 16 is greater than the thickness of the joining flange 10 so that the projections 16 extend beyond the upper surface of the joining flange 10 for a predetermined amount when the structural member 2 has been positioned so as to be engaged by the projections 16 and 18 ( see fig2 ). the free ends of the projections 16 will be deformed by upsetting so as to provide upset beads 20 ( see fig3 ) which positively retain the fastening element 2 to the structural member 4 as will be explained in more detail below . the cylindrical projection 18 , which is not absolutely necessary and could be dispensed with , is of a length corresponding to the thickness of the joining flange 20 so that it does not extend beyond the upper surface of the joining flange 20 and will not be provided with an upsetting bead . its function is to increase the joining assembly &# 39 ; s resistance to relative rotational movements . it should be understood that the number , shape and position of the recesses 12 , 14 and the projections 16 , 18 can be selected to be different from those in the shown embodiment . the annular segmental shape of the recesses 12 and projections 16 provides for substantial shear resistance at minimal space . depending on the particular application other geometrical shapes may be appropriate . as shown the walls of the recesses 2 and projections 16 extend perpendicularly to the external surface 6 of the structural member 4 . however , it would be possible to provide for small tapers of the recesses 12 in order to facilitate insertion of the projections into the structural member 2 . as an alternative the recesses 12 could be tapered in the opposite direction so that there will be additional space for receiving material when material is deformed for making the upsetting beads 20 . this would increase the joining assembly &# 39 ; s resistance to withdrawal . preferably the projections 16 should be dimensioned somewhat smaller than the recesses 12 in order to facilitate insertion of the projections 16 into the structural member 2 . of course the projection 18 which could be dispensed with may also be of a shape different from the shape as shown . for example it could be of angular , profiled or toothed shape . furthermore , the projection 18 , similar to projections 16 , could be of an axial length sufficient to provide for an upsetting bead 20 so that it would also assist in axially securing the fastening element 2 . the main body 8 of the fastening element 2 which is a hollow cylinder in the embodiment as shown is provided with functional means 22 . in the embodiment shown the functional means 22 are comprised of a smooth bore ; alternatively they could be comprised of a tapped bore , a portion of a closure or snapping means , a smooth or threaded bolt or similar fastening means . as may be seen from the figures , the bottom surface of the joining flange 10 may be ribbed or fluted in order to increase the resistance to relative rotational movements between the fastening element 2 and the structural member 4 . the joining assembly comprising the fastening element 2 and the structural member 4 will be manufactured as follows : initially the fastening element 2 and the structural member 4 are manufactured separately from each other , for example by injection moulding or in any other suitable manner . thereafter the fastening element 2 is positioned upon the external surface 6 of the structural member 4 such that the projections 16 and 18 are received from the recesses 12 and , respectively , 14 as shown in fig2 . the dimensions of the respective components may be selected such that e . g . the projections 16 are received in the recesses 12 with play while the projection 18 is received in the recess 14 by a press - fit . this allows precisely to position the fastening element 2 relative to the structural member 4 if required . thereafter the projecting free ends of the projections 12 are deformed into upsetting beads 20 by plastifying and deforming the material by means of a welding tool 24 ( schematically indicated in fig2 )โ similar to a riveting or grimping operation โ to provide for a positive joint between the fastening element 2 and the structural member 4 . the dimensions and shape of the upsetting beads 20 will be chosen in dependence of the specific application . when the structural member 4 is made of light metal , the projections 16 and 18 are preferably formed as hollow rivets so that the upsetting beads 20 can be made by a conventional riveting operation ( cold deformation ). | 1 |
recently , a manufacturing process for the present polarization splitter was published by the inventor in ieee photonics technology letters , vol . 8 , 4 , pp . 548 - 550 , 1996 . it has been found that nickel and zinc diffusion into lithium niobate separately or nickel and zinc diffusion into lithium niobate at the same time , under different manufacturing conditions , can manufacture waveguides for ordinary polarized light , waveguides for extraordinary polarized light and waveguides for both ordinary and extraordinary polarized light . a nickel diffusion lithium niobate waveguide , under different manufacturing conditions , will have different polarization characteristics . a certain thickness of nickel , if its diffusion depth is superficial to a certain level , can produce a waveguide which can only guide light in an extraordinary polarized direction ; if the diffusion depth is deep enough , a waveguide is produced which can only guide light in a ordinary polarized direction , and if the diffusion depth is between the depths mentioned above , a waveguide is produced which will guide light in random polarized directions . in another situation , if the thickness of nickel is thin to a certain level , a waveguide is produced which will only guide the light in a ordinary polarized direction . if the thickness of nickel is thicker than the critical thickness , a waveguide is produced that will guide light in random polarized directions . zinc diffusion waveguide have the same characteristics as mentioned above , and zinc diffusion along with nickel also has the same characteristics . the invention which makes use of nickel diffusion to make the polarization splitter is shown in fig2 . it is an unsymmetric y - branch configuration and the splitting angle is ฮธ . the input terminal 1 is the waveguide guiding the light in randomly polarized directions ; branch 2 is the waveguide only guiding the light in the ordinary polarized direction and branch 3 is the waveguide only guiding the light in the extraordinary polarized direction . the invention which makes use of two nickel diffusions to manufacture the polarization splitter is shown in fig3 : ( a ) first , a light cover erosion ( photoresist ) technique is used to erode a strip concavity on a z cut linbo 3 ( 10 ) chip . ( c ) a portion of the linbo 3 ( 10 ) chip is covered with a silicon chip on a layer of ni ( 30 ) is deposited . ( e ) the photoresist is washed off with organic solvent ; for example acetone , and this step will cause two sections with different thicknesses to be formed ; one is element &# 39 ; s input terminal and the other is branch 2 . ( f ) the first diffusion is performed on both sections at the same time , under high temperature for a short time period . ni ( 20 ) and ni ( 30 ) will diffuse into lithium niobate chip . the section with thinner nickel layer will produce the single ordinary polarized light waveguide , and the section with thicker nickel layer will produce the random polarized light waveguide . zro 2 ( 40 ) will be left on the surface as the mark of input terminal waveguide . ( g ) the light cover erosion ( photoresist ) technique are used and vacuum techniques to erode a strip concavity with a slope angle connecting with the zro 2 ( 40 ); then ni ( 50 ) is plated on branch 3 with the thickness needed by branch 3 to form a y - branch configuration . the photoresist is washed out . ( h ) the second diffusion is performed under lower temperature . thus , input terminal 1 and branch 2 are diffused twice , once under high temperature and once under lower temperature . the branch is formed with one diffusion under lower temperature . zro 2 ( 40 ) can be substituted by titanium , titanium oxide , zinc , zinc oxide , magnesium oxide , silicon , silicon oxide , aluminum or aluminum oxide . either ni ( 20 ) or ni ( 30 ) can be substituted by zinc . ni ( 50 ) can also be substituted by zinc . the other method of this invention uses zinc and nickel diffusion at the same time to make the polarization splitter . the process is similar to the process for making the lithium niobate polarization splitter by two nickel diffusions . the technique is diagrammed fig4 : ( a ) first , a light cover erosion ( photoresist ) technique is used to erode a strip concavity on a z cut linbo 3 ( 100 ) chip . ( d ) a portion of the linbo 3 ( 100 ) chip is covered with a silicon chip by vertical strip direction and a layer of zn ( 400 ) is deposited . ( f ) the photoresist is washed off with organic solvent , for example acetone , and this step will cause two sections with different thicknesses to be formed ; one is element &# 39 ; s input terminal and the other is branch 2 . ( g ) the first diffusion is performed on both sections at the same time , under high temperature for a short time period causing zinc and nickel to diffuse into the lithium niobate chip . the section with thinner nickel layer will produce the single ordinary polarized light waveguide , and the section with the thicker nickel layer will produce the random polarized light waveguide . the titanium will turn into tio 2 ( 502 ) and be left on the surface as the mark of input terminal waveguide . ( h ) the light cover erosion ( photoresist ) technique is used to erode a strip concavity with a slope angle connecting with the tio 2 ( 502 ); then a layer of ni ( 600 ) is deposited on branch 3 with the thickness needed by branch 3 to form a y - branch configuration by the vacuum technique . ( i ) the second diffusion is performed under lower temperature . thus , input terminal 1 and branch 2 are diffused twice , once under high temperature and once under lower temperature . the branch 3 is formed with one diffusion under lower temperature . ti ( 500 ) can be substituted by zinc , zinc oxide , magnesium oxide , silicon , silicon oxide , aluminum , aluminum oxide or zirconium oxide . ni ( 600 ) can be substituted by zinc , and zn ( 400 ) can be substituted by nickel . the process parameters for the extraordinary polarized light waveguide , ordinary polarized plane light waveguide , and the random polarized light waveguide are summarized below : ( 1 ) deposit nickel ( or zinc ), or both nickel and zinc 1 - 12 ฮผm wide , 20 - 1500 รฅ thick on lithium niobate . in order to assist with the understanding of the method and effect of this invention , the following examples are provided to describe the best mode . the invention should not be limited to these specific examples . the splitter was manufactured by the technique shown in fig3 and with the manufacturing process parameters shown on table 1 to yield a nickel - indiffused polarization splitter operating at 0 . 6238 ฮผm wavelength . the configuration of element is shown on fig2 . when the branch angle ฮธ = 1 ยฐ, its operation characteristics , shown as fig5 ( a ), ( b ), ( c ), are light signals whose polarization directions have 45 ยฐ, 0 ยฐ, 90 ยฐ angle with the z axis respectively . when polarization is 45 ยฐ to the z axis , both branch 1 and branch 2 have signals and can be recognized from fig5 ( a ). when the polarization direction has a 0 ยฐ angle to the z axis , only branch 2 has a signal . when polarization direction has a 90 ยฐ angle with z axle , only branch 1 has signal . at 0 . 6328 ฮผm , te and tm model extinction ratios are 21 db and 18 db , respectively . the splitter was manufactured by the technique shown in fig3 and with the manufacturing process parameters shown on table 2 to yield a nickel indiffused polarization splitter operating at 1 . 3 ฮผm wavelength . the configuration of element is shown on fig2 . when the branch angle ฮธ = 0 . 5 , its operation characteristics , shown as fig6 ( a ), ( b ), ( c ), are light signals whose polarization directions have 45 ยฐ, 0 ยฐ, 90 ยฐ angle with the z axis , respectively . when polarization direction is a 45 ยฐ angle with z to the z axis , both branch 1 and branch 2 have signals and can be recognized from fig6 ( a ). when the polarization direction has a 0 ยฐ angle to the z - axis , only branch 2 has a signal . when the polarization direction has a 90 ยฐ angle with the z - axis , only branch 1 has signal . at 1 . 3 ฮผm , te and tm mode extinction ratios are 23 db and 21 db , respectively . the splitter was manufactured by the technique shown in fig5 and with the manufacturing process parameters shown on table 3 , to yield a nickel / zinc indiffused polarization splitter operating at 1 . 3 ฮผm wavelength . the configuration of element is shown on fig4 . when the branch angle ฮธ = 0 . 5 ยฐ, its operation characteristics , shown as fig7 ( a ), ( b ), ( c ), are light signals whose polarization directions have 45 ยฐ, 0 ยฐ, 90 ยฐ angle with the z - axis , respectively . when polarization is at a 45 ยฐ angle with the z - axis , both branch 1 and branch 2 have signals and can be recognized from fig7 ( a ). when the polarization direction has a 0 ยฐ angle with the z - axis , only branch 2 has signal . when the polarization direction has a 90 ยฐ angle with the z - axis , only branch 1 has a signal . at 1 . 3 ฮผm , te and tm mode extinction ratios are 22 db and 20 db . ( 1 ) the nickel ( or zinc ) diffusion polarization splitter manufactured by this process has a high extinction ratio , and is suitable for practical use . ( 2 ) this process is very simple and is suitable for mass production in industry . table 1______________________________________ the fabrication process parameters for example 1 ni ni first secondwaveguide width thickness diffusion diffusion______________________________________input branch 1 4 ฮผm 320รฅ 950 ยฐ c . 650 ยฐ c . ( te + tm ) 2 . 5 hrbranch 2 4 ฮผm 100รฅ 950 ยฐ c . 650 ยฐ c . ( te ) 2 . 5 hrbranch 3 4 ฮผm 100รฅ 650 ยฐ c . ( tm ) 2 . 5 hr______________________________________ table 2______________________________________ the fabrication process parameters for example 2 ni ni first secondwaveguide width thickness diffusion diffusion______________________________________input branch 1 12 ฮผm 700รฅ 1000 ยฐ c . 900 ยฐ c . ( te + tm ) 50 min . branch 2 300รฅm 1000 ยฐ c . 900 ยฐ c . ( te ) 50 min . branch 3 400รฅm 900 ยฐ c . ( tm ) 50______________________________________ min . table 3______________________________________ the fabrication process parameters for example 3 ni / zn ni / zn first secondwaveguide width thickness diffusion diffusion______________________________________input branch 1 8 ฮผm zn 1000รฅ 1000 ยฐ c . 900 ยฐ c . ( te + tm ) ni 250รฅ 90 min . 50 min . branch 2 8 ฮผm zn 500รฅ 1000 ยฐ c . 900 ยฐ c . ( te ) ni 250รฅ 90 min . 50 min . branch 3 8 ฮผm ni 480รฅ 900 ยฐ c . ( tm ) 50 min . ______________________________________ | 6 |
in fig1 a pump 1 containing a flow control valve draws hydraulic fluid oil from an oil tank 30 and forces it out always at a constant flow rate , into a supply line 2 . this hydraulic fluid oil is supplied to a servo valve 3 of an open center type , which produces a fluid pressure on the upstream side in accordance with steering wheel movement , and returns excess oil to the pump 1 through a return line 5 . the fluid pressure produced by the servo valve 3 is introduced into a proper one of the two power chambers of a power cylinder 6 , and thus provides a power assistance . there is further provided , between the supply line 2 and the return line 5 , a bypass line 7 bypassing the servo valve 3 . a bypass control valve 8 is disposed in the bypass line 7 for controlling the flow through the bypass line 7 . the bypass control valve 8 is controlled by a control circuit 10 which is provided with electric power from a power source 9 . the control circuit 10 supplies an electric current of a controlled magnitude to a moving coil 12 of the bypass valve . by a repulsive force between the moving coil 12 and a fixed coil 14 caused by the supplied current , a plunger 12a which is fixed with the moving coil 12 and urged toward the right in fig1 by a spring 13 , is moved toward the left . this leftward movement of the plunger 12a reduces the opening degree of a variable orifice 15 to control the flow rate through the bypass line 7 . in this way , the control circuit 10 is capable of controlling the amount of fluid supply to the servo valve 3 by controlling the fluid flow through the bypass line 7 . the bypass valve 8 further has a spool 16 which is arranged to maintain the pressure difference between the both sides of the orifice 15 constant , so that the amount of the fluid flowing through the bypass line 7 is not influenced by a change of the assist pressure produced by the servo valve 3 but is corrected controlled by the opening degree of the orifice 15 . the control circuit 10 controls the bypass valve 8 in accordance with two input signals , one from a vehicle speed sensor 11 and the other from an angle sensor 17 for sensing an angular displacement of the steering wheel 4 . for example , the angle sensor 17 is composed of a potentiometer provided to a steering shaft 18 . as shown in fig2 the control circuit 10 comprises a differentiator or a differentiating circuit 19 , two operation circuits 20 and 22 , a comparator 21 , and an amplifier 23 . the angle signal of the angle sensor 17 indicative of an angular displacement of the steering wheel 4 is first fed to the differentiator 19 , which differentiates the angle signal and produces an angular velocity signal indicative of the time rate of change of the angular displacement . the time rate of change of the angular displacement is the angular velocity of the steering wheel . this angular velocity signal of the differentiator 19 is supplied to the operation circuit ( second operation circuit ) 20 . the operation circuit 20 calculates a desired quantity or of the fluid supply to the servo valve 3 in accordance with the angular velocity of the steering wheel . in this case , the desired quantity of the fluid supply rate is determined in accordance with an increase rate of the capacity of one power chamber of the power cylinder 6 so as to prevent a lack of the hydraulic fluid supply to the power cylinder 6 . the increase rate of the capacity of one power chamber of the power cylinder 6 is determined by the angular velocity of the steering wheel . if the fluid supply to the power cylinder 6 is smaller than the increase rate of the capacity of one power chamber of the power cylinder 6 , this results in a lack of the fluid supply to the power cylinder 6 . therefore , in order to prevent a lack of the fluid supply to the power cylinder 6 , the desired quantity must not be smaller than , but must be equal to or greater than this increase rate of the capacity of one power chamber of the power cylinder 6 . thus , the operation circuit 20 produces an output signal indicative of the calculated desired quantity and sends this output signal to the comparator 21 . on the other hand , the vehicle speed signal of the vehicle speed sensor 11 is sent to the operation circuit ( first operation circuit ) 22 of the control circuit 10 , which determines a basic quantity q b of the fluid supply in accordance with the vehicle speed . the operation circuit 22 determines the basic quantity of the fluid supply to control the fluid supply to the servo valve 3 in such a manner that the steering effort is made heavier as the vehicle speed increases . that is , the basic quantity is decreased as the vehicle speed increases . the output signal of the operation circuit 22 indicative of the thus determined basic quantity of the fluid supply is supplied to the comparator 21 . the comparator 21 compares the signal from the operation circuit 20 and the signal from the operation circuit 22 , and allows a greater one of both signals to pass to the amplifier 23 whichever signal is greater . that is , the comparator 21 compares the basic quantity q b determined by the operation circuit ( second operation circuit ) 22 and the desired quantity q d determined by the operation circuit ( first operation circuit ) 20 , and then determines an actual quantity of the fluid supply rate which is equal to the basic quantity if the basic quantity is equal to or greater than the desired quantity , and which is equal to the desired quantity if the desired quantity is greater than the basic quantity . thus , the comparator 21 produces a signal indicative of the determined actual quantity , and supplies the signal to the amplifier 23 . the amplifier 23 amplifies the input signal and then supplies it to the moving coil 12 . thus , the bypass valve 8 reduces the fluid supply to the servo valve 3 by increasing the flow rate of the fluid flowing through the bypass line 7 as the vehicle speed increases in order to make the steering effort heavier at higher vehicle speeds . on the other hand , the bypass valve 8 increases the fluid supply beyond the amount determined by the vehicle speed if the driver turns the steering wheel 4 so rapidly that the amount of the fluid required by the power cylinder 6 exceeds the fluid supply determined by the vehicle speed . thus , the fluid supply is controlled to satisfy the demand of the power cylinder 6 even if the angular velocity of the steering wheel 4 is high , so that this system can avoid the possibility that the steering effort becomes heavy abruptly by reason of a lack of the fluid supply . another embodiment of the present invention is shown in fig3 . in this embodiment , the rate of the fluid supply determined by the vehicle speed is modified in accordance with the angular velocity signal . in the control circuit shown in fig3 the operation circuit 20 and the comparator 21 in fig2 are replaced by two operation circuits 24 and 25 . the operation circuit 24 ( demanded quantity determining circuit ) receives the angular velocity signal from the differentiator 19 as in the preceding embodiment , determines a demanded quantity q d of the fluid supply , that is , an increase rate of the capacity of one chamber of the power cylinder 6 corresponding to the angular velocity of the steering wheel 4 , and produces an output signal indicative of the determined demanded quantity of the fluid supply . the output signal of the operation circuit 24 is supplied to the operation circuit ( adder circuit ) 25 which adds the signal of the operation circuit 24 to the signal from the operation circuit 22 , and sends an output signal indicative of the sum to the amplifier 23 . that is , in this embodiment , the actual quantity in accordance with which the fluid supply to the servo valve is actually controlled , is determined by the operation circuit ( adder circuit ) 25 so that the actual quantity is the sum of the basic quantity and the demanded quantity . the amplifier 23 amplifies the input signal and supplies it to the moving coil 12 . accordingly , when the vehicle is running at high speed without manipulation of the steering wheel , the operation circuit 25 is provided with no signal from the operation circuit 24 , and controls the fluid supply to the servo valve 3 in accordance with the vehicle speed . if the steering wheel 4 is turned when the vehicle is running at high speed , the operation circuit 24 produces the output signal indicative of the fluid supply rate demanded in accordance with the angular velocity of the steering wheel , and the operation circuit 25 adds this output signal of the operation circuit 24 to the signal from the operation circuit 22 . thus , the fluid supply is increased when the angular velocity of the steering wheel is high , so that a lack of fluid supply is prevented even when the steering wheel is turned rapidly at high vehicle speed . | 1 |
referring to fig1 , there is shown a generating system for generating electricity which is indicated by the reference numeral 1 . the generating system 1 comprises a conical member 3 made of a flexible material such as polyethylene or polypropylene or even carbon fibre . it may be a woven or sheet material . if the flexible material is prone to be fouled by marine organisms , it is preferred that at least the outer surface of the flexible material be covered by an anti - fouling agent or a material which resists fouling such as polyethylene . the base 4 of the conical member 3 sits on the sea floor 5 and will be held down by appropriate means some of which are described hereinafter . the base 4 sits over a seep 13 from which there is a water flow 15 . the upper portion 6 of the conical member 3 is provided with a join 21 connecting the narrower end of the conical member to a flexible pipe 23 . the flexible pipe may be made of any material which may be sufficiently strong to resist the pressure of water inside the flexible pipe and it may also incorporate or be composed of a material which resists fouling by marine organisms . it may be formed of the same material as the material forming the conical member . a float 11 joined by a cable 12 to a relief valve 19 provided at the top of the conical member holds the conical member upright at a level beneath the surface 17 of the sea . in this way , it is possible to maintain the top of the conical member at a depth below which it is not likely to be unduly disturbed by ocean waves . a solid pipe 25 joined to the end of the flexible pipe 23 at a region where the flexible pipe abuts the sloping floor of the sea floor sits along the sloping floor and directs water flowing through the pipe to the shore 9 . an electrical generator 27 sitting on the shore 9 is driven by water from the pipe 25 . an offtake pipe 29 takes water exiting the electrical generator and returns it to the sea or pipes it for ongoing use such as irrigation or domestic use . in fig2 , it can be seen that the conical member 3 has its edges covered by an aggregate 31 to hold the conical member down on the sea floor in a manner that the water flow 15 from the seep is not in communication with the water of the sea . in such an arrangement , any pressure inherent in the water flow 15 is additive to the pressure derived from the difference in density between the water flow 15 and the sea water . in fig3 a , it can be seen that the conical collecting member having a circular base 35 and an apex 37 is reinforced with battens 39 . offtake water 40 is bled off from near the apex of the conical collecting member 33 as per the description with reference to fig1 . in fig3 b , the conical member 41 has a square base 43 . it may also optionally be reinforced with battens and offtake water 45 is again taken near the apex of the conical member . the collecting member 47 shown with reference to fig3 c shows that a range of alternative shapes of collecting members may be used provided that offtake water 49 is taken from a high point along the collecting member and provided the cross - sectional area of the connection for taking the offtake water 49 is less than the cross - sectional area of the seep over which the collecting member is placed . this is to ensure that there is sufficient water flow and pressure to drive machinery which is piped from the seep . it is to be appreciated that all types of different shapes and sizes of collecting member may be used depending upon the particular dimensions of the seep , the depth of the water , topography and rate of water flow . in this regard , referring to fig4 , which shows a multiple system generally designated 51 , it can be seen that two or more collecting members such as the two conical members 53 may be placed over one or more seeps providing seep water 54 and may be joined in series by flexible pipes 55 which can direct water from the seep to one or more locations . whilst the illustration in fig4 shows two collecting members 53 in series , it is to be appreciated that , series , parallel and combination series / parallel systems may also be employed . referring to fig5 , the illustration on the left hand of fig5 shows one of the first stages of deployment of a conical member over a seep water flow 65 prior to the conical member being fully erected . initially , a flexible membrane 57 wrapped on a pole 59 is suspended beneath the ocean surface 63 by a float 61 . the pole 59 is held down by a weight 71 and wires 73 secure the bottom of the , flexible membrane , to a plurality of weights 67 . the wires 73 extend under pulleys 81 and extend upwardly as wires 69 to one or more vessels on the surface 63 of the water during deployment . by pulling on wires 69 , the flexible membrane is extended to the conical shape shown on the right side of the drawing of fig5 . a cable 77 extends into and attaches to the relief valve . the float 61 suspends the top of the flexible membrane 57 at a predetermined depth and maintains it in a conical shape . subsequently , the offtake pipe 79 may be fitted to the top of the conical member in the region of the pressure relief valve and aggregate may be placed over the edges of the bottom of the conical member to hold it on to the ocean floor . whilst the above description includes the preferred embodiments of the invention , it is to be understood that many variations , alterations , modifications and / or additions may be introduced into the constructions and arrangements of parts previously described without departing from the essential features or the spirit or ambit of the invention . it will be also understood that where the word โ comprise โ, and variations such as โ comprises โ and โ comprising โ, are used in this specification , unless the context requires otherwise such use is intended to imply the inclusion of a stated feature or features but is not to be taken as excluding the presence of other feature or features . the reference to any prior art in this specification is not , and should not be taken as , an acknowledgment or any form of suggestion that such prior art forms part of the common general knowledge . | 5 |
referring to fig1 a , 1 b , and 1 c , an exemplary rainwater collection system 10 includes a building downspout 12 ( e . g ., connected to a roof gutter system ), a first flush diversion unit 14 and a pretreatment unit 16 that feed to one or more storage tanks 18 . the first flush diversion unit 14 includes an inlet 20 and outlets 22 and 24 . the downspout 12 connects to the inlet 20 to feed water into the unit 14 . internal of the unit a diversion control device 26 ( fig2 a , 2 b and 2 c ) is located such that in one position ( bypass mode ( fig2 b )) the device causes or permits incoming water to flow to the outlet 24 , while in another position ( collection mode โ fig2 c )) the device causes or permits water to flow to the outlet 22 . an internal wall 28 of the diversion unit separates the two outlets 22 and 24 . outlet 22 feeds to a collection path that includes the pretreatment unit 16 and piping 31 , while outlet 24 feeds to a traditional runoff path such as standard downspout piping 27 ( e . g ., typically a path that does not involve collection of the water for later use ). the diversion control device 26 includes an associated actuator 30 ( e . g ., a pivotally mounted solenoid or motor with associated linear actuator rod 33 ) that is linked to control the position of the device 26 . the actuator may be powered by standard line power or alternatively , by a battery , source of solar power , or any combination of the foregoing . in the illustrated embodiment shown in fig2 b and 2c , the device 26 takes the form of a channel or plate member or flapper 32 that is pivotably moveable between the two positions . in the collection mode position the channel member 32 is moved below the inlet 20 to cause the incoming water to flow over toward the outlet 22 . the diversion control device 26 may be controlled based upon rainfall quantity . specifically , a rainwater gauge 34 ( fig1 a and 1b ) with associated electronic or electrical control may be used to monitor rainfall and control when the actuator moves the diversion control device from the bypass mode position to the collection mode position . in the illustrated example the rainwater gauge 34 is located above one of the tanks 18 and may detect when the rainwater reaches a specific level or depth ( certain number of millimeters etc . ), which may be adjustable . of course , the location of the rainwater gauge could vary . when the specific level is detected , a signal is sent to the actuator 30 ( e . g ., via wire or wireless ) and the actuator responds by moving the device 26 . the device 26 is normally in the bypass mode position and is only moved to the collection mode position after the specific level of rainfall has occurred . after a predetermined amount of time without any rainfall , which may be adjustable , the device 26 resets to the bypass mode position . in this manner , the first flush or initial flow associated with a rain event flows straight through the device from input 20 to output 24 so that leaves , twigs , bird droppings , dead bugs or birds , rodents and other contaminants bypass the rainwater collection system . the cleaner water is then collected in the system for later use and after the rain event the system is reset to prepare for the next rain event . in addition , as shown in fig2 a , the first flush diversion unit 14 includes an access opening 36 that is closed by a removable panel 38 to enable the device 26 to be evaluated if necessary and to facilitate cleaning the interior of the unit . as shown in fig3 a , the pretreatment device 16 includes an inlet 40 and an outlet 42 . the inlet is connected to receive flow from the first flush control device output 22 . in the illustrated embodiment shown in expanded view in fig3 b , water entering the device 16 impinges , preferably tangentially or substantially tangentially , upon a curved internal deflector panel 44 and moves downward into a collection space 46 defined by lower screen member 48 . the water must move outward through a lower screen member 48 ( e . g ., cylindrical in shape ) that defines the collection space 46 , as shown in fig3 c . in one example , the screen member may take the form of a continuous deflection screen such as that described in u . s . pat . no . 5 , 788 , 848 , which is hereby incorporated by reference herein in its entirety . after moving through the screen the water can then move back upward to exit through the space between the lower screen member and the housing and through outlet 42 . in this manner , incoming debris can be trapped within the collection space to avoid such debris entering the collection tanks 18 . referring to fig3 b , 3 d , and 3 e , in one embodiment , the internal structure of the pretreatment device 16 is formed as removable module or unit , including a lower base ring 50 that is diametrically sized to match the internal diameter to the tank or housing 52 of the unit . the periphery of the ring may include one or more slots 54 that are positioned to align with angles or plates 56 that are mounted on the internal surface of the tank 52 . in this manner , proper alignment of the module within the tank 52 is assured . the upper portion of the module also includes diametrically opposed edge trim members 58 and 60 that are sized to engage with the internal surface of the tank wall to help stabilize the module within the tank . the tank includes a removable access lid 62 for cleaning the collection space and / or for removing the module . the collection space may include a solid floor 64 ( e . g ., internal part of ring 50 ), as shown in fig3 f , so that any collected debris will stay with the module upon its removal , which can then be emptied by simply turning the module upside down . an overflow path 33 ( fig1 b ) may also be provided from the storage tank 18 back to the traditional runoff path in the event the water flow into the storage tank exceeds the tank capacity . while the primary embodiment illustrates use of an above - ground system that receives water from a gutter downspout , it is recognized that the various features of the invention could be implemented in a system in which the storage tank ( s ), diversion unit and / or pretreatment device are located underground . in addition , although the rainwater collection system shown in fig1 a utilizes an above ground vertical standing storage tank , it is recognized that a horizontally disposed storage tank can be used , as well as buried storage tanks . also , while the first flush diversion unit and pretreatment unit of the primary embodiment are , in each case , shown as mounted on a building wall structure , other locations for such units are possible . in one implementation , as shown in fig4 and 4a , the storage tank includes an internal day tank configuration as follows . water enters the storage tank 1 through the inlet pipe 2 into a first compartment 66 . in one embodiment , following the inlet pipe 2 , the water encounters a calming inlet , comprising at least one baffle 74 and an overflow compartment 3 . water is allowed to enter an internal day tank compartment 68 behind ( e . g . to the left in fig4 ) the weir wall 5 through one way valve 6 and opening in the wall 7 . the first compartment 66 and the internal day tank compartment 68 are separated by the weir wall 5 . when water is called for from the tank , a pump 4 located in the internal day tank compartment is powered and level or depth in the tank 1 is reduced by pulling water from the internal day tank compartment 68 . level sensor 8 will indicate a low water level , and fresh water makeup line 9 is responsively activated ( e . g ., a valve is opened ) to refill internal day tank compartment . the internal day tank compartment 68 fills and one - way valve 6 closes preventing water to traverse weir wall 5 through opening 7 as level of water rises above one way valve 6 . when level sensor 8 indicates that peak refill level of the day tank side of the unit is achieved , the fresh water makeup line 9 is responsively turned off or closed . the remainder of storage tank 1 , e . g . the first compartment 66 , is available for storage of rainwater from next storm event . in one embodiment , the location of the weir wall 5 between a first side 70 and a second side 72 of the storage tank is variable . the amount of fresh water required to fill the internal day tank compartment can be set by appropriate positioning of the weir wall 5 within the storage tank and setting of the fill level triggered by the senor 8 so that a large volume is not needed and so that sufficient space remains in the tank to collect rainwater from the next storm event . typically , the minimum internal day tank compartment volume ( e . g ., the amount of fresh water that would be called for if the day tank side of the unit was empty ) may be set at between 40 and 100 gallons , though numerous variations are possible . in one embodiment , fresh water can be well or municipal water . it is to be clearly understood that the above description is intended by way of illustration and example only and is not intended to be taken by way of limitation . for example , while the primary embodiment contemplates a storage tank formed of a tubular pipe structure ( e . g ., corrugated metal pipe or some form of plastic pipe such as steel reinforced plastic pipe ), other collection unit structures could be used , including concrete or metal plate . moreover , a collection unit could be formed of multiple interconnected tanks . other variations are possible . | 8 |
turning now to the drawings wherein like numbers refer to like structures , fig1 schematically illustrates a compression ignition engine 10 for an on - highway vehicle 12 . the engine 10 includes an engine control unit 14 that controls operation of the engine 10 and also controls exhaust component urea dosing according to the present invention as described below . exhaust manifold sensors 16 and tail pipe sensors 18 provide information to the engine control unit ( ecu ) 14 , that may be comprised of an engine control module and a component control module in communication with each other over an engine common area network ( ecan ) that is used to ensure that the component control module and the ecu functions in a coordinated manner to operate the engine and attendant systems . the ecu controls the engine and the exhaust component operation , including urea dosage as will hereinafter be described . the exhaust manifold sensors 16 may provide information regarding no x levels , air / fuel ratios , temperature , and pressure at any of the exhaust system components . more specifically , the exhaust manifold sensors 16 and tail pipe sensors 18 may provide information regarding no r , and temperature that enable the ecu to detect an impending need for ammonia storage in the scr or urea dosage . the ecu may also monitor other engine operating parameters to determine the need for urea dosage or ammonia storage . for example , the ecu may contain data tables or maps populated with data . the map or data points may further be developed according to a one dimension model of the operation of the scr and a one dimension model inverse logic model for the scr . the ecu , based upon input from sensors at the scr inlet and scr outlet uses the tables or maps to determine how urea dosing can be adjusted and the engine exhaust gas flow will meet emission standards regardless of the age of the scr . the exhaust system is seen with conduit 19 and particulate filter 22 , catalyzed soot filter 24 , or no absorber catalyst , such as the scr 20 . urea doser 26 is in close proximity to the scr inlet for the administration of urea according to a method of the present disclosure . a warning light 28 may be provided to alert an operator that the scr is too old to operate efficiently and should be replaced . turning to fig2 , there is illustrated a model based open loop scr control system i / o 30 according to one embodiment of the present disclosure . specifically , the model illustrates that engine air mass flow rate 32 , engine total air flow rate 34 , engine no flow rate 36 , scr inlet no 2 over no ratio 38 , scr inlet pressure 40 , scr inlet temperature 42 , doc inlet temperature 44 , ambient temperature 46 , o 2 flow rate from diesel particulate filter ( dpf ) 48 , and vehicle speed 50 are input into the model . the model considers sensor input indicative of ammonia storage of the scr 52 , ammonia slip from the scr 54 , scr outlet no 56 , scr deno x efficiency 58 and the requested ammonia rate in order to determine and the ammonia rate for dosing and thereby control the urea doser to ensure that the proper amount of urea is used at all stages of the scr operation as indicated at 59 . fig3 is a schematic representation of model 60 showing the inputs as described in relation to fig2 above , and their consideration by a one dimensional model 62 that then inputs its determinations to model inversion 64 which , together with the input regarding critical ammonia storage and slip 66 , is considered in the model inversion 64 to determine ammonia dosing rate 59 . note that the ammonia dosing rate is in a feedback loop with the one dimensional scr model 62 as an input therein . generally , the urea dosing rate is controlled by targeting the critical ammonia storage and slip in the model schematically presented in fig3 . specifically , one example to explain the inverse logic of a one dimensional scr model may be represented by the equation ( 1 ) ฮฑ = f a ( t , time resi ) b = f b ( ฮธ star , c nox ) c = f a ( ratio no2 , c 02 ) ฮธ star = f ฮธ ( t , t , time resi , ratio no2 , c 02 , c nox , c nh3 . . . ) one example of the inverse model , as depicted in fig3 , may be represented by the equation wherein the variables have the same values as set forth in regard to equation ( 1 ) above . ฮธ = 1 is the ammonia storage capacity of the scr . if the scr is fully stored with ammonia , there will be ammonia slippage from the scr . the higher the ammonia storage levels , the higher the conversion of ammonia and no x to n 2 will occur , but there will also be higher ammonia slip past the scr . in operation , based upon engine and scr conditions , a particular ammonia storage level is targeted so that there can be a higher no x conversion rate to n 2 , thereby reducing ammonia slippage . fig4 a through 9b are not taken from actual test data , but are merely predictive and provide to illustrate the concept of the instant application . fig4 a is a graph showing ammonia storage capacity in the scr as a function of scr temperature , based upon the model developed according to one embodiment of the present disclosure . specifically , model data points 70 , 72 , 24 , 76 and 78 form a curve 80 , that is almost identical with observed data points 82 , 84 , 86 , 88 and 90 which form an almost identical curve 92 as curve 80 . this correlation indicates that the model is a very good predictor of ammonia storage as a function of scr temperature , and may be relied upon instead of the actual observed data points . fig4 b is a graph showing ammonia storage level in the scr as a function of time and temperature of the scr . it can be seen that as scr inlet temperature 92 increases to a spike 93 of about 400 ยฐ c ., ammonia storage 94 increases until the scr inlet temperature reaches about 400 ยฐ c ., at which point 95 ammonia storage decreases , and ammonia slippage increases . considering the data from the two graphs of fig4 a and 4b , it may be seen that ammonia storage should be limited to prevent ammonia slip past the scr during step - acceleration operation of the vehicle . the graph shows that the nh 3 dosing strategy is best determined by noting when the nh 3 slip is equal to nh 3 slip critical 93 , should be that ammonia slippage should equal ammonia slip critical and the nh 3 storage 96 is less than or equal to ammonia storage critical fig5 is a reading of a model based scr control at step acceleration condition . basically , the graphs show scr substrate temperature , dosing alpha , deno x efficiency , ammonia slippage past the scr and ammonia storage percent . it can be seen that under dosing due the lower deno x efficiency results in higher ammonia storage critical , whereas overdosing due to ammonia oxidation results in an increase in the ammonia slip critical . fig6 is graph demonstrating a one dimension ammonia storage distribution based upon scr inlet temperature and time . it can be seen that as the scr inlet temperature changes from 200 to 350 ยฐ c ., at 2000 rpms , ammonia storage distribution decreases and assumes an almost steady state as indicated at 97 . fig7 is a graph showing model based scr control at transient and steady state conditions . note that when the scr substrate reaches a predetermined temperature , in this case of about 350 ยฐ c ., the dosing alpha , deno x efficiency ammonia slip and ammonia storage percentage each assumed a steady state , as indicated at 81 , 83 , 85 and 87 respectively . fig8 a and 8b are graphs showing constant dosing alpha strategy ammonia slip . as seen therein the dosing alpha is equal to 1 , and ammonia slip past the scr depends upon cycles . as is apparent in the graphs , a longer low temperature period permits higher ammonia slip past the scr . the graph 100 is comprised of two parts . section 102 is the temperature of the scr over operating on engine and 104 is the temperature of the scr in celsius . section 106 is nh 3 slip as measured in parts per million 108 . time in seconds is shown at 110 . as can be seen by reference to graphs 8 a & amp ; 8 b , as cr temperature increases to beyond about 650 ยฐ c ., the nh 3 slip , as measured in ppm past the scr spikes , and then decreases , and then decreases as the scr temperature decreases due to dosing with fuel . in addition , the longer the period of time the scr remains at a low temperature , the greater the ammonia slip past the scr . in addition , ammonia slip past the scr is independent of engine operation . rather , it is dependent upon temperature of the scr . fig8 c and 8d form a graph showing a model based dosing strategy ammonia slip according to one embodiment of the present application . specifically , the model shows that as scr temperature passes approximately 650 ยฐ c ., the nh 3 slippage spikes , and decreases when the scr temperature is reduced . moreover , the model further shows that the nh 3 slip is independent of engine cycle time . fig9 a is graph 112 showing a model of scr aging as a function of scr temperature . the x axis 114 is scr temperature in celsius , and the y asix 116 is the scr aging as a function of scr temperatures . basically , the aging of the scr may be presented by the equation : using the formula , it is possible to create a scr aging factor function based on scr aging test results by assuming aging factor is unit at 700 ยฐ c ., and normalize aging rate at other temperatures to establish a correlation between scr age and no x reduction efficiency . fig9 b is a graph 118 showing scr deno x efficiency as a function of scr aging time . to create a scr aging factor function based on actual scr test results , it is helpful to assume that the aging factor is a predetermined temperature , in this case , the unit is at about 700 ยฐ c . the scr aging rate may be normalized at other temperatures as well . a correlation between the scr age and the nox reduction efficiency is established and the plot 120 set forth in fig9 a indicates that as scr temperature rises , the scr aging factor rises as well . similarly , fig9 b the plots 122 , 124 and 126 indicate that when the scr is operated at 700 ยฐ c ., 600 ยฐ c . and 500 ยฐ c . respectively , the deno x efficiency decreases as the scr aging cycle time advances . fig1 is a software flow diagram showing one method 128 according to the present disclosure . specifically , step 130 is determining the condition of the scr . in this regard , temperature and time operated at specific temperature above a predetermined temperature are factors that are considered . step 132 is determining engine out no x flow rate into the scr . this may be accomplished by sensor input at the scr inlet . step 134 is adapting a urea dosing condition to current scr conditions , according to the model and inverse models as set forth above . step 136 is determine the ammonia slip , and no x conversion at the scr and step 138 is recalibrate the scr condition to a pretargeted ammonia storage based upon ammonia slip and no x conversion , and the software loops back to step 130 . the words used in the specification are words of description and not words of limitation . many variations and modifications are possible without departing from the scope and spirit of the invention as set forth in the appended claims . | 8 |
fig1 shows a connector member 3 in place with an optical fiber 1 mounted therein . the end of the fiber is stripped , i . e ., the protective jacket 2 has been removed . similar to the prior art , the connector member 3 has at its point an outer cone 16 serving as a fitting surface to an inner cone in a gauge block 15 which has two concentric inner cones , and an opposed outer cone 16 of another connector member shown schematically . the outer cone 16 is a portion of a tube 4 on which there is a fixing nut 8 . in the example shown , the fixing nut is connected to the tube 4 via a loose ring 7 in a groove , the fixing nut 8 is designed for fixing the connecting member to an intermediate piece ( not shown ), for example . the tube section 4 is extended with a second , screwed - on tube section 5 , so that the member has a first part 4 and a second part 5 , both with a through - hole 12 . the hole in the first part 4 is tapered at the tip to form an interior approximately conical surface 10 . an adjuster member 9 , also with a through - hole 13 , is inserted in the hole 12 . the fiber 1 is inserted in the hole 13 . the adjuster member 9 is sufficiently long to protrude out of the part 4 at the rear when the part 5 is not in place , but hardly protrudes , if at all , from the part 5 when it is screwed onto the thread 6 . ( fastening by other means than threads , i . e ., adhesive , is of course also possible .) the adjuster member 9 is pointed at the end , with a mounted tip 11 in the example shown . the tip 11 is more bluntly tapered than the tapered surface 10 of the hole 12 , and thus the adjuster member rests against the surface 10 somewhat inwards from the tip , in this case about 2 mm inwards . when mounting and adjusting the connector member , the fiber 1 is stripped at the end and inserted in the adjuster member 9 in its hole 13 which is tapered at 14 . it is advisable to coat the end of the fiber , with a thermosetting resin for example to fix it in the adjuster member and anchor the end at the tip . the rear part 5 is then slipped on outside the fiber coating 2 so as to be out of the way . the adjuster member 9 is then inserted in the front part 4 until the tip reaches the bottom . the front part is mounted in an inner cone in front of a microscope . it is now possible to move the fiber somewhat in relation to the axis of the outer cone 16 , by allowing the adjuster member 9 to pivot , its point sliding where it rests against the surface 10 . it is then possible to study in the microscope the fiber , which is preferably illuminated . this illumination can be effected from the opposite end of the fiber . it is also possible to allow a light beam to enter via the hole 18 in the adjuster member , this being suitable if the opposite end of the fiber is inaccessible , for example . the core of the fiber is centered to cross hairs in the microscope by a x - y - board actuating the extension 21 of the adjuster member . the adjuster member is then permanently fixed in place , e . g ., with thermosetting resin at 17 , for example , and the extension 21 is removed . suitable thermosetting resins are known to those skilled in the art . the entire space between the part 4 and the adjuster member 9 may possibly be filled with thermosetting resin . the rear part 5 is then screwed in place on the front part 4 , thus concealing the adjuster member 9 . it is then possible , if desired , to pinch the rear part 5 to remove mechanical pressure on the fiber cable 2 in a conventional manner . the means for adjustment shown in fig2 is especially suited to this method . a so - called reversed metallographic microscope 24 has a lens ( with 10 ร enlargement and n . a . 0 . 2 , for example ), a mirror 26 and an ocular 27 , in front of which there are cross hairs or a measuring ring disc 28 . the microscope is adjusted to view along the axis of an upwardly opening inner cone in a disc 15 &# 39 ;. the part 4 is fixed with the nut 8 and the adjuster member 9 , with the fiber 1 anchored therein , is inserted in the part 4 . an extension arm 21 is fixed to the protruding rear end of the adjuster member by means of a screw 22 . the extension arm 21 has at its end a slot 30 going through the center , so that the fiber 1 can exit to the side . the microscope table has a column 31 at the top of which there is a common crossboard 20 with adjustment means in the form of knobs 32 and 33 for translational movement in two perpendicular directions . a resilient plate 23 which can be made to press against the free end of the extension arm 21 is mounted on the crossboard 20 . by turning the knobs 32 and 33 , the extension arm 21 and the adjuster member 9 can be pivoted against the surface 10 ( fig1 ), thereby adjusting the fiber as it is observed in the microscope . the length of the extension arm can be 100 mm for example . as is already mentioned , the adjuster member bears against the surface 10 approximately 2 mm inwards from the tip . a movement of 0 . 01 mm on the crossboard results in an angular change of 10 - 4 rad ., and the outer end of the fiber will move 0 . 2 ฮผm . since any play in the crossboard can be taken into account , it is clear that it is possible to carry out an adjustment to at least this accuracy . it should be noted that the direction of the fiber does not change very much as the adjuster member 9 is pivoted . this is important since light transported in the fiber emerges in a certain direction ( low numerical aperture , n . a . often of the order of magnitude 0 . 1 ). as was stated above , the required adjustment is often 3 - 5 ฮผm . moving the center of the fiber end 5 ฮผm will result in an angular change of 2 . 5 ร 10 - 3 rad ., which is substantially negligible relative to the numerical aperture . it is also possible to use a microscope which can produce a conoscopic image ( e . g ., through an amici - bertrand lens ), and thereby check , in the same apparatus , that the light emerging from the fiber end does not deviate in direction too much from the axis of symmetry of the connector member . a particular embodiment of the invention involves the following steps . the stripped end of the fiber 1 is inserted in the adjuster member 9 , which has first been filled with thermosetting resin ( two - component adhesive of type epotech 360 from epoxy technology , which sets at 120 ยฐ c .). after setting , the protruding fiber end is cut off by first lightly scoring and then breaking . the adjuster member 9 is placed loosely in the front part 4 , and the entire unit is sanded by hand from the front using sandpaper of decreasing coarseness in the usual manner to achieve an even surface structure of the fiber end . the unit is then mounted in an adjusting means as shown in fig2 and a ring of adhesive of rather thick cyanacrylate adhesive ( tak pak from loctite ) 17 ( see fig1 ) is applied , and adjustment is then carried out . after adjustment is completed , the cyanacrylate adhesive is set by applying the appropriate hardener , producing very rapid setting . the adjusted arrangement can then be removed and a thermosetting resin of the above - mentioned epoxy type injected in the space between the adjuster member 9 and the front end 4 . providing the nose portion at 19 &# 39 ; with an axial groove enables the adhesive to penetrate to the tip . after hardening , the rear end can be screwed on and the fiber permanently fixed by clamping . it should be noted that the adjuster member in fig1 is made in two pieces , with a nose piece , because it would otherwise be difficult to drill a sufficiently small hole , of the size of the fiber . it is conceivable that the midportion of the adjuster member can be made of so - called cannular tubes and a somewhat heavier , specially - made tube attached in the other end , provided with the hole 18 . the visible portions of the connector member should be made in stainless material which makes it easier to achieve precision tolerances since no particular surface treatment is necessary . | 6 |
unless defined otherwise , all terms of art , notations and other scientific terms or terminology used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this disclosure belongs . many of the techniques and procedures described or referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art . as appropriate , procedures involving the use of commercially available kits and reagents are generally carried out in accordance with manufacturer defined protocols and / or parameters unless otherwise noted . all patents , applications , published applications and other publications referred to herein are incorporated by reference in their entirety . if a definition set forth in this section is contrary to or otherwise inconsistent with a definition set forth in the patents , applications , published applications , and other publications that are herein incorporated by reference , the definition set forth in this section prevails over the definition that is incorporated herein by reference . as used herein , โ a โ or โ an โ means โ at least one โ or โ one or more .โ this description may use relative spatial and / or orientation terms in describing the position and / or orientation of a component , apparatus , location , feature , or a portion thereof . unless specifically stated , or otherwise dictated by the context of the description , such terms , including , without limitation , top , bottom , above , below , under , on top of , upper , lower , left of , right of , in front of , behind , next to , adjacent , between , horizontal , vertical , diagonal , longitudinal , transverse , etc ., are used for convenience in referring to such component , apparatus , location , feature , or a portion thereof in the drawings and are not intended to be limiting . an actuator mechanism for compressing deformable fluid vessels โ such as blisters on a liquid reagent module โ embodying aspects of the present invention is shown at reference number 50 in fig2 . the actuator mechanism 50 may include an articulated blister actuator platen assembly 52 and a sliding actuator plate 66 . the sliding actuator plate 66 is configured to be movable in a direction that is generally parallel to the plane of the liquid reagent module โ horizontally in the illustrated embodiment โ and may be driven by a linear actuator , a rack and pinion , a belt drive , or other suitable motive means . sliding actuator plate 66 , in the illustrated embodiment , has v - shaped edges 76 that are supported in four v - rollers 74 to accommodate movement of the plate 66 in opposite rectilinear directions , while holding the sliding actuator plate 66 at a fixed spacing from the actuator platen assembly 52 . other features may be provided to guide the actuator plate 66 , such as rails and cooperating grooves . a component 40 โ which may comprise liquid reagent module 10 described above โ having one or more deformable fluid vessels , such as blisters 36 and 38 , is positioned within the actuator mechanism 50 beneath the articulated blister actuator platen assembly 52 . further details of the configuration of the articulated blister actuator platen assembly 52 and the operation thereof are shown in fig3 a - 6b . as shown in fig3 a and 3b , the actuator platen assembly 52 includes a chassis 54 . a cam body 56 is disposed within a slot 57 of the chassis 54 and is attached to the chassis 54 by a first pivot 58 . a platen 64 is pivotally attached to the cam body 56 by means of a second pivot 60 . the cam body 56 is held in a horizontal , unactuated position within the slot 57 by means of a torsional spring 55 coupled around the first pivot 58 . cam body 56 further includes a cam surface 65 along one edge thereof ( top edge in the figure ) which , in the exemplary embodiment shown in fig3 b , comprises an initial flat portion 61 , a convexly - curved portion 62 , and a second flat portion 63 . the sliding actuator plate 66 includes a cam follow 68 ( a roller in the illustrated embodiment ) rotatably mounted within a slot 72 formed in the actuator plate 66 . in an embodiment of the invention , one cam body 56 and associated platen 64 and cam follower 68 are associated with each deformable vessel ( e . g . blister 36 ) of the liquid reagent module 40 . the actuator platen assembly 52 and the sliding actuator plate 66 are configured to be movable relative to each other . in one embodiment , the actuator platen assembly 52 is fixed , and the actuator plate 66 is configured to move laterally relative to the platen assembly 52 , supported by the v - rollers 74 . lateral movement of the sliding actuator plate 66 , e . g ., in the direction โ a โ, causes the cam follower 68 to translate along the cam surface 65 of the cam body 56 , thereby actuating the cam body 56 and the platen 64 attached thereto . in fig3 a and 3b , before the sliding actuator plate 66 has begun to move relative to the actuator platen assembly 52 , the cam follower 68 is disposed on the initial flat portion 61 of the cam surface 65 of the cam body 56 . in fig4 a and 4b , the sliding actuator plate 66 has moved relative to the actuator platen assembly 52 in the direction โ a โ so that the cam follower 68 has moved across the initial flat portion 61 of the cam surface 65 and has just begun to engage the upwardly curved contour of the convexly - curved portion 62 of the cam surface 65 of the cam body 56 . in fig5 a and 5b , the sliding actuator plate 66 has proceeded in the direction โ a โ to a point such that the cam follower 68 is at the topmost point of the convexly - curved portion 62 of the cam surface 65 , thereby causing the cam body 56 to rotate about the first pivot 58 . the platen 64 is lowered by the downwardly pivoting cam body 56 and pivots relative to the cam body 56 about the second pivot 60 and thereby compresses the blister 36 . in fig6 a and 6b , sliding actuator plate 66 has moved to a position in the direction โ a โ relative to the actuator platen assembly 52 such that the cam follower 68 has progressed to the second flat portion 63 of the cam surface 65 . accordingly , the cam body 56 , urged by the torsion spring 55 , pivots about the first pivot 58 back to the unactuated position , thereby retracting the platen 64 . thus , the articulated blister actuator platen assembly 52 is constructed and arranged to convert the horizontal movement of actuator plate 66 into vertical movement of the platen 64 to compress a blister , and movement of the platen does not require pneumatic , electromechanical , or other components at larger distances above and / or below the liquid module . an alternative embodiment of a blister compression actuator mechanism is indicated by reference number 80 in fig7 a and 7b . actuator 80 includes a linear actuator 82 that is coupled to a cam rail 84 . cam rail 84 is supported for longitudinal movement by a first support rod 96 extending transversely through slot 86 and a second support rod 98 extending transversely through a second slot 88 formed in the cam rail 84 . the first support rod 96 and / or the second support rod 98 may include an annular groove within which portions of the cam rail 84 surrounding slot 86 or slot 88 may be supported , or cylindrical spacers may be placed over the first support rod 96 and / or the second support rod 98 on opposite sides of the cam rail 84 to prevent the cam rail 84 from twisting or sliding axially along the first support rail 96 and / or the second support rail 98 . cam rail 84 includes one or more cam profile slots . in the illustrated embodiment , cam rail 84 includes three cam profile slots 90 , 92 , and 94 . referring to cam profile slot 90 , in the illustrated embodiment , slot 90 includes , progressing from left to right in the figure , an initial horizontal portion , a downwardly sloped portion , and a second horizontal portion . the shapes of the cam profile slots are exemplary , and other shapes may be effectively implemented . the actuator mechanism 80 also includes a platen associated with each cam profile slot . in the illustrated embodiment , actuator 80 includes three platens 100 , 102 , 104 associated with cam profile slots 90 , 92 , 94 , respectively . first platen 100 is coupled to the cam profile slot 90 by a cam follower pin 106 extending transversely from the platen 100 into the cam profile slot 90 . similarly , second platen 102 is coupled to the second cam profile slot 92 by a cam follower pin 108 , and the third platen 104 is coupled to the third cam profile slot 94 by a cam follower pin 110 . platens 100 , 102 , 104 are supported and guided by a guide 112 , which may comprise a panel having openings formed therein conforming to the shape of each of the platens . in fig7 a , cam rail 84 is in its furthest right - most position , and the platens 100 , 102 , 104 are in their unactuated positions . each of the cam follower pins 106 , 108 , 110 is in the initial upper horizontal portion of the respective cam profile slot 90 , 92 , 94 . as the cam rail 84 is moved longitudinally to the left , in the direction โ a โ shown in fig7 b , by the linear actuator 82 , each cam follower pin 106 , 108 , 110 moves within its respective cam profile slot 90 , 92 , 94 until the cam follower pin is in the lower , second horizontal portion of the respective cam profile slot . movement of each of the pins 106 , 108 , 110 downwardly within its respective cam profile slot 90 , 92 , 94 causes a corresponding downward movement of the associated platen 100 , 102 , 104 . this movement of the platens thereby compresses a fluid vessel ( or blister ) located under each platen . each platen may compress a vessel directly in contact with the platen or it may contact the vessel through one or more intermediate components located between the vessel and the corresponding platen . thus , the blister compression actuator mechanism 80 is constructed and arranged to convert the horizontal movement cam rail 84 , driven by the linear actuator 82 , into vertical movement of the platens 100 , 102 , 104 to compress blisters , and movement of the platens does not require pneumatic , electromechanical , or other components at larger distances above and / or below the liquid module . when compressing a fluid vessel , or blister , to displace the fluid contents thereof , sufficient compressive force must be applied to the blister to break , or otherwise open , a breakable seal that is holding the fluid within the vessel . the amount of force required to break the seal and displace the fluid contents of a vessel typically increases as the volume of the vessel increases . this is illustrated in the bar graph shown in fig1 , which shows the minimum , maximum , and average blister burst forces required for blisters having volumes of 100 , 200 , 400 , and 3000 microliters . the average force required to burst a blister of 400 or less microliters is relatively small , ranging from an average of 10 . 7 lbf to 11 . 5 lbf . on the other hand , the force required to burst a blister of 3000 microliters is substantially larger , with an average burst force of 43 . 4 lbf and a maximum required burst force of greater than 65 lbf . generating such large forces can be difficult , especially in low profile actuator mechanisms , such as those described above , in which horizontal displacement of an actuator is converted into vertical , blister - compressing movement of a platen . accordingly , aspects of the present invention are embodied in methods and apparatus for opening a fluid vessel , or blister , in a manner that reduces the amount of force required to burst the vessel and displace the fluid contents of the vessel . such aspects of the invention are illustrated in fig8 a and 8b . as shown in fig8 a , a fluid vessel ( or blister ) 122 is mounted on a substrate 124 and is connected by means of a channel 130 to a sphere blister 128 . in certain embodiments , channel 130 may be initially blocked by a breakable seal . a film layer 129 may be disposed on the bottom of the substrate 124 to cover one or more channels formed in the bottom of the substrate 124 to form fluid conduits . an opening device , comprising a sphere 126 ( e . g ., a steel ball bearing ) is enclosed within the sphere blister 128 and is supported , as shown in fig8 a , within the sphere blister 128 by a foil partition or septum 125 . the foil partition 125 prevents fluid from flowing from the vessel 122 through a recess 127 and fluid exit port 123 . upon applying downward force to the sphere 126 , however , a large local compressive stress is generated due to the relatively small surface size of the sphere 126 , and the foil partition 125 can be broken with relatively little force to push the sphere 126 through the partition 125 and into the recess 127 , as shown in fig8 b . with the foil partition 125 broken , a relatively small additional force is required to break a seal within channel 130 and force the fluid to flow from the vessel 122 through the fluid exit port 123 . in fig8 b , the sphere blister 128 is shown intact . in some embodiments , a force applied to the sphere 126 to push it through the foil partition 125 would also collapse the sphere blister 128 . an apparatus for opening a vessel by pushing a sphere 126 through foil partition 125 is indicated by reference number 120 in fig9 a , 9b , 9c , 9d . in the illustrated embodiment , the apparatus 120 includes a ball actuator 140 extending through an opening formed through a blister plate , or platen , 132 . with the blister plate 132 and an actuator 138 configured for moving the blister plate 132 disposed above the vessel 122 , the ball actuator 140 is secured in a first position , shown in fig9 a , by a detent 136 that engages a detent collar 144 formed in the ball actuator 140 . as shown in fig9 b , the blister plate 132 is moved by the actuator 138 down to a position in which a contact end 142 of the ball actuator 140 contacts the top of the of the sphere blister 128 . actuator 138 may comprise a low profile actuator , such as actuator mechanisms 50 or 80 described above . as shown in fig9 c , continued downward movement of the blister plate 132 by the actuator 138 causes the ball actuator 140 to collapse the sphere blister 128 , thereby pushing the opening device , e . g ., sphere 126 , through a partition blocking fluid flow from the vessel 122 . in this regard , it will be appreciated that the detent must provide a holding force sufficient to prevent the ball actuator 140 from sliding relative to the blister plate 132 until after the sphere 126 has pierced the partition . thus , the detent must provide a holding force sufficient to collapse the sphere blister 128 and push the sphere 126 through a partition . as shown in fig9 d , continued downward movement of the blister plate 132 by the actuator 138 eventually overcomes the holding force provided by the detent 136 , and the ball actuator 140 is then released to move relative to the blister plate 132 , so that the blister plate can continue to move down and collapse the vessel 122 . after the vessel 122 is collapsed , the blister plate 132 can be raised by the actuator 138 to the position shown in fig9 a . as the blister plate 132 is being raised from the position shown in fig9 d to the position shown in 9 a , a hard stop 146 contacts a top end of the ball actuator 140 to prevent its continued upward movement , thereby sliding the ball actuator 140 relative to the blister plate 132 until the detent 136 contacts the detent collar 144 to reset the ball actuator 140 . an alternative embodiment of an apparatus for opening a vessel embodying aspects of the present invention is indicated by reference number 150 in fig1 . apparatus 150 includes a pivoting ball actuator 152 configured to pivot about a pivot pin 154 . a top surface 156 of the pivoting ball actuator 152 comprises a cam surface , and a cam follower 158 , comprising a roller , moving in the direction โ a โ along the cam surface 156 pivots the actuator 152 down in the direction โ b โ to collapse the sphere blister 128 and force the sphere 126 through the foil partition 125 . pivoting actuator 152 may further include a torsional spring ( not shown ) or other means for restoring the actuator to an up position disengaged with the sphere blister 128 when the cam follower 158 is withdrawn . fig1 is a plot of compressive load versus time showing an exemplary load versus time curve for an apparatus for opening a vessel embodying aspects of the present invention . as the apparatus contacts and begins to compress the sphere blister 128 , the load experiences an initial increase as shown at portion ( a ) of the graph . a plateau shown at portion ( b ) of the graph occurs after the sphere 126 penetrates the foil partition 125 . a second increase in the force load occurs when the blister plate 132 makes contact with and begins compressing the vessel 122 . a peak , as shown at part ( c ) of the plot , is reached as a breakable seal within channel 130 between the vessel 122 and the sphere blister 128 is broken . after the seal has been broken , the pressure drops dramatically , as shown at part ( d ) of the plot , as the vessel 122 is collapsed and the fluid contained therein is forced through the exit port 123 ( see fig8 a , 8b ) supporting the sphere 126 . an alternative apparatus for opening a vessel is indicated by reference number 160 in fig1 a . as shown in fig1 a , a fluid vessel ( or blister ) 162 is mounted on a substrate 172 and is connected by means of a channel โ which may or may not be initially blocked by a breakable seal โ to a dimple 161 . a film layer 164 may be disposed on the bottom of the substrate 172 to cover one or more channels formed in the bottom of the substrate 172 to form fluid conduits . an opening device comprising a cantilevered lance 166 is positioned within a lance chamber 170 formed in the substrate 172 where it is anchored at an end thereof by a screw attachment 168 . a foil partition or septum 165 seals the interior of the dimple 161 from the lance chamber 170 . an actuator pushes the lance 170 up in the direction โ a โ into the dimple 161 , thereby piercing the foil partition 165 and permitting fluid to flow from the blister 162 out of the lance chamber 170 and a fluid exit port . the spring force resilience of the lance 166 returns it to its initial position after the upward force is removed . in one embodiment , the lance 166 is made of metal . alternatively , a plastic lance could be part of a molded plastic substrate on which the blister 162 is formed . alternatively , a metallic lance could be heat staked onto a male plastic post . a further option is to employ a formed metal wire as a lance . a further alternative embodiment of an apparatus for opening a vessel is indicated by reference number 180 in fig1 . a component having one or more deformable vessels includes at least one blister 182 formed on a substrate 194 . in the arrangement shown in fig1 , an internal dimple 184 is formed inside the blister 182 . internal dimple 184 encloses an opening device comprising a fixed spike 186 projecting upwardly from a spike cavity 188 formed in the substrate 194 . a film layer 192 is disposed on an opposite side of the substrate 194 . as an actuator presses down on the blister 182 , internal pressure within the blister 182 causes the internal dimple 184 to collapse and invert . the inverted dimple is punctured by the fixed spike 186 , thereby permitting fluid within the blister 182 to flow through an exit port 190 . an alternative apparatus for opening a vessel is indicated by reference number 200 in fig1 a . as shown in fig1 a , a fluid vessel ( or blister ) 202 is mounted on a substrate 216 and is connected by means of a channel โ which may or may not be initially blocked by a breakable seal โ to a dimple 204 . an opening device comprising a lancing pin 206 having a fluid port 208 formed through the center thereof ( see fig1 b ) is disposed within a segmented bore 220 formed in the substrate 216 beneath the dimple 204 . a partition or septum 205 separates the dimple 204 from the bore 220 , thereby preventing fluid from exiting the blister 202 and dimple 204 . an actuator ( not shown ) presses on a film layer 212 disposed on a bottom portion of the substrate 216 in the direction โ a โ forcing the lancing pin 206 up within the segmented bore 220 until a shoulder 210 formed on the lancing pin 206 encounters a hard stop 222 formed in the segmented bore 220 . a lancing point of the pin 206 pierces the partition 205 thereby permitting fluid to flow through the fluid port 208 in the lancing pin 206 and out of a fluid exit channel 214 . an alternative embodiment of an apparatus for opening a vessel is indicated by reference number 230 in fig1 a and 16b . as shown in fig1 a , a fluid vessel ( or blister ) 232 is mounted on a substrate 244 and is connected by means of a channel โ which may or may not be initially blocked by a breakable seal โ to a dimple 234 . an opening device comprising a lancing pin 236 is disposed within a segmented board 246 formed in the substrate 244 beneath the dimple 234 . a partition or septum 235 separates the dimple 234 from the segmented bore 246 . the upper surface of the substrate 244 is sealed with a film 240 before the blister 232 and dimple 234 are adhered . an actuator ( not shown ) pushes up on the lancing pin 236 in the direction โ a โ until a shoulder 238 formed on the lancing pin 236 encounters hard stop 248 within the bore 246 . the pin 236 thereby pierces the partition 235 and remains in the upper position as fluid flows out along an exit channel 242 formed on an upper surface of the substrate 244 . a fluid tight seal is maintained between the pin 238 and the bore 246 by a slight interference fit . as the collapsible fluid vessels of a liquid reagent module are configured to be compressed and collapsed to displace the fluid contents from the vessel ( s ), such vessels are susceptible to damage or fluid leakage due to inadvertent exposures to contacts that impart a compressing force to the vessel . accordingly , when storing , handling , or transporting a component having one or more collapsible fluid vessels , it is desirable to protect the fluid vessel and avoid such inadvertent contact . the liquid reagent module could be stored within a rigid casing to protect the collapsible vessel ( s ) from unintended external forces , but such a casing would inhibit or prevent collapsing of the vessel by application of an external force . thus , the liquid reagent module would have to be removed from the casing prior to use , thereby leaving the collapsible vessel ( s ) of the module vulnerable to unintended external forces . an apparatus for protecting and interfacing with a collapsible vessel is indicated by reference number 260 in fig1 , 18 , and 19 . a component with one or more collapsible vessels includes a collapsible blister 262 formed on a substrate 264 . a dispensing channel 266 extends from the blister 262 to a frangible seal 268 . it is understood that , in some alternative embodiments , the dispensing channel 266 may be substituted with a breakable seal , providing an additional safeguard against an accidental reagent release . frangible seal 268 may comprise one of the apparatuses for opening a vessel described above and shown in any of fig8 - 16 . a rigid or semi - rigid housing is provided over the blister 262 and , optionally , the dispensing channel 266 as well , and comprises a blister housing cover 270 covering the blister 262 and a blister housing extension 280 covering and protecting the dispensing channel 266 and the area of the frangible seal 268 . a floating actuator plate 276 is disposed within the blister housing cover 270 . in the illustrated embodiments , both the blister housing cover 270 and the floating actuator plate 276 are circular , but the housing 270 and the actuator plate 276 could be of any shape , preferably generally conforming to the shape of the blister 262 . the apparatus 260 further includes a plunger 274 having a plunger point 275 at one end thereof . plunger 274 is disposed above the blister housing cover 270 generally at a center portion thereof and disposed above an aperture 272 formed in the housing 270 . the floating actuator plate 276 includes a plunger receiver recess 278 , which , in an embodiment , generally conforms to the shape of the plunger point 275 . the blister 262 is collapsed by actuating the plunger 274 downwardly into the aperture 272 . plunger 274 may be actuated by any suitable mechanism , including one of the actuator mechanisms 50 , 80 described above . plunger 274 passes into the aperture 272 where the plunger point 275 nests within the plunger receiver recess 278 of the floating actuator plate 276 . continued downward movement by the plunger 274 presses the actuator plate 276 against the blister 262 , thereby collapsing the blister 262 and displacing fluid from the blister 262 through the dispensing channel 266 to a fluid egress . continued pressure will cause the frangible seal at 268 to break , or an apparatus for opening the vessel as described above may be employed to open the frangible seal . the plunger point 275 nested within the plunger point recess 278 helps to keep the plunger 274 centered with respect to the actuator plate 276 and prevents the actuator plate 276 from sliding laterally relative to the plunger 274 . when the blister is fully collapsed , as shown in fig1 , a convex side of the plunger receiver recess 278 of the floating actuator plate 276 nests within a plunger recess 282 formed in the substrate 264 . accordingly , the blister housing cover 270 protects the blister 262 from inadvertent damage or collapse , while the floating actuator plate inside the blister housing cover 270 permits and facilitates the collapsing of the blister 262 without having to remove or otherwise alter the blister housing cover 270 . in components having more than one collapsible vessel and dispensing channel , a blister housing cover may be provided for all of the vessels and dispensing channels or for some , but less than all vessels and dispensing channels . while the present invention has been described and shown in considerable detail with reference to certain illustrative embodiments , including various combinations and sub - combinations of features , those skilled in the art will readily appreciate other embodiments and variations and modifications thereof as encompassed within the scope of the present invention . moreover , the descriptions of such embodiments , combinations , and sub - combinations is not intended to convey that the inventions requires features or combinations of features other than those expressly recited in the claims . accordingly , the present invention is deemed to include all modifications and variations encompassed within the spirit and scope of the following appended claims . | 1 |
the nial โ cocraly alloy may be formed using conventional melting techniques and elemental constituients . also , mechanical alloying may be used by mixing elemental constitutents or master alloy powders , nial and cocraly , in proportion and milling it to form nial โ cocraly alloy . as noted above , the cocraly may comprise 15 to 30 volume percent of the alloy . also , an 85 / 15 volume percent ratio may be used . the nial โ cocraly alloy may be used as a bond coat for ni - based superalloys , but its properties may be further improved with the addition of particulate aln as discussed below . the nial โ cocraly โ aln composite of the present invention is prepared using cryomilling . the component nial and cocraly alloys may be prepared from elemental constituents in accordance with known techniques or purchased from commercial sources . in the following example , a prepared nial alloy is combined with a commercially available cocraly . in preparation for cryomilling , about 85 percent by volume of prealloyed nial ( 50 atom percent ) and 15 percent by volume of a commercially supplied cocraly alloy were mixed and cryomilled in a union process 01 - hdt attritor . the grinding media comprised 304 stainless - steel balls of ยผ inch diameter . the milling was carried out in the presence of liquid nitrogen for about 16 hours . the outer jacket of the vessel was also cooled with liquid nitrogen . the milled powder was consolidated by hot extrusion or by hot isostatic pressing . referring to fig1 an sem micrograph shows the nial โ cocraly โ aln composite as extruded . the elongated grains of nial are particularly illustrated . referring to fig1 a , the light phase corresponds with the ( nico ) al phase and a dark mantle region consists of nanosized aln particles . the aln particles range in size from 10 to 50 nanometers . the consolidated material was used to form oxidation coupons , 4 point bend and tensile specimens . these were machined from the consolidated material . isothermal oxidation tests were carried out between 1100 ยฐ c . and 1400 ยฐ c . for 200 hours . referring to fig2 a plot of the specific weight gain vs . time for the nial โ cocraly โ aln composite of the invention and several other currently used mcraly bond coat alloys is shown . only the 16 - 6 ( 16 % cr and 6 % al ) alloy showed comparable performance with that of the inventive composite up to about 200 hours . thereafter , the nial โ cocraly โ aln composite is characterized by a lower specific weight gain . referring to fig3 an x - ray diffraction pattern for an oxidized specimen of nial โ cocraly โ aln is shown . the peak corresponds with alumina . sem analysis showed that the alumina scale is continuous , very compact and thin . this agrees with the effective oxidation resistance displayed by the nial โ cocraly โ aln composite and the low specific weight gain observed . referring to fig4 the arrhanius plot shows the relationship of the parabolic scaling oxide constant ( k p ) and 1 / t for nial โ cocraly โ aln and nial0 . 1zr . the k p values for nial โ cocraly โ aln are lower than those of nial0 . 1zr alloy and indicate a lower rate of forming alumina for all temperatures . cyclic oxidation tests were performed at 1160 ยฐ c . and 1200 ยฐ c . for 200 cycles in air . each cycle consisted of one - hour heating and 20 minutes of cooling . for purposes of comparison , the cyclic oxidation of cocraly under these conditions was also tested . the results are reported in fig5 . referring to fig5 the cocraly alloy displays a much lower specific weight gain at 50 cycles or higher indicating a greater degree of spallation . in comparison , nial โ cocraly โ aln at 200 cycles had a specific weight gain of โ 3 mg / cm2 at 1165 ยฐ c . and โ 13 mg / cm2 at 1200 ยฐ c . the coefficient of thermal expansion of freestanding nial โ cocraly โ aln was measured at temperatures ranging from 20 ยฐ c . to 1000 ยฐ c . in an argon atmosphere . the average coefficient of thermal expansion is plotted against temperature in fig6 . for comparison purposes , a commercially used 16 - 12 bond coat alloy ( 16 % cr and 12 % al ) was also tested , and the results are included in fig6 . as shown , the nial โ cocraly โ aln composite had a lower coefficient of thermal expansion . at temperatures of about 1150 ยฐ c ., the coefficient of thermal expansion is less than about 16 for the nial โ cocraly โ aln composite . tensile tests were carried out on butterhead type specimens between room temperature and 1000 ยฐ c . the dynamic young &# 39 ; s modulus values were measured and correlated with temperature , the data being plotted in fig7 . in addition to the nial โ cocraly โ aln alloy , similar measurements were made for a 16 - 12 alloy and a plasma sprayed , partially stabilized zirconia ( psa ) alloy . as shown , both of the bond coats have a much higher modulus then in the thermal barrier coat which is porous . since the elastic stress generated in the coating will be dominated by the lower modulus material , it is evident that the ceramic layer modulus will determine the stress in the thermal barrier coating up to the operating temperature . the most important property of a bond coat is , of course , the thermal fatigue life of the thermal barrier coating system for that bond coat . the fatigue lives of thermal bond coatings having an air plasma sprayed ceramic top coat and a low pressure plasma spray applied nial โ cocraly โ aln bond coat or a 16 - 6 bond coat were evaluated using a jet - fuel fired mach 0 . 3 burner rig to simulate gas turbine conditions . a jp - 5 fuel was used in the burner . samples were heated in the burner for six minutes to a steady state temperature of 1160 ยฐ c . and then forced - air cooled for 4 minutes during each cycle . the results of the thermal cycle testing are reported in fig8 . as shown , the 16 - 6 alloy ( 16 % cr and 6 % al ) had a cycle life of about 220 cycles and the nial โ cocraly โ aln composite of the invention had a cycle life of about 325 cycles . this corresponds to about a 50 percent increase in cycle life . | 2 |
one embodiment of the present invention provides a method for the production of semiconductor component using deep ultraviolet ( duv ) and extreme ultraviolet ( euv ) radiation to induce the adsorption of doping agents into a carbon semiconductor . in one such embodiment , photolithographic masking may be employed to expose patterns on a region of a workpiece to radiation in the uv radiation . diamond like carbon ( dlc ) thin films and single wall nanotubes ( swnts ) have electrical and chemical properties making them especially suitable for semi conductor structures . in their un - doped state , dlcs are insulators , while swnts have a slight n - type bias . diamond - like carbon films have a high hardness , are chemically inert , and exhibit a high degree of thermal conductivity . in one embodiment swnts may be doped by the introduction of halide or alkali metals as electron acceptors or donators , respectively . as uptake of dopant by both dlc thin films and swnts can be controlled by exposure to ultraviolet light , ultraviolet light may be used to effect a change in the electrical character of the structure . arf or krf laser radiation is used , in some embodiments to dissociate halide molecules producing halogen radicals , while other embodiments utilize such radiation to increase the energy of the molecules facilitating bonding with the carbon based layers . compounds used as doping precursors include , but are not limited to , cof 2 , cf 2 cl 2 , cf 2 br 2 , cf 3 br , cf 3 i , cf 3 no , and co ( cf 3 ). gas phase group 1 metals may likewise be used , such as cesium or potassium . in one embodiment , dissociation of these molecules generates highly reactive radicals . dlc films and swnts are exposed to the highly reactive radicals thus produced . the reactive radicals bond with the dlc films and swnts . in some embodiments , inorganic gas sources may be provided , introducing simple gas phase inorganic molecules , including but not limited to hydrogen dimer , oxygen dimer . it has been found that the introduction of such simple inorganic compounds into the gas permits greater control of the material properties of the resulting semiconductor . chemisorption of hydrogen or oxygen can give rise to insulative properties . while in some applications this may be valuable , in one embodiment of the present invention , the doping process is conducted in a closed environment from which hydrogen and oxygen are substantially excluded . as these atmospheric gases are light dissociative or excitable and reactive , their presence between the light source &# 39 ; s lens and the wafer would lead to unwanted modification of the electrical properties of the wafer . as illustrated in fig1 and 2 a block diagram illustrating a system configured according to one embodiment of the present invention . in this system a docked coater 12 received a substrate wafer 30 , the substrate wafer 30 is coated with a layer of carbon or carbon based semiconductor 32 . the carbon layer 32 is introduced to a processing unit , which in one embodiment is a duv / euv stepper scanner . the stepper scanner may include a deep ultraviolet or extreme ultraviolet light source 34 is equipped with the capacity to control the chemistry of the process environment . within the system , a wafer 30 and subsequent carbon layers 32 may be coated by the coater 12 and irradiated by stepper 34 a number of iterations until a completed electrical component is produced without cleaning or etching of the work piece . the completed wafer 10 is then expelled from the docked coater 12 . as illustrated in fig2 a mask , such as a photo lithographic mask 58 , is disposed in the path of an ultraviolet light source . various photolithographic masks are known to those skilled in the art . the emitted light 35 passes from a light source 34 through the mask 58 becoming masked or patterned light 37 and is concentrated through optical components 60 as a focused patterned light 61 . the focused patterned light 61 is thus restricted or directed to regions 39 corresponding to a pattern 62 controlled by the mask 58 and the optics 60 . the light 61 locally and instantaneously energizes a fluid 36 passing beneath the focused patterned light 61 . a more efficient patterning may thus be obtained than through direct , unmasked scanning and narrowly targeted illumination of the workpiece surface as masked regions of the workpiece may be illuminated , effecting excitation of both the fluid 36 and the layer 32 . as illustrated in fig3 a - 3e , block diagrams illustrating the steps of producing carbon based electronics construction configured according to one embodiment of the present invention . the method provides a carbon layer 32 . the carbon layer , may , in one embodiment be disposed upon a substrate 30 . the carbon layer 32 may comprise a layer of diamond - like carbon , a single walled nanotube mat , or a layer of graphene . one skilled in the art will readily appreciate that other carbon based molecules having sp2 or a combination or sp2 and sp3 bonding may be employed in similar ways . in one such embodiment , a single walled nanotubes mat may be configured from at least one single walled nanotube , split along its longitudinal axis . what remains is a sheet of sp2 bonded carbon with a thickness on the order of a few angstroms , structurally analogous to graphene . mats or layers of graphene , or diamond - like carbon may be deposited using chemical vapor deposition or other known techniques . these mats or layers may , in accord with one embodiment of the present invention , be aligned with a laser 34 . in one embodiment , this laser 34 is a stepper laser . in one embodiment of the present invention , the laser 34 may be configured with lenses and optical components 60 and other components configured of or coated with materials resistant to chemical attack , including , but not limited to sapphire , diamond - like carbon or other suitably resistant coatings . between the surface of the carbon wafer 32 and the chemically resistant laser 34 a flow of fluid 36 is introduced . the fluid may be in either the gaseous or liquid phases , or such other phases as are best suited to a particular doping agent . as illustrated in fig4 , alternative embodiments where the doping agent is applied by spinning a layer of condensed phase doping agent or doping agent precursor 136 on the surface of the carbon wafer 32 . the fluid 36 , 136 may comprise desired doping agents or their precursors . doping agents may be selected based on the electrical characteristics of the doped carbon structure and on the response of the doping agent or its precursors to photonic exposure . referring again to fig3 a - 3f , the carbon layer 32 is then selectively irradiated with laser light , illuminating only those areas of the layer where the circuit design requires doping 38 , 40 . depending on the doping agent used , the resulting doped regions 39 are may be either n - type regions 40 , p - type regions 38 , highly electrically conductive regions 50 , or electrically insulative regions 42 . as the light 61 passes through the fluid flow 136 , 36 , into the carbon layer 32 , carbon to carbon bonds are excited , facilitating bonding between the carbon layer 32 and the doping agent 136 , 36 . the same light exposure effects a dissociation of precursor molecules 136 , 36 , resulting in a release of doping agent radicals or other excited state molecules . having excited state carbon bonds in close proximity to excited state doping agents or doping agent radicals markedly increases adsorption in irradiated areas , while leaving non - irradiated areas substantially free of doping agents , that is with a level of doping agent inadequate to significantly effect the electrical properties of the carbon . successive layers of carbon may be deposited and doped in this way , simply by depositing a second or subsequent layer of carbon 44 , introducing a doping agent fluid 136 , 36 , and irradiating the fluid and carbon layer 44 . as the carbon irradiation and exposure to doping agent occur at the surface of the carbon , layers disposed beneath the top most layer will be uneffected by the process . the building of successive layers permits the construction of three dimensional circuits , such as those illustrated in fig3 e and in fig5 . fig3 e illustrates one embodiment of the present invention wherein horizontal 52 and vertical 54 transistors are shown , as well as a misfet ( metal insulator semiconductor field effect transistor ) 56 . the production of such a component may be conducted , in accordance with one embodiment of the present invention , in an enclosed environment using automated wafer handling tools . as no photoresist or associated cleaning and etching steps are required , the production of such devices may be carried out in a closed environment , minimizing wafer handling and any attendant contamination . a similar process may be employed to prepare an inverter , a simple example of which is shown in fig5 . describing now in more detail , the three dimensional circuit configured according to one embodiment of the present invention is illustrated in fig3 e . the doped wafer device 10 is formed of layers of single walled nanotube mats with selective areas of each successive mat doped to create n 40 , p 38 , and conductive regions 50 . from the foregoing description , one skilled in the art will readily appreciate that instead of single walled nanotube mats , other layers of sp2 and or sp3 bonded carbon may be used , such as graphene . as is also well known in the art , the juxtaposition of doped n 40 and p 38 produces transistors . in one embodiment of the present invention , such juxtaposition may be obtained in a single layer , producing a โ horizontal โ transistor 52 , or may be produced by the superposition of alternating doped layers , producing a โ vertical โ transistor 54 . vias or conductive elements 50 may be formed within the structure to connect the transistors and link these transistors contacts with external components . contacts 64 for carbon based electrical components configured according to on embodiment of the present invention may be of indium or other suitable material , and may be configured to provide for flip chip configuration or bump bonding . examples of flip chips are well known to those skilled in the art . the foregoing description of the embodiments of the invention has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . many modifications and variations are possible in light of this disclosure . it is intended that the scope of the invention be limited not by this detailed description , but rather by the claims appended hereto . | 1 |
with reference to the drawings , fig1 depicts the entire assembly of a log severing device according to the present invention . a log 10 has been inserted into an anvil 12 . the log is guided into the circular - shaped anvil by means of roller mechanism 14 . the anvil 12 is fixedly attached to a base assembly 16 which is configured to retain the anvil in relatively stationary position against the very high forces of cutting to which the log 10 will be subjected . anvil 12 is preferably a section of circular pipe which penetrates a pair of plates 18 and 20 . since plates 18 and 20 are spaced apart , the anvil 12 is maintained laterally and also rotationally against the forces to which it will be subjected . the base assembly 16 additionally comprises a base plate 22 which supports the entire structure . legs 24 are disposed at the corners of base plate 22 and provide the appropriate elevation for the entire device which is mounted on top of base plate 22 . the legs 24 additionally have support plates 26 by which means the entire assembly may be supported on the ground or bolted to the floor . a motor drive mechanism 30 is generally shown which comprises a motor and chain or belt drive to a shaft 32 . it will be appreciated that the means for driving shaft 32 may vary and there is no preferred way of transmitting the power . the power may also be directly transmitted by an axially mounted power supply rather than a chain or belt driven side mount supply . one specific example of a power supply is illustrated in fig5 . the power take - off from a tractor 50 is conventional and need not be described here . rotational shaft 32 is vertically disposed and supported by bearings 34 which are mounted on a structural support 36 which is itself rigidly connected to base support plate 22 . guide rollers 35 are provided at the side of the drum rigidly mounted to support plate 22 , only a single bearing configuration being illustrated . mounted upon rotational shaft 32 is cutter drum 40 defined by a wall which is preferably a cylindrical section in which one or more cutter holes have been placed . the shape of the cutter holes is not critical but a generally rectangular shape has been illustrated in the cylindrical drum 40 . the critical part is to have a leading section to admit logs and a trailing section to sever the inserted logs . teardrop - shaped blades 42 are mounted at the trailing edge of the cutter hole . the direction of rotation of the drum 40 is such that the larger diameter portion of the teardrop - shaped cutter hole passes the anvil before the smaller diametered portion passes the anvil . this teardrop shape results in generally equal and opposite cutting forces which balances the stress on cylinder 40 . the teardrop shape of the blades is not critical ; they could be v - shaped or a single , diagonally extending blade could span the opening in some way ; alternative blade shapes need not be illustrated because all are within the inventive concept . additionally , mounted within the cutter holes , immediately behind the cutter opening , are stops 44 which are adjustable to control the length of log 10 to be inserted within the hole prior to it being sheared off by the blades 42 . adjustment of stops 44 may be by a hinge or other means . an alternative stop for controlling the length of the cut piece is best seen in fig3 where a sliding block is mounted on a bar bisecting the drum interior . where there are two diagonally opposed cutter openings and it is desired that the log be cut to a length less than one - half the diameter of the drum , plural stops would be required . in operation , the cutter drum 40 is rotated by rotational force being imparted to rotational shaft 32 , and at the same time log 10 is inserted through the roller means 14 and further through the anvil 12 and into contact with cutter drum 40 . each time the cutter hole passes the log , the log will advance into the cutter hole , and as the cutter drum continues to rotate , the log 10 will be sheared by the action of the blades 42 in the smaller diameter portion of the cutter hole shape . the cut chips , chunks or pieces of wood then drop through the bottom of cutter drum 40 and through a clear hole in base support plate 22 . turning now to fig2 which is a side elevational view of drum 40 , it can be seen that cutter blades 42 are borne on the edges of a reinforced plate 50 which is a removable plate assembly thereby allowing replacement and renewal of cutter blades 42 . blades formed on the trailing edge of the cutter hole rather than as a separate piece are within the inventive concept . plate 50 is removably attached to the perimeter surface of drum 40 . drum 40 also bears a bearing ring 52 at its lower extremity and this bearing ring engages the rollers 35 thereby providing alignment for the drum 40 during rotation . turning now to fig3 which is a plan sectional view taken along line 3 -- 3 of fig2 it can be seen that an access ramp 56 is provided just inside the drum surface . the ramp 56 is inclined inwardly from the drum surface to provide a smooth entry of the log into the drum . additionally , this provides a strengthening position for the drum at a point of high stress during cutting . in order to provide continuity of cutting , a fly wheel 33 is provided on the shaft 32 in the area above drum 40 . in one embodiment of the invention a fly wheel assembly includes the sprocket and fly wheel 33 integral with a bearing , which bearing engages ( but is not attached to ) the periphery of the drive shaft 32 . the fly wheel will tend to smooth out the pulsing type of force inherent to the cutting or chipping action of the log chipping machine and will aid in the production of uniform sized chips , chunks or pieces . fig4 illustrates an alternative embodiment wherein the rotating drum 40 is cone shaped rather than cylindrical . the operation is identical so no additional explanation appears necessary . theoretically , the resulting wood piece could be of infinite length because the inserted log does not have the possibility of engaging the opposite side of the cutting drum . as indicated previously in relation to the cylindrical cutting drum , the shape of the cutting blades is not critical . it will be apparent from the above description that the present invention provides for an improved wood chipping apparatus which is inherently non - clogging . the chips , chunks or pieces will fall through a hole in the bottom of the device without having to pass the drive mechanisms , and additionally , the fully enclosed cutting area or hole inherently produces a situation in which only logs and tree segments up to but not exceeding the maximum size capabilities of the machine may be inserted into the cutting device in the first place . the above &# 34 ; detailed description of the invention &# 34 ; and &# 34 ; summary &# 34 ; describes an apparatus for reducing the size of logs . it is understood that it is also within the scope of the invention to utilize wood pieces such as small diameter trees , branches , and logging residues . the resulting products are , by adjusting the stops , of varying size such as conventional wood chips for pulp , chunk size for firing boilers and the like , and firewood size pieces . with further regard to fig3 ., stop 6 is a sliding block mounted on bar 8 . bar 8 is attached to base plate 22 underneath drum 40 and does not rotate with drum 40 . it is also understood that stop 44 is adjustably attached to ramp 56 . | 8 |
fig1 illustrates a side - by - side refrigerator 100 in which the present invention may be practiced . it is recognized , however , that the benefits of the present invention apply to other types of refrigerators , freezers , refrigeration appliances , and refrigeration devices , including climate control systems having similar control issues and considerations such as , for example , but not limited to , one compartment units , three compartment units , units with any number of compartments , commercial units including vending units , and residential units . consequently , the description set forth herein is for illustrative purposes only and is not intended to limit the invention in any aspect . refrigerator 100 includes a fresh food storage compartment 102 and a freezer storage compartment 104 . freezer compartment 104 and fresh food compartment 102 are arranged side - by - side in an outer case 106 with inner liners 108 and 110 . a space between case 106 and liners 108 and 110 , and between liners 108 and 110 , is filled with foamed - in - place insulation . outer case 106 normally is formed by folding a sheet of a suitable material , such as pre - painted steel , into an inverted u - shape to form top and side walls of case . a bottom wall of case 106 normally is formed separately and attached to the case side walls and to a bottom frame that provides support for refrigerator 100 . inner liners 108 and 110 are molded from a suitable plastic material to form freezer compartment 104 and fresh food compartment 102 , respectively . alternatively , liners 108 , 110 may be formed by bending and welding a sheet of a suitable metal , such as steel . the illustrative embodiment includes two separate liners 108 , 110 as it is a relatively large capacity unit and separate liners add strength and are easier to maintain within manufacturing tolerances . in smaller refrigerators , a single liner is formed and a mullion spans between opposite sides of the liner to divide it into a freezer compartment and a fresh food compartment . a breaker strip 112 extends between a case front flange and outer front edges of liners . breaker strip 112 is formed from a suitable resilient material , such as an extruded acrylo - butadiene - styrene based material ( commonly referred to as abs ). the insulation in the space between liners 108 , 110 is covered by another strip of suitable resilient material , which also commonly is referred to as a mullion 114 . mullion 114 also preferably is formed of an extruded abs material . it will be understood that in a refrigerator with separate mullion dividing a unitary liner into a freezer and a fresh food compartment , a front face member of mullion corresponds to mullion 114 . breaker strip 112 and mullion 114 form a front face , and extend completely around inner peripheral edges of case 106 and vertically between liners 108 , 110 . mullion 114 , insulation between compartments 102 , 104 , and a spaced wall of liners 108 , 110 separating compartments 102 , 104 sometimes are collectively referred to herein as a center mullion wall 116 . shelves 118 and slide - out drawers 120 normally are provided in fresh food compartment 102 to support items being stored therein . a bottom drawer or pan 122 partly forms a quick chill and thaw system ( not shown ) and selectively controlled , together with other refrigerator features , by a microprocessor ( not shown ) according to user preference via manipulation of a control interface 124 mounted in an upper region of fresh food storage compartment 102 and coupled to the microprocessor . a shelf 126 and wire baskets 128 are also provided in freezer compartment 104 . in addition , an ice maker 130 may be provided in freezer compartment 104 . a freezer door 132 and a fresh food door 134 close access openings to fresh food and freezer compartments 102 , 104 , respectively . each door 132 , 134 is mounted by a top hinge 136 and a bottom hinge ( not shown ) to rotate about its outer vertical edge between an open position , as shown in fig1 and a closed position ( not shown ) closing the associated storage compartment . freezer door 132 includes a plurality of storage shelves 138 and a sealing gasket 140 , and fresh food door 134 also includes a plurality of storage shelves 142 and a sealing gasket 144 . in accordance with known refrigerators , refrigerator 100 also includes a machinery compartment ( not shown ) that at least partially contains components for cooling air . the cooled air is used to refrigerate one or more refrigerator or freezer compartments via fans ( not shown ). the construction of the cooling system components is well known and therefore not described in detail herein . refrigerator 100 includes a plurality of temperature sensors 146 . in one embodiment , sensors 146 are thermistors . alternatively , sensors 146 are thermocouples . fresh food and freezer compartments 102 , 104 each include a side wall 148 , 150 respectively . some sensors 146 are located on side walls 148 and 150 to avoid obstruction of compartments 102 and 104 . additionally , some sensors 146 are located in mullion 114 . although the purpose of sensors 146 are to sense the temperature of compartment 102 and 104 , sensors 146 sense the temperature of the location where each sensor 146 is located . sometimes the measured temperature will be different from the true temperature in compartments 102 and 104 . additionally , the measured temperature is also influenced by the temperatures and the temperature change on the other side of side walls 148 and 150 on or in which a particular sensor 146 is installed . for example , a sensor located in mullion 114 senses the temperature change on both fresh food compartment 102 and freezer compartment 104 because of heat transfer through mullion 114 . therefore , to improve the accuracy of the temperatures in compartments 102 and 104 , the temperature measurements from sensors 146 are corrected as described herein . the moving force of heat transfer through walls 148 and 150 , doors 132 and 134 , and mullion 114 is a temperature difference between the temperatures from both sides of the walls 148 and 150 , doors 132 and 134 , or mullion 114 . with good accuracy , the heat flux q may be described by the equation q = u * a *( t 1 โ t 2 ), where u is a heat transfer coefficient that combines the influence of the heat transfer resistance from air to both sides of walls 148 and 150 , doors 132 and 134 , or mullion 114 with the conductance of walls 148 and 150 , doors 132 and 134 , or mullion 114 material . a is the surface area , and t 1 and t 2 are temperatures from a sensor mounted to an exterior surface and a sensor mounted to an interior surface of a wall , wherein the interior surface is interior to the compartment being measured and the exterior surface is exterior to the compartment but not necessary exterior to refrigerator 100 . for example , one sensor 146 is coupled to a surface of mullion 114 interior to fresh food compartment 102 and one sensor 146 is coupled to mullion 114 exterior to fresh food compartment 102 and interior to frozen food compartment 104 . also , in one embodiment , the two different compartments are both above freezing but at different temperatures . also the surface area each particular sensor 146 is exposed to is also constant . so , with good accuracy the heat flux q is proportional to dtw = t 1 โ t 2 or q = cw * dtw ( equation 1 ), where cw is a constant that depends on the refrigerator and thermal sensor cavity geometry , and where dtw represents the temperature difference between a first sensor interior a compartment and a second sensor exterior the compartment . the temperature influence ( dts ) on each sensor 146 from heat flux q can be calculated as dts = q /( us * as ), where us is the heat transfer coefficient from air to a particular sensor 146 and as is the sensor surface area exposed to the heat flux q . during operation of the closed cooling system , sensors 146 do not move and therefore the areas as are constant . although , airflow can influence the heat transfer coefficients us , each sensor 146 is usually located in a cavity ( not shown ) with very small air movement within the cavity and changes in air movement within the cavity during a full cycle are not considerable . therefore , us also can be considered as a constant . thus , dts = q / cs ( equation 2 ), where cs is a constant . combination of equations ( 1 ) and ( 2 ) results in dts = c * dtw ( equation 3 ), where c is a constant combining two constants cw and cs . constant c for each combination of sensors can be either calculated or found experimentally . the correction in the sensor temperature is done depending on the location of a particular sensor 146 and a difference between the temperatures from both sides of the wall . for any sensor ( s ) located in side walls 148 and 150 , or doors 132 and 134 , the sensor temperature correction is proportional to the difference between ambient temperature and the temperature of compartments 102 or 104 . for sensor ( s ) located in mullion 114 , the sensor temperature correction is proportional to the difference between temperatures in adjacent compartments 102 and 104 . the temperatures in compartments 102 and 104 are known . thus , for any sensor ( s ) 146 located in mullion 114 , there is no need for any additional temperature measurement . in other words , each compartment has an associated target temperature , say 1 ยฐ for freezer compartment 104 and 35 ยฐ for fresh food compartment 102 . the correction is then 34 times the constant coefficient . to correct the temperature from a sensor located in the walls or doors the ambient temperature is used . however , with an assumption that the ambient temperature in a kitchen is a constant the correction is calculated as dts = cc * tc + ca , where cc and ca are constants that can be determined by experiment . for example , fresh food compartment 102 has a target temperature of 38 ยฐ and the ambient temperature is measured at 72 ยฐ, then the correction factor is proportional to 72 โ 38 which is 34 . as used herein a target temperature is the temperature that the compartment is set to maintain . fig2 illustrates test data with the above described compensation of refrigerator 100 . the accuracy of the temperature was significantly improved over refrigerators which do not compensate the sensor readings . accordingly , a cost effective refrigerator is provided that economically compensates for the difference between the true temperature in a compartment and the measured temperature in the compartment . additionally , while described in the context of sensors mounted in mullions and side walls of refrigerators , it is contemplated that the benefits of the invention accrue to all cooling devices having temperature sensors . while the invention has been described in terms of various specific embodiments , those skilled in the art will recognize that the invention can be practiced with modification within the spirit and scope of the claims . | 5 |
shown in fig1 and 1 ( a ) are block schematic diagram views of a preferred embodiment of a two - channel digital tape recorder 10 that preferably involves non - return - to - zero ( nrz ) recording , though , of course , it could employ other recording techniques , hereinafter referred to as recorder . fig1 and 1 ( a ) should be taken as being read from left to right with inputs from first and second channels entering , as a stereo performance , at main track inputs 11 and 12 . shown in fig1 and 1 ( a ), the recorder 10 preferably involves a clock 13 that feeds pulses , as shown in line ( a ) in fig3 into a record control 14 , to synchronize the main track inputs after their passage through lowpass filters 15a and 15b . while main and backup tracks are called for herein , it should be understood that the data could be recorded on any appropriate media in any appropriate flow without departing from the subject matter coming within the scope of this disclosure . low - pass filters 15a and 15b mentioned hereinabove are provided to filter out frequencies above a so - called nyquist frequency to prevent aliasing in the sample and hold analog to digital conversion . from the record control the signal from clock 13 is imposed upon the signals entering track and hold circuits 16a and 16b , the record control 14 also passing a timing pulse , shown at line ( b ) in fig3 to circuitry 17a and 17b as identified as 16 bit linear analog to digital converter ( a / d ). the 16 bits , of course , assume a 16 bit data word . while such 16 bit data word is preferred , it should be obvious that any appropriate number of bits could be so employed . therefore , if more or less than 16 bits per data word are so employed then circuitry 17a and 17b would be modified appropriately . at circuitry 17a and 17b the audio analog signal , as timed by a pulse shown at line ( c ) of fig3 is converted to digital form , preferably the 16 bit data word . that data word is fed at intervals to circuitry for adding a parity bit and synchronization code bits , forming thereby a 20 bit word output , which word is represented by a line ( d ) in fig3 . shown in fig1 the parity bit is inserted into each 16 bit word by parity generators 18a and 18b that are shown in the main tracks and a parity bit generator 18c that is connected so as to also insert a parity bit in each data word in a backup track , the function of which backup track will be explained in detail later herein . the above mentioned synchronization code is entered into the main track data flow by circuitry identified as sync code 19a and 19b . synchronization coding is also added to the data word in the backup track by circuitry shown as sync code 19c . the preferred synchronization code preferably consists of a start bit inserted prior to the 16 data bits with two stop bits inserted after the parity bit at the end of the word as illustrated by line ( d ) of fig3 though , of course , any arrangement of synchronization bit coding and appropriate number of bits therefore could be so used , the arrangement of the present invention being shown for illustration only . the data word with parity and synchronization codes inserted in the main and backup tracks , as described hereinabove , are assembled in circuitry identified as a parallel to serial block 20a , 20b , and 20c , to travel therefrom and be recorded as a high density recording by an appropriate recorder , which recording is made preferably on a high density tape 21 in fig1 hereinafter referred to as tape , though , of course , any other appropriate medium could be so used . as stated above , the present invention preferably involves two main tracks and a single backup track . the backup track , as shown best in fig2 preferably receives , for recording on tape 21 a reproduction of the first 8 bits of each of the 16 bit data words from each of the primary tracks , that are identified as msb , meaning most significant bits , backup track data thereby also totaling a 16 bit data word . the 16 bit data word on that backup track receives , as mentioned hereinabove , the described parity and synchronization code data bits therewith . the present invention provides for recording of the first 8 bits of each 16 bit data word as they are the most significant data of that word . specifically , the first 8 bits of each 16 bit word are accurate to one part in 256 , with a full 16 bit word reproduction being accurate to one part in 65 , 536 . reproduction of such first 8 bits for a 16 bit word , as for substitution of backup track data for primary track data , while not a complete reproduction , is sufficiently accurate so as not to introduce unacceptable distortion in a reproduction of an audio performance . it should be noted that , while the present invention utilizes a 16 bit data word reflective of an amplitude point in an analog signal with intervals therebetween of equal length to the sample length , a different number of data bits representing that point of amplitude or a different distance therebetween could be so employed without departing from the subject matter coming from the scope of the present disclosure . it should be understood that the recorder 10 of the present invention preferably operates at 37 . 5 kilohertz , and provides for a satisfactory data reproduction for an audio band width of 15 kilohertz though , of course , other band widths could be used depending upon needs of the system . the line diagram shown in fig2 represents circuitry whrerethrough analog signals are converged into the described groups of 16 bit digital data words , the first 8 bits of each data word on each main track being copied onto the backup track , with separate synchronization and parity coding encoded thereto , and the stream is converted from parallel to serial . this flow is shown as lines leading from 16 bit linear a / d 17a and 17b . the flow therefrom travels into blocks 22a , 22b and 22c that should be understood to contain the parity generator 18a , 18b and 18c , sync code 19a , 19b and 19c , and parallel to serial 20a , 20b and 20c circuitry described hereinabove . the main and backup information flow passed from blocks 22a , 22b and 22c is recorded on tape 21 . the recorder 10 in fig1 ( a ) is shown as being in a playback mode with the data words , described above , being picked up off the tape 21 that is shown in fig1 and as an arrow in fig2 . those data words picked up off of the tape travel on main and backup tracks passing to bit synchronizer circuitry 23a , 23b and 23c , respectively , as three separate streams that are band limited and have signal - to - noise ratios limited by the tape recorder electronics and tape . at the bit synchronization circuitry the streams are turned back into logical ones and zeros compatible with logic circuitry , which flow is shown at line ( f ) in fig3 . bit synchronizer 23a , 23b and 23c determine bit intervals and generates a clock signal into the streams , as shown at line ( g ) in fig3 represented as lines 24a , 24b and 24c , respectively . the clock signal is synchronized with the data signal output from that bit synchronizer , shown as line 25a , 25b and 25c , respectively , for the main and backup tracks . shown in fig1 ( a ), the data stream and clock signal for each track enters clock signal converters 26a , 26b and 26c , respectively , shown as broken lines in fig1 ( a ) and solid lines in fig2 . therein , the bits in the serial stream are shifted from a serial form to parallel form at serial to parallel circuitry 29a , 29b and 29c , passing also through the sync finder 27a , 27b and 27c . the sync finder locates the synchronization bits in each data word that , as described hereinabove , preferably consist of a start bit at the front of the word and two stop bits at the end of the word . each time that synchronization code is located , the data word is passed to a register as being a good data word . simultaneously , parity checker 28a , 28b and 28c , respectively for each track , determine if the parity is good in that data word . therefrom , the data flow passes to an error detection / correction circuitry portion of the present invention described hereinbelow . in fig3 arrows a , b and c show the synchronization code being identified as trigger commands to operate that error detection / correction circuitry , and commands pass therefrom . the error detection / correction logic of the present invention will be described in more detail later herein with respect to fig5 but briefly involves , as shown in fig1 ( a ), circuitry consisting of a block entitled error detection and correction 30 that is arranged to control the passage of each data word in each track , receiving parity and synchronization data from blocks and an analysis of data match between main and backup track information from the comparator selector circuitry 31a and 31b . the error detection / correction circuitry analyzes that data then commands operations of circuits to pass the main track data as received or the main track last 8 bits with the first 8 most significant bits from the backup track , as will be explained with respect to fig5 . the data word as received or corrected in the comparator selector circuitry is passed for further processing in a 64 word fifo ( first - in - first - out ) memory 32a and 32b , whose operation is commanded by the error detection / correction 30 as illustrated by the pulse at line ( i ) in fig3 . while a 64 word memory as shown herein is preferred , obviously circuitry employing greater or lesser memory could be so employed without departing from the subject matter of this disclosure . it should be noted that , as shown in fig2 the comparator selector circuit 31a and 31b and the error detection / correction circuitry 30 are identified as multiplexor circuitry 33a and 33b , that circuitry for passing therethrough the most reliable data word to the remainder to the channel outputs in fig1 ( a ) of reproduction logic circuitry identified at 34a and 34b , whose function will be explained hereinbelow wirh reference to fig1 ( a ). preferably , as shown in fig1 ( a ), the 64 word fifo memory 32a is connected to a servo control 35 that provides control signals to a tape deck &# 39 ; s speed circuitry , not shown . such servo control circuitry is preferably standard , and is identified herein only as an arrow 36 . shown in fig1 ( a ), the 64 word fifo memory 32a and 32b are each connected to clock 37 that should be understood to generate signals like that shown at lines ( i ), ( j ) and ( k ) in fig3 commanding of writing into and reading from data words therein . such clock signal passes also to 16 bit digital to analog converter circuitry 38a and 38b for synchronizing data outputs therefrom , that data synchronization being commanded by a signal like that shown at line ( 1 ) in fig3 . the data word signal passed from the converter circuitry 38a and 38b travels preferably through low - pass filters 39a and 39b . they function like the described low - pass filters 15a and 15b to remove all frequencies above the so - called nyquist frequency . the output therefrom travels to the stereo output channels 1 and 2 for playback . it should be noted that 64 word fifo memory 38a and 38b is provided to insure that data coming in one end goes out the other end in the same order that it came in . the purpose thereof is to remove the effects of wow and flutter in the tape mechanism , to synchronize the output , and to provide a steady state output therefrom . this is essentially where the servo control 35 to tape deck 36 , as described herein above , comes in to synchronize that data stream output . it should also be noted that clock 37 , as described herein with respect to fig1 ( a ), controls the rate at which data stream processing takes place , as that rate is not necessarily equivalent to a crystal controlled oscillator rate . the 64 word fifo memory 38a and 38b will therefore accept data words passed therefrom under the control of a crystal oscillator that connects to the servo control as described above , but is not shown . fifo memory therefore has a varying number of words in it , that number being dependent upon whether the tape is slowed down or sped up appropriately . as the fifo memory empties , that condition is sensed and the tape is sped up so that more bits will come off of the tape and the memory will fill up again , providing thereby a self controlled feed - back system . in recording an audio signal , such as a musical performance , it is often the case that over certain periods of time the signal being recorded may not change markedly . therefore , during such period , that signal as it is being converted to a digital format would remain at a very near zero voltage , with the digital representation thereof being a string of zeros or a partial patter of voltages of the same amplitude . the described bit synchronizer 23a , 23b and 23c relies on bit transition or voltage value changes to determine where bit intervals begin and end . therefore , absent such voltage changes , differentiating bits is difficult . such difficulties result in a greater likelihood of error . it has been found in practice that the greater the number of transitions between bits , the more accurately the bit period can be defined , and therefore the fewer errors . the present invention recognizes this condition and provides circuitry and data bit representations , as shown best in fig4 ( a ) and fig4 ( b ), for inverting every other bit in a bit stream . therein , the bit stream is shown entering at ( a ) in fig4 ( a ) made up of all zeros , indicative of a constant sound . after passage through an invertor 40 , the signal is , as shown in line ( b ). thereafter , that signal is reformed into a square wave , as shown in line ( c ), for recording onto tape . line ( d ) showns how that bit stream would appear if the inverters 40 were not present . in fig4 ( a ), each inverter 40 is shown to includean analog to digital converter 41 , with a signal therefrom passing through appropriate inverters 42 wherein the voltage of every other bit in the data stream is inverted . therefrom , the inverted signal is passed to the balance of circuitry shown in fig1 . in fig1 broken lines 40 show that the inverters of fig4 ( a ) are optional inclusions therewith after the 16 bit linear a / d 17a and 17b . shown in fig4 ( b ), are inverters 43 , that are also shown in broken lines in fig1 ( a ) arranged after the 64 word fifo memory 32a and 32b and should be understood to be , along with inverters 40 , an optional inclusion . inverters 43 receive the bit stream coming off from the tape going through circuitry 44 wherein it is checked for errors , with most reliable information being passed therefrom , as described hereinabove . that signal enters inverters 45 , as shown at line ( a ), with the signal , after bit synchronization , shown at line ( b ). this signal , in digitally coded parallel form , is shown in line ( c ), and line ( d ) shows the signal as it would appear after it has then passed through inverters 45 . inverters 45 would operate like the described inverters 42 to reverse the polarity of every other bit , converting that digital code back to the signal as it originally entered the system . therefore , the signal passes through the 16 bit d / a converter 38a and 38b , shown in fig1 and shown in fig4 ( b ) as 38 . therefrom , the signal passes through a standard playback portion of the recorder , now shown . the inverter circuitry , shown in fig4 ( a ) and 4 ( b ), is , of course , optional and is provided only to limit errors that generate in recording long strings of unchanging voltages as when recording an unchanging audio signal . this is particularly true when the analog to digital conversion is putting out codes that are at or near zero , as is most frequently encountered in sound recording . in fig5 is shown in block schematic a preferred error detection / correction logic diagram that should be taken as being representative of error detection / correction circuitry already shown and described with respect to fig1 excepting that only a single main track is completely shown , with signals from a backup track shown entering therein . the circuitry of fig1 ( a ) heretofore identified as having sub - letters a , b , or c for the two main and single backup tracks , respectively , are therefore shown therein as the number alone . as an example , the left hand side of fig5 shows bits synchronizer circuitry as an arrow identified as 23 , that should be taken as being the bit synchronizers 23a , 23b and 23c , of fig1 ( a ). it should be noted that the diagram of fig5 proceeds from left to right with the data word from the bit synchronizers passed to bit shift register 26 where it is checked by circuitry identified as sync finder 27 . the sync finder 27 looks for the synchronizer code arranged at the beginning and end of the 20 bit data word , as shown at line ( d ) in fig3 . the 20 bit data word , of course , also includes a parity bit , the checking thereof to take place at parity check 28 whereat the presence of absence of parity is determined and that information transmitted to error detection / correction block 30 . the error detection / correction block 30 is connected to sync finder 27 through a line 45 , with arrows 46 and 47 indicating the presence of sync error or loss and / or bad parity in the backing track . a signal indicating a sync error or loss in the main track is shown entering through line 45 , and a parity check error in the main track data shown entering through line 48 . in a chart at the bottom left hand portion of fig5 a first left hand column indicates a bad match between main track ( channel 1 ) and backup track ( bu ). the absence of an error is reflected therein by a zero , with the presence of an error shown as a 1 . a corrective action to be taken by the circuitry of the present invention is shown in a far right column . this chart and its functioning will be described in detail later herein . continuing across the flow diagram of fig5 a comparator 49 is shown as receiving the first 8 bits of a 16 bit word from the main track bit stream , after sync and parity have been checked therein , and in the corresponding 8 bits from backup track , shown at arrow 50 . within the comparator 49 a determination is made , as indicated by arrow 51 , as to whether there is a good match between the first 8 bits of the 16 bit word from the main track with the corresponding 8 bits from the backup track . continuing across the flow diagram of fig5 the least significant bits of the 16 bit word are the last 8 bits thereof that are shown to continue through the comparator 49 and into a holding register 53 whether an error is indicated in the first 8 bits or not . therefrom , the data travels into the 64 word fifo memory 32 . wherefrom , as shown in fig1 ( a ), the least significant portion of the data word progresses for pickup on either the first or second channel . should it be determined at the error correction / detection circuitry 30 that there is a mismatch , sync or parity error , a signal so indicating is passed to the multi - plexor 52 through line 54 wherein a choice is made between the 8 bits from the primary or backup tracks as to which data is most likely correct for passage therethrough into the holding register 53 . the logic involved in this determination will be explained later herein with respect to the chart in fig5 . it should , however , be noted that , if it is determined that neither data can be relied upon , as when a hold signal is passed through line 54 to the holding register 53 , that instruction will cause an integration or averaging between good data on either side of that questionable data . integrated or average data is then passed , as has been explained hereinbefore with respect to fig1 ( a ). such command signal , as has been mentioned above with respect to the multiplexor , goes through line 54 with a timing signal , shown as strobe 55 , passing from the error detection / correction logic 30 to synchronize the output from the holding register 53 . the logic involved in the error detection / correction outlined hereinabove is shown best in the chart at the lower left hand portion of fig5 . therein the first line thereof shows no errors detected and therefore no correction procedureis undertaken with the main track data progressing , as described , through to the 64 word fifo memory 32 . should there be a bad sync or bad parity reflected on the backup channel , as shown at line 2 , then the same procedure would occur , the data on the main track being passed therethrough . however , as in line 3 of the chart , where a sync or parity loss is indicated in the main track data , then there would be a switching to the backup track information , with the appropriate bits thereon passed to the 64 word fifo memory 32 substituting for the first 8 bits of the main track data . where , however , as in line 4 of the chart , there are sync and parity errors indicated at both the main and backup tracks , then a hold signal is generated calling for integration or averaging between good data across the data where the error was sensed . where , as in line 5 , there is a mismatch and no parity or sync errors detected , the same hold signal is given to command the same integration or averaging . where , however , as on line 6 of the chart , there is indicated a mismatch with a sync error or bad parity in the backup track , then the most likely correct data is that on the main track and therefore that main track data is passed for further processing . similarly , where there is indicated a mismatch with a sync or parity error on the main track , this condition would indicate that the backup track data is correct , and the multi - plexor 52 would be switched appropriately to substitute that backup track data for the main track data . whereas , as in line 8 , there is shown a mismatch with sync or parity errors on both the main and backup tracks , a determination cannot be made as to which rack , if either , is correct and therefore a hold signal is given calling for an integration or averaging order between good data . in summary , the error detection / correction logic outlined hereinabove involves a checking of each data word on each main and backup track for a proper arrangement of synchronization bits and one parity bit therewith . the invention further provides for a check for a match of backup and appropriate main track data , that appropriate data being determined to be the first 8 bits of a 16 bit data word , with that comparison being made at a comparator 49 of fig5 . the checking for match and for proper sync and parity coding is made to determine which information on the main and backup tracks is most likely correct should differences exist therebetween . obviously , as the backup track records most significant data from both the two main tracks , then a parity or sync error in the backup track information would be reflected as a backup track error for each main track . as outlined hereinabove , the present invention , when an error in one or both main and backup track data is detected , provides for selecting the most likely correct data and , in the event such determination cannot be made , provides for an integration or averaging between good data . as a further explanation of certain elements and operations of the preferred two channel digital tape recorder , it should be noted that the aforementioned record side clock 13 is preferably a crystal oscillator . such clock 13 puts out pulses happening at each bit period rate , which bit period rate preferably is approximately 37 , 500 words per second times each 20 bits per word . clock 13 generates a signal that is known as track and hold , which signal , or course , controls the track and hold 16a and 16b of the present invention . in operation , therefore , the track and hold circuit will either hold the sample value that is being looked at , or track the analog value up to the next sample point . at the time the sample and hold switches into a hold mode , when the analog to digital converter is operated , that 20 bit data word is shifted out of the transmit logic . on the playback side of the recorder 10 , the bit stream coming from the tape 21 travels into a synchronizer which restandardizes the wave form and converts it into a logic wave form of zeros and ones and then passes it into the 64 word fifo memory 32a and 32b wherein anyproblems of wow and flutter effects introduced from the tape mechanism are removed . clocks 13 and 37 control the synchronization of data , the clock period being the same as a bit period that comes off the tape and so the clock will also have wow and flutter . such wow and flutter are compensated for in that , everytime the sync finder locates an appropriate 20 bits of a data word in the right location , it will put out a pulse called the sync registration to require the data to be written in the 64 word fifo memory 32 . a request is then generated by the crystal oscillator on the playback side of recorder 10 , identified as clock 37 , whereby the clock 37 pulls the data words out of the 64 word fifo memory 32 , shown in fig5 at the defined crystal oscillator rate . each word then passes therefrom into the 16 bit digital to analog converter 38a . thereafter , each word passes through the low - pass filter 39 , as shown in fig1 ( a ), that is provided to smooth out the wave forms of the signal passed through the 16 bit d / a converter 38a . outlined hereinabove is the preferred circuitry arrangement for first conversion of an analog signal to digital and recording that data on a tape medium , and for lifting of that data off from that tape medium and converting from digital back to analog for playback . while an audio signal has been referred to herein , it should be obvious that any analog signal can to be processed as called for herein . it should also be noted that individual electrical components and the recording techniques employed by the present invention are well known in the art . however , the present invention provides for a novel and unique arrangement of such components to provide the logic circuitry required for performing the signal handling and error detection / correction functions described hereinabove . certain circuitry is , however , unique to the present invention and is , therefore , claimed herein . the present invention should be understood to involve both apparatus and a method for its used that are believed by the inventor to be unique to the art and a significant improvement over prior digital recorders and error detection / correction methods . although a preferred embodiment of my invention in an apparatus for digitally recording of information and an error limiting , correction / detection method for use therewith have been shown and described herein , thisdisclosure is to be understood to be made by way of example and that variations are possible without departing from the subject matter and coming within the scope of the following claims , which claims i regard as my invention . | 6 |
fig1 is a sectioned perspective view , illustrating the blade tip 12 of a conventional turbine blade 10 . the turbine blade 10 has a hollow interior 15 which is bounded at one end by a tip plate 14 . the tip plate 14 mates with a flange 16 which extends inward towards the center of the turbine blade 10 . the tip plate 14 is offset from the end of blade tip 12 to form a tip cavity 18 bounded by a wall 20 . the tip cavity 18 allows for cooling air to escape the airfoil between the blade tip 12 and the shroud of the casing during operation . as mentioned previously , the blade tip 12 is exposed to extreme temperatures and stress during operation . this can cause the blade tip 12 to deteriorate over time . other components of the turbine blade are also subject to extreme stresses which can possibly lead to deterioration of the turbine blade . in one aspect , the present invention comprises a method of repairing a turbine blade to improve the performance or longevity of the blade . in another aspect , the present invention comprises a composite turbine blade . in another aspect , the present invention comprises a method of manufacturing a composite blade . as illustrated in fig2 , a method of manufacturing a composite blade in accordance with an embodiment of this embodiment begins with the step of preparing a turbine blade 100 having a modified top surface 22 . the turbine blade 100 of fig2 may be prepared by removing the tip plate 14 and the material of the wall 20 above the flange 16 of the turbine blade 10 of fig1 . alternatively , the turbine blade 100 may be originally cast to have the profile shown in fig2 . the modified top surface 22 forms a plane across the flange 19 from the innermost point 21 of the flange 19 to the outer surface of the turbine blade 100 . as illustrated in fig3 , the plates 24 and 26 are attached to the modified top surface 22 of fig2 . the plate 24 may be attached the plate 26 and the flange 19 by various processes including , but not limited to , brazing , welding , or diffusion bonding . alternatively , the plates 24 and 26 may consist of weld - deposited materials . the plates 24 and 26 may comprise the same or different materials . in one embodiment , the plate 24 comprises a material that provides excellent mechanical tolerance at high temperatures . in particular , plate 24 may comprise a material which is more resistant to creep than the material of the airfoil of turbine blade 100 . although the preferred material for the plate 24 may vary , renรฉ 142 โข, renรฉ 80 โข, renรฉ n4 โข, renรฉ n5 โข, gtd 111 โข, and gtd 222 โข alloys ( general electric company ) are exemplary materials for the plate 24 because of their resistance to stress rupture at high temperature . in certain embodiments , the plate 26 comprises a material that may withstand even higher temperatures without oxidizing . renรฉ 142 โข and haynes 214 โข ( haynes international ) alloys are exemplary materials for the plate 26 because of their resistance to oxidation , however many other materials may be used for the plate 26 including , but not limited to , renรฉ 195 โข ( general electric company ) and haynes 230 โข ( haynes international ) alloys . although the present embodiment illustrates the use of two plates ( plates 24 and 26 ), it should be noted that any number of plates may be used . for example , in some embodiments a single plate being both resistant to low cycle fatigue and oxidation may be used . alternatively , a plurality of plates may be stacked to produce a gradient effect with each plate possessing the optimal properties for the thermodynamic and mechanical stresses at the particular location on the airfoil . for example , an intermediate plate comprising a material having an intermediate level of creep resistance and oxidation resistance relative to the plates 24 and 26 may be added between the plates 24 and 26 . the expression โ different material โ and variations thereof as used herein encompasses the use of different alloys among different components . the term also encompasses the use of the same alloy in different orientations among different components where the difference in orientation appreciably affects the manner in which the component responds to thermodynamic and mechanical stresses at the particular location where the component is placed on the turbine blade . unlike conventional blade tip designs ( e . g ., the design of fig1 ), the quality of the bond between the plates 24 and 26 and the turbine blade 100 may be easily inspected without destroying the attached components or the bond . for example , the bond quality may be visually inspected or may be inspected using ultrasonic imaging techniques . as such , a bond quality assessment may be made before proceeding to the next step in the manufacturing process . as illustrated in fig4 , a blade tip 27 is then formed by machining the plates 24 and 26 to produce a cavity 28 bounded by a wall 29 and a tip plate 25 . the cavity 28 is preferably formed by milling away material from the plates 24 and 26 using a cnc milling machine ; however , other machining methods may also be used . further , the exterior walls of plates 24 and 26 may be machined to match the contours of the turbine blade . as such , the interior and exterior profile of wall 29 of the composite blade tip 27 may be made to mimic the wall profiles of the conventional blade tip 12 of fig1 or a new design may be employed . it should be noted that the unique manufacturing process for producing composite blade tip 27 allows for the manufacture of profile designs which would normally be disallowed by the constraints of the casting processes . although not illustrated herein , in some embodiments the wall 29 may not entirely surround machined cavity 28 . for example , the wall 29 may comprise one or more gaps to allow cooling air to escape from the machine cavity 28 . as such , the term โ substantially surrounding โ and variations thereof when referring to the wall 29 of blade tip 27 herein is intended to encompass embodiments where the wall 29 completely surrounds the machined cavity 28 and embodiments where gaps are provided in the wall 29 . the foregoing process may be either used for manufacturing a new turbine blade or retrofitting a composite blade tip 27 to a used turbine blade ( for repairing the used turbine blade or improving the performance of the used turbine blade ). as mentioned previously , the principle variation in the process relates to the method of producing the modified top surface 22 of fig2 . in repairing or retrofitting applications , material must generally be removed from the used turbine blade before the composite blade tip 27 may be added . in new manufacturing applications , the turbine blade component may be manufactured to be shorter in length , and the composite blade tip 27 is then added to the end of the manufactured airfoil component . in another aspect , the present invention comprises a composite turbine blade 100 having a blade tip 27 produced by the foregoing method . one additional benefit of the blade tip configuration of the present invention is that the tip plate 25 is attached to the turbine blade 100 over a larger contact area than the tip plate 14 of the conventional blade tip design of fig1 . this reduces the risk of the tip plate 25 becoming disconnected from the turbine blade 10 during operation . furthermore , the configuration of the present invention avoids the complexity associated with providing sufficient weld penetration in the conventional blade tip design of fig1 . the turbine blade 100 having a composite blade tip 27 benefits from variation in metallurgical properties at the tip of the blade . as described previously , the material of the plate 24 and the plate 26 may be generally selected to possess the optimal properties for the thermodynamic and mechanical stresses encountered at the particular location on the airfoil . in some embodiments , the blade tip 27 may be designed to simply prevent cracks which initiate in the airfoil from propagating to the tip of the airfoil . in embodiments where this is the principle design criteria , it may not be necessary to use an entirely different alloy for the blade tip 27 . for example , the blade tip 27 may comprise the same alloy as the cast portion of the airfoil where the grain orientation of the alloy of blade tip 27 is generally perpendicular to the grain orientation of the cast portion of the airfoil . such a variation in grain orientation may be considered a โ different material โ from the material of the cast portion of the airfoil since the orientation appreciably affects the manner in which the component responds to thermodynamic and mechanical stresses at the particular location where the component is placed on the turbine blade ( i . e . the orientation of the grain arrests the propagation of the crack ). as illustrated in fig5 , the turbine blade 100 may be further reinforced by modifying the platform 30 to which the root of the airfoil is attached . an insert 32 , which comprises a different material from the material of the platform 30 , is provided within an orifice formed in platform 30 . the orifice may be formed during the casting process used to produce the turbine blade 100 . alternatively , the orifice may be formed after the turbine blade is cast by milling away a portion of the material of the platform 30 . the insert 32 adds strength beyond that which is normally provided by the material of the platform 30 . as such , the insert 32 makes the platform 30 more strain tolerant . although various materials may be used for the insert 32 , renรฉ 80 โข, renรฉ 142 โข, renรฉ 195 โข alloys are exemplary materials for the insert 32 because of their excellent resistance to low cycle fatigue . as with the composite blade tip 27 , the insert 32 may be added during the manufacture of a new turbine blade or may be employed as retrofit strengthening or repair solution for a used turbine blade . similar to the composite blade tip 27 , the utilization of an insert 32 allows the metallurgical properties of the platform 30 to be optimized for the thermodynamic and mechanical stresses encountered at each location of the platform 30 . many different profiles may used for the insert . as illustrated in fig6 , the insert 32 may have vertically - straight sidewalls which mate with the vertically - straight sidewalls of the orifice in the platform 30 . alternatively , as illustrated in fig7 , the insert 34 may have a โ stepped โ sidewall which mates with a vertically - straight sidewall of the orifice in the platform 30 . in this embodiment , the insert 34 comprises a flange which overlaps a portion of the platform 30 . in another embodiment , as illustrated in fig8 , the insert 36 may have a stepped sidewall which mates with a orifice having a stepped sidewall in the platform 30 . in this embodiment , the platform 30 has a counterbore which mates with the flange of the insert 36 . in another embodiment , as illustrated in fig9 , the insert 38 has a tapered sidewall which mates with a orifice having a tapered sidewall in the platform 30 . in each of the foregoing examples , the insert may be attached to the platform 30 by various processes including , but not limited to , brazing , welding , or diffusion bonding . in one non - limiting example , a turbine blade of a conventional design is uniformly cast using a renรฉ 41 superalloy . the turbine blade tip is then modified as shown in fig2 using a cnc machine to form a modified top surface 22 having a flat plane across the flange 19 from the innermost point of the flange 19 to the outer surface of the turbine blade 100 . a plate of haynes 230 โข alloy , corresponding to the plate 24 , is then welded to the modified surface 22 as illustrated in fig3 . a plate of haynes 214 โข alloy , corresponding to the plate 26 , is then welded to the plate of haynes 230 โข alloy as illustrated in fig3 . the plates of haynes 230 โข alloy and haynes 214 โข alloy are then milled using the cnc machine to form the shape of the profile illustrated in fig4 . the platform 30 of the cast turbine blade is then milled using a cnc machine to remove the cast superalloy material in the region of the platform 30 occupied by the insert 32 of fig5 ( i . e ., the region of the platform 30 partially encircled by the curved face of the turbine blade ). an insert 32 is then cut from a plate of haynes 214 โข alloy to match the shape of the resulting void . the insert 32 is then joined by welding or brazing to the platform 30 as illustrated in fig5 . this written description uses examples to disclose the invention , including the best mode , and also to enable any person skilled in the art to practice the invention , including making and using any devices or systems and performing any incorporated methods . the patentable scope of the invention is defined by the claims , and may include other examples that occur to those skilled in the art . such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims , or if they include equivalent structural elements with insubstantial differences from the literal languages of the claims . | 5 |
several component parts of the trigger sprayer of the invention are found in the typical construction of a trigger sprayer , and therefore these component parts are described only generally herein . it should be understood that although the component parts are shown in the drawing figures and are described as having a certain construction , other equivalent constructions of the component parts are known . these other equivalent constructions of trigger sprayer component parts are equally well suited for use with the novel features of the invention to be described herein . the trigger sprayer includes a sprayer housing 12 that is formed integrally with a connector cap 14 . the connector cap 14 removably attaches the trigger sprayer to the neck of a bottle containing the liquid to be dispensed by the trigger sprayer . the connector cap 14 shown in the drawing figures has a bayonet - type connector on its interior . other types of equivalent connectors may be employed in attaching the trigger sprayer to a bottle . a liquid inlet opening 16 is provided on the sprayer housing 12 in the interior of the connector cap 14 . the inlet opening 16 provides access to a liquid supply passage 18 that extends upwardly through a cylindrical liquid column 22 formed in the sprayer housing 12 . the column 22 has a center axis 24 that is also the center axis of the liquid supply passage 18 . an air vent opening 26 is also provided on the sprayer housing 12 in the interior of the connector cap 14 . a cylindrical sealing rim 28 projects outwardly from the connector cap interior and extends around the liquid inlet opening 16 and the vent opening 26 . the rim 28 engages inside the neck of a bottle connected to the trigger sprayer to seal the connection . the sprayer housing includes a pump chamber 32 contained inside a cylindrical pump chamber wall 34 on the sprayer housing 12 . the pump chamber cylindrical wall 34 has a center axis 36 that is perpendicular to the liquid supply passage center axis 24 . the interior surface of the pump chamber wall 34 has a smaller interior diameter section adjacent a rear wall 38 of the pump chamber , and a larger interior diameter section adjacent an end opening 42 of the pump chamber . the smaller interior diameter portion of the pump chamber 32 functions as the liquid pump chamber , and the larger interior diameter portion of the pump chamber 32 functions as a portion of a venting air flow path through the sprayer housing 12 . the vent opening 26 in the sprayer housing connector cap 14 communicates the interior of the larger interior diameter portion of the pump chamber 32 with a bottle connected to the trigger sprayer . a pair of openings 46 , 48 pass through the pump chamber rear wall 38 and communicate the interior of the pump chamber with the liquid supply passage 18 . the first of the openings 46 is the liquid input opening to the pump chamber 32 , and the second of the openings 48 is the liquid output opening from the pump chamber . a liquid discharge tube 52 is also formed on the sprayer housing 12 . the liquid discharge tube is cylindrical and has a center axis 54 that is parallel with the pump chamber center axis 36 . the liquid discharge tube 52 defines the liquid discharge passage 58 of the sprayer housing . one end of the liquid discharge passage 58 communicates with the liquid supply passage 18 in the liquid column 22 , and the opposite end of the liquid discharge passage 58 exits the sprayer housing 12 through a liquid outlet opening 62 on the sprayer housing . the sprayer housing 12 is also formed with a pair of exterior side walls or side panels 64 that extend over opposite sides of the pump chamber wall 34 and over opposite sides of the discharge tube 54 . the side walls 64 extend over the pump chamber wall 34 in the area of the pump chamber rear wall 38 , but do not extend in the forward direction the full extent of the pump chamber wall 34 to the end opening 42 . the side walls 64 are spaced outwardly from the pump chamber wall 34 and the discharge tube 54 forming voids 66 between the side wall 64 and the pump chamber wall 34 and the discharge tube 54 . the side walls 64 have lengths on the opposite sides of the liquid discharge tube 54 that extend substantially the entire length of the discharge tube . a pair of pivot surfaces 70 are provided on the forward ends of the side walls 64 . as seen in fig2 , the pair of pivot surfaces 70 are positioned on opposite sides of the liquid discharge tube 54 . rear walls 68 of the sprayer housing 12 extend outwardly from opposite sides of the liquid column 22 and connect to the rearward edges of the side walls 64 . a valve assembly comprising an intermediate plug 72 , a resilient sleeve valve 74 and a resilient disk valve 76 is assembled into the liquid supply passage 18 . the valve assembly is inserted through the liquid inlet opening 16 and the valve assembly plug 72 seats tightly in the liquid supply passage 18 between the pump chamber input opening 46 and the pump chamber output opening 48 . thus , the plug 72 separates the liquid inlet opening 16 into the pump chamber 32 from the liquid outlet opening 62 from the pump chamber 32 . the disk valve 76 is positioned in the liquid supply passage 18 to control the flow of liquid from the liquid inlet opening 16 into the pump chamber 32 , and to prevent the reverse flow of liquid . the sleeve valve 74 is positioned to control the flow of liquid from the pump chamber 32 and through the liquid discharge passage 58 and the liquid outlet opening 62 , and to prevent the reverse flow of liquid . a valve plug assembly comprising a valve seat 78 , a dip tube connector 82 , and an air vent baffle 84 is assembled into the liquid inlet opening 16 inside the connector cap 14 . the valve seat 78 is cylindrical and seats against the outer perimeter of the valve assembly disk valve 76 . a hollow interior bore of the valve seat 78 allows liquid to flow through the bore and unseat the disk valve 76 from the seat 78 as the liquid flows from the inlet opening 16 to the pump chamber 32 . the periphery of the disk valve 76 seats against the valve seat 78 to prevent the reverse flow of liquid . the dip tube connector 82 is a cylindrical connector at the center of the plug assembly that connects to a separate dip tube ( not shown ). the valve plug assembly positions the dip tube connector 82 so that it is centered in the connector cap 14 of the sprayer housing . the air vent baffle 84 covers over but is spaced from the vent opening 26 in the connector cap 14 . the baffle 84 has a baffle opening 86 that is not aligned with the vent opening 26 , but communicates with the vent opening through the spacing between the air vent baffle 84 and the interior surface of the connector cap 14 . this allows air to pass through the vent opening 26 and through the baffle spacing and the baffle opening 86 to vent the interior of the bottle connected to the trigger sprayer to the exterior environment of the sprayer . because the vent opening 26 and baffle opening 86 are not directly aligned , the air vent baffle 84 prevents liquid in the bottle from inadvertently passing through the baffle opening 86 , the baffle spacing and the vent opening 26 to the exterior of the trigger sprayer should the trigger sprayer and bottle be inverted or positioned on their sides . a nozzle assembly 92 is assembled to the sprayer housing 12 at the liquid outlet opening 62 . the nozzle assembly 92 can have the construction of any conventional known nozzle assembly that produces the desired discharge pattern of liquid from the trigger sprayer . in the preferred embodiment of the invention , the nozzle assembly 92 has a rotatable nozzle cap 94 that selectively changes the discharge from a โ off โ condition where the discharge is prevented , to a โ spray โ condition , a โ stream โ condition and / or a foaming discharge . the nozzle assembly also has a tube 96 that attaches over the end of the liquid discharge tube 54 . this enables the liquid discharge tube 54 to have a smaller cross - sectional diameter dimension that increases the rate of liquid flow through the liquid discharge tube 54 and exiting the tube . a piston assembly comprising a liquid pump piston 102 and a vent piston 104 is mounted in the pump chamber 32 for reciprocating movement along the pump chamber axis 36 . the pump piston 102 reciprocates between a charge position and a discharge position in the pump chamber 32 . in the charge position , the pump piston 102 moves in a forward direction away from the pump chamber rear wall 38 . this expands the interior of the pump chamber creating a vacuum in the chamber that draws liquid into the pump chamber , as is conventional . in the discharge position , the pump piston 102 moves in an opposite rearward direction into the pump chamber toward the pump chamber rear wall 38 . this compresses the liquid drawn into the pump chamber 32 and forces the liquid through the output opening 48 , past the sleeve valve 74 and through the liquid discharge passage 58 and the liquid outlet opening 62 . as the pump piston 102 reciprocates in the pump chamber 32 between the charge and discharge positions , the vent piston 104 reciprocates between a vent closed position where the vent piston 102 engages against the interior surface of the pump chamber wall 34 , and a vent open position where the vent piston 104 is spaced inwardly from the interior of the pump chamber wall 34 . in the vent open position of the vent piston 104 , air from the exterior environment of the sprayer can pass through the pump chamber opening 42 , past the vent piston 104 to the vent opening 26 , and then through the spacing between the baffle 84 and the connector cap 14 , through the vent baffle opening 86 and to the interior of the bottle connected to the trigger sprayer . a manually operated trigger 112 is mounted on the sprayer housing 12 for movement of the trigger relative to the sprayer housing . the trigger 112 has a pair of pivot posts 114 that project from opposite sides of the trigger . the posts 114 engage in a sliding contact with the pivot surfaces 70 on the sprayer housing and thereby mount the trigger to the sprayer housing 12 for pivoting movement . a pair of tab abutments 116 project outwardly from the pivot posts 114 limit the pivoting movement of the trigger 112 toward the sprayer housing 12 . the tab abutments 116 are positioned to engage against the sprayer housing pivot surfaces 70 in the forwardmost position of the trigger 112 relative to the sprayer housing . in this way the pivot surfaces 70 function as stop surfaces that prevent any further forward pivoting movement of the trigger 112 . the construction of the trigger includes a finger engagement surface that is engaged by the fingers of a user &# 39 ; s hand . squeezing the trigger causes the trigger to pivot rearwardly toward the pump chamber 32 , and releasing the squeezing force on the trigger allows the trigger to pivot forwardly away from the pump chamber . the novel construction of the trigger sprayer of the invention includes a piston rod 122 that is operatively connected between the trigger 112 and the pump piston 102 and vent piston 104 . the piston rod 122 has a length with a annular collar or ring 124 at one end of the rod length . the ring 124 is assembled to the pump chamber 32 around the chamber end opening 42 . the opposite end 126 of the piston rod 122 engages with and is operatively connected to the trigger 112 . the novel construction of the trigger sprayer also includes a pair of springs 132 that are formed integrally with the piston rod 122 and the ring 124 . together the springs 132 , the piston rod 122 , and the ring 124 are one , monolithic piece of plastic material , thereby reducing the number of separate component parts that go into the construction of the trigger sprayer . the pair of springs 132 each have a narrow , elongate length that extends between opposite proximal 134 and distal 136 ends of the springs . the intermediate portions 138 of the springs between the proximal ends 134 and distal ends 136 have the same bent or inverted u - shaped configurations . the spring proximal ends 134 are connected to the piston rod 122 at the first end or forward end 126 of the piston rod . from the proximal ends 134 , the lengths of the springs angle upwardly away from the piston rod 22 and the pump chamber center axis 36 and then extend through the intermediate portions 138 of the springs . as the lengths of the springs extend through their u - shaped intermediate portions 138 , the springs extend along opposite sides of the liquid discharge tube 154 and over the pump chamber wall 34 . the springs then extend downwardly toward the pump chamber center axis 36 as the springs extend to their distal ends 136 connected to the ring 124 . the ring is attached around the pump chamber 32 at the end opening 42 and thereby connects the spring distal ends 136 to the sprayer housing 12 . the inverted , u - shaped configurations of the springs 132 bias the piston rod 122 and the connected pump piston 102 and vent piston 104 outwardly away from the pump chamber rear wall 38 . this biases the pump piston 102 toward its charge position relative to the pump chamber 32 and the sprayer housing 12 . by manually squeezing the trigger 112 , the spring proximal ends 134 move toward the spring distal ends 136 , narrowing the u - shaped bend in the intermediate portions 138 of the springs . when the squeezing force on the trigger 112 is removed , the resiliency of the springs pushes the trigger 112 away from the pump chamber rear wall 38 and moves the pump piston 102 back to its charge position relative to the pump chamber 32 . a shroud 142 is attached over the sprayer housing 12 to provide an aesthetically pleasing appearance to the trigger sprayer . the shroud 142 has a lower edge 144 that is positioned below the u - shaped bends in the pair of springs 132 . thus , the shroud 142 protects the springs 132 from contact with portions of the hand or other objects exterior to the trigger sprayer when the trigger sprayer is being operated . fig5 - 16 show a further embodiment of the trigger sprayer apparatus of the invention . many of the component parts of the trigger sprayer embodiment shown in fig5 - 16 are substantially the same as those of the embodiment shown in fig1 - 4 and described above . therefore , these same component parts will not be further described . the embodiment of the trigger sprayer shown in fig5 - 16 differs from the earlier described embodiment in the construction of the pivoting connection between the trigger 152 and the sprayer housing 154 . referring to fig5 and 11 - 16 , the sprayer housing 154 comprises a pump chamber 156 , a liquid inlet opening 158 , a liquid supply passage 162 that communicates the liquid inlet opening 158 with the pump chamber 156 , a liquid outlet opening 164 and a liquid discharge passage 166 that communicates the liquid outlet opening with the pump chamber 156 . except for the liquid discharge passage 166 , these are all basically the same as those of the embodiment of fig1 . the liquid discharge passage 166 extends through a liquid discharge tube 167 of the sprayer housing 154 . the discharge tube has a reduced cross - sectional area which reduces the cross sectional area of the liquid discharge passage 166 . the reduced cross - sectional area of the liquid discharge passage 166 increases the velocity of liquid flow and the force of liquid ejected from the liquid outlet opening 164 over that of prior art trigger sprayers . the liquid outlet opening 164 has a center axis 168 that defines an axial direction relative to the sprayer housing 154 . the axial direction extends forwardly to the left in fig5 and rearwardly to the right in fig5 . the sprayer housing 154 also has a pair of side walls 169 that are similar to those of the previously described embodiment . however , each of the sprayer housing side walls 169 has a socket hole 172 . the socket holes 172 are each partially defined by pivot surfaces 174 that are similar to the pivot surfaces 70 of the earlier described sprayer housing . the sprayer housing 154 is also formed with a pair of stop surfaces 176 on the sprayer housing side walls 169 . the stop surfaces 176 are positioned on the side walls 169 outside of the pivot surfaces 174 that define the socket holes 172 . both the stop surfaces 176 extend in the axial direction rearwardly from the pivot surfaces 174 of the socket holes 172 on opposite sides of the liquid outlet opening center axis 168 . the sprayer housing 154 is also formed with a pair of exterior flanges 178 . the pair of exterior flanges 178 are positioned on the sprayer housing 154 outside of the pair of stop surfaces 176 and outside the pair of pivot surfaces 174 . thus , there is a spacing between the sprayer housing side walls 169 that contain the socket holes 172 and the exterior flanges 178 . this spacing is occupied by the stop surfaces 176 . the trigger 152 of the embodiment shown in fig5 - 16 has a forwardly directed finger engagement surface 184 . a pair of spaced arms 186 project upwardly from the trigger finger engagement surface 184 . the arms 136 extend across opposite sides of the sprayer housing liquid discharge tube 167 . the arms 186 project from the trigger finger engagement surface 184 to distal ends 188 of the arms that are positioned above the liquid discharge tube 167 . the arm distal ends 188 are also positioned between the sprayer housing side walls 169 and the sprayer housing exterior flanges 178 . pivot posts 192 are provided on the arm distal ends 188 . the pivot posts 192 project from the arm distal ends 188 toward each other and into the spacing between the pair of arms 186 . the pivot posts 192 engage in a sliding contact with the pivot surfaces 174 of the sprayer housing 154 and thereby mount the trigger 152 to the sprayer housing 154 for pivoting movement of the trigger between a forward , charge position of the trigger relative to the sprayer housing and a rearward , discharge position of the trigger relative to the sprayer housing . the trigger 152 is also formed with a pair of abutments or tabs 194 that project from the pivot posts in the axial direction rearwardly from the trigger 152 . the pair of tabs 194 disengage from the stop surfaces 176 and move through an arc movement away from the stop surfaces 176 when the trigger 152 is moved from the charge position relative to the sprayer housing 154 toward the discharge position of the trigger relative to the sprayer housing . the tabs 194 are positioned to engage against the stop surfaces 176 as the trigger 154 is pivoted to its forward , charge position . the engagement of the tabs with the stop surfaces 176 prevents further forward movement of the trigger toward the nozzle assembly 196 . this prevents the trigger 152 from pushing against the nozzle assembly 196 and potentially pushing the nozzle assembly 196 off the sprayer housing 154 . although the trigger sprayer of the invention has been described above by reference to a specific embodiment , it should be understood that modifications and variations could be made to the trigger sprayer without departing from the intended scope of the following claims . | 1 |
a telephone circuit in accordance with the present invention , whose block diagram is shown in fig1 comprises a signal amplifier circuit sa , having at least one input terminal rt for connection to exchange components designed to generate a sinusoidal ac signal with a frequency identical to that of the ringing signals to be sent to the line , but having a smaller amplitude . the amplifer sa also has an enabling terminal e and first and second output terminals for connection to a two - wire telephone line ( not shown ). sgs microelettronica s . p . a . part no . l 3000 may be used for the amplifier circuit sa . the exchange components referred to in the description are not shown in fig1 . the telephone circuit of fig1 further comprises a timing signal generator circuit fc , having at least one input terminal connected to the input terminal rt and having at least one output terminal . the timing signal generator circuit fc generates a timing signal at each instant of time in which the amplitude of the sinusoidal signal supplied to the terminal rt passes through zero during signal variations of the same type , i . e . either only when the amplitude of the sinusoidal signal is monotonally increasing or only when the amplitude of the sinusoidal signal is monotonally decreasing . sgs microelettronica s . p . a . part no . lm 399 may be used for the generator circuit fc . in fig1 a logic control circuit c has a first terminal cs for connection to exchange components and generates control signals for supplying ringing signals to the line . these signals determine the beginning and end of the subscriber call signal and the ringing rhythm . a dc current detector circuit rs detects a dc current on the line , even when an ac current is simultaneously present on the line , and generates a signal when it detects a dc current on the line . a current comparator comp generates a signal when the value of the line current exceeds a predetermined value ( i ref ). fig1 a illustrates such a comparator circuit comp . the comparator i . c . may be formed of sgs microelettronica s . p . a . part no . l 339 . both the detector circuit rs and the current comparator comp have at least one input terminal il for connection to the line . the detector circuit rs has an output terminal connected to a second terminal ps of the logic circuit c , while the comparator comp has an output circuit connected to both a third terminal sc of the logic circuit c and to an input terminal of a transfer circuit hs also incorporated in the circuit . the logic control circuit c has a fourth input terminal ck connected to the timing generator circuit fc and may change its logic state only at the time of these signals . the logic circuit c has a first output terminal is connected to the enabling terminal e of the signal amplifier circuit sa and a second output terminal inh connected to an inhibiting terminal of the transfer circuit hs . the transfer circuit hs has at least one output terminal for connection to exchange control components ( not shown ) designed to recieve and process signals generated by the transfer circuit with a memory as signals advising that an off the hook condition has actually taken place . the following is an examination of the operation of a telephone circuit in accordance with the present invention describing possible practical embodiments on the various circuit blocks included in the diagram of fig1 . the signal amplifier circuit sa may be a normal amplifier of a type known to persons skilled in the art which is switched on and off by a control or &# 34 ; enabling &# 34 ; terminal e . the switching on and off of the amplifier gives rise , from the sinusoidal signal coming from the exchange components , to the ringing signals which are spaced in time and also have a sinusoidal wave shape . the amplifier circuit sa is in general not directly coupled to the telephone line , but rather via further circuit amplification and supply means of the line . the timing signal generator circuit fc may be constructed as a circuit known in the technical literature as a &# 34 ; zero crossing detector &# 34 ;. when an ac signal is supplied to the input of this known circuiit , it is possible to obtain a pulse signal output each time that the amplitude of the input signals passes through zero or reaches a predetermined threshold , or each time that it passes through zero in a predetermined manner . in the latter case , if a sinusoidal signal is supplied to the input terminal , the circuit generates pulse output signals with a frequency equal to the frequency of the sinusoidal input signal . in a telephone circuit in accordance with the present invention , these pulse signals act a timing signals to synchronize all of the functions of the circuit exactly with points in time in which the amplitude of the ringing signals to be supplied to the line pass through zero . the detector circuit rs may take the form , using known solutions , of a line current transducer and integrator circuit which integrates the current supplied by the transducer over one or more whole periods of the line voltage . a solution of this type is disclosed , for example , in italian patent application 23832 a / 83 , and the corresponding english language european cognate patent application no . 0143435 a 2 . when the integrator detects the presence on the line of a dc current having a value greater than a predetermined value , an information signal , showing that there is a dc current on the line and therefore that an off the hook condition may have taken place , is generated . this information signal supplied by the detector circuit rs is processed , however , by the logic control circuit c in such a way that the exchange components cannot be erroneously advised of an off the hook condition which has not , in fact , taken place . the logic circuit c is connected for this purpose to the current comparator comp , of a type known to those skilled in the art , which generates an information signal when the instantaneous value of the line current exceeds a predetermined value . this signal , which is taken by the logic circuit c as advice that an off the hook condition has taken place , is also transmitted to the exchange components via the transfer circuit hs which is driven , via its inhibiting terminal , by the logic circuit c such that the signal generated by the current comparator comp is transmitted only when the information that an off the hook condition has taken place is certain . the transfer circuit hs may simply be an electronic switch which prevents the transfer of the signal generated by the comparator when a signal generated by the logic circuit c is supplied to the inhibiting terminal . for particular design reasons , it may , however , take the form of the more complex circuit comprising a memory component shown in fig2 . in this case , the transfer circuit hs is designed , when no signal is being supplied to the inhibiting terminal , to transfer as output the signals supplied to the input terminal and is , in contrast , designed to store , at the instant in which a signal is supplied to the inhibiting terminal , the presence or absence of an input signal , generating , when a signal is supplied in this instant to the input terminal , an output signal until the signal supplied to the inhibiting terminal is discontinued . the main component of a telephone circuit of the invention is the logic control circuit c , whose operating stages are fully synchronized with the instants of time in which the ringing signal has a zero amplitude by the timing signals supplied to the input terminal ck . the logic control circuit c comprises circuit means designed to generate , via the output terminal is , a signal enabling the signal amplifier circuit sa to supply ringing signals to the line when a control signal from the exchange is supplied to the control terminal cs , starting to generate this signal , however , only after a predetermined number of timing signals from the instant of time in which the control signal is supplied and continuing to generate the signal , if no off the hook condition ( whether actual or assumed ) is detected , up to the instant of time in which the first timing signal following the cessation of the control signal is supplied to the terminal ck . this avoids uncertainties as regards the control signal from the exchange and avoids , as mentioned above , the generation of interference on the line . these circuit means included in the logic control circuit c are also designed to generate , via the output terminal inh , from the same instant of time as that in which the enabling signal begins to be generated via the output terminal is , a signal inhibiting the transfer circuit hs from transmitting any signals to the exchange control components . this inhibiting signal continues to be generated , when an off the hook condition has not been confirmed , up to the instant of time in which a predetermined timing signal , following the cessation of the control signal supplied to the terminal cs , is supplied to the terminal ck . this predetermined timing signal in not in general the first timing signal after the cessation of the control signal , but a subsequent signal , selected such that before transmission of an information signal advising that an off the hook condition has taken place to the exchange components , there is time for the confirmation of an off the hook condition by the logic control circuit c and such that this transmission takes place when the telephone network is stabilized after the supply of ringing signals to the line has been discontinued . the logic control circuit c also comprises a first and a second timed control circuit which make it possible to interrupt or prevent the generation of signals via the output terminals is and inh . the first timed control circuit is designed to detect any signal of an assumed off the hook condition supplied to the input terminal ps only in those instants in time in which a control signal is being supplied to the input terminal cs and a timing signal is simultaneously being supplied to the input terminal ck , with the exception of a predetermined number of such instants of time after each occasion in which the first timed control circuit detects the supply of a signal to the input terminal ps . when it detects the supply of a signal to the terminal ps , the first timed control circuit inhibits the generation , via the output terminal is , of the enabling signal until a predetermined timing signal is subsequently supplied to the input terminal ck . in this way the logic control circuit c , during the calls stage , as soon as it receives advice from the circuit means rs of a possible off the hook condition , discontinues for a predetermined period , needed for the subsequent confirmation of an actual off the hook condition , the supply of ringing signals to the line . if an off the hook condition has not in fact taken place , the supply of ringing signals may be restarted if , obviously , a control signal is still being supplied to the input terminal cs . the operation to check whether an off the hook condition has actually taken place is essentially carried out by the second timed control circuit , which detects , via the terminal sg , a possible signal generated by the current comparator comp only when the input terminal ck is being supplied with that predetermined timing signal which also enables the generation of the enabling signal to be continued via the output terminal is , after every interruption thereof , and when , at the same time , a control signal is being supplied to the input terminal cs . in this way the possible signal from the comparator comp may be detected in an instant of time in which the network is stabilized and there is still not ac current on the line , starting to supply ringing signals to the line only at that instant of time , since this possible signal is undoubtedly a confirmation of a dc current on the line due to an actual off the hook condition . when the second timed control circuit detects the supply of a confirmation signal to the terminal sg , it disables the first timed control circuit from detecting the supplying of signals to the input terminal ps and inhibits the generation of signals via the two output terminals is and inh until the first timing signal following the cessation of the supply of the control signal from the exchange components to the input terminal cs is supplied to the input terminal ck . as soon as the generation of the inhibiting signal via the terminal inh is discontinued , the transfer circuit hs enables the transmission of the signal generated by the current comparator comp to the exchange components as advice that an off the hook condition has taken place and this interrupts the control signal being supplied to the first input terminal cs of the logic control circuit c which , as is clearly shown form the mode of operation described below , returns to an initial state in which it waits for further control signals from the exchange . it should be noted that there is no difference between a discontinuation of the control signal designed to determine the ringing rhythm and a discontinuation due to the cessation of the call phase . a relatively simple circuit embodiment of the logic control circuit c is immediately suggested to persons skilled in the art on the basis of the characteristics described above with respect to the circuit means which generates the output signals and the first and the second timed control circuits . these may be constructed directly in a known manner , or , obviously to the person skilled in the art , using and gates , d type flip - flops and timing pulse signal counters . it is important to note , however , that the logic control circuit c may be constructed as a logic state machine designed to carry out a number of functions , not just those listed , comprising an assembly of constituent logic components from which is would not be possible to pick out , unequivocally in time , circuit means for generating signals and timed control circuits , even though it would be possible to pick out , at each instant of time , the various logic components designed to form them in practice . only the fact that the logic circuit always comprises these circuit means and timed control circuits is a feature of the present invention . fig3 thus shows a flow chart illustrating the evolution over time of the logic states of a logic state machine designed to form the logic control circuit c . a person skilled in the art could construct the circuit of the logic state machine directly from this flow chart using the circuit components which he has available . the form of the illustration of fig3 is of a conventionally known type . each rectangle , which represents a logic state , shows the state of the outputs of the logic control circuit c , indicating the symbol of the output terminal ( s ) via which a signal is being generated . each diamond , which represents a decision function of the logic circuit , shows the symbol of the input terminal to which a signal is being supplied causing the subsequent passage , shown by an arrow , to another logic state . the letter y indicates the passage caused by the supply of a signal to this terminal , while the letter n indicates the passage which takes place if no signal is being supplied . passage from one logic state to the next takes place at each timing signal supplied to the input terminal ck . the rectangles is dashed lines represent the possibility of one or more repetitions of the prior state shown by a rectangle in continuous lines . it is evident that telephone circuit in accordance with the present invention not only makes it possible to prevent interference on the line and to obtain at the same time reliable detection of an off the hook condition actually taking place , but also allows its integration in more complex interface circuits whose completely separate functions may be carried out by the same logic circuit . although a single embodiment of the invention has been described and illustrated it is evident that many variants are possible without departing from the scope of the invention . | 7 |
in the following detailed description , reference is made to the accompanying drawings which form a part hereof , and in which is shown by way of illustration specific embodiments by which the invention may be practiced . it should be understood that like reference numerals represent like elements throughout the drawings . these exemplary embodiments are described in sufficient detail to enable those skilled in the art to practice the invention . it is to be understood that other embodiments may be utilized , and that structural , logical and electrical changes may be made without departing from the spirit and scope of the present invention . the terms โ wafer โ and โ substrate โ are to be understood as including all forms of semiconductor wafers and substrates including , silicon , silicon - on - insulator ( soi ), silicon - on - sapphire ( sos ), doped and undoped semiconductors , epitaxial layers of silicon supported by a base semiconductor foundation , and other semiconductor structures . furthermore , when reference is made to a โ wafer โ or โ substrate โ in the following description , previous process steps may have been utilized to form regions or junctions in or above the base semiconductor structure or foundation . in addition , the semiconductor need not be silicon - based , but could be based on other semiconductors , for example , silicon - germanium , germanium , or gallium arsenide . the term โ pixel โ refers to a picture element unit cell containing circuitry including a photosensor and semiconductors for converting electromagnetic radiation to an electrical signal . for purposes of illustration , fabrication of a representative pixel is shown and described . typically , fabrication of all pixels in an imager will proceed simultaneously in a similar fashion . the following detailed description is , therefore , not to be taken in a limiting sense , and the scope of the present invention is defined by the appended claims . although the invention is described herein with reference to the architecture and fabrication of one or a limited number of pixels , it should be understood that this is representative of a plurality of pixels as typically would be arranged in an imager array having pixel cells arranged in an array , for example , an array of pixel rows and columns . in addition , although the invention is described below with reference to a pixel array for a cmos imager , the invention has applicability to all solid - state imaging devices using pixels ( e . g ., a ccd imager ). the invention may also be employed in display devices where a pixel has a light emitter for emitting light . the following detailed description is , therefore , not to be taken in a limiting sense , and the scope of the present invention is defined only by the appended claims . color filters in a trench recess are beneficial for reduced stack height and improved pixel optics . the recessed color filter array provides an improved acceptance angle range for incoming light , reducing optical crosstalk . the recessed color filter array essentially places the micro - lens and color filter substantially closer to the photosensor , thus reducing the amount of diffracted or misdirected light reaching - neighboring pixels . however , if the color filter array thickness , while recessed , is less than the depth of the trench , effective planarization by cmp is not possible . fig1 shows a cross sectional view of an image sensor pixel array constructed in accordance with an exemplary embodiment of the invention . the image sensor 100 comprises a photo - conversion device 170 , a micro - lens 110 , and a plurality of fabricated layers between the photo - conversion device 170 and the micro - lens 110 . the photo - conversion device could include a photosensor , which receives light and generates an electrical signal or a photo emitter , which receives an electrical signal and generates light . the plurality of fabricated layers typically include a clear polymide planarization layer 120 , a color filter array layer 130 , a silicon nitride passivation layer 140 , a plurality of interlayer dielectric layers 150 and associated metallization layers , and a boron - phosphorous glass layer ( bpsg ) 160 . the color filter array 130 is recessed into a trench 190 in a passivation layer 140 . the color filter array 130 thickness is less than the depth of the trench 190 . fig2 is a flow chart of a method for forming a color filter array according to the invention . fig2 a - 2d illustrate the fig1 structure prior to formation of an upper planarization layer 120 and micro - lens layer 110 . fig2 a shows a photosensor 170 in a substrate 180 . over that is bpsg layer 160 , which is below one or more interlayer dielectric layers 150 and associated metallization layers . above the uppermost interlayer dielectric layer 150 can be a passivation layer 140 , e . g ., a silicon nitride layer . according to an exemplary embodiment of the invention , in step 201 , and referring to fig2 and 2 a , a trench 190 is created in the passivation layer 140 above the photosensor 170 , which is filled partially with a color filter material 130 . the trench 190 may also be etched through passivation layer 140 , ild and associated metallization layers 150 and partially into the bpsg layer 160 . the color filter array 130 thickness is less than the depth of the trench 190 . at this stage , the color filter array 130 will have imperfect planarity . the color filter array 130 can be any thickness between a thin layer above the surface of the bottom of the trench 190 and filling the depth of the trench 190 completely . next , referring also to fig2 b , in step 202 any remaining trench above the color filter array 130 is filled with a fill material 125 such as a photoresist material . the photoresist material 125 can be a spin coated material but can be deposited as well . the photoresist material 125 fills the trench 190 until the material 125 exceeds the depth of the trench 190 . then in step 203 , referring also to fig2 c , the resist material 125 surface is planarized to the top surface of the passivation layer 140 . the preferred method for planarizing the resist material 125 surface is cmp . however , any of a number of other methods for planarizing already known in the art can be used . finally , referring to fig2 d , in step 204 the resist material 125 and color filter array 130 are dry etched back to form a planarized cfa surface . after the etch process , the thickness of the color filter array 130 will be uniform and is less than the depth of the trench 190 . the resist material 125 and color filter array 130 can also be etched back by any method known in the art , e . g ., wet etch . the preferred method is an unselective dry etch . it should be appreciated that the etch can be masked , if needed , by a suitable resist mask . by masking the etch , the passivation layer around the recessed area can be protected . after the etch , the optional upper planarization layer 120 and the micro - lens layer 110 are added . by recessing the color filters in a trench , a reduced stack height can be obtained and the lens 110 can be located closer to the photo - conversion device 170 . the recessed color filter helps reduce optical crosstalk due to diffracted or misdirected light , effectively increasing the angular acceptance range for incoming light and reducing color artifacts . it should be appreciated that in the exemplary embodiment discussed above the trench 190 has been described as recessed into the passivation layer 140 , however the trench 190 may be recessed from or continue into additional layers , i . e ., a plurality of fabricated layers , e . g ., layers 150 , 160 . for example referring to fig3 , trench 190 may begin at the level of micro - lens layer 110 , or at the level of upper planarization layer 120 and continue downward through the passivation layer 140 into the interlayer dielectric layers 150 and associated metallization layers . in other words , the trench 190 may recess through any other layer included within the image sensor 100 between the photosensor layer 170 and the micro - lens layer 110 . the invention may be used in solid state imagers employing various kinds of photosensors formed on a substrate in photosensor layer , including but not limited to photodiodes , photo transistors , photoconductors , and photogates . fig4 illustrates an exemplary cmos imager 1100 that may utilize the invention . the cmos imager 1100 has a pixel array 1105 comprising pixels constructed to include the recessed color filter array in accordance with the invention . the cmos pixel array 1105 circuitry are conventional and are only briefly described herein . array row lines are selectively activated by a row driver 1110 in response to row address decoder 1120 . a column driver 1160 and column address decoder 1170 are also included in the imager 1100 . the imager 1100 is operated by the timing and control circuit 1150 , which controls the address decoders 1120 , 1170 . a sample and hold circuit 1161 associated with the column driver 1160 reads a pixel reset signal vrst and a pixel image signal vsig for selected pixels . a differential signal ( vrst - vsig ) is amplified by differential amplifier 1162 for each pixel and is digitized by analog - to - digital converter 1175 ( adc ). the analog - to - digital converter 1175 supplies the digitized pixel signals to an image processor 1180 which forms a digital image . fig5 shows a processor system 1200 which includes an imaging device 1210 ( such as the imaging device 1100 illustrated in fig3 ) of the invention . the processor system 1200 is exemplary of a system having digital circuits that could include image sensor devices . without being limiting , such a system could include a computer system , camera system , scanner , machine vision , vehicle navigation , video phone , surveillance system , auto focus system , star tracker system , motion detection system , image stabilization system , and other systems employing an image sensor . system 1200 , for example a camera system , generally comprises a central processing unit ( cpu ) 1220 , such as a microprocessor , that communicates with an input / output ( i / o ) device 1270 over a bus 1280 . imaging device 1210 also communicates with the cpu 1220 over the bus 1280 . the processor system 1200 also includes random access memory ( ram ) 1290 , and can include removable memory 1230 , such as flash memory , which also communicate with the cpu 1220 over the bus 1280 . the imaging device 1210 may be combined with a processor , such as a cpu , digital signal processor , or microprocessor , with or without memory storage on a single integrated circuit or on a different chip than the processor . it should also be appreciated that the imager device 1100 of the claimed invention may also be used within display imager devices having light emitters fabricated on a substrate rather than photosensors . the processes and devices described above illustrate preferred methods and typical devices of many that could be used and produced . the above description and drawings illustrate embodiments , which achieve the objects , features , and advantages of the present invention . however , it is not intended that the present invention be strictly limited to the above - described and illustrated embodiments . any modification , though presently unforeseeable , of the present invention that comes within the spirit and scope of the following claims should be considered part of the present invention . | 7 |
the principles of the present invention are particularly useful when incorporated in a lithotripter , generally indicated at 1 in fig1 . the lithotripter 1 is composed of a first sub - housing 3 and a second sub - housing 5 , which are essentially rotationally symmetrical . the sub - housing 3 has an upper domed part 3a with a central opening 7 , which is covered by a coupling membrane 9 , which is over the opening . shockwave pulses generated in the lithotripter 1 will emerge through this opening 7 via the coupling membrane 9 into a patient 11 , which is to be treated . a lower , essentially annular part 3b of the first sub - housing 3 , is rotatably connected to the second sub - housing 5 by a plain cylindrical bearing 13 . the second sub - housing 5 includes a non - pivotable upper or first part 15 , which is fashioned as an annular member and whose outside surface is received by the part 3b to form the cylindrical bearing 13 . the sub - housing 5 has a pivotable pot - shaped or second part 17 , whose floor or base has an opening 18 on which a shockwave source 19 is secured . the shockwave source 19 can , preferably , be a shockwave tube , which is disclosed in greater detail in u . s . pat . no . 4 , 674 , 505 . the pivotable pot - shaped part 17 is pivotably mounted to tilt around a swivel axis 21 by a pair of trunnions 22 which , as illustrated , lie in the plane of the paper in fig1 . the exact arrangement of the swivel axis 21 shall be set forth in greater detail hereinafter . in order to achieve a water - tightness of the lithotripter housing 3 and 5 , the pivotable pot - shaped part 17 and the non - pivotable part 15 are interconnected to one another by an inwardly situated bellows 23 . given a pivot of the pot - shaped part 17 , one half of the bellows 23 will be compressed , while the other half is pulled or stretched apart . a filling of the housing parts 3 and 5 with a dielectric , such as , for example , water , is required for reasons of the shockwave propagation . the shockwave source 19 has a central axis z , which coincides with the central axis of a focussing means 25 , which is mounted in the housing parts 3 and 5 adjacent the membrane 9 . the focussing means 25 , as illustrated in the exemplary embodiment , is a biconcave lens . the convergent lens of the focussing means is arranged centrally relative to the central axis z and is mounted for displacement along the central axis z by displacement means 29 . to this end , the displacement means comprises , for example , three rotating rods 31 ( only one being shown for purposes of illustration in fig1 ) having threads , which rods are offset by an angle of 120 ยฐ relative to one another . the threads are cut into the upper part of the revolving rod 31 , which is received in a lower part 31a of the revolving rod 31 . the lower rod 31a is mounted in the floor or base of the part 17 in a rotationally movable fashion . two respective locking rings 30 hold every rod 31 axially rigid with respect to the part 17 . to provide a seal for the rod , an o - ring 32 is situated in an annular channel which is formed in the part 31a between the locking rings 30 . the edges of the revolving threads 31 engage into the inside threads at an outer edge 27 of the lens or focussing means 25 . a uniform rotation of the three revolving threads 31 displaces the lens 25 along the central axis z and , thus , perpendicular to the shockwave emission surface formed by the membrane 9 . a gear wheel 34 is mounted on the ends of each of the three thread parts 31a to create this linear displacement . all three gear wheels 34 are driven by a common tooth belt ( not shown ), which is driven by a motor ( not shown ). the lens 25 has a focal point f , which , thus , remains on the central axis z during displacement . the heads 33a and 35a of the two ultrasound transmission and reception means 33 and 35 , respectively , are fashioned as sector scanners and are arranged on the edge 27 of the lens 25 with a relative offset to one another by a rigidly prescribed angle alpha with respect to the axis z . in the illustrated embodiment , the angle alpha amounts to 90 ยฐ. the first head 33a is shown in broken lines , since it is situated in front of the plane of the observation with respect to the cross section of fig1 . the scanning plane e1 of the first ultrasound transmission and reception apparatus 33 extends perpendicular to the plane of the paper and proceeds through the central axis z . the second scan plane e2 , which is produced by the second sector scanner or head 35a of the second ultrasound transmission and reception means lies in the plane of the paper and is illustrated by lines including dashes and three dots . the second scan plane e2 also extends through the axis z . the geometrical conditions for the scan planes e1 and e2 , which extend perpendicular to one another and both extend through the central axis z of the focussing means 25 , are rigidly prescribed . the ultrasonic heads 33a and 33b are illustrated as being inclined towards the focal point f and are accommodated in the periphery or at the edge 27 of the lens 25 and are , thus , firmly mounted therein . three or four reinforcements or bulges 37 ( only one is shown ) are provided on the part 3b of the first sub - housing 3 . each of these bulges has a bore 39 , which receives rods or members of a mounting means , which enable the lithotripter 1 to be moved into and out of engagement with the patient 11 . the process or method of locating the lithotripter 1 is illustrated in fig2 - 5 . fig2 illustrates a schematic plan view of the effective focussing means 25 , as well as the first sector scanner 33a with its first scan plane e1 in the plane x - z , and the second scanner head 35a with its second scan plane e2 , which is in the plane y - z . in order to pivot the second scan plane e2 around the swivel axis 21 of fig1 the y axis is provided with a symbolic swivel bearing 41 . the sector - shaped scan planes e1 and e2 can be viewed on a picture screen of the apparatus 33 or 35 . in broken lines , fig2 shows a constellation of the axis x &# 39 ;, y &# 39 ; and z &# 39 ;, wherein z &# 39 ; is identical to z of the lithotripter 1 relative to a calculus k in the inside of the patient 11 , as initially randomly derived when the lithotripter is coupled to the patient still undirected when first applied . the calculus or stone k lies at some location between the scan planes e1 &# 39 ; and e2 &# 39 ;, which are not yet aligned . as a first step for the exact location of the stone k in a lithotripter adjustment , the second sub - housing 5 is rotated around the central axis z with the assistance of the cylindrical bearing 13 upon entrainment of both the apparatuses 33 and 35 until the calculus or stone k appears in the first scan plane e1 of the first ultrasonic scanner head 33 . this corresponds to a solid line x , y axis in fig2 . for the sake of clarity , the apparatus 33 and 35 are shown outside of the lens 25 , however , in the present case , the overall arrangement of the lens 25 , with the heads 35a and 33a are all rotated together . with the stone or calculus k lying in the plane e1 , the apparatus will have the configuration or cross section illustrated in fig3 a . the picture screen image of the calculus k and the mixed - in focus f occurs , as illustrated in fig3 b . however , the scan plane e2 , which in fig3 a extends perpendicular to the plane of the paper through the axis z , still misses the calculus or stone k . the picture screen for the second sector scanner 35 , thus , does not yet show the calculus k . as illustrated in fig4 a , the next step is to pivot the shockwave source 19 and focussing means 25 , plus the rigidly connected ultrasound transmission and reception apparatuses 33 and 35 around the swivel axis 21 , which extends perpendicular to the plane of the paper from the position illustrated in broken lines to a position where the calculus k will lie in the plane e2 and will appear in the picture screen of the second sector scanner 35 . the swivel axis 21 is aligned so that the calculus or stone k simultaneously remains in the scan region of the first ultrasonic scanner 33a . this means that the axis 21 must be arranged to extend perpendicular to the central axis z and must also lie in the scan plane e2 of the second ultrasonic scanner head 35a , which is imaged as lying in the back side of the focussing means 25 . fig4 b is the image for the first sector scanner 33 with the position of the calculus k shown in broken lines before the pivoting and the position after pivoting is shown in bold lines . in fig4 c , the image for the sector scanner 35 illustrating the position of the calculi after the pivoting so that the calculi also lies in the plane e2 . after the second positioning step , which is the step of pivoting on the axis 21 , the lithotripter 1 is aligned so that the calculus or stone k lies on the central axis z and , thus , can be seen on both picture screens . the depth position of the calculus k on the central axis z , however , has not coincided with the focal point f of the focussing means 25 . the focal point f is now displaced towards the calculus k in a third adjustment step by turning the rotating threads or positioners 31 of the displacement means 29 . the focussing procedure is , thus , concluded and the first shockwave pulses can now be triggered to disintegrate the stone k . the displaceability of the focal point f , without having to modify the position of the coupling membrane 9 relative to the patient 11 is an advantage of the lithotripter of the present invention . the possibility of turning and / or swivelling the scanning planes e1 and e2 of the ultrasound scanners 33 and 35 , respectively , creates the possibility of undertaking a reliable positioning , even given complicated calculus positions , which occurs particularly with gall stones . in the above description , it is assumed that the calculus was in a fixed position . however , movement of the stone will occur because of breathing activities , and this movement is a continual appearance and disappearance in the two ultrasound images . the same , to a lesser degree , will also occur due to the heart activity . it is , therefore , advantageous when the registration of the ultrasound image respectively occurs in the same respiration and / or each ecg position at which the shockwave is likewise to be triggered . it is just as advantageous for the evaluation carried out by the attending physician when only these ultrasound images are displayed . in fig5 a common trigger mechanism or means 50 is provided for this purpose . this trigger mechanism is used both during the registration for the ultrasound images , as well as when triggering the shockwaves . to this end , a pickup or sensor 55 for the respiration and a pickup or sensor 57 for the heart activity ( ecg ) are arranged on the patient 11 , who is positioned on a patient supporting plate 51 . as illustrated , the plate 51 has an opening 53 , through which the lithotripter extends to apply the shockwaves to the patient . the output signal of the sensors 55 and 57 are supplied to correspondingly known evaluation devices or means 59 and 61 , respectively . the output signals of these evaluation devices or means are conducted in common to a trigger mechanism 50 in the present installation . it is adequate in many uses to only provide the one sensor 55 with its evaluation means or device 59 for supervising respiration and to omit the sensor , such as 57 , and its evaluation means 61 for heart activity . in a known way , the trigger mechanism 50 forms a trigger signal t from the supplied signals , and this trigger signal t is then supplied via a selective switch 63 , either to a trigger mechanism or starting means 65 for the shockwaves , or to an exposure starting means 67 for the ultrasound images . in the illustrated switch position , the shockwave supply or generator means 69 , which belongs to the shockwave source 19 , is driven with the trigger signal t . in the present case , the shockwave source 19 is shown as a known shockwave tube . in the other non - illustrated position of the switch 63 , the trigger signal t charges the exposure starting means or mechanism 67 for the ultrasound images of the two ultrasound scanners 33 and 35 . the echo signals picked up by the heads 33a or , respectively , 35a are portrayed on the picture screens ( not shown ) with the assistance of the apparatus or means 33 and 35 , respectively . according to the arrangement of fig5 the registration of the two ultrasound images respectively occurs in a respiratory position in which the shockwave will also be subsequently triggered . as explained , this can also apply to phase relationship of the heart activity . although various minor modifications may be suggested by those versed in the art , it should be understood that we wish to embody within the scope of the patent granted hereon all such modifications as reasonably and properly come within the scope of our contribution to the art . | 0 |
[ 0018 ] fig1 is a schematic diagram 100 of a computer 102 connected 104 to a printing apparatus 106 . the connection 104 may be a computer network such as an ethernet implementation ; a serial connection such as universal serial bus ( usb ) or ieee 1394 cable ; a parallel port connection ; or a wireless connection such as bluetooth or ieee 802 . 11 lb . the computer 102 preferably includes a print manager 103 . a plurality of remote computers 110 ( only one shown ) may also be communicatively coupled to the computer 102 via a packet switching network such as the internet 114 . images ( not shown ) 110 may be transferred from the remote computer 110 via the internet 114 to the print manager 103 in the computer 102 , or may originate in the computer 102 . [ 0019 ] fig2 is a block diagram of a preferred embodiment of the printing apparatus 106 shown in fig1 . the printing apparatus 106 includes a source of sheet material 204 which is preferably a web 202 . the sheet material 204 may be , for example , paper , film , metal , or cloth . the printing apparatus 106 also includes a first feed mechanism 206 for feeding the sheet material 204 from the web 202 to a print engine 208 which may be , for example , a laser - writer or an ink - jet print engine . the print engine 208 prints images onto the sheet material 204 . the images may be , for example , two or three dimensional images ; holographic images ; text ; or any combination thereof . the print engine 208 may print on either or both sides of the sheet material 204 to produce printed sheet material 212 . the printing apparatus 106 has a second feed mechanism 210 for feeding the printed sheet material 212 from the print engine 208 to a cutter 214 . the cutter 214 therefore includes a web input mechanism that includes the second feed mechanism 210 for receiving the printed sheet material from the print engine 208 . the cutter 214 cuts the printed sheet material 212 into sheets 218 of an appropriate size . the cutter 214 may constitute , for example , a blade , a laser or shearing mechanism . the printing apparatus 106 also has a third feed mechanism 216 for feeding the sheets 218 from the cutter 214 to a stacker 220 . the stacker 220 is an embodiment of a page laying unit adapted to lay the sheets 218 into a stack 222 of documents 224 . the stacker 220 may be , for example , a mechanism for sorting and / or collating documents ; or a tray for receiving pre - sorted / pre - collated documents . the printing apparatus 106 may include a processor 230 coupled by connections 235 , 246 , 248 , 250 to monitor or control other aspects of the printing apparatus 106 . for example , the processor 230 is coupled by connection 235 to sensor 260 , which senses a condition of the web 202 , such as a โ source empty โ condition . the processor 230 is coupled by connection 246 to the print engine 208 , whereby the processor 230 may transfer image data to the print engine 208 . the processor 230 is coupled by connection 248 to the cutter 214 for controlling the cutter 214 to cut the printed sheet material 212 into sheets 218 in accordance with available data and a predetermined program . finally , the processor 230 is coupled by connection 250 to the stacker 220 for controlling the operation of stacker 220 or for sensing a condition of the stacker 220 such as a โ tray full โ condition . the printing apparatus 106 also includes a communication interface 232 coupled by a connection 234 to the processor 230 and adapted to communicate with the computer 102 ( fig1 ) via the connection 104 , whereby print job information is obtained from the computer 102 . the processor 230 is also coupled by a connection 238 to a keypad 236 for a user ( not shown ) to input commands to the processor 230 , and coupled by a connection 242 to a display 240 to permit the user to receive messages generated by the processor 230 . a memory 244 is also coupled to the processor 230 by a memory bus 252 for intermediate storage and processing of images received from the printer manager 103 ( fig1 ) via the connection 104 and the communication interface 232 before the image data is transferred to the print engine 208 . the sheets 218 produced by the cutter 214 may be of a first size , such as letter , legal or a 4 , referred to herein as pages ; or a second size having a dimension , such as length or width , different from a corresponding dimension of the first size , referred to herein as flag sheets 226 . the dimension of the flag sheets 226 is preferably greater than the respective dimension of the pages . the flag sheets 226 separate the pages into logical groupings . an appropriate logical grouping may be a print job , a part of a document , or any other serial set of pages identified by a processor 230 . for convenience , such logical groupings are referred to herein collectively as documents 224 . the printing apparatus 106 produces the stack 222 of documents 224 that are partitioned by flag sheets 226 that facilitate identification and separation of individual documents in the stack 222 and reduce retrieval errors . advantageously , the flag sheets 226 facilitate the identification and / or separation of the documents 224 by a user ( not shown ). it should be noted that the documents 224 may be copies , unique documents , or any combination of 226 may be identical to one another the two . also , the flag sheets may have unique printed images to facilitate identifying individual documents 224 . preferably , the shape of the pages in a document 224 or of the flag sheet 226 separating the documents 224 is rectangular . the use of flag sheets 226 having a different dimension than the corresponding dimension of the pages constituting a document 224 provides a mechanism for easily identifying where a document 224 begins and ends , without mutilating the pages of the document 224 , such as is the case with the use of staples . additionally , the identification of where documents 224 remaining in a document stage 222 begin and end is maintained , even if a document 224 has been retrieved from the middle of the stack 222 . the embodiments of the invention described above are intended to be exemplary only . the scope of the invention is therefore intended to be limited solely by the scope of the appended claims . for example , it may not be strictly necessary for the printing apparatus 106 to use printed sheet material in a web , which material is cut to length by a cutter . rather , the printed sheet material may be pre - cut and an appropriate size of printed sheet material used for both the document pages and for the flag sheets . for example , a document consisting of letter - sized pages may be separated by a flag sheet of legal - size dimension . in such a case , the identification of the separating flag sheets may be enhanced by using printed sheet material for the flag sheet having a different colour , texture , thickness or consistency than that used for the pages of the document . | 1 |
fig1 illustrates an automatically controlled sheet cutting apparatus , indicated generally at 10 , and generally similar to that described in u . s . pat . no . 3 , 495 , 392 entitled &# 34 ; apparatus for working on sheet material &# 34 ;. the apparatus 10 also includes a blade sharpening device such as that shown in u . s . pat . no . 4 , 133 , 236 to the same inventor , david r . pearl . the apparatus 10 is numerically controlled by a computer controller 12 connected to it by a cable 14 . a tape storage 16 converts the data into machine commands for guiding the reciprocating blade 20 along a programmed path p , which path may be the periphery of a pattern piece or panel . in the present disclosure , the sheet material preferably comprises a single sheet or ply s rather than a layup , and more particularly , the sheet s comprises a composite of oriented space age fibers , such as boron or graphite , in an epoxy matrix which is generally uncured in this cutting stage . still with reference to fig1 the apparatus 10 includes a table 22 having a penetrable bed 24 , of upwardly projecting bristles as shown in fig3 to define a support surface for the sheet material s . these bristles are of plastic material , being relatively stiff and capable of reacting vertical forces imposed thereon by the cutting blade 20 , but also capable of moving or bending laterally as necessary to allow the blade 20 to follow the path p . a vacuum hold down system , such as shown and described in the above mentioned u . s . pat . no . 3 , 495 , 392 is also provided to hold the sheet material in fixed relation to the bed . a polyethelene sheet ( not shown ) may also be used to preserve the vacuum below the sheet . the blade 20 is mounted in a cutting head 18 which is movable in the x and y directions as a result of carriages 26 and 28 , the latter being movable along the former to cause cutting head 18 to move in a horizontal plane . carriage 28 is movable in the x direction on racks 30 and 31 at the sides of the table 22 , and carriage 26 is movable in the y direction by lead screw 38 . drive motors 34 and 36 are energized from the controller 12 to cause movement of the x and y carriages , 26 and 28 respectively . a drive motor ( not shown ) in the head 18 provides reciprocating movement of the blade 20 under the control of controller 12 , and at a frequency ( f ) such that the blade 20 moves through approximately five cycles ( 10 vertical up and down strokes ) as it moves a linear distance corresponding to it &# 39 ; s own width w ). the path of the reciprocating blade 20 is illustrated schematically in fig3 wherein the horizontal displacement of the blade has been expanded approximately 100 times to depict one vertical reciprocation cycle . the apparatus for moving the blade in it &# 39 ; s x and y direction ( horizontally ) must do so at a speed of 200 - 400 inches per minute , and the means for reciprocating the blade between the limit positions shown at a and b in fig3 preferably does so at approximatley 4000 cycles per minute . this speed relationship will provide a ratio of forward progress to frequency in the range of 200 / 4000 and 400 / 4000 inches per cycle ( that is 0 . 05 - 0 . 10 inches per cycle ). in order to achieve the desired condition referred to previously ( of five cycles per blade width ) it follows that the blade 20 should have a width of at least approximately 3 / 32 of an inch . this geometry will provide substantially all cutting action of the blade 20 to be accomplished by the most forward portions of vertically spaced chisel edges 20a and 20b of a notch 20c formed in the blade leading edge 20d . as best shown in fig3 the blade 20 has this relatively deep notch 20c , with a depth of approximately one half the blade width and a vertical height of approximately 60 percent the vertical stroke made by the blade during it &# 39 ; s reciprocating movement . this relationship assures that the vertical speed of the blade 20 will be at or near it &# 39 ; s maximum as the chisel edges 20a and 20b chop through the sheet s at blade positions e and d respectively . the motion of blade 20 is basically sinusoidal in its oscillatory advancing mode , and therefor maximum cutting speed occurs between the limit positions a and b in fig3 . as the upper chisel edge 20a chops down through the sheet s ( position e ) it will be apparent that the bristle bed 24 supports the sheet during this downward stroke of the blade . as best shown in fig2 and 5 a pressure foot 30 is provided on a depending post 33 to hold the sheet s downwardly during the upward stroke of the blade ( see position d in fig3 ). still with reference to the configuration of the blade 20 , fig4 shows the v - shaped leading edge 20d defined by opposed sharpened , or ground surfaces , and the lower end of which cooperates with a lower edge 20e which is also v - shaped and defined by opposed sharpened surfaces . these edges 20d and 20e define an included angle of approximately 135 degrees ( and which angle is preferably in the range between 120 - 150 degrees ). as so configured it will be seen from fig3 that this lower edge 20e does achieve some cutting of the sheet s during downward blade motion from the right hand limit position a of fig3 to the adjacent blade position . turning next to a more detailed consideration of the specific sheet material to be cut , fig6 shows the orientation of it &# 39 ; s parallel fibers of graphite or boron and also shows that the path p of the blade 20 can be either across these fibers or close to tangential with respect thereto . it is in this latter position that the blade 20 displays its most impressive advantages . as a result of the incremental chopping action of the chisel edges 20a and 20b the parallel fibers are cut only a few at a time and there is very little tendency for the blade 20 to tend to displace these fibers laterally in lieu of cutting them . thus , it is an important feature of the present invention that the notch 20c have generally horizontally extending chisel edges 20a and 20b for so chopping the fibrous sheet material . furthermore , the notch 20c has a non - sharpened inner boundary 20c and these upper and lower edges 20a and 20b are parallel to one another and generally horizontal . as best shown in fig5 these chisel edges 20a and 20b can be conveniently sharpened by moving a skewed sharpening device through the blade notch at an angle of approximately 45 degrees to the longitudinal axis of the blade 20 . although 45 degrees is the presently preferred skew angle for this single notch 20c in the blade 20 , any angle in the range between 30 degrees to 60 degrees will provide some of the advantages of the invention . finally , the blade 20 can be seen from fig4 to have its single notch 20c located close to the lower edge 20e in order to minimize the vertical stroke required to achieve the advantages alluded to above . thus , the lower edge 20b of notch 20c is located adjacent to this lower edge 20e and more particularly the vertical distance the middle of notch 20c and edge 20e between is in the same dimensional range as the height of the notch itself ( that is , in the range of 60 percent of the blade stroke ). the notch depth is preferably in the range of 40 - 60 percent of the blade width as mentioned above , and the said vertical distance between the notch lower edge 20b and the blade lower edge 20e is preferably comparable to the blade width so as to minimize the vertical stroke required to cut through the sheet material during both the downward and the upward movement of the blade . | 8 |
as shown in fig1 a switch 100 has four ports 105 a - 105 d . ports 105 a - 105 d are circuits that may include hardware , software , firmware or any combination thereof . the ports 105 a - 105 d are coupled to four buses 110 a - 110 d , respectively , and are used to transmit data from and receive data into switch 100 . ports 105 a - 105 d and buses 110 a - 110 d are full duplex in that they can transmit and receive data frames simultaneously . in one implementation , switch 100 is an ethernet switch . a receiving bus 115 a and a transmitting bus 115 c are coupled to ports 105 a - 105 d . receiving bus 115 a forwards received data frames from ports 105 a - 105 d to a control circuit 120 . an intermediate bus 115 b forwards received data frames from control circuit 120 to main memory 125 . a bus 150 forwards address data to main memory 125 for use in storing the received data frames . the transmitting bus 115 c forwards data frames stored in main memory 125 to ports 105 a - 105 d . four transmission queues 130 a - 130 d that are associated with ports 105 a - 105 d , respectively , are interspersed in switch 100 . control circuit 120 is coupled to the four transmission queues 130 a - 130 d and main memory 125 through control signal paths . it should be noted that control circuit 120 and transmission queues 130 a - 130 d may be implemented as logic circuits that may include gates , hardware , software , firmware or any combination thereof to perform the functions described . in general , the switch 100 receives data frames on buses 110 a - 110 d at ports 105 a - 105 d . the received data frames then are forwarded to control circuit 120 using receiving bus 115 a . control circuit 120 non - randomly determines particular locations in main memory 125 for storing the received data frame . control circuit 120 forwards the received data frame to main memory 125 for storage . transmission queues 130 a - 130 d determine when to output the stored data frame over buses 110 a - 110 d using ports 105 a - 105 d based upon control data received from control circuit 120 . as shown in fig2 exemplary port 105 a contains control circuit 210 and multiplexers 220 . exemplary port 105 a receives a data frame on transmitting bus 115 c for forwarding . the data frame received on transmitting bus 115 c is extracted from transmitting bus 115 c by multiplexers 220 . control circuit 215 exchanges control signals with ccslc 120 and oclcs 130 a - 130 d . as shown in fig3 control circuit 120 includes a memory 305 . memory 305 is smaller than main memory 125 and tracks the occupied and available locations in main memory 125 . control circuit 120 also includes a frame mapper circuit 310 and a frame address generator circuit 315 . frame mapper circuit 310 is a logic circuit that receives data from memory 305 and determines an empty or vacant ( i . e ., not currently storing valid data ) location in main memory 125 that will store the recently received data frame . in addition , frame address generator 315 also generates data or map codes that indicate the location in main memory 125 that will store the recently received data frame . frame address generator circuit 315 is also a logic circuit but it generates addresses based upon the data or map code it receives from the transmission queues 130 a - 130 d . the generated addresses are used to read out the desired data frame from its particular location in main memory 125 . as shown in fig4 a , an exemplary memory 305 may include an array of memory cells 405 , a channel decoder 410 and a segment decoder 415 . in one implementation , array 405 is four bits wide and sixteen bits long . this correlates to main memory 125 , which has four channels and sixteen segments . each cell in array 405 holds a single bit and correlates to a particular channel in a particular segment of main memory 125 . if a particular cell in memory 305 currently stores a 1 - bit , that is an indication that the corresponding channel of the corresponding segment of main memory 125 contains valid frame data and cannot presently accept a new data frame . alternatively , if a particular location in memory 305 currently stores a 0 - bit , that is an indication that the corresponding channel of the corresponding segment of main memory 125 contains invalid frame data , ( i . e ., it is empty ) and can presently accept new data . each cell in array 405 is individually addressable through channel decoder 410 and segment decoder 415 , which receive control signals from the frame mapper circuit 310 and frame address generator circuit 315 . in either implementation , the cells also may be addressable by row or column . as shown in fig4 b , each cell 420 of array 405 may be implemented as an s - r flip flop that is enabled by a combination of the appropriate channel decoder and segment decoder signals . the set input of the flip - flop is connected to a write signal , and the reset input is connected to a read signal . thus , the value of the cell is set to one when the write signal is asserted and the channel decoder and segment decoder signals indicate that data are being loaded into the corresponding portion of memory 125 , and is set to zero when the read signal is asserted and the decoder signals indicate that data are being read from the corresponding portion of main memory 125 . the cell 420 may be further configured to produce an output only when the enable signal is asserted so as to permit the controller to poll the memory 305 to detect cells having values indicative of available portions of main memory 125 . an exemplary main memory 125 may have four channels , each of which is 64 bytes wide , and sixteen segments . this means that main memory 125 can store 64 , 64 - byte data frames ( one in each channel in each segment ), sixteen , 256 - byte data frames ( one spanning all four channels in each segment ), or other combinations . [ 0035 ] fig5 shows a pair of exemplary cells 550 , 555 in main memory 125 that each store 64 bytes . each cell represents one location in main memory 125 ( i . e ., one channel of one segment ). a decoder 560 uses the address bus 150 to generate signals that are combined with read and write signals to enable writing to and reading of a particular one of the cells 550 , 555 . it should also be noted that any type of randomly accessible , writeable storage device may be used . examples include ram , sram , dram , rdram and sdram . when a data frame is received , a determination is made as to which portion of main memory 125 is to store the received data frame . the received data frame then is forwarded onto bus 115 b and the address bus 150 is used to identify one or more appropriate cells . the appropriate cells are activated by a combination of a signal from the decoder 560 and a write enable signal from the control circuit 120 . similarly , a stored data frame is forwarded onto bus 115 c by signals on the address bus 150 identifying the appropriate cells . the cells are activated by a combination of a signal from the decoder 560 and a read enable signal from the control circuit 120 . as shown in fig6 an exemplary frame mapper circuit 310 includes size determiner circuit 605 and port determiner circuit 610 . frame mapper circuit 310 also includes channel availability circuit 615 and segment availability circuit 620 . size determiner circuit 605 receives some of the header data from received data frames . more particularly , size determiner circuit 605 receives data that inform switch 100 of the size of the received data frame . these data are used to map wide data frames , typically wider than a single channel , to multiple channels in a single segment in main memory 125 . it should be noted that in other implementations , wide data frames may be written into multiple channels in multiple segments . port determiner circuit 610 performs two functions . the first function is to determine which port 105 a - 105 d received the data frame . an exemplary way to perform this function is to have each port output a unique signal onto receiving bus 115 a that port determiner circuit 610 decodes to determine which port 105 a - 105 d forwarded the data frame to it . one way of decoding the unique signal is to take the assigned port number and perform a modulo operation ( e . g ., if the switch has four ports , the decoder performs a modulo 4 operation ). the second function of port determiner circuit 610 is to determine which output port is to transmit the received data frame . one way to accomplish this function is to have port determiner circuit 610 receive a portion of the header data and read the destination address therein . port determiner circuit 610 then correlates this header data with the appropriate port 105 a - 105 d . channel availability circuit 615 receives data from memory 305 and determines which channel locations in main memory 125 are free of valid data frame data . it forwards these results to segment availability circuit 620 which then determines which segment locations in main memory 125 are free of valid frame data . in other implementations , both of these two circuits receive data directly from memory 305 ( this variation is represented by the dashed line in fig6 ). these circuits operate by simply polling memory 305 to determine where zeroes , indicative of empty locations in main memory 125 , are located . size determiner circuit 605 , port determiner circuit 610 , channel availability circuit 615 and segment availability circuit 620 all output data to look - up table 625 . look - up table 625 uses these data inputs to generate address signals for enabling the corresponding locations in main memory 125 to store the received data frame and associated map codes that are forwarded to the transmission queues 130 a - 130 d that are used to retrieve the stored data frame as is described later . since the look - up table 625 generates the same address when it receives a particular set of inputs , the look - up table 625 orders the received data frames to be stored systematically ( i . e ., not randomly ). in other words , this systematic storing of data frames is a result of an established one - to - one association or relationship between the data received by the look - up table 625 and the addresses it generates . in some implementations , look - up table 625 may only output addresses for contiguous channels . for example , if the received data frame is 128 bytes wide ( two channels ), look - up table 625 will only output contiguous addresses to adjacent channels . in alternative implementations , look - up table 625 may be programmed to output non - contiguous addresses . this feature allows for more efficient packing of the data frames in main memory 125 . as shown in fig7 frame address generator 315 includes collision detector circuit 705 . collision detector circuit 705 receives data from the four transmission queues 130 a - 130 d . collision detector circuit 705 outputs data to arbitrator circuit 710 . arbitrator circuit 710 outputs data to look - up table 715 . in general , exemplary collision detector circuit 705 looks for possible collisions when outputting data from main memory 125 . an example of a collision is attempting to output data from two different data frames from memory 125 onto the same portion of transmitting bus 115 c . another example of a collision is outputting too much data ( e . g ., the enabling of a pair of segments and a pair of channels , which would allow the output of four , 64 - byte quantities , where the ports are only ready to transmit three , 64 - byte quantities ). this second collision causes one location to be emptied before the ports 105 a - 105 d can output the data frame such that data stored in that particular location are lost . collision detection is accomplished by comparing the map codes received from the transmission queues 130 a - 130 d . collision detector 705 operates using a set of rules that may be programmed into software , hardware or firmware . an exemplary rule is the comparison of the received map codes to determine if two or more of the received map codes will cause data to be output onto the same portion of transmitting bus 115 c . if main memory 125 is configured to output one set of channel data onto a particular portion of transmitting bus 115 c , it follows that if two segments output data from the same channel simultaneously a data collision will occur . thus , a simple comparison to determine if the transmission queues 130 a - 130 d are requesting data from the same channel address on two different segment addresses is performed . collision detector 705 generates output data based upon the one or more comparisons it performs . the output data indicate which , if any , of the received map codes are colliding . arbitrator 710 uses this output data to select one or more map code combinations that instruct main memory 125 to output data frame data without causing collisions . in an alternative implementation , arbitrator 710 selects one or more colliding map codes for temporary removal and forwards the non - colliding map codes to look - up table 715 . look - up table 715 receives the non - colliding map codes from arbitrator 710 and translates those map codes into addresses . the addresses generated by look - up table 715 are used by main memory 125 to output data frames and by memory 305 to indicate newly vacated locations in main memory 125 . fig8 shows an alternative switch 800 that includes a general processor 820 . like exemplary switch 100 , switch 800 includes four ports 105 a - 105 d that are coupled with four external buses 110 a - 110 d and internal buses 115 a - 115 c . processor 820 is coupled with internal bus 115 a and intermediate bus 115 b . memory 125 is coupled with intermediate buses 115 b and internal bus 115 c . the function and operation of most of the elements of exemplary switch 800 have been previously described and will not be repeated . one difference between exemplary switches 100 and 800 is the use of a general purpose processor to perform the determining of acceptable memory locations to store the received data frames and the outputting of data frames from memory 125 to ports 105 a - 105 d for transmission over buses 110 a - 110 d . processor 820 contains memory such as rom or ram ( not shown ) that holds the instructions used to control the operation of processor 820 and therefore the operation of switch 800 . [ 0051 ] fig9 shows an exemplary process for storing a received data frame . this process is initiated when the switch receives a data frame ( step 905 ). the header information , which contains at least destination information and frame size , is extracted from the data frame ( step 910 ). using the header data , the size of the received data frame is determined ( step 915 ). in addition , the identity of the port that received the data frame is determined ( step 920 ). next , the empty locations in main memory are determined ( step 925 ). one exemplary method of performing this step is to store 1 - bits and 0 - bits in a separate memory that correspond to full and empty locations , respectively , in the data frame memory and to poll this separate memory to locate an adequate concentration of 0 - bits that correlate to the size in the data frame memory that can store the copies of the received data frame . once all of the suitable locations in frame memory have been identified , one or more locations are selected to store the copies of the data frame ( step 930 ). the data frame is then stored in the selected memory locations of the frame memory ( step 935 ). each data frame is associated with a port that will transmit it and this association , along with the locations in frame memory of the data frame , is stored in a memory ( step 940 ). the process then ends ( step 945 ). [ 0053 ] fig1 shows an exemplary process 1000 for outputting data frames from a switch . the process begins when multiple associations are selected ( step 1005 ). in other words , each port of the switch is polled to determine if it has a data frame in frame memory that is ready to be transmitted . one exemplary way of performing this step is to store the associations in a queue and read them in a first - in - first - out ( fifo ) order . with multiple ports requesting data from the frame memory at the same time , a conflict may arise such that two ports will require data from locations that share a data output bus in the frame memory . accordingly , a determination is made to see if there is a conflict ( step 1010 ). if there is no conflict such that every port that has data frames to output may do so simultaneously , then the data frames are read from the frame memory in parallel ( step 1015 ). the ports select the data frames that are to be output , based on the association described above , and output the selected data frames ( step 1020 ). the process then ends ( step 1025 ). if a conflict is determined ( see step 1010 ), then one of the ports that has a conflict is instructed to wait ( step 1030 ) and the remaining associations are checked again for a conflict ( step 1010 ). at worst case , ports will be instructed to wait until only one port remains and then the remaining port will be able to retrieve and output its data frames freely ( see steps 1015 - 1025 ). [ 0056 ] fig1 a - 11 d show portions of a main memory . fig1 a shows exemplary segment 9 and a portion of channel 0 . of the seven shown locations , six are currently holding data . when new data frame r is received , it is possible that the random address generation circuit ( not shown ) will randomly pick the six full locations before selecting the empty location . thus , in a worst - case scenario , the performance of the switch that randomly selects occupied locations will wait six cycles before properly placing the newly received data frame r in the empty location addressed by segment 9 , channel 0 . in contrast , a switch implementing the systems and methods described above will properly place the newly received data frame r in the vacant location at the first cycle . [ 0058 ] fig1 b shows a portion of a memory where the data frames are stored contiguously and random location selection was performed . since data frame m could not be divided , it was stored in segment 6 across all four channels . thus , at least four segments are needed to store the four received data frames . in addition , due to random location selection , the memory is not utilized to its maximum bandwidth potential . that is , data frame n is not stored in segment 3 , channels 2 and 3 but is instead stored in segment 5 . thus , to forward data frames l - o will require four clock cycles . as shown in fig1 c , data frame n is stored in segment 3 along with data frame l . by using a systematic method of storing data frames into the memory , the useful bandwidth of the memory increases . assuming there are not conflicts for output ports between data frames l and n , all of the data frames l - o can be forwarded in three clock cycles instead of four . as shown in fig1 d , allowing data frames to be divided allows the four received data frames to be stored in three segments . thus , implementations that allow data frames to be stored non - contiguously allows for increased useful bandwidth of a memory . that is , assuming there no conflicts for output ports between the various data frames , the four data frames l - o can be forwarded in three clock cycles instead of four . a number of implementations have been described . nevertheless , it will be understood that various modifications may be made . for example , in alternative implementations , the fifo function of the transmission queue is modified to take into account priority of the received frames . thus , a data frame that is added later to the queue but that has a high priority can be output before other data frames that were received earlier . | 7 |
the present system is exemplified with respect to a sagd well with an esp pump . however , this is exemplary only , and the invention can be broadly applied to any high vapor producing well wherein the downhole pump has a tendency to blow through by vapor . the invention also has the advantage of reducing gas - locking , although this is not the primary intent . the following examples are intended to be illustrative only , and not unduly limit the scope of the appended claims . downhole pumps in the oil industry are designed mainly for lifting liquids . they are designed on the assumption that vapor is separated downhole and directed to the casing annulus , thus not entering the pump and causing problems . depending on the pump specifications , the presence of vapor / gas phase more or less reduces the downhole pump efficiency . however , the amount of vapor that can be vented out from the annulus is restricted by the pressure of the casing gas treater . if the rate of the vapor accumulation is higher than the rate that expelled from the casing and tubing , e . g . : more vapor will be accumulated in the casing annulus , and the increased volume and / or pressure can lower the level of liquid above the pump . if this level lowers to the pump intake level , vapor will enter the pump and reduce the overall pump performance , producing periods where no or low liquid is produced . we have studied a variety of parameters during normal and no - flow or low - flow conditions in actual sagd wells , and our results are shown in simplified manner in fig1 a - e to 2 and described below . fig1 a illustrates a typical normal flow condition , where vapor in annular is produced at a level that matches the vapor shunted out of the casing . since gas removal occurs at levels equal to the rate of gas accumulation , the system is stable . in more detail , fig1 a ( not drawn to scale ) shows the sagd chamber 110 where oil gravity drains to the casing liner 120 . oil enters the downhole pump 130 , but vapor typically rises and is collected in the annular casing 150 , where it travels via through casing valve 153 to e . g ., casing gas treater 155 , and from there to various treatments and / or shipment . oil continues to flow up via production tubing 140 to valve 143 to e . g ., production separator 145 and from there to various treatments and / or shipment . in a desired and ideal operation , such as that shown here , the total vapor entering the system is equal the vapor exiting the system via the casing valve 153 . the system is thus stable . however , casing vapor removal is constrained by pressure and pipe size . when vapor accumulates faster than it can be removed , this results vapor column build up , as shown in fig1 b and 1c . this vapor continuously accumulates in the annular space and pushes the dynamic fluid level ( dfl ) down ( see arrows ). eventually vapor builds up to a sufficient level as to cause โ gas blow through ,โ as shown in fig1 d . in detailed explanation , when the vapor volume is large enough and the dfl is low enough ( dfl = 0 ), vapor breaks through into the pump 130 and production tubing 140 . as a result , fluid density in the tubing 140 reduces due to vapor or gas emulsions in the tube and pump load reduces . at this time , well - head pressure approaches the level of casing head pressure . even though the downhole pump is running , it runs idle , meaning little or no liquid is being โ pumped โ to the surface since the tubing is filled with mostly vapor or a gassy emulsion , resulting in a nf / lf event . in the case of an esp pump , the pump current ( amperage ) drops due to the low load . some downhole temperature change due to the joule thompson effect may also occur , associated with gas expansion or compression . the blow through is typically of short duration because the annular space volume is relative small , and typically the vapor accumulation rate is much lower than the blow through rate . thus , the pressure is quickly released . after the blow through , the tubing / casing annular space refills with reservoir fluids ( fig1 e ), which makes the dynamic fluid level rise and production flow eventually recovers . the reservoir fluid may flow into the wellbore with a velocity that may create a temporary bottom hole pressure surging . this may be explained as a result of fluid velocity momentum due to the fact that reservoir fluid is hydraulically connected to the wellbore , and is many times larger in size than the wellbore . it is also noted that when fluid is filling up the wellbore the fluid column density increases from the prior vapor blow through condition , and that well head and / or bottom hole temperature changes may be observed due to joule thompson effect . the gas column build up may start again , and the cycle repeats . a simplified vapor blow through model indexes are shown in fig2 for an esp pump case . as can be seen , when gas blow through occurs , the pump current drops although the pump frequency remains the same . this is because the vapor or gassy emulsion weighs less , which reduces the load on the pump , resulting in reduced current draw ( amperage ). also seen in fig2 , the casing well - head pressure remains the same . bottom hole or pump intake pressure increases when tubing fluid falls down and back to the annulus . another reason for bottom hole pressure to increase is the wellbore is recharged by reservoir fluid . once the blow though completed , a liquid fill - up stage occurs , wherein pump temperature and bottom hole temperature rise , fluid density in the tubing recovers and bottom hole pressure and pump intake pressure increase . this cycle could repeat at various rates , depending on the existing well conditions . for instance , cycle repeat can happen in hours for some high vapor wells , while in days or weeks for low vapor wells . it is also noted that the production rate also impacts the cycle period . the solution to the problem of vapor blow through is the installation of a vapor blow through avoidance system , discussed next . the system typically requires the following components : 1 . a casing gas remover ( cgr ), which can be a any type of compressor or multiphase pump , but preferably a casing gas blower ( cgb ) or an adjustable choke ( ac ), or both . the cgr is installed at e . g ., the well - head casing to reduce casing gas pressure , removing it to e . g ., the casing gas treater or other unit . 2 . a dynamic fluid level ( dfl ) detector ( dfld ) is installed at the well - head or downhole ( as appropriate ) that can detect the dfl . such detectors detect e . g ., the interface between vapor and liquid ( or a pseudo interface ) numerically representing dfl . alternatively , this dfl can be calculated based on the bottom hole pressure if fluid density can be well defined . other ways to calculate dfl include detecting fluid density profile by series of density sensor or pressure sensors . buoyancy , sound wave detector , optic , temperature or acoustic , resistance or capacitance and other methods could be used as well . either gradient , absolute value or their profile can be used to detect the dfl . 3 . a downhole pump , which could be any pump used for lifting the fluid . it is noted that since esp is used as example in this disclosure , amperage is the pump load indicator . as a skilled person knows for other types of pump , pump load is indicated as : rod pump by its load cell on rod , pcp ( progress cavity pump ) by rod torque and hydraulic pumps by their power fluid pressure . 4 . a control processor that collects the related data , performs the analysis , and directs the action of the cgr and the dhp as needed . dfl is continuously collected with the dfld and the processor compares the collected dfl with the dflt . the system can also diagnose if vapor blow through is happening via checking other related production and pump performance data and comparison with the model index in fig2 . however , vapor blow through should not occur if the vapor blow through avoidance system is operating correctly . the cgr rate and dhp rate are then adjusted as needed based on the following logic ( see also fig3 ): a . increase cgr rate , or reduce dhp rate as a second option , if gas column building up is detected to the pre - set criteria ( dfl & lt ; dflt ). c . keep cgr and the dhp rates constant if dfl remains stable at the target level dflt or within the target dflt range . importantly , removing casing gas will result in pressure reduction in the casing , which may further promote gas break out or steam flashing . thus , the rate of gas exit through the cgb or ac should be controlled so the pressure does not get too low . of course , the cgr should have enough power and throughput to be able to remove adequate vapor for practical ranges of casing pressure . the dflt can be adjusted or changed any time between each logic cycle . setting or changing the target dflt is based on : pump submergible height request considering reservoir productivity and to allow the least frequent changes of the cgb and the highest possible pump rate . typically , a suitable range of dfls will be set as the target dfl , thus minimizing the on / off cycling of the systems . the schematic of the entire system is shown by fig4 . in fig4 , the sagd chamber is 410 and it is fluidly connected to the casing liner ( slotted liner ) 420 . fluid enters pump 430 and is pumped to the surface via tubing 440 where it passes valve 443 on its way to e . g ., unit 445 . vapor floats and is trapped in the annular space between casing 450 and pump tubing 440 , past valve 453 to e . g ., gas treater 455 . casing gas remover 454 is operably coupled to the control processor ( herein represented symbolically with dotted lines ). the control processor is also operably connected to a dfl detector 457 and pump 430 . the control processor controls dfl primarily by activating the cgr , and secondarily by controlling the pump 430 . the cgr 454 can be an adjustable choke or a casing gas blower or both can be used . fig6 shows a system using both . a group well application is illustrated in fig5 ( three shown , but could be any number ). three wells are shown , each with a dfld , pump , and ac . common cgb is shown and is connected to common casing gas line , downstream of the individual lines . the control processor can be single or multiple , as desired , but a single processor is shown and is more cost effective . the processor is operably connected ( see dotted line ) to the dflds , pumps , acs and common cgb . the dflt is set individually for each specific well , and individual casing pressure is primarily controlled through the separate adjustable chokes ( ac ) installed on each gas casing . a larger cgb is installed and connected to the combined casing gas flow line for all three wells , and the cgb rate can be increased if the pressure is too high for the ac to function . the cgb should have sufficient horsepower and created sufficient pressure sink and rate for the combined wells . one advantage of this embodiment is cost savings , since multiple ac &# 39 ; s are used instead of multiple cgbs . the acs are passive , thus also saving energy costs over cgb use . a schematic of an alternate embodiment is shown in fig6 . in fig6 , the sagd chamber is 710 and it is fluidly connected to production tubing ( slotted liner ) 720 . fluid enters pump 730 and is pumped to the surface via tubing 740 where it passes valve 743 on its way to e . g ., unit 745 . gas floats and is trapped in the annular space between outer casing 750 and pump tubing 740 , past valve 753 to e . g ., gas treater 755 . cgb 754 and adjustable choke 756 are fluidly connected to the casing gas exit line and operably coupled to the control processor ( herein represented symbolically with dotted lines ). the control processor is also operably connected to a dfld 757 and pump 730 . the control processor controls dfl primarily by activating the ac , because this is a passive system not requiring energy . if needed , the cgb can be activated as a secondary control measure , and as a ternary option , the dhp speed can by changed by controlling the pump 730 . the process is applicable to any high gas content producing well , where gas disturbs pump performance . the producing well could be crude oil or gas well or any subsurface reservoir fluid producing well , including horizontal , vertical , deviated and cluster wells , for instance coal bed methane water removing well or sagd bitumen producing well . equipment and process control computer program can be further developed and manufactured based on this innovation . | 4 |
as shown in fig1 , a stable stand 30 supports an arm or armature component 16 , which in turn supports the impulse treatment device head 28 . arm 16 is slidably enclosed by sleeve 19 . the stand 10 can raise or lower the arm 16 by a large retractable piston or linear actuator 12 that is operator controlled . the arm 16 is mounted at the top of the stand &# 39 ; s piston 12 at a complex joint with three degrees of freedom , called the stand coupling 14 . the stand coupling 14 allows the arm 16 to rotate in a horizontal plane , creating a yaw angle . the transducer head can tilt in this direction but the arm cannot . last , the stand coupling 14 allows a tilt of the aim 16 off the horizontal plane , creating a roll angle . the aim 16 slides forward and back in sleeve 19 relative to the stand 10 . releasing a lock 21 allows arm 16 to rotate within sleeve 19 . a groove in arm 16 and a biased ball bearing in the interior cylindrical surface of sleeve 19 pauses arm 16 to encounter the resistance of having to move the ball bearing out of the groove in arm 16 when rotating arm 16 relative to sleeve 19 . a yoke 18 has two arm components , which curve around and attach to the device head 28 by means of dual pivot points 20 on either side of the device head 28 . the yoke 18 is supported by arm 16 . the yoke 18 is best seen in the top view of the apparatus in fig1 a . there is a manual locking mechanism 17 close to the pivot point 20 on one side of the device head 28 . a touch screen 26 at the top of the device head 28 displays a user interface which is used for device positioning and control . a collapsible stylus 30 protrudes from the device head 28 and its end point 34 is used to deliver impulses to a predetermined contact point 35 on a patient &# 39 ; s body 32 . the point of contact 35 may be the top or atlas vertebra , behind the ear , as shown in fig1 . the patient 32 is lying on a bed 44 and the desired contact point 35 is in a fixed location . the many components and degrees of freedom of the device head 28 mounting scheme described above in combination , allow positioning of the linear axis 36 of the device head 28 and collapsible stylus 30 in any direction in three dimensions ( 3d ), while simultaneously keeping the end of the stylus end 34 at a desired fixed location in 3d . for treatment , this fixed location is the contact point 35 on the patient 32 . at the time of treatment , the linear axis of the stylus is in any selected angle 36 in 3d , and this angle is calculated relative to the vertical direction 8 in the preferred embodiment . angular control is explained below . also shown on fig1 is a remote computer 40 , which may be in any location and is not necessarily close to the treatment area . patient data from x - rays and overlaid drawings or other drawings are digitized and input to the remote computer 40 by means of a graphics tablet 42 peripheral . calculations are made in the remote computer 40 on the raw data and operating parameters are derived . these parameters are sent to the spinal and upper cervical impulse treatment device by means of any data communications link 38 , such as a serial data link or wireless link . the types of links are not limited . with reference to fig2 , the device head 28 includes a shielded enclosure 62 or housing , designed to conform to emi standards . a power supply has been removed from the view in fig2 . the main components of the device head 28 are a controller 22 section , a transducer 24 section , and the collapsible stylus 30 . the controller section includes a touchscreen 26 , which displays a user interface and an electronics motherboard 70 ( see fig3 ). the transducer 24 section includes a voice actuator , a stepper motor and other parts to connect them to the collapsible stylus 30 . a linear voice coil actuator 52 is attached at the top of the collapsible stylus 30 axis and is used to deliver sinusoidal impulse waveforms along the collapsible stylus 30 linear axis . a large gear 54 holds the collapsible stylus 30 in position along its longitudinally extending axis . the large gear 54 is movable in the axial direction , allowing easy linear motion , but is rigid torsionally . a flexible belt 56 having a toothed surface on one side which engages the large gear 54 is driven by a rotational stepper motor which causes the flexible belt 56 to rotate through a precise angle to deliver a required amount of rotational motion to the collapsible stylus 30 during the time it contacts the patient . sensors are employed in conjunction with the movement of the belt to limit the angle through which the probe can move . a constant torque is provided by the stepper motor . the voice coil actuator is a precision audio component and is readily commercially available . fig3 illustrates additional components of the device head , as needed for an electronic device . an optional cooling fan 72 is shown on the right and a large heat sink 76 and power supply 74 are shown on the left . the large heat sink 76 is connected to the transducer frame 60 to dissipate transducer heat and it is connected to the power supply 74 , another heat source in the device . the heat sink is aluminum and relatively light for its size , but weight is not a major issue , since the device head is mounted on a fixed stand . the size of the heat sink enables excellent heat dissipation , which is a concern in a medical device . a controller 22 , comprised of a touchscreen 26 and electronics motherboard 70 , is shown at the top . components may appear in alternate locations in different device embodiments , although a shielded housing 62 will always be on the outside . the collapsible stylus 30 will always have a linear axis with a measured direction and this will most often be placed approximately along the centerline of the transducer 24 component . a safety coupling 64 is incorporated along the stylus 30 linear axis as shown in fig2 . the safety coupling 64 is an important component , for patient safety , since the patient contact point and stylus end 34 are both in fixed locations in space . the safety coupling allows the stylus to collapse by up to one inch under a moderate applied force in the linear axis , however , the force must exceed the normal treatment force . this safety coupling on the stylus is referred to as the โ collapsible stylus โ. the safety coupling 64 is shown in more detail in fig2 a . the stylus is comprised of two separate parts , namely an outer sleeve 79 , at the top of the safety coupling 64 , and a lower stylus tube 30 , which fits into the safety coupling sleeve 79 . the range of motion 66 of the stylus tube 30 in the sleeve 79 is approximately one inch and is sufficient to avoid injury due to sudden movements by the patient . the range of motion 66 is controlled by a guide pin 78 and slot arrangement , which are also visible in fig2 . the degree of force needed to cause stylus 30 to collapse is controlled by an o - ring 77 which presses three steel , balls 67 against the walls of the stylus tube . the three steel balls 67 are at 120 degree angles to one another , as shown in the horizontal cross - section of the o - ring on the right side of fig2 a . during normal operation , the three steel balls 67 press into three spherical indents 65 along the stylus tube 30 wall creating a firm contact , so that the sleeve 79 and stylus tube 30 move in tandem . a sufficient force will allow the three steel balls 67 to expand the o - ring 77 so that the balls pop out of the indents 65 . the stylus tube 30 then collapses upward into the safety coupling sleeve 79 which incorporates a hall effect sensor which senses the collapsed position and turns the machine off . the stylus tube 30 is reset manually by pulling on the stylus end 34 until the balls clicks into place . as an additional safety feature , arm 12 cannot be lowered any further into stand 10 once the stylus tube 30 has been collapsed . in addition , the collapsing of the stylus tube 30 shuts off the machine . another safety feature is a deadman switch 33 that is operated by the patient to stop the machine in the event of any malfunction . transducer 24 design within the spinal and upper cervical impulse treatment device is also aimed at greater accuracy and consistency of operation than available in known devices . voice coil actuators 52 and 58 are used for both linear and rotational movements , enabling greater accuracy . these components are selected for stability over a range of operating temperatures and may be calibrated at the time of manufacture . displacement sensors and precision clocks ( crystal oscillators ) may be used to monitor performance and make dynamic adjustments , as directed by the controller 22 , to ensure that calibration is maintained . sinusoidal waveforms are used for both linear and rotational impulses . a typical , sine wave 80 is shown in the top half of fig4 . the smooth nature of the curve is noted , in contrast to the abrupt , and imperfect square wave 82 below . the smooth sinusoidal waveform is judged to be superior for medical applications . the accepted industry technique for generating analog waveforms , and sinusoidal waveforms 80 in particular , is known as pulse width modulation ( pwm ). creation of analog waveforms using pwm and low pass filters is well known and well documented . many companies manufacture and sell controllers or microprocessors that incorporate waveform tables and supply cookbook descriptions of analog waveform generation . practical low pass filter circuits and their characteristics are included in the documentation . in brief , a high frequency digital output has its duty cycle modified to reflect an analog data value , like a point on a sine wave . this pwm pulse then travels through a low pass filter . the resultant signal carries the desired analog waveform , without use of a digital to analog converter ( dac ). the impulse frequencies sought in the current invention are low , and a simple one - stage low pass filter , comprised of a resistor and capacitor , is sufficient to obtain a sine wave 80 . complex waveforms may be derived from multiple frequencies and these are limited in practice only by the performance characteristics of the voice coil actuators . precision audio voice coils 52 and 58 will typically operate in the range of 20 hz to 40 khz , as designed for stereo equipment and any complex waveform in that range may be produced and implemented in the icid . the amplitude of the waveform is also selected by the practitioner and represents the impulse energy to be delivered during treatment . maximum amplitude 96 and high end frequency are set for safety purposes . at present , the latter is set at 200 hz . the sinusoidal waveform selected for the current invention increases linearly in frequency as a function of time , as shown in fig5 and 6 . because of its audio characteristic , this waveform is called a chirp . in the preferred embodiment of the invention , the chirp starts with one cycle at 50 hz 90 , followed by cycles at 51 hz 92 , 52 hz 93 , and so on up to 99 hz 98 and 100 hz 100 . at that time , the frequency resets to 50 hz and the process starts again . the result is a linear frequency ramp as a function of time , as shown in fig6 . with an average frequency of 75 hz , reset will occur every 0 . 67 sec . the number of pulses delivered depends on the pulse duration set by the practitioner . this is calculated and known before starting treatment . the frequency ramp in fig6 shows a large discontinuity 102 , but this does not appear on the actual impulse waveform applied to the patient . the breakout , diagram on the right illustrates that the discontinuity 102 is just a small change in the slope of the sine wave near the zero crossing , at the transition from 100 hz to 50 hz . to recap , the use of a controller and pwm approach allows the creation of any complex waveform less than the 40 khz range of the voice coil actuator . the selected waveform for the preferred embodiment of the invention is a linear frequency ramp or chirp , which cycles through 50 hz to 100 hz as shown in fig5 and 6 . square waves 82 will not be implemented in the current invention . a smooth sinusoidal waveform , like one with gradually increasing frequency , is viewed as an ideal impulse waveform for medical treatments . rotational impulses are also produced by a geared stepper motor . typically the angle of rotation will be small , but this is not limited by the stepper motor , but rather by limit switches incorporated into the rotational gear system . the stylus end in contact with the patient has a non - smooth surface , in order to apply the rotational force . the irregular stylus end will have a bar pattern , or cross hairs , or multiple small protrusions . the irregular surface will have smooth edges , as necessary for patient comfort . a means to measure direction in 3d is shown in fig7 . the linear axis 36 of the stylus is represented relative to the vertical direction 48 , which corresponds to the z axis on a conventional 3d cartesian co - ordinate system . at right angles to the vertical 48 , the conventional cartesian x and y axes are shown lying in the horizontal plane 104 . the direction of the patient bed 44 , and zero position and direction of all spinal and upper cervical impulse treatment device components , are known relative to the selected x , y , z co - ordinate system . the angular direction of the linear axis 36 is therefore uniquely defined in 3d by the angle from the vertical , alpha 106 , and a rotational angle from the x axis , beta 108 , in the horizontal plane 104 . a desired treatment angle is determined by a practitioner on the basis of morphological data such as x - rays , physical examination , other inputs , and considerable clinical experience . practitioners will record and track the efficacy of selected treatment angles across many patients and many situations . it is important to apply linear impulses at a correct treatment angle to obtain consistent results . the current invention includes โ data validation โ to improve reliability . the actual angle 36 of the linear axis of the collapsible stylus 30 is measured in near real - time , at microsecond intervals , by any common angular measurement device . for example , accelerometers measure angular direction relative to vertical . as shown in fig8 , the actual angle 36 of the linear axis of the stylus is compared to the preset treatment angle 110 , as defined by the practitioner . the measured linear axis angle 36 and the preset treatment angle 110 must be very close to one another before the device will start - delivering impulses . a maximum angular difference 112 is set by the device manufacturer and higher accuracy options are available to the practitioner . locking mechanisms are engaged when the correct angular direction is achieved . if the locks fail and angular alignment is lost , the device will stop operating immediately ( within microseconds ). this approach removes human error entirely from active treatment . care must still be taken in setup and automated setup improvement methods are described further below . the current invention overcomes shortcomings in previous devices by preventing operation when the angle of the stylus axis 36 is misaligned relative to the preset treatment , angle 110 . data validation has many elements . additional controls are imposed on the device . the time duration of impulses , or number of impulses to be delivered , is automatically controlled in the current invention . operation does not depend oh a human depressing and releasing a trigger , an approach that lacks accuracy and repeatability . data validation also pertains to selection of impulse energy or intensity . a maximum impulse energy or sine wave amplitude is built into the transducer and this can be reduced by the practitioner . maximum rotational angle is predefined . this is a minimum set of controls for the current invention . additional elements of data validation may be incorporated into the spinal and upper cervical impulse treatment device , based on experience by practitioners . for example , experience may show that certain frequencies have the best results in certain situations . extensions in data parameter input , and associated data validation , are within the expected embodiments of the device . the spinal and upper cervical impulse treatment device is comprised primarily of a touchscreen 26 input panel and electronics motherboard 70 . a controller will typically include a microprocessor and various input and output interfaces . as an alternative to the touchscreen 26 , the user input panel may be implemented as any convenient combination of display and input components , such as a regular lcd display and keypad , or any other display and input mechanisms , which provide a friendly user interface ( ui ). distinctive characteristics of the controller and input means of the spinal and upper cervical impulse treatment device include mounting on or near the device head , as shown in fig2 , as well as the friendly ui . by placing the controller 22 in the proximity of the transducer 24 , the current , invention ensures that the attention of the practitioner can be focused on the region of the device . this design is preferred to separation of the impulse transducer from its controller , with some displacement between these two components of the system , a situation where a practitioner &# 39 ; s attention is split across different regions of the system , and operational errors may occur . a user friendly interface via a touchscreen 26 is shown at the top of the device head 28 in fig1 a . the user interface is menu driven . there is a logical sequence to the functions displayed to the practitioner , to enable walk - through of the spinal and upper cervical impulse treatment device operational setup with relative ease . default parameter settings are allowed as appropriate within treatment protocols . final treatment parameter settings are to be displayed . changes may be applied to the setting . there is no need to follow a sequence to adjust settings . other means of device setup , such as automated data parameter input , are discussed next . automated data input is an optional but integral part of the spinal and upper cervical impulse treatment , device . a graphics tablet 42 is used to capture information from x - rays and overlaid , diagrams or other diagrams . the input is digitized , allowing the data to be manipulated by computer algorithms . an experienced practitioner has defined the calculations needed to produce the correct preset treatment angle 110 . this is matched by the actual angle 36 of the linear axis of the impulse stylus in three dimensions . other treatment parameters , such as linear and rotational impulse parameters , defining frequency and energy , are then added to fully define the spinal and upper cervical impulse treatment for a particular patient . all treatment data parameters are organized so that they may be interpreted by the spinal and upper cervical impulse treatment device 22 , data parameters are transferred from a remote computer to the spinal and upper cervical impulse treatment device by any standard communications link 38 , such as a serial link , or universal serial bus ( usb ) port , or wireless data link and the means of communications are not limited . there are several advantages to automated data input . first , it is more convenient to digitize data from a graphics tablet 42 , than to manually calculate and input numbers from a diagram . once data is in digital form , it can be manipulated by algorithms . data may be archived on a computer 40 , representing many patients and treatment situations . such historic data and data patterns can be applied to new situations to improve the efficacy of treatment protocols . once treatment parameters have been defined , these may be automatically compared to other data , as well as being reviewed by an experienced practitioner . thereafter , treatment parameters are applied by the spinal and upper cervical impulse treatment device , in an accurate and consistent manner , providing overall confidence in treatment protocols . the therapeutic application of the spinal and upper cervical impulse treatment device is described as a flow chart of operations in fig9 . a patient examination and consultation takes place at step 120 . at step 122 pre - treatment x - rays are taken as well as static measurements of pelvic / shoulder level and leg length discrepancy , using calipers on the body . data points of interest are marked on the graphics tablet , such as cervical tilt , head tilt and atlas position , relative to the skull and cervical spine . at step 124 , digitised data points are transferred from the graphics tablet to a computer . x - ray analysis is conducted in three dimensions using custom spinal and upper cervical impulse treatment software . at step 126 , data parameters for device operation are derived from the spinal and upper cervical impulse treatment software and data archives , including : ( a )โ linear impulse frequency and duration , ( b )โ linear impulse angle , ( c )โ linear impulse force , and ( d )โ rotational angle . data parameters are transferred to the spinal and upper cervical impulse treatment software , manually via touch - screen , or automatically via a serial data communications link at step 128 . at step 130 , impulse parameters are validated in the spinal , and upper cervical impulse treatment software , including maximum impulse force , frequency and duration . settings are displayed on the touchscreen 26 . at step 132 , whether the measured linear impulse angular direction is in close agreement with the preset treatment angular direction is tested . the allowed difference is preset . if correct alignment is not achieved , then the system goes to step 134 . if alignment is acceptable , then the system goes to step 136 . at step 134 , the angle of the stylus linear axis is adjusted to try to achieve correct alignment . the system then returns to step 132 . at step 136 , once angular alignment is achieved , the angle of the linear axis of the stylus is fixed or locked and the location of the stylus end is locked . the spinal and upper cervical impulse treatment transducer is then allowed to start operation . if angular alignment is lost , operation will cease . the calculations in steps 132 and 134 are ongoing during treatment . at step 138 , post spinal and upper cervical impulse treatment includes measurement of the impact of treatment on pelvic / shoulder unlevelling and leg length discrepancy , using body calipers . at step 140 , following review and recommendations , the patient &# 39 ; s next appointment is scheduled as needed . at step 142 , post - treatment , x - ray analysis is conducted after 5 weeks , to determine progress and the efficacy of the treatment . the assembly , generally referred to as 208 is shown in fig1 . the assembly includes a body imaging device 209 , for example , but not limited to , x - ray , magnetic resonance imaging ( mri ) or computed axial tomography ( ct ) machines . a treatment device includes an impulse delivery mechanism comprising a stylus used to deliver waveforms of various frequencies , and amplitudes , both linearly and rotationally to the vertebrae of the spine . a stable stand 210 supports an arm or armature component 216 , which in turn supports the impulse treatment device head 228 . arm 216 is slidably enclosed by sleeve 219 . the stand 210 can raise or lower the arm 216 by a large retractable piston or linear actuator 212 that is operator controlled . the arm 216 is mounted at the top of the stand &# 39 ; s piston 212 at a complex joint with three degrees of freedom , called the stand coupling 214 . the transducer head can tilt in this direction but the arm cannot . the stand coupling 214 allows a tilt of the arm 216 off the horizontal plane , creating a roll angle . the arm 216 slides forward and back in sleeve 219 relative to the stand 210 . releasing a lock 221 allows arm 216 to rotate within sleeve 219 . a groove in arm 216 and a biased ball bearing in the interior cylindrical surface of sleeve 219 causes arm 216 to encounter the resistance of having to move the ball bearing out of the groove in arm 216 when rotating arm 216 relative to sleeve 219 . a yoke 218 has two arm components , which curve around and attach to the device head 228 by means of dual pivot points 220 on either side of the device head 228 . the yoke 218 is supported by arm 216 . there is a manual locking mechanism 217 close to the pivot point 220 on one side of the device head 228 . a touch screen 226 at the top of the device head 228 displays a user interface which is used for device positioning and control . a collapsible stylus 230 protrudes from the device head 228 and its end point 234 is used to deliver impulses to a predetermined contact point 235 on a patient &# 39 ; s body 232 . the point of contact 235 may be the top or atlas vertebra , behind the ear , as shown in fig1 . the patient 232 is lying on a treatment bed 244 and the desired contact point 235 is in a fixed location . the many components and degrees of freedom of the device head 228 mounting scheme described above in combination , allow positioning of the linear axis 236 of the device head 228 and collapsible stylus 230 in any direction in three dimensions ( 3d ), while simultaneously keeping the end of the stylus end 234 at a desired fixed location in 3d . for treatment , this fixed location is the contact point 235 on the patient 232 . at the time of treatment , the linear axis of the stylus is in any selected angle 236 in 3d , and this angle is calculated relative to the vertical direction 208 in the preferred embodiment . also shown on fig1 is a remote computer 240 , which can be any processor , which may be in any location and is not necessarily close to the treatment area . patient data from x - rays and overlaid drawings or other drawings are digitized and input to the remote computer 240 by means of a graphics tablet 242 peripheral . calculations are made in the remote computer 240 on the raw data and operating parameters are derived . these parameters are sent to the spinal and upper cervical impulse treatment device by means of any data communications link 238 , such as a serial data link or wireless link . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the skin of a patient adjacent a lumbar vertebrae in the vicinity of the transverse process of the vertebrae . treatment will be at a force of less than about 5 pounds , more preferably less than about 4 pounds and most preferably less than about 2 . 5 lbs ( about 22 n , about 18 n and about 11 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the skin of a patient adjacent a thoracic vertebrae in the vicinity of the transverse process of the vertebrae . treatment will be at a force of less than about 5 lbs , more preferably less than about 4 pounds and most preferably less than about 2 . 5 lbs ( about 22 n , about 18 n and about 11 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 5 minutes , more preferably 10 minutes , and can be as long as 15 minutes . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the skin of a patient adjacent a cervical vertebrae in the vicinity of the transverse process of the selected vertebrae โ it need not be c1 . treatment will be at a force of less than about 5 lbs , more preferably less than about 4 pounds and most preferably less than about 2 . 5 lbs ( about 22 n , about 18 n and about 11 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . large animals , for example , but not limited to , horses and cattle can be treated using the method of the present technology . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the hide of a patient adjacent a lumbar vertebrae in the vicinity of the transverse process of the vertebrae . treatment will be at a force of less than about 9 pounds , preferably less than about 7 lbs , and most preferably less than about 5 lbs ( about 40 n , about 31 n and about 22 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 5 minutes , more preferably 10 minutes , and can be as long as 15 minutes . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . large animals , for example , but not limited to , horses and cattle can be treated using the method of the present technology . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the hide of a patient adjacent a thoracic vertebrae in the vicinity of the transverse process of the vertebrae . treatment will be at a force of less than about 9 pounds , preferably less than about 7 lbs , and most preferably less than about 5 lbs ( about 40 n , about 31 n and about 22 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . large animals , for example , but not limited to , horses and cattle can be treated using the method of the present technology . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the hide of a patient adjacent a cervical vertebrae in the vicinity of the transverse process of the selected vertebrae โ it need not be c1 . treatment will be at a force of less than about 9 pounds , preferably less than about 7 lbs , and most preferably less than about 5 lbs ( about 40 n , about 31 n and about 22 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . small animals , for example , but not limited to , dogs and cats , can be treated using the method of the present technology . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the skin of a patient adjacent a lumbar vertebrae in the vicinity of the transverse process of the vertebrae . treatment will be at a force of less than about 5 lbs , more preferably less than about 4 pounds and most preferably less than about 2 . 5 lbs ( about 22 n , about 18 n and about 11 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . small animals , for example , but not limited to , dogs and cats , can be treated using the method of the present technology . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the skin of a patient adjacent a thoracic vertebrae in the vicinity of the transverse process of the vertebrae . treatment will be at a force of less than about 5 lbs , more preferably less than about 4 pounds and most preferably less than about 2 . 5 lbs ( about 22 n , about 18 n and about 11 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . small animals , for example , but not limited to , dogs and cats , can be treated using the method of the present technology . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the skin of a patient adjacent a cervical vertebrae in the vicinity of the transverse process of the selected vertebrae โ it need not be c1 . treatment will be at a force of less than about 5 lbs , more preferably less than about 4 pounds and most preferably less than about 2 . 5 lbs ( about 22 n , about 18 n and about 11 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . axial vibration was applied by placing individual discs into a chamber filled with cell culture medium . the lid on the chamber was fixed with a spring ( k = 26 . 2 n / cm ) that applied static axial load ( mean 40 . 6 n ) on the disks during the unconstrained vibration . the chamber had an ยฑ 1 . 7 g accelerometer fixed to it to track the vibration load when the chamber was mounted to a voice coil . the accelerometer was previously calibrated . the vibration of the voice coil was controlled with the output of a linear current amplifier module which received its command signal from a function generator . the voice coil and chamber were secured with damping to a shelf in a 37 ยฐ c . and 5 % co2 environmental control chamber . the control signal to the voice coil and the accelerometer output was monitored in real - time via an oscilloscope during the loading . vibration was applied at various frequencies ( 0 , 8 , 16 , 20 , 30 , 40 , 50 , 60 , 70 , 80 , 160 , 200 hz ) and amplitudes ( 0 - 0 . 54 g rms ) for either 10 or 60 minutes . the order of both amplitude and frequency selection was randomly assigned to eliminate any time - dependent trends due to sample storage . all conditions were run on a minimum of 5 separate discs ( from at least two different bovine tails ). the results indicated that frequency significantly affected expression of collagen type ii , decorin , and versican mrna . the regression slopes for each of these genes were not significant . amplitude significantly affected expression of biglycan , collagen type i , collagen type ii , decorin , and versican mrna . the regression slopes for these genes were significant and positive for all of these genes , with the exception of versican , which was not significant . in general , the results indicated a positive effect of axial vibration on extracellular matrix gene expression . most genes were at or above control levels for most frequencies and amplitude &# 39 ; s , with the notable exceptions of biglycan and versican . both of these genes exhibit complex expression patterns with high and low regions throughout the amplitude spectrum . regardless of frequency and amplitude , versican expression was reduced after 60 minutes of exposure . in general , it was concluded that the conditions that promoted nucleus pulposus gene expression were about 0 . 5 g , about 16 hz for half the time with a sweep from about 50 to about 80 hz for half the time for 10 minutes . vibration was applied by placing the stylus of the device disclosed in ca2005 / 000353 to khan et al . onto the sensitive region of a 450 n load cell that was fixed over the area of the spinous process of the center vertebrae of the 5 segment bovine tail . three dimensional ยฑ 10 g accelerometers were mounted on a cube and aligned with the axes of the disc ( x - axial compression / tension , y - shear 90 deg out of alignment with applied load , z - shear parallel with applied load ) and glued to the bone using cyanoacrylate to track acceleration of both the loaded and adjacent vertebral bodies . the accelerometers were previously calibrated using a 1 g shaker plate . the voice coil mounted and producing the vibration from within the device was controlled with the output of a linear current amplifier module which received its command signal from a function generator . the current going to the voice coil and the accelerometer output was monitored in real - time via an oscilloscope during the loading . imparted mechanics vibration was tested at four different current values (ห 0 . 9 - 1 . 9 amp driving current ). the testing vibration was applied at two static frequencies ( 0 or 16 hz ) and / or one sweep frequency ( 50 - 80 hz ) that would step up the frequency by 2 hz every two cycles of oscillation . each frequency treatment was applied for 10 minutes and one treatment alternated combined frequencies of 16 and 50 - 80 hz for 5 minutes each to maintain the overall 10 minute application . all amplitudes were sustained at 0 . 5 - 5 g peak root mean square [ rms ] of the vertebrae directly receiving the load . this is similar to current clinical treatments using the device , and corresponds to those stimuli eliciting peak responses in previous experiments . the order of control samples versus actual vibration samples was randomly assigned to eliminate any time - dependent trends due to sample storage . all conditions were run on a minimum of 6 separate discs ( from at least three different tails ). control discs were treated equally ( stored , handled , dissected , and snap - frozen ) in order to perform as true unloaded controls . the results showed non - significant changes in expression of collagen type i and increased expression of aggrecan , collagen type ii and versican . this suggests a potential beneficial effect of the current vibration loading pattern tested in the study . when compared to example 10 , it can be concluded that the placement of the stylus of the device on the vertebrae rather than providing unconstrained vibration to the vertebrae provides a further improvement in maintaining and potentially improving disc health through increased gene expression . on the basis of the results of this study and the clinical studies of spinal intervention , a suitable treatment for human patients was determined to be exposing at least one intervertebral disc to a repetitive sinewave impulse at a force of about 5 . 5 n to about 12 . 2 n , each sinewave impulse having an acceleration of about 0 . 5 g to about 5 g , at 16 hz followed by a sweep between about 50 to about 80 hz . the preferable treatment was at a force of 0 . 5 n with an acceleration of 0 . 5 g . the method is preferably effected using the treatment device disclosed in ca2005 / 000353 to khan et al . using saggital plane cervical x - rays , pre and post intervention mars were calculated for 44 patients with chronic neck pain . the study used a randomized , single blinded , and sham controlled design for comparisons of outcome measures . the intervention input was assessed using a load cell and vertebral acceleration and the outcome measures were : 1 . cervical mars , 2 . self - reported neck pain [ 11 - point scale ], 3 . neck disability index scores , 4 . psycho - social assessments for stress , anxiety , and depression . the device used was a spinal and upper cervical treatment device consisting of a controller mounted on top of an impulse delivery mechanism , or device head , which is mounted on a movable armature to a fixed stand . the device head generates waveforms [ sinewave at 50 - 110 hz ] and the stylus located at the base of the device head mechanically transduces the waveforms through the skin and ultimately to the spine , causing minor vibration of the vertebrae and minor repetitive stretching / activation of the attached soft tissues . the stylus amplitude is controlled by a touch screen setting called the โ intensity โ which ranges from 0 to 1 and controls the amplitude of current that is supplied to the stylus actuator . treatment is typically given at 0 . 5 and stylus imparted mechanics has been quantified using in situ bovine tail here in . patients in both groups were required to undergo treatment , either actual or sham , two or three times per week for a period of four to six weeks with each treatment lasting about 10 minutes . the preferred treatment was an acceleration of about 0 . 5 g to about 2 . 2 g , at a force of about 9 n to about 10 . 5 n and a frequency sweep from about 40 hz to about 120 hz for a period of about 30 seconds to about 5 minutes , with repeated individual treatments for 4 to 6 weeks . the more preferred treatment was an acceleration of about 0 . 5 g to about 1 . 5 g , at a force of about 9 . 5 n to about 10 . 4 n and a frequency sweep of about 45 hz to about 115 hz for a period of about 30 seconds to about 2 minutes . the most preferred treatment was an acceleration of about 0 . 5 g , at a force of 10 . 3 n , and a frequency sweep of about 50 to about 110 hz for a period of 30 sec to 2 min , with repeated individual treatments for 4 - 6 weeks . the treatment improved pain and neck disability scores significantly compared to sham controls , corrected 62 percent of abnormal mars with significantly larger mar vector magnitude differences [ pre - post ] at the c5 - c6 level than shams , and in patients without changes in mar locations , the treatment significantly improved neck disability scores above the sham group . mar correction was significantly related to improving both pain and neck disability across all subjects . hence the study provided biomechanical evidence of spinal โ re - alignment โ and its ability to improve both pain and neck disability . caliper measurements were used to determine alignment of the spine , by measuring the shoulder tilt and the hip tilt . as would be known to one skilled in the art , any means that allows a practitioner to assess tilt can be used , for example , but not limited to optical devices or a tape measure . a top skull x - ray image , a lateral x - ray image and a frontal x - ray image were taken to determine the location and orientation of the atlas . as would be known to one skilled in the art , any body imaging device that allows a practitioner to identify spinal vertebrae can be used , for example , but not limited to ct scans or mri . on the basis of the location and orientation , the physician determined the vector for treatment . for example , if the atlas is tilted up the treatment vector will be down . the vector can be determined manually , but preferably is determined with a suitable processor , for example , but not limited to a computer . the stylus can be placed in the general vicinity of the altas . he then ensured that the stylus angle was correct and positioned the stylus into position on the patient &# 39 ; s neck using the pen mark as a locator . the stylus is aligned along the treatment vector . the stylus caused a depression of approximately 2 mm below the skin surface and was on a bony landmark of the transverse process of the atlas , however , the stylus need not be placed on a bony landmark of the transverse process โ it can be placed in the general vicinity of the altas . further , there may be more than one probe , for example two probes . the preferred device for the treatment is one that controls the location and angle of the stylus relative to the patient and provides a highly controlled impulse in the form of a sinusoidal wave . the preferred treatment was an acceleration of about 0 . 5 g to about 2 . 2 g , at a force of about 9 n to about 10 . 5 n and a frequency sweep from about 40 hz to about 120 hz for a period of about 30 seconds to about 5 minutes , with repeated treatments weekly , or every two weeks , or every three weeks or every month for 4 to 6 weeks or 6 to 8 weeks , or more , as needed . the more preferred treatment was an acceleration of about 0 . 5 g to about 1 . 5 g , at a force of about 9 . 5 n to about 10 . 4 n and a frequency sweep of about 45 hz to about 115 hz for a period of about 30 seconds to about 2 minutes . the most preferred treatment was an acceleration of about 0 . 5 g , at a force of 10 . 3 n , and a frequency sweep of about 50 to about 110 hz for a period of 30 sec to 2 min , with repeated individual treatments . the results showed at least one of an improvement of spinal alignment , a reduction in shoulder and / or hip tilt , a reduction in pain , a reduction in swelling and an improvement in mental health . the foregoing is a description of the technology . as would be known to one skilled in the art , variations are contemplated that do not alter the scope of the technology . | 0 |
the following description is of the best - contemplated mode of carrying out the invention . this description is made for the purpose of illustrating the general principles of the invention and should not be taken in a limiting sense . the scope of the invention is best determined by reference to the appended claims . fig3 shows an embodiment of a data receiver 300 according to the invention . the data receiver 300 comprises a data extractor 304 for sampling the equalized signal # d q and outputting an output value # d out . the data extractor 304 is also able to detect signal quality of the equalized signal # d q and accordingly adjust the boost value of equalizer 202 . in the embodiment , a boost value generator 412 is dedicated to provide the boost value . the boost value may be dynamically adjusted according to the signal quality detected by the data extractor 304 . the adjustment may be performed by various approaches . for example , the data extractor 304 may perform a calibration to directly determine an optimal boost value associated with the present cable . first , the boost value generator 412 recursively and incrementally issues various boost values to the equalizer 202 during an interval containing multiple symbol periods t p . the interval is used for calibration . the interval should contain sufficient symbol periods to get a meaningful result . in response to every incremental boost value , the data extractor 304 acquires corresponding quality information from the equalized signal # d q . basically , the estimated signal quality is proportional to the boost value , thus , the outcomes may organize a line of positive slope . when the signal quality is saturated no matter how the boost value increases , the boost value at the saturation point is deemed to be an optimal one . hence , the boost value generator 412 stops the incremental adjustment , and the equalizer 202 switches to normal mode and operates at the optimal boost value . in fig3 , the data extractor 304 uses an over sampler 404 to sample the equalized signal # d q , by which a plurality of sampled values # d s may be acquired per symbol period t p . the sampled values # d s are buffered in a buffer 406 for further analysis before an output value # d out is determined . the buffer 406 has a capacity to store a plurality of sampled values # d s correspondingly obtained from a plurality of consecutive symbol periods t p , and an edge detector 410 reads them to detect locations of transition edges of each symbol period t p . the equalizer 202 may use an inadequate boost value to equalize a distorted input signal # d in , rendering an unstable equalized signal # d q in which transition edges rapidly change throughout consecutive symbol periods t p . the more edge uncertainty increases , the shorter the hold time t h โฒ where an output value is ensured valid . the edge detector 410 may determine the transition edges by comparing amplitude levels of two consecutive time points . for example , two sampled values # d s sampled before and after the transition edge may have significant amplitude difference . a transition edge can be deemed found when the amplitude difference between two consecutive sampled values # d s exceeds a predetermined threshold . the edge detection may also be accomplished by various conventional approaches , however , it is assumed that those skilled in the art are knowledgeable of these approaches , thus , detailed examples are not provided further . thereafter , the edge detector 410 sends a location signal # edge to the quality controller 408 , providing location information of the transition edges of every symbol period t p for further analysis . the quality controller 408 receives the location signal # edge , and accordingly selects one optimal sampled value # d as an output value # d out of a symbol period t p . specifically , the over sampler 404 is performing an over - sampling operation whereby the equalized signal # d q is sampled at different phases within each symbol period t p . for example , a symbol can be sampled at 5 different phases within one period to obtain 5 values of the equalized signal # d q . according to the location signal # edge , the quality controller selects one of the sampled values # d s to be the output value # d out , which is associated with a time point most close to the center of two transition edges within the symbol period t p . in other words , if the first and fifth sampled values # d s are deemed to be on the transition edges , the third sampled value # d s would be chosen to be the output value # d out . for the quality controller 408 , there is a current pointer p pointing to the optimal phase ( or time point ) within a sample period . the current pointer p could be determined by previous 4 sample periods ( s 0 , s 1 , s 2 , and s 3 ). during the next 4 sample periods ( s 0 โฒ, s 1 โฒ, s 2 โฒ, and s 3 โฒ), the quality controller 408 determines transition edges of the sample periods ( s 0 โฒ, s 1 โฒ, s 2 โฒ, and s 3 โฒ). the quality controller 408 also checks whether the current pointer p is pointing to the middle of each sample period of the 4 sample periods ( s 0 โฒ, s 1 โฒ, s 2 โฒ, and s 3 โฒ). if the pointer p is pointing to the left side of the middle point of a sample period , the quality controller 408 may determine that the pointer p should jump up to be more close to the middle point . conversely , if the pointer p is pointing to the right side of the middle point of a sample period , the quality controller 408 may determine that the pointer p should jump down to be more close to the middle point . in this embodiment , the quality controller 408 determines a jump up or jump down every 4 sample periods . jump ups or downs are represented by a pointer shift flag . the quality controller 408 records the total number of shifts ( jump ups or downs ) over a long period ( 1000 sample periods for example ). the more the number , the more frequently the pointer shifts . frequent pointer shifts means that the quality of the equalized signal is poor . the shifts should be as less as possible . by testing several transfer functions of the equalizer 202 , one can determine a best transfer function that results in minimum shifts . it means that the particular transfer function is the optimum choice to compensate the input signal d in . fig4 shows an embodiment of sampling an equalized signal # d q . a plurality of consecutive symbol periods t p is illustrated , in which distortions are represented as shadowed areas where sampled data is deemed invalid . four sampled values # d s are obtained correspondingly at five time points t 1 to t 4 in each symbol period t p , among which an optimal one would be selected as the output value # d out ( denoted as o 1 to o 4 ). in one symbol period t p , the time points t 1 to t 4 may be five equivalently distributed points . the output value # d out tends to be the most central one within the white area of each symbol period t p . other than that , amplitudes v 1 to v 4 of the output values # d out o 1 to o 4 may also be considered as references for signal quality . hence , the data extractor 304 sequentially receives and analyzes the equalized signals # d q and outputs corresponding output values # d out . alternatively , the over sampler may comprise five different samplers each tracking a different phase in the symbol period t p . the embodiment does not limit the implementation of the over sampler 404 . the optimal sampling point for the sample period s 0 is t 3 , which is denoted by o 1 . however , the current pointer p may point to t 4 . the pointer p is pointing to the right side of o 1 . therefore , for the sample period s 0 , it would be better to shift the current pointer p to t 3 , which is the optimal sampling point determined by the quality controller 408 . similarly , for the sample period s 1 , it would be better to shift the current pointer p to t 3 , which is the optimal sampling point determined by the quality controller 408 . after checking 4 sample periods ( s 0 - s 3 ), the quality controller 408 may determine to shift the current pointer p to t 3 , and then proceeds similar checking flow during the next 4 sample periods ( s 0 โฒ- s 3 โฒ). obtaining 5 sampling points for each sample period and checking 4 sample periods to decide to shift the current pointer are merely an example . one can determine the number of sampling points for each sample period and the number of sample periods to be checked according to different design requirements . fig5 is a more detailed embodiment of the data receiver 300 shown in fig3 . with reference to fig5 , an input signal # d in is distorted because of cable transmission . an equalizer 504 is used to compensate the distorted input signal # d in and generates an equalized ( compensated ) signal # d q . the equalizer 502 has several transfer functions for a boost value to select . the equalized signal # d q is determined by a selected transfer function . an over - sampling operation is performed by the k * n sampler 506 . in this embodiment k can be 4 and n can be 5 . a sample period of the equalized signal # d q is sampled at 5 ( k ) different phases within a single period . 4 ( n ) consecutive sample periods ( s 0 , st , s 2 , and s 3 ) will be sampled 20 times at 20 different phases . in this embodiment , 20 sampled values are produced before determining the quality of the equalized signal # d q . however , the sampling number ( k * n ) is not a limitation . one can determine the sampling number depending on different design requirements . the frequency of the input signal # d in can be , for example , 1 g hz . the clock frequency can be , for example , 100m hz . a pll or dll module 514 can produce 20 sampling signals fs , where each sampling signal fs has a phase shift relative to another sampling signal . the 20 sampling signals fs can be used by the k * n sampler 506 to sample 4 consecutive sample periods at 20 different phases and then produce 20 sampled values # d s . subsequently , the 20 sampled values # d s are input to a data pick up 508 . the data pick up 508 can be a buffer , which is corresponding to the buffer 406 in fig3 . the 20 sampled values # d s are then output as the output values # d out . a transition edge detection / shift decision module 510 also receives the 20 sampled values # d s . the transition edge detection / shift decision module 510 determines the edges of the 4 consecutive sample periods . a current pointer p is stored in the transition edge detection / shift decision module 510 . the current pointer p is determined by previous 4 consecutive sample periods . the transition edge detection / shift decision module 510 also determines the optimal sampling point for each sample period based on the 20 sampled values and the edges . the transition edge detection / shift decision module 510 compares the optimal sampling points ( denoted by o 1 - o 4 in fig4 ) with the current pointer p ( pointing to t 4 in fig4 ) and then determines whether to shift the current pointer p to a new position ( denoted by p โฒ hereafter ). in the example given by fig4 , the current pointer p will shift left ( jump down ) to match the newly decided optimal sampling points o 1 - o 4 . the transition edge detection / shift decision module 510 sends shift instruction ( up / down ) to a digital loop filter & amp ; data pick - up pointer adjustment module 512 . the transition edge detection / shift decision module 510 also sends shift instruction ( up / down ) to an equalizer controller 504 . over a long period ( 1000 sample periods for example ), the equalizer controller 504 accumulates the number of shifts ( or jumps ) of the current pointer p . the accumulated number of shifts denotes the quality of the compensation performed by the equalizer 502 . the more the accumulated number , the worse the compensation is . then , based on the accumulated number , the equalizer controller 504 sends a boost value to the equalizer 502 to select another transfer function . the equalized signal # d q is determined by the newly selected transfer function and then a next round of quality determination process is performed . during the next 1000 sample periods , the quality of the newly selected transfer function will be examined to see whether the compensation is better . after certain rounds , a best compensation quality using an optimal transfer function of the equalizer 502 will be picked and the calibration is accomplished . the following input signal # d in can be compensated by the best transfer function the equalizer controller 504 could provide . the transition edge detection / shift decision module 510 and the digital loop filter & amp ; data pick - up pointer adjustment module 512 are examples of the quality controller 408 shown in fig3 . the equalizer 202 is an example of the boost value generator 412 . fig6 shows another embodiment of the data receiver 300 shown in fig3 . the embodiment is the same as that shown in fig5 except a transition edge detection module 610 and a shift decision & amp ; digital loop filter & amp ; data pick - up pointer adjustment module 612 . part of the functions performed by the transition edge decision and shift decision / shift decision module 510 is moved to the shift decision & amp ; digital loop filter & amp ; data pick - up pointer adjustment module 612 . in this embodiment , the transition edge detection module 610 only takes care of transition edge determination and sends the edge information to the shift decision & amp ; digital loop filter & amp ; data pick - up pointer adjustment module 612 . the shift decision & amp ; digital loop filter & amp ; data pick - up pointer adjustment module 612 does most of the work , including shift of the current pointer p and data pick - up pointer adjustment . the transition edge detection module 610 and the shift decision & amp ; digital loop filter & amp ; data pick - up pointer adjustment module 612 do the same thing as the combination of the transition edge detection / shift decision module 510 and the digital loop filter & amp ; data pick - up pointer adjustment module 512 . the transition edge detection module 610 and the shift decision & amp ; digital loop filter & amp ; data pick - up pointer adjustment module 612 are also examples of the quality controller 408 shown in fig3 . any portions of functions can be separately or integrally performed by a specific module . this is merely variations of the invention . while the invention has been described by way of example and in terms of preferred embodiment , it is to be understood that the invention is not limited thereto . to the contrary , it is intended to cover various modifications and similar arrangements ( as would be apparent to those skilled in the art ). therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements . | 7 |
a substance 11 , which emerges for example from the column of a liquid chromatograph ( not shown ) and is dissolved in a solvent 10 , is collected in a relatively large - capacity collecting vessel 12 . the latter has a receiving capacity of at least approximately 1 cm 3 . the solvent 10 is then evaporated in the said collecting vessel 12 so that the substance 11 , which is to be analysed for example in a mass spectrometer ( not shown ) is left as a residue in the collecting vessel 12 . a sample holder 13 of relatively small dimensions is arranged inside the collecting vessel 12 or forms a part thereof . the design of the said sample holder 13 and its position relative to the collecting vessel 12 are such that , when or after the solvent 10 is evaporated , the substance 11 is left as a residue in or on the sample holder 13 . the said sample holder can then be introduced directly into the mass spectrometer or into an ionisation chamber thereof . in the exemplary embodiment according to fig1 the lower section of the collecting vessel 12 is funnel - shaped as a result of having a converging inner bottom face 14 . at the lowest point on the bottom face 14 , which point is central in the present case , the collecting vessel 12 forms an opening 15 . the sample holder 13 fits into the said opening in such a way that the bottom face 14 is completed by the upper side of the sample holder 13 . in the exemplary embodiment according to fig1 and 2 , the funnel - shaped bottom face 14 is continued in a likewise funnel - shaped recess 16 on the upper side of the sample holder 13 . as a result , in the arrangement according to fig1 the lower part of the interior of the collecting vessel 12 is generally funnel - shaped in such a way that , upon evaporation of the solvent 10 , the substance 11 automatically collects in the area of the recess 16 and therefore at the desired place on the sample holder 13 . as a result of the recess 16 , the said sample holder acts in principle like a known crucible for further processes , i . e . like a sample holder having a recess for receiving the substance . in the alternative according to fig3 the sample holder 13 is of substantially flat form in the section receiving the substance 11 . the sample holder 13 acts in this case as a plate 17 which , however , similarly to the exemplary embodiment according to fig1 and 2 , is adjacent to the bottom face 14 of the collecting vessel 12 in the area of the lowest point thereon . similary , the sample holder according to fig4 is attached to a collecting vessel 12 in such a way that a wire 18 , which is in the form of a loop , spiral or of similar design , projects into the collecting vessel 12 . in this case also , the arrangement relative to the collecting vessel 12 is such that the substance 11 collects at or on the wire 18 upon evaporation of the solvent 10 . therefore , virtually all the known conventional types of sample holders can be used in the described sense when they are correspondingly designed . this makes it also possible to use various ( known ) ionisation processes . for example , the wire 18 can be heated ( electrically ) in order that the sample may be evaporated in the ionisation chamber in this way . such a solution ( heatisng for evaporation ) can also be implemented with regard to the sample holders 13 according to fig1 to 3 . however , through &# 34 ; activation &# 34 ; the wire 18 can also be provided with a large number of tips which make it possible to carry out field desorption as an ionisation process . the sample holders 13 are designed so that they can be positively connected to and fitted on the collecting vessel 12 in the area of the opening 15 . for this purpose the sample holders 13 shown in this case are provided with a projection 19 which is limited by a ledge and which fits into the correspondingly formed opening 15 of the collecting vessel 12 . a shoulder 20 , which is connected to the said projection , on the sample holder 13 abuts on the flat underside of the collecting vessel 12 . moreover , the collecting vessel 12 and the sample holder 13 also can be made of different materials in such a way that they are optimally adapted to each field of used . the collecting vessels 12 which are designed in the manner described can be used particularly for the automatic transfer of samples using magazines . an example of a suitable sample magazine 21 is illustrated in fig5 to 8 . the sample magazine 21 is in the present case in the form of a rotating disc . the collecting vessels 12 are received in an upper magazine disc 22 . for this purpose , the said magazine disc is provided along its periphery with suitable holders in the form of through - holes 23 , each serving to receive a collecting vessel 12 . the upper sections of the collecting vessel 12 are provided for this purpose with supporting flanges 24 which rest on the magazine disc 22 . the collecting vessels 12 pass through the magazine disc 22 in such a manner that , in the starting position ( fig5 ), the sample holders 13 rest on a second lower magazine disc 25 . the position of the magazine discs 22 and 25 relative to one another is such that collecting vessels 12 and sample holders 13 are kept in a sealing contact with one another . the lower magazine disc 25 is provided for this purpose with cup - shaped recesses 26 which correspond to the holes 23 of the magazine disc 22 . the lower parts of the sample holders 13 are received in the recesses 26 , that is , while being supported on a flexible base which in this case is in the form of a compression spring 27 . in the starting position according to fig5 the liquid ( solvent and substance ) emerging from an lc is introduced into the collecting vessels 12 by a filling device 28 connected to the lc . for this purpose the sample magazine 21 is rotated cyclically by a stepping motor 29 which acts on a driving shaft 30 carrying the magazine discs 22 and 25 . the filling device 28 , which is pivotably mounted on a supporting column 31 , is in this case pivoted into a position above the magazine discs 22 , 25 . after the collecting vessels 12 of the sample magazine 21 are filled , the filling device 28 is pivoted into a lateral position ( fig6 ). then the upper magazine disc 22 is moved upwards , i . e . is separated from the lower magazine disc 25 . as a result , the collecting vessels 12 are separated from the sample holders 13 retained on the magazine disc 25 . the sample holders 13 provided with the samples can now be appropriately removed from the sample magazine 21 , namely the magazine disc 25 . the sample magazine 21 , namely the upper magazine disc 22 , can be heated . a heating system 32 , ( electrical heating or a flowing heating medium ), which is arranged in the area of the outer periphery and extends around the magazine disc , is provided in the present exemplary embodiment . the said heating system causes the solvent 10 to be evaporated or the evaporation to be accelerated . | 6 |
with reference to the accompanying drawings in which like numerals indicate like elements , fig1 shows a portable commode with lift assist seat which is generally indicated by the numeral 10 . the portable commode 10 of fig1 generally has a floor stand 12 which as shown in the drawings is self - supporting and free standing on four legs , and a seat assembly 14 . the floor stand 12 further has four upright legs including two front legs 22 and two rear legs 24 . a side brace 26 connects each front leg to a corresponding rear leg , a first cross - brace 28 interconnects the side braces , and a second cross brace 29 connects the rear legs to each other , giving structural rigidity to the floor stand . the stand has two opposite sides , each side made up of a front leg , a rear leg and a side brace . the legs and braces are preferably made of lightweight aluminum tubing in order to maintain a low overall weight of the commode 10 . seat assembly 14 includes a seat frame 31 having a generally u - shaped element 30 which has two side portions 32 connected by a rear cross - portion 34 , and two front ends 36 . the side portions 32 are also connected by a front cross - brace 38 . the seat assembly also includes a generally annular seat 40 having a central opening 42 . the seat 40 is securely mounted on the seat frame 31 between the rear cross - portion 34 and the front cross - brace 38 by suitable fasteners , not shown in the figure . the rear legs 24 extend upwardly above the seat 40 and are bent to a generally horizontal position to define an armrest 41 on each side of the seat , which may be grasped by an infirm user for support and balance while lowering himself or herself onto the seat 40 or while rising therefrom . the rear legs 24 and arm rests 41 are defined by a continuous length of tubing , and each arm rest is a generally horizontal portion of the continuous length , terminating in a free end 43 . in the depicted embodiment of the invention , the arm rests 41 are consequently supported only on the rear legs 24 . each front end 36 of the seat frame is connected by a bolt 44 and nut 46 , as shown in fig5 to the top end 48 of a corresponding front leg 22 to form two hinges 52 connecting the seat assembly to the floor stand . the rear cross - brace of the seat assembly is supported on the second cross - brace of the floor stand in a lowered or depressed condition of the seat assembly illustrated in fig3 such that the body weight of a person seated on seat 40 in this condition is carried by the four legs of the floor stand . the commode 10 has a pair of pneumatic springs 50 each of which has a lower end 54 and an upper end 56 . as shown in the drawings , the preferred pneumatic springs 50 are self - contained and are not connected to any external source of power . each lower end is pivotably connected to the floor stand 12 , specifically , at the junction of the side brace 26 and the rear leg 24 . the upper end of each spring is connected to the seat frame 31 by means of a pivot assembly 58 depicted in detail in fig6 . the pivot assembly 58 has a pivot bolt 62 extending transversely to the longitudinal dimension of the spring 50 and passing through an attachment hole 64 in a plate 66 which is affixed as by welding along the underside of each side portion 32 of the seat frame 31 . a nut 63 threaded on the bolt 62 secures the pivot connection . the two springs 50 are selected so that in a fully extended condition of the two springs the seat assembly is lifted to a forwardly tilted position illustrated in fig1 and 4 , with the rear 43 of the seat 40 elevated at approximately a 45 degree angle relative to its aforementioned depressed , generally horizontal position of fig3 . the plate 66 is perforated with a series of such attachment holes 64 evenly spaced apart in a direction generally towards and away from the hinge line defined by hinges 52 . that is , the attachment holes 64 lie along a line which is transverse and approximately radial to that hinge line . each hole 64 defines an attachment point for the upper end of the corresponding spring so . in effect , the different attachment points provide a range of leverage factors by which the force of the springs 50 acting on the seat assembly 14 can be selectively modified . the effective spring force is the actual expansion force of the springs 50 compressed between the floor stand 12 and the seat assembly 14 , adjusted for the leverage effect of the selected attachment point along the plates 66 . in general , the effective spring force acting to lift the seat 40 increases as the attachment point is displaced away from the hinges 52 towards the rear of the seat , and conversely is at its minimum when the upper ends of the springs 50 are connected at the holes 64 closest to the hinges . as shown in fig3 and 4 , the attachment points are sufficiently spaced away from the hinge connection 52 of the stationary lower portion of the tubular frame with the seat frame 14 so that when installed at the attachment point nearest to the hinge the pneumatic springs 50 will provide the aforementioned effective spring force is obtained at any of the attachment points 64 of the springs 50 . furthermore , it will be seen from fig3 and 4 that the angle of the spring 50 remains approximately the same during the lifting of the seat assembly 14 from the generally horizontal position of fig3 to the elevated position in fig4 . the springs 50 are selected to provide an effective spring force normally urging the seat assembly upwardly towards its elevated , tilted position with sufficient spring force to support and carry a significant portion of the body weight of an intended infirm user of the commode 10 . the effective lifting force of the seat 40 can therefore be adjusted by repositioning the attachment point of the springs between the floor stand and the seat assembly , to suit the needs of a particular user . a greater or lesser degree of lift assist to the user can be provided by appropriate adjustment of the spring connections . it will be appreciated that an equivalent range of leverage factors can be achieved by providing a series of attachment points for the lower ends 54 of the springs 50 while providing a single pivotable attachment point for the upper ends 56 . the commode of fig1 is configured as a self - contained portable toilet by providing an on - board waste receptacle 70 supported under the central seat opening 42 between the first and second cross - braces of the floor stand on mounting flanges 72 , 74 which are best seen in fig4 . the receptacle 70 is removable from the commode for waste disposal and cleaning . it will be appreciated that the waste of receptacle 70 is supported on the stationary portion of the floor stand , and does not lift with the seat assembly 14 . in this configuration the commode is suited for use where a nearby bathroom is not available or the condition of the user is such that a toilet closely adjacent to a bed is needed . removal of the waste receptacle 70 configures the commode 10 for use with a conventional toilet fixture in an existing bathroom . the width of the commode measured between the opposite sides and the height of at least the second cross - brace 29 , and preferably both first and second cross - braces 28 , 29 , are such as to span the bowl b of a conventional toilet fixture f as illustrated in fig2 . the rear legs 24 are spaced apart to admit the width of the bowl b while the height of the second cross - brace 29 admits the height of the same bowl into position between the opposite sides of the floor stand and under the central opening 42 of the seat 40 , as illustrated in fig2 . springs other than pneumatic springs can be used with the commode 10 , including mechanical springs such as coil springs , or hydraulic springs . it must be understood that these and other changes , modifications and substitutions to the preferred embodiment , which has been described and illustrated for purposes of clarity and example , will be apparent to those having ordinary skill in the art without thereby departing from the scope and spirit of the present invention , which is defined by the following claims . | 0 |
the various aspects of the present invention provide methods for preparing bcc , the latter being represented by the formula ( cuco 3 ) x ( cu ( oh ) 2 ) y , wherein x & gt ; 0 and y & gt ; 0 . desirably , in this formula , when y is 1 , x may be 1 or 2 , may range from about 0 . 95 to less than 1 or to 1 , and , more desirably , x is 1 or 2 when y is 1 . more than one species of bcc may be prepared by the inventive methods . for example , malachite ( cu 2 ( oh ) 2 co 3 , wherein x and y are 1 in the formula ) or azurite ( cu 3 ( oh ) 2 ( co 3 ) 2 , wherein x is 2 and y is 1 in the formula ) may be prepared , as may mixtures thereof . in one aspect , the invention provides a method of preparing bcc comprising : ( a ) providing a solution of copper ( ii ) in a reaction vessel , the solution comprising copper ( ii ), an amine , carbonic acid , and water , adjusting the ph of the solution until bcc is provided ; and recovering the bcc . the foregoing method may be practiced in any suitable reaction vessel , e . g ., a spray chamber , a stirred tank reactor , a rotating tube reactor , or a pipeline reactor , in either a continuous or batch process . it is desirable to practice the method as a continuous process , more desirably using a continuous stirred tank reactor . the type of reaction vessel may influence the morphology of the bcc formed therein , such as particle size and particle shape . for example , a constantly stirred tank reactor ( cstr ) tends to provide fairly uniform spherical agglomerated bcc particles , whereas a rotary evaporator - type reactor , as exemplified in u . s . pat . no . 4 , 686 , 003 , produces more rod - like bcc particles . thus , bcc particle size and shape may be influenced in connection with the inventive method via appropriate reactor vessel selection . the particle size of bcc may also be controlled by varying the concentrations of copper ( ii ) and ammonia in the solution , as well as by regulating the input rate of copper solution and / or co 2 into the reaction vessel , and / or the endpoint of the precipitation reaction . the particle size may also be controlled by other process parameters , such as residence time or temperature . in the solution provided in the reaction vessel , or feed solution , the copper ( ii ) included therein may originate from any suitable source . in practice , a typical copper ( ii )- containing feed stream contains ammonia , water , carbonic acid , and other components . a typical feed stream will include components , in certain amounts , as follows : copper ( ii ), from about 10 g / l to about 160 g / l , desirably from about 70 g / l to about 105 g / l ; water ; ammonia , from about 3 g / l to about 110 g / l , desirably from about 50 g / l to about 90 g / l ; and ammonia to copper ( ii ) molar ratio from about 2 . 5 to about 3 . 3 , desirably from about 2 . 8 to about 3 . 1 ; and carbonic acid from about 15 g / l to about 130 g / l , desirably from about 95 g / l to about 110 g / l . generally , as the content of the feed stream is known , one skilled in the art should be able to create the feed stream with the amount of each component needed to be present in the reaction vessel to practice the inventive methods . in the aspect of the invention that involves introducing a copper metal - containing material into a copper ( ii )- depleted solvent system to provide an enriched copper ( ii ) solution , an additional amount of an amine may be added to assist in solubilizing the copper metal in the aqueous medium . the amine is desirably ammonia ( which exists in the aqueous medium in equilibrium with ammonium hydroxide ). the amount required to effect this dissolution will vary , but will generally range from about 0 . 5 : 1 to about 4 : 1 , and desirably from about 1 : 1 to about 2 : 1 , moles of amine to moles of copper metal . on an absolute basis , the amount of amine in the aqueous solution is desirably limited , ranging from about 15 g / l to about 105 g / l , and more desirably from about 60 g / l to about 96 g / l , of nh 3 . in general , as the pressure in the reactor vessel increases , the allowable amine concentration may be increased . the carbonic acid may be provided in the reaction vessel by any suitable means , but is preferably provided by introducing co 2 into the reaction vessel , e . g ., by bubbling co 2 through the aqueous solution , or by providing a relative increase in the partial pressure of co 2 within the reaction vessel . as used herein , the term carbonic acid includes carbonic acid as well as bicarbonate and carbonate ions , as it will be appreciated by one of ordinary skill in reading this disclosure that all of these species may be present when co 2 is introduced into the aqueous solution . following precipitation and separation of the solids , it may be necessary to reduce the carbonate level , or increase the ph , in the solution to provide a suitable solution for copper leaching . this can be accomplished by reducing the partial pressure of co 2 in the vessel , or nominally through a reduction of the total pressure within the reaction vessel . the relationship between the components in the system , while not being bound by theory , may be simplistically explained in terms of an equation : [ cu 2 + ] n [ oh โ ] m [ co 3 2 โ ] p = k sp , wherein n , m , and p are greater than 0 , and k sp is a solubility product for bcc . when the product of certain ionic concentrations exceed the solubility constant for bcc ( i . e ., k sp ) bcc will precipitate out of the solution . not shown in the k sp equation is the solvating ligand ammonia that influences the concentration of copper ions available for bonding . in the inventive methods , selectively increasing the concentration of one or more of copper ( ii ), hydroxide ions or carbonate ions , or decreasing the ammonia concentration may be sufficient to cause bcc to precipitate from the solution . for this invention addition of the co 2 also adjusts the ph of the solution in order to precipitate bcc . in this regard , the ph of the solution is desirably relatively low , for example less than about 10 , during the formation of bcc . more desirably , the ph may range from about 7 to about 10 , preferably from about 7 to about 9 , and more preferably from about 7 to about 8 . preferably , the ph of the solution is adjusted by the introduction and removal of co 2 from the reaction vessel . one of the advantages of the inventive methods is that bcc may be obtained from copper ( ii )- containing solutions using less energy relative to known methods . while the methods may be carried out at any suitable temperature , e . g ., from about 25 ยฐ c . to the boiling point of the solution , it is desirable that a limited amount or no heat need be added to the solution during the formation of the bcc . for example , the methods desirably contemplate maintaining the temperature of the solution from about 15 ยฐ c . to about 100 ยฐ c . more desirably from about 21 ยฐ c . to about 82 ยฐ c ., and even more desirably from about 38 ยฐ c . to about 79 ยฐ c . preferably , the temperature of the solution may range from about 60 ยฐ c . to about 77 ยฐ c . the preparation of azurite , malachite or a mixture thereof may be controlled by controlling the temperature of the solution in the reaction vessel . more specifically , azurite is provided in relatively greater quantities when the temperature of the solution is relatively low , while malachite is provided in relatively greater quantities when the temperature of the solution is relatively high . while these temperatures may vary depending on the operating pressure in the reaction vessel , at 100 psig pressure the temperature of the solution to provide azurite is desirably between about 4 ยฐ c . and about 71 ยฐ c ., and more desirably between about 38 ยฐ c . and about 68 ยฐ c . ; to provide malachite the temperature is desirably between about 65 ยฐ c . and about boiling , and more desirably between about 68 ยฐ c . and about 79 ยฐ c ., and to provide a mixture the temperature of the solution is desirably between about 65 ยฐ c . and about 71 ยฐ c ., and more desirably between about 65 ยฐ c . and about 68 ยฐ c . at relatively lower pressures , the temperature ranges will be relatively lower than those disclosed above . while the preparation of bcc may be carried while the reaction vessel is at ambient pressure , it may be desirable to increase the pressure in the reaction vessel in order to increase the yield per liter of feed solution . if desired , the pressure in the reaction vessel may desirably range from about 0 psig to about 1500 psig , more desirably range from about 0 psig to about 300 psig , and preferably range from about 50 psig to about 200 psig . in a related aspect , the inventive methods provide for the preparation of bcc by the introduction of a copper metal - containing material into a solution of copper ( ii ), the solution comprising copper ( ii ), an amine , carbonic acid , and water . illustrative of suitable copper materials are copper metal , bronze , copper - containing plastics , alloys , compounds , and clads . the aforesaid copper ( ii ) solution includes a relatively low concentration of copper ( ii ) therein , as it is preferably the solvent system which remains after a copper ( ii ) solution having a relatively high copper ( ii ) concentration has been processed in accordance with the methods described herein to provide bcc . the copper in the aforementioned copper - containing solution is oxidized prior to introduction into the primary reaction vessel . oxygen , and more desirably , air , is used as the oxidizer . the conditions under which oxidation will occur are well known to those skilled in the art . desirably , and prior to introduction into the reaction vessel , the copper metal - containing material is dissolved in a copper ( ii )- depleted solvent system comprising an amine to provide a solution which contains a relatively high concentration of copper ( ii ), which is preferably at least 88 g / l , more preferably at least 92 g / l , and most preferably at least 96 g / l copper ( ii ). desirably , the ammonia concentration ranges from about 60 g / l to about 96 g / l , and the primary reaction vessel is at about 50 psig to about 200 psig , wherein this copper ( ii ) replenished solution is then introduced into the primary reaction vessel wherein bcc is formed . desirably , the methods of the invention contemplate that , in the reaction vessel , the molar ratio of ammonia to copper ( ii ) ranges from about 2 . 6 to about 3 . 9 ; the temperature of the solution in the reaction vessel ranges from about 20 ยฐ c . to near boiling ; and the pressure in the reaction vessel ranges from about 0 psig to about 1500 psig . more desirably , in the reaction vessel , the molar ratio of ammonia to copper ( ii ) in the solution ranges from about 2 . 7 to about 3 . 8 ; the temperature of the solution in the reaction vessel ranges from about 48 ยฐ c . to about 80 ยฐ c . ; and the pressure in the reaction vessel ranges from about 20 psig to about 500 psig . preferably , in the reaction vessel , the molar ratio of ammonia to copper ( ii ) ranges from about 2 . 7 to about 3 . 2 ; the temperature of the solution in the reaction vessel ranges from about 60 ยฐ c . to about 75 ยฐ c . ; and the pressure in the reaction vessel ranges from about 80 psig to about 250 psig . as mentioned previously , an aspect of the inventive methods desirably provides a means for the continuous preparation of bcc . fig1 is a schematic diagram which provides an exemplary operational flow of a method of providing bcc in according with this aspect of the invention . referring to this figure , the method includes processing stages which may be referred to as precipitation 1 , filtration 3 , co 2 separation 5 , and leaching 7 . in the precipitation process , bcc is formed and precipitated from an aqueous solution comprising copper ( ii ), ammonia , and carbonic acid ( provided via the introduction of co 2 2 , as described herein ), as described in more detail herein . after bcc formation is completed , the solution may be filtered 3 to recover the bcc 4 . the filtration process contemplated by the invention may be performed by any suitable means , but is desirably performed under pressure ( e . g ., between about 1 psig and about 1500 psig ) to prevent the desorption of co 2 , the latter potentially causing solids to re - dissolve in the solvent solution . further , filtration under pressure ( above ambient ) may prevent the solids from agglomerating at the bottom of the filter . after filtration is completed , the copper ( ii )- depleted solvent desirably may be degassed to remove excess co 2 by boiling for a designated time in a vessel equipped with a condenser ( to collect the distillate ). alternatively , or in addition , co 2 may be removed by air stripping or pressure reduction . the co 2 removed by degassing may be reused by recycling 6 it back to the precipitation vessel 1 . the copper ( ii )- depleted solvent may then be used in a leaching / oxidation process 7 to obtain a replenished copper ( ii ) solution , which solution then may be recycled and utilized in the method described herein ( to provide bcc ). as this method provides for continuous processing in a closed loop , waste production is minimized and lower energy consumption is achieved . the exemplary continuous processing illustrated in fig1 is provided as one possible embodiment of the inventive method , and may be modified as desired . for example , the replenished copper ( ii ) solution may be diluted with water prior to its use in the method in order to restore an appropriate solution concentration . also , after bcc is formed , and prior to filtration , the resultant slurry may be subjected to a thickening process . additionally , after the copper metal is added to the copper ( ii )- depleted solvent system ( after the leaching process ), the resulting aqueous solution may be oxidized to obtain a solution having a relatively higher amount of copper ( ii ) ( for example , higher than 1 g / l ) and a lower amount of copper ( i ) ( for example , lower than 1 g / l ). the solution may also be heated after this oxidizing process to control the temperature of the solution as desired , which would permit some control over the type of bcc formed using the method , as described herein . this temperature control also may be implemented after oxidation , or at a different processing juncture , e . g ., prior to and / or during the precipitation process . the inventive method also contemplates preparing bcc by contacting copper metal with an aqueous solution comprising an amine , carbonic acid ( which may be present as a carbonate , as described herein ), and oxygen under conditions where the copper metal is converted into bcc ; and recovering the bcc . the invention further contemplates a method of forming bcc comprising the steps of providing copper ( ii ) hydroxide in an aqueous solution comprising an amine and a sufficient amount of carbonic acid to convert at least one fourth of the copper hydroxide to bcc ; under conditions where the copper hydroxide is converted to bcc ; and recovering the bcc . in this aspect of the invention , the amine is desirably ammonium hydroxide , and the copper hydroxide is desirably formed by contacting copper metal with an oxidant and an aqueous solution comprising ammonium hydroxide under conditions that the copper metal is converted to copper ( ii ) hydroxide . those skilled in the art will appreciate that copper ( ii ) hydroxide may be formed when the solution has a high concentration of hydroxide ions relative to carbonate ions , and that the copper ( ii ) hydroxide is disassociated in the presence of water , providing copper ( ii ) ions in the aqueous solution . desirably , the solution may contain from about 0 . 1 gram to 15 grams of soluble copper ions per liter of soluble copper . the following examples further illustrate the invention but , of course , should not be construed as in any way limiting its scope . this example demonstrates production of bcc by reducing the ph of a plant solution left from caustic boil production of bcc and containing copper ( ii ), ammonia and co 2 . 3 l of an aqueous solution containing 48 g / l co 2 , 48 g / l nh 3 , 54 g / l copper ( ii ), and at a ph of 10 were added to a stoppered erlenmeyer flask whose side - arm was open to the atmosphere ; the stopper held a gas dispersion tube connected to a source of co 2 gas , and a thermometer . the starting temperature was 22 . 9 ยฐ c . co 2 gas was bubbled into the solution at a rate of 0 . 5 lpm , with constant mixing . at 1 . 5 hours , the ph was 8 . 07 and the temperature had risen to 31 . 1 ยฐ c . ; solids started to form . after 3 . 5 hours , 10 g of blue solids were collected by filtration . the remaining solution had a ph of 7 . 7 and a temperature of 29 . 7 ยฐ c ., and contained 94 g / l co 2 , 47 g / l nh 3 , and 49 g / l copper ( ii ). the collected solids constituted 53 . 84 % copper determined by electrogravimetry , 24 . 38 % co 2 determined by differential pressure , and 0 . 68 % nh 3 determined by the kjeldhal method . this example illustrates the preparation of bcc from a copper ( ii ) solution by lowering the ph , and without additional energy input ( e . g ., the solution was not heated after introduction into the reaction flask ). this example demonstrates leaching of copper metal into an aqueous solution containing copper ( ii ), ammonia and co 2 . after the filtration of bcc therefrom , the resultant copper ( ii )- depleted solution was boiled to remove excess co 2 . after boiling , the aqueous solution contained 16 . 4 g / l copper ( ii ), 18 . 9 g / l nh 3 , and 25 . 6 g / l co 2 , and had a ph of 8 . 3 . 1 . 0468 kg of 78 % copper - on - steel wire was added to 9 . 0 l of the boiled solution in a 10 l cylindrical glass reactor with a peristaltic feed pump . at time zero , the solution had a temperature of 28 ยฐ c ., which was brought to and maintained at 38 - 40 ยฐ c . during the leaching . air was sparged through system . at the end of 8 . 0 hours , the solution contained 22 . 8 g / l copper ( ii ), 20 g / l nh 3 , 24 . 3 g / l co 2 , and had a ph of 8 . 15 . the boiled solution was enriched by the leaching of 6 . 4 g / l copper ( ii ) from copper metal . this copper - enriched solution is suitable as the feed solution for use in the bcc preparation process described herein . this experiment demonstrates that bcc may be precipitated from a copper - depleted solution that had been enriched by dissolving copper metal . 10 l of enriched solution from a leaching test was put into a stirred tank reactor . the initial conditions of the aqueous solution were : 21 . 7 g / l copper ( ii ), 17 . 7 g / l nh 3 , 30 . 1 g / l co 2 , ph 9 . 0 , and temperature 24 ยฐ c . the co 2 flow rate was set to 2 . 0 lpm . after 1 hour , the ph had dropped to 7 . 46 , the temperature was 46 ยฐ c . and solids had started to form . after 3 hours , 156 . 7 g of dark green solids were collected by filtration . the final solution had 11 . 1 g / l copper ( ii ), 18 . 2 g / l nh 3 , 37 . 8 g / l co 2 , a ph of 7 . 6 and a temperature of 43 ยฐ c . the dried solids were 56 . 7 % copper . thus , a process loop was achieved . all references , including publications , patent applications , and patents , cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein . the use of the terms โ a โ and โ an โ and โ the โ and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms โ comprising ,โ โ having ,โ โ including ,โ and โ containing โ are to be construed as open - ended terms ( i . e ., meaning โ including , but not limited to ,โ) unless otherwise noted . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., โ such as โ) provided herein , is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventors for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context . | 2 |
the present invention will now be described in detail with reference to the appended drawings showing preferred embodiments of the invention . firstly referring to fig1 to 4 , coins are successively fed to a coin guide passage 1 and conveyed through the passage by a conveyor belt 2 . the coin guide passage 1 is provided with means for rejecting coins of different species , for example a coin rejection hole or slot 3 , sensors for detecting the passage of coins comprising photoelectric elements 4 and 4 , a stopper 5 for stopping passage of coins after a pre - set number of coins has been passed to a coin accumulator tube 7 and adapted to rotate to a normal position for allowing the coins to pass in response to a signal for instructing to start the next cycle operation , and another conveyer belt 6 moving at a relatively higher speed than the conveyor belt 2 so as to increase the gaps between adjacent coins . a coin accumulator tube , designated by numeral 7 , has a hollow cavity 7 &# 39 ; in which coins are accumulated . the diameter of the cavity 7 &# 39 ; may be varied in accordance with the diameter of coins to be accumulated therein , or a coin accumulator tube having a cavity for snugly receiving coins of single species may be selected from a group of accumulator tubes to be assembled in the system . a coin reception recess 7 &# 34 ; is formed on the top of the coin accumulator tube 7 . the coin accumulator tube 7 is assembled such that the top face of the coin reception recess 7 &# 34 ; is flush with the guide face of the coin guide passage 1 or positioned at the level slightly lower than the latter . a vertically - extending slit 8 is cut through the peripheral wall of the tube 7 , and a circumferential slit 9 is formed at the lower portion of the cylindrical tube 7 . a radial through - hole 10 for an upper photoelectric sensor 10 &# 39 ; for sensing the height of accumulated coins is provided at the upper portion of the tube 7 . another radial through - hole 11 for a lower photoelectric sensor 11 &# 39 ; for detecting the presence of a carrier bar 12 ( see fig3 ) is provided at the lower portion of the tube 7 . a movable shutter mechanism b is associated with the coin accumulator tube 7 . the movable shutter mechanism b of this embodiment comprises shutter plates 13 and 13 &# 39 ; each having a generally semicircular free end , an elongated stem portion and a generally trapezoidal base portion . in the normal closed position , both shutter plates 13 and 13 &# 39 ; engage with each other with their free ends forming a generally circular shutter which is inserted in the cavity of the coin accumulator tube 7 to form the bottom thereof and to support the accumulated coins until a pre - set number of coins is stacked in the tube 7 . the base portions of the shutter plates 13 and 13 &# 39 ; are pivoted by pins 15 and 15 &# 39 ; of a support member 14 and moved by rollers 16 and 16 &# 39 ; mounted on lugs of the base portions to open or close the shutter formed by the generally semicircular free ends of the shutter plates 13 and 13 &# 39 ;. an operation pin 17 is mounted to another lug of the base portion of the one shutter plate 13 &# 39 ;. the support member 14 has a threaded hole for engaging with a screw shaft 18 and another hole through which a guide rod 19 extends to prevent the support member 14 from rotating . the screw shaft 18 is rotated by a driving system 30 to lower or raise the support member 14 . when the support member 14 is lowered to the lowermost position , the operation pin 17 engages with a hole 21 of an operating lever 22 . the operating lever 23 is connected to a solenoid 23 . referring now to fig3 the lower movement of the shutter plates 13 and 13 &# 39 ; which is controlled on the basis of the output signal generated from the upper photoelectric sensor 10 &# 39 ; will be first explained . at the beginning of the accumulation operation , in order to raise the support member 14 to its uppermost position , as shown in dot - and dash line , a reversible motor 25 is actuated to rotate the screw shaft 18 in a reverse direction . when the support member 14 reaches the uppermost position , a cam 24 mounted to the support member 14 engages with an actuator of a limit switch a to switch - off the limit switch a thereby to stop the motor 25 . in the state , the shutter plates 13 and 13 &# 39 ; are closed and supported at a level slightly lower than the top face of the recess 7 &# 34 ; of the coin accumulator tube 7 . coins a are successively fed by a conveyer belt 2 and the gaps therebetween are increased by the action of the high speed conveyer belt 6 . the coins are then passed through the recess 7 &# 34 ; to be placed on the shutter plates 13 and 13 &# 39 ;. since the difference in height between the top face of the recess 7 &# 34 ; and the shutter plates 13 and 13 &# 39 ; is small , the distance of falling movement of individual coins within the hollow cavity 7 &# 39 ; of the tube 7 is limited . as coins a are stacked on the shutter plates 13 and 13 &# 39 ; and the through - hole 10 is shielded by the accumulated coin pile , a signal is generated to actuate the reversible motor 25 to rotate the same in the forward direction , whereby the screw shaft 18 is rotated through the driving system 20 in the direction to lower the support member 14 . the lowering speed of the support member can be controlled by detection , by the sensor 10 &# 39 ;, of the coins accumulated in the accumulator tube or by the combination of the pitch of the screw and the rotational speed of the shaft 18 , so that the shutter mechanism is lowered in synchronized with the coin feeding rate . the shutter mechanism is thus lowered stepwisely or continuously while maintaining the distance between the top face of the lastly stacked coin and the top face of the recess 7 &# 34 ; at a small limited value . coins a fed to the accumulator tube 7 are counted by the counting elements 4 as described before , and when the counted number reaches the pre - set number , the stopper 5 is rotated to interrupt the coin flow in the coin guide passage 1 to stop coin supply . at that time , the shutter plates 13 and 13 &# 39 ; are lowered to the lowermost position , shown by the solid line in fig3 to be aligned with the circumferential slit 9 . in the meanwhile , the tube 7 may have a height such that the shutter plates 13 and 13 &# 39 ; clear the bottom peripheral face thereof when the pre - set number of coins is stacked thereon and the shutter plates 13 and 13 &# 39 ; reach their lowermost position . in such a case , the circumferential slit 9 may be dispensed with . anyway , when the shutter plates 13 and 13 &# 39 ; are lowered to the lowermost position , the cam 24 depresses the actuator of a limit switch b to stop the reversible motor 25 and the carrier bar 12 is raised beneath the shutter plates 13 and 13 &# 39 ; to be ready for receiving the coin pile . when the lower through - hole 11 is shielded by the thus raised carrier bar 12 , a signal is generated from the lower photoelectric sensor 11 &# 39 ; for energizing the solenoid 23 , whereupon the operating lever 22 is drawn or retracted by the solenoid 23 with its hole 22 receiving the operating pin 17 to swing the base portions of the shutter plates 13 and 13 &# 39 ;. as the result of these swinging movements of the base portions , the shutter plates 13 and 13 &# 39 ; are opened to pass the stack of coins accumulated thereon to the carrier bar 12 . the coin stack is then carried by the carrier bar 12 to be moved to a wrapping station ( not shown ). the shutter plates 13 and 13 &# 39 ; are kept open until the top face of the uppermost coin clears the level of the through - hole 11 , since the hole 11 is shielded by the descending coin stack until then . when the coin stack clears the level of the through - hole 11 , the solenoid 23 is deenergized and the operating lever 22 is returned back to the normal extended position , whereby the shutter plates 13 and 13 &# 39 ; are swinged back to the closed position . then , the reversible motor 25 is actuated to rotate the screw shaft 18 in the reverse direction to raise the shutter mechanism b to the uppermost position to be ready for the next cycle operation . although not specifically shown , the screw shaft 18 may be replaced by a rack which is meshed with a pinion rotated by a suitable motor mounted on the support member 14 . a further modified arrangement is shown in fig5 which comprises a swingable arm 26 having one end engaging with the support member 14 . the arm 26 is swinged by a roller 28 mounted on a rotatable cam plate 27 to lower or raise the support member 14 . the limit switches a and b are also operated by the cam plate 27 to be brought to the on or off position . there is provided means for controlling the swinging movement of the arm 26 thereby to lower the support member 14 from the uppermost position to the lowermost position at a substantially constant speed . such means include an electric circuit for controlling the rotating speed of the motor by changing the pulse number depending on the number of counted coins , and a servo or pulse ( step ) motor assembled in place of the reversible motor 25 . the control of the above mentioned movable shutter mechanism b will be now explained . as a first embodiment , the control system which is made by utilizing the outputs from the upper photoelectric sensor 10 &# 39 ; ( hereinafter referred to as an upper photo ) associated with the through - hole 10 will be first explained . this control system is based on the idea that if the counted coins are detected by the upper photo , it is clear that the counted coins are stacked at least up to the position where the upper photo is located or the height of the upper photo . in such a case , the shutter plates 13 and 13 &# 39 ; are lowered until the coins are not detected by the upper photo . fig6 diagrammatically shows the above - mentioned control in a block diagram . the upper and lower photos 10 &# 39 ; and 11 &# 39 ; are actuated by the coins a ; by these photos 10 &# 39 ; and 11 &# 39 ;, and the upper and lower limit switches a and b , the motor 25 and the solenoid 23 are electrically actuated ; and by the motor 25 and the solenoid 23 , the movable shutter mechanism b is mechanically actuated . in turn , by the movable shutter mechanism 6 , the coin a and the upper and lower limit switches a and b are mechanically actuated . fig7 is a flow - chart for explaining a sequence of operations of the above - mentioned control system and fig8 shows its embodied circuit . the circuit of fig8 will be explained with reference to the flow chart of fig7 . to a terminal 801 , the h level of a pulse signal is put in by a start operation ( which corresponds to start 701 of the flow chart of fig7 ; only numerals will be indicated hereinafter ) and the signal is put in a set terminal s of a flip - flop ff1 through an or gate or1 . furthermore , the flip - flop ff1 is provided for memorizing a condition that the shutter plates 13 and 13 &# 39 ; should be returned to their initial position . the h level signal is put out from the output terminal q of the flip - flop ff1 and is put in an and gate and1 . at another input terminals of the and gate and1 , a signal which is turned to the h level when the limit switch a is turned on is put in from a terminal 803 through an inverter inv1 , and in addition , a signal which is turned to the h level when the upper photo 10 &# 39 ; detects a certain coins a is put in from a terminal 804 through an inverter inv2 . for this , the output of the and gate and1 maintains the h level from the time when the flip - flop ff1 is set until the time when the limit switch a is turned on , and this signal of the h level output of the and gate and1 is given to the motor 25 as a reverse rotation signal through a buffer amplifier ba1 and a terminal 809 ( 702 , 703 of fig7 ) to raise the shutter plates 13 and 13 &# 39 ; of the movable shutter mechanism b to their initial position . in such a case , if there are coins a on the shutter plates 13 and 13 &# 39 ;, the shutter plates cannot be raised to their initial position . therefore , if any coin is detected by the upper photo 10 &# 39 ;, the output of the inverter inv2 is turned to the l level to make the output of and gate and1 to be at the l level , for safety . when the shutter plates 13 and 13 &# 39 ; are raised to the initial position , the limit switch is turned on and , therefore an h level signal is put in at a terminal 803 . this h level signal causes the output of the reverse rotation signal ( put out from the terminal 809 ) to be stopped and at the same time resets the flip - flop ff1 since the signal is put in at a reset terminal r of the flip - flop ff1 ( 703 , 704 of fig7 ). furthermore , the signal which is put in at the terminal 803 is also put in an and gate and2 at one terminal thereof and at the other terminal , a start hold signal is put in . this start hold signal is one which is maintained to be at an h level from the time when the start operation ( 701 of fig7 ) is made to the time when the operation is ended , for example , by a stop operation or an actuation of an automatic stop mechanism due to detection of nonpresence of coins ( 728 , 729 of fig7 ). the output of the and gate and2 is put in at a set terminal of a flip - flop ff2 , and the output from the output q of the flip - flop ff2 is fed as a coin transfer signal to a motor , not shown , for driving the conveyor belt 2 , through a buffer amplifier ba2 from a terminal 810 . consequently , as soon as the shutter plates 13 and 13 &# 39 ; return to their initial position , the flip - flop ff2 is caused to be set to start the transfer of the coins ( 705 of fig7 ). furthermore , at the reset terminal r of the flip - flop ff2 , a count end signal which is turned to the h level when the coins a reaches predetermined number ( or wrapping number ) is put in from a terminal 805 and the flip - flop ff2 is reset so as to stop the transfer of the coins a at the time of the count end . in a meanwhile , attendent on the transfer and accumulation of the coins , the coins a are detected by the upper photo 10 &# 39 ;. the detection signal of the upper photo 10 &# 39 ; is put in an and gate and3 through a fall edge delay circuit nd and an or gate or2 . at the other input terminal of the or gate or2 , the signal from the output terminal q of a flip - flop ff3 is put in the flip - flop ff3 puts out its h level signal when the count end signal put in from the terminal 805 is put in at the set terminal of the flip - flop ff3 and puts out its l level signal when a shutter plate closing signal , hereinafter described , is put in at the reset terminal r of the flip - flop ff3 . furthermore , at the other input terminal of the aforementioned and gate and3 , a signal which is turned to the h level when the limit switch b for detecting the shutter plates 13 and 13 &# 39 ; being lowered up to their open position is turned on , is put in through an inverter inv3 through from a terminal 806 . the output of the aforementioned and gate and3 is fed to the motor 25 as a forward rotation signal through a buffer amplifier ba3 from a terminal 811 . when the coin a is detected by the upper photo 10 &# 39 ;, an h level singal is put in at the fall edge delay circuit nd ( 706 of fig7 ). this h level signal is put in the and gate and3 through the or gate or2 . in a meanwhile , since the counting operation has been just started , the flip - flop ff3 is maintained to be reset and since the shutter plates 13 and 13 &# 39 ; is not in the open position , an l level signal is supplied to the terminal 806 . this l level signal is put in the and gate and3 as a h level signal through the inverter inv3 . for this , an h level signal is put out from the and gate and3 to issue the forward rotation signal from the terminal 811 ( 707 of fig7 ). while the coins a are successively transferred , counted and accumulated , the detection signals by the upper photo 10 &# 39 ; are intermittently put out at a very short interval . for this , if the forward rotation signals put out from the terminal 811 are intermittently put out at a very short interval , such intermittent output are not suitable for the motor 25 . in order to avoid these intermittent outputs , the fall edge delay circuit nd is provided for absorbing the intermittent condition and putting out a smoothed or continuous forward rotation signal as a whole . consequently , when the coins a are successively accumulated and detected by the upper photo 10 &# 39 ;, the motor 25 is caused to continue its forward rotation and if the coins a are intermittently detected beyond a predetermined interval , the motor 25 is caused to be stopped at each time of detection ( 708 , 709 , 710 of fig7 ). thus , mainly , the motor 25 is controlled by the detection signals of the upper photo 10 &# 39 ; until the shutter plates 13 and 13 &# 39 ; reach their open position to make the limit switch on and thereby putting the l level signal from the inverter inv3 in the and gate and3 . in other words , in case where the coins a are successively accumulated , before the shutter plates 13 and 13 &# 39 ; reach the open position , the count operation is ended . at the time , the h level of the count end signal is put in from the terminal 805 at the reset terminal r of the flip - flop ff2 and the set terminal s of the flip - flop ff3 . the resetting of the flip - flop ff2 causes the transfer of the coins a to be stopped ( 712 , 713 of fig7 ). on the other hand , the flip - flop ff3 is caused to be set . the flip - flop ff3 is provided for automatically lowering the shutter plates 13 and 13 &# 39 ; up to the open position , regardless of the condition of the detection signal of the upper photo 10 &# 39 ; in case where the count operation is ended before the shutter plates 13 and 13 &# 39 ; reach the open position . when the flip - flop ff3 is set , the h level signal is fed from its output terminal q to the and gate and3 through the or gate or2 to continue to put out the forward rotation signal until the limit switch b is turned on . on the other hand , in case where the coins a are intermittently accumulated , there is a possibility that the shutter plates 13 and 13 &# 39 ; reach the open position before the end of count . in such a case , the limit switch b is turned on and an h level signal is put in from the terminal 806 , inverted into a l level signal through the inverter inv3 and then put in the and gate and3 . consequently , thereafter the forward rotational signal is not put out from the terminal 811 ( 711 , 717 of fig7 ). in this state , the shutter plates 13 and 13 &# 39 ; are stand - by until the count end and at the time of the count end , the transfer of the coins a is stopped in a similar manner mentioned above ( 718 , 719 of fig7 ). in either case of the above , at the time when the coin count is ended , a signal for starting a wrapping operation is put out by a conventional control , not shown . then , the carrier bar 12 starts to be upwardly moved toward the shutter plates 13 and 13 &# 39 ; up to just below the same in order to receive the coins a accumulated in the tube 7 and transfer the same to a wrapping mechanism , not shown . when the carrier bar 12 is moved just below the shutter plate 13 and 13 &# 39 ; in open position , the shutter plates 13 and 13 &# 39 ; are opened to transfer the accumulated coins a onto the carrier bar 12 . more particularly , when the lower photo 11 &# 39 ; detects the carrier bar 12 and the transferred coins a to put out a detection signal , the detection signal is put in an and gate and4 from an terminal 807 . at the other terminals of the and gate and4 , the signal from the output terminal q of the flip - flop ff3 and the detection signal from the limit signal b are put in . then , the output signal of the and gate and4 is put out as a shutter plate open signal to the solenoid 23 through buffer amplifier ba4 from a terminal 812 and simultaneously put in a fall edge detection circuit ndf . this fall edge detection circuit ndf puts out an h level pulse signal by detecting the time when an input signal is fallen from h level to l level and the output signal is fed to the or gate 1 and the reset terminal r of the flip - flop ff3 as a shutter closing signal showing that the shutter plate open signal is not put out from the terminal 812 . under a condition that the count end signal is put out , that is , the h level signal is put out from the output terminal q of the flip - flop ff3 , and when the limit switch b is on , as the carrier bar 12 is detected by the lower photo 11 &# 39 ;, the h level signal is put out from the and gate and4 to be fed as the shutter plate open signal to the solenoid 23 from the terminal 812 ( 720 , 721 of fig7 ). thus , the accumulated coins a are dropped on the carrier bar 12 from the shutter plates 13 and 13 &# 39 ;. thereafter , when the carrier bar 12 is started to be lowered so as to transfer the coins a to the wrapping mechanism , not shown , the lower plate 11 &# 39 ; continues to detect the carrier bar 12 and the accumulated coins . when the carrier bar 12 is further lowered and then the accumulated coins a are not detected , since the h level signal is put in at the terminal 807 , the h level of the shutter plate open signal is not put out from the terminal 812 ( 722 , 723 of fig7 ). for this , due to deenergization of the solenoid 23 , the shutter plates 13 and 13 &# 39 ; are closed by an action of the spring . on the other hand , when the shutter plate open signal is not put out , the h level of pulse signal is put in the set terminal s of the flip - flop ff1 and the reset terminal r of the flip - flop ff3 from the fall edge detection circuit ndf . then , when the flip - flop ff1 is set , the shutter plates 13 and 13 &# 39 ; are actuated to be returned to the initial position ( 724 - 726 of fig7 ) in a similar manner to initial operations at the starting time ( 701 - 704 of fig7 ). furthermore , by the resetting of the flip - flop ff3 , the forward rotation signal is inhibited not to be put out to the motor 25 from the terminal 811 even when the shutter plates 13 and 13 &# 39 ; are moved from the open position . furthermore , when all operations for the coin a are ended , the h level of the start hold signal which has been supplied to the terminal 802 is reset ( 727 - 729 of fig7 ). moreover , in case where a step motion or a pulse motor may be used as the motor 25 in order to perform a reliable position control of the shutter plates 13 and 13 &# 39 ;, the outputs of the and gates and1 and and3 may be put in and gate and5 and and6 , respectively , and at the other input terminals of the and gates and5 and and6 , the pulse signal may be put in from the terminal 808 , as shown in dotted lines of fig8 . each output of two and gates and5 and and6 may be fed to the motor as the reverse rotation signal or the forward rotation signal through each buffer amplifier ba5 , ba6 from each terminal 813 , 814 . as a second embodiment , the control system which utilizes the outputs of the counter elements 4 provided for counting the number of the coins a will be explained . this control system is based on the idea that from the counted number of the coins a counted by the counting elements 4 , the accumulated height of the coins a accumulated in the tube can be calculated since a specific kind of the coins to be counted is preset and , therefore , the thickness of the one coin can be found . in the case , the shutter plates 13 and 13 &# 39 ; are lowered in accordance with the accumulated height of the coins a corresponding to the number of the accumulated coins a . fig9 diagrammatically shows the above - mentioned control in a block diagram . the coin kind signal which is issued from a coin kind setting switch 901 associated with coin kind setting means , such as a dial or a button switch , not shown for selecting a specific kind of coins to be counted , is put in a pulse member setting circuit 902 . the pulse number setting circuit 902 determines a pulse number per one number of coin corresponding to the selected kind of the coins and feeds a pulse number signal to a pulse generator 902 . the pulse generator 903 feeds pulses per one number of coin to the step motor 25 through a driver d each time when it receives a count pulse from count elements 4 . then , the movable shutter mechanism b is driven by the step motor 25 . consequently , the shutter plates 13 and 13 &# 39 ; are caused to be lowered by the height corresponding to the number of the accumulated coins a . furthermore , the pulse generator 903 is operated by the limit switches a and b which are actuated by the movable shutter mechanism b , and the lower photo 11 &# 39 ; for detecting the transfer of the accumulated coins a by the carrier bar 12 so as to move the shutter plates 13 and 13 &# 39 ; to the initial position or the open position . fig1 is a flow - chart from explaining a sequence of operations of the above control system and fig1 shows its embodied circuit . since the main portions of the circuit elements shown in fig1 are similar to these of fig8 the different points will be explained mainly . relationship among the coin kind setting switch 901 , the pulse number setting circuit 902 and the pulse generator 903 is mentioned above , and in the illustrated embodiment , there are six kinds of coins and four kinds of coin thickness ( the pulse numbers n 1 , n 2 , n 3 , n 4 ). the pulse generator 903 receives four pulse number signals representative of the coin thicknesses at its terminals n 1 , n 2 , n 3 and n 4 . the pulse generator 903 also receives the reverse rotation signal put out from the and gate and1 at its terminal r , receives a coin signal put out from the and gate and3 at its terminal f , and receives the forward rotation signal put out from the and gate and4 . in addition , the pulse generator 903 further receives a drive signal put out from the or gate or2 when either one of these reverse rotation signal , coin signal and forward rotation signal are put in the or gate or2 . in accordance with combination of the above - mentioned input signals , the pulse generator 903 feeds a reverse rotation drive signal from its terminal rd or a forward rotation drive signal from its terminal fd , respectively , through the driver d from a terminal 1111 or 1112 . the reverse rotation signal put out from the and gate and1 is put out in a similar manner to that of the first embodiment , and similarly the coin transfer signal put out from a terminal 1109 and the shutter plate open signal put out from a terminal 1110 are also constructed in a similar manner to those of the first embodiment . that is , the pulse signal by the start operation , the start hold signal , the signal by on operation of the limit switch a , the detection signal of the upper photo 10 &# 39 ;, the count end signal , the signal by on operation of the limit switches 13 , and the detection signal of the lower photo 11 &# 39 ; are put in at terminals 1101 , 1102 , 1103 , 1104 , 1106 , 1107 and 1108 , respectively . from each terminals , these signals are put in a group of gates constructed in a similar manner to those of the first embodiments . therefore , detailed explanations on functions of the gates will be omitted . in case where the lowering of the shutter plates 13 and 13 &# 39 ; is controlled by the number of the coins a , the count is always ended before the shutter plates 13 and 13 &# 39 ; reach the open position . therefore it is necessary to drive the step motor 25 until the shutter plates 13 and 13 &# 39 ; reaches the open position . then , the drive by the count elements and the drive after the count end must be controlled , which will be explained . at the terminal 1105 , the coin count signal from the count elements 4 is put in , and this signal is fed to the and gate and3 at one terminal thereof through the delay circuit td . furthermore , the delay circuit td is provided in view of the transfer period of the coins from count element position to accumulator tube position . at the other terminal of the and gate and3 , the signal by on operation of the limit switch b which is put in from the terminal 1107 is put in through the inverter inv3 and while the coin count signal is put in the and gate and3 , the limit switch b is usually not actuated . therefore , as mentioned above , each coin signal per each coin is put in at the terminal f of the pulse generator 903 from the and gate and3 and the drive signal is put in at the terminal d of the pulse generator 903 through the or gate or2 so as to issue a predetermined pulse number ( either one of n 1 , n 2 , n 3 and n 4 ) of the forward rotation drive signal per each coin from the terminal fd ( 1008 - 1011 of fig1 ). the output terminal q of the flip - flop ff3 which memorizes the count end condition by receiving the count end signal from the terminal 1106 is connected to one input terminal of the and gate and4 , and at the other input terminal , the signal by on operation of the limit switch b is put in through the inverter inv3 from the terminal 806 . consequently , when a predetermined number of the coins a , the flip - flop ff3 is set and , thereby the forward rotation signal for moving the shutter plates 13 and 13 &# 39 ; to the open position is put in at the terminal ff of the pulse generator 903 from the and gate and4 . the pulse generator 903 continues to put out the forward rotation drive signal from the terminal fd until the forward rotation signal put in from the terminal ff disappears . thus , the step motor 25 is actuated to move the shutter plates 13 and 13 &# 39 ; to the open position ( 1011 - 1016 of fig1 ). the second embodiment can allow the fall distance of each coin in the accumulator tube to be maintained to be a minimum , comparing with the first embodiment . | 8 |
the preferred embodiment of the method for measuring the lifetime of a semiconductor material and the apparatus therefor according to the present invention will be explained with reference to the drawings . according to the apparatus of the present invention , as shown in fig7 a , a quartz glass plate 24 is placed on a metal table 25 , and a semiconductor material 10 to be measured is placed on the quartz glass plate 24 . a more detailed view is shown in fig7 b . in the operation of the measurement apparatus shown in fig7 a and 7b , a portion of the microwave energy irradiated from a waveguide 8 ( for outputting and receiving microwave energy ) reflects on the semiconductor material 10 and another portion of the microwave energy passes through the semiconductor material 10 . a portion of the microwave energy which has passed through the semiconductor material 10 reflects on the quartz glass plate 24 and another portion of this microwave energy passes through the quartz glass plate 24 and reaches the surface of the metal table 25 . it is understood that the reflected microwave energy received by the waveguide 8 is mainly that which has reflected from the semiconductor material 10 and the metal table 25 . the phasic relation between these two reflected microwave energy is determined by the distance between the semiconductor material 10 and the metal table 25 . accordingly , it is possible to determine this distance using the effect of the portion of the microwave energy reflected from the metal table 25 to the portion of the microwave energy reflected from the semiconductor material 10 by continuously checking the phasic relation . when the thickness of the semiconductor material 10 to be measured is previously determined , the distance between the semiconductor material 10 and the metal table 25 is controlled by adjusting the thickness ( for example , 2 to 3 mm ) of the quartz glass plate 24 . accordingly , it is possible to maximize the intensity of the effective reflective microwave energy . further , when the thickness of the semiconductor material 10 varies a little ( for example , it is shown by p or q ), the position of the waveguide 8 for outputting and receiving the microwave is finely adjusted to instantly obtain the maximum reflective microwave energy as shown in fig8 . according to the preferred embodiment of the measurement method of the present invention , the metal plate 23 shown in fig3 c is used and a quartz glass plate having a fixed - thickness is introduced . the quartz glass plate is employed in the preferred embodiment as anon - metal material of the measurement table 21 in fig3 c . however , it is apparent that any non - metal material other than quartz glass may be used in the method of the present invention . it is noted that the method for measuring the lifetime of the semiconductor material according to the present invention enables an increased output precision by more than several fold in comparison to the conventional measurement method and a constant generation of highly reliable lifetime signals having no - strain through the reflective microwave energy . when the semiconductor material to be measured by the present invention is the widely employed cz - silicon , the signals containing the lifetime information can be treated without applying any amplifying steps , can enjoy a wide range of measurable proportional resistivities and can result in a significantly improved s / n ratio . in addition , notwithstanding the relatively easy and simple treatment of the output signals , it is possible to obtain an improved reliability , economy and maintenance . in fig9 the microwave energy oscillated by a microwave oscillator 1 is directed to a waveguide 8 via a magic tee 4 and irradiated onto a semiconductor material ( not shown ) which is an object of the measurement . the microwave energy is reflected by the semiconductor material to return to the waveguide 8 , passed through the magic tee 4 and detected by a detector 7 . the waveguide 8 is provided with a stub tuner 12 . the stub tuner 12 has a structure which is shown in the enlarged view of fig1 wherein the distance d between three screws 13 1 , 13 2 and 13 3 is determined by the frequency of the microwave energy to be used . the distribution circuit of the waveguide 8 may be made variable by providing the stub tuner 12 on the waveguide 8 and by adjusting the lengths l 1 , l 2 and l 3 inserted within the waveguide 8 . the above arrangement can also transform the characteristic curve of the reflected microwave signals from the curve a denoting the arrangement without the stub tuner ( to position where measurement is impossible being at z 01 ) to the curve b as shown in fig1 . the point where a measurement is impossible may be avoided for almost all materials by setting the resistivity , for example , at 100 ฯm in the case of a si - wafer . accordingly , the reflected microwave signals are outputted as an ideal waveform as shown in fig5 a . the curve b in fig1 is improved to assume a relatively linear form relative to the non - linear characteristics in the region extending toward a point z 02 , and the amplitude variation or distortion of the reflected microwave can also be restricted . although a stub tuner is used as the means to make the equivalent distribution circuit of the waveguide variable in the above embodiment , such means is in no way limited to the above and various modifications are possible , without departing from the scope of the appended claims . as described in the foregoing , the method and apparatus for measuring the lifetime of the semiconductor material according to the present invention is highly effective since it can measure all the semiconductor materials to obtain accurate reflected microwave signals , it can significantly enhance the overall measurement reliability as well as data reproducibility and it can realize a flexible measurement arrangement . as shown in fig1 , a heat - resisting or refractory member 35 is placed on an x - y stage 36 and a heater 37 is buried in the upper portion of the refractory member 34 . on the refractory member 34 , a non - metal refractory plate 33 is placed . the semiconductor material 10 to be measured is placed on the system consisting of the non - metal refractory plate 33 and the refractory member 34 and the x - y stage 36 . in operation , microwave energy irradiates through a waveguide 8 ( for outputting and receiving the microwave energy ) which is placed above the semiconductor material 10 and excitation rays of wavelengths ฮป 1 and ฮป 2 are outputted from the laser diodes 9 1 and 9 2 . the semiconductor material 10 which is polluted by metal taints is gradually heated by the heater 37 embedded in the refractory member 34 then a lifetime of the semiconductor 10 is measured using the reflective microwave energy passing therethrough . the measurement results as shown in fig1 a depict large changes in the lifetime of the semiconductor material at a certain temperature . this phenomenon is generated because the energy levels of very small metal taints contained in the silicon material approach those of electrical conductors when the silicon is heated and the excited electrons are apt to disappear . fig1 b shows an example of the lifetime changes of measurement data in which graphed on the abscissas is the inverse temperature 1 / temperature ( 1 / t ) and on the ordinates is lifetime ฯ . measurement data was obtained on a sample a of a semiconductor material having metal diffused and a second sample b having no metal . the lifetime of the second sample b is lengthened when the temperature of the semiconductor material 10 exceeds a certain level . however , the lifetime of the first sample a doesn &# 39 ; t extend as much , generating a large difference between the lifetimes of the two samples . the above result has a correlation with the peak in the measurement data obtained the dlts method as shown in fig1 c . by previously determining on an experimental basis a relation between the temperature 1 / ta shown in fig1 b and the temperature tb shown in fig1 c , according to the non - contact and non - destructive method for measuring the lifetime of the semiconductor material 10 of the present invention , it is possible to judge an existence of very small metal taints and to determine the type of such a metal . it is possible to presume that almost all of the pollutants in the semiconductor material concentrates in the surface of the semiconductor chip , so that heating the semiconductor chip and measuring its lifetime results in a lifetime of the much polluted surface of the semiconductor material and another lifetime of the little polluted interior of the semiconductor chip , and thus a separative analysis of the surface and bulk lifetimes is possible at a high s / n ratio . while the preferred embodiments employs a heater as the heating means as herein disclosed , it is to be understood that other forms of heating might be adopted . by measuring the lifetime of the semiconductor material after it is warmed according to the present invention , it is possible to determine the existence of fine heavy metal taints which are identified conventionally only by destructive type methods , and to separately evaluate the surface recombination velocity ( surface lifetime ), thus obtaining an advantageous lifetime measurement system . it should be understood that many modifications and adaptations of the invention will become apparent to those skilled in the art and that the invention is intended to encompass such obvious modifications and changes in the scope of the claims appended hereto . | 6 |
the present invention describes a method of carrier frequency synchronization supported by special synchronization signals , which avoids the above - described disadvantages and is distinguished by its particular simplicity . the synchronization signals used can be respectively interpreted as a group of 2l + 1 ( l = 1 , 2 , 3 , . . . ) sinusoidal tones whose frequency f 1 is a function of ## equ1 ## relative to a medium frequency f 0 ( hereinafter also called carrier frequency ). here w is the bandwidth of the channel available for carrier frequency synchronization . because such sinusoidal tone groups are broadband signals , they are not as strongly affected by the fading as an individual sinusoidal tone . different base stations generate the sinusoidal tones at identical frequencies but different phases , that is , if ฯ il is the phase of the lth sinusoidal tone of the ith base station , the following usually applies : if , therefore , the respective lth sinusoidal tones of the base stations i and j eliminate one another because ฯ il =- ฯ jl , then ฯ ik =- ฯ jk typically does not apply , i . e ., the respective kth sinusoidal tones do not cancel one another out . moreover , a device ( matched filter ) with which carrier frequency synchronization can be performed efficiently is described further below , in section &# 34 ; 2 . algorithm for carrier frequency estimation .&# 34 ; we assert that the arrangement ( in a base station ) illustrated in fig1 generates a group of 2l + 1 sinusoidal tones at the frequencies ## equ2 ## where f 0 is the carrier frequency and the lth sinusoidal tone has the power of ## equ3 ## here p is the total power of the signal . the m generator generates a maximum - periodic series of the period length ( number of cycles ) 2l + 1 , where must apply as the boundary condition . series of this type can be generated by feedback m - digit shift registers , in which instance the feedback can be represented by a primitive polynomial of gf ( 2 m ) ( gf means galois field -- see 3 !). the maximum - periodic series here is defined such that its elements can only assume the values + 1 and - 1 . ( alternatively , it could also be defined such that the elements assume the values 0 and 1 .) the maximum - periodic series is supplied to a so - called pulse modulator that generates a pulse function having the weight s ( k ) at a time t = k / w . the following therefore applies with the dirac &# 39 ; s function ฮด : ## equ4 ## this pulse function series is now supplied to a low - pass with the dirac pulse response h s ( t ) or transmission function ## equ5 ## the output signal of this low - pass , then , is ## equ6 ## ideally , the low - pass should have the same amplification factor at the frequencies ## equ7 ## moreover , a linear phase is desired , that is , the phase shift ฯ l dictated by the filter at the frequency f 1 is a linear function in f l where c is a constant . the third condition on the transmission function of the filter is the filtered signal is modulated to a carrier having the frequency f 0 , and the transmission signal is now a sinusoidal tone group having the frequencies ## equ8 ## in a mobile radio network , the individual base stations can generate the synchronization signals according to the same method , but each station uses a different feedback polynomial to generate the maximum - periodic series . the number of possible feedback polynomials is e ( 2 m - 1 )/ m . where m is the number of shift register cells and e is the so - called eulerian function 4 ! : if z is a natural number , e ( z ) is the number of natural numbers x , with 1 โฆ x & lt ; z , which are relatively prime to z . the limitedness of the number of possible feedback polynomials does not imply a limitedness of the total number of base stations . base stations located far enough apart can readily use the same feedback polynomial . the above - described method of generating a sinusoidal tone group is not totally optimal . ideally , all of the sinusoidal tones should have the same power , which is not quite the case here ( for large l , however , the deviations are negligible ). furthermore , the limited number of different feedback polynomials means a limitation in the signal design . the advantages of this method lie in the simplicity of the generation of synchronization signals ( with the aid of a maximum - periodic series -- the sinusoidal tones of the group must not be generated individually ) and the fact that the discrete - time signals s ( k ) in the base band have a constant amplitude . consequently , the transmission signals ( radiated synchronization signals ) also have a virtually constant amplitude , which is desirable for numerous applications . fig2 shows an arrangement that serves to determine the carrier frequency of the synchronization signal . in the mobile station , the reception signal r b ( t ) is converted into the base band with a variable quadrature demodulator . at the beginning of the synchronization process , f e is the oscillator frequency . this frequency is varied continuously during the synchronization process ; v is the detuning normalized to the signal bandwidth w . the two quadrature components are respectively supplied to a low - pass , which is expected to meet the same requirements as the transmitter low - pass . it is assumed that the transmission signal s b ( t ) is linearly distorted during transmission , and is additionally disturbed by white gaussian noise n b ( t ). the reception signal is therefore the linear distortions are therefore described as a folding of the transmission signal with the dirac pulse response h c ( t ) of the channel . the output signals of the low - passes are respectively scanned at the rate w ; the scanning values are processed in a digital matched filter . the dirac pulse response of this matched filter comprises n scanning values of any maximum - periodic series of the period length 2l + 1 , i . e ., if s ( k ) is a maximum - periodic series of period length 2l + 1 , then it must be taken into consideration that h ( k ) can be derived from any maximum - periodic series ; it need not be the one used in the transmitter . the only condition is that the transmitter and receiver use a maximum - periodic series of the same period . in a mobile radio application , however , this means that the receiver of the mobile station automatically evaluates the synchronization signals of all receivable base stations . because the dirac pulse response coefficients of the channel that have been derived from the maximum - periodic series only assume the values of + 1 and - 1 , the digital matched filter can be configured without a multiplier . from 2l + 1 sequential output values of the matched filter , the detector squares the amounts and adds them . a maximum results with detuning or at one of the frequencies f 0 set by the quadrature demodulator . this frequency is a nearly optimum maximum likelihood estimation value for the actual carrier frequency . it is noted here that the arrangement shown in fig2 can be used not only when the synchronization signals are generated according to the arrangement shown in fig1 but whenever the synchronization signal is a group of sinusoidal tones having the frequencies ## equ9 ## where the number of sinusoidal tones must fulfill the condition following is a detailed description of the invention and a demonstration of its functionality . 1 . generation of a sinusoidal tone group with the aid of maximal - periodic series a periodic series { s ( k )} is given . the period length is 2l + 1 , that is , s ( k + 2l + 1 )= s ( k ). the interval between two scanning values is 1 / w . the spectrum of this series therefore exclusively comprises lines at the frequencies ## equ10 ## having the amplitudes ## equ11 ## the power of the lth spectral line is therefore ## equ12 ## if a maximum - periodic series is selected for { s ( k )}, then 4 ! is therefore , if { s ( k )} is a maximum - periodic series and 2l + 1 is the period length , then these series has 2l spectral lines of identical power . only the power of the line at f = 0 is smaller by the factor 2l + 2 . the functionality of the arrangement shown in fig2 is demonstrated in this paragraph . first , the optimum ml estimation algorithm is derived , which is essentially based on the ideas of rife and boorstyn 5 !, 6 !. it will be shown subsequently how this algorithm can be structured particularly favorably as a matched filter . first , f c is the reception frequency set by the oscillator of the quadrature demodulator . the digital matched filter then sees a signal scanning series of the form ## equ14 ## here ฮดf is the difference between the oscillators in the receivers and transmitters , which has been normalized to the signal bandwidth w , ## equ15 ## and a ( 1 ) is the ( complex ) amplitude of the lth sinusoidal tone . it must be considered here that this amplitude is not only a function of signal generation , but also of the dirac pulse response of the channel and the time delay of the signal , and is therefore unknown to the receiver . gaussian - distributed white noise is symbolized by n ( k ). a maximum - likelihood ( ml ) formulation can be used as a synchronization formulation for simultaneously estimating ฮดf and all a ( 1 ). if v is the ml estimation value for ฮดf and ฮฑ ( 1 ) is the ml estimation value for a ( 1 ), according to the ml rule , ## equ16 ## is minimal for ฮฑ ( 1 )= ฮฑ ( 1 ) and v = v , or ## equ17 ## is maximal for the same choice . it was assumed here that a total of n scanning values of the received signals r ( k ) were evaluated . the second term is ## equ18 ## if it is assumed that n is a whole multiple of 2l + 1 , then ## equ19 ## it follows that ## equ20 ## therefore , from ( 1 ), ## equ21 ## with the use of the abbreviation ## equ22 ## ( ฮป ( f ) is the fourier - transformed scanned input signal at the point f ), and ( 2 ) can be written as ## equ23 ## with a simple variation calculation , it can now be shown that the relationship ## equ24 ## applies for the maximum points of this expression . if this relationship is used in ( 3 ), it can be seen that the maximum of the expression ( 3 ) can be written thus : ## equ25 ## in this case , generally here ฯ
v ( f ) can be generated , for example , by detuning the carrier oscillator by - vw . the ml algorithm derived for determining a suitable estimation value v for the carrier frequency offset ฮดf can be realized by the arrangement illustrated in fig3 . up to the post - scanning components , the arrangement corresponds to the arrangement shown in fig2 . the oscillator of the quadrature demodulator is detuned by - vw ; the scanned received signal is then ฯ
v ( k ). from this , the ml tester then calculates the value ## equ26 ## the detuning for which the highest value results corresponds to the optimum estimation value for the carrier frequency error , i . e ., during this detuning the receiving oscillator is optimally synchronized to the carrier frequency in the sense of the ml rule . to bring to a close the demonstration of the functionality of the arrangement shown in fig2 it only remains to be shown that the relatively complicated block ml test can be replaced by the matched filter described in section 2 . the values ## equ27 ## can be generated by supplying r v ( k ) to a bank of 2l + 1 filters with the dirac pulse responses ## equ28 ## and taking the output value at the time k = 0 . if g 1 ( n ) is the output signal of the lth filter at time n , then ## equ29 ## the ml tester therefore calculates ## equ30 ## that is , it squares the output values of the 2l + 1 filters at time 0 and adds them . if n is large compared to 2l + 1 , then the following applies with good precision for n = 0 , . . . , 2l ## equ31 ## this conversion allows the use of a simple filter having the dirac pulse response of ## equ32 ## instead of the above filter bank . points of interest here are not only the filter output value at time k = 0 , but also 2l + 1 sequential filter output values . these values are squared and added . because the phases of the individual partial oscillations are insignificant , only one filter is required whose transmission function comprises 2l + 1 same - magnitude lines at the points f = 1w /( 2l + 1 ), 1 =- l , . . . ,+ l . the dirac pulse response of this type of filter can be realized with good approximation in that n scanning values of a maximum - periodic series of period length 2l + 1 are taken . as shown in the last section , a filter having such a dirac pulse response has the desired transmission function , except at the point f = 0 . 1 ! cept / cch / gsm recommendation 05 . 02 : multiplexing and multiple access on the radio path , 1988 . 5 ! d . c . rife , r . r . boorstyn , &# 34 ; single - tone parameter estimation from discrete - time observations ,&# 34 ; ieee transactions on information theory , vol . it - 20 , pp . 591 - 598 , 1974 . 6 ! d . c . rife , r . r . boorstyn , &# 34 ; multiple tone parameter estimation from discrete - time observations ,&# 34 ; bell system technical journal , vol . 55 , pp . 1389 - 1410 , nov . 1976 . john wiley & amp ; sons , 1982 . | 7 |
the invention offers advantages in the field of open coil resistance heaters in that the problems in noise generation and premature failure of heater components are minimized . in addition , the inventive open coil electrical resistance heater is advantageous in reducing the amount of shadowing that occurs in prior art heaters and promoting a longer life operation of the heater . the invention is particularly adapted for heaters that employ resistance wire coils that are aligned with the flow of air through the heater . it is these coils that are susceptible to the problem of shadowing and the offsetting of the insulators to create the sinusoidal shape in the coil minimizes this problem . the offsetting that creates the sinusoidal coil configuration also contributes to filling the volume of the heater that air passes through for better heating efficiency . 1 ) an open coil electric heater for heating moving air with the heating element made up of sections of coils such that one end of a given coil section is located on the inlet air portion and the other end is at the exit air portion . 2 ) insulators engage sufficient numbers of convolutions at points along each coil section supporting the coil thereby holding the heater coils section in place as each insulator is retained by a metal plate . 3 ) the insulators are retained in the metal plate by cutouts in the metal plate engaging slots and possibly arms in the insulators . 4 ) each cutout in the metal plate is designed so as to engage the corresponding slots and possibly arms in the insulators retained yet allow for expansion and contraction resulting from the heating and cooling of the heater . 5 ) the insulators supporting a given coil section are arranged so as to create a sinuous path for the coil section . the sinuous coil path thereby creates sufficient tension so as to dampen vibration of the insulators against the metal plate . 6 ) the sinuous coil passes effectively expose a greater portion of each coil pass to the moving air stream for greater transfer of heat to the moving air stream being heated . 7 ) the sinuous coil passes effectively reduce the โ shadowing โ relative to a straight coil section arranged parallel to the air flow direction . referring now to fig3 - 7 , one embodiment of a partial assembly of open coil electrical resistance heater is illustrated . the embodiment depicts components of a heater assembly critical to the invention , but omits those components that are well known , e . g ., terminals and terminal blocks , means for fastening the plate to the duct , the necessary lead wiring to connect lead ends of the resistance wire coils to a source of power for energizing the heater , etc . fig4 depicts a plate 40 , with surface 40 a , which is especially configured to orient the insulators and a resistance wire coil in the inventive configuration . the plate 40 includes a number of cutouts 41 and 42 . the cutouts 41 are shown on path x with the cutouts 42 aligned with path y . the cutouts 42 on path y are offset from the cutouts 41 on path x to provide improved performance in terms of noise reduction , reducing the shadowing effect , and other advantages as explained in more detail below . the plate 40 also includes tabs 43 and 45 , which interface with a duct for attachment thereto . the other features of the plate are conventional and do not require further explanation for understanding of the invention . referring now to fig4 - 7 , the plate 40 and its other side 40 b , is shown in combination with resistance wire formed schematically into coils 47 and insulators 49 . the insulators 49 are configured with tabs 51 , formed to create spaces 53 to receive segments 55 of the resistance wire forming the coil 47 to hold the coil in place . the insulators also have slots 57 sized to receive a portion of the plate and arms 59 intended to abut a plate surface when the insulators are mounted in the cutouts . the cutouts as well as the slots and arms should be configured so that the insulator is held in place while allowing the metal plate to expand and contract as a result of the heater operation . fig4 best shows one effect of the offset created by the cutouts 41 and 42 and insulators 49 mounted therein when the configured coils 47 are aligned with a path of the air passing through the heater . by offsetting the cutouts 41 and 42 , the coils 47 takes on a sinusoidal shape at least along a portion of their length . in this embodiment , only a portion of the cutouts are offset from each other , with the cutout 41 a at the end of the plate 40 where the wire crossover 54 occurs , lying on the same path x . in this embodiment , the cutout 41 a is not offset from its adjacent cutout so that the coils are centralized for the crossover . the invention is ideally adapted for a heater that has the path of air aligned with the longitudinal orientation of the coils 47 . this path of air is shown in fig4 as path q . by offsetting the cutouts and mounted insulators such that the coils 47 follows a sinusoidal or at least partially sinusoidal path overcomes three of the prior art problems noted above . first , by arranging the insulators 49 of a given coil section in an offset fashion , tension forces resulting from the coil seats each insulator against a side of the cutout , see side 44 in fig3 as an example . this has the effect of dampening the vibration of the insulator against the metal plate 40 , thus reducing the vibration or โ rattling โ of the heater coil support insulator 49 against the plate 40 thereby reducing noise , which is desirable . second , by arranging the insulators 49 supporting a given coil section in an offset fashion , the resultant sinuous pattern of the heating coil reduces the tendency for vibration resonance to occur as compared to a straight coil pattern . third , by arranging certain of the insulators of a given coil in an offset fashion , shadowing of downstream heater coil convolutions in any given straight section by upstream heater coil convolutions from that same given straight coil section is reduced . shadowing results when air heated by an upstream helix flows over and heats down stream helixes . by reducing shadowing , the operating temperature of the heater coil is reduced which is desirable . this is best seen in fig4 and 6 . here , the coil 47 is identified by coil segments 47 a and 47 b that make up part of the sinusoidal shape . by offsetting the support of the coil using the cutout 42 and insulator 49 , the coil segment 47 b is exposed . this exposure means that the air entering the heater along path q contacts the coil 47 . the air strikes not only the initial coil segment 47 a but also the coil segment 47 b , created by the offset insulator 49 . since the coil segment 47 b is exposed to the air traveling on path q , coil segment 47 b is not subjected to the increased heating that would occur if the coil 47 had a straight alignment and the portion of the coil downstream of initial coil segment 47 a is contacted by hot air already heated by coil segment 47 a . fig6 also shows the plate 40 in combination with a circular duct 61 . the circular duct is one option , but other duct cross sectional configurations could be employed , oval , rectangular , square , and the like . fourth , by arranging the insulators of a given coil section in an offset fashion , each subsection of the given heater coil will be angled relative to the axis of airflow through the duct and arranged so as much of the duct cross section as possible is filled or covered by heating element material to maximize heat transfer to the air stream . the cutouts 41 and 42 are exemplary of ways in which the insulators can be mounted to the plate 40 . other modes of mounting could be employed if so desired . the important aspect is that a certain number of the insulators that support the resistance wire are offset from other insulators to create the sinusoidal shape of the coil and the advantages discussed above , e . g ., noise reduction and minimizing shadowing . also , while a plate is employed to support the insulators , other types of supports could also be used . for example , a wire frame could be employed , with clips that hold the insulators as are found in some open coil electrical resistance heater configurations . also , differently - configured insulators could also be employed with the support and resistance wire coil . the degree of offset of certain of the insulators can also vary . the degree of offset can be gauged by the distance between the two paths x and y of fig4 . the greater the distance between x and y , the greater the offset and the higher the amplitude of the sinusoidal shape of the coil . using an offset distance that is too small approximates the straight line coils of the prior art and the advantages of the invention discussed above are lost . the offset distance can be measured in terms of the resistance wire coil diameter since a smaller resistance wire coil will allow more offset than a larger resistance wire coil , all other things being equal . thus , a minimum offset guideline can be ยฝ to 2 times the diameter of the resistance wire coil . also , while the offset of the cutouts 42 is shown to be the same along the paths x and y , the offset could vary along the path . thus , one cutout could be offset more than another cutout so that the sinusoidal shape of the resistance wire coil would not be uniform along the length of the coil . while fig3 - 7 depict a heater that employs three coils 47 for heating purposes , wherein the cutouts 41 and 42 defining a path for the resistance wire coil 47 are shown in three sets , a single coil could be employed on just one side the plate 40 so that it would start and end on opposite ends of the plate , and only one set of cutouts would be needed . alternatively , a single coil could be employed that would start on one end of the plate 40 , crossover at the other end and terminate at the starting point end . in this latter case , the insulator would be configured to hold the resistance wire coil above and below the plate . if the resistance wire coil is positioned on only one side of the plate , the insulators 49 could be configured to support such one segment of the coil rather than two as shown in fig5 . as such , an invention has been disclosed in terms of preferred embodiments thereof which fulfills each and every one of the objects of the present invention as set forth above and provides a new and improved open coil resistance heater with a specially configured coil and a method of heating using the specially configured coil . of course , various changes , modifications and alterations from the teachings of the present invention may be contemplated by those skilled in the art without departing from the intended spirit and scope thereof . it is intended that the present invention only be limited by the terms of the appended claims . | 7 |
a typical bridge crane , as shown in fig1 includes a runway 4 formed by a pair of overhead parallel rails , a transverse bridge 6 spanning the rails of the runway 4 and movable along the runway by a conventional bridge trolley mechanism , and a hoist trolley 8 either suspended from or supported on a linear track running the length of the bridge 6 . the hoist trolley 8 carries a trolley motor for moving the hoist along the bridge 6 and hoisting apparatus including suitable tackle powered by a reversible hoist motor for raising and lowering the hoisting hook . in the circuit of fig2 power is supplied to operate a hoist motor or the like by means of a stationary control circuit 10 via a stationary bus bar or trolley wire 12 to a movable control circuit 14 which would be mounted on the hoist trolley 8 . thus the bus bar 12 symbolically represents both runway and bridge electrification . the bus bar on the bridge 6 would be connected via another collector to the corresponding bus bar along the runway 4 . in the embodiment described herein , the control circuit 10 is stationary in the true sense , for example , as a panel mounted on a wall of a building . however , in crane installations where an operator cab on the bridge 6 is necessary , the control circuit 10 would be located in the cab , and &# 34 ; stationary &# 34 ; in that situation would mean stationary relative to the bridge . bus bar control would still be used in that case for the hoist motor and the control circuitry would be substantially as described herein . the stationary circuit 10 employs a dc power supply with the output arranged like four 12 volt batteries connected in series with the center connection grounded . the power supply thus provides positive terminals 16 and 18 at 24 and 12 volts respectively , negative terminals 20 and 22 at 12 volts and 24 volts respectively and a common ground terminals 24 . the positive terminals , 16 and 18 are used in connection with two - speed operation of the hoist motor while raising the hook . likewise , the negative terminals 20 and 22 are used for lowering the hook at two different speeds . raising and lowering the hoisting hook is directly analogous to running the hoist trolley 8 back and forth on the bridge 6 or the bridge 6 back and forth along the runway 4 . thus the description of this embodiment as a control circuit for the hoist motor is merely illustrative of the type of control functions accomplished by this circuit . the positive high voltage terminal 16 is connected via push - button switch contacts 26 to a series diode d1 connected to be forward - biased by positive voltage from the terminal 16 . the positive low voltage terminal 18 is similarly connected via a pair of push - button contacts 28 to a similarly oriented series diode d2 . diodes d1 and d2 are connected in common via push - button safety switch contacts 30 to a feeder line 32 connected directly to the bus bar 12 . on the negative side , the low and high negative voltage terminals 20 and 22 are connected respectively via push - button switch contacts 34 and 36 to respective diodes d3 and d4 connected in the opposite fashion from the diodes d1 and d2 so as to be forward - biased by reverse current flowing to the negative voltage terminals 20 and 22 . the diodes d3 and d4 are connected in common via push - button safety switch contacts 38 to the line 32 and bus bar 12 . the six pairs of push - button switch contacts described above are operated by a pair of ganged push - button switches 40 and 42 . the ganged switch 40 is a conventional break - before - make push - button switch having two discrete operative levels of depression . depression of switch 40 to the first level causes normally closed safety switch contacts 38 on the negative side to be opened and contacts 28 for low positive voltage to be closed for raising the hoist at low speed ( up low ) without closing the contacts 26 for the high speed raising operation at high voltage . further depression of the push - button switch 40 to the second level first breaks the connection between contacts 28 ( up low ) and then closes contacts 26 ( up high ). the normally closed contacts 38 remain open at both levels of depression of the push - button switch 40 . the ganged push - button switch 42 operates in the same manner for two - speed lowering . the normally closed safety contacts 30 and 38 insure against the effects of accidental actuation of both switches 40 and 42 at the same time . the diodes d1 and d4 insure complete isolation of the positive and negative high and low voltage terminals . the movable control circuit 14 is powered via a collector , shoe or pantograph 44 which slides along the bus bar as the hoist trolley moves along the bridge or as the bridge moves along the runway . the collector 44 is connected directly to three parallel branch circuits 46 , 48 and 50 . the left - hand branch 46 includes a pair of normally closed contacts 52a operated by the down relay 52 in series with the right - hand branch 50 . the contacts 52a are connected in series with alternate parallel paths 54 and 56 in the left - hand branch 46 . in the path 54 , normally closed contacts 58a are operated by a high relay coil 58 connected to common ground via a resistor r2 in the middle branch 48 . the alternate path 56 includes a resistor r1 in series with a normally open contact 58b operated by the high coil 58 . the alternate paths 54 and 56 are connected in series with an up relay coil 60 , which in turn is connected in series to common ground via a diode d5 connected such that current can only flow in the left - hand branch 46 when one of the positive terminals 16 and 18 is interconnected with bus bar 12 . the right - hand branch 50 includes normally closed relay coil contacts 60a operated by the up coil 60 in the left - hand branch circuit . the relay coil contacts 60a are connected in series to alternate paths 62 and 64 implemented in exactly the same fashion as in the left branch 46 . the path 62 thus includes normally closed high relay contacts 58c and the path 64 includes normally open high relay contacts 58d connected in series with a resistor r3 . the alternate paths 62 and 64 are connected in common to the down relay coil 52 which in turn in connected to common ground via a diode d6 connected to be forward - baised by the negative terminal 20 or 22 in the stationary control circuit 10 . in operation , by pressing the up push button 40 in until the up low contacts 28 close , plus 12 volts current flows to the up relay coil 60 via diode d2 , normally closed contacts 30 , bus bar 12 , collector 44 , normally closed down contacts 52a and normally closed high contacts 58a , through the up relay coil 60 and diode d5 to common ground for a complete circuit . further depression of the up button 40 breaks the positive 12 volt up low circuit and closes the up high 24 volt circuit . the high positive current flows through diode d1 , normally closed contacts 30 , bus bar 12 , collector 44 , high relay coil 58 , resistor r2 , to common ground . the current at this level flowing through the high coil 58 is sufficient to energize the coil to switch the high relay coil contacts 58a through 58d . the 24 volt positive current also flows from the collector 44 to the normally closed down contacts 52a , normally open high contacts 58b ( now closed ), resistor r1 , up coil 60 and diode d5 to common ground , maintaining the upward direction of travel at the higher speed . the resistors r1 and r2 bias the 12 volt relays for 24 volt operation . thus all of the relay coils 52 , 58 and 60 are interchangeable . the operation of the circuit for downward travel with one of the negative voltage terminals connected is analogous to operation in the upward direction . the invention may be embodied in other specific forms without departing from its spirit or essential characteristics . for example , the same circuit can be implemented with equivalent solid state logic circuitry . moreover additional speeds ( voltage levels ) beyond the two described herein can be implemented in an iterative fashion . the present embodiment is , therefore , to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the claims rather than by the foregoing description ; and all changes which come within the meaning and range of the equivalents of the claims are therefore intended to be embraced therein . | 1 |
the invention will now be described by way of exemplary embodiments shown by the drawing figures , in which like reference numerals indicate like elements in all of the several views . turning to fig1 , a data processing host system 2 that may be used to implement the invention is configured with a collection of shared data processing hardware resources that include one or more central processing units ( cpus ) 4 1 , 4 2 . . . 4 n , a memory 6 , and a set of input / output ( i / o ) facilities 8 . a hypervisor program 10 , also known as a virtual machine monitor or vmm , executes as firmware ( or software ) on the system 2 to provide logical partitions for various operating system instances and application programs to be described in more detail below . the hypervisor 10 is assumed to be conventional in nature . as such , it can be implemented according to any of the vmm design concepts that have been in use since hypervisors were first developed in the late 1960s ( taking into account the vm support capabilities of the underlying hardware ). well known examples of commercial hypervisors include the cp control program used in the ibm vm / 370 ยฎ mainframe product introduced by international business machines corporation in 1972 , the current z / vm ยฎ hypervisor used in the ibm zseries ยฎ mainframe product , and the hypervisor used in ibm pseries ยฎ products . note that the references to the foregoing commercial products are not intended to suggest that the invention is limited to any particular system or vendor . as is known to persons skilled in the art , a conventional hypervisor or vmm is a low level service that virtualizes the underlying hardware to provide a subset of the cpu , memory and i / o resources ( i . e ., a virtual machine ) on behalf of higher level โ guests .โ in fig1 , the hypervisor 10 is shown to provide four logical partition environments 12 1 , 12 2 , 12 3 and 12 4 on behalf of four operating system instances 14 , 16 , 18 and 20 . each operating system instance 14 , 16 , 18 and 20 , in turn , respectively supports an application space 22 , 24 , 26 and 28 for running user applications . as described in more detail below , one or more of the user applications could be a database server providing database and database management functions on behalf of one or more database clients ( not shown in fig1 ). the hypervisor 10 performs various functions that support concurrent operation of the operating systems 14 - 20 and their applications 22 - 28 on the system 2 . in particular , the hypervisor 10 provides the plural logical partition environments 12 1 , 12 2 , 12 3 and 12 4 by allocating cpu bandwidth , memory and i / o resources , for use by each partition . each operating system 14 - 20 within a partition 12 1 - 12 4 behaves as if it were operating on real hardware , with the hypervisor facilitating such operation by ( 1 ) translating accesses to virtual memory and i / o space to real memory and i / o space accesses , ( 2 ) selectively distributing interrupts from i / o devices to the various operating systems for servicing , and ( 3 ) scheduling cpu process execution on a prioritized basis . note that the operating systems 14 - 20 need not necessarily be unaware of the hypervisor 10 insofar as there are some operating systems that are designed , for efficiency reasons , to cooperate with a hypervisor . the ibm ยฎ aix ยฎ 5l operating system is an example of such a program . lastly , and of significance to the present invention , the data processing system 2 supports conventional dynamic logical partitioning , meaning that the partitions 12 1 - 12 4 can be dynamically reconfigured by adding or removing resources such as processors , memory and i / o slots , or by moving such resources between partitions , without rebooting the operating system instances 14 , 16 , 18 , 20 running therein . as indicated by way of background above , the ibm ยฎ aix ยฎ 5l operating system is an example of an operating system that supports dynamic logical partitioning and does not have to be rebooted when partition reconfiguration occurs . a conventional dynamic partitioning api is also provided by the data processing system 2 so that dynamic logical partitioning requests can be made using automated software control . with additional reference now to fig2 , which presents a different view of the data processing system 2 of fig1 , reference numeral 30 of fig2 illustrates a dynamic partitioning api that is accessible from each of the partitions 12 1 - 12 4 , as is known in the art . as is further conventionally known , the dynamic partitioning api 30 in the fig2 view of the data processing system 2 also maintains an interface to a network 32 configured as a lan ( local area network ) or other communication system . as additionally shown in fig2 , the network 32 connects to the partitions 12 1 - 12 4 , and optionally to one or more remote data processing systems , such as a data processing host 34 . with this connectivity , the dynamic partitioning api 30 can be accessed from each of the partitions 12 1 - 12 4 , and from other systems , such as the host 34 . as mentioned by way of background above , one example of a data processing platform that provides the foregoing dynamic logical partitioning functionality is the ibm pseries ยฎ line of products , such as the p690 and p670 systems , running the ibm ยฎ aix ยฎ 5l operating system . these pseries ยฎ products support a user interface for managing dynamic logical partitioning via a hardware management console ( hmc ). the hmc allows administrators to manually perform dynamic logical partition reconfiguration . in addition , the software supporting the hmc can be accessed by a component found in version 5 . 2 of the ibm ยฎ aix ยฎ 5l operating system known as the dr ( dynamic reconfiguration ) manager . each partition running an instance of the ibm ยฎ aix ยฎ 5l operating system can issue dynamic logical partitioning requests via its dr manager . each partition &# 39 ; s dr manager is in turn accessible to user applications running in the same partition . support is also provided for remote secure shell ( ssh ) execution of dynamic logical partitioning commands sent over a network by software entities running on remote systems . the same kind of local and remote execution support can be provided by the dynamic partitioning api 30 shown in fig2 , as could other conventional forms of command interaction . turning now to fig3 , a database server application 36 is shown that provides database and database management functions for data resident on one or more data storage subsystems 38 . for purposes of example only , it is assumed that there are four of the data storage subsystems 38 , and that these subsystems are respectively associated with four instances of the database server application 36 . each instance of the database server application 36 is assumed to respectively run in one of the application spaces 22 , 24 , 26 and 28 shown in the fig1 view of the data processing system 2 . each such instance could operate separately to implement an independent database on one of the data storage subsystems 38 , or alternatively , each instance could be configured to operate cooperatively with other instances to provide a single distributed database . as is conventionally known , a distributed database can be distributed over multiple physical or logical partitions to facilitate parallel processing on defined subsets of data . in the context of the data processing system 2 , one instance of the database server application 36 could be installed on each logical partition to collectively provide a distributed database with four partitions ( with additional instances physically partitioned on other data processing hosts also being possible ). the database server application 36 is conventionally adapted to communicate with one or more clients 40 issuing database query requests by way of a network 42 , which could be the same as or different than the network 32 of fig2 . the database server application 36 services these client query requests by invoking appropriate database query functions , and returning the query results to the requesting client ( s ), as is conventional . the programming in the database server application 36 is assumed to implement the usual set of database and database management functions . these include , but are not necessarily limited to , various transaction management functions , scheduling functions and data management functions , including but not limited to query optimization , scan processing , join processing , aggregation processing , sort processing , convergence processing , final result set processing , logging , recovery , index management , concurrency control , buffer pool management , and parallel query processing . the database server application 36 may need to accommodate a variety of clients 40 issuing potentially diverse types of database query requests . these requests could include routine online transaction processing ( oltp ) queries in which relatively few database records need to be processed with sub - second response time . the clients 40 could also issue , on an ad hoc basis , processor - intensive decision support system ( dss ) requests requiring hours to complete . to support such query diversity , the database server application 36 is assumed to possess autonomic self - tuning functionality of the type found in modern database management systems . as indicated by way of background above , self - tuning allows various database and database manager parameters to be automatically assigned values based upon current workload and the availability of resources such as cpu ( central processing unit ) cycles , memory , and i / o ( input / output ). given a particular workload and resource availability , parameter values are selected that will produce optimal performance . version 8 of the ibm ยฎ db2 ยฎ database manager product is one example of a database program that may be used to implement the database management server application 36 . tunable parameters associated with database management operations of this partitioned database product include : 1 ) maximum number of parallel operations per sql statement ; 2 ) partition memory available for database server application instance management ; 3 ) number of inter - partition communications buffers ; 4 ) processor speed per instruction ; 5 ) inter - partition communications bandwidth ; 6 ) system monitor switches ; and 7 ) index recreation scheduling . with respect to storage and integrity of the database itself ( as opposed to database management ), tunable parameters in the ibm ยฎ db2 ยฎ database manager product include : 1 ) catalog cache size ; 2 ) utility heap size ; 3 ) database heap size ; 4 ) sort heap size ; 5 ) statement heap size ; 6 ) degree of intra - partition parallelism ; 7 ) table space extent size ; 8 ) extent prefetch size ; 9 ) average number of active applications ; 10 ) maximum number of active applications ; 11 ) package cache size ; 12 ) maximum storage for lock list ; 13 ) maximum number of locks ; 14 ) default query optimization class ; and 15 ) number of commits per commit group . it will be appreciated that other database programs could be used to implement the database server application 36 . thus , the foregoing listing of tunable parameters associated with the ibm ยฎ db2 ยฎ database manager product are set forth for the purpose of illustration only , and not by way of limitation . as indicated by way of summary above , the present invention allows whatever autonomic self - tuning functions that may be present in the database server application 36 to be extended and complemented using the dynamic partitioning functions of the data processing system 2 . this is accomplished by 1 ) defining ( at application deployment time ) one or more desired operational parameters relating to application level resource utilization and / or operating system level performance , 2 ) monitoring the defined parameters during application execution ; and 3 ) performing dynamic logical partition reconfiguration as necessary if the parameters are violated . each instance of the database server application 36 has an associated set of defined parameters that may be referred to as a service level agreement or sla . there is one sla associated with each database server application instance , and each sla can define any number of different parameters . by way of example only , and not by way of limitation , an sla associated with one ( or more ) instances of the database server application 36 might specify the following parameters : 1 ) processor load should be in a range 80 %- 90 % on partition ; 2 ) database buffer pool hit ratio should be & gt ; 95 %; 3 ) database client response time should be & lt ; 5 seconds ; 4 ) . . . . [ others ]. an sla can be continuously ( or periodically ) monitored and whenever one of its parameters is violated , as by the parameter going outside of a defined range for a specified period of time , the associated partition can be dynamically reconfigured . for example , using the exemplary sla above , if the current processor load for a partition is 99 % for five minutes , the partition could be reconfigured by adding a new processor to keep the processor load at or under 90 %. similarly , for database buffer pools , a partition could be reconfigured by adding additional memory if the current buffer pool hit ratio is , for example , 50 % for two minutes . the same is true for processor / memory removal . if there is processor under - utilization and unused buffer pool pages in a partition , a processor and memory could be removed from the partition and placed in a free pool . these resources would then be available in the future to the same partition or to other partitions that need them . note that when partition resources are not available in the free pool , they can be obtained from one or more other partitions that are not as resource sensitive or are defined as lower priority sla partitions . a partition priority and arbitration mechanism can be used to implement such reallocations . the monitoring function for monitoring the slas associated each instance of the database server application 36 can be provided by a monitor running as a thread , process or other execution context in a partition that concurrently runs a database server application instance ( or in any other partition ). for example , as shown in fig2 , if partitions 12 1 , 12 2 , 12 3 and 12 4 each run an instance of the database server application 36 , there could be a monitor mon 1 , mon 2 , mon 3 and mon 4 respectively running on each partition . each monitor can be implemented to run in either operating system kernel mode or user application mode . however , it will be appreciated that the latter requires no operating system modifications and thus may be less costly to implement . as indicated above , each of the monitors mon 1 , mon 2 , mon 3 and mon 4 can track conditions associated with the sla parameters of the database server application instance running in its partition , and initiate responsive action whenever a parameter is violated . this responsive action involves notifying the dynamic partitioning api 30 that partition reconfiguration is required . although it would be possible for each monitor to provide such notification directly to the dynamic partitioning api 30 , efficiency can be improved by providing an intelligent intermediary that controls the manner in which dynamic reconfiguration requests are made to the dynamic partitioning api 30 . in an exemplary embodiment of the invention , this intelligence is provided by a dynamic reconfiguration ( dr ) suggestion listener that can run as a thread , process or other execution context on one of the partitions 12 1 , 12 2 , 12 3 and 12 4 . in fig2 , the dynamic reconfiguration listener ( drl ) is shown by way of example only to run on the partition 12 4 . its function is to receive dynamic reconfiguration suggestions from the monitors mon 1 , mon 2 , mon 3 and mon 4 and then determine what dynamic reconfiguration requests need to be made to the dynamic partitioning api 30 . communication between the listener drl and the monitors mon 1 , mon 2 , mon 3 and mon 4 can be implemented over the network 32 , or by way of a conventional inter - partition communication mechanism provided by the data processing system 2 , if present . the discussion of fig4 below will illustrate the kind of decision making that can be performed by the listener drl following the receipt of dynamic reconfiguration suggestions from the monitors mon 1 , mon 2 , mon 3 and mon 4 . however , before turning to fig4 , it should be pointed out with reference to fig2 that the illustrated arrangement in which the monitors mon 1 , mon 2 , mon 3 and mon 4 and the listener drl are installed on the various partitions of the data processing system 2 is not the only way that these functions can be implemented . as further shown in fig2 , all monitor and listener functions could be implemented on the host 34 , due to that system &# 39 ; s ability to communicate with each partition of the data processing system 2 , as well as the dynamic partitioning api 30 , via the network 32 . relatedly , all of the monitor and listener functions could likewise be implemented on a single one of the partitions 12 1 , 12 2 , 12 3 and 12 4 of the data processing system 2 . turning now to fig4 a and 4b , the illustrated flow diagram represents exemplary processing steps that may be performed in accordance with the invention to support autonomic self - tuning of a database management system in a dynamic logically partitioned environment . in a first step 50 , an sla for a database server application 34 running on the data processing system 2 is accessed by a monitor of the type described above . in step 52 , the monitor continuously ( or periodically ) monitors the partition resources defined in the sla . in fig4 a , this includes the monitoring of processor usage in step 52 ( 1 ) , the monitoring of buffer pool usage in step 52 ( 2 ) , and the monitoring of one or more other partition resources , as shown by step 52 ( n ) . note that all monitoring of partition resources can be performed using conventional operating system calls of the type provided by most modern operating systems . in step 54 , the monitor determines whether the partition resources being monitored are consistent with the corresponding sla parameters . in fig4 a , this includes determining whether processor usage is within the corresponding sla processor usage parameter in step 54 ( 1 ) , whether buffer pool usage is within the corresponding sla buffer pool parameter in step 54 ( 2 ) , and performing similar evaluations for one or more other partition resources being monitored , as shown by step 54 ( n ) . if an sla parameter is not found to be violated in step 54 , processing returns to step 52 . if an sla parameter is found to be violated in step 54 , a test is made in step 56 to determine whether the corresponding processor resource is above or below the sla parameter value . for example , in fig4 a , the illustrated decision box for step 56 represents a determination by the monitor as to whether partition processor resources are being underutilized or over utilized . the monitor then performs suggestion processing , as exemplified by the remaining steps of fig4 a , to determine an appropriate dr suggestion to be made to a listener of the type described above . steps 58 and 60 are performed if processor usage is below the sla parameter . in step 58 , the monitor determines the number of processors that the partition has available to send to a free pool of resources maintained by the data processing system 2 . conventional linear interpolation / extrapolation algorithms are available to make the processor availability determination . for example , if a partition has four running processors and processor usage is 40 %, donating two processors should boost processor usage to a more efficient 80 %. note that the concept of a free pool for logically cataloging available resources is a well - known feature of dynamic logical partitioning environments . in step 60 , the monitor generates a dr suggestion to the listener for processor removal using the number of processors determined in step 58 . steps 62 and 64 are performed if processor usage is above the sla parameter . in step 62 , the monitor determines the number of processors needed by the partition . again , conventional linear interpolation / extrapolation algorithms are available to make this determination . for example , if a partition has four running processors and the processor usage is 100 %, acquiring one more processor will reduce processor usage to 80 %. in step 60 , the monitor generates a dr suggestion to the listener for processor addition using the number of additional processors determined in step 58 . although not shown in fig4 a , similar processing is performed in connection with other partition resources being monitored . as shown in fig4 b , the dr suggestion is processed by the listener in step 66 . if the dr suggestion involves removing resources from the partition issuing the dr suggestion , this is accomplished without further processing by the listener issuing an appropriate remove request to api 30 of fig2 . if the dr suggestion involves adding resources to the partition issuing the dr suggestion , the listener issues an appropriate call to the api 30 in step 68 to determine the availability of resources in the free pool of unassigned resources maintained by the data processing system 2 . based on the response from the api 30 , the listener determines in step 70 whether there are enough of the requested resources in the free pool . if enough resources are available , step 72 is performed in which the listener requests the api 30 to add the requested resources . if there are not enough resources in step 70 , step 74 is performed in which the listener determines the availability of resources in other partitions . this is done by issuing conventional queries to the operating systems in these partitions . in step 76 , the listener evaluates the responses received from the partition ( s ) being queried and determines whether there are available resources that can be borrowed . if there are , step 72 is invoked and the listener requests the api 30 to deliver the required resources from the other partition ( s ) in which the resources are available . if there are not enough resources available in other partitions , the listener performs step 78 to determine whether there are enough resources to partially satisfy the dr suggestion . if there are , the listener requests the api 30 to deliver whatever partial resource requirement can be obtained from the other partitions . if it is determined in step 78 that a partial request cannot be satisfied , processing returns to step 66 . note that the decision making of steps 76 and 78 can involve arbitration by the listener to determine the partitions that are the most likely candidates to give up resources . this arbitration can be based on the evaluation of factors such as partition priority , partition resource sensitivity , sla priority , etc . thus , by way of example only , if all partitions lack extra resources , or are perhaps even low on resources , one or more partitions with the lowest ranking ( s ) according to the factors being evaluated could be selected to satisfy some or all of the resource needs of a requesting partition with higher priority . accordingly , a database partition monitoring and reconfiguration system for supporting an autonomic self - tuning database management system running in a dynamic logical partitioning operating system environment has been disclosed . it will be appreciated that the inventive concepts may be variously embodied in any of a data processing system , a machine implemented method , and a computer program product in which programming means are recorded on one or more data storage media for use in controlling a data processing system to perform the required functions . exemplary data storage media for storing such programming means are shown by reference numeral 100 in fig5 . the media 100 are shown as being portable optical storage disks of the type that are conventionally used for commercial software sales . such media can store the programming means of the invention either alone or in conjunction with an operating system or other software product that incorporates read - copy update functionality . the programming means could also be stored on portable magnetic media ( such as floppy disks , flash memory sticks , etc .) or on magnetic media combined with drive systems ( e . g . disk drives ) incorporated in computer platforms . while several embodiments of the invention have been shown and described , it should be apparent that many variations and alternative embodiments could be implemented . it is understood , therefore , that the invention is not to be in any way limited except in accordance with the spirit of the appended claims and their equivalents . | 6 |
this invention pertains to a novel approach to covalently attach organic molecules to a surface of a type ii , iii , iv , v , or vi material , a doped variant thereof and / or an oxide thereof . in general the method involves : 1 ) providing a heat resistant organic molecule comprising an attachment group and / or derivatized with an attachment group ; and 2 ) contacting the derivatized heat resistant organic molecule a surface comprising a group ii , iii , iv , v , or vi material ; and 3 ) heating the surface and / or molecule to a temperature of at least about 200 ยฐ c . whereby the attachment group forms a covalent bond with the surface . in certain embodiments , the heat resistant organic molecule is dissolved in an organic solvent ( e . g ., thf , mesitylene , durene , o - dichlorobenzene , 1 , 2 , 4 - trichlorobenzene , 1 - chloronaphthalene , 2 - chloronaphthalene , n , n - dimethylformamide , n , n - dimethylacetamide , n , n - dimethylpropionamide , benzonitrile , anisole , and the like ). the solvent containing the molecule can then be applied to the surface . heating can be accomplished by any of a variety of conventional methods . for example , the solvent can be heated before application to the surface . in certain embodiments , both the solvent and the surface can be heated before the solvent is applied to the surface . in certain preferred embodiments , the surface is heated after application of the solvent . this is conveniently accomplished by baking the surface ( e . g ., in an oven ). in certain preferred embodiments , the surface is heated ( e . g ., baked ) under an inert atmosphere ( e . g ., argon or other inert gas ( es )). various parameters can be optimized for attachment of any particular organic molecule . these include ( 1 ) the concentration of the molecule ( s ), ( 2 ) the baking time , and ( 3 ) the baking temperature . fig2 , and 4 show the results of these studies for a representative porphyrin ( molecule 104 in fig1 ). in each figure , the left panel shows the cyclic voltammogram of the covalently attached molecule . the characteristic features of the voltammograms are indicative of covalent attachment and robust electrochemical behavior ( see , e . g ., li et al . ( 2002 appl . phys . lett . 81 : 1494 - 1496 ; roth et al . ( 2003 ) j . am . chem . soc . 125 : 505 - 517 ). the right panel shows the molecular coverage . saturating coverage for this type of molecule is in the range of 10 โ 10 mol cm โ 2 . although the three parameters above are not independent , the figures illustrate the following key observations . first , using the methods described herein , the molecules can be attached at relatively high surface coverage ( in the range of 5 ร 10 โ 11 mol cm โ 2 ) using micromolar concentrations of materials ( see , e . g ., fig2 ). facile attachment using extremely small amounts of material ( e . g ., concentration less than about 5 mm , preferably less than about 1 mm , more preferably less than about 500 ฮผm or 100 ฮผm , still more preferably less than about 10 ฮผm , and most preferably less than about 1 ฮผm ) is distinctly different from other procedures that have been used to anchor molecules to silicon . these procedures typically use very high concentrations of molecules in solution or neat molecules . the use of very small amounts of material indicates that a few grams of information storage molecules could be used to make millions of chips . the use of small amounts of material also indicates that relatively small amounts of organic solvents can be used , thereby minimizing environmental hazards . in addition , it was a surprising discovery that baking times as short as a few minutes ( e . g ., typically from about 1 sec to about 1 hr , preferably from about 10 sec to about 30 min , more preferably from about 1 minute to about 5 , 10 , or 15 minutes , and most preferably from about 30 sec to about 1 or 2 minutes ) afford high surface coverage ( fig3 ). short times minimize the amount of energy that is used in the processing step . it was also a surprising discovery that baking temperatures as high as 400 ยฐ c . can be used with no degradation of the molecules ( fig4 ). this result is of importance in that many processing steps in fabricating cmos devices entail high temperature processing . in certain embodiments , preferred baking temperatures range from about 125 ยฐ c . to about 400 ยฐ c ., preferably from about 200 ยฐ c . to about 400 ยฐ c ., more preferably from about 250 ยฐ c . to about 400 ยฐ c ., and most preferably from about 300 ยฐ c . to about 400 ยฐ c . a further significant point is that diverse functional groups on the information storage molecules are suitable for use in attachment to silicon or other substrates . the groups include , but are not limited to , alcohol , thiol , s - acetylthiol , bromomethyl , allyl , iodoaryl , carboxaldehyde , ethyne , vinyl , hydroxymethyl . it is also noted that such groups such as ethyl , methyl , or arene afforded essentially no attachment as demonstrated by the failure to achieve substantial attachment with the zinc chelates of octaethylporphyrin , meso - tetraphenylporphyrin , meso - tetra - p - tolylporphyrin , and meso - tetramesitylporphyrin . the successful attachment via s - acetylthiol , bromomethyl , iodoaryl , carboxaldehyde , and ethyne is unprecedented . the successful attachment via the iodoaryl group is extraordinarily valuable in affording a direct aryl - si attachment . the resulting information - storage molecules can be positioned vertically from the surface , which facilitates subsequent patterning . the ability to attach via such diverse functional groups provides great versatility . while in certain embodiments , heating is accomplished by placing the substrate in an oven , essentially any convenient heating method can be utilized , and appropriate heating and contacting methods can be optimized for particular ( e . g ., industrial ) production contexts . thus , for example , in certain embodiments , heating can be accomplished by dipping the surface in a hot solution containing the organic molecules that are to be attached . local heating / patterning can be accomplished using for example a hot contact printer , or a laser . heating can also be accomplished using forced air , a convection oven , radiant heating , and the like . the foregoing embodiments , are intended to be illustrative rather than limiting . it was a surprising discovery that a large number of organic molecules , including redox - active organic molecules , are sufficiently heat resistant to be amenable and even quite effective in the methods of this invention . suitable heat resistant organic molecules typically include , but are not limited to metallocenes ( e . g ., ferrocene ), porphyrins , expanded porphyrins , contracted porphyrins , linear porphyrin polymers , porphyrin sandwich coordination complexes , and porphyrin arrays . certain preferred heat resistant organic molecules include , but are not limited to 5 -[ 4 -( s - acetylthiomethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -[ 4 -( mercaptomethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -[ 4 -( hydroxymethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -[ 4 -( hydroxymethyl ) phenyl ]- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( 4 - allylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - formylphenyl )- 15 - phenyl - 10 , 20 - di - p - tolylporphinatozinc ( ii ), 5 -( 4 - bromomethylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - ethynylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - iodophenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - bromophenyl )- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( 4 - hydroxyphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 , 10 - bis ( 4 - ethynylphenyl )- 15 , 20 - dimesitylporphinatozinc ( ii ), 5 -[ 4 -( 4 , 4 , 5 , 5 - tetramethyl - 1 , 3 , 2 - dioxaborolan - 2 - yl ) phenyl ]- 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 - iodo - 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 , 10 - bis ( 4 - iodophenyl )- 15 , 20 - dimesitylporphinatozinc ( ii ), 5 -[ 4 -( 2 -( trimethylsilyl ) ethynyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 , 15 - bis ( 4 - ethynylphenyl )- 10 , 20 - dimesitylporphinatozinc ( ii ), 5 , 15 - bis ( 4 - iodophenyl )- 10 , 20 - dimesitylporphinatozinc ( ii ), 5 , 10 , 15 - tris ( 4 - ethynylphenyl )- 20 - mesitylporphinatozinc ( ii ), 5 , 15 - bis ( 4 - ethynylphenyl )- 10 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 , 15 - bis ( 4 - ethynylphenyl ) porphinatozinc ( ii ), 5 , 15 - bis ( 3 - ethynylphenyl )- 10 , 20 - dimesitylporphinatozinc ( ii ), 5 , 10 , 15 , 20 - tetrakis ( 4 - ethynylphenyl ) porphinatozinc ( ii ), 5 , 10 - bis [ 4 -( 2 -( trimethylsilyl ) ethynyl ) phenyl ]- 15 , 20 - dimesitylporphinatozinc ( ii ), 5 -( 3 , 5 - diethynylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 3 , 7 - dibromo - 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 -[ 4 -( 2 -( trimethylsilyl ) ethynyl ) phenyl ]- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -[ 4 -( se - acetylselenomethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - iodophenyl )- 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 , 10 - bis ( 4 - ethynylphenyl )- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 , 10 - bis ( 4 - ethynylbiphen - 4 โฒ- yl )- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 -( 4 - vinylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - vinylphenyl )- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( hydroxymethyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - allylphenyl )- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( 4 - allylphenyl )- 10 , 15 , 20 - tri - p - tolylporphinatocopper ( ii ), type c triple decker [( tert - butyl ) 4 phthalocyaninato ] eu [( tert - butyl ) 4 phthalocyaninato ] eu [ 5 , 15 - bis ( 4 - ethynylphenyl )- 10 , 20 - bis ( 4 - tert - butylphenyl ) porphyrin ], type c triple decker [( tert - butyl ) 4 phthalocyaninato ] eu [( tert - butyl ) 4 phthalocyaninato ] eu [ 5 -[ 4 -[ 2 -( 4 -( hydroxymethyl ) phenyl ) ethynyl ] phenyl ]- 10 , 15 , 20 - tri - p - tolylporphyrin ] 5 , 10 - bis [ 4 -( 2 -( triisopropylsilyl ) ethynyl ) biphen - 4 โฒ- yl ]- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 , 10 - bis [ 4 -( 2 -( triisopropylsilyl ) ethynyl ) phenyl ]- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), and the like . the suitablility of particular molecules for use in the methods of this invention can readily be determined . the molecule ( s ) of interest are simply coupled to a surface ( e . g ., a hydrogen passivated surface ) according to the methods of this invention . then sinusoidal voltammetry can be performed ( e . g ., as described herein or in u . s . pat . nos . 6 , 272 , 038 , 6 , 212 , 093 , and 6 , 208 , 553 , pct publication wo 01 / 03126 , or by ( roth et al . ( 2000 ) vac . sci . technol . b 18 : 2359 - 2364 ; roth et al . ( 2003 ) j . am . chem . soc . 125 : 505 - 517 ) to evaluate 1 ) whether or not the molecule ( s ) coupled to the surface , 2 ) the degree of coverage ( coupling ); and 3 ) whether or not the molecule degraded during the coupling procedure . table 1 illustrates the test results ( electrochemical characteristics ) of a number of porphyrins examined using the attachment procedure described herein . for those porphyrins that attached a subjective egfp scale was used to rate their electrochemical behavior . it is noted that the above - described compounds are meant to be illustrative and not limiting . other suitable compounds can readily be ascertained using routine screening procedures as described herein . it is also noted that where certain organic molecules decompose at particular sites at high temperature ( e . g ., 200 ยฐ c . to 400 ยฐ c .) the โ reactive โ site can often be derivatized with a stable protecting group . the molecule can be coupled to the surface according to the methods of this invention and the protecting group can then be chemically removed from the organic molecule . the organic molecule is typically provided in a solvent , dispersion , emulsion , paste , gel , or the like . preferred solvents , pastes , gels , emulsions , dispersions , etc ., are solvents that can be applied to the group ii , iii , iv , v , and / or vi material ( s ) without substantially degrading that substrate and that solubilize or suspend , but do not degrade the organic molecule ( s ) that are to be coupled to the substrate . in certain embodiments , preferred solvents include high boiling point solvents ( e . g ., solvents with an initial boiling point greater than about 130 ยฐ c ., preferably greater than about 150 ยฐ c ., more preferably greater than about 180 ยฐ c .). such solvents include , but are not limited to benzonitrile , dimethylformamide , zylene , orthodichlorobenzene , and the like . to effect attachment to the substrate ( e . g ., a group ii , iii , iv , v , or vi element , semiconductor , and / or oxide ) the heat resistant organic molecule either bears one or more attachment group ( s ) ( e . g ., as substituent ( s )) and / or is derivatized so that it is attached directly or through a linker to one or more attachment groups . a wide variety of attachment molecules ( groups ) are suitable for use in the methods of this invention . such attachment groups include , but are not limited to alcohols , thiols , s - acetylthiols , bromomethyls , allyls , iodoaryls , carboxaldehydes , ethynes , and the like . in certain embodiments , the attachment groups include , but are not limited to 4 -( hydroxymethyl ) phenyl , 4 -( s - acetylthiomethyl ) phenyl , 4 -( se - acetylselenomethyl ) phenyl , 4 -( mercaptomethyl ) phenyl , 4 -( hydroselenomethyl ) phenyl , 4 - formylphenyl , 4 -( bromomethyl ) phenyl , 4 - vinylphenyl , 4 - ethynylphenyl , 4 - allylphenyl , 4 -[ 2 -( trimethylsilyl ) ethynyl ] phenyl , 4 -[ 2 -( triisopropylsilyl ) ethynyl ] phenyl , 4 - bromophenyl , 4 - iodophenyl , 4 - hydroxyphenyl , 4 -( 4 , 4 , 5 , 5 - tetramethyl - 1 , 3 , 2 - dioxaborolan - 2 - yl ) phenyl bromo , iodo , hydroxymethyl , s - acetylthiomethyl , se - acetylselenomethyl , mercaptomethyl , hydroselenomethyl , formyl , bromomethyl , chloromethyl , ethynyl , vinyl , allyl , 4 -[ 2 -( 4 -( hydroxymethyl ) phenyl ) ethynyl ] phenyl , 4 -( ethynyl ) biphen - 4 โฒ- yl , 4 -[ 2 -( triisopropylsilyl ) ethynyl ] biphen - 4 โฒ- yl , 3 , 5 - diethynylphenyl , 2 - bromoethyl , and the like . these attachment groups are meant to be illustrative and not limiting . the suitability of other attachment groups can readily be evaluated . a heat resistant organic molecule bearing the attachment group ( s ) of interest ( directly or on a linker ) is coupled to a substrate ( e . g ., hydrogen - passivated si ) according to the methods described herein . the efficacy of attachment can then be evaluated electrochemically , e . g ., using sinusoidal voltammetry as described above . the attachment groups can be substituent ( s ) comprising the heat - resistant organic molecule . alternatively , the organic molecule can be derivatized to covalently link the attachment group ( s ) thereto either directly or through a linker . means of derivatizing molecules , e . g ., with alcohols or thiols are well known to those of skill in the art ( see , e . g ., gryko et al . ( 1999 ) j . org . chem ., 64 : 8635 - 8647 ; smith and march ( 2001 ) march &# 39 ; s advanced organic chemistry , john wiley & amp ; sons , 5th edition , etc .). where the attachment group comprises an alcohol , in certain embodiments , suitable alcohols include , but are not limited to a primary alcohol , a secondary alcohol , a tertiary alcohol , a benzyl alcohol , and an aryl alcohol ( i . e ., a phenol ). certain particularly preferred alcohols include , but are not limited to 2 to 10 carbon straight chain alcohols , benzyl alcohol , and phenethyl alcohol . when the attachment group comprises a thiol , in certain embodiments , suitable thiols include , but are not limited to a primary thiol , a secondary thiol , a tertiary thiol , a benzyl thiol , and an aryl thiol . particularly preferred thiols include , but are not limited to 2 to 10 carbon straight chain thiols , benzyl thiol , and phenethyl thiol . the methods of this invention are suitable for covalently coupling organic molecules to essentially any or all group ii , iii , iv , v , or vi materials ( e . g ., group ii , iii , iv , v , or vi elements , semiconductors , and / or oxides thereof ), more preferably to essentially any or all group iii , iv , or v materials ( e . g ., carbon , silicon , germanium , tin , lead ), doped group ii , iii , iv , v , and vi elements , or oxides of pure or doped group ii , iii , iv , v , or vi elements . in certain preferred embodiments the surface is group iii , iv , or v material , more preferably a group iv material ( oxide , and / or doped variant ), still more preferably a silicon or germanium surface or a doped and / or oxidized silicon or germanium surface . the group ii , iii , iv , v , or vi element can be essentially pure , or it can be doped ( e . g ., p - or n - doped ). p - and n - dopants for use with group ii - vi elements , in particular for use with groups iii , iv , and v elements , more particularly for use with group iv elements ( e . g ., silicon , germanium , etc .) are well known to those of skill in the art . such dopants include , but are not limited to phosphorous compounds , boron compounds , arsenic compounds , aluminum compounds , and the like . many doped group ii , iii , iv , v , or vi elements are semiconductors and include , but are not limited to zns , znse , znte , cds , cdse , cdte , mgs , mgse , mgte , cas , case , cate , srs , srse , srte , bas , base , bate , gan , gap , gaas , gasb , inp , inas , insb , als , alp , alsb , pbs , pbse , ge and si and ternary and quaternary mixtures thereof . the surface can take essentially any form . for example , it can be provided as a planar substrate , an etched substrate , a deposited domain on another substrate and the like . particularly preferred forms include those forms of common use in solid state electronics fabrication processes . although not necessarily required , in certain embodiments the surface is cleaned before use , e . g ., using standard methods known to those of skill in the art . thus , for example , in one preferred embodiment , the surface can be cleaned by sonication in a series of solvents ( e . g ., acetone , toluene , acetone , ethanol , and water ) and then exposed to a standard wafer - cleaning solution ( e . g ., piranha ( sulfuric acid : 30 % hydrogen peroxide , 2 : 1 )) at an elevated temperature ( e . g ., 100 ยฐ c .). in certain embodiments , oxides can be removed from the substrate surface and the surface can be hydrogen passivated . a number of approaches to hydrogen passivation are well known to those of skill in the art . for example , in one approach , a flow of molecular hydrogen is passed through dense microwave plasma across a magnetic field . the magnetic field serves to protect the sample surface from being bombarded by charged particles . hence the crossed beam ( cb ) method makes it possible to avoid plasma etching and heavy ion bombardment that are so detrimental for many semiconductor devices ( see , e . g ., balmashnov , et al . ( 1990 ) semiconductor science and technology , 5 : 242 ). in one particularly preferred embodiment , passivation is by contacting the surface to be passivated with an ammonium fluoride solution ( preferably sparged of oxygen ). other methods of cleaning and passivating surfaces are known to those of skill in the art ( see , e . g ., choudhury ( 1997 ) the handbook of microlithography , micromachining , and microfabrication , soc . photo - optical instru . engineer , bard & amp ; faulkner ( 1997 ) fundamentals of microfabrication , and the like ). in certain embodiments , the heat - resistant organic molecules are attached to form a uniform film across the surface of the group ii , iii , iv , v , or vi material . in other embodiments , the organic molecules are separately coupled at one or more discrete locations on the surface . in certain embodiments , different molecules are coupled at different locations on the surface . the location at which the molecules are coupled can be accomplished by any of a number of means . for example , in certain embodiments , the solution ( s ) comprising the organic molecule ( s ) can be selectively deposited at particular locations on the surface . in certain other embodiments , the solution can be uniformly deposited on the surface and selective domains can be heated . in certain embodiments , the organic molecules can be coupled to the entire surface and then selectively etched away from certain areas . the most common approach to selectively contacting the surface with the organic molecule ( s ) involves masking the areas of the surface that are to be free of the organic molecules so that the solution containing the molecule ( s ) cannot come in contact with those areas . this is readily accomplished by coating the substrate with a masking material ( e . g ., a polymer resist ) and selectively etching the resist off of areas that are to be coupled . alternatively a photoactivatible resist can be applied to the surface and selectively activated ( e . g ., via uv light ) in areas that are to be protected . such โ photolithographic โ methods are well known in the semiconductor industry ( see e . g ., van zant ( 2000 ) microchip fabrication : a practical guide to semiconductor processing ; nishi and doering ( 2000 ) handbook of semiconductor manufacturing technology ; xiao ( 2000 ) introduction to semiconductor manufacturing technology ; campbell ( 1996 ) the science and engineering of microelectronic fabrication ( oxford series in electrical engineering ), oxford university press , and the like ). in addition , the resist can be patterned on the surface simply by contact printing the resist onto the surface . other approaches involve contact printing of the reagents , e . g ., using a contact printhead shaped to selectively deposit the reagent ( s ) in regions that are to be coupled , use of an inkjet apparatus ( see e . g ., u . s . pat . no . 6 , 221 , 653 ) to selectively deposit reagents in particular areas , use of dams to selectively confine reagents to particular regions , and the like . in certain preferred embodiments , the coupling reaction is repeated several times . after the reaction ( s ) are complete , uncoupled organic molecules are washed off of the surface , e . g ., using standard wash steps ( e . g ., benzonitrile wash followed by sonication in dry methylene chloride ). the foregoing methods are intended to be illustrative . in view of the teachings provided herein , other approaches will be evident to those of skill in the semiconductor fabrication arts . it was a surprising discovery of this invention that coupling of redox - active molecules to a doped or undoped substrate ( e . g ., a substrate comprising a group iii , iv , or v element ) results in higher and more uniform packing of the organic molecules ( e . g ., redox - active species ) than other previously known methods . with redox - active organic molecules this manifests as lower oxidative current at higher anodic potentials observed in voltametric measurements . in addition , a cyclic voltammogram shows sharper and more symmetric peaks . in addition , the improved uniformity and higher packing density of redox - active molecules on the substrate results in materials capable of storing a significantly higher charge density . thus , in preferred embodiments , this invention provides a group iv element substrate having coupled thereto one or more redox - active species that can store charge at a charge density of at least about 75 ฮผcoulombs / cm 2 , preferably at least about 100 ฮผcoulombs / cm 2 , more preferably at least about 150 ฮผcoulombs / cm 2 , and most preferably of at least about 200 or 250 ฮผcoulombs / cm2 per non - zero oxidation state of the redox - active molecules . such materials are useful in the fabrication of molecular memories ( memory chips ). where various binding moieties are used instead of redox - active species , the high uniformity and molecule density provides sensors having greater sensitivity and selectivity for a particular analyte . [ heading - 0101 ] vii . uses of organic molecules coupled to a group iv material . the methods of this invention can be used to attach essentially any heat - resistant organic molecule to a group ii , iii , iv , v , or vi material surface , preferably to a group iii , iv , or v surface . in certain preferred embodiments , the molecule is a redox - active molecule and can be used to form a molecular memory . in other preferred embodiments , the molecule can be essentially any other heat - resistant molecule . certain other heat - resistant molecules include , but are not limited to binding partner ( e . g ., certain antibodies , ligands , nucleic acids , sugars , etc .) and can be used to form a sensor for detecting particular analyte ( s ). in โ molecular memory โ redox - active molecules ( molecules having one or more non - zero redox states ) coupled to the group ii , iii , iv , v , or vi materials are used to store bits ( e . g ., each redox state can represent a bit ). the redox - active molecule attached to the substrate material ( e . g ., silicon , germanium , etc .) forms a storage cell capable of storing one or more bits in various oxidation states . in certain embodiments , the storage cell is characterized by a fixed electrode electrically coupled to a โ storage medium โ comprising one or more redox - active molecules and having a multiplicity of different and distinguishable oxidation states . data is stored in the ( preferably non - neutral ) oxidation states by the addition or withdrawal of one or more electrons from said storage medium via the electrically coupled electrode . the oxidation state of the redox - active molecule ( s ) can be set and / or read using electrochemical methods ( e . g ., cyclic voltammetry ), e . g ., as described in u . s . pat . nos . 6 , 272 , 038 , 6 , 212 , 093 , and 6 , 208 , 553 and pct publication wo 01 / 03126 . because group ii , iii , iv , v , and vi materials , in particular group iv materials ( e . g ., silicon , germanium , etc . ), are commonly used in electronic chip fabrication , the methods provided herein readily lend themselves to the fabrication of molecular memory chips compatible with existing processing / fabrication technologies . in addition , details on the construction and use of storage cells comprising redox - active molecules can be found , in u . s . pat . nos . 6 , 272 , 038 , 6 , 212 , 093 , and 6 , 208 , 553 and pct publication wo 01 / 03126 . certain preferred redox - active molecules suitable for use in this invention are characterized by having a multiplicity of oxidation states . those oxidation states are provided by one or more redox - active units . a redox - active unit refers to a molecule or to a subunit of a molecule that has one or more discrete oxidation states that can be set by application of an appropriate voltage . thus , for example , in one embodiment , the redox - active molecule can comprise two or more ( e . g ., 8 ) different and distinguishable oxidation states . typically , but not necessarily , such multi - state molecules will be composed of several redox - active units ( e . g ., porphyrins or ferrocenes ). each redox - active molecule is itself at least one redox - active unit , or comprises at least one redox - active unit , but can easily comprise two or more redox - active units . preferred redox - active molecules include , but are not limited to porphyrinic macrocycles . particularly preferred redox - active molecules include a porphyrin , an expanded porphyrin , a contracted porphyrin , a ferrocene , a linear porphyrin polymer , a porphyrin sandwich coordination complex , and a porphyrin array . in certain embodiments , the redox - active molecule is a metallocene as shown in formula i . where l is a linker , m is a metal ( e . g ., fe , ru , os , co , ni , ti , nb , mn , re , v , cr , w ), s 1 and s 2 are substituents independently selected from the group consisting of aryl , phenyl , cycloalkyl , alkyl , halogen , alkoxy , alkylthio , perfluoroalkyl , perfluoroaryl , pyridyl , cyano , thiocyanato , nitro , amino , alkylarnino , acyl , sulfoxyl , sulfonyl , imido , amido , and carbamoyl . in preferred embodiments , a substituted aryl group is attached to the porphyrin , and the substituents on the aryl group are selected from the group consisting of aryl , phenyl , cycloalkyl , alkyl , halogen , alkoxy , alkylthio , perfluoroalkyl , perfluoroaryl , pyridyl , cyano , thiocyanato , nitro , amino , alkylamino , acyl , sulfoxyl , sulfonyl , imido , amido , and carbamoyl . certain suitable substituents include , but are not limited to , 4 - chlorophenyl , 3 - acetamidophenyl , 2 , 6 - dichloro - 4 - trifluoromethyl , and the like . preferred substituents provide a redox potential range of less than about 2 volts . x is selected from the group consisting of a substrate , a reactive site that can covalently couple to a substrate ( e . g ., an alcohol , a thiol , etc .). it will be appreciated that in some embodiments , l - x is an alcohol or a thiol . in certain instances l - x can be replaced with another substituent ( s 3 ) like s 1 or s 2 . in certain embodiments , l - x can be present or absent , and when present preferably is 4 - hydroxyphenyl , 4 -( 2 -( 4 - hydroxyphenyl ) ethynyl ) phenyl , 4 -( hydroxymethyl ) phenyl , 4 - mercaptophenyl , 4 -( 2 -( 4 - mercaptophenyl ) ethynyl ) phenyl , 4 - mercaptomethylphenyl , 4 - hydroselenophenyl , 4 -( 2 -( 4 - hydroselenophenyl ) ethynyl ) phenyl , 4 - hydrotellurophenyl , 4 -( hydroselenomethyl ) phenyl , 4 -( 2 -( 4 - hydrotellurophenyl ) ethynyl ) phenyl , 4 -( hydrotelluromethyl ) phenyl , and the like . the oxidation state of molecules of formula i is determined by the metal and the substituents . various suitable metallocenes are disclosed in u . s . pat . nos . 6 , 272 , 038 , 6 , 212 , 093 , and 6 , 208 , 553 , and pct publication wo 01 / 03126 . other suitable redox - active molecules include , but are not limited to porphyrins illustrated by formula ii . where , f is a redox - active subunit ( e . g ., a ferrocene , a substituted ferrocene , a metalloporphyrin , or a metallochlorin , etc . ), j 1 is a linker , m is a metal ( e . g ., zn , mg , cd , hg , cu , ag , au , ni , pd , pt , co , rh , ir , mn , b , al , ga , pb , and sn ), s 1 and s 2 are independently selected from the group consisting of aryl , phenyl , cycloalkyl , alkyl , halogen , alkoxy , alkylthio , perfluoroalkyl , perfluoroaryl , pyridyl , cyano , thiocyanato , nitro , amino , alkylamino , acyl , sulfoxyl , sulfonyl , imido , amido , and carbamoyl wherein said substituents provide a redox potential range of less than about 2 volts , k 1 , k 2 , k 3 , and k 4 are independently selected from the group consisting of n , o , s , se , te , and ch ; l is a linker ; x is selected from the group consisting of a substrate , a reactive site that can covalently couple to a substrate . in preferred embodiments , x or l - x is an alcohol or a thiol . in some embodiments l - x can be eliminated and replaced with a substituent independently selected from the same group as s 1 or s 2 . other suitable molecules include , but are not limited to 5 -[ 4 -( s - acetylthiomethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -[ 4 -( mercaptomethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -[ 4 -( hydroxymethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -[ 4 -( hydroxymethyl ) phenyl ]- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( 4 - allylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - formylphenyl )- 15 - phenyl - 10 , 20 - di - p - tolylporphinatozinc ( ii ), 5 -( 4 - bromomethylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - ethynylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - iodophenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - bromophenyl )- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( 4 - hydroxyphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 , 10 - bis ( 4 - ethynylphenyl )- 15 , 20 - dimesitylporphinatozinc ( ii ), 5 -[ 4 -( 4 , 4 , 5 , 5 - tetramethyl - 1 , 3 , 2 - dioxaborolan - 2 - yl ) phenyl ]- 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 - iodo - 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 , 10 - bis ( 4 - iodophenyl )- 15 , 20 - dimesitylporphinatozinc ( ii ), 5 -[ 4 -( 2 -( trimethylsilyl ) ethynyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 , 15 - bis ( 4 - ethynylphenyl )- 10 , 20 - dimesitylporphinatozinc ( ii ), 5 , 15 - bis ( 4 - iodophenyl )- 10 , 20 - dimesitylporphinatozinc ( ii ), 5 , 10 , 15 - tris ( 4 - ethynylphenyl )- 20 - mesitylporphinatozinc ( ii ), 5 , 15 - bis ( 4 - ethynylphenyl )- 10 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 , 15 - bis ( 4 - ethynylphenyl ) porphinatozinc ( ii ), 5 , 15 - bis ( 3 - ethynylphenyl )- 10 , 20 - dimesitylporphinatozinc ( ii ), 5 , 10 , 15 , 20 - tetrakis ( 4 - ethynylphenyl ) porphinatozinc ( ii ), 5 , 10 - bis [ 4 -( 2 -( trimethylsilyl ) ethynyl ) phenyl ]- 15 , 20 - dimesitylporphinatozinc ( ii ), 5 -( 3 , 5 - diethynylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 3 , 7 - dibromo - 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 -[ 4 -( 2 -( trimethylsilyl ) ethynyl ) phenyl ]- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -[ 4 -( se - acetylselenomethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - iodophenyl )- 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 , 10 - bis ( 4 - ethynylphenyl )- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 , 10 - bis ( 4 - ethynylbiphen - 4 โฒ- yl )- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 -( 4 - vinylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - vinylphenyl )- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( hydroxymethyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - allylphenyl )- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( 4 - allylphenyl )- 10 , 15 , 20 - tri - p - tolylporphinatocopper ( ii ), type c triple decker [( tert - butyl ) 4 phthalocyaninato ] eu [( tert - butyl ) 4 phthalocyaninato ] eu [ 5 , 15 - bis ( 4 - ethynylphenyl )- 10 , 20 - bis ( 4 - tert - butylphenyl ) porphyrin ], type c triple decker [( tert - butyl ) 4 phthalocyaninato ] eu [( tert - butyl ) 4 phthalocyaninato ] eu [ 5 -[ 4 -[ 2 -( 4 -( hydroxymethyl ) phenyl ) ethynyl ] phenyl ]- 10 , 15 , 20 - tri - p - tolylporphyrin ] 5 , 10 - bis [ 4 -( 2 -( triisopropylsilyl ) ethynyl ) biphen - 4 โฒ- yl ]- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 , 10 - bis [ 4 -( 2 -( triisopropylsilyl ) ethynyl ) phenyl ]- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), and the like . control over the hole - storage and hole - hopping properties of the redox - active units of the redox - active molecules used in the memory devices of this invention allows fine control over the architecture of the memory device . such control is exercised through synthetic design . the hole - storage properties depend on the oxidation potential of the redox - active units or subunits that are themselves or that are used to assemble the redox - active storage media used in the devices of this invention . the hole - storage properties and redox potential can be tuned with precision by choice of base molecule ( s ), associated metals and peripheral substituents ( yang et al . ( 1999 ) j . porphyrins phthalocyanines , 3 : 117 - 147 ). the design of molecules for molecular memory is discussed in detail in u . s . pat . nos . 6 , 272 , 038 , 6 , 212 , 093 , and 6 , 208 , 553 , and pct publication wo 01 / 03126 . in still another embodiment , this invention provides kits for practice of the method of this invention or for use of the materials produced by methods of this invention . in one embodiment , the kit comprises one or more reagents used to couple an organic molecule to a type ii , iii , iv , v , or vi material according to the methods of this invention . such reagents include , but are not limited to reagents for cleaning and / or passivating the material surface , and / or the organic molecule ( s ) that are to be coupled to the surface , and / or attachment molecules for derivatizing the organic molecule ( s ) ( e . g ., reagents for derivatizing an organic molecule with an alcohol or a thiol ), and / or solvents for use in coupling the derivatized organic molecule to the surface , and / or reagents for washing the derivatized surface , and the like in certain embodiments , the kits comprise a type ii , iii , iv , v , or vi material having a heat - resistant organic molecule ( e . g ., a redox - active molecule ) coupled thereto as described herein . the type ii , iii , iv , v , or vi material can , in certain embodiments , comprise a molecular memory and in , certain embodiments , comprise a sensor . in addition , the kits can optionally include instructional materials containing directions ( i . e ., protocols ) for the practice of the methods of this invention . preferred instructional materials provide protocols utilizing the kit contents for coupling a heat - resistant organic molecule to a type ii , iii , iv , v , or vi material according to the methods of this invention , and / or for using type ii , iii , iv , v , or vi materials having coupled organic molecules as memory elements or as sensors . while the instructional materials typically comprise written or printed materials they are not limited to such . any medium capable of storing such instructions and communicating them to an end user is contemplated by this invention . such media include , but are not limited to electronic storage media ( e . g ., magnetic discs , tapes , cartridges , chips ), optical media ( e . g ., cd rom ), and the like . such media may include addresses to internet sites that provide such instructional materials . the following examples are offered to illustrate , but not to limit the claimed invention . molecules can perform in electronic devices under real - world processing and operating conditions the central tenet of the field of molecular electronics is that molecular components can be used as functional elements in place of the semiconductor - based devices present in conventional microcircuitry ( kwok and ellenbogen ( 2002 ) materials today , 28 - 37 ; carroll and gorman ( 2002 ) angew . chem . int . ed . 41 : 4378 - 4400 ). to serve in this role , the molecular components should remain robust under daunting conditions including high - temperature ( e . g ., 400 ยฐ c .) processing steps during manufacture and very large numbers ( 10 9 - 10 12 ) of operational cycles over a lifetime ( international technology roadmap for semiconductors ( itrs ), semiconductor industry association , san jose , calif . ( 2000 )). there has been considerable skepticism whether molecular materials possess adequate stability to meet such requirements . herein , we demonstrate that porphyrin - based information storage media meet the processing and operating challenges required for use in computational devices . our approach for molecular - based information storage employs redox - active porphyrin molecules as charge - storage elements ( roth et al . ( 2000 ) vac . sci . technol . b 18 : 2359 - 2364 ). we have shown that these molecules can be covalently attached to device - grade silicon platforms to form the basis of first - generation hybrid molecular / semiconductor devices ( roth et al . ( 2003 ) j . am . chem . soc . 125 : 505 - 517 ). the porphyrin - based information storage elements exhibit charge - retention times that are long ( minutes ) compared with those of the semiconductor elements in dynamic random access memory ( milliseconds ) ( roth et al . ( 2000 ) vac . sci . technol . b 18 : 2359 - 2364 ; roth et al . ( 2003 ) j . am . chem . soc . 125 : 505 - 517 ). these molecules also exhibit redox characteristics that make them amenable for use as multibit information - storage media . fig5 a shows the cyclic voltammetric behavior of a porphyrin monolayer tethered to si ( 100 ) via a si โ o โ c linkage . this monolayer was formed by placing a small amount (ห 1 ฮผl ) of a dilute solution (ห 100 ฮผm ) on a micron - scale photolithographically patterned , hydrogen - passivated si ( 100 ) platform and baking the sample at 400 ยฐ c . for several minutes under inert atmosphere conditions . the voltammetric response of the porphyrin monolayer is identical to that of porphyrin monolayers formed at much lower temperatures ( 100 - 200 ยฐ c . for several hours ) ( roth et al . ( 2003 ) j . am . chem . soc . 125 : 505 - 517 ) and demonstrates that molecular integrity is maintained at temperatures where most organic molecules thermally decompose . the high - temperature procedure is readily adaptable to current semiconductor fabrication technology and has the important added benefit that extremely small quantities of material are needed to make a device . the robustness of the porphyrin information - storage medium was examined by repeatedly performing the cycle of ( 1 ) oxidizing the electrically neutral monolayer and ( 2 ) reducing the resulting positively charged monolayer to its electrically neutral state . the oxidation event is equivalent to writing a bit of information ; the reduction event is equivalent to erasing or destructively reading out the information . the five voltammograms in fig5 a show the response of the system after 0 , 2 . 5 ร 10 4 , 1 . 8 ร 10 6 , 1 . 1 ร 10 9 , and 1 . 0 ร 10 10 oxidation / reduction cycles . during the experiment , the nature of the electrical cycling was varied . on some days , the system was continuously cycled for 24 hrs . on others , cycling was stopped intentionally for periods ranging from a few minutes up to 12 hrs . at one point , cycling was stopped unintentionally due to an electrical power failure . the data indicate that after an initial โ burn - in โ period of ห 10 7 cycles the voltammetric response stabilizes . this robustness of the system is further illustrated in fig5 b wherein the integrated voltammetric signal ( corresponding to the charge in the monolayer ) is plotted as a function of the number of cycles . these data indicate that the charge - storage characteristics of the monolayer exhibit minimal variation ( few percent ) over the course of the entire experiment . at the time cycling was arbitrarily stopped (& gt ; 10 10 cycles ; ห 27 days ), the system showed no signs of degradation . collectively , these data indicate that the porphyrin - based information storage medium is extremely robust and augur well for the use of selected molecules in hybrid molecular / semiconductor electronic devices . it is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims . all publications , patents , and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes . | 8 |
referring to the drawings in detail , depicts a conventional hair clipper 1 is provided with the bottom blade 2 attached at the front end of the clipper 1 with the usual reciprocating blade 3 mounted above the bottom fixed blade 2 and having a space 20 between the two blades . on the underside of the clipper 1 , the wedge 5 can be mounted . the hair clipper blade illustrated is a conventional example of one type of hair clipper on which the invention may be mounted . the wedge 5 can be one piece ( as shown in fig4 ) or two pieces ; the preferred embodiment is in two pieces . the wedge 5 is made up of a left portion 6 and a right portion 7 which are generally mirror images of each other . each portion has a top side 8 and 9 , respectively , a bottom side , 10 and 11 , respectively , and a predetermined angle 12 in the range of 1 degree to 90 degrees formed at an apex 50 . the bottom sides , 10 and 11 , can easily slide or glide over a cutting surface 30 , allowing for hair 40 to pass through the bottom fixed blade 2 and the reciprocating blade 3 to get cut . the uncut hair then passes under the bottom sides . the wedge 5 supports the clipper 1 at a selected angle 12 and retains the blades 2 and 3 at a desired elevation and angle relative to the cutting surface 30 . at the outside leading edge 13 of each top side of the portions is fixedly mounted is a front leading - edge tab 14 , a rear leading - edge tab 15 , and a back tab 16 which slide into the space 20 and frictionally grip the bottom blade 2 . the left portion 6 has a fixedly mounted protruding clip 17 which aligns with the receiving dip 18 on the right portion 7 . the protruding clip 17 is inserted into the receiving clip 18 which secures the left portion and the right portion to form the wedge 5 as a whole . the user can depress the nodule 19 on the protruding clip to release the protruding clip from the receiving clip which will release the left and right portions which can then be removed from the bottom blade . there are various attachment mechanisms that would allow the wedge to remain as a fixed , but removable , attachment to the clipper besides the frictional gripping of the portions by the tabs mentioned above . limiting movement of the wedge upon the clippers is paramount . other attachment mechanisms could include magnets , screws , hook and loop material , or any other suitable manner . it is to be noted that with the attachment of the wedge 5 to the clippers 1 , the bottom blade 2 and reciprocating blade 3 is disposed in a downward direction toward the cutting surface 30 forming a constant angle 12 as long as the bottom side of the wedge is sliding along the cutting surface whereby the blades of the clipper is positioned close to , but nevertheless spaced above , the cutting surface so as to cut the hair to a uniform , length . the foregoing description is for purposes of illustration only and is not intended to limit the scope of protection accorded this invention . the scope of protection is to be measured by the claims , which should be interpreted as broadly as the inventive contribution permits . the wedge 5 can also be attached to the clipper 1 by a magnet 60 . the wedge 5 can also be attached to the bottom fixed blade 2 by penetrating screws 70 . although exemplary embodiments of the invention have been shown and described , many changes , modifications and substitutions may be made by one having ordinary skill in the art without necessarily departing from the spirit and scope of this invention . | 1 |
in the following description , certain specific details are set forth in order to provide a thorough understanding of various embodiments of the invention . however , one skilled in the art will understand that the invention may be practiced without these details . in other instances , well - known structures associated with computers , computer networks , data structures , databases and networks such as the internet , have not been described in detail to avoid unnecessarily obscuring the descriptions of the embodiments of the invention . unless the context requires otherwise , throughout the specification and claims which follow , the word โ comprise โ and variations thereof , such as โ comprises โ and โ comprising โ are to be construed in an open , inclusive sense , that is as โ including but not limited to .โ [ 0017 ] fig1 shows a parts identification and tracking system 10 including a number of client computing systems 12 and a server computing system 14 that communicate over a network , such as the world wide web portion of the internet 18 . the client computing systems 12 each include a display 20 , screen 22 , cabinet 24 , keyboard 26 and mouse 28 . the mouse 28 can have one or more user selectable buttons for interacting with a graphical user interface (โ gui โ) displayed on the screen 22 . the cabinet 24 includes a slot 30 for receiving computer - readable media , such as a cd - rom disk 32 . although the computer - readable media is represented as a cd - rom disk 32 , the parts identification and tracking system 10 can employ other computer - readable media , including but not limited to , floppy disks , tape , flash memory , system memory , and hard drives . the server computing system 14 includes a cabinet 24 having a slot 30 for receiving computer - readable media , such as a cd - rom disk similar to the cd - rom disk 32 . the server computing system 14 can optionally include a display , screen , keyboard , and / or mouse as described above . the server computing system 14 also includes a server database 34 . the server database 34 is shown as being external to the cabinet 24 for ease of representation in the drawings , although in many embodiments the server database 34 can be located within the cabinet 24 . the network 18 can take the form of any conventional network , such as one or more local area networks (โ lans โ), wide area networks (โ wans โ), and / or extranets , intranets , or the internet . [ 0020 ] fig2 shows a system block diagram of the client computing systems 12 used in executing an illustrated embodiment of the present invention . as in fig1 the client computing systems 12 each include the display 20 , keyboard 26 and mouse 28 . additionally , each of the client computing systems 12 can include subsystems , such as a processor 36 , system memory 38 , fixed persistent memory 40 , media drive 42 , display adapter 44 , sound card 46 , speakers 48 , and network interface 50 . arrows 52 represent the system bus architecture of the client computing systems 12 . the client computing systems 12 can take any of a variety of forms , such as a micro - or personal computer , a mini - computer , a workstation , or a palm - top or hand - held computing appliance . the processor 36 can take the form of any suitable microprocessor , for example , a pentium ii , pentium iii , power pc 603 or power pc 604 processor . the system memory 38 can take the form of random access memory (โ ram โ) or other dynamic storage that temporarily stores instructions and data for execution by the processor 36 . the fixed persistent memory 40 can take the form of a hard drive or other nonvolatile computer - readable media . the media drive 42 can take the form of a cd - rom reader , dvd reader , optical disk reader , floppy disk reader , or other similar device that reads instructions and / or data from computer - readable media . while not shown in detail , the server computing system 14 can have a similar structure to the client computing systems 12 , as shown in fig2 . in practice , the server computing system will typically take the form of a web server , the details of which are commonly understood by those skilled in the art . the server computing system 14 employs database software , such as structured query language (โ sql โ) software , to store and retrieve data within the server database 34 . the computing systems 12 , 14 are illustrative of the numerous computing systems suitable for use with the present invention . other suitable configurations of computing systems will be readily apparent to one of ordinary skill in the art . other configurations can include additional subsystems , or fewer subsystems , as is suitable for the particular application . for example , a suitable computing system 12 , 14 can include more than one processor 36 ( i . e ., a multiprocessor system ) and / or a cache memory . the arrows 52 are illustrative of any interconnection scheme serving to link the subsystems . other suitable interconnection schemes will be readily apparent to one skilled in the art . for example , a local bus could be utilized to connect the processor 36 to the system memory 38 and the display adapter 34 . [ 0024 ] fig3 shows a portion of a bill of material data structure 40 for a particular machine , such as a power turbine . the bill of material data structure 40 is illustrated as a bill of material table 42 including parts information for the various parts of the machine , although other formats may be suitable . the bill of material data structure 40 can take the form of an computer - readable file resulting directly from the design / manufacturing process , or can be an computer - readable file populated from a prior existing set of legacy data , such as by typing or scanning data from a paper bill of material . the bill of material table 42 includes a number of rows 44 corresponding to the individual parts and / or groups of parts forming the machine . the bill of material table 42 includes a number of columns for detailing information regarding each of the parts . for example , a โ unit identifier โ column 46 (โ unit num โ) contains an identifier such as a serial number for a unit to which the corresponding part belongs . the unit identifier can , for example , identify a model of machine . a โ parent โ column 48 (โ mpl items โ) identifies a assembly or sub - assembly to which the part belongs , if any . for example , a joint vent tube is a component of a connection joint insulation and hardware assembly . a โ parent part description โ column 50 (โ parent part desc โ) provides a brief textual description of the assembly or sub - assembly . often , the designers and engineers create the brief textual description , and intend the description only for internal use . thus , the brief textual description is typically cryptic , employing jargon such as abbreviations and acronyms that are not readily understood by those who are not intimately familiar with the machine . for example , the textual description for a connection joint insulation and hardware sub - assembly may be โ b7k - joint insul & amp ; hdwr .โ a โ child part identifier โ column 52 (โ child part โ) contains an identifier such as a serial number identifying the part to which the row corresponds . a โ child part description โ column 54 (โ child part desc โ) includes a brief textual description of the part . again , the legacy textual description is likely to employ jargon such as abbreviations and acronyms that are not readily understood by those who are not intimately familiar with the machine . for each of the parts , a โ quantity description โ column 56 (โ quantity โ) identifies the number of the corresponding parts for the machine , assembly and / or sub - assembly . a โ unit of measure โ column 58 (โ um โ) identifies the units of measure in which the quantity is specified . for example , the unit of measurement can be โ each โ (โ ea โ) referring to each individual part . an โ mpl item number โ column 60 (โ mli โ) contains a part identifier from the original master parts list . in many cases , the part identifier is the only piece of part information that is not lost or changed as the master parts list evolves into the bill of materials . a โ distribution code โ column 62 (โ code โ) identifies a distribution code for the part . a โ category identifier โ column 64 (โ category โ) identifies a category to which the part belongs . for example , a part may form a portion of a stator (โ s โ) of a turbine . [ 0027 ] fig3 also shows a portion of a translation data structure 66 for company &# 39 ; s machines . the translation data structure 66 is illustrated as a translation table 68 including parts information for the various parts , assemblies and / or sub - assemblies . the parts identification and tracking system 10 generates the translation data structure from the bill of materials data structure 40 , with or without human assistance . a single translation data structure 66 can store all the parts information for one or more machines . thus , the company can make available a single parts listing for each of its products . the translation table 68 includes a number of rows 70 corresponding to each of the individual parts and / or groups of parts . the translation table 68 also includes a number of columns for detailing information regarding each of the parts . several of these columns are similar to the columns from the bill of material table 42 . for example , an โ mpl item number โ column (โ mli โ) 72 is similar to the โ mpl item number โ column 60 of the bill of material table 42 , containing the part identifier from the original master parts list . a โ distribution code โ column 74 (โ code โ) is similar to the โ distribution code โ column 62 of the bill of materials table 42 , containing a distribution code for the part . a โ category identifier โ column 76 (โ category โ) is similar to the โ category identifier โ column 64 of the bill of materials table 42 , containing an identifier corresponding to the category to which the part belongs . additionally , the translation table 68 includes a โ title โ column 78 (โ title โ), containing a title for the part . the translation table 68 also includes a โ plain language title โ column 80 (โ extranet title if different from title โ) containing a plain language version of the title or description of the part . the plain language version of the title or description is written to clearly identify the part to those who would likely be searching for the part , such as a technician or repair person . the parts identification and tracking system 10 employs a user interface (โ ui โ) for allowing users , such as technicians and repair persons , to identify and / or order replacement parts . the parts identification and tracking system 10 implements the ui functionality in software which can reside on the server computing system 14 and / or the client computing system 12 . for example , the ui can take the form of a web site having one or more web pages hosted on the server computing system 14 . the web pages are transmitted to the client computing systems 12 in response to requests placed by web browsers executing on the client computing systems 12 . alternatively , the ui can take the form of one or more screens stored in the memory 38 of the client computing system 12 , or the server computing system 14 . in response to a user query made via the ui , the server computing system 14 makes one or more database quires of the bill of materials data structure 40 and the translation data structure 66 to generate a response providing requested parts information . the response can take the form of a response data structure 82 . the response data structure 82 is illustrated as a response table 84 , although other formats may be suitable . the response table 84 includes a number of rows 86 corresponding to parts and groups of parts satisfying the parameters of the user query . the response table 84 also includes a number of columns for detailing information regarding each of the parts . for example , a โ title โ column 88 (โ title โ) includes a title for the part or group of parts . a โ part number โ column 90 (โ part #โ) includes the corresponding identifier from the โ parent โ column 48 or โ child part identifier โ column 52 of the bill of material table 42 . a โ bill of material quantity โ column 92 (โ bom qty โ) includes the corresponding number of parts from the โ quantity description โ column 56 of the bill of material table 42 . an โ assembly โ column 94 identifies whether the corresponding row identifies an individual part or a group of parts ( e . g ., assembly , sub - assembly ). for example , if a row such as row 96 includes a checkbox 98 in the โ assembly โ column 94 , the row 96 corresponds to a group of parts . otherwise , the row 86 corresponds to an individual part . the user can select the checkbox 98 to view the individual parts of the group of parts . a check 100 in the checkbox 98 provides a visual indication that the user has selected the checkbox 98 . a notation โ part break down โ in row 102 indicates that the parts that follow belong to the group of parts . some or all of the information from the response data structure 82 can be provided to the user , for example via the display 20 of the client computing system 12 . the plain language title 80 provided in the translation table 68 allows people unfamiliar with the precise naming convention employed by designers of the machine to successfully search the parts information . [ 0034 ] fig4 shows a method 104 of providing legacy parts information in a computer - searchable form , that begins at a start step 106 . the method 104 may employ legacy parts information in electronic form , or may require the conversion of legacy parts information from paper form to electronic form , for example by keying or scanning . in particular , fig4 shows the creation of the translation data structure 66 of fig3 . in step 108 , the parts identification and tracking system 10 identifies a part using a part identifier . for example , the parts identification and tracking system 10 can employ the mpl item number from the โ mpl item number โ column 60 of the bill of material table 42 ( fig3 ). in step 110 , the parts identification and tracking system 10 creates an entry in the computer - searchable database 34 ( fig1 ) corresponding to the part . in step 112 , the parts identification and tracking system 10 provides a category identifier in the computer - searchable database 34 . the category identifier identifies a category to which the part belongs , if any . for example , the parts identification and tracking system 10 can employ the category identifier from the โ category identifier โ column 64 of the bill of material table 42 ( fig3 ). this allows a user to quickly identify a needed part based on the part &# 39 ; s functionality within a system or subsystem . for example , all stator related parts can be rapidly identified . in step 114 , the parts identification and tracking system 10 provides a distribution code the computer - searchable database 34 . the distribution code can identify a salable part or group of parts as a salable unit , filtering out non - salable items from the machine parts list or bill of material such as raw material , manufacturing operations , manufacturing processes and strategic parts not intended to be sold as stand alone parts . for example , the parts identification and tracking system 10 can employ โ distribution code โ column 62 of the bill of materials table 42 ( fig3 ). this is particularly useful where the parts are intended to be sold via electronic commerce . the parts identification and tracking system 10 can ensure that the user only selects parts in predefined packages . this results in the user receiving all of the parts necessary for a particular repair or rehabilitation job . this also permits the company to pre - package parts , which can later be easily and quickly shipped upon request . in step 116 , the parts identification and tracking system 10 provides a plain language title and / or description in the computer - searchable database 34 . the plain language title can be entered by a human , or the parts identification and tracking system 10 can automatically generate the plain language title / description by automatically substituting plain language words for previously defined jargon such as abbreviations and acronyms . in step 118 , the parts identification and tracking system 10 determines if all of the parts for the machine have been entered into the translation data structure 66 . if last part has been entered , the method 104 terminates at an end step 120 . if not , control returns to step 108 for creating an entry in the translation data structure 66 for the next part . [ 0040 ] fig5 shows a method 122 of accessing parts information , that starts at step 124 . in step 126 , the parts identification and tracking system 10 receives a search request in the form of a plain language parts description . for example , a user can submit a plain language description of the part to the server computing system via the keyboard and / or mouse of the client computing system . in step 128 , the parts identification and tracking system 10 automatically locates at least one machine part that corresponds to the received plain language parts description . for example , the server computing system 14 can employ a database query of the โ plain language title โ column 80 of the translation table 68 ( fig3 ). in step 130 , the parts identification and tracking system 10 transmits part information to the user for a corresponding salable part . for example , the server computing system 14 can transmit parts information as web page to the client computing system 12 . the method 122 terminates at end step 132 . although specific embodiments , and examples for , the invention are described herein for illustrative purposes , various equivalent modifications can be made without departing from the spirit and scope of the invention , as will be recognized by those skilled in the relevant art . the teachings provided herein of the invention can be applied to other parts tracking and distribution systems , not necessarily the exemplary machine parts tracking and distribution system generally described above . for example , the teachings can be employed with a tracking and identification system for products other than machines . the various embodiments described above can be combined to provide further embodiments . the system can employ communications channels other than the internet , for example lans , or wans . additionally , or alternatively , the described methods can omit some steps , can add other steps , and can execute the steps in other orders to achieve the advantages of the invention . these and other changes can be made to the invention in light of the above detailed description . in general , in the following claims , the terms used should not be construed to limit the invention to the specific embodiments disclosed in the specification , but should be construed to include all computers , networks and distribution systems that operate in accordance with the claims . accordingly , the invention is not limited by the disclosure , but instead its scope is to be determined entirely by the following claims . | 6 |
the method of the invention uses non - invasive sensors placed at one or more sites on a patient &# 39 ; s body to monitor primary and reference parameters , as follows : a non - invasive sensor array that includes sensors for emg , amg ( in the below - described study ), and peripheral temperature ( fig1 a ) is placed at each monitor site ; ekg and reference sensors are applied where and / or as appropriate ( fig1 b ). splash - proof coverings can be used to protect each monitor site . to discriminate the cephalo - caudal spatial effect of the neural block it is preferable to use multiple monitor sites as shown in fig1 . in the clinical tests described below , three specific sites were identified for use : the fourth thoracic dermatome ( nipple , t4 ) and tenth thoracic dermatome ( umbilicus , t10 ) levels on the anterior axillary line and the anterior of the thigh , representing the second lumbar dermatome ( l2 ). for muscle innervation the level and density of the neural blockade is quantified by , respectively , the placement of the sensor array and a change in the signal amplitude of the surface emg , wherein the density is inversely proportional to the signal amplitude . for skin temperature , the level and density of the neural blockade is quantified by , respectively , the placement of the sensor array and a change in skin temperature , wherein the density of the neural blockade is directly proportional to skin temperature . finally , for heart rate , the level and density of the neural blockade are quantified by a change in heart rate , wherein the density of the neural blockade is inversely proportional to heart rate . the invention was demonstrated in a study involving seven men ( table 1 ) who were all undergoing elective radical retropubic prostatectomy using lumbar epidural blockade . table 1______________________________________subject demographics epi - time - to - sub - age weight asa dural incisionject ( years ) ( kg ) status site ( min ) notes______________________________________1 55 85 . 7 2 l4 - 5 n / a combined ga and regional due to history of apnea ; epidural dosed after incision2 42 83 2 l4 - 5 17 . 03 47 78 2 l2 - 3 17 . 74 63 104 2 l2 - 3 12 . 55 55 103 2 l3 - 4 15 . 06 65 110 2 l3 - 4 29 . 3 converted to combined ga and regional7 60 88 2 l - 5 15 . 5______________________________________ time from main epidural dose to start of incision spontaneous surface electromyogram ( emg ), acoustomyogram ( amg ) and temperature ( t ) measurements were made along the anterior axillary line at t4 , t10 , and l2 dermatomal levels along with lead - ii electrocardiogram ( ekg ). reference measurements included tympanic and ambient temperature , and ambient sound . as discussed below , time - series data were acquired before epidural dosing and at predefined intervals after dosing . a dedicated pc - based system provided system control and data storage . based on the predicted temporal response to epidural dosing , data epochs were collected immediately prior to the main epidural dose ( baseline ) and at 2 , 5 , 10 , 15 , 20 , 25 , 30 , 45 , 60 , 75 , and 90 minutes after dosing . the epochs were designed to have a minimum duration of 20 seconds . temperature data records were time - continuous , starting immediately after the thermocouples were placed and ending approximately 2 minutes after the last emg / amg / ekg sampling epoch . table 2 below summarizes the data acquisition conditions for the parameters of interest . table 2______________________________________data acquisition conditions for monitored parameters sampling rate no . ofparameter passband ( hz ) ( sec . sup .- 1 ) channels______________________________________amg 0 . 5 - 100 1000 4ekg 2 - 100 1000 1emg 10 - 500 2000 3temperature dc - 0 . 02 0 . 2 6______________________________________ as discussed below , root - mean - square ( rms ) of emg and amg , average t , and average heart rate ( r - r interval ) were assessed for the levels as a function of time relative to epidural dosing . changes in objectively monitored variables were compared to qualitative assessment ( e . g ., pinch test ) of the block effectiveness . both emg and amg are broadband signals that contain information in the time and frequency domains . what is needed is a single derived value that is descriptive of the instantaneous physiological condition of the patient . typically , the power in the signal provides such an indication in the time domain . power is proportional to the square of the amplitude of the signal . and , for a signal that has a non - constant ( e . g ., alternating current ) component , it is necessary to average over a finite period of the signal in order to generate a meaningful value . emg assessments have traditionally computed the average rectified emg ( aremg ) or the rectified integrated emg ( riemg ), given by : ## equ1 ## the historical computation methods are clearly not power indicators , so the invention uses the root - mean - square ( rms ) estimator : ## equ2 ## ( note , other methods , e . g ., spectral analysis , bi - spectral analysis , etc ., may also be useful . the gradient of the signals may also provide useful information .) regardless of the method used , selection of the integration interval ( i . e ., the value of n ) is an important factor . the value of n is inversely proportional to the upper frequency response characterized by the computation . an integration interval was selected that retained as much of the passband information as is practical . emg are integrated over 50 msec ( n = 100 ) and amg signals are integrated over 250 msec ( n = 250 ). many discrete rms computations are possible within 20 - second sampling epochs . running rms values are computed . the rms value at t = 0 includes the first n data points in a series . subsequent rms values incrementally delete the earliest data point and add the next latest point of the series . the minimum value of the computed rms sequence is selected as representative of the muscle - only condition for any pre - defined sampling epoch . the time - series data from the study subjects demonstrated that emg and amg signals contained noise artifacts that correlated to the use of the electrocautery , suction , and other electronic systems . the slope and intercept of the frequency spectra of the data were used as acceptance criteria to validate that the rms data values were devoid of noise . the absolute value of emg signals can be influenced by conditions such as skin conductance , skin temperature , electrode displacement , and site preparation . to mitigate discrepancies , the emg data were normalized , which involved applying a gain factor that resulted in an expansion or compression of the histogram of the raw data sets . based on a common time epoch for all study subjects , emg data were normalized such that the basis histogram contained 50 % of all data values between ยฑ 5 mv . other epochs were scaled by the same gain factor calculated for the basis . it was apparent that amg signal artifacts were correlated to motions directly induced by the surgeons or indirectly induced by movements near the patient . amg data are compensated , on a sample - by - sample basis , for the presence of acoustically transmitted noise by subtraction of the ambient signal level . changes in skin temperature are adversely influenced by changes in both body core temperature and ambient air temperature . to accommodate these conditions , the raw ( t dl , si ) dermatome temperature value is standardized ( t dl , si ) by the tympanic and ambient temperatures as in the following : where dl is the dermatome level and si is the sampling interval . si = 0 correlates to the data epoch before the main epidural dose . standardized temperature data were then parsed into 20 - second segments that correlated with the emg / amg / ekg sampling epochs . the average of each of the normalized epochs was computed as a simple arithmetic mean of the data . each study subject &# 39 ; s average heart rate was determined from the lead - ii ekg data sets . the average for the 20 - second data intervals was computed as a simple arithmetic mean of the related r - to - r intervals . the occurrence of the leading edge of the r peak was determined by an automated algorithm . the data revealed three notable aspects of the emg signals . first , emg signal amplitude decreased at a rate inversely related to the number of dermatomal levels separating the monitor site and the epidural catheter . that is , the signals at the more cephalad dermatomal levels decreased later than the more caudal levels . second , after a period of time ( between 15 and 30 minutes ), all emg signal amplitudes assumed a generally constant and lower level than at initiation of the primary dose . third , the constant level at the l2 dermatomal level was approximately 30 % lower than that of the t4 and t10 dermatomal levels , perhaps indicating that effective block was created at this discrete level simply by the test dose . average temperature trends for the tympanic - and ambient - compensated data all showed a gradual increase as a function of time ; longer onset was noted at more rostral dermatomal levels . heart rate increased by an average of 7 . 8 ยฑ 9 . 2 bpm to 10 minutes following initiation of the primary dose , then decreased an average of 19 . 0 ยฑ 10 . 8 bpm in the following 15 minutes . in sum , temporal changes in emg , skin surface temperature , and heart rate were associated with adequate blockade and correlated to the clinical assessment of the level and density of the block . during block onset the rms emg signal level decreased & gt ; 15 mv , temperature increased & gt ; 1 ยฐ c ., and ekg decreased & gt ; 7 beats per minute ( bpm ). amg showed primary correlation to external influences ; response to the block was not evident in the presence of noise . fig2 shows a set of curves of the rms emg signal amplitudes for all seven subjects . the data are fifth - order polynomial curves fit to the normalized signal amplitudes for the seven study subjects at each of three monitor levels . the plot also indicates the typical dermatomal level of blockage achieved , according to pinch tests administered by the attending anesthesiologist . time is referenced to the administration of the main epidural dose ( t = 0 ) and the baseline data set is plotted at t =- 1 minute . the traces are normalized to the baseline by subtracting the respective baseline value from each successive data point . the time between the main dose and the surgical incision was 17 ยฑ 6 minutes . lower amplitude limits of the l2 and t10 signals are reached sooner ( t = 15 minutes ) than the t4 signal ( t = 30 minutes ). this suggests that the l2 and t10 levels achieve onset before the t4 level , as expected . fig3 presents average temperature data for the dermatomal levels for all seven subjects . all levels exhibit the same upward trend as a function of time ; they approach a relative increase of approximately 3 . 5 ยฐ c . over the 90 - minute data collection period . the changes in temperature reflect the effect of sympathectomy upon administration of local anesthetic . these changes also suggest differences in the contribution of blood volume changes and vascular relaxation at each dermatomal level . the average heart rate for all seven subjects is shown in fig4 . these data conform to the previously reported effect of local anesthetic on the cardiac accelerator fibers in the t1 - t4 spinal segments . the use of passive and non - invasive monitors to objectively distinguish the level and density of neural blockade as a function of time , and as related to the administration of local anesthetic , has been examined . the data from the emg , temperature , and ekg monitors , combined with the clinical assessment provided by the anesthesiologist and the conditions of the operative procedure , confirm that an objective measure of block level and density can be performed in the clinical setting . a universal neural blockade monitor must be fully functional regardless of when it is applied , relative to the administration of the anesthetic agent . the rate of change , or gradient , of the absolute signals presents salient information . the most compelling indicator is the change in emg signal level between the time of zero minutes and 10 minutes , as shown in fig2 . level l2 decreases approximately 1 . 5 times that of t10 and 2 . 5 times that of t4 . using the monitored parameters in combination rather than singly will enhance the utility of a universal monitor . the weighted summation of emg and temperature will likely satisfy the basic requirement for a level - discriminating determination of block density . the method of the invention can be integrated into an automated system for controlling drug delivery to the patient or simply notifying the physician or nurse about patient status , e . g ., during post - op recovery . the invention is also applicable to use with animal patients . the onset of neural blockade can be objectively monitored by placement of one or more sensors and quantifying a decrease in signal amplitude of a surface emg ; an increase in skin temperature ; and changes in heart rate . moreover , the blockade density determined by these objective means appears to compare favorably with the traditional subjective method of pinch - tests . the invention provides the anesthesiologist with a passive , objective tool for real - time , non - invasive monitoring of the level and density of neural blockade . | 0 |
referring to fig1 - 2 , a robotic handler 2 for moving a wafer 4 has two primary components , namely , a robotic arm 6 and an end effector 8 attached to one end of robotic arm 6 . end effector 8 is used to grab , hold and orient a wafer 4 . robotic arm 6 , which includes various motors and mechanical mechanisms not shown in the figures , moves end effector 8 and the wafer that it holds within its grasp . wafer 4 is typically a circular disk of semiconductor material , e . g . silicon . it generally is of uniform thickness and has an alignment feature 11 at one location on its circumference . alignment feature 11 is typically a v - shaped notch , as depicted in fig1 - 2 . the alignment feature serves as a reference that can be used to align the wafer to a known orientation . as will be described in greater detail below , end effector 8 includes a frame 9 attached to robotic arm 6 and a movable drive housing 10 for grasping and rotating wafer 4 as it is being held by the end effector . the end effector also includes sensor circuitry 100 for detecting the alignment feature and thereby determining and establishing the orientation of wafer 4 . in the described embodiment , the gripping mechanism includes two pairs of idler rollers 12 a - b and 12 c - d mounted at the remote ends of a support frame 9 , and a pair of drive rollers 12 e - f mounted in a drive housing 10 . all of the rollers 12 a - 12 f are arrayed in a common plane having parallel axes of rotation . referring to fig1 - 3 , drive housing 10 includes bearings 22 and 24 , and bearing 26 , that slide over shafts 30 and 32 , respectively . shafts 30 and 32 are connected at one end to frame 9 . drive housing 10 also includes a linear drive motor 34 that has a splined drive shaft 36 extending into a gear chamber 60 . splined shaft 36 is connected to mesh with a gear 38 that is connected to mesh with linear shaft 32 . thus , in response to a control signal , the rotational movement of drive shaft 36 causes housing 10 ( and drive rollers 12 e - f ) to move towards , or away from , idler roller pairs 12 a - b and 12 c - d . when housing 10 is moved away from idler roller pairs 12 a - b and 12 c - d , a separation space 40 ( see fig1 ) becomes large enough to accept wafer 4 ( separation space 40 is defined by the three rollers pairs 12 a - b , 12 c - d and 12 e - f ). once wafer 4 is located within separation space 40 , motor 34 is actuated to move housing 10 towards idler roller pairs 12 a - b and 12 c - d until all three pairs of rollers contact the outer periphery of and hold wafer 4 ( see fig2 ). roller pairs 12 a - b , 12 c - d and 12 e - f are positioned so that they contact the periphery of wafer 4 at locations which are separated sufficiently from each other so that that wafer readily slides into the grasp of the rollers and is held securely there . referring to fig4 a bearing 93 a and shaft 91 a supports idler roller 12 a , so that roller 12 a rotates freely . idler rollers 12 b - 12 d are supported similarly on corresponding bearings ( not shown ) and shafts 91 b - 91 d , respectively . referring to fig3 and 4 , each drive roller 12 e and 12 f is mounted on a rotating shaft 18 e and 18 f , respectively , that are supported by bearing pairs , mounted in housing 10 . bearing pair 20 a and 20 b , which support both ends of shaft 18 e , respectively , is shown in greater detail in fig4 . a similar bearing pair ( not shown ) supports shaft 18 f in drive housing 10 , and is constructed similarly . the mechanism for rotating drive rollers 12 e - f includes a rotational drive motor 50 mounted on drive housing 10 . drive motor 50 is a servo - controlled motor that has a splined drive shaft 52 , which extends into gear chamber 60 . drive shaft 52 meshes with a large spur gear 56 . large spur gear 56 is connected to mesh with two smaller spur gears 58 and 59 that are connected to an upper end of rotating shafts 18 e and 18 f , respectively . thus , when actuated , drive motor 50 causes both drive rollers 12 e - f to rotate in the same direction and speed . and when drive rollers 12 e - f are contacting the periphery of wafer 4 , it causes wafer 4 to rotate within the grasp of the three roller pairs 12 a - b , 12 c - d and 12 a - f . each individual roller within a roller pair 12 a - b , 12 c - d and 12 e - f is mounted with a slight separation between its partner in the pair , for example roller 12 a is mounted with a slight separation from roller 12 b . therefore , as the alignment notch 10 is rotated past a roller pair an un - notched section of the wafer edge is always fully in contact with one of the rollers in the roller pair . the use of closely - spaced roller pairs , rather than single rollers , to support the wafer edge reduces the potential skip and noise caused by the detent of the alignment notch rotating past each roller . still referring to fig3 drive housing 10 is partitioned into two particle containment chambers , a gear chamber 60 and a drive roller chamber 70 . gear chamber 60 surrounds gears 56 , 58 and 59 , and motor shafts 36 and 52 . and drive roller chamber 70 surrounds drive rollers 12 e and 12 f . a vacuum source ( not shown ) is connected to draw air from chambers 60 and 70 , thereby removing particles that may be generated by the meshing of gears in gear chamber 60 and generated by the rotation of the wafer edge against drive rollers 12 e - f in roller chamber 70 , respectively . referring to fig3 and 4 , roller chamber 70 includes a cover 72 attached to a side of drive housing 10 to more fully enclose drive rollers 12 e and 12 f . cover 72 includes a longitudinal access slot 74 that extends end - to - end into a side of cover 72 . slot 74 allows wafer 4 to be inserted into roller chamber 70 and make contact with drive rollers 12 e and 12 f . access slot 74 is beveled at edges 76 and 78 to guide a slightly mis - aligned wafer into slot 74 . each of the idler roller pairs 12 a - b and 12 c - d are contained with idler roller chambers 80 and 90 , respectively . the construction of idler roller chamber 80 is shown in greater detail in fig4 . idler roller chamber 90 is constructed similarly . a cover 82 is attached to frame 9 and defines the upper section of chamber 80 surrounding rollers 12 a and 12 b . cover 82 includes a longitudinal access slot 86 that extends end - to - end into a side surface of cover 82 and allows a wafer to be inserted into chamber 80 and make contact with idler rollers 12 a and 12 b . slot 86 is beveled at edges 88 and 89 to guide a slightly mis - aligned wafer into slot 86 . an airflow channel 84 is formed into frame 9 with an end of channel 84 directly below and into chamber 80 . a vacuum source ( not shown ) connected to the airflow channel draws air into chamber 80 and draws any particles away from idler roller chamber 80 . in one embodiment , airflow channel 84 is formed internally within frame 9 , as shown in fig4 . alternatively , as shown in fig5 airflow channel 84 is formed into a surface of frame 9 and covered with a channel cover 92 to direct an airflow through channel 84 . typically , end effector 8 is housed in a clean room environment with highly filtered air surrounding end effector 8 . therefore , a vacuum source ( not shown ) connected to draw air from chambers 60 , 70 , 80 and 90 causes a flow of filtered air from the clean room into the respective chambers and draws any particles away from the clean room environment . the geometry of drive roller 12 e is shown in greater detail in fig4 . the other rollers 12 a - d and 12 f are constructed similarly . roller 12 e has a substantially cylindrical outer rim 26 , which includes a v - shaped positioning groove 94 formed around its outer circumference . when the rim of the roller is brought into contact with the periphery of the wafer , positioning groove 94 receives and holds the edge of the wafer thereby preventing the wafer from sliding either up or down on the roller . since all six rollers 12 a - f have a similar positioning groove , when the rollers are contacting the periphery of the wafer and the wafer sits in the corresponding positioning grooves of the six rollers , the plane of the wafer is fixed and precisely determined . to reduce the generation of particles and noise while spinning a wafer , the outer surfaces of rollers 12 a - f are made from a polyethyletherkeytone - filled ( peek - filled ) material . for similar reasons , in an embodiment , v - groove 94 has a polished finish with pits and valleys that measure sixty - four micro - inches or less . for similar reasons , in an embodiment , the maximum speed of wafer rotation is less than , or equal to , two revolutions per second , and the side load pressure applied against the wafer edge by the roller pairs is in the range of one to three pounds . referring to fig3 and 6 , end effector 8 has an optical sensing system 100 for detecting the presence of the alignment feature 11 on wafer 4 as it passes by while the wafer is being rotated . examples of sensing system 100 are described in the &# 39 ; 342 application , which was previously incorporated by reference . sensing system 100 has an upper arm 102 that contains the light emitting components and a lower arm 104 that contains the light detecting components . when the wafer is being held by rollers 12 a - 12 f , the edge of the wafer lies between upper and lower arms 102 and 104 . upper arm 102 includes a light source 106 ( shown in phantom ) that is used to illuminate the edge of the wafer ( light source 106 may be implemented , for example , as a diode , a fiber optic or a bulb ). the light from light source 106 passes through a cylindrical tube 108 that acts as a collimator to guide the light from light source 106 . tube 108 includes an aperture opening 110 that directs the light down through aperture 110 toward the wafer . aperture 110 is narrow and long , with its longer dimension oriented perpendicular to the edge of the wafer . lower arm 104 includes a silicon diode receiver 112 which has a detecting window that is also long and narrow , and is aligned with the aperture of the tube 108 . the signal generated by diode receiver 112 is proportional to the amount of light from aperture 110 that reaches it . when wafer 4 is rotated within the grasp of end effector 8 , the edge of the wafer passes between the light emitting and light detecting components . optical housing 100 is positioned so that the edge of the wafer prevents some of the light from tube 108 from reaching diode receiver 112 . when the alignment feature passes between the light emitting and light detecting components , more light is allowed to reach diode receiver 112 and its output signal increases . and as the alignment feature moves past the sensor , the signal decreases to its previous value . thus , by monitoring the output signal of the diode receiver , the electronics can detect the presence of the alignment feature , can determine its precise angular location as a function of the rotational position of the wafer , and can precisely align the angular orientation of the wafer . in an embodiment of sensing system 100 , the interior walls of tube 108 are coated with a diffusing material , e . g ., a white paint . the diffusing coating on the interior surface causes the light passing through the tube to be diffused and reflected and may increase the amount of light passing through aperture 110 . in another embodiment , the end of tube 108 , opposite from the light source 106 , is capped ( not shown ) with a cap having an interior surface coated with a diffusing material , e . g ., a white paint . the cap &# 39 ; s diffusing interior coating causes the light passing through the tube to be diffused and may increase the amount of light , or intensity of the light , passing through aperture 110 . in either of these two embodiments , an increase in the amount or intensity of the light emitted from aperture 110 may reduce the required sensitivity of receiver 112 , or may reduce the amount or intensity required from light source 106 . the techniques for determining the angular location of the alignment feature and then aligning the wafer based on that information are well known to persons skilled in the art . such techniques are typically used in connection with standalone pre - aligners of the type briefly mentioned earlier . an example of one such technique that can be used is described in u . s . pat . no . 4 , 457 , 664 , entitled โ wafer alignment station โ and incorporated herein by reference . end effector 8 is coupled to a processor ( not shown ) which implements the electrical control functions that are necessary . for example , it generates the control signals for the drive motor and the linear motor , and it analyzes the sensing signal to determine and establish the orientation of the alignment feature of the wafer . referring to fig7 a typical use of the end effector is to grab wafers from a wafer storage rack 120 and then transfer them to a masking station ( not shown ). generally , rack 120 has a wafer holder 122 mounted on a platform 124 that can be displaced in a direction z . the wafer holder holds wafers 130 a - c , which are spaced apart by spaces 132 a , 132 b . there are numerous illumination and imaging (โ i / i โ) schemes in the prior art that are usable for the reading of markings on a surface of a wafer , e . g ., optical character recognition ( ocr ) markings , dot - t7 codes , bar codes , and the like . for example , u . s . pat . nos . 5 , 231 , 536 , 5 , 737 , 122 and 5 , 822 , 053 describe i / i schemes . a conventional i / i system includes an illumination component that shines light onto a wafer , for example , and a camera system that captures a reflected image of the ocr , bar code , or dot - t7 code from the wafer surface . typically , the i / i systems project light from various selectable angles onto the smooth , mirror - like wafer surface . the relative angles of incidence of this illumination is sometimes very close to on - axis and is called bright field illumination , or at steep angles and is called dark field illumination . typically , the information being imaged by the camera is not the relatively shiny surface of the wafer , but instead , what is imaged are the micro pits of the markings that have been etched into the wafer surface , that is , it is the slope of these pits that is actually imaged . conventional i / i system typically require a fairly large amount of space to hold the various components in the system , e . g ., using a package that may measure 3 โณ wide , 2 โณ high and 5 โณ long . the relatively large size of the conventional i / i system may not be easily adapted to operate as part of applicants &# 39 ; edge effector , since it would occupy too much room on the pre - aligner and hinder the movement and access of the pre - aligner to close - fitting spaces for wafer pickup and deposit . moreover , the use of a conventional i / i system typically requires a separate station apart from the pre - aligner station , which would , therefore , require additional time to perform that step in the process of wafer fabrication . in an embodiment , edge effector 8 includes a low - profile i / i system 140 ( see fig1 and 2 ) that illuminates and images wafer surface markings as part of the pre - aligner 4 . described below are a number of embodiments of the low - profile i / i system that typically occupy about ยผ โณ of space above or below the wafer surface . an embodiment of the low - profile i / i system may be included as part of pre - aligner 4 , therefore the pre - aligner may be used to perform the grabbing , orienting and imaging of a wafer in a single pre - aligner station . referring to fig8 a first embodiment of a low - profile i / i system 140 is shown . i / i system 140 includes a light source that emits light that is diffused by one or more diffusing elements and reflected by a reflective element ( e . g ., a mirror ) onto a surface of a wafer . the diffused light from the wafer surface is reflected and detected by a camera as an image that may be used to determine the markings on the wafer surface . in the described embodiments of i / i system , the diffused light is produced by passing light beams through a diffusing element ( e . g ., a frosted glass element and / or a diffuser element ). the diffused light source ( e . g ., the frosted glass element and / or diffuser element ) is located adjacent to the wafer being illuminated , therefore the distance the diffused light must travel to illuminate the wafer surface is reduced . the relatively close proximity of the diffused light source to the wafer surface may reduce the required amount and / or intensity of the light from the light source . therefore a smaller light source may be used and the size of other components included in a low - profile i / i system may also be reduced . still referring to fig8 in this embodiment , system 140 includes an led array 142 that acts as a light source . during operation , led array 142 is turned on to shine light beams through a set of diffusers 146 a - b , and a frosted glass 150 towards a beam - splitter 160 . the diffused light beams are partially reflected by a beam - splitter 160 towards two mirrors , 152 a and 152 b , that are mounted above and below a wafer 4 , respectively . mirrors 152 a and 152 b reflect the diffused light towards the edge of the upper and lower surfaces of wafer 4 , respectively . the diffused light reflects off of the upper and lower surfaces of wafer 4 , and in turn , is reflected back by mirrors 152 a and 152 b towards beam - splitter 160 . beam - splitter 160 passes part of the reflected light towards lenses 166 , which focuses the reflected light onto a charge - coupled detector ( ccd ) array 169 of camera 170 . the reflected light received on ccd array is usable as an image to determine the markings on the edge surfaces of wafer 4 . referring to fig9 the two mirrors , 152 a and 152 b , are arranged to reflect the light from both the upper and lower surfaces of wafer 4 , so that an image 180 is obtained that includes an image of the upper surface 182 , the wafer edge 186 and the lower surface 184 . in an embodiment , i - i system 140 includes mirrors 152 a and 152 b that are each located about ยผ โณ above and ยผ โณ below wafer 4 , respectively . the overall package size containing the other components of system 140 may be relatively larger . referring to fig1 , a second embodiment of a low - profile i / i system is shown as system 200 . system 200 includes a led array 202 that shines light that is first diffused by one or more diffusers 206 a and 206 b . the diffused light is reflected by mirror 208 and further diffused by passing through frosted glass 210 . the further diffused light is partially reflected by a beam - splitter 212 onto mirror 216 that reflects the further diffused light onto the lower surface of wafer 4 . the further diffused light is reflected by wafer 4 onto mirror 216 and back through beam - splitter 212 , through lenses 218 and onto ccd array 221 or camera 220 . in this case only one surface of wafer 4 is illuminated and imaged . also , in this embodiment , an absorber 214 is included to reduce back - reflections of light passing through beam - splitter 214 . referring to fig1 , a third embodiment of low - profile i / i system is shown as system 240 . system 240 includes only a single mirror , mirror 246 . the use of fewer mirrors may reduce the amount of error included in a reflected image . system 140 includes a led array 242 that shines light through a diffuser element 244 , the diffused light is reflected on a mirror 246 and through a frosted glass 248 . the diffused light that passes through frosted glass 248 is partially passed through beam - splitter 250 and onto the lower surface of wafer 4 . the diffused light is reflected from the lower surface of wafer 4 back onto beam - splitter 250 which partially reflects the light towards lenses 260 which focus the light onto a ccd array 272 of camera 270 . although the described embodiments of the i / i systems included multiple diffuser elements , a single diffuser element may be used . in the described embodiments of the i / i systems an led array was described as the light source . in an embodiment , individual rows of the led array may be turned on or off to produce on - axis or off - axis illumination of the wafer surface . a number of embodiments of the invention have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . for example , more than three roller pairs may be used to grasp the periphery of the wafer and the transport mechanism for rotating the wafer . we also mentioned specific geometries and construction materials of the rollers used in the end effector . however , other roller materials and geometries could be used . we also mentioned opening and closing the gripping mechanism with a linear drive motor and associated gearing . however , other devices could be used to open and close the gripping mechanism , for example , a hydraulically operated device . also , other kinds of sensors may be used to sense the orientation of the wafer . the sensors may detect the presence of the alignment feature by physical contact , magnetic fields , or capacitance , just to name a few possible ways . accordingly , other embodiments are within the scope of the following claims . | 7 |
the general structure and techniques , and more specific embodiments which can be used to effect different ways of carrying out the more general goals , are described herein . the present application describes an automatic cable handling system , which allows automated processing of the cable . one of the issues found with cable handling in the prior art is that the cable was effectively stretched across a work floor . this stretching and the subsequent coiling was done manually , and required significant manual effort . the cables laid across the floor , hence causing a hazard . moreover , the cables got very dirty during their time on the floor . the stretched cables were then bundled up . one aspect of this application cleans the cable while the cable is being conveyed . a cable clamp holds various sizes of cable , conveying the cable along a conveyor . in operation , the cable is first sorted by type . the cable sorting may be done on a dock or other table . the cables may then be sent , for example , to the input stage of the conveyor shown in fig1 - 3 . the cables are initially placed in cable holders such as 145 . the cable holders move along a support , forming the conveyance path in the direction of arrow 105 . cable clamp 145 holds the cables as they are moved . the cable clamps 145 , 155 may be located on the support 160 every 20 feet , for example ; see fig2 . the clamps are driven to move in a continuous loop , so that clamps such as 145 are driven in a first direction to stretch the cable , and 150 is driven in a second direction to return the clamp back to the cable - initiation point at which point a new cable can be attached and stretched . after attachment , the cables are first conveyed to a soap and water wash spot , which may include a presoak area 129 which presoaks the cables . the cables are then each washed by brushes . brushes 125 , 126 are shown for a first cable , and 127 , 128 for a second cable . it should be understood that there may be other brushes in other locations . the cables are then rinsed with water or solvent in a rinse area 130 . water is blown off the cables at 135 by an air blower device . the cables pass through area 140 , held by the cable clamp / grippers 145 in fig2 . this shows a second area of the conveyor , along which the cables are allowed to dry , and / or blown off . in the embodiment , the cable grippers may be located on 20 foot centers . the cable continues being conveyed to the section of fig3 . the cable is then passed to a bundler 130 , which rotates a wrapper 160 , for example , to bundle the cables into any desired configuration , such as bundles or spools . the wrapper 160 may also include a label printer 161 which automatically affixes information indicative of the cables . for example , this can be an inventory number or the like to facilitate the tracking . since the conveyance path is along a support , the conveyance surface can be open , to allow foreign objects such as dirt and liquid , to fall off . this is different than a belt style conveyance , in which all dirt and foreign objects would fall on the belt , for example . a side view of the conveyor is shown in fig4 a - 6 . fig4 a illustrates the conveyor support including the cable grippers 145 , 150 , 155 and other structures . 145 is conveying a cable in the direction of stretching , 150 is a cable clamp that is returning back toward the origin . the returning clamp 150 is conveyed around a curved support area 161 , after which it is ready to receive another cable . fig4 b shows another view of the conveyance path , which shows the different stations , including the presoak station 129 , the rollers 125 , 126 , the rinse station 128 , and the air blower station 130 . the different structures which hold the washing material are also shown . fig4 b , for example , shows the fresh water tank 400 , soap concentrate held in receptacle 402 , and also shows a soap drain tank 404 for receiving the dirty water . input 408 represents an air compressor , for the air blower 130 . the area under the conveyance path , in the area of washing and rinsing , is preferably a mesh structure , e . g ., a metal mesh . fig5 a illustrates a close - up of the different structure including the presoak , brushes , and the motor . fig5 c shows a perspective view with presoak , rinses and drying , as well as the brushes . fig5 b illustrates the end part of the conveyance path . note that the clamp 155 is holding the cables such as cable 500 . at degrip zone 510 , the cables are released from their clamps . this may be automatically done when sensing the position of a mechanical part 504 . the cable 501 , once so released , may be loaded onto a desired caddie for coiling . a roller device 520 may also be provided , to facilitate rolling up bundles of cable . fig5 b also illustrates the second end portion 602 of the support 600 , in which the clamps such as 145 are turned around to be returned to the origin . since these cables are heavy and bulky , an important feature is the emergency switch . an emergency off switch 530 is located within the reach of each operator . fig6 shows an alternative view of the fig5 embodiment , showing how the cables can be released from the different grippers . fig7 shows a top view of the conveyor including two cables 700 , 702 . emergency stop buttons 710 and 720 are located on opposite sides of the table . fig8 a , 8b , 9 a and 9 b illustrate a more detailed view of the cable gripper . the cable gripper is formed of a first holding piece and a second holding piece 800 , 805 . the gripper 145 rides on , and moves along , an edge surface 811 of a support piece 810 . for example , the support piece 810 can be an โ i beam โ, and the edge surface 811 can be the portion of the i beam that is substantially perpendicular to the main support piece . the two pieces 800 , 805 are opened by the movement of a linear driving part such as piston 820 . this causes the bottom piece 805 to tilt downward , opening the area between the top and bottom pieces . fig8 a and 8b illustrate the pieces 800 , 805 in their open position . in this position , the cables 830 , 832 can be inserted therein . fig9 a and 9b illustrate the cylinder in its closed position , with two cables , 830 and 832 , held between the two gripper parts 800 , 805 . in this way , a number of cables of similar sizes can all be held by the same device . the opening and closing can be via an air operated part , such as an air piston , the device in essence self - adjusts โ closing with a certain amount of force to thereby hold the cables of any size automatically . note that the cables are held between a first movable surface 801 that is controlled by the piston 820 , and a second surface 802 . the second surface may also move against a spring force . accordingly , any size cable can be held by the gripper . the gripper assembly itself is connected to a carriage 850 but moves on rollers 852 along the conveyor . in an embodiment , a foot pedal may be provided that allows the operator to press the foot pedal to raise the first movable surface , after which the cables are placed into position , and the foot pedal is released to lower the first movable surface . an important feature of this system is that pans and troughs may be located under the device to catch runoff . fig1 illustrates a cross - section along the line 10 - 10 in fig5 . this shows , for example , how the presoak nozzles 1000 , 1002 , 1004 , 1006 can be used to spray presoak water onto the cables . drain pans 1010 and 1020 are located under this area of the conveyor , to capture the overflow water . the brushes are shown in fig1 , where brushes are formed in an area so that the cable needs to pass between the brushes . in the area of the brushes 1100 , there may be splash guards 1102 to prevent the water from splashing . the brushes 1100 have indentations which are intended to provide additional surfaces for cleaning the cable . a piston drives the position of the brushes . fig1 illustrates a side view of the rinsing station , again with nozzles such as 1200 , and splash areas 1202 . this structure allows the cable to be pulled and washed at the same time . all customer markings can be removed by washing , as well as dirt and the like . an automatic release system allows the end of the cable to be released once the cable end reaches the correct area . an automatic bundling system may be used at that area . the printer may print a barcode that is associated with the cable , and which states characteristics of the cable . after bundling the cable , a barcode may be scanned into an inventory management system , which indicates that a bundle , having those specific characteristics , is ready to rent . the cable is then placed on pallets for storage , for example , and when rented , the barcode is scanned again , removing the cable from inventory . in operation , operators may be on each side of the conveyor . a conveyor button may be pressed when the conveyor is ready for work . the next available cable gripper opens automatically , on the side of the operator where the conveyor button was pressed . the operator inserts the cable into the open gripper area , and then presses a pre - start part , for example a prestart switch on the floor , to close the gripper . as a safety measure , the operator may be forced at that point to press either a wash , or a pass selector switch to start the operation . the wash switch causes the cables to be washed , by raising the brushes via the piston 1105 , while the pass switch just passes the cables without washing . the cable , while gripped , is passed through the washer area . depending on the buttons which are pressed , either wash operations or no wash operations is performed . if wash has been selected , a selected sensor will read the cable gripper and start a wash cycle . the different structure shown along the conveyor includes a prewash cycle which begins using a water and soap solution . the cable is then passed through foam brushes where one brush moves over the cable , and a second brush moves up from the bottom . the cable is then rinsed with water , and finally passes through an air blower area . cable droop may prevent some part of the cable from being washed . when the cable reaches the end of the conveyor , the clamping device automatically releases the cable at the discharge area via the unclamping ramp in the area 510 . in one embodiment , emergency stop buttons are mounted in each corner of the conveyor , near each location where a worker might be located . pressing any of the emergency stop buttons causes all equipment functions to stop . the general structure and techniques , and more specific embodiments which can be used to effect different ways of carrying out the more general goals are described herein . although only a few embodiments have been disclosed in detail above , other embodiments are possible and the inventor ( s ) intend these to be encompassed within this specification . the specification describes specific examples to accomplish a more general goal that may be accomplished in another way . this disclosure is intended to be exemplary , and the claims are intended to cover any modification or alternative which might be predictable to a person having ordinary skill in the art . for example , other kinds of bundling can be used . also , the inventor ( s ) intend that only those claims which use the words โ means for โ are intended to be interpreted under 35 usc 112 , sixth paragraph . moreover , no limitations from the specification are intended to be read into any claims , unless those limitations are expressly included in the claims . the computers described herein may be any kind of computer , either general purpose , or some specific purpose computer such as a workstation . the computer may be a pentium class computer , running windows xp or linux , or may be a macintosh computer . the computer may also be a handheld computer , such as a pda , cellphone , or laptop . the programs may be written in c , or java , brew or any other programming language . the programs may be resident on a storage medium , e . g ., magnetic or optical , e . g . the computer hard drive , a removable disk or media such as a memory stick or sd media , or other removable medium . the programs may also be run over a network , for example , with a server or other machine sending signals to the local machine , which allows the local machine to carry out the operations described herein . | 1 |
the preferred embodiment of the invention is shown in and described with reference to fig1 to 8 , and will be described first . fig1 diagrammatically illustrates a radial arm saw 20 according to the present invention and comprising a saw assembly 22 , a saw table frame 24 , and a wall support 26 securely mounted on a wall 28 . the wall 28 may be a brick or block wall or a wooden framed wall of a workshop or other room in a building . the saw assembly 22 comprises a saw unit 30 having a circular saw blade 32 and a handle 34 . the saw unit 30 is suspended by a carriage 36 from a radial arm 38 and along which the saw unit 30 is translatable by grasping and moving the handle 34 . the radial arm 38 is mounted on and cantilevered from the upper end of an upright , vertical column 40 the lower end of which is clamped in a socket 42 . the radial arm 38 can be moved up and down the column 40 by means of a handle 44 for adjusting the height of the saw blade 32 . the radial arm 38 can be pivoted about the column 40 in horizontal planes and locked in any selected position by a lever 46 . the frame 20 comprises a frame structure 48 having mounted thereon a horizontal work table 50 comprising a front fixed section 52 , removable middle and rear sections 54 , 56 , with an upstanding fence 58 removably disposed between the sections 54 , 56 . the sections 54 , 56 and the fence 58 are forwardly clamped against the rear edge of the fixed front section 52 . the frame structure 48 is pivotally mounted between upstanding side plate extensions 60 of the wall support 26 on bolts 62 , one on each side . the wall support 26 has a hollow box portion 64 from which the extensions 60 extend upwardly from adjacent the front thereof . the rear of the box portion 64 has a vertical leg 66 securely attached to each side thereof . each leg 66 has a pair of brackets 68 , one at the top and the other partway along its length , which are securely fixed to the wall 28 by screws 70 . at the lower end of each leg 66 is provided a plumb adjuster 72 and a height adjuster 74 which are adjusted to compensate for any variations in the wall 28 and the floor 75 so that the lower end of each leg 66 firmly engages both the wall 28 and the floor 75 . it should be noted that the brackets 68 and the adjuster 72 space the leg 66 a short distance from the surface of the wall 28 ; this also helps in accommodating any variations in the surface of the wall 28 . a pair of foldway legs 76 , one on each side , are pivotally connected at their upper ends by pivot bolts 78 to opposite sides of the frame structure 48 adjacent the front thereof . a bracing strut 80 is pivotally connected at one end , its forward end , to an upper portion of each leg 76 by a pivot bolt 82 . both the strut 40 and the leg 76 are of u - shaped channel section , and the forward end of the strut 80 is located inside the leg 76 . the rear end of each bracing strut 80 is pivotally attached to the wall support 26 by a pivot bolt 84 located adjacent the top of the box portion 64 just rearwardly of the upstanding side plate extension 60 . as can be seen , the rear end of the strut is curved upwardly , and the remainder of the strut 80 extends forwardly and upwardly at a small angle to the horizontal . the bottom of each leg 76 is provided with an adjustable foot 86 which telescopically extends upwardly inside the leg 76 ( as shown in broken lines ) and is secured in the adjusted position by a locking bolt 88 . a locking sleeve 90 of rectangular tubular cross section is a loose sliding fit on the upper portion of each leg 76 , and is located between the pivot bolts 78 and 82 which may act as stops to limit the sliding travel of the sleeve 90 . as can be seen in fig1 the lower edge of the sleeve 90 rests on the extended strut 80 and is thereby spaced a short distance d above and from the pivot bolt 82 . at its upper forward edge the sleeve 90 is provided with a forwardly extending tab handle 92 . from the operative position shown in fig1 the radial arm saw 20 can be folded away into a stored position adjacent the wall 28 . first , the column socket 42 is unlatched and pivoted about a horizontal axis 91 until the column 40 lies along the back edge of the table 50 , the radial arm 38 lies along the far side of the table 50 , and the saw unit 30 extends downwardly partway through the table 50 to the position shown in fig3 and as will be described more fully later . secondly , the front of the table part 52 is then grasped in one or both hands and raised upwards and backwards to pivot the frame structure 48 upwardly about the pivot bolt 62 . the table part 52 is so pivoted until it reaches the broken line position shown in fig1 with its lower surface now in the vertical plane v . during this pivoting of the table 50 and frame structure 48 , each leg 76 pivots about its pivot bolt 78 and hangs therefrom vertically , the strut 80 pivoting upwardly about its pivot 84 and also pivoting relative to the leg 76 about the pivot bolt 82 . the final vertical position of the leg 76 is shown in broken lines in fig1 and as can be appreciated , in this stored position the strut 80 becomes nested inside the leg 76 . as the leg 76 reaches its stored position and the strut 80 folds inside the leg , the locking sleeve 90 is free to slide down the leg 76 until arrested by the pivot bolt 82 . in this position , the locking sleeve 90 prevents downward return pivoting of the table 50 , as will be described in more detail later , and so locks the radial arm saw in the stored position . during the folding ( and subsequent unfolding ) of the table 52 from the extended position shown in fig1 full lines to the stored position shown in broken lines , the arcs along which various parts move are shown in broken lines . the front edge of the table 50 moves along a circular arc 94 centered on the axis of pivot bolt 62 . the pivot 78 at the top of the leg 76 moves along a circular arc 96 also centered upon the axis of pivot bolt 62 . the pivot bolt 82 , connecting the strut 80 and the leg 76 , moves along a circular arc 98 centered upon the axis of pivot bolt 84 at the rear end of the strut 80 . the adjusting foot 86 at the bottom of the leg 76 moves along an arc 100 so that in the stored position the adjustable foot 86 is located outside and just above the bottom of the box portion 64 of the wall support 26 as shown in broken lines . thus , it will be appreciated , that in the stored position , the leg 76 , the frame structure 48 , the table 50 , and the saw assembly 22 are all positioned above the bottom of the box portion 64 and also are all positioned rearwardly of the front face of the box portion 64 . the box portion 64 is hollow and is bounded by side plates , a top , a bottom , and a back . the front of the hollow box portion 64 is closed by a door 102 ( shown in broken lines in fig1 ) which is pivoted at its lower edge to the side plates of box portion 64 by pivot hinges 104 . when the radial arm saw is in the stored position , the door 102 is readily accessible and can be pivoted downwardly and forwardly to store in or remove from the inside of the box portion 64 accessories , tools etc . usable in association with the radial arm saw . in the operative position of the radial arm saw shown in fig1 the frame structure 48 is securely supported by the wall support 26 at the rear and the pair of legs 76 at the front with the bracing struts 80 therebetween . however , if desired , means may be provided to lock or latch the frame structure 48 in its operative , extended position . for example , a locking bolt 106 can be inserted through each side plate extension 60 into the frame structure 48 , such bolt 106 being manually removed before pivoting the frame structure 48 to the stored position . alternatively , a releasable latch may be provided between each side plate extension 60 and the associated side of the frame structure 48 . at a location between the pivot bolts 78 and 82 , and just above the sleeve 90 , the pair of legs 76 are rigidly secured together by a handle bar 107 which extends forwardly from each leg 76 just above the tab handle 92 on each sleeve 90 . the purpose of the handle bar 107 is to facilitate unfolding the table 50 and frame structure 48 from the stored position to the operative position . to perform this unfolding operation , the handle bar 107 is grasped on each side by each hand , a finger of each hand used to engage the tab handle 92 of each sleeve 90 and raise that sleeve to unlock each leg 76 from its associated strut 80 , and then the table unit pivoted downwardly using the handle bar 107 . once this downward pivoting has commenced , the fingers can release each tab handle 92 as each strut 80 becomes separated from inside the associated leg 76 . in a desirable modification of the locking sleeve arrangement , the head and nut of the pivot bolt 82 may be recessed in the sides of the leg 76 and / or otherwise shaped and dimensioned so that the sleeve 90 passes over the pivot bolt 82 in the folded - away position of the saw table , each sleeve 90 then in such position sliding all the way down the leg 76 until it is stopped by the curved portion of the strut 80 extending rearwardly out of the leg 76 . with this modification , to unfold the saw table the sleeves 90 are first slid upwardly to a position above the pivot bolts 82 and held in this raised position by a finger of each hand while the ends of the bar handle 107 are then grasped to lower the saw table . it should be noted that the pivot bolt 84 is disposed rearwardly of the frame structure pivot bolt 62 so that the pivot bolt 84 will not interfere with the vertical stored position of the leg 76 ; and the rear end of the strut 80 is curved to accommodate this . fig2 is a diagrammatic front elevational view of the radial arm saw and shows the electric motor 108 of the saw unit extending to the opposite side of the radial arm 38 to the saw blade 32 . the two parallel legs 76 can be seen connected together by the handle bar 107 . the lower portion of the right hand front leg 76 has been broken away to show the bottom of the right hand rear leg 66 of the wall support 26 . the four brackets 68 can be seen extending sideways outside the legs 76 and 66 . the upstanding side plate extensions 60 can be seen spaced outwardly from the frame structure 48 with the two pivot bolts 62 bridging the gaps therebetween . the downwardly pivoting door 102 of the box portion 64 is provided with a handle 110 which can also be used to lock the door in the closed position . an on / off switch 105 for the motor 108 is located in the front face of the radial arm 38 . fig3 is a diagrammatic top plan view of the saw table , with parts omitted and a portion broken away to show more details of the frame structure 48 . the front portion 52 of the table is screwed to the frame structure 48 . the middle portion 54 , the fence 58 , and the rear portion 56 of the table top are clamped by clamps 112 against the rear edge of the fixed portion 52 . the clamps 112 may be tightened and loosened by rotating handles 114 . by loosening the handles 114 , the back portion of the table top comprising the parts 54 , 58 and 56 can be removed . after removal of the parts 54 , 58 and 56 , the saw assembly 22 can be pivoted to the inoperative position shown in broken lines . to reach this position , the column 40 and socket 42 pivot about the horizontal pivot bolt 115 ( shown in broken lines ) until the column 40 and the radial arm 38 lie outside the saw table in substantially the plane thereof . during the final portion of this pivoting , the motor 108 enters and is partly housed in a cavity 109 between members of the frame structure 48 , this cavity 109 being exposed when the table parts 54 , 58 , 56 are removed . after the saw unit 22 has been pivoted to the inoperative position shown in fig3 the saw table and frame structure 48 are then ready to be pivoted upwardly and backwardly to the stored position indicated in broken lines in fig1 . i it will thus be appreciated that in the stored position , the saw assembly , particularly the saw blade 32 , is positioned between the wall 28 and the now upright saw table 50 and frame structure 48 , so shielding the saw assembly and the saw blade from access and accidental interference . also , the on / off switch 105 of the saw will be adjacent the top of the stored radial arm so pointing upwards towards the ceiling ; in this position the on / off switch is most inaccessible . fig4 diagrammatically shows a section on the line 4 -- 4 in fig1 with the sleeve 90 resting on top of the bracing strut 80 . the u - shaped channel form of the leg 76 inside the sleeve 90 is clearly shown as is the tab handle 92 extending from the front of the sleeve 90 . fig5 is a diagrammatic section on the line 5 -- 5 in fig1 and shows the u - shaped channel sectioned bracing strut 80 nested inside the leg 76 . in this position the sleeve 90 has dropped down over the upper end of the nested strut 80 so preventing the strut 80 from pivoting relative to the sleeve 90 or the leg 76 . to render this locking position of the sleeve 90 more effective , a cutout 116 is provided in the lower portion of each side of the sleeve to accommodate the head of the pivot bolt 82 and its nut 118 and allow the sleeve 90 to slide partially past the pivot bolt 82 . each cutout 116 extends approximately halfway up the height of the sleeve 90 , as shown in fig1 . fig6 and 8 illustrate a latch mechanism 120 for locking the column 40 in the upright , vertical operative position ( fig6 and 7 ), and also for locking the column 40 in the horizontal inoperative position ( fig8 ). an arm 122 extends at right angles to the socket 42 from one side thereof below the pivot 115 ( fig7 ) about which the socket 42 is pivotal . in the upright vertical position of the column 40 , an arm assembly 126 carrying an l - shaped bracket 124 is resiliently biased about a pivot 128 to cause the base of the l - shaped bracket 124 to engage over the free end of the arm 122 and latch the socket 42 in its vertical position -- as shown in fig7 . to pivot the column 40 to the inoperative position , the l - shaped bracket 124 is manually pivoted clockwise in fig7 to unlatch the arm 122 , so allowing the socket 42 to be pivoted counter - clockwise to its inoperative , stored horizontal position . when the l - shaped bracket 124 is released , its upper end is resiliently biased counter - clockwise to engage the base of the socket 42 and also engage under a ramp - like detent 130 extending from the base of the socket 42 to latch the socket 42 and column 40 in the horizontal collapsed position . to again erect the column 40 to its vertical position , the bracket 124 is manually moved clockwise against the spring bias to disengage the bracket 124 from the detent 130 so allowing the column 40 to be pivoted clockwise . this column latching arrangement 120 is more fully disclosed in u . s . pat . no . 4 , 523 , 504 in which it is illustrated in fig9 and 11 thereof . also , the manner of pivoting the saw assembly into and around the frame structure of a radial arm saw to collapse such for storage is more fully described and illustrated in u . s . pat . no . 4 , 523 , 504 the whole disclosure of which is hereby incorporated herein by reference . fig9 and 11 illustrate a second embodiment of the present invention . in this embodiment the saw table 50 , the saw unit 30 , the radial arm 38 , and the column 40 are the same as previously described with respect to the previous embodiment . however , the base of the column socket 140 is provided with a flange which is mounted on the top of a box - like wall support 142 and secured thereto by four bolts 144 ( only two of which can be seen ). the box - like wall support 142 is hollow to form a storage compartment and has a downwardly pivoting front door similar to that previously described in relation to fig1 and 2 . the box - like support 142 is mounted on and secured to the wall 28 by four screws 145 ( two of which are shown in broken lines ) which are driven home into the wall 28 from inside the support 142 . the saw table 50 is supported on a frame structure 146 which is provided at its rear lower edge with a pair of downwardly extending lugs 148 each of which is pivotally mounted on a side of the wall support 142 by a pivot bolt 150 . a bracing strut 152 comprising two part - struts 154 and 156 is pivotally attached at its lower end to the wall support 142 by a pivot 158 , spaced below the pivot 150 , and at its upper end the strut 152 is pivoted to the side of the frame structure 146 adjacent the front thereof by a pivot bolt 160 . the two strut parts 154 , 156 are pivoted together at 162 . a releasable latch means may be provided to prevent the strut parts 154 and 156 pivoting relative to each other when in the supporting position of fig9 ; this releasable latch means is schematically shown and identified by the reference numeral 164 . alternatively , or in addition , one of the strut parts 154 , 156 could be provided with a flange at one edge and abutting the other strut part to prevent the bracing strut 152 folding and moving the pivot 162 upward under the weight of the saw table 50 and the frame structure 146 . a releasable latch may be provided between the wall support 142 and the frame structure 146 to releasably lock the frame structure 146 in the extended , horizontal operative position shown in fig9 ; such a releasable latch is schematically illustrated by the broken line 166 . fig1 illustrates the stored position of the radial arm saw ; this position has been obtained from fig9 by releasing the lever 46 , pivoting the radial arm 38 on the column 40 until parallel to the wall 28 , locking the radial arm 38 in this position with the lever 46 , and then releasing the latch 164 with movement of the pivot 162 downwards to enable the saw table 50 and frame structure 146 to be pivoted downwardly about the pivot 150 to extend downwardly in a vertical position in front of the wall support 142 . the storage position of the saw table 50 and frame structure 146 is shown in solid lines in fig1 and broken lines in fig9 . the extended operative position of the saw table and frame structure is shown in solid lines in fig9 and broken lines in fig1 . the front edge of the saw table 50 moves through a circular arc 168 about the axis of the pivot 150 when moving between the operative and stored positions . as will be appreciated , the surface of the saw table 50 lies in a horizontal plane h 1 in the extended operative position , and in a vertical plane v 1 in the stored position . it will also be appreciated that there is a pivot 150 on each side of the wall support 142 , and also a pair of bracing struts 152 one on each side of the frame structure . fig1 is a top plan view of this second embodiment viewed along the line 11 -- 11 in fig9 . in broken lines the radial arm 38 and saw unit 30 are shown swung counter - clockwise about the vertical column 40 to nearly the stored position shown in fig1 . during swinging movement of the saw unit 30 to and from the stored position of fig1 , the radially outer end of the radial arm 38 moves along an arc 170 centered on the vertical axis of the column 40 . a third embodiment of the present invention is illustrated in fig1 and 13 . fig1 shows the radial arm saw in the operative position with the saw table 50 extended . fig1 shows the radial arm saw in the stored position with the saw table 50 folded upwardly to a vertical position and the column 40 , radial arm 38 , and saw unit 30 stored between the saw table 50 and the wall 28 . in this embodiment , the wall support 176 is similar to that in the previous embodiment except it has a pair of upstanding lugs 182 at the top front edge . each lug 182 supports a pivot 184 on which the frame structure 180 of the saw table is pivotally mounted . the socket 172 of the column 40 is provided with a base flange 174 and a front flange 178 . the base flange 174 is mounted on the top of the box - like wall support 176 and releasably secured thereto by four machine screws 175 . the forward flange 178 is releasably secured to the rear edge of the frame structure 180 by machine screws 179 . thus , in the operative position shown in fig1 , the saw table 50 and its frame structure 180 are cantilevered forwardly from the wall support 176 and immoveably secured in this position to the wall support via the flanges 178 and 174 of the socket 172 . in this operative position the top of the saw table 50 lies in a horizontal plane h 2 . to move the radial arm saw into the stored position shown in fig1 , the machine screws 175 and 179 are removed ; then the saw unit and column 40 lifted up and stored on the wall support 176 with the socket 172 and column 40 lying along the top of the wall support 176 , and with the saw blade guard of the saw unit 30 being positioned adjacent the wall 128 . the removable rear portions of the saw table 50 are now removed , i . e . the parts 54 , 56 , and 58 , and placed on top of the wall support 176 in the space between the column and radial arm unit 40 , 38 and the wall 28 , as illustrated in fig1 . the saw table 50 and frame structure 180 are then pivoted upwardly about the pivot 184 until the surface of the saw table 50 lies in a vertical plane v 2 . during this upward pivoting of the saw table 50 , the end of the motor 108 extending away from the wall 28 enters into and is stored in a recess in the frame structure 180 exposed by removal of the rear portion of the saw table 50 ( similarly as described with references to fig3 ). when the frame structure 180 has reached the vertical position shown in fig1 , it is latched in position by latch means operative between the wall support 176 and the frame structure 180 as indicated schematically by the broken line 186 . in the embodiment of fig1 to 8 , the removable rear parts 54 , 56 and 58 of the saw table 50 can , in the stored position of the radial arm saw , also be stored on top of the wall support between the wall 28 and the column 40 in a similar manner to that shown in fig1 . the above described embodiments , of course , are not to be construed as limiting the breadth of the present invention . modifications , and other alternative constructions , will be apparent which are within the spirit and scope of the invention as defined in the appended claims . | 1 |
hoat polypeptide is defined as a polypeptide sequence that is at least about 85 % homologous by amino acid sequence ( ordinarily at least about 90 %, and prefereably at least about 95 %) with the sequence of fig1 ( reference sequence hoat ). an expressed sequence tag ( est ) of approximately 200 bp having high homology to a segment of hoat is found in the genbank est entries under accession no . r25797 . invention hoat nucleic acids per se as defined herein exclude any expressed sequence tag ( est ) or other nucleic acid sequences found in public databases on the filing date ( such databases being expressly incorporated by reference ), including the sequence of accession no . r25797 as well as the rat roat1 and oat1 , and mouse nkt , sequences of the prior art . however , other inventive subject matter such as isolated protein , methods for screening and the like as set forth above do not ( unless expressly stated to the contrary ) exclude the use of the r25797 sequence or its expression product . โ homology โ is defined as the percentage of residues in a candidate amino acid sequence that is identical with the residues in the reference sequence hoat after aligning the two sequences and introducing gaps , if necessary , to achieve the maximum percent homology . methods and computer programs for the alignment are well know in the art . one computer program which may be used or adapted for purposes of determining whether a candidate sequence falls within this definition is โ align 2 โ, authored by genentech , inc ., which was filed with user documentation in the united states copyright office , washington , d . c . 20559 , on dec . 10 , 1991 . โ isolated โ hoat nucleic acid is one that has been separated from its environment as it is found in nature , i . e ., from the genome in the case of dna or from cellular environment in the instance of rna . โ isolated โ hoat polypeptide is one that has been separated from its normal cellular environment , and includes hoat protein that is homogeneous by sds - page using silver stain . in calculating amino acid sequence homology the candidate and reference sequences are aligned in the fashion that produces the maximum number of aligned residues , with insertions and deletions of residues represented by gaps in the aligned sequences . for example , a 120 residue polypeptide containing a 100 residue reference sequence fragment fused at its n - terminus to a 6 residue polyhistidine affinity tag , but with a single substitution in the hoat domain , is calculated to be 99 % homologous to the hoat reference sequence since the sequence of the fragment corresponds exactly to the maximally aligned hoat reference sequence except for a single residue substitution and the 6 residue n - terminal fusion . thus , if the alignment - maximizing comparison of the candidate and reference sequences reveals an insertion ( or deletion ) of one or more amino acid residues , then these residues are ignored for the purposes of making the homology calculation . applicant recognizes that this convention gives rise to theoretical 100 % homology between 2 differing sequences , but has chosen to establish his own definition for the purposes of this filing . analysis of homology is based on any one or more of the sequences imputed from the nucleic acid used to express the hoat , the sequence of the product as first produced in vitro , or the sequence after any post - translational modification . thus , if the reference and candidate sequences are identical when expressed , but a glutamine residue is later deaminated to glutamic acid , the first candidate is 100 % homologous , but the deaminated sequence is not . for the purposes herein โ hoat activity โ means any one or more of the functions performed by hoat in the human , including in particular the transport of organic anions . it is not necessary for a polypeptide to have anion transport activity in order to fall under the definition of hoat herein . for example , in some embodiments hoat polypeptides possess at least one immune epitope that is capable of substantial cross - reaction with an antibody raised against reference sequence hoat , and thus are useful in immunoassays for hoat , but may possess mutations that render the polypeptide incapable of anion transport . the hoat polypeptides of this invention comprise substitutions for , deletions of , or insertions of any amino acid residue adjacent to any of the reference sequence amino acid residue sites shown in fig1 . substitutional hoats are those in which at least one amino acid residue in the reference sequence has been removed and a different amino acid inserted in its place at the same position . one or more residues are substituted . alanine is a common substitution for any residue , and is commonly used in alanine scanning to identify functional residues , but it is within the scope of this invention to substitute other residues into the hoat reference sequence . the introduced residues generally are naturally occurring amino acids , commonly g , a , y , v , l , i , s , t , d , e , q , c , m , n , f , p , w , k , r or h ( using conventional single letter code ; ep 323 , 149 ). suitable residues also include hydroxyproline , beta - hydroxyaspartic acid , gamma - carboxyglutamic acid , hydroxylysine or norleucine , to be employed as alternatives to their namesakes . these substitutions may be conservative , i . e ., the substituting residue is structurally or functionally similar to the substituted residue . other substitutions will be less conservative in that they constitute an exchange between different structural or functional classes of residues . for the purposes herein , these classes are as follows : 1 . electropositive : r , k , h ; 2 . electronegative : d , e ; 3 . aliphatic : v , l , i , m ; 4 . aromatic : f , y , w ; 5 . small : a , s , t , g , p , c ; 6 . charged : r , k , d , e , h ; 7 . polar : s , t , q , n , y , h , w ; and 8 . small hydrophilic : c , s , t . intergroup substitutions generally will have greater effects on protein function than conservative ( intraclass ) substitutions . thus , it is particularly within the scope of this invention to introduce conservative substitutions into hoat and , if the results are not satisfactory , to introduce non - conservative substitutions at the sites . typically , however , proline , glycine , and cysteine substitutions or insertions into the sequence are not favored . an example of an expressed variant is a change at codon 498 from agc to atc , resulting in expression of isoleucine in place of serine . other variants are introduced into dna encoding hoat without resulting in a change in protein sequence , e . g . from atc to att at codon 453 or from ggg to ggt at codon 491 . hoat variants are readily identified by methods apparent to the ordinary artisan . for example , sites shown by alanine scanning to influence selected biological activity are subjected to saturation mutagenesis to identify the optimal modification for the activity in question , e . g . selectivity for transport of a particular anion . hoats representing combinations of sequence variants are within the scope of this invention . 2 , 3 , 4 , 5 , or more substitutions , deletions or insertions are introduced into hoat as defined herein . typically , a deletion of a single residue will be accompanied by an insertion within 1 to about 3 residues of the deletion site . generally , deletions of larger domains unnecessary for anion transport activity need not be accompanied by an insertion . the results of individual amino acid substitutions are generally additive except when the residues interact with each other directly or indirectly . they are readily screened using the same procedures described in sweet et al . or sekine et al . ( supra ) in order to identify those having the properties of reference sequence hoat or the desired modified properties . included within the scope of this invention are hoats having one or more amino acids inserted immediately adjacent to a hoat amino acid at any position in the reference sequence . insertional hoats generally will have a polypeptide structure comprising the sequence nh 2 - pp - a -( x ) n1 - b - pp - cooh , wherein x is the inserted residue ( s ) ( which may be the same or different ), n1 is an integer ( generally 1 โ 30 , typically 1 or 2 ), either a or b are the designated residue sites for insertion and pp represents the remainder of the hoat or a bond at the hoat n or c terminus . the invention includes fusions of hoat and selected antibody recognition sequences ( heterologous polypeptides ) for immunoaffinity purification of hoat from cell culture , fusions of hoat sequences with affinity tags such as flag or polyhistidine , and chimeric sequences ( particularly fusions of hoat sequence fragments with fragments of other receptors of the 12 - transmembrane spanning region class ). also included within the scope of this invention are hoats in which a glycosylation site is introduced or removed from the reference sequence , whether by substitution , insertion or deletion of one or more amino acid residues . such changes will result in the installation or removal of the sequence nxs or nxt , where x can be any residue . thus , asparagine can be substituted for any residue located 2 residues n - terminal to serine or threonine to introduce a glycosylation site . alternatively , single glycosylation can be omitted by substituting glycosylated asp with any residue , deleting site - adjacent serine or threonine substituting any residue into the glycosylation site to perturb the nxs or nst sequence . also included within the scope of this invention are deletional hoats , i . e ., hoats in which one or more amino acid residues of the reference sequence have been removed at a designated site , whereby flanking residues are now joined by a peptide bond in the ordinary fashion . it generally is not preferred to delete p , c or g residues . typically , deletions or insertions are relatively small , on the order of 1 to 10 residues and generally no more than 2 , although deletions or insertions can be quite large if they are not in critical portions of the reference sequence , or the additional sequence is to be removed at some point during post - translational or post - recovery processing . the number of residues that are deleted or inserted in part will depend upon whether or not they are found in secondary structural components such as helices or sheets ( whereupon only 1 or , preferably 2 residues are inserted or deleted ), or are in less structurally confined domains such as loops , where larger numbers of residues may be deleted or inserted without unduly perturbing the structure of hoat . the hoats of this invention may be subject to post - translational covalent modification , e . g . deamidation of asparagine or glutamine , or oxidation of cysteine residues . glycosylation can be variant or absent depending upon the host cell used to express the variant . hoats containing such modifications are included within the scope of this invention . if hoat is glycosylated in recombinant cell culture , it preferably is glycosylated with carbohydrates characteristic of mammalian cells , although it also may bear fungal ( such as yeast ) glycosylation patterns . glycosylation is acceptable which is characteristic of expression of hoat from one or more of fibroblast , kidney , brain , lung , skin , neural , liver or bone marrow cells or cell lines , or from any mammalian cell line such as cho or embryonic kidney cells . naturally occurring human alleles are included within the scope of this invention . these readily are identified by obtaining nucleic acid samples from individuals in a population , sequencing hoat from such individuals and determining residues at which variation is found . once each variation is identified , it is straight - forward to determine the frequency of the putative allele in other individuals by pcr using primers specific for the domain in question , or such other methods as are conventional in the field for determining proportions of alleles in human populations . the hoats of this invention are readily prepared by methods known in the art . in general , nucleic acid encoding the hoat is prepared by pcr , by in vitro synthesis ( vasser et al ., โ n . a . r .โ 18 ( a0 ): 3089 [ 1990 ]), by cloning from a human genomic or kidney cdna library or combinations thereof . site - directed mutagenesis of hoat - encoding nucleic acid is used to prepare nucleic acid encoding sequence variants . the + ( coding ) and โ strands ( antisense ) of hoat are included within the scope of hoat nucleic acids , as are hoat - encoding cdna , genomic dna and rna . hoat dna includes 5 โฒ and 3 โฒ regions of the hoat gene that are not transcribed but serve as transcription control domains , and transcribed but not expressed domains such as introns ( including splice junctions ), polyadenylation signals , ribosomal recognition domains and the like . the hoat nucleic acid is expressed in in vitro systems or in recombinant host cells . one method for expression is ribosome based synthesis using dedicated trnas ( benner , โ tibtech โ 12 : 158 โ 163 [ 1994 ] and robertson et al ., โ j . am . chem . soc .โ 113 : 2722 โ 2729 [ 1991 ]). ordinarily , however , the hoat - encoding nucleic acid ( generally dna ) is inserted into an appropriate expression vector recognized ( transcribed and translated ) by the host cells , host cells are transfected with the expression vector , the recombinant host cells are grown in suitable culture medium , and optionally the desired hoat is recovered from the recombinant cell culture by chromatographic or other purification methods . it is also within the scope of this invention to partially synthesize the hoat in recombinant cell culture or by in vitro methods and then ligate the polypeptide fragments by peptide ligase ( reverse proteolytic synthesis ). the nucleic acid for expression of the hoat may comprise an exogenous signal sequence . here , the hoat is expressed as a preprotein of hoat , whereby the hoat is expressed as a precursor that is processed to mature hoat . suitable presequences include those of ( a ) microbial proteases such as subtilisin , ( b ) mammalian polypeptides , ( c ) cytokines such as gamma interferon or an interleukin , ( d ) growth factors such as growth hormone or tgf - alpha , ( e ) polypeptides or proteins having n - terminal mature sequences that are homologous to human hoat , ( f ) immunoglobulins , ( g ) receptors , or ( h ) other presequences of secreted or cell membrane bound proteins . signal sequences optionally are derived from or are homologous to the host cell , or at least the phylogenetic branch to which the host cell belongs . for example , one ordinarily would use a presequence of a yeast protein , such as mating factor , in a yeast expression system , or of a bacterium , such as st - ii or beta - lactamase , in bacterial cell culture systems . a wide variety of suitable signal sequences are known and can be used in methods for the preparation of the hoats described herein . the nucleic acid constructs encoding hoat generally are spliced into expression vectors where they will be under the control of sequences controlling transcription , translation and rna stability . these sequences include promoters , operators , enhancers and polyadenylation sequences , and are generally known in the art . constructing suitable expression vectors for hoats of this invention is a matter of routine for those skilled in the art , and will be accomplished using the conventional tools of molecular biology , including nucleic acid synthesis in vitro , pcr , adapters , ligases , restriction enzymes , expression and shuttle plasmids , transfection aids and the like , all of which are publicly ( and for the most part commercially ) available . suitable host cells for transfection with nucleic acid encoding hoat are well known . some are mentioned above while others are described in wo 93 / 13208 at page 12 , line 21 โ page 19 , line 5 , and ep 319 , 312 b1 , page 16 , lines 10 โ 18 and table ii thereof . it may be optimal to use host cells that are capable of glycosylating hoat , typically including mammalian cells such as embryonic kidney 293 cells , cos cells , cho , bhk - 21 cells and the like . xenopus oocytes are suitable for expression of hoat rna . in addition , host cells that have been used heretofore to express anion transporter polypeptides in recombinant cell culture are suitable . the host - vector system should yield substantially homogeneous hoat , thereby avoiding the need to purify various hoat alleles , isoforms or cleavage products from one another . if the host cell is capable of glycosylation , essentially all of the hoat molecules should be glycosylated . in addition , host cells optimally will not proteolyse hoat . cells can be selected that contain no protease , e . g ., in the periplasm , that will cleave hoat . for example , e . coli and other microbial strains are known that possess little or no extracellular or periplasmic proteolytic activity ( other than signal peptidases ). the absence of deleterious proteases helps to ensure that the product is not rendered microheterogenous as to chain length by host - endogenous proteases acting on the hoat expression product . in addition , or alternatively , basic residues of hoat that define sites for proteolytic cleavage are substituted with residues other than k or r . the hoat recombinant cells are cultured under conventional conditions using conventional culture media heretofore employed with the cells in question . these conditions and media are widely known . freshly transfected cells may only transiently express the hoats , but stable transformants readily are obtained in accord with conventional practice using cotransformation with a selection gene such as dhfr or glutamine synthetase and serial culture in the presence of a selection agent such as methotrexate or methionine sulfoximine , respectively . yields of hoats can differ substantially despite minor differences in the character of substituents or insertions . in such cases , it is desirable to screen for an expression system that will yield a quantity of hoat that is at least about 75 % of that obtained with the reference hoat in the same expression system . the hoat may be expressed in bacteria in the form of retractile bodies , in which base the insoluble hoat is recovered and refolded using known methods , e . g . dissolution in a denaturant such as guanidinium hydrochloride followed by gradual removal of the denaturant . directly expressed hoats of this invention may have an extra n - terminal methionine or blocked methionine residue , although host cells can be employed that will cleave away such n - terminal methionine residues if they are extraneous to the protein as found in nature . in order to avoid difficulties with insoluble expression products it is preferable to express hoat in eukaryotic , more preferably mammalian , cells . hoat is isolated or purified from recombinant cell culture by methods heretofore employed for other proteins , e . g ., native or reducing / sds gel electrophoresis , isoelectric focusing , immobilized ph gradient electrophoresis , salt precipitation , solvent fractionation ( using ethanol for example ) and chromatography such as gel filtration , ion exchange ( cation or anion ), ligand affinity ( cibacron blue f3ga or p - aminobenzamidine ), immunoaffinity , chromatofocusing , reverse phase or hydrophobic interaction chromatography . typically , the hoat will be isolated so as to be & gt ; 95 % pure by weight of protein , and preferably greater than 99 % pure . however , the term โ isolated โ as used in reference to hoat protein or nucleic acid refers to the absence of one or more of the normal human polypeptides or nucleic acids found in association with hoat in its natural environment , and does not necessarily imply that the hoat is purified to any degree free of non - hoat proteins . since hoat is normally found in the cell membrane , it is preferable to recover recombinant hoat as a membrane preparation ; otherwise the function of hoat may be perturbed . in any case , many utilities for hoat do not require purification of the protein at all ; screening assays for agonists or antagonists are best conducted in intact host cells . the hoat polypeptides or their fragments optionally are prepared in vitro , especially if they are relatively small , e . g . on the order of about 30 residues or less . for example , hoats are prepared by synthesis using standard solid - phase peptide synthesis procedures as described by merrifield โ j . am . chem . soc .โ 85 : 2149 ( 1963 ). these then are ligated together by the use of peptide ligase reverse proteolysis ). in vitro methods of protein synthesis also are used to prepare hoats without the need for recombinant cell culture . such methods are useful for small - scale preparations , and have the advantage of reducing the possible effect on yields of host cell proteases . in vitro hoat protein synthesis has one additional quite substantial advantage in that it permits the site - specific introduction into the hoat of a non - naturally occurring amino acid residue . accordingly , when the term โ amino acid residue โ is used herein ( in connection with hoat modification by substitution or insertion , especially by a single amino acid ) it will be understood that the amino acid is not limited to the naturally occurring residues associated with native trnas . aminoacyl trna is efficiently prepared using a variety of non - naturally occurring amino acid residues (โ non - naturally occurring โ means not naturally found in proteins , although the amino acid might be found elsewhere in nature ). since the trna is selected to be incorporated at a codon not recognized by any of the trnas normally involved in protein synthesis , the selected non - naturally occurring amino acid residue is incorporated only at the particular site in the hoat sequence chosen for the unique codon . thus , in these cases the hoat is encoded by a nucleic acid having a nonsense codon , e . g ., uag , at the desired unique insertion or substitution site . suitable non - naturally occurring amino acids are described for example in greenstein et al ., โ chemistry of the amino acids โ vols . 1 โ 3 , 1986 . in general , one will use pharmaceutically innocuous l - amino acids that are found in nature but ordinarily not incorporated into proteins . such amino acids typically will be structurally related to a naturally occurring residue that produces the desired effect at a given site and will be used to further resolve and optimize the desired property of the hoat . the hoats of this invention also include hoats that have been substituted by a non - peptidyl moiety , either for purposes of preparing the hoat to begin with or as a subsequent modification of the hoat prepared by amino acid substitution , insertion or deletion as described elsewhere herein . covalent modification may accomplish essentially the same objective as a site - directed mutant at the same location using a naturally occurring residue . tryptophan is a relatively rare amino acid in hoat . accordingly , this residue is an attractive site for post - translational convalent modification because substitution at other sites is expected to be less than may be the case with more common residues . reaction of trp with an oxidant such as a halogen donor , e . g . bromine , will yield the side chain structure this reaction should be conducted in aqueous solvent and at low halogen concentrations . other covalent modifications of hoats will be apparent to the artisan . sensitive side chains are protected by masking them with antibodies directed against an epitope that includes the residue to be protected . reagents for accomplishing such modifications are well - known and have been widely used in the diagnostic and preparative fields . see t . creighton , proteins : structure and molecular properties , 1983 . hoats are cross - linked to a water insoluble matrix or incorporated into a lipid vehicle such as a liposome , usually a ulv . cross - linking is accomplished by reacting the hoat and matrix with a bifunctional agent . examples of suitable bifunctional agents include 1 , 1 - bis ( diazoacetyl )- 2 - phenylethane , glutaraldehyde , n - hydroxysuccinimide esters , for example , esters with 4 - azidosalicylic acid , homobifunctional imidoesters , including disuccinimidyl esters such as 3 , 3 โฒ- dethiobis ( succinimidylpropionate ), and bifunctional maleimides such as bis - n - maleimido - 1 , 8 - octane . derivatizing agents such as methyl - 3 -[( p - azidophenyl ) dithio ] propioimidate yield photoactivatable intermediates that are capable of forming crosslinks in the presence of light . alternatively , hoat is immobilized on reactive water - insoluble matrices such as cyanogen bromide - activated carbohydrates and the reactive substrates described in u . s . pat . nos . 3 , 969 , 287 ; 3 , 691 , 016 ; 4 , 195 , 128 ; 4 , 247 , 642 ; 4 , 229 , 537 ; and 4 , 330 , 440 . hoats also are covalently modified by linking the hoat to various nonproteinaceous polymers , e . g ., polyethylene glycol ( peg ), polypropylene glycol or polyoxyalkylenes , in the manner set forth for example in u . s . pat . nos . 4 , 640 , 835 ; 4 , 496 , 689 ; 4 , 301 , 144 ; 4 , 670 , 417 ; 4 , 791 , 192 or 4 , 179 , 337 . peg is a non - immunogenic , linear , uncharged polymer with three water molecules per ethylene oxide unit . see maxfield , et al ., โ polymer โ 16 : 505 โ 509 ( 1975 ); bailey , f . e . et al ., in โ nonionic surfactants โ, schick , m . j ., ed , pp . 794 โ 821 ( 1967 ). several therapeutic enzymes have been conjugated to peg to increase their in vivo half - life ( abuchowski , a ., et al ., โ j . biol . chem .โ 252 : 3582 โ 3586 ( 1977 ); abuchowski , a . et al ., โ cancer biochem . biophys .โ 7 : 175 โ 186 ( 1984 ). an il - 2 ( interleukin - 2 )- peg conjugate has been reported to increase circulatory life and potency ( katre , n . v . et al ., โ proc . natl . acad . sci .โ 84 : 1487 โ 1491 ( 1987 ); goodson , r . et al ., โ bio / technology โ 8 : 343 โ 346 ( 1990 )). see also abuchowski , a . et al ., โ j . biol . chem .โ 252 : 3578 โ 3581 ( 1977 ). any of the methods for peg conjugation used in these citations is acceptable for use with the hoats of this invention . the hoats of this invention are useful in therapeutic , diagnostic and preparatory methods . their use will depend upon the properties that they possess , as will be apparent to the ordinary artisan . for the most part , all of the hoats will retain hoat immune epitopes , so they are useful in place of hoat in hoat immunoassays whether or not they possess any anion transport activity . the hoats of this invention are useful in identifying substances that bind to hoat ( hoat binding partners , or โ tbp โ). of particular interest are substances that are capable of binding to hoat to substantially inhibit the anion transport activity of hoat , or , preferably , to introduce favorable selectivity into the transport activity such that nephrotoxic drugs such as amphotericin or cidofovir are not taken up as avidly as in the absence of the substance . tbp &# 39 ; s ability to bind to hoat also is useful in methods for recovering hoat from contaminated mixtures such as cell culture supernatants of recombinant hoat - expressing cells ( including the hoat amino acid sequence hoats herein ). typically , hoats can be used in place of hoat standards in immunoassays for hoat if they possess at least one hoat epitope recognized by the antibody used in the hoat immunoassay in question , while the tbps are used in place of antibodies for hoat . the hoats also are useful , as appropriate , in functional assays for certain individual properties of hoat . peptide tbps are obtained by the use of in vitro directed evolutionary methods such as those employing filamentous phage to present candidate sequences ( otherwise known as phage display ) and similar methods known per se which rely on the systematic generation and screening of peptides for activity . these typically are rather small molecules , containing on the order of about 5 to 20 residues . antibody tbps are immunoglobulins , ordinarily monoclonal antibodies , which ( in preferred embodiments ) are capable of specifically inhibiting the transport function of hoat . antibodies are raised in conventional fashion by immunizing an animal with an immunogenic hoat conjugate , e . g . hoat crosslinked to keyhole limpet hemocyanin . the term โ monoclonal antibody โ as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies , i . e . the individual antibodies comprising the population are essentially identical in specificity and affinity . monoclonal antibodies include hybrid and recombinant antibodies ( e . g . โ humanized โ antibodies ) regardless of species of origin or immunoglobulin class or subclass designation , as well as antibody fragments ( e . g ., fab , f ( ab โฒ) 2 โฒ , and fv ). thus , โ monoclonal โ antibodies are produced by any particular method that will yield a substantially homogeneous population . for example , monoclonal antibodies may be made using the methods described by kohler & amp ; milstein , โ nature โ 256 : 495 ( 1975 ), goding , monoclonal antibodies : principles and practice pp . 59 โ 103 ( 1986 ), kozbor , โ j . immunol .โ 133 : 3001 ( 1984 ), or brodeur , et al ., monoclonal antibody production techniques and applications , pp . 51 โ 63 ( 1987 ), or may be made by recombinant dna methods . cabilly , et al ., u . s . pat . no . 4 , 816 , 567 . in a preferred embodiment of the invention , the monoclonal antibody will have an affinity for reference sequence hoat of at least about 10 9 moles / liter , as determined , for example , by the scatchard analysis of munson & amp ; pollard , โ anal . biochem .โ 107 : 220 ( 1980 ). also , the monoclonal antibody typically will inhibit the transport activity of hoat ( using a standard organic anion such as para - aminohippurate ) by at least about 50 %, preferably greater than 80 %, and most preferably greater than 90 %, as determined by conventional methods . dna encoding the monoclonal antibody is readily isolated and sequenced using conventional procedures ( e . g ., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies ). hybridoma cells serve as a preferred source of such dna . once isolated , the dna may be placed into expression vectors , which are then transfected into host cells such as simian cos cells , chinese hamster ovary ( cho ) cells , or myeloma cells that do not otherwise produce immunoglobulin protein , to obtain the synthesis of monoclonal antibodies in the recombinant host cells . the dna optionally may be modified in order to change the character of the immunoglobulin produced by its expression . for example , humanized forms of murine antibodies are produced by substituting a complementarity determining region ( cdr ) of the murine antibody variable domain for the corresponding region of a human antibody . in some embodiments , selected framework region ( fr ) amino acid residues of the murine antibody also are substituted for the corresponding amino acid residues in the human antibody . humanized forms of murine antibodies also may be produced by substituting the coding sequence for human heavy and light constant chain domains in place of the homologous murine sequences . morrison , et al ., โ pnas โ 81 : 6851 ( 1984 ). tbp also includes nucleic acid sequences that bind hoat . evolutionary selection methods for oligonucleotides that bind to target proteins are well known ( wo 92 / 14843 ; ellington et al ., โ nature โ 355 : 850 ( 1992 ); bock et al ., โ nature โ 355 : 564 ( 1992 ); ellington et al ., โ nature โ 346 : 818 ( 1990 ); tuerk et al ., โ science โ 249 : 505 ( 1990 ). these oligonucleotides , commonly known as aptamers , generally contain the usual a , t , g , c or u bases or derivatives thereof , and comprise sequences that bind to a predetermined site on a target protein . a selection method for tbps that inhibit the transport function of hoat comprises ( a ) preparing a pool of candidates ( oligonucleotides , peptides , extracts , proteins , etc . ), ( b ) contacting the candidates with hoat having anion transport activity ( typically reference sequence hoat ) ( c ) isolating from the hoat those candidates that are able to bind to hoat , ( d ) contacting the candidates from step c ) with an hoat in which the hoat transport function has been mutated substantially out of the hoat , and ( e ) recovering those candidates that do not bind to the mutated form . for diagnostic applications , the hoats of this invention optionally are labeled with a detectable moiety , either in vivo or in vitro . the detectable moiety can be any substituent which is capable of producing , either directly or indirectly , a detectable signal . for example , the detectable moiety may be a radioisotope , such as 3 h , 14 c , 32 p , 35 s , or 125 i , a fluorescent or chemiluminescent compound , such as fluorescein isothiocyanate , rhodamine , or luciferin ; a radioactive isotopic label , such as , 125 i , 32 p , 14 c , or 3 h , or an enzyme , such as alkaline phosphatase , beta - galactosidase or horseradish peroxidase . any method known in the art per se can be used to conjugate the hoat to the detectable moiety . see the methods described supra and hunter , et al ., โ nature โ 144 : 945 ( 1962 ); david , et al ., โ biochemistry โ 13 : 1014 ( 1974 ); pain , et al ., โ j . immunol . meth .โ 40 : 219 ( 1981 ); and nygren , j . โ histochem . and cytochem .โ 30 : 407 ( 1982 ). oligonucleotide tbps are labeled in the conventional fashion heretofore employed in the diagnostic probe art . the tbps or hoats of the present invention optionally are employed in known immunoassay techniques , such as competitive binding assays , direct and indirect sandwich assays , and immunoprecipitation assays . zola , monoclonal antibodies : a manual of techniques , pp . 147 โ 158 ( 1987 ). competitive binding assays rely on the ability of a labeled standard ( which may be hoat , or an immunologically reactive portion thereof such as a labeled hoat of this invention ) to compete with the test sample hoat for binding with a limited amount of tbp . the amount of hoat in the test sample is inversely proportional to the amount of standard that becomes bound to the tbp . to facilitate determining the amount of standard that becomes bound , the tbp generally is insolubilized before or after the competition , so that the standard and analyte that are bound to the tbp conveniently are separated from the standard and analyte which remain unbound . sandwich assays involve the use of two tbps , each capable of binding to a different target portion , or epitope , of hoat . in a sandwich assay , the test sample analyte is bound by a first tbp which is immobilized on a solid support , and thereafter a second tbp binds to the analyte , thus forming an insoluble three part complex . david & amp ; greene , u . s . pat . no . 4 , 376 , 110 . the second antibody may itself be labeled with a detectable moiety ( direct sandwich assays ) or may be measured using an anti - tbp antibody that is labeled with a detectable moiety ( indirect sandwich assay ). for example , one type of sandwich assay is an elisa assay , in which case the detectable moiety is an enzyme . the tbps of this invention also are useful for in vivo imaging , wherein a tbp labeled with a detectable moiety is administered to a host , preferably into the bloodstream , and the presence and location of the labeled tbp in the host is assayed . hoat nucleic acids or tbps also can be used in a method for identifying isoforms or alleles of hoat nucleic acids or polypeptides that place a patient at particular risk for nephrotoxicity . such variants , alleles or isoforms will exhibit different selectivity towards uptake of certain anions . if these anions are nephrotoxic drugs or drug metabolites , then a patient may be at particular risk of injury . the patient can be tested ( e . g ., by amplifying genomic hoat - encoding dna from a blood sample ) to determine if the at - risk variant , isoform or allele is present . if so , then the dosage of the drug can be reduced or an alternative drug used . this method comprises identifying one or more naturally - occurring sequence variations in the human population and determining the selectivity of such variations for transport of a selected nephrotoxic substance . then a patient is tested for the variation associated with relatively selective transport of the nephrotoxic substance . similarly , allelic variation in the transcriptional control regions of the hoat gene can be analyzed for correlation with susceptibility to uptake and transport of selected nephrotoxic drugs ; here the correlation will be with the amount of expression of hoat as opposed to the selectivity of the hoat protein . this method comprises identifying one or more naturally - occurring sequence variations in the expression control domain of hoat in the human population and determining the expression levels of hoat in cells containing such variant . patients having relatively high levels of expression of hoat may not be considered suitable for treatment with nephrotoxic drugs , or the dosage of such drugs may be reduced . since at least a domain of hoat is expressed in the brain as well as the kidney ( cf brain est r25797 and example 3 below ), it is also within the scope of this invention to probe a brain library to obtain the full length gene corresponding to r25797 . the sequence of this gene may or may not diverge substantially from the reference sequence hoat . this notwithstanding , the brain - expressed gene is also a suitable subject for determination of sequence variants such as alleles and isoforms . these may be involved in important neural functions and are suitable subjects for screening to identify them . hoat also is useful in screening methods for compounds that can act to suppress or enhance anion uptake and transport by hoat . suppression of hoat activity ( antagonism ) is useful in reducing the nephrotoxicity of drugs , i . e ., to serve as nephroprotective agents , while enhancement of hoat activity ( agonism ) is useful in the treatment of kidney dysfunction . the screening methods comprise providing a candidate hoat agonist or antagonist , contacting the candidate with hoat nucleic acid or polypeptide , determining the effect of the candidate on the transcription of the hoat nucleic acid ( or the expression or biological activity of the hoat polypeptide ), identifying a hoat agonist or antagonist , and optionally preparing additional quantities of the agonist or antagonist that is so identified . biological activity of hoat is assayed using the stable cell line of example 1 as shown in example 2 . hoat is useful in screening assays for modified forms of heretofore nephrotoxic drugs , or as part of a toxicology screening program to determine the potential nephrotoxicity of new therapeutic compounds . accumulation of the candidate in hoat transformants as opposed to control cells is an indicia of potential nephrotoxicity . determining cc 50 &# 39 ; s using the hoat transformants would produce a direct measure of potential nephrotoxicity . a candidate form of a suspected compound or a known nephrotoxic drug , e . g ., a prodrug , is contacted with the hoat and its effect on the transport by hoat of a benchmark anion is determined . transport of the test compound itself ( usually in an isotopically labeled form ) also can be determined . alternatively , transport of the compound in the presence of probenecid can be assayed . if the compound is no longer transported , or the benchmark anion transport is not affected by the compound , or probenecid has no influence on whether or not the compound is transported , then the candidate is suitable for further study in animals as a potential non - nephrotoxic drug , for example , in the case of a prodrug as a non - nephrotoxic form of the parental drug . prodrugs of nucleotide phosphonate analogues such as cidofovir , pmea or pmpa suitable for testing include mono and di - esters and amidates of the phosphonyl group . a cell line stably expressing hoat1 was prepared and characterized to ultimately prove that the isolated cdna encodes functional hoat1 protein . the expression construct containing hoat1 gene was prepared as follows . hoat1 coding sequence was pcr amplified from plasmid isolated from human kidney cdna library . pcr reaction was performed under standard conditions using expand high fidelity pcr system ( boehringer mannheim ). oligonucleotides 5 โฒ- accgtctagaatt ctttttatttttaattttctttcaaatac gtccaccatggcctttaatgacctcctgcagcagg - 3 โฒ ( seq . id no . 3 ) and 5 โฒ- tactcacgtggatcctgatcagacgtctgtaggaccttccctccctttagg - 3 โฒ ( seq . id no . 4 ) were used as a sense and antisense primer to introduce ecori and bamhi restriction site , respectively . in addition , the sense primer contained truncated 5 โฒ- untranslated sequence of alfalfa mosaic virus ( underlined ) and favorable kozak consensus sequence ( ccaccatgg ) ( seq . id no . 5 ) to maximize initiation of translation . the pcr product was digested with ecori / bamhi and cloned into piresneo expression vector ( clontech , palo alto , calif .) using the corresponding restriction sites to yield pires - hoat plasmid . after cloning , the correct nucleotide sequence of the whole fragment generated by pcr was verified . pires - hoat plasmid was transfected into cho - k1 cells ( atcc ccl61 ) growing in f - 12 nutrient mixture supplemented with 10 % fetal bovine serum , 100 u / ml penicillin , and 100 ฮผg / ml streptomycin . 24 hours before transfection , approximately 6 ร 10 6 cho - k1 cells were seeded into 100 - mm petri dish . at the time of transfection , media was aspirated and 6 ml of fresh media containing 12 ฮผg of pires - hoat and 60 ฮผg of cytofectin gsv cationic lipid ( glen research , sterling , va .) was added to the cells . following overnight incubation , selection of stable transformants started in phenol red - free f - 12 nutrient mixture containing fetal bovine serum , penicillin and streptomycin as above , plus 1 mg / ml g418 ( clontech ). viable colonies were isolated after 2 - week selection and tested for uptake of p - aminohippuric acid ( pah , a prototype substrate of organic anion transport systems ) in the presence and absence of probenecid ( inhibitor of organic anion transport ). for the pah uptake assay , the cells were seeded into 12 - well plates at the density of 2 ร 10 5 cell / well . after 48 hours , growth media was aspirated and the cells were washed twice with phosphate buffered saline ( pbs ). the uptake assay was performed in transport buffer ( 135 mm nacl , 5 mm kcl , 2 . 5 mm cacl 2 , 1 . 2 mm mgcl 2 , 0 . 8 mm mgso 4 , 28 mm glucose , and 13 mm hepes ph 7 . 2 ) containing 5 ฮผm [ 3 h ] pah ( new england nuclear , spec . activity 1 . 2 ci / mmol ) ยฑ 1 mm probenecid . after 90 min incubation at 37 ยฐ c . in the transport buffer , the cells were washed 3 - times with ice - cold pbs ( 2 ml / well ) and lysed directly on the plate in the presence of 0 . 3 % triton x - 100 ( 0 . 5 ml / well ) for 20 min at room temperature . plates were washed with additional 0 . 5 ml / well of triton x - 100 , the lysate and wash were combined , scintillation fluid was added , and the radioactivity counted . as a result of this assay , a transformed clone with 30 - fold increase in pah uptake compared to parental cho - k1 cells was identified and designated cho - hoat . kinetics of hoat1 - mediated pah uptake was characterized using cho - hoat cells . the uptake assay was performed as described above with various concentrations of [ 3 h ] pah ranging from 5 to 160 ฮผm . to assess net hoat1 - specific uptake , background uptake measured in parental cho - k1 cells at each substrate concentration was subtracted from that determined in cho - hoat cells . kinetic constants were calculated using enzyme kinetics software ( chemsw , fairfield , calif .). as expected , pah uptake in cho - hoat cells was saturable with k m = 13 ฮผm and vmax = 42 pmol / 10 6 cells . as oppose to the background uptake of pah in cho - k1 cells , uptake in cho - hoat cells was strongly sensitive to probenecid with ic 50 = 6 . 2 ฮผm when measured at pah concentration equal to its k m . in addition , pah accumulation in cho - hoat was stimulated approximately 2 . 5 - fold by preloading the cells with 10 mm glutarate indicating that the hoat protein functions as an organic anion / dicarboxylate exchanger . a human multiple tissue northern blot ( clontech ) was used for localization of hoat1 expression in human tissues . a hoat1 - specific [ 32 p ] datp labeled probe was generated by random priming the bsrgi / bsu36i dna fragment corresponding to nucleotides 420 โ 854 of the hoat1 coding sequence . the membrane was hybridized for 1 hour at 68 ยฐ c . in expresshyb hybridization buffer ( clontech ) and then washed twice in 2 ร ssc with 0 . 05 % sds for 30 minutes at room temperature followed by a single wash in 0 . 1 ร ssc with 0 . 1 % sds at 50 ยฐ c . a strong signal was detected in kidney corresponding to a 2 . 5 kb hoat1 transcript . no positive signal was found in the other tested tissues ( brain , heart , skeletal muscle , colon , thymus , spleen , small intestine , placenta , lung , or peripheral blood leukocytes ). in addition , hoat1 expression in various human tissues was examined by more sensitive rt - pcr amplification . for this purpose , the multiple choice cdna kits i and ii containing tissue specific cdnas ( origene technologies , rockville , md .) and two sets of hoat1 - specific primers were used for pcr detection of hoat1 expression . the oligonucleotides , 5 โฒ- cccgctggcactcctcctccgggag - 3 โฒ ( seq . id no . 6 ) ( sense ), and 5 โฒ- gtagagctcggcagtcatgctcacca - 3 โฒ ( seq . id no . 7 ) ( antisense ), was used to amplify a 606 - bp fragment from the hoat1 coding region ( nucleotides 815 โ 1420 ). in the independent set of pcr reactions , a 295 - bp hoat1 fragment ( comprised of the last 175 coding nucleotides and 120 nucleotides of the 3 โฒ- utr ) was amplified using the oligonucleotides , 5 โฒ- ccagcgctgtcactgtcctcctgc - 3 โฒ ( seq . id no . 8 ) ( sense ), and 5 โฒ- aacccccacacttgggtcaccatttcctc - 3 โฒ ( seq . id no . 9 ) ( antisense ). pcr reactions were carried out using the expand high fidelity pcr system ( boehringer mannheim ) in a total volume of 25 ฮผl containing 1 ฮผg of tissue - specific cdna . thirty - five amplification cycles ( 95 ยฐ c . for 40 s , 58 ยฐ c . for 1 min , and 72 ยฐ c . for 45 s ) were performed . positive tissues were identified after separation of pcr reactions on a 1 % agarose gel . as expected , a strong positive signal was consistently detected in kidney . in contrast with the northern analysis , brain and skeletal muscle was also positive for hoat1 expression although to lesser extent compared to kidney . presence of hoat protein in human kidney tissue was verified by an immunoblot analysis with rabbit anti - hoat1 polyclonal antibody prepared at anaspec ( san jose , calif .) using standard immunological techniques . briefly , an immunogenic peptide , nh2 - tvqdlesrkgkqtr - cooh ( seq . id no . 10 ), corresponding to hoat1 amino acids 515 โ 528 was conjugated to keyhole limpet hemocyanine through a cysteine residue added to the peptide &# 39 ; s c - terminus . animal serum was collected after 4 immunizations in the presence of complete freund &# 39 ; s adjuvant and affinity - purified against the immunogenic peptide immobilized on a sepharose resin . for immunoblot analysis , human kidney cortex was extractracted with a buffer containing 20 mm tri - hcl , ph 7 . 5 , 150 mm nacl , 1 % np - 40 , 0 . 5 % deoxycholate , and 0 . 1 % sds . after homogenization in the presence of complete proteinase inhibitor cocktail ( boehringer mannheim ) the extract was clarified by high - speed centrifugation , separated by electrophoresis on an 8 % sds - polyacrylamide gel and electroblotted onto a nitrocellulose membrane ( millipore , bedford , mass .). the membrane was blocked in pbs / 5 % dry milk ( pbs - m ) for 1 hour , washed 3 times in pbs / 0 . 05 % tween 20 ( pbs - t ), and incubated overnight in pbs - m with the anti - hoat antibody . following wash in pbs - t , the membrane was incubated in pbs - m with goat anti - rabbit antibody conjugated to horseradish peroxidase ( zymed , south san francisco , calif .). after an additional wash and incubation with a chemiluminescent substrate ( amersham , arligton heights , ill . ), the immunoblot was exposed to x - ray film . the antibody recognized a heterogeneous product with an apparent molecular weight of 80 to 90 kda . this was significantly larger than the predicted molecular weight from the hoat1 amino acid sequence ( 60 . 3 kda ). however , when the cortex extract was treated with peptide : n - glycosidase f , which specifically cleaves n - linked oligosaccharide chains , a homogeneous product of 60 kda was detected on the immunoblot . determination of nephrotoxic potential by cell culture assay using hoat transformants adefovir ( adv ) is an anti - hiv nucleotide analog with unique resistance profile currently undergoing phase iii clinical evaluation . the most important clinical toxicity of adv is nephrotoxicity associated with changes in laboratory markers of renal functions . adv is a substrate for human renal organic anion transporter 1 ( hoat ) located in the basolateral membrane of the proximal convoluted tubules . in this example , the role of hoat in the mechanism of adv nephrotoxicity was investigated . chinese hamster ovary cells ( cho ), which exhibit low sensitivity to adv cytotoxicity due to its limited uptake , were stably transformed with hoat cdna to generate cho - hoat cells as described above . uptake and cytotoxicity of adv in the two cell lines was compared . cho - hoat accumulated adv to levels & gt ; 300 - fold higher compared to cho . uptake of adv by cho - hoat was saturable ( k m = 23 um , v max = 390 pmol / 10 6 cells ) and sensitive to the hoat inhibitor probenecid ( pbc ; ic 50 = 6 . 5 um ). importantly , adv was ห 500 - fold more cytotoxic in cho - hoat compared to cho cells . however , in the presence of 1 mm pbc , cho - hoat were only 3 - fold more susceptible to adv than were cho . another antiviral nucleotide , cidofovir ( cdv ), but not its cyclic prodrug ( ccdv ), also efficiently accumulated in cho - hoat ( k m = 70 um , v max = 1 , 110 pmol / 10 6 cells ). accordingly , cdv was & gt ; 400 - fold more cytotoxic in cho - hoat compared to cho . in contrast , cytotoxicity of ccdv was increased to much lesser extent in cho - hoat cells corresponding with the lack of ccdv nephrotoxicity . similar to adv , cdv cytotoxicity was also significantly reduced by pbc . expression of hoat enhances cytotoxicity of adv . since high - level expression of hoat is specific to renal tubules , hoat plays a crucial role in the mechanism of adv nephrotoxicity . thus , hoat inhibitors ( e . g . pbc ) may be useful to overcome adv nephrotoxicity . observations with cdv and ccdv correlate with their nephrotoxic potential and provide additional support for the involvement of hoat in this process . | 2 |
before explaining the present invention in detail , it is to be understood that the invention is not limited in its application to the particular arrangement shown since the invention is capable of other embodiments . referring first to fig1 viewed from the outside the present display unit has a thin , flat , letter - size housing or casing made up of a rectangular base 10 and a similar front or top cover 11 detachably connected to the base in any suitable fashion and covering it when the display unit is in use . the cover 11 presents a flat lcd ( liquid crystal display ) panel or screen 14 of substantially rectangular outline . for supporting the screen 14 the cover has a rectangular frame with opposite , narrow , flat side walls 15 and 16 , a narrow , flat top wall 17 , and a narrow , flat bottom wall 18 , and a border for the screen 14 with narrow , flat front segments 15 b , 16 b , 17 b , and 18 b which extend in from the correspondingly numbered side , bottom and top walls of the frame . preferably , the frame is substantially the same size as a standard letter - size sheet of paper , i . e ., 8 . 5 inches wide by 11 inches long , so that the user handling or viewing it receives a mental impression similar to what he or she would get while reading from a standard letter - sized sheet of paper . the base 10 of the housing has opposite side walls 115 and 116 , a top wall 117 , and a bottom wall 118 which merge smoothly with the correspondingly numbered ( minus 100 ) walls of the cover when it is closed , as shown in fig1 . on the left front segment 15 of the cover near the top are led &# 39 ; s 20 , 21 , 22 and 23 for indicating various functions associated with the display unit , such as โ power ,โ โ battery ,โ โ memory ,โ and โ test .โ on the right front segment 16 b of the cover are manually operable push - buttons 24 , 25 , 26 , 27 and 28 for initiating various commands to the electronic circuitry that determine what appears on the screen 14 , such as โ file ,โ โ document ,โ โ next ,โ โ back ,โ and โ system .โ also on the right front segment 16 b near the top is located a mouse - like scroll bar 29 which the user may slide up and down to quickly locate a document , file or particular line of text displayed on the screen 14 . referring to fig2 and 3 , the base 10 supports on the inside of the housing the following electronic components of the present display unit : a microprocessor 30 , memory chips , 31 , a battery pack 32 , and a microprocessor 34 . a data input port 35 of known design ( fig2 ) is located in the bottom wall 118 of the base . a flexible multi - conductor cable 37 connects the output of microprocessor 30 to the lcd screen 14 . the microprocessors 30 and 34 , memory chips 31 , and various other components of the display unit &# 39 ; s electronic circuitry are on a circuit board 38 located on the inside of base 10 . on the back or inner side of the cover 11 a circuit board 40 carries a backup battery 41 for the ram , a co - processor 42 , chips 43 for sound and infra - red functions , and various other electronic components . a backup power input terminal 44 ( fig3 ) is located in the top wall 17 of the cover . in the use of this device , the user can take it to the location of any computer whose data the user wants to access at his or her convenience . this can be the user &# 39 ; s own desktop computer or portable computer , or a computer to which the user has authorized access , or a central network or another electronic image display unit . the user by a well known technique downloads data from that computer into the user &# 39 ; s portable display unit via the input port 35 . that data now is available for display on the screen 14 any time the user chooses to do so . thus , an abundance of information is readily and conveniently available to the user without the exchange of any paper documents . since the present display unit is limited to read - only operation , there is no possibility for the user to alter or corrupt the downloaded data in any way . the flow chart of fig4 is self - explanatory and does not require extensive reiteration . depressing files displays all files loaded into memory ; depressing doc . displays all documents in a selected file ; depressing next advances to next document in file ; depressing back returns to previous document in file . fig5 shows the unit as a removable screen for a laptop computer . the unit functions as normal after removal . | 8 |
fig1 is an overall block diagram of a data receiver which includes a timing recovery circuit and a jitter canceller circuit in accordance with the present invention . this receiver could be used in a modem designed for a modulated carrier transmission system ; other uses for the invention are described below . the signal s ( t ) received via a transmission channel on line 101 is applied first to a bandpass filter 102 which separates the frequency band of interest . the output s ( t ) of filter 102 is applied both to an analog - to - digital converter 103 and to a timing recovery circuit 105 , which may be arranged as shown in fig2 and as discussed in more detail below . the purpose of timing recovery circuit 105 is to generate a sampling clock signal f s on line 115 which controls the time at which s ( t ) is sampled . diagramatically , control is shown in fig1 by provision of switch 105 which is closed under control of clock signal f s . generally , f s must be at least twice the highest frequency contained in the received signal ; illustratively , f s is chosen at 9600 samples per second . samples s ( nt s ) where t s represents the assumed sampling period , are output from converter 103 and applied to the input of a digital hilbert filter 106 , which resynthesizes the in - phase and quadrature - phase components of the received signal from its real part s ( nt s ) in a manner that is well known to those skilled in the art . these components ( on output lines 107 and 108 , respectively ) are then subsampled at a rate determined by the type of equalizer used ; illustratively , subsampling may occur at a rate of 1200 samples per second , corresponding to a t / 2 fractionally spaced equalizer , where 1 / t represents an assumed symbol rate of 600 symbols per second . again , for diagramatic purposes , subsampling is accomplished in fig1 via closure of switches 109 and 110 . the in - phase and quadrature - phase components of the analytic signal output from filter 106 are designated respectively , and are applied to jitter cancellation circuit 120 which is at the heart of the present invention . this circuit is intended to remove from the applied signal the effects of phase or timing jitter introduced by timing recovery circuit 105 . its construction and manner of operation will be described more fully below . the in - phase and quadrature - phase outputs of jitter cancellation circuit 120 are designated respectively , and are applied to an adaptive equalizer 130 which ideally , removes all intersymbol interference present in the signal as well as all other linear spectral degradations imposed on the signal by the transmission channel . the output of equalizer 130 , designated q i ( nt ) and q g ( nt ), is again subsampled but now at the symbol rate 1 / t ; subsampling is again diagramatically illustrated by provision of switches 131 and 132 . the subsampled output is then applied to demodulator 140 to yield complex information bearing quantities a n and a n &# 39 ;, respectively . when particular carrier frequencies and sampled rates are used , the equalizer subsampling operation partially performs the demodulation . the complex demodulated samples a n and a n &# 39 ; are applied to a decision circuit 150 which determines what symbol a n , a n &# 39 ; in a signalling alphabet used during modulation at the transmitter is closest to the received signal . a decoder 160 then converts each symbol back into its corresponding data bits , which are then applied to a descrambler 170 to provide on line 175 a replica of the original data . outputs a n and a n &# 39 ; from demodulator 140 , as well as the outputs a n , a n &# 39 ; from decision circuit 150 , are also applied to an equalizer update circuit 135 which recursively updates coefficients used to perform equalization . see , for example u . s . pat . no . 4 , 237 , 554 , issued dec . 2 , 1980 to r . d . gitlin et al entitled &# 34 ; coefficient tap leakage for fractionally - spaced equalizers &# 34 ;, u . s . pat . no . 4 , 247 , 940 , issued jan . 27 , 1981 to k . h . mueller et al entitled &# 34 ; equalizer for complex data signals &# 34 ;, and u . s . pat . no . re . 27 , 047 issued feb . 2 , 1971 to r . w . lucky entitled &# 34 ; digital adaptive equalizer system &# 34 ; for an explanation of various aspects of adaptive equalization . the same outputs from demodulator 140 and decision circuit 150 are also applied to a carrier recovery circuit 145 to generate a carrier signal f c on line 146 which is used in demodulator 140 . carrier recovery circuit 145 typically includes a phase locked loop which derives the exact carrier frequency ( which may not precisely agree with frequencies generated by a local oscillator ) and tracks any phase changes acquired by the received signal due to phase jitter or frequency offset . fig2 is a block diagram of one arrangement for implementing timing recovery circuit 105 of fig1 . a hilbert filter 201 ( similar to filter 106 in fig1 ) is arranged to receive the output s ( t ) from bandpass filter 102 and generate in - phase and quadrature - phase components r ( t ) and jr &# 39 ;( t ) on lines 202 and 203 , respectively . these signals are squared in circuits 205 and 206 , the outputs of which are algebraically combined in adder circuit 207 . squaring is used to obtain the envelope of the signal ; alternatively , fourth power circuits may be employed . ( see , for example , bell system technology journal , vol . 57 , no . 5 , may - june 1978 , pp . 1489 - 1498 , &# 34 ; jitter comparison of tones generated by squaring and by fourth power circuits ,&# 34 ; j . e . mazo .) the output of adder circuit 207 is applied to a bandpass filter 210 having its passband centered at the symbol frequency . the output of filter 210 is hard limited in limiter 215 , the output of which supplies the input to a phase locked loop 220 . at this point , the signal has been transformed into a square wave signal of desired amplitude at the symbol frequency . various arrangements for phase locked loop 220 may be used , all of which are intended to provide a sampling clock signal f s on line 115 which controls the sampling performed by analog - to - digital converter 103 of fig1 . as shown in fig2 phase locked loop 220 may include a comparator 222 arranged to compare the input received from limiter 215 with clock signal f s output from counter 224 . the difference or error signal generated by comparator 222 is applied to a control circuit 225 which generates an up / down signal k &# 39 ; which controls the operation of a divider circuit 223 . this signal can take on the value of ยฑ 1 , depending on whether the output from counter 224 is leading or trailing the output of limiter 215 . divider circuit 223 also receives a clock signal f clkv from a fixed rate oscillator 221 illustratively at frequency 2 . 4576 mhz and divides these pulses by a nominal integral factor , illustratively four . in order to obtain the desired nominal frequency for clock signal f s and the desired symbol frequency 1 / t , the output of divider circuit 223 is applied to a count down chain circuit 224 . once per symbol , however , a correction is made by altering the operation of divider circuit 223 in accordance with the value of k &# 39 ;. if the output of control circuit 225 indicates that a phase advance is required , divider circuit 223 divides the output of oscillator 221 by three ; if a retard condition exists , divider circuit 223 switches to division by five . while the arrangement of phase locked loop 220 ensures the sampling frequency f s on line 115 tracks the input applied from bandpass filter 102 , it is observed that each time an adjustment is made , the time at which the next input sample is taken changes by one period of oscillator 221 . this change appears to the receiver as a small phase hit , which reduces the overall receiver performance or gain . similar problems exist with other implementations of phase locked loop 220 . in order to avoid the problems just discussed , the apparatus and method of the present invention uses information derived from the up / down signal , the frequency f clkv of oscillator 221 , as well as the frequency f c of the recovered carrier to generate a recursively updated correction factor e j ฮธ . sbsp . n . each sample output from digital hilbert filter 106 is then corrected in accordance with the corresponding factor . a timing jitter cancellation circuit 120 in accordance with the present invention for use with timing recovery circuit of fig2 is shown in fig3 . as stated previously , the purpose of circuit 120 is to compensate for the phase hits or jumps which are caused by corrections occurring in timing recovery circuit 105 . such phase hits are &# 34 ; permanent ,&# 34 ; since each adjustment in the timing loop corresponds to a hit that never recovers . while the magnitude of the phase hit is reduced as the period of f clkv is reduced , the smallest usable period must be consistent with the ability of the receiver to meet ccitt specified tolerances . for a 600 hz symbol rate , a frequency f clkv near 2 . 4576 mhz has been found to be reasonable . even at this high rate ( with a period of 407 ns ), a phase hit of 0 . 35 degrees occurs at a 2 . 4 khz carrier frequency ; this phase jitter is easily visible on the receiver constellation . the jitter cancellation circuit of fig3 is arranged to correct each sample by performing a complex multiplication of the analytic output r q &# 39 ; ( nt ) and r i &# 39 ; ( nt ) of hilbert filter 106 by a correction factor e j ฮธ . sbsp . n which is a complex vector of unity magnitude having phase ฮธ n . once per symbol interval , at rate 1 / t , ฮธ n is updated , such that ; where ( as stated previously ) k is ยฑ 1 , depending upon the direction ( advance or retard ) of the correction occurring in recovery circuit 105 , f c is the nominal carrier frequency used in the receiver , and f clkv is the clock frequency of oscillator 221 within phase locked loop 220 . it is thus seen that k2ฯf c / f clkv is a correction term having a magnitude determined by the amount of discrete phase change introduced into the received signal when the timing recovery circuit adjusts to keep f s aligned with the input signal . the sign of this quantity depends upon the direction ( advance or retard ) of the correction . in fig3 arithmetic circuit 301 is arranged to receive information representing the values of f clkv and f c , as well as a delayed version k of the value of k &# 39 ;. this delay is introduced in order to compensate for the delay incurred in processing within hilbert filter 106 . the phase correction term ฮธn for the n th sample generated by circuit 301 on line 303 is also fed back to the input of circuit 301 to generate the correction term ฮธ n + 1 for the ( n + 1 ) th sample in accordance with equation ( 1 ). the correction term ฮธ n is applied to a look up circuit 304 which generates the values of sinฮธ n and cosฮธ n on lines 305 and 306 , respectively . this enables correction of the output of filter 106 by the e j ฮธ . sbsp . n = cosฮธ n + jsinฮธ n via a complex multiplication . the outputs of circuit 310 , r i ( nt / 2 ) and r q ( nt / 2 ), are used as inputs to adaptive equalizer 130 . a more detailed illustration of the present invention in block diagram form is found in fig4 . as shown , the product of 2ฯf c / f clkv ( supplied on line 122 from a register 121 ) and the value ( sign ) of k ( supplied on line 123 ) is formed in a multiplier 401 which provides a first input to a summation circuit 402 . the second input to circuit 402 is the value of the phase correction term ฮธ n for the n th sample stored in a one sampled delay element 403 . thus , in accordance with equation ( 1 ), the output of summation circuit 402 provides the updated value ฮธ n + 1 of the correction term for the ( n + 1 ) th sample . the current value of ฮธ n is applied to a read only memory 410 which operates as a look - up table in order to derive the values of sinฮธ n and cosฮธ n on lines 412 and 411 , respectively . the value of sinฮธ n is extended to first inputs of multipliers 421 and 422 , while the value of cosฮธ n is extended to first inputs of multipliers 420 and 423 . second inputs to multiplier 420 and 421 are derived from the output of switch 109 and represent the value of r i &# 39 ; ( nt / 2 ) second inputs to multipliers 422 and 423 represent r q &# 39 ; ( nt / 2 ) output of switch 110 . the outputs of multipliers 420 and 422 are algebraically combined in a first adder circuit 430 such that r i ( nt ) is given by : in like fashion , the outputs of multipliers 421 and 423 are combined in an algebraic combining circuit 431 to yield r q ( nt ) which is given by the outputs of circuits 430 and 431 represent the complex product of each sample and the corresponding correction factor and provide the inputs to adaptive equalizer 130 of fig1 . fig5 and 6 show the receiver constellations with correction in accordance with the present invention ( fig6 ) and without jitter cancellation ( fig5 ). as can be clearly seen , significant reduction in divergence is attained by use of the method and apparatus described above . fig7 illustrates the bit error rate observed with and without jitter cancellation . as can be seen , about 2 db in signal - to - noise ratio improvement was attained . the present invention is most useful when low symbol rates are employed , because timing changes then occur at a slower rate , resulting in larger step size changes in the output of timing recovery circuit 105 . the invention is also most useful in situations in which large variations in clock frequency drift are expected . in most ddd applications where communications occur between modems of different manufacturers , such large variation can be expected . various adaptations and modifications of the present invention can be made by those skilled in the art without departing from the spirit and scope of the invention . accordingly , it is intended that the invention be limited only by the following claims . for example , in fig1 it is possible to locate the timing jitter canceller 120 at the output of adaptive equalizer 130 rather than proceeding its input . however , with this modification , the delay occasion by processing in the equalizer must be estimated such that the value of k used in circuit 120 corresponds to the value used to control sampling of the output of analog - to - digital converter 103 . it is also possible to use an analog hilbert filter instead of digital hilbert filter 106 of fig1 . in this event , a / d converters , placed after the hilbert filter instead of using converter 103 , sample at rate f s / 2 . with this modification , delay element 310 is adjusted accordingly or eliminated . | 7 |
the following table provides a dictionary of the terms used in the description of the invention . table i______________________________________abbreviateddesignation______________________________________ amino acidala l - alaninephe l - phenylalaninehomophe s - 2 - amino - 4 - phenylbutyric acidlys l - lysinenaphthylala 1 - naphthylalaninecyclohexylala cyclohexylalaninetyr ( ome ) o - methyl - l - tyrosinetyr l - tyrosinetza s - 2 - amino - 3 -( 4 - thiazolyl ) propionic acid ( thiazolylalanine ) his l - histidinegly glycineleu l - leucinemet l - methioninealg s - 2 - amino - 4 - pentenoic acid ( allyl glycine ) ppg s - 2 - amino - 4 - pentynoic acid ( propargyl glycine ) pgy s - 2 - amino - pentanoic acid ( propyl glycine ) bgy s - 2 - amino - hexanoic acid ( butyl glycine ) nia s - 2 - amino - 3 - cyanopropanoic acid ( nitrile alanine ) z benzyloxycarbonylboc tert - butyloxycarbonyltr triphenylmethyl acylsiva isovalerylbnma bis -( 1 - naphthylmethyl )- acetyl esters with -- och . sub . 3 methanol -- oc . sub . 2 h . sub . 5 ethanol -- och ( ch . sub . 3 ). sub . 2 2 - propanol -- oc ( ch . sub . 3 ). sub . 3 tert - butanol solvents and reagentschcl . sub . 3 chloroformdmf n , n - dimethylformamidedmso dimethylsulfoxidehobt hydroxybenzotriazoledcc n , n &# 39 ;- dicyclohexyl - carbodiimidehoac acetic acidet . sub . 3 n triethylaminethf tetrahydrofuranch . sub . 2 cl . sub . 2 dichloromethanemeoh methanoletoac ethyl acetate______________________________________ a is boc , iva , bma , ## str5 ## wherein : r , r 1 are each independently h , ch 3 , c 2 h 5 , n - c 3 h 7 or i - c 3 h 7 ## str6 ## is a saturated ring containing two to five carbon atoms with q = o , s , n - boc , n - z , nr or ch 2 - d is ## str7 ## or ch 3 ; x is absent , phe , homophe , naphthylala , cyclohexylala , tyr or tyr ( ome ) with the proviso that when a = ## str8 ## y is leu , ala , gly pgy , ppg , bgy , met , his , tza , alg , nia ## str9 ## wherein : ( r 1 is as defined above r 2 is ## str10 ## b a straight chain of from two to six carbons that is saturated , olefinic or acetylenic . r 3 = r 1 and r 2 . ## str11 ## is as defined above ; w is ## str12 ## wherein : r 4 =-- ch 2 ch ( ch 3 ) 2 , -- ch 2 ph , -- ch 2 - chexyl , -- ch 2 - cpentyl , or - chexyl ; r 5 = ## str13 ## or r 5 is a keto group with the proviso that either r 6 or r 7 is absent . r 6 , r 7 are each independently -- h , ## str14 ## wherein r , r 1 and ## str15 ## are as defined above . preferred compounds of the present invention are those of formula i wherein ## str16 ## r and r 1 are each independently h , ch 3 , c 2 h 5 , n - c 3 h 7 or i - c 3 h 7 ; ## str17 ## is a saturated ring containing two to five carbon atoms and q is o , s , nr or ch 2 with r defined above . more preferred compounds of the present invention are those of formula i wherein ## str18 ## wherein r and r 1 are each independently ch 3 , c 2 h 5 , n - c 3 h 7 or i - c 3 h 7 . particularly preferred compounds falling within the scope of the invention include the following compounds , their isomers , and pharmaceutically acceptable acid addition salts : ## str19 ## the compounds of the present invention have the advantage of increased hydrophilicity . this property makes the compounds more readily absorbed . the compounds include solvates and hydrates and pharmaceutically acceptable acid addition salts of the basic compounds of formula i above . certain novel intermediates are useful in the preparation of the compounds of the instant invention . they include but are not limited to : ## str21 ## compounds of formula i may be prepared by a process which comprises : ( a ) condensing ## str22 ## with excess organometallic reagent in an inert solvent to produce ## str23 ## wherein r 8 is ethyl , vinyl , isopropyl or 1 , 3 - dithian - 2 - yl ; ( b ) reducing with kbh 4 the product of step ( a ) above to produce ## str24 ## wherein r 8 is c 2 h 5 , c 2 h 3 , ch ( ch 3 ) 2 , ## str25 ## ( c ) modifying the product of step ( a ) above wherein r 8 is vinyl by reacting with amines or mercaptans to produce ## str26 ## wherein r 1 is lower alkyl and then reducing the product with kbh 4 to produce ## str27 ## wherein r 9 is n ( r 1 ) 2 or sr 1 ( d ) reacting ## str28 ## from step ( b ) or ( c ) above with ## str29 ## in a protic solvent to produce ## str30 ## wherein r 10 is ethyl , vinyl , isopropyl , 1 , 3 - dithian - 2 - yl , ## str31 ## or ch 2 ch 2 sr 1 which are then separated by column chromatography ; or ( e ) alternatively reacting ## str32 ## from step ( b ) or ( c ) above with methanolic hydrogen chloride in dichloromethane to produce ## str33 ## wherein r 10 is as defined above which are separated by column chromatography ; and ( f ) using the products of step ( d ) above to produce by known means the desired compound of formula i above . the term pharmaceutically acceptable acid addition salt is intended to mean a relatively nontoxic acid addition salt either from inorganic or organic acids such as , for example , hydrochloric , hydrobromic , hydroiodic , sulfuric , phosphoric , acetic , citric , oxalic , malonic , salicylic , malic , benzoic , gluconic , fumaric , succinic , ascorbic , maleic , tartaric , methanesulfonic , and the like . the salts are prepared by contacting the free base form with a sufficient amount of the desired acid to produce a salt in the conventional manner . the free base forms may be regenerated by treating the salt form with a base . the modified peptides of the present invention possess one or more chiral centers and each center may exist in either the r or s configuration . the present invention includes all enantiomeric and epimeric forms as well as the appropriate mixtures thereof . additionally , the preferred absolute configuration is shown on two illustrative examples below : ## str34 ## the stereocenter marked with an asterisk is preferred in both r and s configurations as both show renin inhibitory action . some of the above novel peptides may be prepared in accordance with well - known procedures for preparing peptides from their constituent amino acids . other of the novel peptides of the present invention are prepared by a step - wise procedure or by a fragment coupling procedure depending upon the particular final product desired . the following scheme illustrates novel methods of preparing certain peptides of the present invention . ## str35 ## according to scheme i above , the boc - lactam , ( 1 ) ( prepared according to methods found in u . s . pat . no . 4 , 876 , 343 is reacted with excess grignard reagent such as vinyl or ethyl magnesium bromide in an inert solvent such as ether or thf to afford the ring opened product , ( 2 ). in the case of the vinyl adduct the r - side chain may be further modified by michael additions with amines and mercaptans . scheme i shows the addition of n - methyl - aminoethane to give ( 3 ). reduction with a hydride agent such as nabh 4 , kbh 4 , znbh 4 , libh 4 and the like in a protic solvent , such as meoh , etoh , iproh , h 2 o , followed by removal of protecting groups with acidic reagents such as meoh . hcl or tfa affords the aminodiol , ( 4 ) as a mixture of two diastereomers that are separated by flash chromatography . stepwise coupling and deprotection of z - his ( tr ) and ## str36 ## ( prepared according to epa 314060 by methods which are standard to the art of peptide chemistry affords the renin inhibitor , ( 6 ). alternatively , intermediate ( 5 ) may be coupled to the carboxylic acid ( 7 ) to give the renin inhibitor , ( 8 ) after removal of protecting groups . both diastereomers of intermediate ( 4 ) lead to active renin inhibitors . an alternative , highly convergent strategy for synthesis of compounds of the present invention is shown in scheme ii . selective removal of the thp protecting group from 12 , using a mildly acidic reagent such as pyridinium p - toluenesulfonate in a protic solvent such as ethanol , methanol or isopropanol at 20 ยฐ- 70 ยฐ c . gives the diastereomeric 1 , 3 - diols , 13 and 14 . these diols are readily separated by flash chromatography on silica gel . compounds 13 and 14 are then individually coupled to an a - x - y fragment such as 15 to afford the desired renin inhibitors , 16 and 17 . the a - x - y fragments are prepared by methods standard to the art of peptide chemistry . ## str37 ## the strategy of peptides chain assembly and selection and removal of protecting groups is discussed in chapter 1 , &# 34 ; the peptide bond ,&# 34 ; in &# 34 ; the peptides . analysis , synthesis , biology ,&# 34 ; e . gross and j . meienhofer , eds ., academic press , new york , n . y ., 1979 , vol . 1 , pp . 42 - 44 . the dcc / hobt method of coupling is well - known to those skilled in the art and is discussed in chapter 5 , &# 34 ; the carbodiimide method &# 34 ; by d . h . rich and j . singh in &# 34 ; the peptides . analysis , synthesis , biology ,&# 34 ; e . gross and j . meienhofer , eds ., academic press , new york , n . y ., 1979 , vol . 1 , pp . 241 - 261 . peptide coupling depends on activating the carboxy terminus of the amino protected amino acid and condensing it with another peptide containing a free amino terminus . in addition to the dcc coupling method described above , other methods of activating the carboxyl group of a protected amino acid include : 1 ) the azide method -- described in chapter 4 of the above reference . 2 ) the mixed anhydride method -- described in chapter 6 of the above reference . 3 ) the active ester method -- described in chapter 3 of the above reference . the term lower alkyl refers to straight or branched chain alkyl radicals containing from one to six carbon atoms including but not limited to methyl , ethyl , n - propyl , isopropyl , n - butyl , iso - butyl , sec - butyl , 2 - methylhexyl , n - pentyl , 1 - methylbutyl , 2 , 2 - dimethylbutyl , 2 - methylpentyl , 2 , 2 - dimethylpropyl , n - hexyl , and the like . aryl means phenyl , naphthyl or other aromatic groups , including mono - or bicyclic , which may be substituted , especially monosubstituted , by f , cl , br , i , cf 3 , oh , or , or r , wherein r is lower alkyl . heteroaryl means aromatic heterocyclic rings containing at least one heteroatom selected from o , s , and n and from three to five carbon atoms including but not limited to thiazoles and imidazoles . aralkyl is as described above for alkyl and aryl , including but not limited to benzyl . the compounds of the present invention are useful for treating renin - associated hypertension , congestive heart failure , and hyperaldosteronism . they are also useful as diagnostic tools for determining the presence of renin - associated hypertension or hyperaldosteronism . pharmaceutical compositions which comprise an effective amount of the compound in combination with a pharmaceutically acceptable carrier are part of the present invention . an important aspect of the present invention is a method of treating renin - associated hypertension in a mammal which comprises administering a pharmaceutical composition containing an effective amount of a compound of the invention in combination with a pharmaceutically acceptable carrier to the mammal . another equally important aspect of the present invention is a method of treating hyperaldosteronism in a mammal which comprises administering a pharmaceutical composition containing an effective amount of a compound of the invention in combination with a pharmaceutically acceptable carrier to the mammal . an additional aspect of the present invention is a method for treating congestive heart failure in a mammal which comprises administering a pharmaceutical composition containing an effective amount of a compound in combination with a pharmaceutically acceptable carrier to the mammal . the effectiveness of the aforementioned compounds is determined by a test for in vitro renin inhibitory activity . this activity is determined by a standard radioimmunoassay for angiotensin i . in this assay the enzyme , renin , incubated for two hours at 37 ยฐ in the presence of a substrate , angiotensinogen , generates the product , angiotensin i . test compounds are added to the incubation mixture . relative activity is reported as the ic 50 , which is the molar concentration of test compound causing a 50 % inhibition of the renin activity . table ii__________________________________________________________________________compound ic . sub . 50__________________________________________________________________________ ( nm ) ## str38 ## 18 ## str39 ## ( fast isomer ) ( slow 11 1 . 1 ) ## str40 ## ( fast isomer ) ( slow 280 220 ## str41 ## 500 ## str42 ## ( fast isomer ) ( slow 0 . 90 0 . 24 ## str43 ## ( slow isomer ) 0 . 26 ## str44 ## ( slow isomer ) 0 . 47 ## str45 ## ( slow isomer ) 1 . 35 ## str46 ## ( fast isomer ) ( slow & gt ; 100 43 . 8 ## str47 ## ( slow isomer ) & gt ; 100 ## str48 ## ( fast isomer ) 13 . 0 ## str49 ## ( fast isomer ) ( slow 5 . 8 0 . 75 ## str50 ## ( slow isomer ) 2 . 1 ## str51 ## ( fast isomer ) ( slow 17 . 0 4 . 95 ## str52 ## 36 . 4__________________________________________________________________________ as can be seen from the above table , the compounds of the present invention have a significant effect on the activity of renin and thus are useful for the treatment of hypertension , hyperaldosteronism , and congestive heart failure . for preparing pharmaceutical compositions from the compounds described by this invention , inert , pharmaceutically acceptable carriers can be either solid or liquid . solid form preparations include powders , tablets , dispersible granules , capsules , cachets , and suppositories . a solid carrier can be one or more substances which may also act as diluents , flavoring agents , solubilizers , lubricants , suspending agents , binders , or tablet disintegrating agents ; it can also be encapsulating material . in powders , the carrier is a finely divided solid which is in admixture with the finely divided active compound . in the tablet the active compound is mixed with carrier having the necessary binding properties in suitable proportions and compacted in the shape and size desired . the powder and tablets preferably contain from 5 to 10 to about 70 percent of the active ingredient . suitable solid carriers are magnesium carbonate , magnesium stearate , talc , sugar , tragacanth , methylcellulose , a low melting wax , cocoa butter , and the like . the term &# 34 ; preparation &# 34 ; is intended to include the formulation of the active compound with encapsulating material as carrier providing a capsule in which the active component ( with or without other carriers ) is surrounded by carrier , which is thus in association with it . similarly , cachets are included . tablets , powders , cachets , and capsules can be used as solid dosage forms suitable for oral administration . the compound of the present invention may be administered orally , buccally , parenterally , by inhalation spray , rectally , or topically in dosage unit formulations containing conventional nontoxic pharmaceutically acceptable carriers , adjuvants and vehicles as desired . the term parenteral as used herein includes subcutaneous injections , intravenous , intramuscular , intrasternal injection , or infusion techniques . for preparing suppositories , a low melting wax such as a mixture of fatty acid glycerides or cocoa butter is first melted , and the active ingredient is dispersed homogeneously therein by stirring . the molten homogeneous mixture is then poured into convenient sized molds , allowed to cool , and thereby solidify . liquid form preparations include solutions , suspensions , and emulsions . as an example may be mentioned water or water / propylene glycol solutions for parenteral injection . liquid preparations can also be formulated in solution in aqueous polyethyleneglycol solution . aqueous suspensions suitable for oral use can be made by dispersing the finely divided active component in water with viscous material , i . e ., natural or synthetic gums , resins , methylcellulose , sodium carboxymethylcellulose , and other well - known suspending agents . also included are solid form preparations which are intended to be converted , shortly before use , to liquid form preparations for either oral or parenteral administration . such liquid forms include solutions , suspensions , and emulsions . these particular solid form preparations are most conveniently provided in unit dosage form and as such are used to provide a single liquid dosage unit . alternately , sufficient solid may be provided so that after conversion to liquid form , multiple individual liquid doses may be obtained by measuring predetermined volumes of the liquid form preparation as with a syringe , teaspoon , or other volumetric container . when multiple liquid doses are so prepared , it is preferred to maintain the unused portion of said liquid doses at low temperature ( i . e ., under refrigeration ) in order to retard possible decomposition . the solid form preparations intended to be converted to liquid form may contain , in addition to the active material , flavorants , colorants , stabilizers , buffers , artificial and natural sweeteners , dispersants , thickeners , solubilizing agents , and the like . the liquid utilized for preparing the liquid form preparation may be water , isotonic water , ethanol , glycerine , propylene glycol , and the like , as well as mixtures thereof . naturally , the liquid utilized will be chosen with regard to the route of administration , for example , liquid preparations containing large amounts of ethanol are not suitable for parenteral use . preferably , the pharmaceutical preparation is in unit dosage form . in such form . the preparation is subdivided into unit doses containing appropriate quantities of the active component . the unit dosage form can be a packaged preparation , the package containing discrete quantities of preparation , for example , packeted tablets , capsules , and powders in vials or ampules . the unit dosage form can also be a capsule , cachet , or tablet itself , or it can be the appropriate number of any of these in packaged form . the quantity of active compound in a unit dose of preparation may be varied or adjusted from 1 mg to 500 mg , preferably 5 to 100 mg according to the particular application and the potency of the active ingredient . the compositions can , if desired , also contain other compatible therapeutic agents . in therapeutic use as renin inhibitors , the mammalian dosage range for a 70 kg subject is from 1 to 1500 mg / kg of body weight per day or preferably 5 to 750 mg / kg of body weight per day optionally in divided portions . the dosages , however , per day may be varied depending upon the requirements of the patient , the severity of the condition being treated and the compound being employed . determination of the proper dosage for a particular situation is within the skill of the art . generally , treatment is initiated with small dosages which are less than the optimum dose of the compound . thereafter the dosage is increased by small increments until the optimum effect under the circumstances is reached . for convenience , the total daily dosage may be divided and administered in portions during the day if desired . [ 1 -( cyclohexylmethyl )- 4 - oxo - 2 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ] hexyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center is rs ; other centers are s ) a solution of 15 . 16 g ( 0 . 040 mole ) of 5 -( cyclohexylmethyl )- 4 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ]- 2 - oxo - 1 - pyrrolidinecarboxylic acid , 1 , 1 - dimethylethyl ester , mixture of [ 4s -[ 4r *( r *), 5r *] and [ 4s -[ 4r *( s *), 5r *]] isomers , in 200 ml of dry tetrahydrofuran is cooled to 5 ยฐ c . under nitrogen and with stirring , 27 . 5 ml ( 0 . 055 mole ) of 2m ethylmagnesium bromide in tetrahydrofuran is added over a period of five minutes , preventing the temperature from rising above 12 ยฐ c . with mild cooling . after stirring at 10 ยฐ c . for one - half hour , the reaction solution is poured , under nitrogen , into a stirred mixture of 300 g of ice and water . saturated citric acid ( 200 ml ) and 300 ml of ether are added . the organic layer is washed well with water , dried ( magnesium sulfate ) and concentrated to give 15 . 80 g of crude product . silica gel chromatography eluting with hexane to 2 : 1 hexane - ethyl acetate gives 9 . 40 g ( 57 %) of pure product ; tlc ( silica gel , 2 : 1 hexane - ethyl acetate ) rf 0 . 6 ; fab - ms , mw = 411 . [ 1 -( cyclohexylmethyl )- 4 - hydroxy - 2 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ] hexyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran and 4 - hydroxy centers are rs ; other centers are s ) a solution of 9 . 30 g ( 0 . 023 mole ) of [ 1 -( cyclohexylmethyl )- 4 - oxo - 2 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ] hexyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center is r , s ; other centers are s ) in 100 ml of absolute ethanol is treated with 0 . 85 g ( 0 . 023 mole ) of sodium borohydride . after one and one - half hours stirring at room temperature , acetone ( 10 ml ) is added with mild cooling . after 15 minutes the solution is concentrated at reduced pressure , water ( 100 ml ) is added and the separated oil is extracted into 200 ml of petroleum ether . the dried ( potassium carbonate ) ether solution is concentrated to give 7 . 90 g ( 83 %) of alcohol product ; tlc ( silica gel , 2 : 1 hexane - ethyl acetate ) double spot rf 0 . 4 - 0 . 5 ; fab - ms , mw = 413 . a solution of 7 . 80 g ( 0 . 019 mole ) of the product from example 2 in 100 ml of methylene chloride and 50 ml of methanol is cooled to 5 ยฐ c . and saturated with hydrogen chloride gas . the solution is allowed to stand at room temperature for six hours and then concentrated at reduced pressure to remove solvent . the crude hydrochloride salt is purified by silica gel chromatography eluting with chloroform to 20 % methanol - chloroform ; weight 4 . 10 g ( 81 %); tlc ( silica gel , 2 : 10 methanol - chloroform ) one spot , rf 0 . 4 . the purified hydrochloride is converted to the base by dissolution in 50 ml of water , addition of 10 % potassium carbonate and extraction into 150 ml of ether ; ms , mw = 229 . n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ n ( ฮฑ )-( phenylmethloxy ) carbonyl - n ( ฯ )- triphenylmethyl ] histidinamide ( two diastereomers isolated : 4 - hydroxy center is r or s , other centers are s ) a solution of 2 . 60 g ( 0 . 011 mole ) of 6 - amino - 7 - cyclohexyl - 3 , 5 - heptanediol from example 3 in 50 ml of methylene chloride is treated successively with 1 . 68 g ( 0 . 011 mole ) of 1 - hydroxybenztriazole hydrate , 5 . 85 g ( 0 . 011 mole ) of z -( trt ) his and 2 . 27 g ( 0 . 011 mole ) of dicyclohexylcarbodiimide . after standing at room temperature the dicyclohexylurea is filtered and the filtrate is concentrated to ca 15 ml volume . ether ( 100 ml ) is added and the solution is washed with 100 ml of 3 % sodium bicarbonate and then 50 ml of water . after drying over sodium sulfate the ether solution is concentrated to give 8 . 20 g of crude product . purification by silica gel chromatography eluting with chloroform to 5 % methanol - chloroform gives a fraction enriched in &# 34 ; fast &# 34 ; moving diastereomer ( tlc ; silica gel , 1 : 10 methanolchloroform , major spot rf 0 . 7 , trace spot rf 0 . 6 ) and a fraction enriched in &# 34 ; slow &# 34 ; moving diastereomer with major spot at rf 0 . 6 and a trace of rf 0 . 7 . each diastereomer shows fab - ms , mw = 742 . 4 . n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ n ( ฯ )- triphenylmethyl ) histidinamide (&# 34 ; fast &# 34 ;) isomer : 4 - hydroxy center is r or s ; other centers are s ) a solution of 2 . 30 g ( 0 . 0031 mole ) of enriched &# 34 ; fast &# 34 ; diastereomer from example 4 in 30 ml of methanol is reduced at low pressure for eight hours with 100 mg of 20 % palladium on carbon and hydrogen . the catalyst is filtered and the methanol solution concentrated at reduced pressure . the crude product is chromatographed with silica gel and elution with chloroform to 5 % methanol - chloroform to give 1 . 60 g of a single spot material , rf 0 . 3 - 0 . 4 ( tlc ; silica gel , 1 : 10 methanol - chloroform ); fab - ms , mw = 608 . 3 . n - 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ n ( ฯ )- triphenylmethyl ] histidinamide (&# 34 ; slow &# 34 ;) isomer : 4 - hydroxy center is either r or s ; other centers are s ) the &# 34 ; slow &# 34 ; diastereomer from example 4 is subjected to catalytic debenzylation and purified as in example 5 to similarly obtain the &# 34 ; slow &# 34 ; isomer , rf 0 . 2 - 0 . 4 with a trace of rf 0 . 3 - 0 . 4 ; fab - ms , mw = 608 . 3 . n -( 4 - morpholinylsulfonyl )- l - phenylalanyl - n - 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l - histidinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; fast &# 34 ; isomer ) a solution of 1 . 45 g ( 0 . 0024 mole ) of &# 34 ; fast &# 34 ; isomer from example 5 in 25 ml of methylene chloride is treated successively with 0 . 37 g ( 0 . 0024 mole ) of 1 - hydroxybenztriazole hydrate , 0 . 76 g ( 0 . 0024 mole ) of morpholineosulfonyl - l - phenylalanine and 0 . 50 g ( 0 . 0024 mole ) of dicyclohexylcarbodiimide . after standing at room temperature overnight the urea is filtered and the filtrate is concentrated at reduced pressure to remove most of methylene chloride . the residue is taken up into 100 ml of ether and the solution is washed with 50 ml of saturated sodium bicarbonate and 50 ml of water . the dried ( sodium sulfate ) organic phase is concentrated to give 2 . 00 g of crude product . purification by silica gel chromatography eluting with chloroform to 5 % methanolchloroform gives the trityl protected product ; weight 1 . 65 g ; tlc ( silica gel , 1 : 10 methanol - chloroform ) rf 0 . 5 ; fab - ms , mw = 904 . 4 . a solution of 1 . 60 g ( 0 . 0018 mole ) of the above adduct in 16 ml of glacial acetic acid is treated with 4 ml of water . the solution is heated at 95 ยฐ c . for six minutes . water ( 25 ml ) is added to precipitate triphenylmethyl alcohol . the mixture is cooled in an ice bath and filtered . the filtrate is concentrated at reduced pressure and 75 ml of saturated sodium bicarbonate and 100 ml of methylene chloride are added . the bottom organic layer is separated , dried over potassium carbonate and concentrated to give 1 . 00 g of crude product . this material is purified by silica gel chromatography eluting with chloroform to 5 % methanol - chloroform to give the desired product ; tlc ; ( silica gel , 2 : 10 methanol - chloroform ) rf 0 . 6 ; fab - ms , mw = 662 . 3 . n -( 4 - morpholinylsulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l - histidinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow &# 34 ; isomer ) the &# 34 ; slow &# 34 ; diastereomer from example 6 is coupled to morpholinosulfonyl - l - phenylalanine as in example 7 giving a material moving slower on tlc ( silica gel , 1 : 10 methanol - chloroform ) rf 0 . 45 with traces at rf 0 . 4 and 0 . 5 ; fab - ms , mw = 904 . 4 . this isomer is detritylated as in example 7 for the &# 34 ; fast &# 34 ; isomer to give &# 34 ; slow &# 34 ; moving product on tlc ( silica gel , 2 : 10 methanol - chloroform ) rf 0 . 55 ; fab - ms , mw = 662 . 3 . note : the slow and fast isomers were compared side by side and mixed on tlc . also , the nmr showed diastereomeric differences . [ 1 -( cyclohexylmethyl )- 4 - oxo - 2 -[ tetrahydro - 2 - h - pyran - 2 - yl ) oxy ]- 5 - hexenyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center is rs ; other centers are s ) a solution of 51 . 36 g ( 0 . 135 mole ) of 5 -( cyclohexylmethyl )- 4 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ]- 2 - oxo - 1 - pyrrolidinecarboxylic acid , 1 , 1 - dimethylethyl ester , mixture of [ 4s -[ 4r *( r *), 5r *] and [ 4s -[ 4r *( s *), 5r *]] isomers , in 500 ml of tetrahydrofuran is cooled to 5 ยฐ c ., under nitrogen with stirring . a quantity of 175 ml ( 0 . 175 mole ) ( 30 % excess ) of 1m vinylmagnesium bromide in tetrahydrofuran is added over 20 minutes , keeping the temperature at 5 ยฐ c . the solution is allowed to warm to 15 ยฐ c . and maintained there for one - half hour . the solution is poured into 800 ml of ice and water with stirring . saturated citric acid ( 300 ml ) and ether ( 800 ml ) are added . the aqueous layer is separated . the organic layer is washed well with water , dried ( magnesium sulfate ) and concentrated ; wt 57 . 0 g . silica gel chromatography , eluting with hexane and then 2 : 1 hexane - ethyl acetate gives purified vinyl ketone ; tlc ( 2 : 1 hexane - ethyl acetate ) rf 0 . 6 . [ 1 -( cyclohexylmethyl )- 6 -( ethylmethylamino )- 4 - oxo - 2 -[( tetrahydro - 2 - h - pyran - 2 - yl ) oxy ] hexyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center is rs ; other centers are s ) a solution of 14 . 33 g ( 0 . 035 mole ) of the vinyl ketone from example 9 in 100 ml of methylene chloride is treated with 4 . 14 g ( 0 . 07 mole ) of n - ethylmethylamine . after one hour the solvent and excess amine are evaporated to give product ; tlc ( 2 : 1 hexane - ethyl acetate , silica gel ) rf 0 . 1 ; fab - ms shows mw = 468 . [ 1 - cyclohexylmethyl )- 6 -( ethylmethylamino )- 4 - hydroxy - 1 , 1 - dimethylethyl ester ( pyran center and 4 - hydroxy center are rs ; other centers are s ) a quantity of 20 ml of water is added to a solution of 16 . 40 g ( 0 . 035 mole ) of the amino ketone in 200 ml of methanol . this solution is treated with a solution of 1 . 89 g ( 0 . 035 mole ) of potassium borohydride in 20 ml of water , cooling to keep the temperature at 20 ยฐ c . after one hour , 20 ml of acetone is added . after 15 minutes the methanol is removed at reduced pressure and the separated gum is extracted into a solution of 300 ml of ether and 50 ml of methylene chloride . the organic phase is dried ( potassium carbonate ) filtered and evaporated to give product ; tlc ( 2 : 10 methanol - chloroform , silica gel ) rf 0 . 2 - 0 . 4 , two overlapping spots ); dei - ms shows mw = 470 . a solution of 16 . 0 g ( 0 . 034 mole ) of the blocked amino alcohol from example 11 in 100 ml of methylene chloride is diluted with 200 ml methanol and cooled on an ice bath under nitrogen . the cold solution is then charged with a vigorous stream of dry hydrogen chloride for five minutes and subsequently allowed to stand at room temperature overnight . the solvent and excess hydrogen chloride are removed at reduced pressure . the dihydrochloride residue is converted to the base by dissolution is 20 ml of water , charcoaling , filtering , saturating with potassium carbonate and extracting into 300 ml of methylene chloride ( top layer ). the organic solution is dried ( potassium carbonate ) and concentrated ; wt 11 . 00 g of mixed diastereomers as a crude oil . purification is effected by silica gel chromatography as follows : the column is packed with 1 : 10 methanol - chloroform . the column is further deactivated by passage of two column volumes of 3 : 10 : 0 . 3 methanol - chloroform - conc . ammonium hydroxide and then two column volumes of chloroform . the diamino diol is placed on the column as a chloroform solution and eluted to separate diastereomers with 3 : 10 : 0 . 3 methanol - chloroform - conc . ammonium hydroxide , giving 2 . 98 g of fast spot material , tlc ; rf 0 . 4 ( 3 : 10 : 0 . 3 methanol - chloroform - ammonium hydroxide , silica gel , and 3 . 69 g of slow spot material , rf 0 . 3 ( same tlc system ); dei - ms shows mw = 286 for both diastereomers . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 6 -( ethylmethylamino )- 2 , 4 - dihydroxyhexyl ]- l - histidinamide (&# 34 ; fast &# 34 ; isomer : 4 - hydroxy center is r or s , other centers are s ) the diaminodiol &# 34 ; fast &# 34 ; isomer from example 12 is sequentially coupled to histidine and n - morpholinosulfonyl - l - phenylalanine as described in examples 5 and 7 lo afford the &# 34 ; fast &# 34 ; isomer of the desired product ; tlc ( silica gel , chloroform - methanol - conc . nh 4 oh . sub . ( aq ), 10 : 3 : 0 . 3 ) r 0 . 4 ; fab - ms shows mw = 720 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 6 -( ethylmethylamino )- 2 , 4 - dihydroxyhexyl ]- l - histidinamide (&# 34 ; slow &# 34 ; isomer : 4 - hydroxy center is r or s , other centers are s ) the diaminodiol &# 34 ; slow &# 34 ; isomer from example 12 is sequentially coupled to histidine and n - morpholinosulfonyl - l - phenylalanine as described in examples 5 and 7 to afford the &# 34 ; slow &# 34 ; isomer of the desired product ; tlc ( silica gel , chloroform - methanol - conc . nh 4 oh . sub . ( aq ), 10 : 3 : 0 . 3 ) rf 0 . 3 ; fab - ms shows mw = 720 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n - 1 -( cyclohexylmethyl )- 6 -( ethyldimethylammonium )- 2 , 4 - dihydroxyhexyl ]- l - histidinamide iodide (&# 34 ; slow &# 34 ; isomer : 4 - hydroxy center is r or s , other centers are s ) a solution of 0 . 33 g ( 0 . 00045 mole ) of the &# 34 ; slow &# 34 ; isomer of example 14 in 5 ml of methylene chloride is diluted with 1 ml of ether and cooled to 10 ยฐ c . a solution of 0 . 065 g ( 0 . 0045 mole ) of methyl iodide in 1 ml of methylene chloride is added and the solution is allowed to warm to room temperature . after three days standing the supernatant is decanted from the separated gum and the gum is triturated with 5 ml of methylene chloride . decantation leaves 0 . 45 g of product . purification is effected by dissolution in ca . 2 ml of methanol and precipitation as an amorphous solid with 25 m of ether . filtration gives 0 . 49 g of product ; hplc , 92 . 7 %; nmr ( ฮด , dmso - d 6 ), 2 . 98 ( s , 6h , + n ( me ) 2 ). a mixture of n -( 4 - morpholinosulfonyl )- phe ( 3 . 15 g , 10 mmol ), dcc ( 2 . 1 g , 10 mmol ), hobt ( 1 . 35 g , 10 mmol ) and dmf ( 20 ml ) was stirred at 20 ยฐ c . for five minutes . the resulting slurry was treated consecutively with n ( ฮต )- z - lys ( ome ). hcl ( 3 . 32 g , 10 mmol ), triethylamine ( 1 . 4 ml , 10 mmol ) and ch 2 cl 2 ( 10 ml ). the reaction was stirred for 48 hours at 20 ยฐ c . then ch 2 cl 2 was evaporated . ethyl acetate was added and the solids were removed by filtration . evaporation of the filtrate gives a wet solid that was triturated with water , dissolved in chcl 3 and washed with 5 % k 2 co 3 ( aq ). the organic layer was dried over mgso 4 and evaporated to a pale yellow solid . trituration with ethyl acetate gives 5 . 3 g of a colorless solid . tlc ( silica gel , chcl 3 - meoh , 9 : 1 ); rf 0 . 75 . a solution of the product from example 16 ( 5 . 28 g , 8 . 95 mmol ) in thf ( 125 ml ) was treated with 20 % pd / c ( 0 . 55 g ) under an atmosphere of hydrogen . after three hours , methanol ( 125 ml ) was added and catalyst removed by filtration . the resulting solution was treated with methyl isothiocyanate ( 0 . 7 g , 9 . 6 mmol ) and stirred 18 hours at 20 ยฐ c . evaporation gave a solid that was recrystallized from hot chcl 3 by dropwise addition of ether to give the desired product ( 4 . 25 g ); fab - ms , mw = 529 . the product from example 17 ( 4 . 25 g , 8 ,. 02 mmol ) was dissolved in thf ( 50 ml ) and 1n naoh ( 20 ml ) added . the reaction mixture was stirred at ambient temperature for 24 hours and the solution diluted with water ( 200 ml ). the mixture was acidified to ph 2 with 2n hcl and extracted three times with methylene chloride . the combined organic layers were dried over anhydrous magnesium sulfate , filtered , and evaporated to dryness to give 3 . 98 g ; fab - ms , mw = 515 . [ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( two diastereomers isolated : 4 - hydroxy center is either r or s , other centers are s ) to a solution of the product from example 2 ( 14 . 1 g , 34 . 09 mmol ) in absolute ethanol ( 140 ml ) was added pyrridinium - p - toluene - sulfonate ( 0 . 86 g , 3 . 41 mmol ). the reaction mixture was heated at 55 ยฐ c . for three hours and the solvent removed under reduced pressure . the residue was taken up in ethyl acetate and extracted twice with water . the organic layer was dried over anhydrous magnesium sulfate , filtered , and the filtrate evaporated under reduced pressure to give 13 . 74 g of a mixture of diastereomers . the diastereomers were separated by flash chromatography eluting with a solvent gradient of 5 to 40 % ethyl acetate in hexane to give 5 . 72 g ( 51 % yield ) of the fast isomer and 4 . 72 g ( 42 % yield ) of the slow isomer ; ci - ms shows mw = 329 for both diastereomers . 6 - amino - 7 - cyclohexyl - 3 , 5 - heptane diol hydrochloride (&# 34 ; slow &# 34 ; isomer : 3 - hydroxy center is either r or s , other centers are s , one of two diastereomers found in example 3 ) the slow isomer from example 19 ( 2 . 25 g , 6 . 83 mmol ) was dissolved in methylene chloride ( 25 ml ) and meoh / hcl ( 0 . 029 g / ml hcl , 20 . 14 mmol ) ( 25 ml ) added to this solution . the reaction mixture was stirred at ambient temperature for 23 hours and the solvent removed under reduced pressure . the residue was triturated with ether and the suspension evaporated to dryness to give 1 . 86 g ( quantitative yield ); dei - ms shows mw = 229 . 6 - amino - 7 - cyclohexyl - 3 , 5 - heptane diol hydrochloride (&# 34 ; fast &# 34 ; isomer : 3 - hydroxy center is either r or s , other centers are s , one of two diastereomers found in example 3 ) the fast isomer from example 19 was treated as in example 20 to give the analogous product ; dei - ms shows mw = 229 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl - l - n ( ฮต )-( n - methylthiocarbamyl )] lysinamide (&# 34 ; slow &# 34 ; isomer : 4 - hydroxy center is either r or s , other centers are s ) to a 5 ยฐ c . solution of the product from example 20 ( 0 . 92 g , 3 . 47 mmol ), the product from example 18 ( 1 . 68 g , 3 . 47 mmol ), hobt ( 0 . 94 g , 6 . 95 mmol ) and triethylamine ( 0 . 70 g , 3 . 47 mmol ) in dmf ( 25 ml ) was added dcc ( 0 . 72 g , 3 . 47 mmol ). the reaction mixture was stirred at 5 ยฐ c . for one hour , then at ambient temperature for 18 hours . the resulting suspension was filtered and the filtrate was evaporated at reduced pressure . the residue was purified by flash chromatography , eluting with 2 to 10 % methanol in methylene chloride to give 1 . 48 g of product ; fab - ms shows mw = 727 . n -( 4 - morphoinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl - l - n ( ฮต )-( n - methylthiocarbamyl )] lysinamide (&# 34 ; fast &# 34 ; isomer : 4 - hydroxy center is either r or s , other centers are s ) the product from example 21 was coupled to the product from example 18 as in example 22 to give the desired compound ; fab - ms shows mw = 727 . 1 - cyclohexylmethyl )- 4 -( 1 , 3 - dithian - 2 - yl )- 4 - oxo - 2 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ] butyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center is rs ; others are s ) preparation of anion of 1 , 3 - dithiane : a solution of 12 . 4 g ( 0 . 10 mole ) of 97 % 1 , 3 - dithiane in 200 ml of thf is cooled to - 30 ยฐ c . a quantity of 62 . 5 ml ( 0 . 1 mole ) of 1 . 6m n - butyllithium is added with stirring under nitrogen over a period of 10 min ant - 30 ยฐ. after 15 min a solution of 42 . 0 g ( 0 . 011 mole ) of 5 - cyclohexylmethyl )- 4 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ]- 2 - oxo - 1 - pyrrolidinecarboxylic acid , 1 , 1 - dimethylethyl ester , mixture of [ 4s -[ r *( r *), 5r *] and [ 4s -[ 4r *( s *), 5r *]] isomers , in 200 ml of thf is added to the above prepared 1 , 3 - dithiane anion over a period of 10 min at - 30 ยฐ. the reaction solution is allowed to warm to room temperature over ca . 2 hours . after another hour at room temperature the solution is poured ( under n 2 ) into a stirred mixture of 500 g of ice and water . saturated citric acid solution ( 200 ml ) and ether ( 600 ml ) are added . the aqueous layer is separated and the organic phase is dried ( mgso 4 ), filtered and concentrated to give crude gum . silica gel chromatography eluting with 1 to 30 % etoac - hexane gives 29 . 30 g ( 59 %) of product as a gum ; tlc ( 2 : 1 hexane - etoac ) major spot rf 0 . 7 , trace rf 0 . 8 . the product crystallizes and is recrystallized from etoac ; mp 129 ยฐ- 131 ยฐ; cl - ms shows mw = 501 . 1 - cyclohexylmethyl )- 4 -( 1 , 3 - dithian - 2 - yl )- 4 - hydroxy - 2 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ] butyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center and 4 - hydroxy centers are rs ; others are s ). a quantity of 0 . 70 g ( 0 . 014 mole ) of ketone from example 24 is dissolved in 150 ml of warm methanol . the cooled solution ( 25 ยฐ c .) is treated with 1 ml of water and then a solution of 0 . 10 g ( 0 . 002 mole ) of kbh 4 in 1 ml of water . after 1 hour acetone ( 5 ml ) is added to the reaction solution . after 15 min the solvent is removed at reduced pressure , water ( 5 ml ) is added and the separated gum is extracted into 20 ml of ch 2 cl 2 . the solution is dried ( k 2 co 3 ), filtered and concentrated to give crude product as a mixture of diastereomers ; tlc ( 2 : 1 hexane - etoac ) 2 spots , rf 0 . 3 and 0 . 5 ; fab - ms shows mw = 503 . 3 . a solution of 0 . 40 g ( 0 . 0008 mole ) of the blocked amino diol from example 25 in 20 ml of 50 % meoh -- ch 2 cl 2 is cooled to 10 ยฐ and saturated with hcl gas . the solution is allowed to warm to room temperature and to stand overnight . the solvent is stripped off at reduced pressure and the residue is dissolved in 5 ml of water . the solution is treated with activated charcoal , filtered , and saturated with solid k 2 co 3 . the separated gum is extracted into etoac , and the organic layer is dried over mgso 4 and evaporated ; wt . 0 . 15 g of mixed diastereomers ; tlc ( 1 : 10 meoh -- chcl 3 - saturated with nh 3 ) 2 spots , rf 0 . 5 and 0 . 7 ; ms shows mw = 320 . 1 . separation of diastereomers is accomplished by silica gel chromatography eluting with from 1 to 10 % meoh -- chcl 3 , saturated with nh 3 . [ 1 -( cyclohexylmethyl )- 6 -( 1 - methylethyl ) thio ]- 4 - oxo - 2 -[ tetra - hydro - 2h - pyran - 2 - yl ) oxy ] hexyl ] carbamic acid , 1 , 1 - dimethyl - ethyl ester ( pyran center is rs ; others are s ) a solution of 20 . 50 g ( 0 . 05 mole ) of the vinyl ketone from example 9 in 100 ml of meoh is treated with 5 . 70 g ( 0 . 075 mole ) of isopropyl mercaptan and then 8 . 10 g ( 0 . 080 mole ) of triethylamine . after 15 min at room temperature the solvent is removed at reduced pressure and 200 ml of cold saturated citric acid and 300 ml of 25 % ch 2 ch 2 - ether are added to the residue . the dried ( mgso 4 ) extract is concentrated ; wt . 21 . 00 g ( 86 %); tlc ( 2 : 1 hexane - etoac ) one spot , rf 0 . 8 ( visualized with ninhydrin and heat ); analysis , calcd for c 26 h 47 no 5 s : c , 64 . 29 ; h , 9 . 75 ; n , 2 . 88 ; s , 6 . 60 . found : c , 65 . 08 ; h , 9 . 91 ; n , 2 . 76 ; s , 5 . 90 . [ 1 -( cyclohexylmethyl )- 4 - hydroxy - 6 -[( 1 - methylethyl ) thio ]- 2 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ] hexyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center and 4 - hydroxy centers are rs ; others are s ) water ( 2 ml ) is added to a solution of 2 . 80 g ( 0 . 0058 mole ) of ketone from example 27 in 20 ml of methanol . a solution of 0 . 31 g ( 0 . 0058 mole ) of kbh 4 in 2 ml of water is added . after one hour at room temperature , 5 ml of acetone is added . the solvent is stripped off at reduced pressure . ice water ( 10 ml ) is added and the product is extracted into 50 ml of ether ; wt . 2 . 58 g ( 91 %); tlc ( 2 : 1 hexane - etoac ) one spot , rf 0 . 55 ; fab - ms shows mw = 487 . 3 . a solution of 2 . 40 g ( 0 . 005 mole ) of blocked amino diol from example 28 in 50 ml of ch 2 cl 2 is treated with 25 ml of methanolic hcl ( methanol saturated with hcl at 10 ยฐ). after four hours at room temperature the volatiles are removed at reduced pressure and the residue is dissolved in 100 ml of water . the charcoaled solution is saturated with k 2 co 3 and the mixed diastereomers are extracted into 100 ml of 25 % ch 2 cl 2 - ether ; wt . 0 . 70 g ( 47 %); tlc ( 1 : 10 meoh - chcl 3 - saturated with nh 3 ) two spots , rf 0 . 4 and 0 . 5 . separation of diastereomers is accomplished by silica gel chromatography eluting with 2 - 5 % meoh - chcl 3 ( saturated with nh 3 ); isomer a , tlc ( above system ) rf 0 . 5 ; ms shows mw = 303 . 2 ; isomer b , tlc ( above system ) rf 0 . 4 ; ms shows mw = 303 . 2 . dimethyl aminomalonate was coupled to n -( 4 - morpholinosulfonyl )- phe as described in example 16 . the product was crystallized from methyl , t - butyl ether ; fab - ms shows mw = 443 . the product from example 30 ( 10 g , 22 . 6 mmol ) was dissolved in a mixture of thf ( 50 ml ) and methanol ( 25 ml ) and treated at 0 ยฐ c . with 2n naoh ( 23 ml , 46 mmol ). after 15 min the reaction was quenched with 2n hcl ( 23 ml , 46 mmol ) and partitioned between ethyl acetate and sat . nacl . sub . ( aq ). the organic layer was dried over mgso 4 and evaporated . the residue was redissolved in ethyl acetate ( 40 ml ), treated at 0 ยฐ c . with diisopropylamine ( 4 . 5 ml , 22 . 6 mmol ) and allowed to stand at room temperature . the crystalline product was collected to give 12 . 9 g ; mp 122 - 123 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n -[ l -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- dl -( 2 - carbomethoxy ) glycinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow isomer &# 34 ;) the aminodiol . hcl from example 20 was coupled with the dicyclohexylamine salt from example 31 by treatment with dcc and hobt in dmf . work - up and chromatography was performed in a manner analogous to example 22 to afford the desired product ; fab - ms shows mw = 640 . 1 - cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ n ( ฮฑ )- 1 , 1 - dimethylethoxy ) carbonyl - 2 -( 2 - propenyl )] glycinamide ( 4 - hydroxy center is r or s ; others are s )(&# 34 ; slow &# 34 ; isomer ) the aminodiol from example 20 was coupled to boc - alg and purified in a manner analogous to example 4 to give the product as a single stereoisomer ; fab - ms shows mw = 426 . n - 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ 2 -( 2 - propenyl )] glycinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow &# 34 ; isomer ) the product from example 33 was dissolved in dichloromethane and treated with methanolic hcl at rt for 1 hour . evaporation afforded the desired product as its hydrochloride salt . the free base was regenerated by partitioning between ethyl acetate and dilute k 2 co 3 ( aq ). the organic layer was dried over mgso 4 and evaporated to a foam ; fab - ms shows mw = 326 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n - 1 - cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ 2 -( 2 - propenyl )] glycinamide ( 4 - hydroxy center is r or s ; others are s (&# 34 ; slow &# 34 ; isomer ) the product from example 34 was coupled to n -( 4 - morpholinosulfonyl )- phe in a manner analogous to example 7 to give the desired product ; fab - ms shows mw = 622 . n -[ 4 -( 1 , 1 - dimethylethoxycarbonyl )- 1 - piperazinosulfonyl ]- l - phenylalanyl - n -[ 1 - cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ 2 -( 2 - propenyl )] glycinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow &# 34 ; isomer ) the product from example 34 was coupled to n -( 4 - boc - 1 - piperazinosulfonyl )- phe in a manner analogous to example 7 to give this product ; fab - ms shows mw = 721 . n -( 1 - piperazinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl )- l - 2 -( 2 - propenyl )] glycinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow &# 34 ; isomer ) the product from example 36 was dissolved in dichloromethane and treated with methanolic hcl to remove the boc group . evaporation of solvents and regeneration of the free base by partitioning between ethyl acetate and dilute k 2 co 3 , drying the organic layer over mgso 4 , and evaporating the organic layer gives the product as a foam ; fab - ms shows mw = 621 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ] glycinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow &# 34 ; isomer ) n -( 4 - morpholinosulfonyl )- l - phenalalanyl glycine was prepared in a manner analogous to examples 30 and 31 , substituting glycine ethyl ester for dimethyl aminomalonate . this material was subsequently coupled to the aminodiol from example 20 in a manner analogous to example 22 to afford the desired product ; fab - ms shows mw = 582 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxy - 6 -[( 1 - methylethyl ) thio ]- dl -( 2 - carboxymethyl )- glycine . ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow &# 34 ; isomers ) the aminodiol . hcl from example 29 was coupled to the dicyclohexylamine salt from example 31 by treatment with dcc and hobt in dmf . work - up and chromatography was performed in a manner analogous to example 22 to afford the desired product ; fab - ms shows mw = 696 . | 2 |
hereinafter , some exemplary embodiments of the present invention are described in detail with reference to the accompanying drawings . fig1 is a perspective view illustrating an exemplary embodiment of the present invention and shows a battery pack 1 . further , fig2 is a diagram showing one of battery modules 2 constituting the battery pack 1 . in a description relating to the exemplary embodiment of the present invention , it is assumed that the battery module 2 ( refer to fig2 ) forms a basic unit capable of supplying a power source and a number of the battery modules 2 , coupled together at regular intervals so that they can be dismantled and assembled in a casing 3 ( refer to fig1 ), form the battery pack 1 . meanwhile , the battery module 2 preferably includes a tray 5 , a battery cell 7 , a cell charger 9 , a cell controller 11 , a heating mat 13 , and a temperature sensor 15 as one set . further , in the exemplary embodiment of the present invention , the battery modules 2 preferably are configured to be easily assembled in the casing 3 using fastening members 16 ( refer to fig1 ), such as screws , and to be easily replaced in the casing 3 as occasion demands . the exemplary embodiment of the present invention is described in more detail below . the casing 3 includes a reception space in which the battery modules 2 can be accommodated . the casing 3 further includes an opening 3 a having one face opened . a plurality of guide slots 3 b is formed in the opposite sides of the casing 3 ( both internal faces on the basis of the front face of fig2 ). the trays 5 are inserted into the guide slots 3 b , provided in the opposite internal faces of the casing 3 , at regular intervals . the guide slots 3 b are disposed at regular intervals in a certain direction . the trays 5 inserted into the guide slots 3 b are stacked in a certain direction . each of the trays 5 has extension portions 5 a on its both sides . the extension portions 5 a are inserted into the guide slots 3 b . that is , the extension portions 5 a are inserted into the guide slots 3 b provided in the casing 3 . further , the trays 5 can be robustly fastened to the casing 3 using the fastening members 16 , such as screws . the trays 5 are fastened to the casing 3 using the fastening members 16 , such as screws , so that the battery module 2 can be easily detached from the casing 3 when the corresponding battery module 2 is defective or run down and a new battery module 2 can be easily coupled to the casing 3 by unfastening the fastening members 16 , such as screws . since the trays 3 and the casing 3 are coupled together by the fastening members 16 such as screws , the maintenance and repair of the battery pack 1 is facilitated , and the life span of the battery pack 1 can be prolonged . the battery cells 7 are provided in the respective trays 5 . the battery cells 7 are charged with a power source and so they can supply a power source externally . the battery cell 7 is coupled to the tray 5 . the battery cell 7 includes terminals 7 a and 7 b connecting an electrode of a negative polarity and an electrode of a positive polarity . the terminals 7 a and 7 b can be used to drain a power source , charged in the battery cell 7 , externally or to charge the battery cell 7 with a power source . the cell charger 9 and the cell controller 11 , as shown in fig3 and 4 , can be coupled to a printed circuit board ( pcb ) or can be provided in the form of a chip . the cell charger 9 functions to charge the battery cell 7 . the cell charger 9 preferably corresponds to one battery cell 7 . the cell controller 11 can control a corresponding cell charger 9 . further , the heating mat 13 and the temperature sensor 15 are electrically connected to the cell controller 11 . that is , the cell controller 11 can receive a value measured by the temperature sensor 15 and control the heating mat 13 . a connector 11 a ( refer to fig2 ) is provided in the printed circuit board ( pcb ) in which the cell controller 11 is provided . the cell controller 11 is electrically connected to the temperature sensor 15 through the connector 11 a . the number of cell controllers 11 preferably corresponds to the number of battery modules 2 . further , a communication connector 11 b connected to a main controller 17 ( refer to fig5 to 7 ) ( i . e ., a battery management system ( bms ) is provided in the printed circuit board ( pcb ) in which the cell controller 11 is provided . accordingly , the cell controller 11 can send and receive data to and from the main controller 17 through the communication connector 11 b . the temperature sensor 15 can measure the temperature of the battery cell 7 and send a measured value to the cell controller 11 or the main controller 17 . when the temperature of the battery cell 7 is low , the heating mat 13 can be controlled by the cell controller 11 in order to raise the temperature of the battery cell 7 . the heating mat 13 , as shown in fig1 and 2 , preferably is configured to surround the battery cell 7 or provided in one side of the battery cell 7 . meanwhile , the battery module 2 can be supplied with a power source for driving the elements of the battery module 2 . fig6 is a diagram illustrating an exemplary embodiment of the present invention and is a block diagram showing the main elements of the battery management system . referring to fig6 , the battery modules 2 of the present invention are electrically connected to each other and connected to each other so that they can be controlled by the respective main controllers 17 . to the main controller 17 are electrically connected a current sensor 19 for sensing current coming from the battery pack 1 and a current breaking switch 21 for breaking current coming from the battery pack 1 . the current breaking switch 21 preferably includes elements suitable for power control , such as a number of insulated gate bipolar transistors ( igbt ) or power fets which are coupled in parallel and are capable of controlling high power . the main controller 17 , as shown in fig6 , includes a charging control module 23 for receiving information about a state of charge ( soc ) of each of the battery cells 7 from the cell controllers 11 and controlling each of the cell chargers 9 based on the information . the charging control module 23 is a control program for controlling the cell chargers 9 . the charging control module 23 can receive data , such as a voltage and a charging current of the battery cell 7 , from the cell controller 11 , analyze the received data , and send a charging command to the cell charger 9 if the battery cell 7 needs to be charged . the main controller 17 further includes a temperature control module 27 . the temperature control module 27 receives signals corresponding to values measured by the temperature sensors 15 and controls the heating mats 13 or the cooling fan 25 for controlling the temperature of the battery cells 7 . the cooling fan 25 is installed in the casing 3 and it can function to lower the general temperature of the battery pack 1 . the temperature control module 27 is a control program for appropriately maintaining the temperature of the battery cells 7 . the main controller 17 includes a battery cell protection control module 29 for controlling the current breaking switch 21 in response to an input signal from the current sensor 19 . the battery cell protection control module 29 is a control program capable of protecting the battery cells 7 from overcurrent or overcharging . the main controller 17 further includes a cell grading control module 31 . the cell grading control module 31 performs a cell grading process of checking the capacities of the battery cells 7 based on signals received from the respective cell controllers 11 and determining whether the battery cells 7 are appropriate . the cell grading control module 31 is a control program for performing the cell grading process for the battery cells 7 . the cell grading control module 31 can determine the remaining life span of the battery cells 7 by calculating the life span of the battery cells 7 based on respective signals received from the cell controllers 11 . if the cell grading control module 31 determines that a specific battery cell 7 is inappropriate and run down , the battery module 2 including the corresponding battery cell 7 can be removed or replaced , thereby prolonging the life span of the battery pack 1 . in this description , for convenience &# 39 ; sake , the cell grading process is illustrated to determine a state of charge ( soc ), a state of health ( soh ), etc . of the battery cell . the main controller 17 further includes a communication control module 33 for sending data , related to the battery cells 7 and received from the cell controllers 11 , and data processed in relation to the data to an external memory 39 or for communicating the data with an external computer . the communication control module 33 is a control program capable of sending and receiving data to and from an external device , such as a computer device . meanwhile , the main controller 17 , as shown in fig5 , includes communication ports 47 , such as a can communication port 41 , a tcp / ip communication port 43 , and a usb communication port 45 . the communication ports 47 can exchange data with the external computer device in various ways under the control of the communication control module 33 . further , internal memories 35 ( refer to fig6 ) are connected to the respective cell controllers 11 . the main controller 17 further includes a history management control module 37 for recording and managing the history of each of the battery cells 7 in the respective internal memories 35 . the history management control module 37 functions to manage data , such as the history of the past of each of the battery cells 7 so that the battery pack 1 can be managed in an optimal state . the operation and function of the battery pack 1 configured as above according to an exemplary embodiment of the present invention is described in detail below . first , a worker inserts the battery modules 2 , included in the battery cell 7 , into the guide slots 3 b provided in the casing 3 and couples the battery modules 2 to the casing 3 using the fastening members 16 , such as screws . next , the worker inserts the extension portions 5 a , provided on both sides of each of the trays 5 constituting the battery modules 2 , into the guide slots 3 b . next , the worker couples the trays 5 to the casing 3 using the fastening members 16 , such as screws . as described above , since the battery modules 2 are sequentially inserted into the casing 3 and fastened thereto using the fastening members 16 , the battery pack 1 of an assembly form can be completed . the number of battery modules 2 connected to the battery pack 1 can be different according to a necessary capacity of power in order to appropriately control the capacity of the battery pack 1 as occasion demands . further , a control process through the main controller 17 according to an exemplary embodiment of the present invention is described below . the cell controller 11 checks a voltage , a charging current , etc . of the battery cell 7 . further , the temperature sensor 15 senses the temperature of the battery cell 7 and sends the sensed temperature to the cell controller 11 . further , the cell controller 11 stores information about the battery cell 7 in the internal memory 35 and simultaneously sends the information to the main controller 17 . further , the current sensor 19 senses the current of the battery pack 1 and sends the sensed current to the main controller 17 . the main controller 17 inputs information about the battery cell 7 to the external memory 39 through the communication control module 33 . further , the main controller 17 can load information about the battery cell 7 , stored in the external memory 39 . the main controller 17 sends a signal to a corresponding cell controller 11 if it determines that a corresponding battery cell 7 needs to be charged based on the information about the corresponding battery cell 7 and the data received from the current sensor 19 . in response to the signal , the cell controller 11 controls a corresponding cell charger 9 so that it charges the corresponding battery cell 7 . the temperature control module 27 of the main controller 17 sends a control signal to the cell controller 11 when the temperature of a specific battery cell 7 has a set value or less . in response to the control signal , the cell controller 11 operates the heating mat 13 in order to raise the temperature of the specific battery cell 7 . further , when the temperature of the battery cells 7 is higher than a set value or more , the temperature control module 27 of the main controller 17 operates the cooling fan 25 . when the cooling fan 25 is operated as described above , the temperature of the battery cells 7 is generally lowered . if the battery cell protection control module 29 of the main controller 17 determines that a specific battery cell 7 has been overdischarged or overcharged or the temperature of the battery cell 7 has exceeded a normal range based on the data received from a corresponding cell controller 11 , it operates the current breaking switch 21 in order to protect the battery pack 1 . meanwhile , the cell grading control module 31 of the main controller 17 can pick out an inappropriate battery module 2 by checking the capacity of a corresponding battery cell 7 , received from the cell controller 11 . accordingly , the worker can remove the inappropriate battery module 2 from the casing 3 and install an appropriate battery module 2 in the casing 3 . consequently , since a battery cell grading process can be performed in a process of manufacturing the battery pack 1 , the battery pack 1 with an excellent quality can be fabricated . further , the cell grading control module 31 calculates the life span of the battery cell 7 based on the data received from the cell controller 11 . accordingly , the general life span of the battery pack 1 can be prolonged by replacing the battery module 2 , including a run - down battery cell 7 , with the battery module 2 including a new battery cell 7 . the signals sent to the main controller 17 can be stored in the external memory 39 through the communication control module 33 . in particular , the history management control module 37 of the main controller 17 databases the histories of the battery modules 2 and stores and manages the data . in accordance with the exemplary embodiments of the present invention , a process of manufacturing the battery pack can be simplified and the manufacturing cost can be reduced because battery cell - balancing needs not to be performed through additional processes . fig8 to 10 are exemplary photographs to which the exemplary embodiments of the present invention are applied . while this invention has been described in connection with what is presently considered to be practical exemplary embodiments , it is to be understood that the invention is not limited to the disclosed embodiments , but , on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . | 7 |
fig1 shows a counterholding tool 1 , which has a housing 2 and a box - end wrench insert 3 , which is placed over a screw nut 4 . if the screw 5 is now tightened by suitable means ( not shown ) from the other side of the illustrated flange 6 , and if the screw nut 4 then also rotates in the direction of the arrow under the influence of the coupling forces exerted upon it by friction , then this torque must be absorbed by the counterholding tool 1 . in the type of use illustrated in fig1 which shows the screw - fastening of a flange 6 , this torque is absorbed by having the housing 2 rest against a further nut 4 &# 39 ;. the housing 2 thus forms the stop of the counterholding tool 1 and the nut 4 &# 39 ; acts as the stationary abutment . the torque exerted upon the nut 4 as the screw is tightened is thus absorbed , and the holder 2 is is pressed against the nut 4 &# 39 ;. when the tightening of the screw 5 is finished , the counterholding tool 1 then has to be removable from the screw nut 4 . this is possible only if the pressure exerted by the housing 2 against the nut 4 &# 39 ;, resulting from the tightening of the screw 5 , can be made to disappear in some manner or other . this is accomplished by having the box - end wrench insert 3 pivotable in the housing 2 with the aid of bolts 7 , 7 &# 39 ; ( fig1 and 4 ), and also by providing a locking mechanism in the housing 2 . if the housing 2 and the box - end wrench insert 3 are fixed relative to one another ( that is , locked ) while the screw 5 is being tightened , then this locking action can be released again after the end of the screwing procedure , by actuating the handle 8 . rotational movement in the housing 2 relative to the box - end wrench insert 3 is thus restored . then the pressure exerted against the nut 4 &# 39 ; by the housing 2 is eliminated , and the entire counterholding tool 1 can be removed easily from the nut 4 . fig2 shows a further possible use from the field of crane erection . the screw head 9 , onto which the box - end wrench insert 3 is placed , is positioned geometrically relative to the rectangular element 10 such that it is not possible for the housing 2 to rest directly on any stationary abutment . in order nevertheless to assure reliable support , the counterholding tool 1 is provided on its underside with a slide track 11 , on which a support element 12 is disposed such that it can be displaced and , with the aid of an arresting lever 13 , arrested . this support element 12 may be adjusted along the slide track 11 such that at a suitable point it presses against some stationary part of the apparatus to be assembled , as shown in fig2 . the handle 8 , which serves to unlock the locking mechanism , is located in an opening 14 in the housing 2 formed by means of a bracket 15 . fig4 shows the reception of the box - end wrench insert 3 in the housing 2 as well as the locking mechanism . the box - end wrench insert 3 is inserted in a receptacle 16 , which in turn , as already noted , is received in a rotatable manner in the housing 2 with the aid of bolts 7 , 7 &# 39 ;. a leaf spring 17 is riveted to the receptacle 16 and is provided with a small pin 18 , which in the illustrated position protrudes through an opening in the receptacle 16 and on into a hold in the box - end wrench insert 3 , thus fixing it within the receptacle 16 . if the leaf spring 17 is bent downward , then the pin 18 moves out of the hole in the box - end wrench insert 3 , so that the insert 3 can be removed or exchanged for another . the receptacle 16 , rotatably supported in the housing 2 with the aid of the bolts 7 , 7 &# 39 ;, has a slide cam 19 whose surface is rounded . the surface of the slide cam 19 rests on the surface of a wedge 20 , which is displaceably supported in a guideway 21 in the housing 2 . the wedge 20 is connected with a rod 22 , which in turn carries a spring plate 23 , against which a spring 24 disposed in a sheath 25 presses . the surface of the slide cam 19 and of the wedge 20 are inclined or adapted to one another such that when the support element 12 presses against an abutment , a displacement force is exerted upon the wedge 20 acting in the direction of the guideway 21 . the wedge 20 is held in the illustrated position by an arresting member 26 ( see fig1 as well ). this arresting member 26 is rotatably supported in the housing 2 by a bolt 27 and presses with its notched edge 28 against the righthand shoulder 29 ( extending vertically in fig4 ) of the wedge 20 . the arresting member 26 is pressed into the position shown in fig4 by a spring 30 , which is held in place by a bolt 31 attached to the arresting member and by a bolt 32 attached to the housing 2 . in the locking position shown in fig4 the notched edge 28 of the arresting member 26 is in engagement with the shoulder 29 of the wedge 20 . if torque is now exerted upon the counterholding tool in the manner shown in fig2 then the slide cam 19 presses with a resultant force against the oblique face of the wedge 20 ; however , the wedge 20 is not capable of following the resultant displacement force in the direction of its guideway 21 , because the displacement force s acts in the direction of the arrow shown in fig1 , toward the notched edge 28 of the arresting member 26 . as also shown in fig1 , the arresting member 26 is embodied with a right angle . the bearing on the bolts 27 , 27 &# 39 ; ( fig1 ) has so much play that the displacement force s in the direction of the arrow is absorbed by a bearing block 33 attached to a holder plate 34 . the arresting member 26 also has a tongue 35 , on which a further tongue 36 rests , which is firmly connected with the handle 8 and can be pivoted with this handle 8 about bolt 50 . now if the bracket 15 and the handle 8 are grasped ( see fig4 ), then the tongue 36 presses against the tongue 35 in such a manner that the arresting member 26 is pivoted upward , counter to the force of the spring 30 . the shoulder 29 of the wedge 20 is thus released , and ( in fig4 ) the wedge 20 is abruptly pressed toward the right by the slide cam 19 on the receptacle 16 for the box - end wrench insert 3 . the slide cam 19 ( fig4 ) is then capable of moving downward . however , the position of the box - end wrench insert 3 in the housing 2 is now no longer fixed ; instead , the arresting action has now been released , and free play exists between the box - end wrench insert 3 and the housing 2 , so that the box - end wrench insert 3 can be removed without difficulty from the nut 4 or from the screw head 9 . as shown , the spring 24 serves the purpose of damping the movement of the wedge 20 toward the right ( in fig4 ) during the unlocking process , and also serves to force the displaceable wedge 20 automatically back to the left again ( fig4 ) after the locking action has been released . the holder plate 34 is still supported relative to the rear side of the housing by the support plate 38 , which at the same time defines the opening 14 . fig6 and 7 show two further inserts , in the form of a fork wrench insert 3 &# 39 ; or square - box wrench insert 3 &# 34 ; for power - tightened nuts intended for further uses ; fig8 - 10 show three further support elements 12 &# 39 ;, 12 &# 34 ;, 12 &# 34 ;&# 39 ;, again for further uses . fig1 shows a second exemplary embodiment , having a hydraulic locking mechanism . the wedge 20 is connected with the piston rod 40 of a hydraulic cylinder 41 . a closed - loop hydraulic line 42 leads from one end of the cylinder 41 to the valve 43 and from there back again to the other end of the cylinder 41 . the valve 43 can be opened by means of a handle 44 ; a thrust plate 45 presses against the shoulder 29 of the wedge 20 and is connected with a guide rod 46 , which is pressed to the left by a spring 47 . in the position shown in fig1 , with the valve 43 closed , the hydraulic fluid keeps the piston rod and thus the wedge 20 in the illustrated position . if the valve 43 is opened by the actuation of the handle 44 , then hydraulic fluid flows through the line 42 from the right - hand end of the cylinder 41 into the left - hand end thereof . the piston rod 40 and with it the wedge 20 thus move toward the right . the locking mechanism is thus unlocked , and the housing 2 has free play again above the receptacle 16 or the box - end wrench insert 3 . the spring 47 subsequently forces the thrust plate 45 to the left , and the thrust plate 45 in turn forces the wedge 20 to the left , back into the illustrated position . the valve 43 is then closed once again , and the counterholding tool is again ready for use . the foregoing relates to preferred exemplary embodiments of the invention , it being understood that other embodiments and variants thereof are possible within the spirit and scope of the invention , the latter being defined by the appended claims . | 1 |
next , preferred embodiments of the present invention will now be described in details with reference to the accompanying drawings . fig1 shows an outer appearance of a photographic film printing apparatus 4 . numeral 1 denotes a film magazine to be detailed later , and numeral 3 denotes a winding device for taking up a film 30 from in the film magazine 1 or reversely discharging the film 30 located in the printing apparatus 4 to the film magazine 1 . the film 30 wound by the winding device 3 is conveyed to a printing exposure stage x by means of a conveyer device including a plurality of rollers 22 , where the film is exposed and printed . numeral 41 denotes a light source , numeral 42 denotes a light modulating filter , numeral 43 denotes a mirror tunnel , and a numeral 44 denotes a negative mask . as these components are not directly related to the present invention , they will not be detailed herein . fig3 and 4 show the entire film magazine 1 to which the present invention relates . this film magazine 1 includes a case 13 principally constituting the overall outer appearance of the magazine , a rotary drum 10 rotatable about a rotation axis 100 disposed centrally of the drum , a drum driving means 21 for rotatably driving the drum 10 , and a plurality of rollers 22 constituting the conveying device ( alias , ` conveying means `) for conveying the film 30 to the drum 10 . the drum 10 equidistantly defines , in its outer periphery , a plurality of slits 11 . through each of these slits 11 , the film 30 is inserted into the drum 10 to be stored therein or discharged from the inside of the drum 10 . adjacent each slit , there is provided a plate spring 15a as a retaining mechanism 15 for retaining an end of the film 30 . further , adjacent a certain plate spring , i . e . the plate spring 15a in this illustrated condition , located at an upper left position in fig4 there is provided a retention releasing cam 16 , as a retention releasing mechanism , which is placed under urged contact with the plate spring 15a . this retention releasing cam 16 , by contacting the plate spring 15a , elastically deforms a free end of this plate spring 15a downwardly , thereby to form a gap ( s ) for allowing insertion of the film 30 therethrough . incidentally , as may be apparent from fig4 the retention releasing mechanism is disposed adjacent a pair of upper and lower guide plates 23a , 23b which are disposed on the left side in the same figure . thus , only the plate spring 15 provided adjacent the slit 11 most adjacent the releasing cam 16 is released . each plate spring 15a is normally under the retaining state for retaining the film 30 . and , the plate spring 15a is elastically deformed to release the film only when the spring 15a comes into contact with the retention releasing mechanism 16 . a roller denoted with numeral 24 functions as a drive transmitting means for transmitting a drive force to the rollers 22 disposed adjacent a film entrance of the magazine 1 when the magazine 1 is attached to the film printing apparatus 4 . in addition to the above - described components , the film magazine 1 further includes a rotation restricting arm denoted with numeral 14 and a position detecting means denoted with numeral 25 for detecting an angular position of the rotary drum 10 . the rotation restricting arm 14 is pivotally supported to the magazine case 13 via a pivot portion 14c provided at the center of the arm . further , a right side end portion 14b in the same figure of the arm 11 is urged by such an urging member as a spring 14e , into loaded contact with the outer periphery of the drum 10 , thereby applying a braking force to the outer periphery of the drum 10 against rotation thereof . when the right - side arm end portion 14b is placed under the loaded contact with the outer periphery of the drum 10 , a left side end portion 14a of the arm projects to the outside of the case 13 . accordingly , when this film magazine 1 is attached to the winding device 3 of the printing apparatus 4 , the winding device 3 come into abutment against a left side face of the magazine case 13 thus depressing the left end portion 14a of the rotation restricting arm 14 . hence , the rotation restricting arm 14 is pivoted so as not to restrict rotation of the drum 10 , in association with attachment of the film magazine 1 to the winding device 3 . the drum driving means 21 for rotatably driving the drum 10 includes a plurality of rollers 21a , 21b and the drive force thereof is supplied from the printing apparatus 4 . more particularly , the roller 21b is constantly placed in contact with the outer periphery of the drum 10 , so that the outer periphery of the drum 10 is rotated in unison with rotation of this roller 21a . incidentally , on and above the outer periphery of the drum 10 , the end of the film 30 is exposed . then , the rollers 21a , 21b , which come into contact with this exposed end of the film , are formed of soft material such as rubber so as not to damage the end of the film . alternatively , in order to avoid contact between the rollers 21a , 21b with the end of the film 30 , these rollers may be constructed so as to contact only a bottom edge of the outer periphery of the drum 10 . the drum position detecting sensor ( alias , ` drum sensor `) 25 detects the angular position of the drum 10 relative to a gap 23c formed between the guide plates 23a , 23b . namely , the condition in which the slit 11 of the drum 10 is aligned with the gap 23c is the position allowing insertion or discharge of the film 30 . then , the sensor 25 detects this condition and outputs its detection data to the control device 2 to be detailed later . more specifically , the drum sensor 25 detects whether or not the drum 10 is located at the position allowing insertion or discharge , by detecting , from the outside , a projecting portion of an unillustrated element inserted into a hole 12 provided for drum position detection . fig5 shows a film magazine having a retaining mechanism different from that of the magazine shown in and described hereinbefore with reference to fig3 and 4 . this retaining mechanism employs an endless belt denoted with numeral 150 . this belt 150 is placed in contact with the outer periphery of the drum 10 over a substantial length of the belt , and the belt 150 functions to bind and retain the film 30 between an inner peripheral portion 151 thereof and the outer periphery 152 of the drum 10 . this belt 150 is driven by means of a plurality of rollers 21a , 21b , 21d , 21e , 21f as the drum driving means 21 , so as to rotatably drive , in turn , the drum 10 . further , the belt 150 has the dual - function , i . e . the function as the film retaining mechanism and the further function as the drum driving means . the roller 24 transmits the driving force from the printing apparatus to the roller 22a . as described hereinbefore , the belt 150 does not contact the drum 10 over the entire periphery thereof , rather , the belt includes a non - contact region not contacting the drum adjacent an entrance for introducing the film 30 into the slit 11 . in this manner , the non - contact region of the belt 150 not contacting the drum 10 is used as an entrance opening for allowing insertion into the drum 10 of the film 30 which is conveyed from the winding device 3 by means of the conveying device 22 , and the retained condition of the film end is released at this non - contact region . therefore , this alternative construction too allows discharge of the film 30 from the drum 10 as well as insertion of the film 30 into the drum 10 . the film magazine shown in fig5 too includes a rotation restricting arm 14 &# 39 ;, which is similar to the arm 14 shown in fig1 . unlike the restricting arm 14 , however , this rotation restricting arm 14 &# 39 ; does not restrict rotation of the drum 10 by being urged against the outer periphery of the drum 10 . rather , this arm 14 effects the restriction of drum rotation by means of a left end portion 14b &# 39 ; thereof which comes into contact with the roller 21e , i . e . the drum driving means , thereby to restrict rotation thereof . incidentally , the left end portion 14b &# 39 ; of this arm 14 &# 39 ; also projects from the left side face of the case 13 , just like the end portion 14b of the arm 14 . then , when the magazine 1 is attached to the winding device 3 , the arm 14 &# 39 ; is pivoted counterclockwise in the figure , thereby to release the rotation restriction to the drum drive transmitting means 21 . next , with reference to fig6 and 7 , the process for feeding the film 30 from the winding device 3 into the film magazine i will be described . in the following description relating to the feeding order , the terms : ` leading end of the film ` and ` trailing end of the film ` are used for the sake of convenience . here , it is understood that the leading end of the film refers to the portion of the film 30 which is first discharged from the winding device 3 , i . e . the portion of the film 30 which is to be first introduced into the film magazine 1 and also that the trailing end of the film refers to the opposite end of the film which is to be last discharged from the winding device 3 into the magazine . incidentally , in the subsequent description relating to the reverse feeding operation of the film 30 from the magazine 1 to the winding device 3 , the terms : ` leading end ` and ` trailing end ` are also used , in spite of the difference in the feeding directions . for conveying the film 30 stored within the winding device 3 to the film magazine 1 , by activating the conveying device of the winding device 3 and the conveying device incorporated within the film magazine , the film 30 is inserted into the slit 11 of the drum 10 . first , the film magazine 1 is attached to the winding device 3 ( the condition illustrated in fig6 a ). with this attachment , the rotation restricting arm 14 of the film magazine 1 is pivoted to release the restriction of rotation of the drum 10 . and , the drum sensor 25 detects whether the angular position of the drum 10 is presently located at the position allowing insertion of the film 30a or not . then , based on this detection , if the drum 10 is not located at the predetermined position allowing film insertion , the drum 10 is driven to rotate via the drum drive transmitting means 21 clockwise in the same figure . when the drum sensor 25 detects the position of the drum position detecting hole 12 defined in a segment 17 of the drum 10 , the rotation of the drum 10 is stopped ( the condition illustrated in fig6 b ). by activating the conveying device 22c , 22d of the winding device 3 and the conveying rollers 22a , 22b incorporated within the magazine , a conveying operation of the film 30a is started ( the condition illustrated in fig6 c ), and the leading end of the film 30a is introduced into the slit 11 ( the condition illustrated in fig6 d ). from the above condition , the conveying operation of the film 30a is continued , until a film sensor 27 is rendered into a non - detecting condition and then a predetermined time period has lapsed . namely , at the moment of detecting absence of the trailing end of the film , there still remains a significant distance between the trailing end of the film 30a and the slit 11 of the drum 10 , thus it is still difficult for the retaining mechanism to retain the film 30 . for this reason , the drum 10 keeps taking up the remaining length of the film therein , and when the length has become suitable for the retention by the film retaining mechanism , the activation of the conveying devices is stopped . as illustrated in fig6 f , after the conveying devices are stopped , the drum 10 is rotated clockwise in the figure . and , this clockwise rotation of the drum 10 is stopped when the drum sensor 25 detects the predetermined position of the drum 10 allowing film insertion . this is the condition under which the film 30b can be inserted into the drum 10 . thereafter , the conveying devices are activated again to convey the next film 30b ( the condition illustrated in fig7 g ). then , as illustrated in fig7 h , the film 30b is conveyed into the drum and the trailing end of this film 30b is conveyed across the position of the film sensor 27 ( the condition of fig7 h ). then , as described hereinbefore , after the lapse of the predetermined time period , the conveying devices are stopped . thereafter , the drum 10 is again rotated clockwise . this rotation of the drum 10 is continued until the drum sensor 25 detects the predetermined position of the drum 10 allowing film insertion ( the condition of fig7 i ). when the sensor 25 detects that the drum 10 has been rotated to the predetermined position , the drum 10 is stopped , and the magazine is ready for receiving the next film 30c . thereafter , as illustrated in fig7 j , 7k , 7l , the steps for inserting this next film 30c into the drum 10 are repeated in the same manners as described above . next , the reverse process for discharging the films 30 from the film magazine 1 will be described with reference to fig8 and 9 . first , from the condition illustrated in fig8 a , the drum 10 is driven , via the drum drive transmitting means 21 , to rotate counter - clockwise in the figures so as to be set to the predetermined position allowing film discharge . this rotation of the drum 10 is stopped when the drum sensor 25 detects the discharging , i . e . predetermined , position of the drum 10 ( the condition illustrated in fig8 b ). then , the drum 10 is again rotated counter - clockwise so as to bring the trailing end of the film 30g past between the pair of guide plates 23a and 23b and to cause the film end to be retained between the rollers 22a , 22b of the conveying device ( the condition illustrated in fig8 c ). incidentally , simultaneously with the counter - clockwise rotation of the drum 10 , the pair of rollers 22a , 22b of the conveying device 22 are driven in the direction for discharging the film . and , as illustrated from fig8 c to fig8 d , the trailing end of the film 30g is wound by the conveying device . then , as illustrated in fig8 e , when the leading end of the film 30g passes the film sensor 27 , like the case described hereinbefore , following the condition illustrated in fig9 f , when the drum 10 is rotated to the discharging position , the rotation of the drum 10 is stopped . and , the trailing end of the film 30f is taken up by the rollers 22a , 22b as the conveying device . thereafter , following the conditions illustrated in fig9 g , 9h , when the leading end of the film 30f passes the film sensor 27 as illustrated in fig9 i , the drum 10 is rotated to the position ready for discharging the next film 30e . then , by repeating the above - described steps , in the reverse order of the take - up order of the films into the film magazine 1 , the films 30e , 30d , 30c , 30b and 30a are discharged one after another from the magazine 1 . in the above - described case , the films are taken up into the magazine 1 in the order of the film 30a , film 30b , film 30c , film 30d , film 30e , film 30f , and the film 30g , and the films are discharged from the magazine 1 in the reverse order of the film 30g , film 30f , film 30e , film 30d , film 30c , film 30b and the film 30a . next , with reference to fig1 , a different case will in described in which the films are discharged from the magazine 1 in the same order as their taken - up order into the magazine 1 . fig1 a illustrates a condition in which the last film 30g has been just taken up and stored in the film magazine 1 . as shown , under this condition , the trailing end of the last film 30g remains between the guide plates 23a , 23b . for this reason , in order to discharge the first film 30a , first , the drum 10 is rotated clockwise by an amount corresponding to two times the angular pitch of the slits . fig1 b illustrates a transitional condition in which from the condition of fig1 a the drum 10 has been rotated clockwise by an amount of one angular pitch of the slits 11 . under this condition of fig1 b , the trailing end of the film 30a to be discharged is not yet present between the guide plates 23a , 23b . hence , if the conveying device 22 is driven under this condition , the target film 30a cannot be discharged . therefore , the drum 10 is further rotated to the condition illustrated in fig1 c . however , under this condition too , the trailing end of the target film 30a is not yet retained between the pair of rollers 22a , 22b . hence , the drum 10 is rotated counter - clockwise and the conveying device 22 is driven at the same time . incidentally , this counter - clockwise angular displacement of the drum 10 corresponds to one pitch of the slits . with this , the trailing end of the film 30a is moved past between the guide plates 23a , 23b and then the film is conveyed by the rollers 22a , 22b . in this way , the target film 30a may be discharged from the magazine 1 . when the leading end of the film 30a is moved past the film sensor 27 , the system is ready for discharging the next film 30b . the discharging operation of the next film 30b is possible by effecting the same steps as described above . that is , from the condition upon completion of the discharging of the film 30a , the drum 10 is again rotated clockwise by the amount corresponding to twice the angular pitch of the slits 11 , so as to cause the leading end of the film 30b retained between the pair of rollers 22a , 22b . thereafter , the conveying device 22 is driven to discharge the film 30b out of the magazine 1 completely . by repeating the above - described steps in series for the following films , i . e . the film 30c , film 30d , film 30e , film 30f and the film 30g , the films 30 may be discharged from the magazine 1 in the same order as they were taken up in the magazine 1 . incidentally , as described hereinbefore , the term : ` angular pitch ` of the slits 11 refers to the angular pitch between adjacent ones of the slits 11 which are formed equidistantly in the outer periphery of the drum 10 . next , with reference to fig1 , a still further case will be described in which a desired , i . e . randomly selected , one of the films is discharged from the magazine . this discharging operation of a selected film is possible by utilizing the same methods described above for sequentially discharging the films in the same order as or reverse order of charging them into the magazine . suppose that e . g . the film 30d is to be selectively discharged from the magazine 1 charged with the films 30 into the plurality of slits 11 as illustrated in fig1 . for this purpose , as described hereinbefore , the system needs to be set to the predetermined condition allowing discharge of this film 30d . that is , to this end , it is necessary for the trailing end of the film 30d to be moved past between the guide plates 23a , 23b and then retained between the rollers 22a , 22b . fig1 a shows the condition in which the magazine 1 is charged with the plurality of films 30 . then , in order to discharge the target film 30d from this condition , the drum 10 is rotated clockwise by three times the angular pitch of the slits 11 . this condition is illustrated in fig1 b . in this condition , the trailing end of the film 30d is not yet retained between the rollers 22a , 22b . thus , the drum 10 is then rotated counter - clockwise by one angular pitch of the slits 11 . this condition is illustrated in fig1 c . in this condition , the trailing end of the film 30d is retained between the rollers 22a , 22b , so that the conveying devices are driven to discharge the film 30d as illustrated in fig1 d . by effecting the above - described steps , any desired one of the films may be discharged from the drum 10 . fig1 is a block diagram of a control device for controlling the rotation of the drum 10 and the activation and deactivation of the conveying device 22 . the detection in the magazine 1 is effected by means of the drum sensor 25 which detects whether the drum 10 is located at the predetermined , charging / discharging position or not . further , the winding device 3 incorporates a film sensor 27 which detects whether the trailing or leading end of the film 30 has been moved past the conveying device 22 or not . and , the detection data from these sensors , i . e . the drum sensor 25 and the film sensor 27 , are all inputted to the control device 2 . this control device 2 includes a conveyer drive instructing means 29 for generating a signal for activating the conveying device 22 in response to the input signals from the sensors 25 , 27 and a drum drive instructing means 28 for generating a signal for driving the drum driving means 20 . a further embodiment of the present invention will be described next . in the case of the construction of the retaining mechanism shown in fig3 and 4 , the plate springs 15 are employed as this mechanism and the releasing cam 16 is provided as the retention releasing means for releasing the retention by the plate springs . however , considering the stiffness of the film in the charging / discharging direction thereof , the releasing cam 16 as the retention releasing means may be eliminated . specifically , by appropriately adjusting the urging force of the plate spring 15 , when the leading end of the film 30 is fed from the winding device into the slit 11 of the drum 10 , this leading end of the film may be inserted , against the urging force of the spring , between the plate spring 15 and upper wall of the slit ( i . e . the side face of the segment 17 of the drum 10 ) against which the plate spring contacts , in the foregoing embodiment , the control device 2 executes control of the driving of the drum 10 and the activation / deactivation of the conveying device . instead , the timings of driving of the drum 10 and of activation and deactivation of the conveyer device may be controlled manually . further , in the foregoing embodiment , the drum 10 obtains its drive force from the printing apparatus . instead , the drum 10 may be driven manually . further , the detection of the film charging position of the slit 11 can be detected as long as the relative position between the projecting portion of the unillustrated element inserted into the hole 12 defined in the segment 17 of the drum 10 and the slit 11 is maintained constant . hence , the slits 11 may be formed in the outer periphery of the drum 10 with unequal inter - distances therebetween . further , in the foregoing embodiment , the total of eight slits 11 are formed in the drum 10 . however , the number of slits may vary as desired , by adjusting the diameter of the drum 10 . also , the drum 10 of the above - described film magazine 1 has a hollow construction . thus , not only the film pieces having 2 to 6 frames , a longer film roll having e . g . 24 frames may be retained to the drum by increasing the entire capacity of the drum 10 . the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the present embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims rather than the foregoing description and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein . | 6 |
referring to fig1 , a uav 10 may be embodied as a fixed - wing aircraft having a fuselage 12 . wings 14 extend laterally from the fuselage 12 may define an airfoil contour . one or more propulsion sources 16 are mounted to the fuselage 12 or the wings 14 . the propulsion source 16 may be embodied as an internal combustion engine coupled to a propeller , turbo fan , or the like . the propulsion source 16 may also be embodied as a jet engine coupled to a propeller or turbo fan or used alone . one or more tail planes 18 defining an empennage of the uav 10 may secure to a rearward end of the fuselage 12 . the tail planes 18 may define a conventional horizontal stabilizer and vertical stabilizer with corresponding elevator and rudder control surfaces . alternatively , tail planes 18 may include a pair of angled tail planes each with a corresponding control surface and protruding upwardly or downwardly from the fuselage 12 . referring to fig2 , a cradle 20 may include a rear clamping member 22 and a front clamping member 24 . the front clamping member 24 may pivotally secure to the rear clamping member 22 by means of a pivot 26 defining a pivot axis 28 . in the illustrated embodiment , the pivot axis 28 is substantially parallel to a longitudinal direction 30 . the longitudinal direction 30 may be defined along a longitudinal direction of a wing clamped within the cradle 20 . a vertical direction 32 may also be defined as perpendicular to the longitudinal direction 30 . the vertical direction 32 may be substantially parallel to the chord line of a wing positioned in the cradle 20 . for purposes of this disclosure โ substantially โ parallel or perpendicular may be interpreted as within 10 degrees of perpendicular or parallel , preferably within 5 degrees , and preferably within 1 degree , of perpendicular or parallel . likewise , โ substantially โ equal to a value may mean within +/โ 5 % of the value , preferably within 1 % of the value . in some embodiments , troughs 34 may extend on either side of the front and rear clamping members 22 , 24 . the troughs 34 may be positioned on one or both sides of the clamping members 22 , 24 along the longitudinal direction 30 . as shown in fig2 , pivot axis 28 may be located vertically adjacent the troughs 34 . stated differently , the troughs 34 may be secured to the rear clamping member 24 near the pivot axis 28 . in some embodiments , the extent of each trough 34 in the longitudinal direction is between 0 . 5 and 2 , preferably between 0 . 9 and 1 , times a width of the rear clamping member 22 . in the illustrated embodiment , each trough 34 has a width substantially equal to the width of the rear clamping member 22 . a locking member 36 engages the front and rear clamping members 22 , 24 . the locking member 36 may selectively lock the front and rear clamping member 22 , 24 relative to one another with a desired amount of locking force . for example , the locking member 36 may be any over - center latch known in the art . inasmuch as a wing stored in the cradle 20 may be shipped by air , the over - center latch is preferably lightweight . the latching force may be defined by the latch and may be adjustable as known in the art . referring to fig3 , in some embodiments a rear clamping member 22 may be as illustrated . the rear clamping member 22 may include cushioning members 40 . for example , one or more cushioning members 40 may be positioned between end plates 38 . in the illustrated embodiments , the cushioning members 40 are sheets of a cushioning material cut to a desired shape . the illustrated rear clamping member 22 may be symmetric about a plane perpendicular to the longitudinal axis 30 . accordingly , for the illustrated end plate 38 a corresponding end plate 38 is located on an opposite side in a mirror configuration . the plates 38 may be fastened to one another such that the cushioning members 40 are captured between the plates . for example , each rod 42 of a plurality of rods 42 may secure to both plates 38 and further extend through the cushioning members 40 positioned between the plates 38 . the rods 42 and plates 38 may be formed of a rigid but light weight material such as aluminum , a rigid plastic , composite material , or the like . the rods 42 may therefore serve to limit compression of the cushioning member 40 . the rods 42 may have circular , rectangular , or some other cross section . in the illustrated embodiment , the rods 42 are secured to the end plates 38 by means of fasteners 44 passing through end plates 38 and engaging an end portion of a rod 42 . in some embodiments , a rod 42 may define interior or exterior threads engaging corresponding threads on the fastener 44 . in other embodiments , the fasteners 44 may be embodied as star fangled nuts and a rod 42 may define a hollow end portion for securing to a star fangled nut . in some embodiments , a backing plate is secured to both end plates 38 , such as by means of welds or other fasteners , and the cushioning members 40 are secured to the backing plate by means of adhesive or some other means . in a like manner , a trough 34 may be defined by cushioning members 48 defining the contour of the trough 34 . the cushioning members 48 may be captured between an end plate 38 and an end plate 46 . likewise , rods 50 may secure to the end plate 38 and the plate 46 in order to capture the cushioning members 48 . the rods 50 may pass through the cushioning members 48 . the rods 50 may secure to the end plate 46 and end plate 38 by any of the fastening means noted above , such as fasteners 52 embodied as star fangled nuts or some other fastener . in some embodiments , a locking member 36 may mount to the rear clamping member 22 by means of a lock mount 54 secured thereto . in the illustrated embodiment , one or more of the cushioning members 40 may define a cutout portion 56 for receiving the lock mount 54 . as is apparent in fig3 , the cutout portion 56 does not extend completely through the cushioning member such that the hard material forming the lock mount 54 does not contact a wing positioned in the cradle 20 . stated differently , a portion of one or more of the cushioning members 40 remains positioned between the lock mount 54 and a wing positioned between the clamping members 22 , 24 . the lock mount 54 may include a back plate 58 and side plates 60 extending outwardly from the back plate 58 . the side plates 60 may secure to the back plate 58 by means of screws , bolts , welds , or some other fastening means . in some embodiments , the back plate 58 and side plates 60 are formed from one monolithic member , such as a channel or rectangular tube having one wall removed . in the illustrated embodiment , the side plates 60 secure to the end plates 38 by means of rods 62 extending through one or more of the cushioning members and secured to the end plates 38 and plates 60 by means of fasteners 64 , such as star fangled nuts or some other fastening means . one or both of the end plates 38 and side plates 60 may define an aperture 66 for receiving a pivot 26 , such as one or more pivot pins 26 , extending through the apertures 66 . referring to fig4 , in some embodiments a front clamping member 24 may be as illustrated . the front clamping member 24 may include cushioning members 70 . for example , one or more cushioning members 70 may be positioned between end plates 68 . in some embodiments , the cushioning members 40 , 48 , 70 may include a polymer , such as a foam polymer , that has a modulus of elasticity of between 0 . 001 and 1 gpa , and preferably between 0 . 01 and 0 . 1 gpa . this modulus of elasticity may refer to the polymer itself or the polymer after any foaming process . the illustrated front clamping member 24 is symmetric about a plane perpendicular to the longitudinal axis 30 . accordingly , for the illustrated end plate 68 a corresponding end plate 68 is located on an opposite side in a mirror configuration . the plates 68 may be fastened to one another such that the cushioning members 70 are captured between the plates 68 . for example , each rod 72 of a plurality of rods 72 may secure to both plates 78 and further extend through the cushioning members 70 positioned between the plates 68 . the rods 72 may have circular , rectangular , or some other cross section . in the illustrated embodiment , the rods 72 are secured to the end plates 68 by means of fasteners 74 passing through end plates 68 and engaging an end portion of a rod 72 . in some embodiments , a rod 72 may define interior or exterior threads engaging corresponding threads on a fastener 74 . in other embodiments , the fasteners 74 may be embodied as star fangled nuts and the rods 72 may define a hollow end portion for securing to a star fangled nut . in some embodiments , a backing plate is secured to both end plates 68 , such as by means of welds or other fasteners , and the cushioning members 70 are secured to the backing plate by means of adhesive or some other means . in some embodiments , a locking member 36 may mount to the front clamping member 24 by means of a lock mount 76 secured thereto . in the illustrated embodiment , one or more of the cushioning members 70 may define a cutout portion 78 for receiving the lock mount 76 . as is apparent in fig3 , the cutout portion 78 does not extend completely through the cushioning member 70 such that the hard material forming the lock mount 76 does not contact a wing positioned in the cradle 20 . stated differently , a portion of the cushioning member 70 is interposed between the lock mount 76 and a wing clamped by the front clamping member 24 . the lock mount 76 may include a back plate 80 and side plates 82 extending outwardly from the back plate 80 . the side plates 82 may secure to the back plate 80 by means of screws , bolts , welds , or some other fastening means . in some embodiments , the back plate 80 and side plates 82 are formed from one monolithic member , such as a channel or rectangular tube having one wall removed in the illustrated embodiment , the side plates 82 secure to the end plates 68 by means of rods 84 extending through one or more of the cushioning members 70 and secured to the end plates 68 and plates 82 by means of fasteners 86 , such as star fangled nuts or some other fastening means . one or both of the end plates 68 and side plates 82 may define an aperture 86 for receiving a pivot 26 , such as one or more pivot pins 26 , extending through the apertures 86 and the apertures 66 of the rear clamping plate 22 . in some embodiments , a bushing 90 extends between the side plates 82 . a rod 90 may pass between opposing end plates 68 and pass through the bushing 90 as well as the side plates 82 . the rod 90 may secure to the end plates 68 by means of fastener 92 in the same manner of other rods discussed hereinabove . referring to fig5 , the front clamping member 24 pivotally secures to the rear clamping member 22 by means of the pivot 26 . in this manner , the front clamping member 24 may be pivoted away from the rear clamping member 22 in order to permit insertion of a wing , as shown by the dotted representation 102 of the front clamping member . the cushioning members 40 of the rear clamping member 22 and the cushioning members 70 of the front clamping member 24 define conformal surfaces 96 , 100 that are shaped to conform to surfaces of a wing . likewise , the cushioning members 48 of the trough 34 define conformal surfaces 100 conforming to one of a leading edge portion and a trailing edge portion of a wing . as noted above , in some embodiments , contact between the cradle 20 and the trailing edge of the wing 14 and any control surfaces is avoided . as known in the art , the cross - sectional shape of a wing preferably varies along the length thereof . accordingly , the conformal surfaces 96 , 98 , 100 may conform to the surface of a wing at a particular longitudinal position . likewise , for a given cradle 20 , the plurality of cushioning members 40 may each have a unique corresponding conformal surface 96 corresponding to a contour of the wing at a particular longitudinal position . likewise each of the plurality of cushioning members 48 may have a unique conformal surface 100 and each of the plurality of cushioning members 70 may have a unique conformal surface 98 . in some embodiments , the conformal surfaces 96 , 98 , 100 are cut such that they are contoured in both vertical 32 and horizontal directions ( e . g . in the plane of the page of fig5 ) and the longitudinal direction 30 in order to conform to variation in the contour of the wing in three dimensions . in other embodiments , the conformal surfaces 96 , 98 , 100 are uniform in the longitudinal direction such that the conformal surfaces 96 , 98 , 100 are contoured in only two dimensions ( horizontal and vertical ). for example , the arbitrary contours of the conformal surfaces 96 , 98 , 100 may be machined using a water jet cutter or other machining process that may machine precise contours in two dimensions . in some embodiments , some or all of the conformal surfaces 96 , 98 , 100 may include a pattern of ridges or other protuberances that are positioned to be located over structural reinforcements under the skin of the wing 14 at the longitudinal location at which the conformal surfaces 96 , 98 , 100 engage the wing 14 . in this manner , pressure exerted on the wing is more concentrated on those areas that are better able to bear such pressure . in some embodiments , the end plates 38 , 46 , 68 may define conformal edges 104 , 106 , 108 respectively that extend along the conformal surfaces 96 , 98 , 100 . the conformal edges may substantially conform to a surface that is offset from a contour of the wing contour by some constant or variable gap , such that during use , the cushioning members 40 , 48 , 70 will not compress to the point that the wing contacts the end plates 38 , 46 , 68 under expected compression forces and amounts . as noted above , the various cushioning members 40 , 46 , 70 of a cradle may not all have conformal surfaces 96 , 98 , 100 of the same shape . in such embodiments , each end plate 38 may have a conformal edge 104 , 106 , 108 that is offset from the conformal surface 96 , 98 , 100 of the cushioning members 40 , 46 , 70 adjacent thereto ( e . g . the outermost cushioning members 40 , 46 , 70 . referring to fig6 , in use a wing 14 may be placed between the front and rear clamping members 22 , 24 and the front clamping member 24 may be pivoted toward the rear clamping member 22 . as shown in fig6 , the leading edge portion of the wing 14 rests in a concave portion of the rear clamping member 22 and the trough 34 . the locking member 36 ( fig2 ) may then be engaged to apply a consistent clamping force between the clamping members 22 , 24 . as a result of the clamping force , the cushioning members 40 , 46 , 70 may compress due to engagement of the wing 14 with the conformal surfaces 96 , 98 , 100 . as noted above , the compression is preferably such that the wing 14 does not contact the end plates 38 , 46 , 68 . referring to fig7 , to facilitate shipping and storage , the uav 10 may be disassembled . as shown in fig7 at least the wings 14 may be removed to reduce the footprint of the uav 10 . other parts of the uav 10 such as the propulsion source 16 and tail planes 18 may also be removed . the wings 14 may secure to the fuselage by means of a wing spar 120 . as known in the art , a wing spar 120 provides structural rigidity to the wing 14 for transferring lift forces to the fuselage 12 . in some embodiments , wings 14 may secure by some other means or interface other than wing spars 120 , such as a plate or other structure defining a hole pattern for receiving fasteners . following shipment or storage according to methods disclosed herein , the wings 14 may be reattached to the fuselage 12 using the wing spars 120 in order to deploy the uav 10 . the fuselage 12 may have indexing members 122 fastened thereto using a fastening system 124 . the fastening system 124 may be a fastening system and corresponding indexing members 122 as disclosed in u . s . application ser . no . 13 / 974 , 350 filed aug . 23 , 2013 and entitled fuselage indexing system and method ( attorney docket no . ecsc - 1 - 1026 ), which is hereby incorporated herein by reference . referring to fig8 , as noted above , the wings 14 may be supported by means of cradles 20 as described herein . as also noted above , the cradles 20 may not provide significant resistance to longitudinal movement of the blade 20 . accordingly , the wing spar 120 may be fastened to a storage container by means of a spar retention system 130 . the spar retention system 130 may be understood with respect to a longitudinal direction 132 that is substantially parallel to the longitudinal axis of the wing 14 used with the spar retention system 130 . a vertical direction 32 may be defined as substantially parallel to a line parallel to a line normal to a surface on which the spar retention system 130 is resting . the spar retention system 130 may include a lock down clamp 134 and a post 136 . the lock down clamp 134 may be any lock down clamp 134 known in the art . as known in the art , a lock down clamp 134 has an open position and a closed position . the lock down clamp 134 provides a determined amount of travel between the open and closed position and may be adjustable as to travel and clamping force in the closed position . the post 136 is coupled to the lock down clamp 134 , such as by means of a fastener 138 . the post 136 is translated upward when the clamp 134 is moved from the closed to the open position and translated downward when the clamp 134 is moved from the open to the closed position . a stop 140 may be selectively secured to the post 136 . for example , the stop 140 may define a slot 142 sized to receive a distal portion of the post 136 . the post 136 may define a distal portion that is wider than the slot 142 to hinder removal of the stop 140 . for example , in the illustrated embodiment , a washer 144 or other structure secures to a distal end of the post 136 , such as by means of a fastener 146 , e . g . screw . in some embodiments , the stop 140 includes a seat , e . g . countersink , sized to receive the washer 144 or other widening structure . inasmuch as the stop 140 is removable from the post , the stop 140 may include an aperture 150 or other structure for receiving a lanyard ( not shown ). the lanyard may be anchored to an anchor 152 secured to a base 154 . the base 154 may support a wing spar 120 secured using the spar retention system 130 . the base 154 may define a rigid and substantially planar surface or have a contour corresponding to a contour of a wing spar 120 . for example , the base 154 may be embodied as an aluminum plate . the base 156 may be interposed between the stop 140 and the clamp 134 . the base 156 may define an aperture 156 through which the post 136 passes . in some embodiments , a cushioning member 158 secures to an upper surface of the plate 154 , e . g . opposite the clamp 134 and facing the stop 140 . the cushioning member 158 may define an aperture 160 through which the post 136 passes . the cushioning member 158 may be include a flexible polymer such as polyurethane or the like . the cushioning member 158 may have a modulus of elasticity such that the cushioning member 158 deforms in response to clamping force exerted by the clamp 134 on the stop 140 . for example , the cushioning member 158 may have a module of elasticity of between 0 . 001 and 1 gpa and , preferably between 0 . 01 and 0 . 1 gpa . in some embodiments , the stop 130 may also have a modulus of elasticity within either of these ranges and may include the same or different material and have the same or different modulus of elasticity as the cushioning member 158 . a die spring 162 may encircle the post 136 . the die spring 162 may be compressed by the stop 140 when the clamp 134 is in the closed position . as a result of the compression , the die spring 162 may also expand outwardly from the post 136 . in some embodiments , the cushioning member 158 may define a seat 164 , e . g . counterbore , that has a diameter that is larger than an undeformed diameter of the die spring 162 . the seat 164 may receive a bushing or other structure secured to a wing spar 120 used in combination with the spar retention system 130 . in some embodiments , the aperture 160 defined by the cushioning member 158 is slightly smaller ( e . g . between 5 and 10 % smaller ) than an undeformed diameter of the die spring 162 passing there through . in this manner , the cushioning member 158 may hinder movement of the die spring 162 when the post 136 is moved upward and downward . in some embodiments , the spar retention system 130 may be mounted to a container or other storage facility directly or by means of one or more intervening members . for example , the spar retention system 130 may mount to a beam 166 that secures to a container or secures to some other member mounted to the container . referring to fig9 and 10 , in use the stop 140 may be removed from the post 136 as shown by the dotted representation 168 . removing the post 136 may be accomplished by sliding the post 136 out of the slot 142 . where the stop 140 includes a seat 148 , the stop 140 may be slid downwardly to disengage the washer 144 from the seat 148 prior to sliding the post 136 out of the slot 142 . in preparation for placement of the wing spar 120 , the clamp 134 may be placed at or near the open position such that the top of the post 136 is elevated above the base 154 and cushioning member 158 is not compressed and therefore small enough to insert through the wing spar 120 . referring specifically to fig1 , with the stop 140 removed , a wing spar 120 may be positioned over the post 136 and die spring 162 . for example , the wing spar 120 may define an aperture 170 and in the open position of the clamp 134 , the uncompressed ( or less compressed due to an open position of the clamp 134 ) die spring 162 may be sized to fit through the aperture 170 as is the washer 144 . the stop 140 may be placed in the position shown having the washer 144 in the seat 148 as shown in fig8 by sliding the post 136 into the slot 142 . the clamp may then be moved to the closed position as shown in fig1 . in the closed position , the die spring 162 may be deformed such that it presses against the aperture 170 and if unconstrained by the aperture 170 would be larger than the aperture 170 . in some applications , the aperture 170 is tapered or has some shape other than cylindrical . the deformation of the die spring 162 may accommodate this geometry by expanding to at least partially fill part of the aperture 170 and thereby hinder movement of the wing spar 120 . the resilience of the cushioning member 158 and the stop 140 may result in deformation of these members due to the clamping force of the clamp 134 thereby reducing any scratching or denting of the wing spar 120 and providing additional grip on the wing spar 120 . fig1 illustrates an example use for the spar retention system 130 . as illustrated the beams 166 form part of a frame 172 that is mounted to a container . in some embodiments , the frame 172 may include structures for retaining or supporting other parts of the uav 10 . for example , the frame 172 may include tail plane supports 174 that are angled or otherwise positioned to support the tail planes 18 of the uav . the tail plane supports 174 may include cushioning surface made having some or all of the properties of other cushioning materials described herein . also shown in fig1 is a lanyard coupled to the stop 140 , such as by means of the aperture 150 . the lanyard may also be connected to some other portion of the frame 172 or spar retention system 130 , such as the anchor 152 ( fig8 ). referring to fig1 , the cradles 20 as disclosed herein above may be used in the storing and shipping of a uav 10 . for example , a container 178 may store a disassembled uav 10 . in such embodiments , a plurality of cradles 20 may secure to the container 178 either directly or indirectly by means of a fixture or frame member . the wing 14 mounts within the cradles 20 as described herein and is thereby retained against movement during shipping . in some embodiments , the cushioning members 40 , 48 , 70 may be configured relative to the end plates 38 , 46 , 68 such that the wing will not contact the plates 38 , 46 , 68 in response to deflection of the cushioning members 40 , 48 , 70 due to expected acceleration of the container 110 . the remainder of the uav 10 may also secure within the container 178 , including the fuselage 12 . as noted above , the fuselage 14 may have a fastening system 124 and indexing members 22 secured thereto as described u . s . application ser . no . 13 / 974 , 350 filed aug . 23 , 2013 and entitled fuselage indexing system and method ( attorney docket no . ecsc - 1 - 1026 ), which is hereby incorporated herein by reference . the container 178 may further have receivers 180 for engaging the indexing members 122 and a corresponding frame 182 mounting the receivers to the container 178 as described in u . s . application ser . no . 13 / 974 , 350 filed aug . 23 , 2013 and entitled fuselage indexing system and method , which is hereby incorporated herein by reference . the container 178 may be a container as described in u . s . application ser . no . 13 / 974 , 322 filed aug . 23 , 2013 and entitled closure system for containers , which is hereby incorporated herein by reference . the spar 120 of the wing 14 may be further restrained by means of the spar retention system 130 as described hereinabove . in this manner , movement of the wing 14 transverse to the longitudinal axis thereof may be restrained by means of the cradles 14 and movement along the longitudinal axis may be restrained by the spar retention system 130 . while the preferred embodiment of the invention has been illustrated and described , as noted above , many changes can be made without departing from the spirit and scope of the invention . for example , although the cradle described herein is shown being used for a wing of a fixed wing aircraft , the cradle may also be used for wings of a rotary wing aircraft , windmill blades , or other long and / or delicate structures . accordingly , the scope of the invention is not limited by the disclosure of the preferred embodiment . instead , the invention should be determined entirely by reference to the claims that follow . | 1 |
fig1 shows a high level block diagram of the overall physical architecture for an example systems engineering model data distribution and communications network arrangement . an information distribution network arrangement of this sort , indicated generally by numeral 100 , conventionally comprises a number of independent and geographically distributed interconnected computer systems or network servers . typically , as might be needed by a public utility company or an electrical power transmission / distribution company or other large company having geographically distributed facilities , an information distribution network of this sort might include , for example , at least some sort of engineering model data publisher or source , such as a geographical information system ( gis ) 101 , and have one or more engineering model data consumers or distributers , such as distribution management system ( dms ) 102 and / or other enterprise management server ( ems ) 103 . a non - limiting hardware arrangement of such an example information distribution network , as generally illustrated in fig1 , may also include a model exchange platform or model manager system / assembly ( mep ) comprising one or more core servers for efficiently managing the notification , distribution and exchange of , among other things , systems engineering model data and notifications between entities across the network at numeral 104 . preferably , the mep includes at least one server on which the non - limiting illustrative example method and program product for phase connectivity evaluation and validation disclosed herein below is implemented . one non - limiting example conventional hardware implementation of the mep would comprise a pair of servers each having , for example , a 2 . 66 ghz quadcore processor , 20 gb or more of ecc sram with 4 ร 146 gb of internal hard disk space , raid controllers and redundant network cards and power supplies ( conventional hardware configuration not illustrated herein ). an example information distribution network for a utility or power transmission / distribution company , such as illustrated in fig1 , might also include other computing and communication handling elements or servers such as an mep bridge extension server 105 for traversing external security zones , a thin client mep user interface ( u 1 ) computer 106 and connections to one or more other ems 103 . in fig2 , a functional block diagram illustrates a non - limiting illustrative example conceptual architecture for a model manager / exchange platform ( mep ) as employed in the information distribution and management system of fig1 . in this particular non - limiting example , the mep server core 104 ( fig1 ) is contemplated as providing a variety of information handling and distribution services including user interface services , model update handling , model and profile validation services , model meta - data management services , model version management and repository services , notification management , open profile repository services , security certificate management , email and sms text user notification services and , in addition , provides database storage and integration adapters for gis . dms and ems systems , as indicated by the respective functional blocks shown in fig2 . in particular , a network model and profile validation service , generally indicated at functional block 201 , is contemplated to provide specific checking , verification and validation of engineering models , design specification profiles and the like that are distributed or exchanged between various authoring and end - user entities connected to the network . the model / profile validation service functions 201 provided by the mep is just one example of a contemplated environment for implementing the non - limiting illustrative example method and program product for circuit component phase connectivity evaluation and validation disclosed herein below . fig3 shows a non - limiting illustrative example process flow diagram for a model data and information synchronization process which may be implemented by a model manager system such as mep 104 of fig1 . in general , a publishing entity 301 produces an initial or incremental data information load , for example , in the form of a conventional cim - xml file , gml file or both . in the example of a cim file , the data may be assembled using cim - xml formatting which is a commonly known protocol conventionally used for sending cim messages on top of http . the file is provided to the mep and the engineering / circuit model specification information contained therein may be read out as strings of xml data . a system integration adapter 302 detects the profile of the specific file type / system and adds metadata to the published message / information / model indicating the profile type . a model normalization adapter 303 then determines if the information is of a specific type , e . g ., an initial load , an incremental update of either cim , gml or both . next , a series of services represented by model profile and validation services block 304 performs various checks of the distributed information and engineering model data including performing both phase connectivity evaluations and validating component connections of circuit models . a model validation service process , such as the example process indicated at functional block 304 , embodies the non - limiting illustrative example process for circuit component phase connectivity evaluation and validation disclosed herein below . next , as illustrated in block 305 , a model metadata management services process gets metadata associated with the incoming transaction and stores the information in a database ( not shown ). the information may be versioned by a version management service 306 and notifications concerning the transaction are sent out by a notification management service 307 . a model update handler 308 sends the information to an open profile repository and also sends a proper profiled response to an end user / subscriber 310 . acceptance or rejection of network changes by the distribution management system ( dms ) results in notification to all subscribing systems of an accepted change or rejection message . accordingly , engineering model changes / updates among other information , may be efficiently managed , versioned , archived , distributed and timely made available to appropriate users / subscribers of such information , such as , in the case of a power distribution company , grid operators , field engineers , service technicians and the like . in a non - limiting example implementation of the phase connectivity evaluation and validation process disclosed herein , different binary bit mask values are assigned for each of the different enumerated phase connectivity types possible at a connection node of a conducting component in a circuit model . in this non - limiting example , there are sixteen different possible phase connectivity types which are enumerated as indicated in table 1 below . alternatively , as shown in table 1 , each phase connectivity type may be identified by a decimal integer value . as also illustrated in table 1 , each possible phase connectivity type for a conducting component in a circuit model is uniquely enumerated and each enumeration is assigned a corresponding unique four bit binary mask number . effectively , the bit mask arrangements of table 1 are based upon the assignment of a separate binary bit location to each of the three different possible types of ac electrical phase present in a circuit , enumerated here as a , b and c , as well as one bit location assigned for neutral or ground , enumerated here as n , thus enabling a unique binary mask representation for all of the possible different phase connectivity types of components . for example : referring now to fig4 a , a block diagram is used to generally illustrate an example pair of conducting electrical components / devices and their respective connection node phase connectivity designations as may be specified by component parameter data for a particular circuit model provided , for example , in a cim - xml file . in this first example , a pair of connected components 401 and 402 of a particular circuit is specified by the circuit model parameter data as having respective associated connection nodes 403 and 404 of different phase connectivity characteristics . more specifically , for this example , component 401 is specified as having a connection node 403 designated as an โ abn โ phase connectivity type and that component 401 is connected to component 402 which is specified as having a connection node 404 designated as an โ an โ phase connectivity type . consequently , in order to validate this connection between components 401 and 402 , the connection of node 403 to node 404 must first be evaluated to determine if the connection between an โ abn โ phase connectivity type component and an โ an โ phase connectivity type component is a compatible / permissible connection . next in fig4 b , a functional block diagram is shown which effectively illustrates the basic phase connectivity evaluation and validation process used for evaluating the connection between components 401 and 402 via their respective connection nodes 403 and 404 . at the outset , a unique binary phase - type connectivity mask value is assigned to each of the different possible electrical phase connection types , for example , as enumerated in table 1 . in this example , component 401 has a phase connectivity type of โ abn โ and has an assigned a bit mask value of โ 1101 โ ( block 406 ). similarly , a second component 402 has a phase connectivity type of โ an โ and has an assigned a bit mask value of โ 1001 โ ( block 407 ). as illustrated , a bit - wise logical โ and โ operation is performed between the two respective phase connectivity bit mask values . if the logical operation result matches the bit mask value of either connection node 403 or connection 404 , then the two connection nodes are deemed to be of compatible phase connectivity and the connection between the two nodes is given a passing validation . conversely , if neither comparison results in a match , then the phase connectivity between the two nodes is considered as not being electrically connectable . in this example , the logical operation result , in this case โ 1001 โ, does not match the bit mask value โ 1101 โ for the โ abn โ type component node ( block 406 ), however , it does match the bit mask value โ 1001 โ for the โ an โ type component node ( block 407 ). consequently , the connection between the two nodes is given a โ passed โ validation ( block 408 ) in this case . in fig5 a , a second example pair of conducting electrical components / devices is illustrated along with their respective connection node phase connectivity designations . in this second example , a pair of connected components 501 and 502 of a particular circuit is specified by the circuit model parameter data as having respective associated connection nodes 503 and 504 of different phase connectivity characteristics . specifically , in this second example , component 501 is specified as having a connection node 503 designated as an โ abn โ phase connectivity type and that component 501 is connected to component 502 which is specified as having a connection node 504 designated as an โ cn โ phase connectivity type . consequently , in order to validate this connection between components 501 and 502 , the connection of node 503 to node 504 must first be evaluated to determine if the connection between an โ abn โ phase connectivity type component and a โ cn โ phase connectivity type component is a compatible / permissible connection . next in fig5 b , a functional block diagram is shown which effectively illustrates the basic phase connectivity evaluation and validation process used for evaluating the connection between components 501 and 502 via their respective connection nodes 503 and 504 . in this second example , a component 501 has a phase connectivity type of โ abn โ and is assigned ( from table 1 ) a bit mask value of โ 1101 โ ( block 506 ). a second component 502 has a phase connectivity type of โ cn โ and is assigned ( from table 1 ) a bit mask value of โ 1001 โ ( block 507 ). as illustrated , a bit - wise logical โ and โ operation is performed between the two respective phase connectivity bit mask values . if the logical operation result matches either bit mask value , then the two connection nodes are deemed to be of compatible phase connectivity and the connection between the two nodes is given a passing validation . conversely , if neither comparison results in a match , then the phase connectivity between the two nodes is considered as not being electrically connectable . in this example , since the logical operation result , in this case โ 0001 โ, does not match either the bit mask value โ 1101 โ for the โ abn โ type component node ( block 506 ) or the bit mask value โ 0011 โ for the โ abn โ type component node ( block 507 ), the connection between the two nodes is given a โ failed โ validation ( block 508 ). consequently , in this case , a โ failed โ validation error notice or message may need to be generated referencing that particular circuit connection . referring now to fig6 , a process flow diagram illustrates a set of non - limiting example processing operations which may be executed by a digital computer / processor or network server of an mep / model manager system to provide fast and efficient circuit model component connection evaluation and validation . initially , as indicated at blocks 601 and 602 , a cim - xml file containing circuit specifications / model data is received over the communications network by an mep / model manager system from an authoring producer / source ( not shown ) and appropriate circuit information , such as constituent component and connection node object specifications , is parsed into strings of xml data . at block 603 , each of the different phase connectivity types possible in a circuit model are given different enumerations and assigned specific corresponding binary bit masks ( e . g ., see table 1 above ). at blocks 604 through 609 , comparison operations are performed on xml data strings for connection node data objects of the circuit components to label each connection node with the appropriate phase connectivity type enumeration and assign to it the associated bit mask . for example , at decision block 604 , a connection node data xml string indicating the phase connectivity type of a particular node is examined to determine if it is of the phase type โ a โ. if so , a connection node data object is created , labeled as a type โ a โ phase connectivity node , assigned the associated binary bit mask of โ 1000 โ and saved , as indicated at block 605 . if it is determined that the xml string data is not the โ a โ phase connectivity type , then it is next examined to determine if it is of a second type . for example , at decision block 606 , the phase indicative xml data string for the node is next examined to determine if it is of the phase type โ b โ. if this turns out to be true , a connection node data object is created and labeled as a type โ b โ phase connectivity node and assigned the associated binary bit mask of โ 0100 โ and that information is saved , as indicated at block 607 . if it turns out that the xml string data is not a โ b โ phase connectivity type , the data string is next examined to determine if it is of yet a another phase type , and so on . as indicated by the flow diagram ellipsis leading from block 606 to block 608 and block 609 , this phase type determination and bit mask assignment process continues until the particular connection node xml data string has been identified as one of the possible different phase connectivity types and is assigned the appropriate associated bit mask as indicated in table 1 . after this process is finished for one connection node , xml data string from the cim - xml file for a particular circuit model are parsed is parsed for another connection node data object and the above processing repeats until all connection node data objects in the cim - xml file have been parsed , as indicated by blocks 610 and 611 . next , once all of the connectivity node data objects for a particular circuit model are parsed , pairs of connected component are selected , as indicated at block 612 , and operations for evaluation and validation of connected component pairs begins . as indicated at block 613 , assigned phase connectivity bit masks for a first pair of connected components are first retrieved and then a logical โ and โ operation is performed between the two bit mask values . next , as indicated at block 614 , the result of the logical โ and โ operation between the two bit mask values is separately compared against the individual bit mask for each component of the pair . if , as determined in block 615 , the result of either comparison is true ( i . e ., the binary value of the logical โ and โ result and the binary value of either bit mask are a match ), then the phase validation is indicated as good ( block 617 ), however , if the result of the comparison does not yield at least one matching value , then the phase validation is considered as bad ( block 616 ). as indicated at block 618 , the operations for evaluating and validating connected component pairs described in blocks 612 through 617 is repeated for each pair of connected components of the circuit model until all connections of the circuit model are evaluated . as indicated at block 619 , the evaluation / validation results , including โ passed validation โ or โ failed validation โ notifications or messages for particular circuit connections , may then be stored and / or delivered via the network to interested user / subscribers . as described above , an implementation of the method disclosed herein may be in the form of computer - implemented process and / or program product for practicing those processes . an implementation may also be practiced or embodied in the form of computer program code containing instructions embodied in tangible media , such as floppy diskettes , cd roms , hard drives , or any other computer - readable storage medium , wherein when the computer program code is read and executed by a computer , the computer becomes an apparatus for practicing the disclosed process or method . an implementation may also be embodied in the form of computer program code , for example , whether stored in a storage medium , loaded into and / or executed by a computer , or transmitted over some transmission medium , such as over electrical wiring or cabling , through fiber optics , or via electromagnetic radiation , wherein when the computer program code is read and / or executed by a computer , the computer becomes an apparatus for practicing the disclosed process or method . when implemented on a general - purpose programmable microprocessor or computer , the computer program code configures the programmable microprocessor or computer to create specific logic circuits ( i . e ., programmed logic circuitry ). while disclosed method and apparatus is described with reference to one or more exemplary embodiments , it will be understood by those skilled in the art that various changes may be made and equivalence may be substituted for elements thereof without departing from the scope of the claims . in addition , many modifications may be made to the teachings herein to adapt to a particular situation without departing from the scope thereof . therefore , it is intended that the claims not be limited to the specific embodiments disclosed , but rather include all embodiments falling within the scope of the intended claims . moreover , the use of the terms first , second , etc . and indicia such as ( i ), ( ii ), etc . or ( a ), ( b ), ( c ) etc . within a claim does not denote any order of importance , but rather such terms are used solely to distinguish one claim element from another . the above written description uses various examples to disclose exemplary implementations of the invention , including the best mode , and also to enable any person skilled in the art to practice the invention , including making and using any devices or systems and performing any incorporated methods . the patentable scope of the invention is defined by the claims which follow , and may include other examples that occur to those skilled in the art . while an exemplary implementation has been described herein in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the claimed invention is not to be limited to the disclosed example embodiments , but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . | 6 |
a general principle of the invention is illustrated by referring to fig1 . nav of mutual fund shares is typically calculated at 4 : 00 p . m . eastern time ( et ), i . e ., at the close of the u . s . financial markets ( including the nyse , ase , and nasdaq markets ). this is well after many , if not most , foreign markets already have closed . thus , events , news and other information observed between the close of the foreign market and 4 : 00 p . m . et may have an effect on the opening price of foreign securities on the next business day ( and thus is likely also to have an effect on the next day &# 39 ; s closing price ), that is not reflected in the calculated nav based on the current day &# 39 ; s closing price . fig1 illustrates an example of the opportunity for trading profit . stock bsy ( british sky broadcasting plc ) is traded on the london stock exchange ( lse ). on may 16 , 2001 , the stock closed at 767 pence at 11 : 30 a . m . et . after the lse &# 39 ; s close , the us stock market had a significant increase โ between 11 : 30 a . m . and 4 p . m . et , the s & amp ; p 500 index had risen by 1 . 6 %. as seen from the chart , during the time that both the lse and the u . s . stock exchanges were open , the price of bsy had a high correlation with the s & amp ; p 500 index . the closing price of bsy obviously did not reflect the increase of the u . s . market between 11 : 30 a . m . and 4 : 00 p . m . et . but bsy &# 39 ; s next day opening price increased by 1 . 56 % ( to 779 pence ) due mostly to the u . s . market rise the previous day . an obvious arbitrage strategy would have suggested buying a mutual fund that included stock bsy on may 16 , with the fund &# 39 ; s nav based on bsy &# 39 ; s closing price of 767 , and then selling it on the next day . this is a very efficient and low - risk strategy , since most likely bsy &# 39 ; s closing price for may 17 would have been higher as a result of the higher opening price . to exclude the possibility of such an arbitrage , bsy &# 39 ; s closing price for may 16 could be adjusted to a โ fair โ price based on a fair value model ( fvm ). because there is no direct observation of the fair value price of a foreign stock at 4 p . m . et , the next day opening price is commonly used as a proxy for a โ fair value โ price . such a proxy is not a perfect one , however , since there is a possibility of events occurring between 4 p . m . et and the opening of a foreign market , which may change stock valuations . however , there is no reason to believe that the next day opening price proxy introduces any systematic positive or negative bias . the goal of fvm research is to identify the most informative factors and the most efficient framework to estimate fair prices . the goal assumes also a selection of criteria to facilitate the factor selection process . in other words , it needs to be determined whether factor x needs to be included in the model while factor y doesn &# 39 ; t add any useful information , or why framework a is more efficient than framework b . unlike a typical optimization problem , there is no single criterion for the fair value pricing problem . several different statistics reflect different requirements for fvm performance and none of them can be seen as the most important one . therefore a decision on selection of a set of factors and a framework should be made when all or most of the statistics clearly suggest changes in the model when compared with historical data . all the criteria or statistics are considered below . there are many factors which can be used in fvm : the u . s . intra - day market and sector returns , currency valuations , various types of derivatives โ adrs ( american depository receipts ), etfs ( exchange traded funds ), futures , etc . the following general principles are used to select factors for the fvm : economic logic โ factors must be intuitive and interpretable ; the factors must make a significant contribution to the model &# 39 ; s in - sample ( i . e ., historical ) performance ; the factors must provide good out - of - sample or back - testing performance . it must be understood that good in - sample performance of factors does not guarantee a good model performance in actual applications . the main purpose of the model is to provide accurate forecasts of fair value prices or their proxies โ next day opening prices . therefore , only factors that have a persistent effect on the overnight return can be useful . one school of thought holds that the more factors that are included in the model , the more powerful the model will be . this is only partly true . the model &# 39 ; s in - sample fit may be better by including more parameters in the model , but this does not guarantee a stable out - of - sample performance , which should be the most important criterion in developing the model . throwing too many factors into the model ( the so - called โ kitchen sink โ approach ) often just introduces more noise , rather than useful information . r i is the overnight return for stock i in a foreign market , which is defined as the percentage change between the price at the foreign market close and that market &# 39 ; s price at the open on the next day ; m is the snapshot u . s . market return between the closing of a foreign market and the u . s . closing using the market capitalization - weighted return based on russell 1000 stocks as a proxy ; s j is the snapshot excess return of the j - th u . s . sector over the market return , where the return is measured between the closing of a foreign market and the u . s . closing , again using the russell 1000 sector membership as a proxy , where sector is selected appropriately ; ฮต represents price fluctuations . in developing an optimized fair value model , the following statistics should be considered . these statistics measure the accuracy of a fair value model in forecasting overnight returns of foreign stocks by measuring the results obtained by the fair value model using historical data with a benchmark . average arbitrage profit ( arb ) measures the profit that a short - term trader would realize by buying and selling a fund with international holdings based on positive information observed after the foreign market close . thus , when a fund with international holdings computes its net asset value ( nav ) using stale prices , short - term traders have an arbitrage opportunity . to take advantage of information flow after the foreign market close , such as a large positive u . s . market move , the arbitrage trader would take a long overnight position in the fund so that on the next day , when the foreign market moves upwards , the trader would sell his position to realize the overnight gain . however , once a fair value model is utilized to calculate nav , any profit realized by taking an overnight long position represents a discrepancy between the actual overnight gain and the calculated fair value gain . a correctly constructed fair value model should significantly minimize such arbitrage opportunities as measured by the out - of - sample performance measure as arbitrage โข โข profit โข โข with โข โข fvm โข โข ( arb ) = 1 t โข โ m โฅ 0 โข โข ( q t - q ^ t ) + 1 t โข โ m & lt ; 0 โข โข ( q ^ t - q t ) , ( 1 ) arbitrage โข โข profit โข โข without โข โข fvm = 1 t โข โ m โฅ 0 โข q t - 1 t โข โ m & lt ; 0 โข q t , ( 2 ) where t is the number of out - of - sample periods , q t is the overnight return of an international fund at time t , and { circumflex over ( q )} t is the forecasted return by the fair value model . the above statistics provide average arbitrage profits over all the out - of - sample periods regardless of whether there has been a significant market move . a more informative approach is to examine the average arbitrage profits when the u . s . market moves significantly . without loss of generality , we define a market move as significant if it is greater in magnitude than half of the standard deviation of daily market return . arbitrage โข โข profit โข โข with โข โข fvm โข โข for โข โข large โข โข moves โข ( arbbig ) = 1 t lp โข โ m โฅ ฯ / 2 โข โข ( q t - q ^ t ) + 1 t lp โข โ m โค - ฯ / 2 โข โข ( q ^ t - q t ) , ( 3 ) arbitrage โข โข profit โข โข without โข โข fvm โข โข for โข โข large โข โข moves = 1 t lp โข โ m โฅ ฯ / 2 โข โข q t - 1 t lp โข โ m โค - ฯ / 2 โข q t , ( 4 ) where ฯ is the standard deviation of the snapshot u . s . market return and t lp is the number of large positive moves ( i . e . the number of times m โง ฯ / 2 ). the surviving observations cover approximately 60 % of the total number of trading days . the arbitrage profit statistics are calculated as follows : for any given stock and any given estimation window , run the regression and compute the forecasted overnight return ; compute the deviation of the realized overnight returns from the forecasted returns ; depending on the size of u . s . market moves , take the appropriate average of the deviation over a selected stock universe and over all estimation windows . it is to be noted that the arbitrage profit statistic is potentially misleading . this happens when the fair value model over - predicts the magnitude of the overnight return , and thus reduces the arbitrage profit because such over - prediction would result in a negative return on an arbitrage trade . for this reason , use of arbitrage profit does not lead to a good fair value model because the fair value model should be constructed to reflect as accurately as possible the effect of observe information on asset value rather than to reduce arbitrage profit . mean absolute error ( mae ). while mutual funds are very concerned with reducing arbitrage opportunities , the sec is just as concerned with fair value issues that have a negative impact on the overnight return of a fund with foreign equities . this information is useless to the arbitrageur because one cannot sell short a mutual fund . nonetheless , evaluation of a fair value model must consider all circumstances in which the last available market price does not represent a fair price in light of currently available information . mae measures the average absolute discrepancy between forecasted and realized overnight returns : for any given stock and any given estimation window , run the regression and compute the forecasted overnight return ; compute the absolute deviation between the realized and the forecasted overnight returns ; take an average of the absolute deviation over a selected universe and over all estimation windows . time - series out - of - sample correlation between forecasted and realized returns ( cor ) measures whether the forecasted return of a given stock varies closely related to the variation of the realized return . it can be computed as follows : for any given stock and any given estimation window , run the regression and compute the forecasted overnight return and obtain the actual realized return ; keep the estimation window rolling to obtain a series of forecasted returns and a series of realized returns for this stock and compute the correlation between the two series ; take an average over a selected stock universe . hit ratio ( hit ) measures the percentage of instances that the forecasted return is correct in terms of price change direction : for any given stock and any given estimation window , run the regression and compute the forecasted overnight return ; define a dummy variable , which is equal to one if the realized and the forecasted overnight returns have the same sign ( i . e ., either positive or negative ) and equal to zero otherwise ; take an average of the defined dummy variable over a selected stock universe and over all estimation windows . similar to how arbbig is defined above , it is more useful to calculate the statistics only for large moves . values of hit in the tables in the appendix below are calculated for all observations . the methodology for obtaining an optimized fair value model are now described . the overnight returns of foreign stocks are computed using bloomberg pricing data . the returns are adjusted if necessary for any post - pricing corporate actions taken . the fvm universe covers 41 countries with the most liquid markets ( see all the coverage details in appendix 1 ), and assumes bloomberg sector classification including the following 10 economic sectors : basic materials , communications , consumer cyclical , consumer non - cyclical , diversified , energy , financial , industrial , technology and utilities . since all considered frameworks are based on overnight returns , it is important to determine if overnight returns behave differently for consecutive trading days versus non - consecutive days . such different behavior may reflect a correlation between length of time period from previous trading day closing and next trading day opening and corresponding volatility . if such difference can been established , a fair value model would have to model these two cases differently . to address this issue , the average absolute value of the overnight returns for any given day was used as the measure of overnight volatility and information content . the analysis , however , demonstrated that there is no significant difference between the overnight volatility of consecutive trading days and non - consecutive trading days for all countries ( see results of the study in appendix 2 ). these results are consistent with several studies , which demonstrate that volatility of stock returns is much lower during non - trading hours . the following regression models are examples of possible constructions of a fair value model according to the invention . in the following equations , the return of a particular stock is fitted to historical data over a selected time period by calculating coefficients ฮฒ , which represent the influence of u . s . market return or u . s . sector return on the overnight return of the particular foreign stock . the factor ฮต is included to compensate for price fluctuations . model 1 assumes that the overnight return is determined by the u . s . snapshot market return m and the respective snapshot sector return s j . model 2 is similar to capital asset pricing model ( capm ) and is a restricted version of model 1 . fig2 illustrates how regression of a stock &# 39 ; s overnight return on the u . s . snapshot return can be built . the observations were taken for australian stock wpl ( woodside petroleum ltd .) for the period between jan . 18 , 2001 and mar . 21 , 2002 . model 3 is based on the theory that the stock return is only affected by sector return . the term s j + m represents the sector return rather than the sector excess return . the sector can be selected based on various rules , as described below . it may be possible that a stock &# 39 ; s price reacts to market and sector changes as a function of the magnitude of the market return . intuitively , asset returns might exhibit higher correlation during extreme market turmoil ( so - called systemic risk ). such behavior can be modeled by the so - called switching regression model , which is a piece - wise linear model as a generalization of a benchmark linear model . taking model 1 as the benchmark model , a simple switching model is described as follows this model assumes the sensitivities of stock return r i to the market and the sector are ฮฒ i m and ฮฒ i s if the market change is less than the threshold c in magnitude . however , when the market fluctuates significantly , the sensitivities become ฮฒ i m + ฮด i m and ฮฒ i s + ฮด i s respectively . alternately , multiple thresholds can be specified , which would lead to more complicated model structures but not necessarily better out - of - sample performances . although this model specifies the stock return as a non - linear function of market and sector returns , if we define a โ dummy โ variable r i = ฮฒ im m + ฮด im ( m * d )+ ฮฒ is s i + ฮด is ( s i * d )+ ฮต i . standard tests to determine whether the sensitivities are different as a function of different magnitudes of market changes are t - statistics on the null hypotheses ฮด i m = 0 and ฮด i s = 0 . according to the invention , once a fair value regression model is constructed using one or more selected factors as described above , an estimation time window or period is selected over which the regression is to be run . historical overnight return data for each stock in the selected universe and corresponding u . s . market and sector snapshot return data are obtained from an available source , as is price fluctuation data for each stock in the selected universe . the corresponding ฮฒ coefficients are then computed for each stock , and are stored in a data file . the stored coefficients are then used by fund managers in conjunction with the current day &# 39 ; s market and / or sector returns and price fluctuation factors to determine an overnight return for each foreign stock in the fund &# 39 ; s portfolio of assets , using the same fvm used to compute the coefficients . the calculated overnight returns are then used to adjust each stock &# 39 ; s closing price accordingly , in calculating the fund &# 39 ; s nav . fig3 is a flow diagram of a general process 300 for determining a fair value price of an international security according to one preferred embodiment of the invention . at step 302 , the stock universe ( such as the japanese stock market ) and the return factors as discussed above are selected . at step 304 , the overnight returns of the selected return factors are determined using historical data . at step 306 , the ฮฒ coefficients are determined using time - series regression . at step 308 , the obtained ฮฒ coefficients are stored in a data file . at step 310 , fair value pricing of each security in a particular mutual fund &# 39 ; s portfolio is calculated using the fair model constructed of the selected return factors , the stored coefficients , and the actual current values of the selected return factors , in order to obtain the projected overnight return of each security . the projected overnight return thus obtained is used to adjust the last closing price of each corresponding international security accordingly , so as to obtain the fair value price to be used in calculating the fund &# 39 ; s nav . fig4 shows a general purpose computer 420 that can be used to implement a method according to a preferred embodiment of the invention . the computer 420 includes a central processing unit ( cpu ) 422 , which communicates with a set of input / output ( i / o ) devices 424 over a bus 426 . the i / o devices 424 may include a keyboard , mouse , video monitor , printer , etc . the cpu 422 also communicates with a computer - readable storage medium ( e . g ., conventional volatile or non - volatile data storage devices ) 428 ( hereafter โ memory 428 โ) over the bus 426 . the interaction between a cpu 422 , i / o devices 424 , a bus 426 , and a memory 428 are well known in the art . memory 428 can include market and accounting data 430 , which includes data on stocks , such as stock prices , and data on corporations , such as book value . the memory 428 also stores software 438 . the software 438 may include a number of modules 440 for implementing the steps of process 300 . conventional programming techniques may be used to implement these modules . memory 428 can also store the data file ( s ) discussed above . the sector for models 1 , 2 , 4 can be selected by different rules described as follows . a ) sector determined by membership : the sector by membership usually does not change over time if there is no significant switch of business focus . b ) sector associated with largest r 2 : this best - fitting sector by r 2 changes over different estimation windows and depends on the specific sample . it usually provides higher in - sample fitting results by construction but not necessarily better out - of - sample performance . this approach is motivated by observing that the sector classification might not be adaptive to fully reflect the dynamics of a company &# 39 ; s changing business focus . c ) sector associated with the highest positive t - statistic : once again , this best - fitting sector changes over different estimation windows and depends on the specific sample . it has the same motivation as the prior sector selection approach . in addition , it is based on the prior belief that sector return usually has positive impact on the stock return . models 1 , 2 , 4 may use one of these types of selection rules ; in exhibits of appendix 3 they are referenced as 1b or 2c , indicating the sector selection method . to evaluate fair value model performance for different groups of stocks , all models defined above have been run , the market cap - weighted r 2 values were computed for different universes , and an average was taken over all estimation windows . each estimation window for each stock includes the most recent 80 trading days . the parameter selected after several statistical tests was chosen as the best value , representing a trade - off between having stable estimates and having estimates sensitive enough for the latest market trends . tables 3 . 1 , 3 . 2 , and 3 . 3 present the results using model 1 a , model 1 b , and model 1c . results on the other models suggest similar pattern and are not presented here . the results clearly suggest that all the models work better for large cap stocks than for small cap stocks . in addition , it can be observed that the r 2 values of model 1b are the highest by construction and the r 2 values of model 1a are the lowest . standard statistical testing has been implemented to examine whether switching regression provides a more accurate framework to model fair value price . one issue arising with the switching regression model is how to choose the threshold parameter . since it is known that the selection of the threshold does not change the testing results dramatically as long as there are enough observations on each side of the threshold , we chose the sample standard deviation as the threshold . therefore , approximately one - third of the observations are larger than the threshold in magnitude . appendix 4 presents the percentages of significant positive ฮด using model 2 as the benchmark . it shows that only a small percentage of stocks support a switching regression model . as mentioned above , back - testing performance is an important part of the model performance evaluation . all back - testing statistics presented below are computed across all the estimation windows and all stocks in a selected universe . the average across all stocks in a selected universe can be interpreted as the statistics of a market cap - weighted portfolio across the respective universe . appendix 7 contains all the results for selected countries representing different time zones with the most liquid markets , while appendices 5 and 6 contain selected statistics for comparison purposes . the out - of - sample performance was evaluated for all models containing a sector component and the pre - specified economic sector model performed the best . it is generally associated with the smallest mae , the highest hit ratio , and the largest correlation ( cor ). table 6 . 1 of appendix 6 presents the mae , hit , and cor statistics of models with pre - specified sectors for top 10 % stocks . it shows that model 2 performs the best . table 6 . 2 summarizes the arbitrage profit statistics of model 2 for top 10 % stocks in each of the countries . however , it is noted that all the models perform very well in terms of reducing arbitrage profit . table 6 . 2 of appendix 6 also shows that less arbitrage profit can be made by short - term traders for days with small market moves . consequently , fund managers may wish to use a fair value model only when the u . s . market moves dramatically . appendix 8 is included to demonstrate that the naรฏve model of simply applying the u . s . intra - day market returns to all foreign stocks closing prices does not reflect fair value prices as accurately as using regression - based models . the us exchange traded funds ( etf ) recently have played an increasingly important role on global stock markets . some etfs represent international markets , and since they may reflect a correlation between the us and international markets , it might expected that they may be efficiently used for fair value price calculations instead of ( or even in addition ) to the u . s . market return . in other words , one may consider the back - testing results , however , don &# 39 ; t indicate that model 2 โณ performs visibly better than model 2 . addition of etf return to model 2 in model 2 โฒโณ does not make a significant incremental improvement either . poor performance of etf - based factors can be explained by the fact that country - specific etfs are not sufficiently liquid . some etfs became very efficient and actively used investment instruments , but country - specific etfs are not that popular yet . for example , ewu ( etf for the united kingdom ) is traded about 50 times a day , ewq ( etf for france )โ about 100 times a day , etc . the results of the tests for etfs are included in the appendix 9 . some very liquid international securities are represented by an adr in the u . s . market . accordingly , it may be expected that the u . s . adr market efficiently reflects the latest market changes in the international security valuations . therefore , for liquid adrs , the adr intra - day return may be a more efficient factor than the u . s . market intra - day return . this hypothesis was tested and some results on the most liquid adrs for the uk are included in appendix 10 . they suggest that for liquid securities adr return may be used instead of the u . s . market return in model 2 . as demonstrated above , it is reasonable to expect that different frameworks work differently for different securities . for example , as described above , for international securities represented in the u . s . market by adrs it is more efficient to use the adr &# 39 ; s return than the u . s . market return , since theoretically the adr market efficiently accounts for all specifics of the corresponding stock and its correlation to the u . s . market . some international securities such as foreign oil companies , for example , are expected to be very closely correlated with certain u . s . sector returns , while other international securities may represent businesses that are much less dependent on the u . s . economy . also , for markets which close long before the u . s . market opening , such as the japanese market , the fair value model may need to implement indices other than the u . s . market return in order to reflect information generated during the time between the close of the foreign market and the close of the u . s . market . such considerations suggest that the framework of the fair value model should be both stock - specific and market - specific . all appropriate models described above should be applied for each security and the selection should be based on statistical procedures . the fair value model according to the invention provides estimates on a daily basis , but discretion should be used by fund managers . for instance , if the fvm is used when u . s . intra - day market return is close to zero , adjustment factors are very small and overnight return of international securities reflect mostly stock - specific information . contrarily , high intra - day u . s . market returns establish an overriding direction for international stocks , such that stock - specific information under such circumstances is practically negligible , and the fvm &# 39 ; s performance is expected to be better . another approach is to focus on adjustment factors rather than the us market intra - day return and make decisions based on their absolute values . table 11 . 1 and 11 . 2 from appendix 11 provide results of such test for both approaches . the test was applied to the ftse 100 stock universe for the time period between april 15 and aug . 23 , 2002 . the results demonstrate that fvm is efficient if it is used for all values of returns or adjustment factors . the average was taken across top 10 % stocks by market cap . t - stats on the hypothesis that over - night volatilities for consecutive and non - table 11 . 3 ftse 100 ( no model ). arb mae equally weighted 0 . 00435 0 . 01098 mcap weighted 0 . 00542 0 . 0101 the invention having been thus described , it will be apparent to those skilled in the art that the same may be varied in many ways without departing from the spirit of the invention . any and all such modifications are intended to be encompassed within the scope of the following claims . | 6 |
referring to fig1 the method of making a conductive coated product is shown schematically . metal substrate material in roll form 10 is unwound in a web 12 which passes through an abrading station 15 which produces an abraded substrate 14 , a coating station 20 which adds a layer of uncured hydrogel material onto the abraded substrate 14 , and a curing station 25 which cures the hydrogel material . release liner material in roll form 30 is unwound in a web 32 and is joined with the web with cured coating 16 . the resulting laminate 40 is wound into a roll 42 . the roll 42 is placed into an oven 50 where it is heated to form a finished roll product 60 . the metal substrate material 10 is typically a thin foil of metal laminated on a polymeric backing material . a polyester backing material such as a polyester terephthalate film with a thin coating ( e . g . 0 . 001 inch ) of aluminum or tin on one side can be used . the metal substrate material 10 used is substantially free of rolling oil and other contaminants . the metal substrate material 10 extends as a web 12 to an abrading station 15 where the metal side of the web 12 is mildly abraded to provide a microscopically rough surface . the abrasions are preferably less than 25 ฮผm apart and between about 2 ฮผm and 10 ฮผm in depth and more preferably , between about 2 ฮผm and 20 ฮผm apart and between about 3 ฮผm and 6 ฮผm apart . the abrasions are preferably aligned predominantly in the same direction as the direction of travel for the web 12 . referring now also to fig2 the abrasions can be produced by an abrasion wheel 70 such as an ultra fine silica carbide flap brush ( e . g . 3m company scotch - brite ยฎ finishing flap brush grade ulf ). the metal substrate 12 is drawn between a backup roll 72 and the counter - rotating abrasion wheel 70 . it will be appreciated by those skilled in the art that the degree and uniformity of abrasion is controlled by the combination of the speed of the web 12 , the pressure applied between the abrasion wheel 70 and the backup roll 72 , and the rotational speed of the abrasion wheel 70 . in a preferred embodiment of the invention , the abraded substrate 14 is also cleaned to prevent stray particles from marring the appearance of the finished product 60 . cleaning can be accomplished , for example , by providing a housing 75 enclosing the abrasion wheel 70 and the abraded substrate 14 and attaching a vacuum source 77 to the housing 75 whereby particles released by the abrasion process can be swept away . in yet another method for cleaning a separate cleaning station 80 can be optionally employed in which a web 82 of paper or cloth is pressed against the abraded substrate 14 and moved in a direction opposite to the direction of movement of the abraded substrate 14 . although the abrasion station 15 is shown to be a part of a continuous production system , it has also been found that it is possible to abrade the metal substrate material 10 in a separate operation , store the abraded substrate for a desired period of time and then apply a coating to the pre - abraded material to make the product 60 without again abrading the substrate . the coating station 20 adds a layer of uncured hydrogel material to the abraded surface of the substrate 14 . the uncured hydrogel material is a mixture of 2 - acrylamido - 2 - methylpropanesulfonic acid ( amps ) or one of its salts , copolymers of the acid , copolymers of the salts of the acid and their various mixtures with water and / or an alcohol . such compositions are set forth more fully in u . s . pat . nos . 4 , 391 , 278 and 4 , 581 , 821 issued to cahalan et al . which are incorporated herein by reference . the compositions can include a variety of additives and modifiers including humectants such as glycerol or propylene glycol , thickeners such as polyvinylpyrrolidone or polyvinyl alcohol , monomers such as acrylic acid or acrylamide , crosslinking agents such as methylene - bis - acrylamide , fillers such as silica , ionizable metal salts such as potassium chloride or sodium chloride , ph modifiers such as sodium hydroxide , and various curing agents . a particularly useful curing agent for this process is hydroxycyclohexylphenylketone which can be added to the amps and other ingredients in a solution of isopropanol . it produces a cure of the hydrogel coating when it is exposed to ultraviolet light . the uncured hydrogel material can therefore be premixed and applied to the substrate by conventional coating equipment . preferably , the uncured hydrogel material is handled in an atmosphere that is dry and substantially free of oxygen . the curing station 25 provides the necessary conditions for the hydrogel coating on the abraded substrate 14 to cure . for example , heat or ultraviolet light can be applied depending on the curing agent used curing by application of ultraviolet light is preferred . after the hydrogel coating is cured , the release liner material in roll form 30 is unwound in a web 32 and is joined with the web with cured coating 16 . the resulting laminate 40 is wound into a roll 42 . if the material has been cured by application of ultraviolet light , the roll 42 then undergoes a heat treatment operation whereby it is placed into an oven 50 at a temperature of at least 45 ยฐ c . and preferably in the range of about 50 ยฐ- 65 ยฐ c . for at least 10 hours and preferably for more than 24 hours to make a finished product 60 . the time required to accomplish the heat treatment will , of course , depend upon the size of the roll 42 and its heat transfer characteristics . heat treatment could be accomplished in as little as one hour for a small sample . it will be appreciated by those skilled in the art that while the invention has been described above in connection with particular embodiments and examples , the invention is not necessarily so limited and that numerous other embodiments , examples , uses , modifications and departures from the embodiments , examples and uses may be made without departing from the inventive concepts . | 0 |
the standing wave simple math processor is a custom designed base 7 math system built to integrate into 3 standing waves running through a capacitance field . the standing wave ( sw ) is created by transmitting alternating current along a conduction line ( wire ) and then having it reflected upon itself . [ fig1 ] in perfect balance , a sw has no net propagation of energy . standing waves create rising and falling areas at the anti - nodes . utilizing these properties it is the intention to introduce imbalances at these anti - nodes . by having the sw travel through a dielectric it will be possible to to influence the anti - nodes . [ fig2 ] dielectrics are a component of capacitors , indeed the intention of this system is to make a sw inside a dielectric , which will allow a dc interaction with an ac wave . dc current interacting with an ac field is critical to the standing wave simple math processor . by introducing a dc current to the ac field at the anti - node the standing wave will become unstable . in normal conditions an unstable standing wave would deteriorate and lose its energy . by fixing , in this case , re - stabilizing the sw before the reflection point , the sw could be preserved . i propose using a dc source to add or remove dc charges at anti - nodes . dc added or removed at the anti - node would in effect be able to re - balance the sw . the inverse is also true that this method would be able to destabilize the sw as well . this in - out ( i / o ) method would be used to move dc charges to and from the anti - nodes . [ fig3 ] as i will illustrate in the next section these dc charges will represent elements of numerical digits and be instrumental to the processing of math in this system . for the purpose of number creation in this system a few elements need to be explained . in this system i will use base 7 . to express base 7 numbers i need to construct them from 3 anti - nodes , that is to say : any one base 7 digit is comprised of 3 consecutive anti - nodes . the first anti - node represents โ 1 โ and the second โ 2 โ and the third โ 3 โ. in this manner , if an anti - node has a dc charge present at the first and third anti - node the number it represents is โ 4 โ. see [ fig5 ] for a more complete illustration of digit composition . the minimum number of anti - nodes are dependant on the digit size of the desired math , and / or the physical length of the sw itself . therefore , these strings of anti - nodes will be referred to as anti - node lines ( al ). each al is itself a sw with an i / o at each of its anti - nodes . as will be explained shortly , the standing wave simple math processor requires at least 3 als to process math . al1 and al2 will function as inputs and al3 will function as the output . [ fig6 ] for sake of clarity , these dc charges will be referred to as electron units ( eu ). eus are the lowest possible unit of dc charge that can be used in this system . obviously , as technology gets better and these physical systems are improved upon the actual dc charge will get smaller and more efficient until the smallest possible unit would be 1 electron . for our concerns though the eu is rather arbitrary and is representative of the smallest possible unit of charge in this system . the critical element at this point then , is the relationship between digit values at the anti - nodes and the amount of eu present . at each anti - node in sequence , a corresponding eu must be present . that is in order to represent โ 2 โ 2 eus must be present at that particular anti - node see [ fig7 ]. although it seems redundant to have the number of eus also represent the number itself it is wholly necessary for later stages . basic math requires both operator and operand . in this case the operand is the number defined by eus at the anti - nodes . the operator function is divided between lattice movement and valence movement . for the purposes of simplicity this specification will refer to the various positions of the al . see fig5 , and 6 again . it must be noted that these numbering conventions are completely relative and change to relate to the particular digit being processed . in brief this means that references to position number ( pos .) are accurate only when that digit is being processed . as this system is capable of dealing with any number of digits the position naming convention as supplied is only applicable as that particular digit is being examined . lattice movement in brief is the transfer of any eus along the input als to the output al . [ fig8 ] the lattice is simply an interconnection of al1 and al2 &# 39 ; s individual anti - nodes to al3 pos . 3 , allowing the transfer of eu charges to be deposited at that location . this transfer has a secondary effect of instantly balancing both al1 and al2 . this is done because any eu present on the al will put it into unbalance , therefore removing those eus will return the al into a โ 0 โ charge state or โ balance โ. the benefits of this cannot be understated , as a necessary process both al 1 and al2 have achieved a balanced state even before final output is achieved . the second phase of the operator function is valence movement . valence movement , in essence , is a set of 4 logical rules for the redistribution of eus present at al3pos . 3 . after lattice movement has taken place , there is now a deposit of eus at al3pos . 3 this deposit is not necessarily compatible with the base 7 numbering system , as such it must be redistributed . redistribution , or valence movement , is governed by the number of eus present at al3pos . 3 in order from largest to least . this governing can be expressed as 4 logical rules dependent on order ; [ fig9 ] 1 ) if the number of eus at al3pos . 3 number 7 , then 6 eus will be recycled via i / o with the remaining 1 eu moved to the next digit up ( al3pos . 6 ). 2 ) if the number of eu at al3pos . 3 number 3 then that quantity will remain at al3pos . 3 . 3 ) if the number of eu at al3pos . 3 number 2 then that quantity will move entirely to al3pos . 2 . 4 ) if the number of eu at al3pos . 3 number 1 eu then that quantity will move to al3pos . 1 . of important note in this system is that the logical operations are magnitude dependant , as such all four rules must be followed sequentially as to ensure accurate redistribution . also of strict importance is which digit to process first . since these digits process math dependent upon the preceding digit , then logically the first digit to be processed must be the digit of least value . in other words , the operator function can only proceed when the digit represented โ beneath โ it is already completed , or is โ 0 โ. in this manner then there is no limit to how many digits can be involved in the math operation , so long as the first digit to have the been processed is the digit of least value . to conclude then , this system uses 3 als to do math . al 1 and 2 are used to create the operands ( input ). al3 serves as the output . an i / o provides both the input of eu values as well as a recycling source for the re - balance of als . by using a lattice interconnection of all the input anti - nodes to al3pos . 3 , al1 and al2 now reach a state of balance after the initial unbalancing of eu input . the lattice movement results in a transfer of eu to a single point on the output sw ( al3 ). using the valence movement rules stated above , these eus can now be sorted into al3 for the purpose of output comprehension ( producing a final output solution ). please see [ fig1 ] for a comprehensive breakdown of this summary . | 6 |
a preferred embodiment of the invention is shown in fig1 to 7 . as fig5 shows , a feed conveyor 45 includes an endless chain 41 powered by a motor 40 to run at a constant speed on which are supported a multiplicity of attachments 42 in equispaced relation . a pair of frames 43 are disposed on both sides of the chain 41 , with a groove 44 formed between top surfaces of the frames 43 . the feed conveyor is adapted to slide an article 46 as pushed by each attachment 42 , within the groove 44 for transfer onto a conveyor 47 located therebehind as shown by the arrow . on both sides of the conveyor are provided a pair of side chains 48 which are each trained around two chain wheels 49 , 50 and a tension wheel 51 . as fig6 shows , the chains 48 are so arranged as to become downwardly inclined in the direction of transport of articles and respectively have a multiplicity of clampers 52 arranged thereon in equispaced relation . the clampers 52 are similar in construction to a known paper clip and are normally allowed to retain their clamping force by a spring force , but only while they are in contact with circular cams ( not shown ) provided on the shafts of the two chain wheels 49 , 50 , the clampers are opened so that they are relieved of their clamping force in order to catch the side edge of the film which is to be described hereinafter . as fig6 shows , a roll - form film 56 is placed on two rod - like rollers 52 , 55 mounted rotatably on a machine frame 53 . as the film is conducted by a roll 58 , powered for rotation by the motor 57 , into the space between the two chaines 48 via a direction changing roll 59 , the belt - like film 60 is obliquely downwardly transported under the rotation force of the chains 48 while being supported at opposite sides thereof by clampers 52 . tension rolls 51 are disposed midway on the chains 48 so that the spacing between the pair of chains 48 is locally enlarged at that location ; therefore , the film 60 is , in effect , placed over each article 46 on the conveyor in such a condition that it is tensioned both sideways . opposite side edges of the film 60 as released from clampers at the rear chain wheels 50 are drawn together toward a center line through the run of a pair of cord - like belts 61 arranged in a v - shaped fashion , being placed one over the other for being welded together in overlapping relation under a clamping force of a pair of heating rolls 62 . as a result , a large number of articles are enclosed in equispaced relation within a tubular film 63 . a pair of seal bars 65 , 66 travelling along an elliptic trajectory 64 as shown by arrow operate to weld the tubular film 63 between adjacent articles which are transported while being aided by side belts 67 for movement on their path of transport . in reality , such a packaging apparatus as described above is not particularly new and is taught in , for example , japanese patent application laid - open publication no . 60 - 183370 . as may be seen from fig5 and 6 , a pipe nozzle 10 is disposed within the tubular film 63 in such a way that its distal end is open adjacent the seal bar 65 . a connecting pipe 11 is connected to the pipe nozzle 10 at an underside open portion thereof adjacent front portions of the pair of cord - like belts 61 arranged in v - shape fashion . as fig3 shows , the pipe nozzle 10 is configured to be laterally flat , being of such a construction as to permit individual articles 46 to slide over the pipe nozzle 10 without any surplus space being produced within the tubular film 63 . as fig1 shows , a vacuum source 14 comprising a vacuum pump 12 and an ancillary tank 13 of a predetermined capacity is connected to the distal end of the connecting pipe 11 . the connecting pipe 11 is provided with a normally - closed type electromagnetic on - off valve 15 in parallel with which a bypass tube 16 is connected to the connecting pipe 11 . the bypass tube is provided with a flow control valve 17 . as fig4 shows , the connecting pipe 11 has a sectional passage area which is about three times as large as that of the pipe nozzle 10 shown in fig3 . the sectional passage area of the bypass tube 16 is substantially smaller than that of the pipe nozzle 10 . as operation of the packaging apparatus is stopped , a valve 19 is closed in response to a signal from a controller 20 . then , the degree of vacuum in the ancillary tank 13 rises as the sucking action of the vacuum pump 12 is still continued . when the valve 19 is opened upon start of operation of the packaging apparatus , a flow of air develops under a differential pressure within the connecting pipe 11 toward the ancillary tank 13 . normally , air flows in the bypass tube 16 at a flow rate regulated by a flow control valve 17 , and the pipe nozzle 10 sucks thereinto the air within the film . the amount of air in the tubular film changes according to the size of the article being packaged , and the flow control valve 17 is operated accordingly . movement of the film causes fresh air to flow successively into the tubular film , but the incoming air is sucked into the pipe nozzle 10 so that the interior of the tubular film is held under negative pressure in such a way that the friction between the pipe nozzle and the film is kept from becoming greater than necessary . the pair of seal bars 65 , 66 press the tubular film from opposite sides so as to cross seal the film and , immediately before the seal bars 65 , 66 move toward each other to press - hold the tubular film therebetween , the electromagnetic on - off valve 15 is opened for about 0 . 2 second upon a signal 18 from the controller 20 . while the valve is so open , an impulsive suction force acts on the pipe nozzle 10 under a vacuum energy accumulated in the ancillary tank 13 , so that the air in the film is momentarily evacuated from a clearance between the pair of seal bars 65 , 66 . immediately thereafter , the seal bars 65 , 66 press and seal that film portion . fig7 shows that inpulsive vacuum suction is effected immediately prior to the sealing action of the seal bars on the film . as may be seen from fig6 an encoder 22 is mounted to a motor 21 which drives the pair of seal bars 65 , 66 to move along the elliptic trajectory 64 , the encoder 22 serving the purposes of detecting the rotation angle of the shaft of the motor and of determining the timing for the pair of seal bars 65 , 66 contacting each other on a predetermined cycle . this encoder 22 and an encoder 23 connected to the motor 40 for driving the feed conveyor 45 rotate in proportional relation with each other . therefore , by connecting one of the encoders to the controller 20 shown in fig1 it is possible to control the electromagnetic on - off valve 15 in corresponding relation to the operation timing for the seal bars . in fig2 in place of such an encoder , a rotary cam 25 and a microswitch 20 are used to constitute a rotation angle detector . in particular , each time when a switch 26 is closed by a cam 25 which is rotated by a motor 21 which drives seal bars 65 , 66 , a timer 27 closes a switch 28 for about 0 . 2 second , and meanwhile the electromagnetic on - off valve 15 of the connecting pipe 11 is opened . in this way , air flowing successively into the tubular film 63 is eliminated by a bypass tube 16 having a smaller sectional passage area , so that a negative pressure is kept within the tubular film 63 in such a way that the friction between the tubular film 63 and the pipe nozzle 10 inserted therein may be kept from becoming greater than necessary . further , immediately before sealing is effected , the connecting pipe 11 which has a greater sectional area of passage is opened to momentarily eliminate air from the tubular film . therefore , it is possible to package articles under high vacuum with little or no stop of film run due to any friction between the pipe nozzle and the tubular film . in fig8 a motor 21 for driving seal bars 65 , 66 , a motor 40 for driving a feed conveyor 45 , and a motor 57 for film transport are respectively provided with encoders 22 , 23 and 24 for converting the number of revolution data on the motors into pulse signals . in response to pulse signals fed back from the encoders to a controller 20 , the controller 20 issues command signals 35 , 36 , 37 to the three motors 21 , 40 , 57 respectively , so that the motors 21 , 40 , 57 are always kept in their normal running speeds . a photoelectric switch 38 provided in a transit zone for articles 46 on the feed conveyor 45 is operative to send pitch data signals 39 successively for entry into the controller 20 , each pitch data signal 39 corresponding to the spacing between adjacent articles 46 passing a zone under the switch . in the process of such signalling , if articles 46 under transport lack one of them , for example , so that the spacing between adjacent articles is increased , two motors 21 and 57 are caused to stop running at abnormality signals 35 , 36 from the controller 20 , and accordingly movement of film 60 , as well as operation of seal bars 65 , 66 , is stopped until the conveyor 45 has made up for such disorder so that a succeeding article overtakes the preceding article . as earlier stated , there is always a flow of air in the bypass tube 16 ; therefore , when film movement is stopped , the interior of the tubular film becomes excessively vacuum . as such , when operation is restarted , considerable friction develops between the pipe nozzle 10 and the film , so that the film is prevented from advancing . therefore , it is arranged that simultaneously upon the film and seal bars 65 , 66 being brought to a halt , a second electromagnetic on - off valve 19 is closed at a signal 30 from the controller 20 , as shown in fig1 . upon the closure of the valve 19 , air naturally flows into the tubular film 63 ; but the controller 20 releases the first and second electromagnetic valves 15 , 19 somewhat earlier than usual . as a consequence , the air in the tubular film is sucked out instantaneously , so that cross sealing can be performed by the seal bars 65 , 66 which have resumed their operation , with any redundant air eliminated . the above described process of operation is shown by a flow chart in fig1 . instead of the above discussed manner of operation in which the on - off valves 15 , 19 are released somewhat earlier than the film and seal bars 65 , 66 are driven for movement again , for the purpose of restarting the tubular film 63 and seal bars 65 , 66 , the film 63 and seal bars 65 , 66 may be so controlled that they go into movement initially at a gradual speed and then at an accelerated speed . that is , the film 63 , once brought to a halt , is allowed to restart movement at a slow speed , whereby it is possible to make time for discharge of the air present therein . subsequently , movement is accelerated for making up for any delay involved . a flow chart for this mode of operation is shown in fig1 . in this way , the on - off valves 15 , 19 are released slightly earlier than usual , or the tubular film 63 , brought to a halt , is allowed to restart movement at a rather slow speed , which makes it possible to make time for discharge of the air which has flowed into the tubular film 63 while at a halt . therefore , when operation is resumed after a short supply of articles being found , for example , it is possible to prevent a first bag of article from being of insufficient vacuum . | 1 |
with reference now to fig1 an automated bond inspection system in accordance with the preferred embodiment of the present invention is schematically illustrated . a wire bonded semiconductor and lead frame assembly 10 is placed upon an electrically grounded supporting carrier or substrate 11 for inspection . these assemblies are typically produced in mass quantities on lead frame strips so that the finished assemblies may be sequentially inspected by simply pulling the strip past the bond inspection system . the supporting carrier 11 is equipped to support and control the positioning of the assemblies during their inspection . the optomechanical system 12 illuminates and images the assembly 10 with a complex illumination and imaging system which effectively captures the three dimensional characteristics of the imaged assembly 10 from a single optical point of view and develops video signals corresponding thereto . the illumination and imaging of system 12 is partially controlled through pneumatically powered instruments within system 12 . pressurized air for the pneumatic instruments is supplied by pneumatic air supply 13 . a video signal digitizer 14 receives the analog output representation of the assembly 10 from system 12 and converts it to a digital signal for input to image analysis computer 16 . computer 16 receives the signals from the digitizer 14 and analyzes the digital information representing the imaged portion of the assembly 10 to determine if any manufacturing defects in the bonding of the die and lead frame have occurred . prior to inspecting assemblies for a particular semiconductor type , a training operation can be performed which sets the specifications for that type of assembly in the memory of the computer 16 . detected signals from the imaged objects are then compared to the master reference created during the training operation . assemblies coming within the specifications of the master assembly pass the inspection . typical manufacturing problems which can cause an inspected assembly to be rejected by the system include bonds which have been misplaced on either the die or the lead frame fingers , bonding wires which have broken , adjacent bonding wires which either touch or are too close to one another , poor quality bonds , bonding wires which are too close to the lead frame island , and bonding wires which are too long or too high . in addition to analyzing the imaged assembly 10 , the computer 16 operates to control the movement of the system 12 , air supply 13 , axis drive 18 and the lead frame feed mechanism 20 . drive 18 controls the positioning of system 12 along the x , y , and z - axes . mechanism 20 controls the positioning of the strip of bonded assemblies to be inspected by the system . a portion of a bonding area of a semiconductor to lead frame connection assembly 10 is illustrated in the partially broken , perspective view depicted in fig2 . the lead frame described above is shown comprised of island 22 and leads or connection fingers 24 , and is depicted as resting upon a support carrier 11 . island 22 creates a mechanical support and heat sink or electrical ground for the semiconductor device or die 26 . metal traces 28 connected to the circuitry portion ( not shown ) of die 26 run to the edges of die 26 and form bonding pads or electrodes 29 . bonding wires 30 provide an electrical connection between the fingers 24 and bonding pads 29 . where the automated wire bonder has attached a bonding wire 30 to a bonding pad 29 by sonic bonding , a ball bond 32 is created . where the automated wire bonder has attached a bonding wire 30 to a finger 24 by sonic bonding , a crescent bond 34 is created . optomechanical system 12 is capable of illuminating and imaging the desired object in a number of manners , the purpose of which will be further illustrated below . system 12 may be moved in the x , y and z - axes directions by drive 18 so that the entire assembly 10 may be imaged either in whole or in part . typically , a large portion of the bonded assembly 10 is imaged at one time , such that only a small number of images are required to completely image each bonded assembly . referring now to fig3 an embodiment of an optomechanical system in accordance with the present invention is depicted in partially broken section at 12 . note that system 12 is disposed immediately above the support 11 ( containing a light source not shown ) and wire bonded assembly 10 , which includes a lead frame to which semiconductor die 26 is attached . the pads 29 of die 26 are electrically connected to the fingers 24 of the lead frame by wires 30 , as is more clearly illustrated in fig2 . an optics case or housing 40 encloses most of the optomechanical components of system 12 . a cover plate 42 , attached with screws 43 to case 40 , is depicted as cutaway to expose the internal components of the system 12 . one means of illuminating the assembly 10 is provided by a bright field illuminator 44 , which casts a narrow angle beam of light rays ( collimated or parallel light rays ) onto assembly 10 . the illuminator 44 is utilized in a number of imaging applications , particularly when a bright field of illumination of the background is required to create a proper optical contrast between the background and the desired object . narrow angle light rays are typically generated by a xenon strobe flash unit ( not shown ) external to the system 12 which is connected to illuminator 44 through fiber optic cable 45 . the diameter of the fiber optic cable 45 must be large enough to fill the desired optical aperture of illumination . light emitted by bright field illuminator 44 passes through a condenser lens 52 which is attached to case 40 by a holder 50 . lens 52 is an aspheric lens , the surface of which has been modified slightly from a spherical surface in order to reduce optical aberrations caused by the greater distance that the narrow angle light rays must travel to reach the bonded assembly 10 . condenser lens 52 preferably has a focal length of 25 mm , although this specification can change depending on the application and the size of the optomechanical system 12 . a pneumatically activated field stop assembly 54 , associated with holder 50 , is utilized to position a field stop aperture 56 in or out of the beam path of illuminator 44 . pressurized air for the pneumatic control of the field stop assembly 54 and various other pneumatic instruments of optomechanical assembly 12 is supplied through a bundle of pneumatic tubing 48 . aperture 56 is primarily used in conjunction with high magnification camera 62 to limit the illumination field of view , as will be further described below . light rays from illuminator 44 then pass through a beam splitter 58 , held in place by a holder 60 , and into an achromatic lens assembly 66 . assembly 66 is a compound lens combination which has the same focal length for at least two different wavelengths and serves to insure that narrow angle light is directed to the bonded assembly 10 lens assembly 66 is attached to the optics case 40 by a holder 68 . light rays passing through lens assembly 66 are reflected downwardly by a beam splitter 80 through the aperture of a telecentric slide stop assembly 84 . the telecentric assembly 84 is basically a telescopic system having an aperture stop at the image side of an object lens 86 . the assembly 84 is telecentric on the image side of the lens 86 . the aperture stop of telecentric assembly 84 is also equipped with an array of selectively actuable light emitting diodes for use in some illumination applications . the telecentric assembly 84 is moved in and out of alignment with the optical axis under the control of a pneumatic actuator 88 . an air diffuser assembly 90 is also provided , and attached to optics case 40 by a screw 91 , to maintain a positive air pressure within optics case 40 , thereby preventing dust and debris from entering optics case 40 . light rays either passing through telecentric slide stop assembly 84 , or generated therefrom , are directed to the object to be imaged by a lens 86 , which is a standard lens ( such as a closed - circuit television lens ) having a focal length of approximately 25 mm , although this can depend upon the application for the lens . lens 86 directs light collected from an object at a working distance , wd , which is the distance from the object side of lens 86 to the point of interest on or above the bonded assembly 10 . since the object within the working distance wd is in the focal plane of the object lens 86 , the light rays after the object lens are collimated . a circular dark field illuminator 92 , having a central aperture 93 with a diameter somewhat larger than the area of the object to be imaged , is positioned beneath the lens 86 and above the die 26 to illuminate the various surfaces of the bonded assembly at a shallow or wide angle . light emitting diodes , or led &# 39 ; s 94 , provide selectively actuable light sources for illuminator 92 as will be further discussed below . regardless of the source of the illumination cast upon the bonded assembly 10 , i . e . from bright field illuminator 44 , telecentric slide stop assembly 84 , or dark field illuminator 92 , some light will normally be reflected from the assembly 10 and be collected and directed by lens 86 into both a high magnification camera 62 via the reflective surfaces of splitters 89 and 58 and a low magnification camera 70 after passage through splitter 80 . camera 62 is secured to case 40 by a bracket 64 . although light is directed to both cameras 62 and 70 , images are only selectively digitized depending on the application . in applications utilizing the low magnification camera 70 , imaged light is directly transmitted through splitter 80 and an imaging lens 78 to camera 70 where an image is then digitized . imaging lens 78 , in this application , preferably has a focal length of 35 mm , and is secured to case 40 by a holder 76 . camera 70 is secured to case 40 by a bracket 72 . each camera is equipped with image sensors comprised of rows and columns of light detectors which develop signals corresponding to each pixel of the illuminated object . optomechanical system 12 operates on a three dimensional coordinate system . the x - axis of the system is parallel to the length of the lead frame strip and the y - axis is directed transverse to the length of the lead frame strip . the z - axis of the coordinate system is perpendicular to the upper surface of the lead frame strip and coincides with the optical axis of system 12 . the origin of coordinate system x , y and z is at the forward focal point of the lens 86 . images reflected to cameras 62 and 70 are recorded in a two dimensional x &# 39 ; y &# 39 ; coordinate system which is in the plane of the image sensors of cameras 62 and 70 . field stop assembly 54 may be better understood through reference to fig4 . assembly 54 is comprised of a field stop aperture 56 , a support bracket 120 and a pneumatic actuator 122 . when high magnification camera 62 is to be utilized , aperture 56 is positioned in line with the optical axis of light transmitted by illuminator 44 so as to limit light projected onto the object to the field of view of camera 62 . a partially exploded , perspective view of telecentric slide stop assembly 84 is depicted in fig5 . the assembly 84 is comprised of a base 128 which is fixed relative to case 40 ( fig3 ), a slide 130 having an aperture 131 formed therein , and an led ring 132 disposed around the perimeter of aperture 131 . the slide 130 , which supports led ring 132 , is positioned &# 34 ; in &# 34 ; and &# 34 ; out &# 34 ; of alignment with the optical axis of system 12 by the pneumatically controlled actuator 88 . when the slide 130 is &# 34 ; out &# 34 ; of alignment with the optical axis of system 12 , the numerical aperture of telecentric slide stop assembly 84 is approximately 0 . 36 . when the slide 130 is &# 34 ; in &# 34 ; alignment with the optical axis of optomechanical assembly 12 , the numerical aperture of telecentric slide stop assembly 84 is approximately 0 . 1 . when it is desired to have a broad field of illumination , but a narrow field of imaging , one or more of the light sources is activated and slide 130 is moved &# 34 ; in .&# 34 ; if the same illumination but a wider field of imaging is desired , slide 130 can be moved &# 34 ; out .&# 34 ; the numerical aperture of slide 130 has no effect on the field of illumination . a broad field of illumination can be obtained at any angle of incidence , since the angle of incidence is not necessarily dependent upon the field of view . fig6 a , 6b and 6c illustrate the different modes , or angles of incidence of illumination that can be created by system 12 depending on the light source utilized . in fig6 a , illuminator 44 is the source of the narrow angled or collimated vertical light rays 140 . in fig6 b , led ring 132 is the source of the slight angled light rays 146 . in fig6 c , led &# 39 ; s 94 are the source of the wide angled ( or low angle to the support 11 ) light rays 150 . depending on the application , each type of illumination , either narrow angle , slight angle , or wide angle illumination , can be utilized independently or in some combination to create the desired illumination effect of the bonded assembly 10 . for example , fingers 24 , pads 29 , bonding wires 30 , ball bonds 32 and crescent bonds 34 as depicted in fig2 are all typically made from materials having similar surface reflectivity . this makes it difficult to distinguish light reflected from the various object surfaces on the basis of reflectivity alone . however , the objects of interest , such as the bonds and wires all have the common characteristics of having surfaces that are more or less rounded , while the background surface areas , such as the pads and lead frame fingers are generally flat . if a rounded object is illuminated by light rays which have an angle of incidence as close to being parallel to the optical axis as possible , such as when illuminated by illuminator 44 , and the telecentric slide 130 is &# 34 ; in &# 34 ; so that there is a small numerical aperture for imaging , only light rays reflected from the background surfaces and from the small portion of the rounded surface object which is perpendicular or nearly perpendicular to the optical axis will be collected by the camera . thus , the camera will see the rounded object surfaces as primarily dark , except for a small area in the middle , while the flat background surfaces will appear light , or as a bright field . how the different illumination modes are utilized to analyze all of the different portions of the bonded assembly 10 can be better illustrated with reference to fig7 a , 7b , and 7c . fig7 a depicts a cross - section representation of how collimated light rays 140 are reflected off the surface of a pad 29 , a ball bond 32 , and a connected bonding wire 30 . the line graph located above the cross - section object represents the intensity of light reflected from the object as collected by the camera 62 or 70 . the mostly flat surface of pad 29 , which has a normal vector approximately parallel to the optical axis , reflects light directly back through object lens 86 to either camera 62 or 70 and as illustrated at 141 produces the highest intensity of reflected light detected by the image sensors of either imaging camera . the line graph depicted in fig7 a illustrates that a unique graphic representation of an imaged object can be created using this technique . the electrical signal equivalent to this graphic representation can be used to determine certain physical characteristics of the ball bond 32 which can then be compared to specifications corresponding to a master of the same ball bond stored in the image analysis computer 16 . as indicated at 143 , the intensity of light reflected from rounded objects and detected by the camera is lower than the intensity of light reflected and detected from flatter object surfaces . thus , the somewhat flattened portion of ball bond 32 reflects more light back to the imaging sensor at a higher intensity , and light reflected off of the edge of ball bond 32 is at a lower intensity . hence , it is possible to produce sufficient information regarding an object from which certain measurements of the object can be taken from a single image of that object , rather than having to recreate an image of the object from a number of different images , either taken from different angles relative to the object or from a single optical point of view with illumination from a number of different angles of incidence . similar unique graphic representations can be created for other aspects of the bonded assembly 10 , such as is depicted in fig7 b for a bonding wire 30 and fig7 c for a crescent bond 34 . graphic representations may also be made for the intensity of light reflected from various other object surfaces versus y - axis or z - axis relative directional displacement . for instance , the intensity of reflected light versus z - axis directional displacement can be utilized to determine the height of a bonding wire 30 with respect to any other surface of the bonded assembly 10 , as will be further discussed below . fig8 a further represents how , through usage of the telecentric slide stop assembly 84 , the same optics can be utilized for various optical measurements . as depicted in part , slide 130 has been cut - away to reveal led ring 132 which is used to control the illumination and imaging of the slightly irregular surface of lead fingers 24 . led ring 132 may be a single row of led &# 39 ; s disposed around the perimeter of aperture 131 as depicted in fig5 or as a number of led &# 39 ; s located on the object side of the slide 130 . in this later configuration , slide 130 and led ring 132 are configured similarly to dark field illuminator 92 and its led &# 39 ; s 94 . as described above , moving the slide 130 &# 34 ; in &# 34 ; or &# 34 ; out &# 34 ; of coaxial alignment with the optical axis of system 12 can vary both the imaging and illuminating numeric apertures of the object lens 86 . the numeric aperture is the quantity of n sin u , where n is the refractive index of the medium between the object and the lens , and u is the angular radius of the lens as seen from a point on the optical axis at the object . by varying the numeric aperture , the depth of field of the optics system can be changed , thereby making it possible to utilize a large imaging numeric aperture in some situations and a small imaging numeric aperture for other applications , while maintaining the same illuminating numeric aperture . fig8 a illustrates that the angle of illumination or the illuminating numeric aperture can be selectively varied without affecting the imaging numeric aperture . the intensity of a point light source within the focal plane of the lens 86 will only be effected by light rays reflected from underlying or adjacent areas . if an adjacent or underlying area is illuminated by the illumination cone 160 in such a way as to direct reflected light rays away from the imaging cone 164 and the imaging camera , a desired object may be differentiated . fig8 a also demonstrates how a small portion , rather than the entire illuminated area , of the total illuminated surface of crescent bond 34 can be imaged by an imaging camera . the surface of lead finger 24 is formed from a number of microscopic planes which are inclined at small angles to the optical axis of system 12 . when this surface is illuminated and imaged through a small aperture , a speckled appearance will result because not all light rays reflected from the entire surface can be collected by the imaging camera . the speckled appearance may be eliminated by illuminating at a larger numerical aperture and imaging at a small numerical aperture , thereby preserving a large depth of focus and causing light from the surface of the lead finger 24 to also be collected by the imaging optics . in addition , fig8 b further demonstrates that the illumination cone 160 need not be circularly symmetrical about the optical axis of system 12 . as long as the approximate orientation of the surface of crescent bond 34 is known , that surface may be selectively illuminated to take advantage of surface variations . by selectively illuminating a portion of the led &# 39 ; s in led ring 132 , light rays reflected from the inclined surface of crescent bond 34 may be projected through aperture 131 . alternatively , the angle of incident light may be selectively varied by backlighting a diffuse surface located in the focal plane of the lens 86 and controlling the light emission by an electrically controlled liquid crystal pattern . by selectively varying the angle of incident illumination , the illuminating and imaging numeric apertures of system 12 , and the position of system 12 and the bonded assembly 10 , the entire bonded assembly 10 can be effectively imaged by system 12 and analyzed for compliance with its specifications by computer 16 . however , before bonded assembly 10 can be analyzed , an optimum or best focus must be established for system 12 at each position over the bonded assembly . the best focus for system 12 is generally calculated through application of a van neumann architecture computer , which is utilized to determine the local maximum for normalized energy density at a selected point on the bonded assembly . much simpler methods , however , may be utilized to determine the best focus , as is shown now with reference to fig9 a . the graphic representation of fig9 a shows that the point spread function for a point of light imaged by system 12 when in focus reaches a sharp peak and then quickly drops off . as an object goes through focus ( as it goes from being out of focus , to in focus , to out of focus ), the point spread function corresponding to the intensity of light reflected by this object ( or if it does not reflect light , from its surrounding background area which does reflect light ) would migrate radially inward and outward . this principle can be illustrated by viewing a point of light in focus and then taking it out of focus . as the point of light moves out of focus , a blurring effect around the periphery of the point of light going out of focus can be detected . likewise , fig9 b illustrates that when system 12 is slightly defocussed , the energy density peak spreads out even more , although the area under the curve remains constant . this implies that the image sensors of the camera , which measure the energy density per unit area , can best detect a maximum energy density when the point light emitter is in perfect focus . to determine the best focus for inspecting the bonded assembly 10 , the system 12 is positioned at a height so that the plane at z = wd , the maximum point of focus within the depth of focus , does not intersect any bonding wires . illumination of the bonded assembly 10 is such that a portion of the surface of bonding wire 30 will appear bright and its background ( also a portion of the bonded assembly 10 ) will be generally dark . this assures that the image sensor will mostly see the contribution from a certain point on a bonding wire rather than the surrounding background . as previously described , when a bonding wire is nearing focus , the slope of the intensity curve versus z - axis relative directional translation is quite sharp while the contribution from the surrounding background , which is out of focus , is small both in energy and in slope . as the system 12 is moved along the z - axis toward or away from the bonded assembly 10 , the light intensity for any of a number of points along the wire can be captured by computer 16 and stored , together with the known information relating to the height of the system 12 at those points . thus , system 12 is typically repeatedly moved by a fixed increment in the direction of the bonded assembly 10 , and for each new height , the intensity of light collected from the imaged object is compared with the previously recorded values . when the new value of intensity is greater than the old value of intensity , the old value is replaced , together with the value of the height of the system 12 at which the replacement occurred . hence , successive information regarding the imaged object is discarded and only information relating to the maximum detected height is retained , since the goal is not to attempt to recreate a three - dimensional image of the object , but just to determine its height . alternatively , a look - up table could be implemented for similarly determining the best focus at every point . also alternatively , the system could be tuned to determine the height of the object or the best focus where there is a dark object and a light background as previously described . the above algorithm , which is utilized to determine best focus , may also be utilized to try to isolate an imaged object when the point light source from that object is surrounded by an area of any degree of brightness , provided that the surrounding area is at a different brightness than the object . because of the radial migration of the point spread function as an object goes through focus , a comparison between intensities at different heights cannot normally be made . however , if slide 130 is positioned &# 34 ; in ,&# 34 ; the change in magnification as a function of z - axis directional translation will be only negligible and the intensity at a point light source in the sensor will always correspond to the same point on the bonding wire , which will allow that point light source to be isolated as the intensity of the surrounding area changes . an alternative to using the slide 130 would be to allow for a change in the magnification ( rather than holding it constant ) while compensating for that change in magnification with the computer 16 through use of standard methods of scan conversion . once best focus for the system 12 has been determined , system 12 and computer 16 can be trained to inspect a particular type of bonded assembly . to train the system and store the specifications of the master assembly in the memory of the computer 16 , an operator generally operates the system to determine the geometry of a master bonded assembly 10 and the proper placement of ball bonds 32 , crescent bonds 34 , and bonding wires 30 . in addition , the position of system 12 and its height at best focus is also determined for each inspection position and digitally stored in computer 16 . alternatively , the system may be trained using a computer aided design system to generate the necessary training information , such as the specifications for the position of the die and bonding wires , and the proper size and placement of bonds . the first operation in inspecting individual bonded assemblies is to determine the alignment of the bonded assembly . alignment is determined by placing the system 12 at the center of the inspection area , at a predetermined height , and focusing the bonded assembly 10 on the image sensor . the bonded assembly 10 is then illuminated from the bottom by the light source located in support 11 . camera 70 is selected to image the bonded assembly 10 and slide 130 is positioned &# 34 ; in &# 34 ;. light rays passing between the lead frame fingers are imaged into camera 70 , converted and stored in computer 16 . this stored image is then cross correlated with the same image ( or specifications for a computer generated equivalent of an image ) of the master assembly stored in the memory of computer 16 . the difference between the two images yields an off - set between the position of the training assembly and the bonded assembly which will later be subject to inspection . the light source within support 11 is then turned off . illuminator 44 is then utilized to project a narrow angle bright field illumination of die 26 . the slide 130 is positioned &# 34 ; in &# 34 ; and low magnification camera 70 is used to determine the off - set between a training die and the die 26 of bonded assembly 10 , which is under inspection . ball bonds are inspected with the slide 130 positioned &# 34 ; in &# 34 ;, narrow angle bright field illumination on , and either the high magnification camera 62 or the low magnification camera 70 . the surface of ball bonds 32 appear dark while the surface background appears light . the image of the ball bond 32 is analyzed by computer 16 and the correct size and position of each ball bond is determined . crescent bonds 34 are typically inspected with slide 130 positioned &# 34 ; in &# 34 ;, narrow angle bright field illumination on , high magnification camera 62 , and field stop 56 positioned &# 34 ; in &# 34 ;. fingers 24 and support 11 will appear light , the crescent bond 34 will appear dark , and the bonding wire 30 , except for the light center , will be dark . the captured image is analyzed by computer 16 . a crescent bond 34 is identified by the large dark area of the image . the bonding wire 30 is identified by its light center and known dimension , and is &# 34 ; cut off &# 34 ; to determine the width , breadth and position of the crescent bond 34 . because of the irregular shape of lead fingers , narrow angle bright field illumination may result in too few light rays reaching camera 62 . in such situations , the slight angle illumination of led ring 132 should be utilized so that the size of the crescent bond 34 may be accurately determined . illumination with led ring 132 may also be required in some situations where the curvature of the surface of the object to be imaged is such that other illumination sources will not reflect light to the imaging camera . alternatively , some combination of illumination sources can be utilized to achieve the proper optical contrast . the path of each bonding wire in the x and y - axis plane , but not in the z - axis direction , can be determined by positioning slide 130 &# 34 ; in &# 34 ;, turning dark field illuminator 92 on , and utilizing camera 62 . bonding wires 30 will appear light and the background will appear dark . the height of each bonding wire 30 can be determined by positioning slide 130 &# 34 ; out &# 34 ;, turning dark field illuminator 92 on , and utilizing camera 70 . system 12 is positioned as close to the surface of bonded assembly 10 as is necessary to focus camera 70 on a bonding wire having the greatest sag . the intensities of all points corresponding to locations on the bonding wire 30 are recorded in computer 16 . system 12 is then raised by about 50 microns and the intensity of each point corresponding to location on the bonding wire are again recorded . utilizing previously described methods , the local energy density maximum can be determined from this information to establish the position of best focus , as well as the height of each bonding wire 30 . it should be noted that the present invention is not limited to usage as an optical inspection system . in general , such a system as is described would be useful in automatically locating or referencing any type of object , or measuring the size of a feature of an object in a number of different applications , such as robotics and medical automation fields . the present invention may also be employed to derive a computer aided database from a pre - existing sample of a part to be manufactured . it should also be noted that the accuracy of z - axis measurement may be increased by replacing the conventional optical system with a confocal microscope . although the present invention has been described in terms of specific embodiments , it is anticipated that alterations and modifications thereof will no doubt become apparent to those skilled in the art . it is therefore intended that the following claims be interpreted as covering all such alterations and modifications as fall within the true spirit and scope of the invention . | 7 |
the preferred embodiments for implementing the present invention will be described with reference to the drawings . fig1 is a perspective view illustrating an example of a flapper 3 . fig2 is an exploded perspective view of the flapper 3 of the present example . fig3 is a perspective view corresponding to fig1 illustrating another example of the flapper 3 of the present invention . fig4 is a cross - sectional view of a fuel filler port closing apparatus using the flapper 3 of the present example . fig5 is a partially enlarged cross - sectional view of the fuel filler port closing apparatus illustrating a normal state in which the flapper 3 closes an opening 211 of a nozzle guide . fig6 is a partially enlarged cross - sectional view corresponding to fig5 of the fuel filler port closing apparatus illustrating a state in which a seal packing 325 is deflected thereby forming a gap ฮด . fig7 is a partially enlarged cross - sectional view corresponding to fig5 of the fuel filler port closing apparatus illustrating a state in which a seal plate 32 is pushed up thereby filling the gap ฮด . fig8 is a pattern diagram illustrating the state that a flapper 603 of a prior arts tilts . the fuel filler port closing apparatus of the present invention has a characteristic flapper 3 for opening and closing an opening 211 of a nozzle guide 21 . the flapper 3 of the present example is configured by a rotation plate 31 , which is pushed and biased upwardly by a torsion coil spring 314 and which is rotatable downwardly ; and a seal plate 32 holding the seal packing 325 pressed against the peripheral edge of the opening 211 of the nozzle guide 21 . the seal plate 32 is coupled so as to be freely displaceable in an up and down direction with respect to the rotation plate 31 on the upper surface side of the rotation plate 31 ( see fig4 ). the entire configuration of the flapper 3 is not greatly different from the conventionally known fuel filler port closing apparatus of the same type in size and in positional relationship of a rotation shaft 317 other than that the flapper 3 is divided to the rotation plate 31 and the seal plate 32 . this means that the flapper 3 of the present invention can be easily applied to the conventionally known fuel filler port closing apparatus of the same type . as illustrated in fig1 and 2 , the flapper 3 of the present example is configured by the rotation plate 31 , the seal plate 32 , and a packing holding plate 33 . the rotation plate 31 is a metal plate having a circular shape in the front and square shape in the back , formed with one - through hole 312 of square shape in plane view at the middle , and one connection hole 311 of circular shape in plane view at the front and back of the through - hole 312 . the rotation plate 31 has a pair of left and right arms 318 , 318 projecting out from both sides towards the back side , and the rotation shaft 317 passed through an axial - attachment plate 313 arranged at each arm 318 . the torsion coil spring 314 is freely fitted to the rotation shaft 317 , and is positionally - fixed by pressing a one end 316 against the inner surface of a closure unit 2 ( see fig4 ). other end 315 of the torsion coil spring 314 is pressed against a pushing projection 323 of the seal plate 32 projecting out from the through - hole 312 of the rotation plate 31 to directly push the seal plate 32 upwardly . the seal plate 32 is a resin plate having a circular shape in plan view for mounting the seal packing 325 having an outer diameter corresponding to the peripheral edge ( valve seat ) 212 of the opening 211 of the nozzle guide 21 ( see fig4 ). the seal plate 32 of the present example has the pushing projection 323 , having a square cross - section equal to the planar shape of the through - hole 312 , projecting out at the middle on the lower surface side . the seal plate 32 also has coupling projections 321 of circular cross - section equal to the planar shape of the coupling holes 311 projecting out from the position on the lower surface side corresponding to the coupling holes 311 with the pushing projection 323 in between . furthermore , the seal plate 32 has an assembly flange 326 projecting out on the upper surface side . the pushing projection 323 is used to push up the seal plate 32 by the torsion coil spring 314 . the coupling projections 321 are used to couple the rotation plate 31 and the seal plate 32 . the assembly flange 326 is used to assemble the packing holding plate 33 , a cover plate 331 ( fig1 and 2 ), and a roller 332 ( fig3 ). the seal plate 32 inserts the two coupling projections 321 to the two corresponding coupling holes 311 formed in the rotation plate 31 , respectively , and projects the coupling projections 321 out from the coupling holes 311 with the lower surface of the seal plate 32 surface contacted to the upper surface of the rotation plate 31 . the seal plate 32 can be coupled so as to be freely displaceable in the up and down direction with respect to the rotation plate 31 by arranging an engagement portion 322 at the portion of the coupling projection 321 at the position spaced apart from the lower surface of the rotation plate 31 . the engagement portion 322 is formed by melting and solidifying the distal end of the coupling projection 321 . the coupling projection 321 has the same cross - sectional shape ( circular cross - section ) as the coupling hole 311 , and thus the coupling hole 311 and the coupling projection 321 closely engage other than in the up and down direction with respect to the rotation plate 31 , and do not tilt in an abnormal direction . the seal plate 32 thus displaces only in the up and down direction with respect to the rotation plate 31 within a range in which the engagement portion 322 engages the lower surface of the rotation plate 31 , and fills the gap ฮด formed between the valve sheet and the seal packing 325 . in the flapper 3 of the present invention , the rotation plate 31 follows a motion of the seal plate 32 by the engagement of the coupling hole 311 the coupling projection 321 pushed up by the torsion coil spring 314 . specifically , the seal plate 32 projects the pushing projection 323 of square cross section out at the middle of the lower surface , and engages one end 315 of the torsion coil spring 314 in an engagement groove 324 extending in the left and right direction formed at the distal end . therefore , the rotation plate 31 functions only as a member for displacing the seal plate 32 that actually opens and closes the opening 211 of the nozzle guide along a circular arc path having the rotation shaft 317 as the center . the seal packing 325 is a circular ring elastic material made of rubber having a protrusion of triangular cross - section on the outer periphery . the seal packing 325 is sandwiched and held by a peripheral edge portion of the upper surface of the seal plate 32 and the lower surface of the packing holding plate 33 to be connected to the seal plate 32 . specifically , the seal packing 325 is mounted on two concentric supporting protrusions formed at the peripheral edge portion of the upper surface of the seal plate 32 . the cylindrical main body of the packing holding plate 33 is then fitted to the inner peripheral edge of the seal packing 325 , and the seal packing 325 is held with the lower surface of the radially and outwardly projecting flange of the holding plate 33 ( see fig5 and subsequent figures ). the holding plate 33 is coupled to the seal plate 32 by projecting the assembly flange 326 of the seal plate 32 out from an assembly hole 336 of the holding plate 33 , communicating an attachment hole 327 of the assembly flange 326 and coupling holes 334 of the holding plate 33 and inserting a coupling pin 333 . the holding plate 33 of the present example includes a metal cover plate 331 having a hill - shaped cross - section at the middle of the upper surface . the cover plate 331 prevents the fuel filling nozzle ( not shown ) from getting caught at the flapper 3 when pulling out the fuel filling nozzle ( not shown ) having the side surface contacted to the push - opened flapper 3 . the cover plate 331 protects the holding plate 33 made of resin . the cover plate 331 of the present example is fixed by communicating the attachment hole 327 of the assembly flange 326 , the coupling holes 334 and the attachment hole 335 of the holding plate 33 and inserting the coupling pin 333 . in order to prevent the fuel filling nozzle being pulled out from being caught at the flapper 3 , a roller 332 may be attached to the holding plate 33 in addition to the cover plate 331 , as illustrated in fig3 . the roller 332 of another example is attached to the holding plate 33 by communicating the assembly hole of the assembly flange 326 , the coupling hole 334 of the holding plate 33 , and a roller shaft hole ( not shown ), and inserting the coupling pin 333 . the cover plate 331 is positionally fixed by inserting the coupling pin 333 to an assembly piece ( not shown ) extended between the assembly flange 326 and the roller 332 . when a finger ( not shown ) is caught at the opening 211 of the nozzle guide by mistake , the roller 332 added to the cover plate 331 allows the finger to be easily removed . the overall configuration of the fuel filler port closing apparatus assembled with the flapper 3 of the present invention will be described hereinafter . as shown in fig4 , the fuel filler port closing apparatus of the present example is configured by a filler neck 1 , a closure unit 2 , and a cover unit 4 . the closure unit 2 is attached with the flapper 3 , which is pushed down by the fuel filling nozzle ( not shown ) inserted from the opening 44 of the filler neck of the cover unit 4 thereby opening the opening 211 of the nozzle guide . an upwardly rotatable cover 5 is attached to the cover unit 4 , where the opening 44 of the filler neck is opened and closed by the cover 5 . the cover unit 4 is also fixed with an attachment plate 56 attached with a rotation shaft 511 of a cover main body 51 . the filler neck 1 is a tubular member made of metal in which an opening at the upper end is wide and a connection port 11 , which is an opening at the lower end , narrows in accordance with a fuel feeding tube main body 8 to be connected . the filler neck 1 of the present example is a separate body from the fuel feeding tube main body 8 , but the end of the fuel feeding tube main body 8 may be enlarged to configure the filler neck 1 . the closure unit 2 is a resin block formed with the nozzle guide 21 for guiding the fuel filling nozzle ( not shown ) inserted from the opening 44 of the filler neck . the flapper 3 for opening and closing the opening 211 is integrally assembled to the closure unit 2 . a ring - shaped fit - in groove 221 is formed at a peripheral surface 22 of the closure unit 2 of the present example . a seal ring 222 is fitted into the ring - shaped fit - in groove 221 to ensure the sealability when the closure unit 2 is fitted into the filler neck 1 . the cover 5 opens and closes the opening 44 of the filler neck positioned at the upper stage of the opening 211 of the nozzle guide to prevent rainwater and dust from accumulating at the opening 211 of the nozzle guide . the cover main body 51 of the cover 5 of the present example is attached to the rotation shaft 511 supported by the attachment plate 56 . the cover main body 51 is biased in an opening direction by the torsion coil spring 512 , and maintains the opening 44 in the closed state by engaging a latch 531 provided on the cover main body 51 to the opening 44 of the filler neck . furthermore , the fuel filler port closing apparatus of the present example has a spacer 6 interposed between the closure unit 2 and the cover unit 4 . the spacer 6 is formed with an opening 61 for fixing the inserted nozzle . the opening 61 is one size smaller than the opening at the upper end of the nozzle guide 21 to engage and hold the inserted fuel filling nozzle . as illustrated in fig5 , according to the flapper 3 of the present invention , the seal plate 32 pushed up by the torsion coil spring 314 closes the opening 211 of the nozzle guide by evenly pressing the seal packing 325 against the peripheral edge ( valve seat ) 212 of the opening 211 in the peripheral direction . the seal packing 325 is pressed against the peripheral edge ( valve seat ) 212 of the opening 211 by the seal plate 32 . the seal plate 32 is directly pushed up by the one end 315 of the torsion coil spring 314 . as long as the seal packing 325 does not deflect , the seal packing 325 is evenly pressed against the peripheral edge ( valve seat ) 212 of the opening 211 in the peripheral direction even if the rotation plate 31 is tilted , whereby reliable sealability is achieved . however , when the seal packing 325 is deflected thereby forming a gap ฮด at one part , as illustrated in fig6 , the seal plate 32 is pushed up in a range where the engagement portion 322 of the coupling projection 321 engages the lower surface of the rotation plate 31 . as a result , the seal packing 325 is again evenly pressed against the peripheral edge ( valve seat ) 212 of the opening 211 of the nozzle guide , as illustrated in fig7 , whereby reliable sealability is achieved . the flapper 3 of the present invention allows the seal plate 32 holding the seal packing 325 to be displaceable only in the up and down direction with respect to the rotation plate 31 . therefore , even if the gap ฮด is formed , the sealability is not affected as the seal plate 32 tilts and deforms the seal packing 325 . the flapper 3 of the present invention thus suppresses the formation of the gap ฮด , and exhibits stable and reliable sealability . in order to assess an effect of the present invention , a sealability of a fuel filler port closing apparatus equipped with the flapper of the present invention and that of a fuel filler port closing apparatus equipped with a conventional flapper ( hereinafter referred to as a โ comparison โ) were measured . as the comparison , the fuel filler port closing apparatus having a flapper made of a single plate and a long bearing hole for a rotation shaft of the flapper was used . configuration of the present invention and the comparison was summarized in table 1 . the connection port 11 of the fuel filler port closing apparatuses of present invention and comparison were connected to a suction pump and were aspirated . the pressure ( kpa ) at which the amount of gas leak ( cc ) per minute reached to 3 cc / min were measured . the measurement was conducted plural times . the results were summarized in the table 2 . according to the present invention the pressure were around โ 10 kpa to โ 12 kpa and were stable . contrast to this , according to the comparison , the pressure were unstable and gas leaking began around โ 3 kpa to โ 5 kpa . | 1 |
a method and apparatus are described for tracking ambiguous states in a multi - node shared memory environment . additionally , based on the ambiguous states , requests are routed and nodes are probed to resolve any existing ambiguities and correctly route the request to the proper target node . enclosed is a mechanism for supporting the full mesi protocol so that multiple architectures can simultaneously be implemented in the same shared memory environment without creating problematic bus demand and unnecessary coherence complications resulting from shared status when an exclusive status is preferable . the enclosed mechanism also supports an exclusive state so any member node may make multiple modifications and need not report any modifications to the home node or any other node until another node requests access to the cache line . in the following description , for the purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the present invention . however , the present invention may be practiced without some of the specific detail provided therein . the invention is described herein primarily in terms of a requesting node initiating a request to a cache line in a distributed shared memory environment . the cache line is accessible by the requesting node , a home node that maintains permanent storage of the cache line memory and a responding node that may have a copy of the cache that is being targeted by the requesting node . the request is sent to an intermediate switch that tracks , by using a snoop filter , the status of each cache line accessible in the shared memory environment . the switch determines the status of the cache line of interest by looking at a table maintained in the snoop filter . wherever an ambiguity exists , i . e . the last known state for the cache line at a given node was a state that could have transitioned since last reported , the switch snoops the node to resolve the ambiguity and makes sure the request is properly routed . the invention , however , is not limited to this particular embodiment alone , nor is it limited to use in conjunction with any particular distributed shared memory environment . for example , the claimed method and apparatus may be used in conjunction with various system architectures such as ia32 or ia64 based architectures . it is contemplated that certain embodiments may be utilized wherein a request is received by an intermediate traffic switch , ambiguous states are resolved so as to properly handle the request and the request is properly routed . the present invention includes various operations that will be described below . the operations of the present invention may be performed by hardware components or may be embodied in machine - executable instructions , which may be used to cause a general - purpose or special - purpose processor or logic circuits programmed with the instructions to perform the steps . alternatively , the steps may be performed by a combination of hardware and software . the present invention may be provided as a computer program product , which may include a machine - readable medium having stored thereon instructions , which may be used to program a computer ( or other electronic devices ) to perform a process according to the present invention . the machine - readable medium may include , but is not limited to , floppy diskettes , optical disks , cd - roms , magneto - optical disks , roms , rams , eproms , eeproms , magnetic or optical cards , flash memory , or other type of media / machine - readable medium suitable for storing electronic instructions . moreover , the present invention may also be downloaded as a computer program product , wherein the program may be transferred from a remote computer ( e . g ., a server ) to a requesting computer ( e . g ., a client ) by way of data signals embodied in a carrier wave or other propagation medium via a communication link ( e . g ., a modem or network connection ). accordingly , herein , a carrier wave shall be regarded as comprising a machine - readable medium . brief initial definitions of terms used throughout this application are given below to provide a common reference point . a home node is a node where the contents of a cache line are permanently stored . a responding node is a node that has a copy of the contents of the cache line of question and whose cache line state is ambiguous at the time the switch receives a request concerning the cache line . a requesting node is a node that initiates a request concerning contents of a particular cache line or memory . an ambiguous state is a condition tracked in a snoop filter that identifies the last known state of a cache line at a member node . when the state last identified is one that could have changed at the member node , then the state is determined to be ambiguous . [ 0028 ] fig1 illustrates an exemplary operating environment 100 according to one embodiment of the invention . in this example , multiple nodes 110 and 120 share memory through a cache based coherence system . the nodes supported are processor nodes 110 each having a local memory 130 and input / output ( io ) nodes 120 . the cache based coherence system is collectively designated the scalability port ( sp ). in node environments with more than two nodes , the sp includes a system node controller ( snc ) chip 140 in each of the processor nodes 110 and an io hub ( ioh ) 150 chip in each of the io nodes 120 . the io node implements a cache , such as an l2 cache , so that it may participate in cache coherency . in addition to the snc 140 and the ioh 150 , the sp provides central control for its snoop architecture in a scalability port switch ( sps ) 160 that includes a snoop filter ( sf ) 170 to track the state of cache lines in all the caching nodes . the snc 140 interfaces with the processor bus 180 and the memory 130 on the processor node 110 and communicates cache line information to the sps 160 when the line is snooped for its current status . similarly , the ioh interfaces with the io bus and communicates information to the sps 160 when a line is snooped for its current status . the sp used to exemplify the invention supports various architectures . for instance , the processor nodes 110 could be based on either the ia32 or ia64 architecture . unlike prior snoop based cache coherence architectures , the sp supports the full mesi ( modified , exclusive , shared and invalid ) protocol as uniquely implemented by both architectures , i . e . the ia32 coherence protocol as well as the ia64 coherence protocol . one example of how these coherence protocols differ is when the cache line state is in a modified state when a read request is initiated . in the ia32 coherence protocol , once the read request is processed , the state of the cache line transitions from modified to an invalid state whereas in the ia64 coherence protocol , the cache line , once read , transitions from a modified state to a shared state . the support of multiple architectures allows for scalability and versatility in the future development of architectures and their corresponding protocols by allowing for the resident component of the sp , i . e , the snc for the processor node and the ioh for the io node , to be implemented to handle the new architecture and its corresponding protocol without having to redesign the central snoop controller , the sps . the central snoop controller switch performs coherence in order to resolve existing ambiguities occurring in the snoop filter . this central snoop coherence protocol is an invalidation protocol where any caching node or agent that intends to modify a cache line acquires an exclusive copy in its cache by invalidating copies at all the other caching agents . the coherence protocol assumes that the caching agents support some variant of the mesi protocol , where the possible states for a cache line are modified , exclusive , shared or invalid . the transitions between these states on various local and remote operations may be different for different types of caching agents . the coherence protocol provides flexibility in snoop responses such that the controller switch can support different types of state transitions . for example , a cache line in the modified state can transition to a shared state on a remote snoop or an invalid state on a remote snoop , and the snoop response can indicate this for appropriate state transitions at the switch and the requesting agent or source node . the snoop filter in the sps is organized as a tag cache that keeps information about the state of each cache line and a bit vector indicating the presence of the cache line at the various caching nodes . the bit vector , called the presence vector , has one bit per caching node in the system . if a caching agent at any node has a copy of a cache line , the corresponding bit in the presence vector for the cache line is set . a cache line may be in one of either invalid , shared , or exclusive states in the snoop filter . the snoop filter only tracks the tag and the cache line state at the indicated node and does not maintain a copy of the cache line . the snoop filter at the sps is inclusive of caches at all the caching agents . in other words , a caching agent cannot have a copy of a cache line that is not present in the snoop filter . if a line is evicted from the snoop filter , it must be evicted from the caching agents of all the nodes , i . e . marked in the presence vector . an illustration of the information maintained in the snoop filter 200 is demonstrated abstractly in fig2 . the contents of memory location 210 , maintained exclusively on the home node 220 , are copied and accessible in a cache 230 on the responding node 240 . the responding node snc ( or ioh ) 250 maintains a local presence vector 260 and status 270 for each cache line it utilizes . a snoop to the snc of node 240 may result in the snoop filter &# 39 ; s presence vector and status being updated . if a caching agent at any node has a copy of the cache line , the corresponding bit in the presence vector for that cache line is set . a cache line could be in the invalid , shared , or exclusive state in the snoop filter . in this case , the home node &# 39 ; s cache line is in a shared state ( s ), while the resource node 280 is in an invalid state ( i ) and the remote node &# 39 ; s cache line was last known to be in an exclusive state ( e ). according to the described embodiment , the cache line in the snoop filter will not indicate that a line is in a modified state , because a read to a cache line that has transitioned to a modified state will result in the modified line changing states in response to a snoop or read inquiry . the snoop filter is inclusive in that it does not contain the cache data , but only tracks the tag and the state of caches at all the caching agents . it is possible to divide the snoop filter into multiple scalability port switches or into multiple caches within one sps to provide sufficient snoop filter throughput and capacity to meet the system scalability requirement . in such cases , different snoop filters keep track of mutually exclusive sets of cache lines . a cache line is tracked at all times by only one snoop filter . the state of a cache line in the snoop filter is not always the same as the state in the caching agent &# 39 ; s snc . because of the distributed nature of the system , the state transitions at the caching agents and at the snoop filter are not always synchronized . in fact , some of the state transitions at the caching agents are not externally visible and therefore it is not possible to update the snoop filter with such transactions . for example , transitions from an exclusive state to a modified state may not be visible external to the caching agent . although other ambiguous situations may exist , the usefulness of the invention is illustrated by the scenario described with reference to fig2 where a cache line is in the exclusive state at the snoop filter . in this case , the snoop filter is aware only that the caching agent , i . e . the responding or remote node 240 , has exclusive access to the cache line as indicated by the presence vector in the snoop filter . however , the state of the cache line at the caching agent may have changed to any of the other mesi protocol states ( e . g ., modified , exclusive , shared or invalid ). if a request is made to the sps 290 for a cache line where ambiguity exists ( i . e . the state at the node having ownership may have changed ), the sps snoops the cache line , in this case the responding node &# 39 ; s cache line , indicated by the presence vector to get its current state and most recent corresponding data if necessitated . other snoop filter states exist as follows : an invalid state in the snoop filter is unambiguous , the cache line is not valid in any caching agent and all bits in the presence vector for the line in the snoop filter must be reset . an unset bit in the presence vector in the snoop filter for a cache line is unambiguous , the caching agents at the node indicated by the bit cannot have a valid copy of the cache line . a cache line in a shared state at the snoop filter is ambiguous and reflects that the cache line at the node indicated by the presence vector may be either in a shared or an invalid state . and finally , if a cache line is in an ambiguous exclusive state at the snoop filter , the cache line at the node indicated by the presence vector may be in any of the supported mesi states , specifically modified , exclusive , shared , or invalid . [ 0036 ] fig3 illustrates what happens in the example illustrated in fig2 where an ambiguity exists in the snoop filter . in this example , the requesting node 280 makes a read request for the most current updated contents of memory location 210 . the home node 220 is the node where the data is stored for memory aaaa and the responding node 240 is the node that currently has a modified copy of the data for memory location aaaa 230 . when the responding node 240 originally acquired its copy of the data for memory location aaaa 230 , the snoop filter 200 indicated that the responding node 240 had a copy by asserting its presence bit vector and additionally indicated that the responding node 240 was taking the copy in an exclusive state 291 . once the snoop filter identifies that the data resides on the responding node , it need not monitor the activity at the responding node until another request is made . additionally , the responding node may modify the data and does not need to report the modified data until a request is made by another node to access the data . in this case , the responding node modified the data from x to x + a on the cache line and consequently its local cache line state changed to modified 270 . [ 0037 ] fig3 demonstrates the sequence of events taken by the scalability port switch to resolve an ambiguity . in step 310 , the requesting node 280 submits a read request for the contents associated with memory location aaaa . at step 320 , the sps 290 determines which node last had ownership of the cache line associated with memory location aaaa . the sps makes this determination by accessing its snoop filter and identifying which node last had exclusive ownership of the aaaa cache line . in step 330 , the sps identifies that responding node 240 last had ownership . the sps , in step 340 , then looks at the status of the aaaa cache line last reported and determines that it is in an ambiguous state as the last known state was an exclusive state . because the exclusive state is known to be ambiguous , the sps must snoop the responding node for its current status as it may have changed due to an internal modification to the responding node &# 39 ; s copy contained on its cache line . fig4 - 5 demonstrate a sequence where the responding node 400 has not modified the contents of the cache line since taking control of the cache line in an exclusive state . fig4 demonstrates the status of the nodes while fig5 is a flow diagram showing the steps taken in the shared memory environment . at step 500 , the requesting node 410 submits a read request for the contents of memory aaaa to the sps 420 . in step 510 , the sps 420 looks at its snoop filter &# 39 ; s presence vector 430 and realizes that the responding node last had control of the cache line in question 440 and had access to the line in an ambiguous exclusive state 450 . because the cache line is in an ambiguous state , the sps 420 takes two actions substantially simultaneously . at step 520 , the sps 420 a ) snoops the responding node 400 to determine if the data has been modified while also simultaneously b ) doing a speculative read on the home node 460 . in this case , the responding node 400 has not altered the data ( still in an exclusive state , not modified 470 ) and , as a consequence of the snoop by the sps , the status of the cache line at the responding node changes to a shared state as the cache line data is being accessed by another node . consequently , the responding node 400 , at step 530 responds to the sps that the state has changed to a shared state . at step 540 , because the responding node has not modified the data and has issued a state change to shared without having modified the data , the sps confirms a memory read to the home node so the best source of the data may be retrieved for the requesting node 410 . at step 550 , the data is written from the home node through the sps to the requesting node . in this sample read transaction , when the requesting node has received a copy of the contents , it &# 39 ; s status at the snoop filter changes to a shared state . the requesting node may then determine that it wants the cache line in an exclusive state and may submit commands to invalidate or prevent modification of the contents of the cache line at other nodes . fig6 - 7 demonstrate a sequence where the responding node 400 has modified the contents of the cache line since taking control of the cache line in an exclusive state . fig6 demonstrates the status of the nodes while fig7 is a flow diagram showing the steps taken in the shared memory environment . at step 700 , the requesting node 610 submits a read request for the contents of memory aaaa to the sps 620 . in step 710 , the sps 620 looks at its snoop filter &# 39 ; s presence vector 630 and realizes that the responding node last had control of the cache line in question 640 and had access to the line in an ambiguous exclusive state 650 . because the cache line is in an ambiguous state , the sps 620 takes two actions substantially simultaneously . at step 720 , the sps 620 a ) snoops the responding node 600 to determine if the data has been modified while also simultaneously b ) doing a speculative read on the home node 660 . in this case , the responding node 600 has modified the data and , as a consequence of the snoop by the sps , the status of the cache line at the responding node changes from a modified state to a shared state as the cache line data is being accessed by another node ( in another case , the state may change from modified to invalid based on a different type of architecture ) consequently , the responding node 600 , at step 730 responds to the sps that the state is changing to a shared state and also provides an instruction to the sps to write the modified data to the home node , known as an implicit - writeback , while providing a copy of the modified data . at step 740 , because the responding node has modified the data and has issued a state change to shared with instructions concerning the modified the data , the sps communicates the modified data to the home node while substantially simultaneously copying the data in step 750 to the requesting node node 410 in response to its read request . in this sample read transaction , when the home node has received the updated copy of the contents , it submits in step 750 a completion response to the sps that directs the completion response to the requesting node . the requesting node may then determine that it wants the cache line in an exclusive state and may submit commands to invalidate or prevent modification of the contents of the cache line at other nodes . the invention has been described above primarily in terms of intel &# 39 ; s scalability port architecture . the snoop filter mechanism for supporting the full mesi protocol as embodied by the claims is not limited to use in a distributed shared memory environment , nor is it limited to use in conjunction with intel &# 39 ; s scalability port . for instance , the claimed invention might be utilized in existing or new snoop based architectures . the foregoing description has discussed the snoop filter mechanism as being part of a hardware implemented architecture . it is understood , however , that the invention need not be limited to such a specific application . for example , in certain embodiments the snoop filter mechanism could be implemented as programmable code to cooperate the activities of multiple memories located in a distributed fashion . numerous other embodiments that are limited only by the scope and language of the claims are contemplated as would be obvious to someone possessing ordinary skill in the art and having the benefit of this disclosure . | 6 |
the detailed description and technical content of the present invention with reference to the drawings , which merely provides reference and illustration without having an intention to limit the present invention , illustrates as following . please refer to fig2 . fig2 shows a first embodiment of a resistive device according to the present invention . the resistive device 20 mainly includes a flexible substrate 100 , a resistive layer 110 located on the flexible substrate 100 , an electrode layer 120 located on the resistive layer 110 opposed to the flexible substrate 100 , and an adhesive layer 130 between the resistive layer 110 and the flexible substrate 100 . the resistive layer 110 is made of ni โ cu alloy , ni โ cr alloy , f โ cr alloy , cu โ mn alloy , cu โ mn โ sn alloy , ni โ cr โ al alloy , ni โ cr โ fe alloy , and so on . in the embodiment , the resistive layer 110 is a sheet of ni โ cu alloy with a thickness of 50 ห 300 ฮผm . the resistive layer 110 is a whole rectangular sheet or may form special shape of opening or groove thereon to have a predetermined resistance value . the flexible substrate 100 is plastic material , such as polyimide ( pi ), polyethylene terephthalate ( pet ), bismaleimide - triazine resin ( bt resin ), having preferable chemical stability with a thickness of 12 ห 45 ฮผm . the adhesive layer 130 may be material of epoxy and acrylic resin etc . with a thickness of 13 ห 102 ฮผm . also , the adhesive layer 130 may be a heat dissipation adhesive with a property of heat dissipation . the electrode layer 120 includes a first electrode part 121 and a second electrode part 122 located at two opposite sides of a lower surface of the resistive layer 110 . the first electrode part 121 and a second electrode part 122 have material of copper or copper alloy . in addition , the resistive device 20 of the embodiment may further include a first outer welding layer 126 covering the first electrode part 121 and a second outer welding layer 127 covering the second electrode part 122 . the first outer welding layer 126 and the second outer welding layer 127 may be used to connect other external components . the first outer welding layer 126 and the second outer welding layer 127 may include a single welding layer or welding multi - layer such as ni layer and sn layer formed by electroplating or sputtering process . in order to prevent the resistive layer 110 from contamination or oxidation , a first protective layer 140 may cover on the lower surface of the resistive layer 110 between the first electrode part 121 and the second electrode part 122 . furthermore , the resistive device 20 of the embodiment may further cover a second protective layer 150 on an upper surface of the flexible substrate 100 . the first protective layer 140 and the second protective layer 150 may have material of epoxy and acrylic resin . in the embodiment , there is not provided a ceramic substrate that is hard to work in the resistive deviceso that the resistive device can be easily further reduced the size . in addition , because both the flexible substrate 100 and the adhesive layer 130 are flexible , the resistive device 20 may have preferable flexibility , and thus the use of the resistive device is wide - spreading . also , the flexible substrate 100 may be easily made thinner because of good workability in such a manner that the resistive device 20 of the present invention has lower thermal impedance . the adhesive layer 130 of the present invention may have preferable heat conductivity due to without using glass fiber . please refer to fig3 . fig3 shows a second embodiment of a resistive device according to the present invention . the difference between the second embodiment and the first embodiment is that the resistive device 30 of the second embodiment may further include a metal layer 160 sandwiched between the flexible substrate 100 and the second protective layer 150 . the effect of heat dissipation of the resistive device 30 can be enhanced by preferable heat conductivity of the metal layer 160 . in this embodiment , the metal layer 160 may preferably have a thickness of 8 ห 105 ฮผm , further preferably have a thickness of 8 ห 70 ฮผm , and particularly preferably have a thickness of 8 ห 35 ฮผm of copper , copper alloy or other metal material with preferable heat dissipation . please refer to fig4 . fig4 shows a third embodiment of a resistive device 40 according to the present invention . the difference between the third embodiment and the second embodiment is that the resistive device 40 of the third embodiment may further include a metal layer 160 having a first metal sheet 162 and a second metal sheet 164 separated with each other , and sandwiched between the flexible substrate 100 and the second protective layer 150 . there is no limitation for the shape of the first metal sheet 162 and the second metal sheet 164 , and the shape may be directed according to the required heat dissipation . in this embodiment , the second protective layer 150 covers the first metal sheet 162 and the second metal sheet 164 , and fills into an area between the first metal sheet 162 and the second metal sheet 164 . in another embodiment , the second protective layer 150 may only fill into the area between the first metal sheet 162 and the second metal sheet 164 without covering the first metal sheet 162 and the second metal sheet 164 . in the embodiment , the first metal sheet 162 and the second metal sheet 164 may have material of copper or copper alloy with a preferable thickness of 8 ห 105 ฮผm , a further preferable thickness of 8 ห 70 ฮผm and a particular preferable thickness of 8 ห 35 ฮผm . please refer to fig5 . fig5 shows the fourth embodiment of a resistive device according to the present invention . the difference between the fourth embodiment and the first embodiment is that the resistive device 50 of the fourth embodiment has no adhesive layer for adhering the resistive layer 110 on the lower surface of the flexible substrate 100 . the resistive layer 110 is directly attached to the flexible substrate 100 . a method for manufacturing a resistive device of the invention is described as following . please refer to fig6 ( a )ห fig . 6 ( g ). at first , as shown in fig6 ( a ) , a flexible substrate 100 and an adhesive layer 130 are provided , wherein the flexible substrate 100 has a metal layer 160 attached on an upper surface thereof , and the adhesive layer 130 may attach on a release film 170 ; the release film 170 can be removed after the adhesive layer 130 is attached on the flexible substrate 100 . next , as shown in fig6 ( b ) , the flexible substrate 100 is attached on the resistive layer 110 with the adhesive layer 130 , and the flexible substrate 100 and the resistive layer 110 adhere close with the adhesive layer 130 by thermal press to form a plate assembly , as shown in fig6 ( c ) . next , as shown in fig6 ( d ) , the resistive layer 110 is etched to form a recess 111 for adjusting the resistance value of the resistive layer 110 . also , the metal layer 160 is etched to form a groove 161 , and thus a first metal sheet 162 and a second metal sheet 164 separated with each other are formed . next , as shown in fig6 ( e ) , a first electrode part 121 and a second electrode part 122 having electrical conductive function located at two opposite sides of a lower surface of the resistive layer 110 are formed by electroplating , press fitting or welding process . next , as shown in fig6 ( f ) , a first protective layer 140 is formed on the lower surface of the resistive layer 110 between the first electrode part 121 and the second electrode part 122 to prevent the resistive layer 110 from contamination or oxidation . also , a second protective layer 150 is formed on an upper surface of the flexible substrate 100 to provide enough strength for supporting the resistive device . at last , as shown in fig6 ( g ) , a first outer welding layer 126 covering the first electrode part 121 and a second outer welding layer 127 covering the second electrode part 122 are formed to increase the adhesion of the first electrode part 121 and the second electrode part 122 , and to increase the bonding strength between the resistive device and pcb . it should be noted , with the above manufacturing method , the flexible substrate 100 having a metal layer 160 on an upper surface thereof is provided in the beginning . in the another embodiment , the above manufacturing method may proceed by only the remaining flexible substrate 100 . for example , the embodiment of the method may manufacture the resistive device of fig3 or fig4 with the metal layer 160 . the embodiment of the method may manufacture the resistive device of fig2 without the metal layer 160 . as shown in fig7 ( a )ห fig . 7 ( e ), which illustrate another method for manufacturing a resistive device of the present invention . as shown in fig7 ( a ) , a flexible substrate 100 and a resistive layer 110 directly attached with each other are provided , wherein there is no adhesive layer between the flexible substrate 100 and a resistive layer 110 for adhering them . in one embodiment , the flexible substrate 100 is directly formed on the resistive layer 110 , for example , a liquid soft material is coated or printed on the resistive layer 110 , and then the flexible substrate 100 is formed and attached on the resistive layer 110 by curing the liquid soft material . in another embodiment , the resistive layer 110 may be formed on the flexible substrate 100 by film - forming method , for example , the resistive layer 110 is formed on the flexible substrate 100 by thick film or thin film process . next , as shown in fig7 ( b ) , a first electrode part 121 and a second electrode part 122 having electrical conductive function located at two opposite sides of a lower surface of the resistive layer 110 are formed by electroplating , press fitting or welding process . also , in this embodiment , a metal layer 160 is further formed on the flexible substrate 100 . it should be noted , the metal layer 160 is used for increasing the heat dissipation of the resistive device , and it can be removed if need . as shown in fig7 ( c ) , the resistive layer 110 is etched to form a recess 111 for adjusting the resistance value of the resistive layer 110 . also , the metal layer 160 is etched to form a groove 161 , and thus a first metal sheet 162 and a second metal sheet 164 separated with each other are formed . as shown in fig7 ( d ) , a first protective layer 140 is formed on the lower surface of the resistive layer 110 between the first electrode part 121 and the second electrode part 122 to prevent the resistive layer 110 from contamination or oxidation . also , a second protective layer 150 is formed on an upper surface of the flexible substrate 100 to provide enough strength for supporting the resistive device . as shown in fig7 ( e ) , a first outer welding layer 126 covering the first electrode part 121 and a second outer welding layer 127 covering the second electrode part 122 are formed to increase the adhesion of the first electrode part 121 and the second electrode part 122 , and to increase the bonding strength between the resistive device and pcb . the described embodiments are preferred embodiments of the present invention . however , this is not intended to limit the scope of the invention . the equivalent changes and modifications may be made in accordance with the claims of the invention without departing from the scope of the invention . | 1 |
a progressive forging machine 10 diagrammatically illustrated in fig1 includes a die breast 11 on which are mounted dies and a slide or ram 12 on which are mounted tools or punches . the dies and punches are sometimes referred to as tooling . reference may be made to aforementioned u . s . pat . no . 4 , 898 , 017 for a description of a similar type of forging machine . the die breast 11 and slide 12 each have a plurality of cooperating work stations b1 through b6 and s1 through s6 , respectively , indicated at their centers . the die breast 11 is rigid with respect to the machine frame designated 13 . the slide 12 riding on liners or bearings reciprocates horizontally towards and away from the die breast to progressively forge workpieces that are transferred to successive work stations b1 - b6 on the die breast 11 . fig2 illustrates a typical work station b on the die breast 11 in section . a cradle block 16 is rigidly bolted down on a horizontal surface 15 of the die breast 11 with bolts 17 . an upper surface 18 of the cradle block is a concave cylindrical pocket formed by a precision machined area . the imaginary axis of the surface 18 is coincident with the center of the associated work station b and , consequently , is horizontal and is parallel to the direction of slide movement . the cradle block 16 is adapted to support a die cassette 19 which is formed as a bolted assembly of a main body 21 and a plate 22 . the main body 21 is precision formed with a cylindrical bore 23 and a cylindrical outer surface 24 concentric with the bore . the radius of the cylindrical cassette body surface 24 is equal to the radius of the cradle surface 18 so that the axis of the bore 23 is situated at and represents the true center of the respective work center b . a tool case or a tool can be locked in the bore 23 by a transverse bar 26 bolted to the body 21 . the plate 22 is bolted to a rear face of the body 21 . this plate 22 includes a bore aligned with the body bore 23 . the plate 22 extends below the body 21 and includes a forward facing side with a chamfer surface 27 at its lower end and an undercut surface 28 adjacent the body 21 inclined forwardly and downwardly . at each station b1 - b6 underneath the respective cradle 16 , a rocker arm 36 pivots on a shaft 37 carried in blocks 38 retained on the bolster by bolts 39 . each rocker arm 36 is operated by an associated hydraulic actuator 41 having a rod 42 contacting one end 43 of the arm . an opposite end 44 of the arm 36 has a surface 46 engageable with the undercut surface 28 of the plate 22 . it will be understood that a separate cradle block 16 , rocker arm 36 and actuator 41 is provided for each work station b1 - b6 . a z - shaped bracket 47 is bolted to the top of the plate 22 for enabling the die cassette assembly 19 to be manipulated by an automatic handling device . referring now to fig4 a , b and 6b , a punch holder mounting plate assembly 51 forms a cassette for the tools or punches carried on the slide 12 . the mounting plate assembly or cassette 51 , as is typical for each of the working stations s1 - s6 , has the form of an inverted l in side view and is comprised of a vertical plate 52 and a bracket 53 bolted to the vertical plate . a punch holder 54 is typically bolted to the plate 52 . the lower end of the plate 52 , ( fig5 a at the station s5 ) has a profile of a circular arc 56 and a central vertical slot 57 . the circular end 56 is received in a cradle block 58 bolted to a machined face block 59 carried on the slide 12 . the bracket 53 has a tapered profile at 62 and a central slot 63 on its lower side that includes an internal vertical clamping shoulder 61 revealed at the station s4 in fig5 a where the bracket is shown with the plate 52 removed . the bracket 53 is received between a respective pair of gage blocks 64 mounted by bolts on the top of the face block 59 against dowel pins 66 pressed into the slide mounted block 59 . the mounting plate assembly or cassette 51 is retained on the slide 12 by a pair of clamp bars 68 , 69 disposed in the respective slots 57 and 63 . spring packs 72 bias the bars 68 , 69 to a clamping position , in a direction away from the die breast 11 , and hydraulic pistons 73 in chambers 74 are actuated to override the clamping force of the springs 72 and release the assembly 51 . the l - shaped configuration of the assembly 51 and a recess 76 in an associated component 77 affords a space for a knockout 78 or other instrumentality associated with a tool . a plate 65 suitably attached to the top of the cassette assembly 51 enables the assembly to be handled conveniently for example , by an overhead robotic arm . with reference to fig7 in accordance with the invention , the tool supporting structures on the bolster or die breast 11 and slide 12 in the form of the cassettes 19 , 51 in the disclosed embodiment , at each work station , are mutually precisely located relative to one another so that the axes of their centers are coincident to the extent that measurement and precision adjustment permit . the alignment can be accomplished by positioning a fixture 79 in a die cassette 19 mounted and clamped on the cradle 16 of a particular work station . with the slide 12 in an advanced position and a punch cassette 51 coarsely located on its cradle 58 , measurements can be made between the fixture 79 and a punch holder 54 on the punch cassette to determine any eccentricity existing between the axis of the fixture 79 , and therefore the die cassette bore 23 , and the center on the punch cassette represented by the bore in the punch or tool holder 54 . a gage block 82 is precision ground in its vertical dimension and located under the cradle block 58 to vertically adjust the cradle block so that the axis of its tool holder 54 is at the same vertical location as is the bore 23 of the die cassette . the gage block 82 is bolted to the cradle block 58 and those elements are bolted to the slide mounted face block 59 . the pair of gage blocks 64 that straddle the bracket 53 at the upper end of the tool cassette 51 are precision ground in their horizontal width to adjust and thereby locate the cassette so that the center of its tool holder 54 is horizontally precisely aligned with the center of the die cassette bore 23 . each gage block 64 rests horizontally against dowel pins 66 press fitted into the top of the face plate 59 and are bolted to this top surface . the surfaces 84 of the gage blocks 64 in contact with the cassettes are in vertical planes parallel to the slide motion and opposite surfaces rest against the dowel pins 66 pressed into the block 59 . the actual work station center on the punch holder 51 is roughly midway between the cradle block 58 and the gage blocks 64 . the arcuate shape of the cradle surface , designated 60 , which is cylindrical and has an axis parallel to slide movement allows the cassette to pivot about this surface for horizontal adjustment of the center without significantly affecting the vertical position of the center . to make initial measurements , slightly undersize gage blocks can be used at the top face plate block 59 . the measurement and alignment technique is done manually at each work station s1 - s6 when the machine is originally manufactured . particularly on large machines , this technique produces a degree of alignment between the die and punch work stations b1 - b6 and s1 - s6 that has not been practically achieved in earlier constructions . the cassettes 19 and 51 are adapted to be manipulated automatically with a robotic tool changer similar to that shown in aforementioned u . s . pat . no . 4 , 304 , 041 . an overhead arm of the automatic tool changer can be arranged to grip one or simultaneously both cassettes 19 , 51 at any particular work station . the die cassette 19 is gripped at the z - shaped plate 47 and the punch cassette is gripped at the plate 65 . the automatic tool changer is positioned over such work station and the cassettes 19 , 51 are lowered towards their respective positions on the bolster 11 and slide 12 . at this time , the surface 46 of the rocker arm 36 is retracted by lowering the rod 42 and adjacent end 43 of the arm through control of the actuator 41 by signals from the machine controller . in this position , the gripping surface 46 is nearly vertical and there is sufficient clearance between it and the bolster to allow passage therebetween of the lower end of the plate 22 . the chamfer surface 27 on the lower end of the plate 22 and a chamfer 86 on a bolster plate 87 facilitate registration of the die cassette into the receiving zone formed by the cradle surface 18 in the lateral direction and by the bolster plate 87 and the clamp arm end 43 in the axial or slide direction . the concave surface 18 of the cradle block 16 mating with the convex surface of the main body 21 guides the die cassette 19 as needed in directions lateral of the direction of slide movement . thus , the die cassette 19 and its receiving zone are mutually self - aligning . with the cassette 19 resting on the cradle block 16 , the master controller for the machine causes the actuator 41 to extend the rod 42 upwardly to rock the arm 36 . the arm surface 46 , because it reacts against the inclined or undercut surface 28 which extends in both horizontal and vertical directions , causes the cassette 19 to be tightly drawn against the breast plate 87 and onto the cradle 16 . the cassette 19 is , consequently , accurately located in the same position on the cradle 16 each time it is installed . at the same time as the automatically controlled tool changer is lowering the die cassette 19 into place , it can lower the punch cassette 51 into position on the slide . the lower end of the plate 52 is tapered at 91 , as viewed from the side in fig4 allow self - alignment to the annular grooves 93 , in the respective clamp bar 68 , in both axial directions parallel to the slide motion . at the lower end of the plate 52 , the cassette 51 is self - aligning to the clamp bar 68 by virtue of a rounded throat opening of the slot 57 and the round cross - section of the bar . when fully lowered , the convex surface 56 on the lower end of the plate 52 is self - aligning with the concave surface 60 of the cradle 58 . at the upper end of the punch cassette 51 , the bracket leg 61 is self - aligning to the gage blocks 64 by virtue of its tapered profile 62 enabling this part of the cassette to align itself laterally between the opposed set of gage blocks as it is lowered into position . it will be understood that surfaces 84 of the gage blocks 64 which laterally confine the cassette 51 lie in vertical planes parallel to the axis of slide motion . as previously described , the gage blocks 64 , cooperating with the cradle block 58 , which is vertically gaged by the block 82 , constrain the cassette into a position that is precision aligned with the die cassette 19 . it will be understood by those skilled in the art that ordinarily a die cassette will have its bore 23 supporting a tool holder which in turn will support an actual die . however , there may be occasion in the making of specific parts that it is desirable to make a die larger than would ordinarily be used with a machine of a given center - to - center distance between stations . in such a case , the main body 21 of the die cassette can be used as a tool holder itself . still further , where a part being made is relatively oversize , it is possible to make a special die cassette at a particular station with oversize dimensions in a lateral direction , but keeping the geometry of the cylindrical surface 24 . in such a case , adjacent die cassettes would be correspondingly reduced in size . if necessary , similar techniques can be used on the tool cassettes on the slide . it should be evident that this disclosure is by way of example and that various changes may be made by adding , modifying or eliminating details without departing from the fair scope of the teaching contained in this disclosure . the invention is therefore not limited to particular details of this disclosure except to the extent that the following claims are necessarily so limited . | 1 |
in fig5 , a pump 10 is shown very schematically , which pump is configured as a radial impeller pump . in the pump chamber , said pump comprises an impeller 11 which draws a fluid through a central suction structure and which discharges said fluid in radial direction into the pump chamber . from there , the fluid can exit through an outlet after a few circulations within the pump chamber . that is known from the prior art . the impeller 11 is specifically configured for said pump , as can be seen from the fig1 to 4 . in the oblique view according to fig1 , the impeller 11 comprises an upper cover plate 13 and a lower cover plate 20 . the upper cover plate 13 comprises a central suction opening 14 . concentrically thereto , the lower cover plate 20 comprises an axle seat 21 by means of which the impeller 11 is plugged onto an axle of the pump motor . the axle seat 21 configured as rounded - off elevation also deflects the drawn in fluid radially outwards . as can be seen from fig1 , the upper face of the upper cover plate 13 is flat except for a slightly thicker edge of the suction opening 14 , as can also be seen in particular from fig4 . the same is true also for the bottom face of the lower cover plate 20 , but in both cases this is not obligatory . likewise , however , a bottom face 16 of the upper cover plate 13 is flat or planar , in particular plane - parallel to the upper face . except for a central region with the axle seat 21 , this is also true for an upper face 23 of the lower cover plate 20 . in particular the bottom face 16 and the upper face 23 are again plane - parallel to one another except for the region of the axle seat 21 . the impeller 11 comprises five blades 27 , the shape or course of which can especially be seen from fig2 and 3 . the blades 27 are in each case configured or shaped identically . an outer edge 28 a of the blades 27 corresponds to an outer edge 18 of the upper cover plate 13 and an outer edge 24 of the lower cover plate 20 . the outer edge 28 a of the blades 27 extends significantly inclined or oblique , see in particular fig1 and 4 . here , the initial angle towards the lower cover plate 20 is approximately 20 ยฐ, in the upper region towards the upper cover plate 13 the angle is greater , namely approximately 40 ยฐ. in the longitudinal course of the blades 27 radially inwards , the inclination decreases more and more , down towards an inner edge 28 b , where said blades extend almost perpendicular relative to the cover plates 13 and 20 and parallel to the central longitudinal axis of the pump or to the rotation axis of the impeller 11 . the inner edge 28 b of the blades 27 is located approximately at the point where the slowly increasing axle seat 21 starts . furthermore , the blades 27 are arranged at an equal distance to one another or are distributed equally , respectively . the side view according to fig4 shows that the inclination steadily increases at the outer edge 28 a of the blades 27 , i . e . strictly monotonously . it can be seen from the plane view according to fig3 that a curvature of the blades 27 also increases from outwards to inwards , although only slightly . per se , such an impeller 11 could be designed from multiple parts during the production in any manner , with blades changing in terms of their inclination in the longitudinal course thereof , since a production by means of synthetic material injection molding is very variable , for example . in particular when a separate upper cover plate is applied to the blades , for example by adhesive bonding , the upper cover plate and the lower cover plate could also be configured in a curved manner , as known from other impellers of similar pumps , see for example u . s . pat . no . 8 , 245 , 718 b2 . however , in order to allow a one - piece configuration and production and to avoid elaborate , expensive and susceptible curved pushers , at least the bottom face 16 of the upper cover plate 13 and the upper face 23 of the lower cover plate 20 have to be plane - parallel to one another or expand from inwards to outwards in a continuous manner , namely in each case in the radial direction . thus , they cannot be curved as known from the aforementioned prior art . in the case of an impeller 11 configured that way , a linear pusher 30 can be used for production as shown in the figures , or five such linear pushers are used , respectively . the push direction s is illustrated . a mold side 31 facing rightwards in the fig3 and 4 is configured exactly the way as to correspond to the side of the blades 27 facing the lower cover plate 20 and in the rotation direction of fig3 . a blade region 33 on the mold side 31 corresponds exactly to said side of the blade 27 . adjacent thereto , there is an inner region 34 which towards the axle seat 21 so to say defines in each case the inner edges 28 b of the blades 27 . the axle seat 21 per se is produced by means of another pusher , which in fig3 is driven into the drawing plane . another blade region 33 โฒ on the linear pusher 30 forms , on the blade 27 adjacent in the circumferential direction , the side of the blade 27 facing in the counter - rotation direction , i . e . the side facing the afore described blade . by means of the impeller 11 having the blades differently inclined in the longitudinal course thereof , very good pumping characteristics of the impeller can be achieved . a desired and very advantageous one - piece production is achieved by means of the plane - parallel cover plates or the plane - parallel faces of the cover plates facing to one another , and by means of the illustrated and described linear pushers . even though the molding tool for the impeller is somewhat more elaborate , the production method per se by means of synthetic material injection molding can be controlled in a good manner and results in good properties of the impeller . it is still much more easy to realize than with curved pushers . | 5 |
a prior art electric motor control 20 is illustrated in fig1 . as shown , a pair of redundant stators 22 and 24 are provided to drive a shaft 26 . the stators include three coils associated with three phases of electrical power , and control coils 27 . the buck regulator comprises of a power stage 32 , a controller 30 and inductor 27 . the buck inductor 27 utilizes a control coil of a regulated permanent magnet machine . the buck regulators control the dc bus current to the inverters 28 . in this prior art system , a signal to shut down one of the faulty electric motors 22 or 24 would come from 34 , into the buck regulators . this is undesirable , since the control coil is sized to handle full motor power to achieve full torque control and not just for protection . the electromagnetic decoupling in dual redundant arrangement can be achieved by designing the motor with considerably smaller size control winding . the prior art does not includes a transient suppressor ( a power resistor connected via power switch to the dc bus ) that would be required during fuel pump fast shutdown to keep dc bus voltage within specification limits , when the motor operates in a regenerative mode . this resulted in undesirably heavy components required by the control for the aircraft fuel pump . fig2 is a schematic of an improved system 39 . in system 39 , a prime mover 40 such as a gas turbine engine , is driven to rotate and generates power by an electric power generating system 42 . as known , the power generating system 42 supplies power over a dc bus 43 to customer load 44 . the customer load 44 may be any number of components on an aircraft . in addition , an accessory bus 45 supplies power to a motor controller 46 , which controls a fuel pump 48 . in this basic architecture , the bus 45 may also supply power to a plurality of accessories which are associated with the gas turbine engine , such as a water pump , a fuel pump , and a lubricant pump . a shutdown switch 50 supplies a shutdown signal to the motor controller 46 . when a shutdown signal is received at the motor controller 46 , a signal 52 is sent back to the electric power generating system 42 . fig3 shows the motor controller 46 . as shown , the fuel pump 48 is provided with a rotor 55 . the plurality of stator windings 54 receive voltage through an inverter 56 . a dc power source 58 , which , in a disclosed embodiment , is the accessory bus 45 , supplies the power through the inverter 56 to control the current associated with the three phase coils 54 , to in turn drive the rotor 55 . a control coil 60 is also associated with the stator for the electric motor . a coil control switch 62 , which may be a mosfet , receives a shutdown signal such as shown at 68 . a pulse width modulator 66 receives the shutdown signal from 68 , and sends a signal through a gate drive 64 to control the switch 62 . when the switch 62 is opened , then power no longer flows to the control coil 60 , and the motor is no longer driven . in the dual redundant arrangement the control coil 60 would electromagnetically decouple this motor from the second one sharing the same rotor shaft . the signal at 68 may be a signal of a potential problem , such as an over - current , an over - voltage , or some other type of emergency such as a fire or fuel leak . as is clear from the fig3 schematic , the switch 62 , which functions as a shut off switch , is positioned intermediate the inverter 56 and the control coil 60 , and upstream of the control coil 60 , and downstream of the inverter 56 , relative to power flow . the motor control utilizes a current - mode bidirectional voltage source inverter 56 . a position feedback signal 70 is sent to a speed detector 72 , a coordinate transformation unit 202 and a space vector modulator 88 . the coordinate transformation unit 202 derives direct ( id_fdbk ) and quadrature ( iq - fdbk ) components of stator current from current transducers 201 . a comparator 74 , which also receives a reference speed signal ( spd_ref ), produces a speed error signal that is processed by a proportional - integral regulator ( pi ) 76 to obtain torque producing reference ( iq_ref ). a shutdown signal 78 is provided on this line , and may be driven to open when the signal is provided at 68 . at this point , the desired current iq_ref would become zero at the comparator 80 . a look - up table 84 produces a direct current reference ( id - ref ) as a function of speed . the motor &# 39 ; s d and q current loops are closed using comparators 86 and 80 , and pi regulators 203 and 204 respectively . the outputs of the current loop pi regulators ( vd_ref and vq_ref ) would then go to a space vector modulator 88 , which would in turn control the gate drives 90 to control current in the stator windings 54 . in addition , when there is a zero signal such as a shutdown signal from the switch 78 , a differentiator 82 supplies a feed forward signal 52 back to a voltage regulator for the power generating system . this will be explained with regard to fig4 . an electric power generating system 42 is shown in fig4 . the prime mover 40 , which may be a gas turbine engine , is associated with a generator 213 . generator 213 can be a flux regulated permanent magnet machine with control coil 92 . generator 213 supplies power through a rectifier 43 , dc filter is comprised of a capacitor 206 , and to a dc bus 43 , and the accessory bus 45 . power quality / emi filter 212 is used to ensure that power quality provided to the customer load meets specification requirements . the voltage regulation on dc bus 43 is achieved by controlling current in the control winding 92 in response to the feedback voltage ( vdc_fdbk ) obtained from the voltage transducer 207 , and includes voltage and current loops . the voltage loop includes a comparator 102 and a pi regulator 211 . the comparator 102 derives a voltage error between reference ( vdc_ref ) and a feedback signal ( vdc_fdbk ). in addition , the comparator 102 includes a third input to accommodate a feedforward signal from the motor - pump controller 48 to maintain power quality on dc bus during large transients associated with the motor - pump , such as fast shutdown . the pi regulator 211 produces a current reference signal ( icc_ref ) in response to the output of comparator 102 . the current loop includes an h - bridge 94 , a current transducer 214 , a comparator 100 , a pi regulator 209 , a pwm modulator 210 , and a gate drive 96 a comparator 100 derives a current error signal between current reference ( icc_ref ) and feedback signal ( icc_ref ) obtained form the current transducer 208 . this signal is processed by a pi regulator 209 to derive a duty cycle for the pwm modulator 210 that controls the gate drive 96 . the h - bridge 94 controls current in the control coil 92 in response to the current reference icc_ref . when the fuel pump electric motor is set into regenerative mode to achieve fast shutdown , there could be a spike of voltage supplied downstream through the bus 43 . however , by providing the feedforward signal 52 back upstream , the voltage transients on the dc bus 43 can be significantly improved . in sum , the present invention provides lower weight system to achieve fast shutdown and a fault redundant architecture of an electric motor for a fuel pump . the invention is particularly well suited for use in controlling a fuel pump for a gas turbine engine in an aircraft application . although an example embodiment has been disclosed , a worker of ordinary skill in this art would recognize that certain modifications would come within the scope of the claims . for that reason , the following claims should be studied to determine their true scope and content . | 5 |
the compound of formula ( i ) has a uretdione group content of 1 . 5 - 2 mmol / g , a cyclic amidine group ( imidazoline ) content of 0 . 3 - 2 % by weight , and a free nco group content of 0 . 2 - 7 % by weight , preferably 1 - 3 % by weight . the melting point of the compound is within a range of about 80 ยฐ- 160 ยฐ c . the present compound further is outstandingly suitable for the preparation of solvent - resistant epoxy resin powder coatings and for bonding metals with enhanced lap shear strength at elevated temperatures . the ipdi uretdione employed in the process according to the invention is described in de - a 30 30 513 and has an nco content of 17 - 18 % by weight with a monomer content of & lt ; 0 . 7 % by weight , after heating at 180 ยฐ c . ( 0 . 5 h ) the nco content is 37 - 37 . 6 % by weight . the reaction between ipdi uretdione and diol or disecondary diamine is carried out in an inert solvent , for example , an aromatic hydrocarbon , an ester or a ketone . acetone has proven to be a particularly advantageous solvent . the compounds which are suitable for the chain extension of the ipdi uretdione are , on the one hand , diols as described , for example , in de - a 27 38 270 , p . 10 , and on the other hand disecondary diamines , as are obtained , for example , in a known manner from the corresponding diprimary diamines by reaction with a carbonyl compound , for example a ketone or aldehyde , followed by hydrogenation . a particularly simple method of preparing the disecondary compounds is the addition reaction of acrylic esters ( ch 2 โ ch -- coor 2 ) with the primary amino groups of the diprimary diamines ( h 2 n -- r 1 -- nh 2 ). in the chain extension of the ipdi uretdione with diols , the diol , for example ethylene glycol , diethylene glycol , butanediol , 3 - methyl - 1 , 5 - pentanediol , 1 , 6 - hexanediol , decanediol , dodcanediol or 2 , 2 , 4 ( 2 , 4 , 4 )- trimethyl - 1 , 6 - hexanediol , is added at 60 ยฐ c . to the acetone solution of the ipdi uretdione and the mixture is heated further at 60 ยฐ c . until one nco group is reacted per oh group employed . in order to accelerate the reaction it has proven advantageous to add 0 . 01 - 0 . 1 % by weight of dibutyltin dilaurate ( dbtl ). in reacting the ipdi uretdione with disecondary diamines , the diamine is metered at room temperature into the acetone solution of ipdi uretdione at a rate such that the temperature of the reaction mixture does not exceed 40 ยฐ c . after the end of the addition of diamine , the reaction too is also virtually at an end . the addition of a catalyst is not necessary . then , in order to prepare the compound according to the invention , the reaction product from the first stage , which is the acetone solution of the chain - extended ipdi uretdione , is reacted in a 2nd reaction step with the cyclic amidine at 60 ยฐ c . the cyclic amidine is added at about 60 ยฐ c . in portions to the acetone solution of the chain - extended ipdi uretdione . after the end of the addition of amidine , heating is continued for about 1 h in order to complete the reaction . then the acetone is removed by distillation . then a vacuum is applied in order to remove the last residues of acetone . it has been found particularly advantageous to isolate the reaction product by removing the acetone in a film extruder under vacuum . by the process according to the invention , 1 - 2 mol of cyclic amidine are reacted per mol of chain - extended ipdi uretdione ( ฮป2 nco equivalents ). the cyclic amidines which are appropriate for preparing the compounds according to the invention are described in de - a 22 48 776 and de - a 28 35 029 . particularly suitable amidines are 2 - phenylimidazoline , 2 - phenyl - 4 - methyl - imidazoline and 2 , 4 - dimethylimidazoline . the present invention also provides pulverulent coating compositions of high storage stability and excellent solvent resistance which are based on 1 , 2 - epoxide compounds having more than one 1 , 2 - epoxide group and more than one oh group in the molecule , on curing agents and on customary coatings additives , wherein the coating composition comprises the following compound as a hardener : ## str9 ## in which x , r , r 1 , r 2 , r 3 , n and b are as defined supra , having an oh : nco ratio of from 1 : 0 . 25 to 1 : 1 , preferably 1 : 0 . 5 , the content of cyclic amidine ( in bonded form ) is from 2 to 8 % by weight , preferably from 3 to 6 % by weight , based on the sum of epoxide compound and hardener , and the hardener comprises from 0 . 5 to 1 mol of cyclic amidine per nco equivalent . the hardener ( 1 ) according to the invention is compatible with oh - containing ep resins and at elevated temperatures produces homogeneous melts which are very suitable for preparing pulverulent coating compositions . they are stable on storage at room temperature , with curing times within 30 - 5 minutes in the temperature range 160 ยฐ- 200 ยฐ c . epoxide compounds which are suitable for preparing the pulverulent coating compositions according to the invention , which are to be used as powder coatings , are of course only those containing more than one oh group in the molecule . these are ep resins which are obtained by reacting bisphenol a and epichlorohydrin in a molar ratio of n :( n + 1 ) where n is 2 - 7 . particularly suitable epoxy resins are those having a ep equivalent weight of about 900 and an oh equivalent weight of 300 . the powder coatings are prepared , for example , by grinding and mixing the individual components , which are ep resin , chain - extended ipdi uretdione blocked with cyclic amidines , and , if desired , additives such as levelling agents , pigments , fillers , uv stabilizers and antioxidants and extruding the mixture at 80 ยฐ- 110 ยฐ c ., preferably 90 ยฐ- 100 ยฐ c . after extrusion , the mass is cooled and is ground to a particle size of less than 100 ฮผm . in the preparation of the binder mixture , the components must be matched to each other such that per oh equivalent of the ep resin there is 0 . 25 - 1 , preferably 0 . 5 , blocked nco group of the hardener together with a cyclic amidine content ( in blocked form ) of 2 - 8 % by weight , preferably 3 - 6 % by weight , based on the sum of resin + hardener . the proportion of hardener , therefore , must be chosen such that its cyclic amidine content is sufficient for catalytic curing of the ep resin ( polymerization of the epoxide groups ) without the oh groups reacting , and at the same time achieving crosslinking of the ep resin by reaction of the oh groups of the ep resin with the blocked nco groups of the hardener , the ep groups , however , remaining intact . the application of the powder coatings to the substrates to be coated can be carried out by known methods , for example by electrostatic powder spraying or fluidized - bed sintering . the coated articles are subsequently cured for 5 - 30 minutes in the temperature range 200 ยฐ- 160 ยฐ c . substrates suitable for coating with the pulverulent coating compositions according to the invention are all those which withstand the curing conditions indicated , examples being metals , glass and ceramic . the powder coatings thus prepared are notable for very good coatings properties and outstanding resistance to aggressive solvents such as , for example , methyl isobutyl ketone . the present invention also embodies the use of the compounds of the invention in the preparation of pulverulent , one - component metal adhesives . the resin / hardener mixture suitable for bonding metals is identical with the pulverulent coating compositions , i . e . has the same composition , preparation and application , and in the case of the bonding of metals it is even sufficient to apply the powder to the metal panels by sieving . after the clean surface of one metal has been coated with the resin / hardener mixture according to the invention , it is fixed with the other metal to be bonded with the aid of a screw clamp . curing takes place , as in the case of the powder - coated substrates , at 160 ยฐ- 200 ยฐ c . within 30 - 5 minutes . the metal bonds thus produced differ markedly from the ep - based one component metal adhesives currently available on the market with respect to their strength ( lap shear strength as determined by the procedure of din 53 283 ) at elevated temperatures . the pulverulent metal adhesives based on ep resins that are currently on the market consist of a ( solid ) ep resin which is cured with dicyandiamide . the metal bonds produced therewith exhibit lap shear strengths which are excellent at room temperature but which decrease sharply with rising temperature and are virtually zero at 150 ยฐ c ., in other words , the bond fails at 150 ยฐ c ., whereas bonds with the resin / hardener mixture according to the invention still have lap shear strengths at 150 ยฐ c . which are about 10 n / mm 2 . the diol is metered in over the course of about 1 hour with intensive stirring to an acetone solution of the ipdi uretdione ( about 50 % acetone based on the sum of ipdi uretdione + chain extender + cyclic amidine ), which contains 0 . 05 % by weight dibutyltin dilaurate , and the mixture is heated further at 60 ยฐ c . until one nco equivalent has reacted per oh equivalent employed . the cyclic amidine is then added in portions . after the addition of amidine has taken place , heating is continued at 60 ยฐ c . for about 1 h . the acetone is then removed by distillation . in order to remove the last residues of acetone , vacuum is applied to the reaction mass . if a disecondary diamine is used instead of the diol for chain extension of the ipdi uretdione , the reaction takes place at room temperature and without dbtl . the ipdi uretdione used for chain extension was prepared in accordance with the reaction conditions described in example 2 of de - a 30 30 513 . the nco content of the ipdi uretdione was 17 . 3 %; on heating at 180 ยฐ c . ( 0 . 5 h ) an nco content of 37 % was found . table 1__________________________________________________________________________compounds according to the invention glass % ncocomposition of the compounds according to the invention transition ( afteripdi point heating atexampleuretdione chain extender cyclic amine m . p . ( dsc ) % nco 180 ยฐ c . nh . sub . 2no . mol ! mol ! mol ! ยฐ c .! ยฐ c .! ( free ) for 1 mmol / g ! __________________________________________________________________________a ) 1 1 -- ## str10 ## 66 - 75 35 - 48 / 42 6 . 6 28 . 4 1 . 6a ) 2 3 2 ho ( ch . sub . 2 ). sub . 6oh 2 b 31 127 - 135 96 - 112 / 100 0 . 1 18 . 7 1 . 0a ) 3 2 1 ho ( ch . sub . 2 ). sub . 6oh 2 b 31 123 - 130 88 - 112 / 93 0 . 2 19 . 8 1 . 4a ) 4 3 2 ho ( ch . sub . 2 ). sub . 12oh 2 b 31 116 - 127 80 - 98 / 84 0 . 1 17 . 2 0 . 9a ) 5 2 1 ho ( ch . sub . 2 ). sub . 12oh 2 b 31 111 - 122 79 - 98 / 82 0 . 1 18 . 8 1 . 3a ) 6 4 3 hoch . sub . 2ch . sub . 2oh ( eg ) 2 b 31 146 - 153 123 - 134 / 126 & lt ; 0 . 1 19 . 3 0 . 8a ) 7 3 2 eg 2 b 31 133 - 141 117 - 128 / 122 & lt ; 0 . 1 19 . 7 1 . 06a ) 8 2 1 eg 2 b 31 128 - 139 108 - 118 / 115 & lt ; 0 . 1 20 . 7 1 . 5a ) 9 5 ## str11 ## ## str12 ## 163 - 175 132 - 145 / 140 1 . 2 15 . 4 0 . 3__________________________________________________________________________ *) r = hc radical of isophoronediamine the ground products each of hardener , epoxy resin and levelling agent masterbatch , were first of all mixed in dry form with the white pigment in an edge runner mill and then homogenized in an extruder at 80 ยฐ- 120 ยฐ c . after cooling , the extrudate was crushed and ground in a pinned - disk mill to a particle size of & lt ; 100 ฮผm . the powder thus produced was applied with an electrostatic powder spraying unit at 60 kv to degreased , optionally pretreated iron panels ( 1 mm thick ) and baked in a laboratory convection oven . 10 % by weight of the levelling agent , which is a commercially available acrylate - oligomer , are homogenized in the melt in the epoxy resin and , after solidifying , are comminuted . in the epoxy resin coating examples infra , a solid epoxy resin was used of the diglycidyl ether of bisphenol a prepared by reacting epichlorohydrin with bisphenol a , which , according to the manufacturer , has an epoxide equivalent weight of 900 - 1000 , an epoxide value of 0 . 10 - 0 . 11 , a hydroxyl value of 0 . 34 and a melting point of 96 ยฐ- 104 ยฐ c . the powder coatings listed in table 2 contain 40 parts by weight of tio 2 , 0 - 5 part by weight of levelling agent , 59 . 5 parts by weight of binder , with the oh : nco equivalence ratio of resin to hardener being generally 2 : 1 . number of strokes with an mek - soaked cottonwool pad under a load of 1 kg until the surface is attacked ( matt surface ). table 2__________________________________________________________________________composition of the pigmented ( 40 % by weight tio . sub . 2 ) powders and thecoatings data ( after curing ) temp . ยฐ c . ! nco oh 200 180 170exampleequiv . equiv . duration min ! no . hardener ep 10 20 30 15 25 25 30__________________________________________________________________________b ) 1 1 a ) 2 2 hk 138 150 140 154 152 155 153 gg 60 ยฐ& lt ;) 29 29 30 26 26 25 28 ch 0 0 1 0 0 1 0 el 3 . 1 3 . 4 6 1 1 . 3 1 . 8 1 . 3 bl rev . 20 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek 120 180 200 & gt ; 200 & gt ; 200 200 200b ) 2 1 a ) 3 2 hk 147 153 154 155 168 163 158 gg 60 ยฐ& lt ;) 40 53 56 42 44 38 45 ch 1 1 0 1 1 1 1 el 4 . 5 3 . 8 4 . 1 1 . 8 1 . 8 2 . 6 2 . 8 bl rev . 20 10 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200b ) 3 1 a ) 4 2 hk 185 183 175 192 184 179 180 gg 60 ยฐ& lt ;) 78 82 84 85 83 78 88 ch 1 1 1 1 1 0 0 el 7 7 . 8 7 . 4 6 . 7 6 . 4 7 . 1 6 . 7 bl rev . 60 50 50 50 50 40 40 mek & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 150 180b ) 4 1 a ) 5 2 hk 164 169 169 180 177 170 170 gg 60 ยฐ& lt ;) 80 76 68 68 69 60 70 ch 4 3 3 0 0 0 0 el 4 . 5 4 . 3 4 . 5 4 . 5 3 . 1 5 . 1 5 . 2 bl rev . 30 20 20 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek 80 120 200 130 180 80 110b ) 5 1 a ) 6 2 hk 101 130 109 133 140 139 128 gg 60 ยฐ& lt ;) 11 10 11 13 12 12 12 ch 0 0 0 0 0 0 0 el 1 . 1 1 0 . 8 0 . 9 0 . 8 0 . 6 0 . 7 bl rev . & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek 200 200 200 16 40 20 26b ) 6 1 a ) 7 2 hk 117 110 116 153 141 137 136 gg 60 ยฐ& lt ;) 19 18 19 21 20 20 21 ch 1 0 0 0 0 0 0 el 1 . 1 1 . 0 1 . 4 0 . 9 0 . 9 0 . 9 1 bl rev . & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek 200 & gt ; 200 & gt ; 200 26 80 46 60b ) 7a1 a ) 1 2 hk 179 183 186 175 174 179 183 gg 60 ยฐ& lt ;) 68 69 70 62 61 60 62 ch 0 0 0 0 1 0 0 el 2 . 5 3 . 0 3 . 1 3 4 2 . 8 3 bl rev . & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200b ) 7b1 a ) 1 4 hk 151 151 151 150 146 170 159 gg 60 ยฐ& lt ;) 30 32 32 25 20 60 25 ch 0 0 0 0 0 0 0 el 3 . 3 4 . 2 3 . 8 3 3 . 5 5 . 1 2 bl rev . & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek 90 100 110 80 100 80 30__________________________________________________________________________ c ) use of the compounds of the invention for the preparation of pulverulent one - component adhesives the hardener of the invention and an ep resin with an ep value of 0 . 1 are subjected to intensive kneading in a plastograph for 5 minutes at 100 ยฐ c . after cooling , the product is ground and applied by sieving to steel panels ( 1 . 5 mm thick ) cleaned with scotch - brite , and bonding is conducted in accordance with the procedure of din 53 283 . the lap shear strengths of these steel bonds ( after curing at 200 ยฐ or 180 ยฐ c .) are listed in the table infra . table 3__________________________________________________________________________metal bonds ( din 53 283 ) with the hardener / ep mixtures according to theinventionadhesive composition curing lap shear strength ( din 53 283 ) n / mm . sup . 2 ! examplenco equiv . oh equiv . temperature time roomno . hardener ep ยฐ c .! min ! temperature 100 ยฐ c . 130 ยฐ c . 150 ยฐ c . __________________________________________________________________________c ) 1 1 a ) 7 2 180 30 20 16 10 9c ) 2 1 a ) 7 1 180 30 21 19 9 9c ) 3 1 a ) 8 2 180 30 20 17 8 7c ) 4 1 a ) 8 1 180 30 18 19 16 15c ) 5 1 a ) 4 2 180 30 21 19 7 6 200 15 20 18 9 7c ) 6 1 a ) 4 1 180 30 17 13 13 12 200 15 18 14 14 15c ) 7 1 a ) 5 2 180 30 21 18 17 14 200 15 20 18 16 16comparison exampleat 1 ( ciba ) 200 30 29 14 3 1__________________________________________________________________________ having now fully described the invention , it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit or scope of the invention as set forth herein . | 2 |
fig1 shows a processor in accordance with the invention and in which the method of the invention may be performed . the processor comprises a cylinder 1 having an open side or end and a closed side or end . the cylinder may be made of stainless steel , plastics or any other suitable material . the cylinder defines a processing drum chamber 4 . a slot 2 with a water tight cover ( not shown ) is provided through the wall of the cylinder to allow a strip of film 3 to be loaded into the drum chamber 4 . a pair of pinch rollers 8 are provided at the entry to the slot 2 . a drive shaft 11 is provided at the closed side or end of the cylinder 1 for rotation thereof . the open end of the cylinder is provided with a flange 12 . the flange retains solution within the processing chamber . processing solutions may be introduced into and removed from the chamber by any suitable means . a central cylindrical member 6 is located within the processing chamber 4 . in the embodiment shown in fig1 the member 6 is solid . however , the member 6 may have a hollow interior . the gap between the outer wall of the member 6 and the inner circumferential wall 5 of the chamber can be any distance from the film thickness to the radius of the chamber . preferably however the gap will be in the order of 10 to 30 mm . the member 6 provides a film retaining means , preventing the film 3 from falling into the centre of the chamber 4 . in one embodiment of the invention the member 6 is attached to the enclosed end 10 of the processing chamber 1 so that it rotates as the chamber rotates . however , in another embodiment , the member 6 may be mounted such that it rotates independently of the chamber . this could be by means of a concentric drive shaft with a clutch assembly . an agitation roller 7 may be provided in the lower part of the chamber 6 . the roller 7 has a diameter of about 1 cm to 3 cm . in this embodiment it is preferred that the gap is sufficiently large to allow the agitation roller 7 to pass freely between the inner circumferential wall 5 and the central cylindrical member 6 . also in practice it is preferred that the gap is sufficiently small so that it properly prevents the film from falling into the centre . the agitation roller 7 is important as it provides agitation and solution mixing . the roller also prevents the emulsion side of the film 3 sticking to the central cylindrical member 6 when it is wet . the cylindrical member 6 can be made of any material but it is preferable that it is made of a material that will not damage the film surface . this material can be soft plastic or rubber and can have a textured surface such as that found in โ soft touch โ rubber rollers used for the so called โ tendency drive โ method . the inner circumference of the drum chamber 4 may also be made of the same soft material . in operation the film 3 is loaded through the entry slot 2 by the pinch rollers 8 while the drum 1 is stationary . the film is fed into the processing chamber 4 with the emulsion side facing inwards . as the film is fed into the chamber it passes under the agitation roller 7 . the film is passed in until the end of the film 3 is reached when it is held by the pinch rollers 8 . the film may be left attached to the cassette 9 or detached from the cassette and driven in by rotation of the cylindrical member 6 . processing solutions are then added and removed as required in order to process the film . full details of the method of processing can be found in co - pending application no gb 0023091 . 2 , the contents of which are herein incorporated . as can be seen various widths of film can be loaded into a single chamber and processed satisfactorily . although edge guides are not necessary they can still be used even though the chamber has a central cylindrical member filling the centre thereof . if edge guides are used then the widest film is loaded and is retained by both the edge guides . when using narrower film the film can be loaded using the edge guide on one side and the central cylindrical member prevents the other side of the film falling into middle of the chamber . thus it can be beneficial to have the middle of the chamber filled and also to use edge guides as well . fig2 a and 3 b illustrate an embodiment of the invention which allows two widths of film to be loaded into the chamber without the need for the central member 6 preventing the narrower film from falling into the middle of the chamber . in the embodiment of fig2 two slots 20 and 22 are provided in the wall of the cylinder to allow film 3 to be loaded into the drum chamber 4 . both slots are provided with water tight covers ( not shown ). each slot has a pair of pinch rollers 8 provided at the entry thereof . narrow channels or guide means 24 and 26 are defined in the wall of drum chamber 4 . slots 20 and 22 are in connection with narrow channels , 24 and 26 , respectively . the distance of the slots from the pair of pinch rollers to the entrance to the channels is in the region of 15 mm to 50 mm , preferably 15 mm to 25 mm . channel 24 has a width suitable for wide film , such as 35 mm film . channel 26 has a width suitable for narrower film , such as 24 mm film . in operation the film 3 is fed into either slot 20 or 22 , dependent on the width of the film , by the pinch rollers 8 as described above . it will be appreciated that although fig3 b illustrates how both widths of film are retained within the slots in practice only one film will be loaded at a time . as stated above , the central cylindrical member 6 may be fixed to the closed end of the chamber to rotate therewith or it may be mounted such that it rotates independently of the chamber . the latter embodiment has benefits in assisting film loading and unloading and in preventing scuffing of the surface of the film . in a further embodiment the central cylindrical member 6 may be rotated at a different speed to that of the chamber . in such an embodiment the difference in speeds of the member 6 and the drum chamber 4 provides sufficient agitation to process the film satisfactorily . therefore a roller is not required . in yet a further embodiment the member 6 may rotate in the opposite direction to the rotation of the chamber . this provides a very high degree of agitation through solution shear . it is also envisaged that the chamber 4 may remain stationary and only the member 6 rotate . if the inner circumferential wall 5 is made of a soft , flexible material , as described above , the film 3 may be fed into the processing chamber 4 emulsion side out . the cylindrical member 6 rotates to assist in loading the film . the film 3 is loaded completely without holding on to the film trailing end . the back of the film contacts the cylindrical member 6 and the front of the film or emulsion side contacts the inner circumferential wall 5 of the drum chamber . the film can slide easily over both the cylindrical member 6 and the inner circumferential wall 5 of the drum chamber . however , it is arranged that the friction between the rotating cylindrical member 6 and the back of the film is greater than the friction between the stationary inner circumferential wall 5 of the drum chamber . this means that although the film 3 can slide on both surfaces it is normally driven round with the rotating cylindrical member 6 and slides over the stationary inner circumferential wall of the drum chamber . this is the first processing mode . in order to effectively wash the back of the film a second processing mode may be provided . in this case a movable stop section ( not shown ) can be placed in the path of the rotating film . this stop section is adjacent to the entry slot 2 and when the leading end of the film comes up against the stop the film can no longer rotate . this causes the rotating cylindrical member 6 to rotate and thus wash the back of the film 3 . the stop section also serves a second purpose and that is to enable unloading of the film . after the last wash the stop section is in the down position , the rotating cylindrical member 6 is now rotated in the opposite direction so that the trailing end of the film comes up against the other side of the stop section . this side of the stop section is angled so as to be in line with the entry slot 2 and so the trailing end of the film is guided out of the entry slot and into the pair of pinch rollers 8 . thus the film is unloaded . fig4 illustrates a further apparatus and method of loading according to the invention . in this embodiment a slot is provided in the wall of the of the cylinder to allow film 3 to be loaded into the drum chamber 4 as described above . a pair of pinch rollers 8 are provided , also as described above . the drum chamber 4 has a filled central member 6 . a plurality of rollers 30 are provided on the outer perimeter of the central member 6 , projecting out therefrom on arm members 32 . the rollers are on arm members 32 to prevent damage to the film surface . the rollers 30 each have a concave section such that only the outside edge of the film 3 contacts the rollers when the film is loaded in the chamber . the rollers have a diameter between 2 mm and 50 mm , preferably 6 mm . the gap between the rollers 30 and the inner circumference of the drum chamber 4 can be a maximum of 50 mm . however the ideal range is from the thickness of the film to 6 mm . at least one cavity , or nest , 28 is provided within the central member . film is fed into the drum chamber 4 by the pair of pinch rollers 8 . both the drum 4 and central member 6 are held stationary as the film 3 is fed into the chamber . the natural curl of the film 3 means that as the film is fed into the chamber 4 it curls up on itself within the nest 28 provided within the central member 6 . once the film has been loaded the end of the film is held by the pinch rollers 8 . the drum 4 is then rotated in the direction shown by the arrow in fig4 . the central member 6 remains stationary . the film is thus uncurled by the rollers 30 and is drawn out of the nest 28 to lie around the inner circumference of the chamber . at this stage the film is held only by the rollers 30 . as the rollers are concave only the outer edges of the film contact the surface thereof thus minimizing damage to the surface of the film . processing then takes place as described above . as the film gets warm and soft during the processing the strength of its natural curl is lost and eventually the film lies against the inner circumferential wall of the chamber by capillary action . the film does not have to be fed in at the top of the drum chamber . the film can be loaded , and unloaded , with the entry lot at various positions . the chamber may have more than one entry slot and nest for different sizes of film . no edge guide means are required in this embodiment , the inner circumferential wall of the chamber being smooth . it is thus easier and cheaper to manufacture this apparatus . the invention has been described in detail with reference to certain preferred embodiments thereof . it will be understood by those skilled in the art that variations and modifications can be effected within the scope of the invention . | 6 |
fig1 shows the circuit arrangement of an image stabilizing device for a camera arranged as an embodiment of this invention . referring to fig1 an angular displacement of a floating element 4 relative to an outer cylinder 2 is arranged to be detected by a psd 5 and an ired 6 . the output of the psd 5 is processed by a position detecting circuit 9 into a voltage output which corresponds to the relative angular displacement mentioned above . the voltage output is inputted to an a / d converter 50 . a winding coil 7 is disposed within a closed magnetic circuit formed by the floating element 4 and a yoke 1 and is arranged to be driven by a coil driving circuit 8 . a photo - taking lens consists of a first lens group 12 , a second lens group 13 , a third lens group 14 , and a fourth lens group 15 . within the photo - taking lens , a zooming lens consists of the second lens group 13 and the third lens group 14 . in the zooming lens , the second lens group 13 is arranged to be movable in the directions of axes x and y within a plane which is perpendicular to the optical axis of the photo - taking lens . the second lens group 13 is thus arranged to serve as a known shifting lens . a camera shake correcting action is performed on the photo - taking lens with the second lens group 13 driven by means of a coil driving circuit 10 and a coil 11 . the absolute position of the second lens group 13 , i . e ., a shifting lens , is detected by a shifting lens position detecting circuit 16 . the result of detection is inputted to the a / d converter 50 . a zoom motor driving circuit 19 and a motor 20 are arranged to drive the second lens group 13 and the third lens group 14 for zooming . the absolute position of the zooming lens is detected by a zoom position detecting circuit 21 . the result of the zoom position detection is inputted to the a / d converter 50 . the first lens group 12 is arranged to be driven for focusing by a focus motor driving circuit 17 and a motor 18 . the absolute position of the focusing lens group 12 is detected by a focus position detecting circuit 22 . the result of detection of focusing position is inputted from the focus position detecting circuit 22 to the a / d converter 50 . as mentioned above , the outputs of the angular - displacement - sensor position detecting circuit 9 , the shifting lens position detecting circuit 16 , the zoom position detecting circuit 21 and the focus position detecting circuit 22 are arranged to be inputted to the a / d converter 50 to be converted into digital data . each digital data thus obtained is supplied to a cpu 51 . the digital data is subjected to an applicable computing operation to be performed within the cpu 51 . the result of the computing operation is supplied via a d / a converter 53 to the coil driving circuit 8 and the other coil driving circuit 10 as driving signals . the operation of the image stabilizing device of the camera arranged as described above is described below with reference to fig2 and 4 which are flowcharts : at steps 200 to 203 , all coefficients to be used in carrying out differentiation by a digital operation are set in internal memories m ( a0h ), m ( a1h ) and m ( b1h ). further , another memory m ( wh ) provided for storing a value which is computed at the time of previous sampling last carrier out and which is necessary for the digital operation is initialized to set its content at &# 34 ; 0 &# 34 ;. the coefficients to be used in a case where a differentiating operation is to be digitally carried out are converted into a formula h ( z ) on a plane z according to a known s - z conversion process ( bilinear conversion in this case ), on the basis of the frequency characteristic of a differentiating circuit shown in fig5 ( a ) and expressed as follows : h ( s )=( sc1 ยท r1 )/( 1 + sc1 ยท r1 ). the values of the coefficients of this formula h ( z ) can be expressed by using a sampling time interval t1 as follows : ## equ1 ## at steps 204 to 207 , coefficients to be used in carrying out a low - pass filter computing operation are set in internal memories m ( a0l ), m ( a1l ) and m ( b1l ). further , a memory m ( wl ) for storing a value which is computed at the time of previous sampling last performed and which is necessary for the digital operation is initialized and set at &# 34 ; 0 &# 34 ;. in a case where the low - pass filter data is to be digitally computed , the coefficients are converted to a formula h ( z ) on a plane z according to the s - z conversion process on the basis of the frequency characteristic of a low - pass filter shown in fig5 ( b ) and expressed as follows : h ( s )= 1 /( 1 + sc2 ยท r2 ). the values of the coefficients of the formula h ( z ) can be expressed by using the sampling time interval t1 as follows : ## equ2 ## at a step 208 , time data t1 is set at a sampling timer 57 which is provided for a digital computing operation on the output value of the angular displacement sensor at intervals of a given period of time t1 . at a step 209 , an interruption by the sampling timer 57 is allowed . at a step 210 , the sampling timer 57 begins to operate . at a step 211 , a sequence timer 52 which is provided for setting a period of time necessary for actually canceling a mechanical offset in the case of this embodiment is reset . at a next step 212 , the sequence timer 52 is allowed to begin to operate . at a step 213 , a flag initl is set within the cpu 51 . at a step 214 , the output of the zoom position detecting circuit 21 is converted into digital data in response to a signal adst coming from the cpu 51 . at a step 215 , a check is made to find if the level of a signal adend has become a high level ( h ). if so , the flow of operation comes to a step 216 . at the step 216 , zoom position data thus obtained is set at a register z which is input or disposed within the cpu 51 . processes after a step 217 are executed for the purpose of obtaining data m ( k ) used for the sequence timer 52 corresponding to the zoom position from among data stored in a rom arranged as shown in fig3 . at the step 217 , the value of the internal register z is first set at a memory address setting register k . at a step 218 : the interruption by the sampling timer 57 is in process during a period before the timer value of the sequence timer 52 reaches the value of the data m ( k ). during this period , digital computing control is executed . this control operation is described below with reference to the flow chart of fig4 : in the main routine of fig2 the flow of operation comes to the interruption process to commence the operation shown in the flowchart of fig4 as soon as the timer value of the sampling timer 57 reaches the given value t1 . at a step 220 of fig4 the level of the output signal adst of the cpu 51 becomes high ( h ) to cause the a / d converter 50 to begin to a / d - convert the output of the angular displacement sensor . at a step 221 , a check is made for the state of the signal adend which indicates the end of the a / d conversion . if the level of the signal adend is found to have become high , the flow of operation comes to a step 222 . at the step 222 , the result of the a / d conversion is set in an internal register a of the cpu . 51 via a bus addata . at a next step 223 , the process of a / d conversion comes to an end with the level of the output signal adst becoming low ( l ). at a step 224 , a check is made for the state of the flag initl within the cpu 51 . if the flag initl is found to have been set at &# 34 ; 1 &# 34 ;, the flow comes to a step 225 to set gain data gkh in a memory m ( gk ). if the flag initl is found to have been reset at &# 34 ; 0 &# 34 ;, the flow comes to a step 226 to set gain data gkl set in the memory m ( gk ). the value of the memory m ( gk ) is arranged to be used for determining the spring constant of the angular displacement sensor with a coil used for the sensor as mentioned in the foregoing . the value of the gain data gkh is arranged to be larger than the value of the other gain data gkl . at a step 227 , the value of the register a and that of the memory m ( gk ) are multiplied by each other . the result of the multiplication is set in a register b . steps 228 to 234 are arranged to carry out a differentiating operation , i . e ., a computing operation process for determining a viscous power of the angular displacement sensor obtained by the coil . at the step 228 , the value of the memory m ( wh ) ( at &# 34 ; 0 &# 34 ; immediately after the memory is reset ) which has already been determined at the time of previous sampling and the value of the memory m ( b1h ) in which a constant value is set at the step 202 of fig2 are multiplied by each other . after that , the result of the multiplication is subtracted from the value of the register a which is set at the output value of the angular displacement sensor . the result of the subtraction is set within a register c . at a next step 229 , a product value obtained from the value of the memory m ( wh ) and the value of the memory m ( a1h ) which is set at a constant value at the step 201 is added to a product value obtained from the value of the register c and the memory m ( a0h ) which is set at a constant value at the step 200 . the result of addition is set in a register d . at this point of time , the result of a differentiating operation digitally carried out on a difference signal of the angular displacement sensor has been set in the register d . next , at a step 230 , a check is made for the state of the flag initl within the cpu 51 in the same manner as at the step 224 . if the flag initl is found to have been set at &# 34 ; 1 &# 34 ;, the flow comes to a step 231 to set gain data ghh in a memory m ( gh ). if the flag initl is found to have been reset at &# 34 ; 0 &# 34 ;, the flow comes to a step 232 to set gain data ghl in the memory m ( gh ). the value of the memory m ( gh ) is to be used for determining the viscosity constant of the angular displacement sensor . the gain data ghh has a larger value than the gain data ghl . at a step 233 , the value of the register d obtained at the step 229 and that of the above - stated memory m ( gh ) are multiplied by each other . the result of multiplication is set again in the register d . at a step 234 , the value of the register c which is necessary for the next sampling is set in the memory m ( wh ). at a next step 235 , the value of the register b in which a spring constant data corresponding to the spring force of the angular displacement sensor is set as mentioned above is added together with the value of the register d in which the viscosity constant data corresponding to the viscous power of the angular displacement sensor is set . the result of the addition is again set in the register b . at a step 236 , the flag initl is checked for its state . if the flag initl is found to have been set at &# 34 ; 1 &# 34 ;, the flow comes to a step 237 . at steps 237 to 239 , low - pass filter data for the register b is computed in the following manner : at the step 237 , the value of the memory m ( wl ) which has its value already set at the time of previous sampling ( the value is &# 34 ; 0 &# 34 ; immediately after resetting ) and the value of the memory m ( b1l ) in which a constant value is set at the step 206 of fig2 are multiplied by each other . after that , the result of multiplication is subtracted from the value of the register b . the result of subtraction is set in a register e . at the step 238 , a value obtained by multiplying by each other the value of the register e and the value of the memory m ( a0l ) which has been set at a constant value at the step 204 is added to a value obtained by multiplying by each other the value of the memory m ( wl ) and the value of the memory m ( a1l ) which has been set at a constant value at the step 205 . the result of addition is set in a register f . at the step 239 , the value of the register e which is necessary for the next sampling is set in the memory m ( wl ). with the low - pass filter computing operation carried out by the steps 237 to 239 in the above - stated manner for spring constant data and viscosity constant data corresponding to the spring force and the viscous power mentioned in the foregoing , any adverse effect of the camera shake caused by the hand of the photographer is removed and dc data for canceling a mechanical unbalance of the angular displacement sensor is computed . while the flag initl is in the state of being set at &# 34 ; 1 &# 34 ;, the level of an output signal dast of the cpu 51 becomes high ( h ) at a step 241 after the low - pass filter computation . then , at a step 242 , the value of the register b is transferred via a bus dadata to the d / a converter 53 , so that a d / a conversion process begins . the output value of the d / a converter 53 becomes the value of a current to be applied to the winding coil 7 via the coil driving circuit 8 . therefore , the floating element 4 of the angular displacement sensor is caused to remain stationary in the neighborhood of its datum position by the strong spring force and the viscous power of the angular displacement sensor . the level of the output signal daend of the d / a converter 53 becomes high ( h ) upon completion of the d / a conversion process . at a step 243 , when this high - level output of the d / a converter 53 is detected , the cpu 51 brings the timer interruption process to an end and the flow of operation comes back to the main process shown in fig2 . the flag initl remains set at &# 34 ; 1 &# 34 ; until the timer value of the sequence timer 52 reaches the data m ( k ). therefore , until then , the actions described above are repeated every time the interruption by the sampling timer 57 takes place . when the sequence timer 52 is found to have counted a given value m ( k ) at the step 218 of fig2 the flag initl is reset at &# 34 ; 0 &# 34 ; at the step 219 . with the flag initl in the state of being reset at &# 34 ; 0 &# 34 ;, a weak spring constant and a weak viscosity constant are selected at the steps 226 and 232 , respectively . then , spring constant data and viscosity constant data obtained in the weak states come to be set in the register b at the step 235 . next , since the flag initl is found to be in the state of being reset at &# 34 ; 0 &# 34 ; at the step 236 , the flow comes to a step 240 . at the step 240 , the value of the register f which stores a dc component for the value obtained by adding together the spring constant data and the viscosity constant data obtained when a strong spring constant and a strong viscosity constant are selected with the flag initl set at &# 34 ; 1 &# 34 ; is added to the value of the register b . the result of addition is then set again at the register b . this value of the register b comes to be outputted from the d / a converter 53 through the steps 241 , 242 and 243 . the output of the d / a converter 53 becomes a current to be applied to the winding coil 7 via the coil driving circuit 8 . in this instance , a dc current corresponding to the value of the above - stated register f is applied . therefore , even if the spring force and the viscous power obtained by the coil are returned to normal values for the angular displacement sensor , the dc current brings about a reaction or a drag against a gravitational component resulting from a mechanical unbalance . in the event of occurrence of an error due to an offset canceling method , the floating element in the angular displacement sensor moves as much as the amount of the error when the spring constant obtained as the spring force of the sensor is brought back to its original value . the adverse effect of this increases accordingly as the focal length of the photo - taking lens increases with the amount of this reduced to an image surface . therefore , if the focal length of a zoom lens is short , a period of stable - state waiting time necessary for carrying out this offset canceling method can be shortened . in view of this , the embodiment is arranged to detect information on zooming of the photo - taking lens of the camera at the beginning of an initial setting action on the angular displacement sensor , and then to vary the period of stable - state waiting time on the basis of the focal length information thus obtained at the time of initial setting ( the actions performed at the steps 216 and 217 of fig2 ). this arrangement enables the embodiment to shorten the build - up time of the angular displacement sensor especially at a short focal length of the photo - taking lens . in other words , a building up action on the angular displacement sensor can be carried out according to the operating state of the camera . the release time lag of the camera thus can be shortened by virtue of this arrangement . as described in the foregoing , this embodiment is provided with varying means for varying a period of stable - state waiting time required before rendering the shake detecting means operable according to information obtained from focal length detecting means . then , since the length of time required in canceling the amount of deflection of the camera body in relation to an absolute space varies with the focal length of the photo - taking lens , the period of table - state waiting time required before the shake detecting means becomes operable is changed according to the information from the focal length detecting means . therefore , with the period of stable - state waiting time of the shake detecting means changed according to the operating state of the camera , the release time lag of the camera can be shortened as much as possible . in the case of this embodiment , displacement amount detecting means for directly detecting angular displacement caused by a shake is employed as the shake detecting means . however , this invention is applicable also to any cases where acceleration or angular acceleration detecting means or speed or angular speed detecting means is employed as the shake detecting means , as long as the lapse of time is required before the detecting means employed becomes capable of stably outputting its detection output after the start of operation thereof . | 6 |
the present capacity maximizing method is best understood by considering a communication channel that is bandlimited to bandwidth b . the frequency range is then divided into n equal width bins , such that the channel , next and fext transfer functions are relatively constant , such as discussed herein before with reference to fig2 . the present capacity maximizing method can be used to determine what signaling scheme to use and the amount of power to place in each of the n bins . one embodiment maximizes the sum of the upstream and downstream capacities subject to a total power constraint p tot . recognizing that the severity of self - next varies with frequency in a typical telephone channel , the present inventors recognized that switching between fds and eqpsd signaling as warranted by the severity of the self - next , would yield maximum channel capacity . a description of the present capacity maximizing method is best understood by considering one embodiment in which s u ( f ) and s d ( f ) denote the psd in a particular bin in the upstream and downstream direction , respectively . [ 0037 ] s u ๎ข ( f ) = { ฮฑ ๎ข 2 ๎ข p w if 0 โค f โค w 2 ( 1 - ฮฑ ) ๎ข 2 ๎ข p w if w 2 & lt ; f โค w 0 otherwise ( 4 ) s u ๎ข ( f ) = { ( 1 - ฮฑ ) ๎ข 2 ๎ข p w if 0 โค f โค w 2 ฮฑ ๎ข 2 ๎ข p w if w 2 & lt ; f โค w 0 otherwise ( 5 ) [ 0038 ] fig3 illustrates all possible combinations of signaling schemes in terms of s u ( f ) and s d ( f ) for a typical telephone channel that employs switching between fds and eqpsd as warranted by the severity of self - next . it can be seen , for example , that when ฮฑ = 0 . 5 , then s u ( f )= s d ( f ) . this situation corresponds to eqpsd signaling , as discussed herein before . alternatively , when ฮฑ = 1 , s u ( f ) and s d ( f ) are disjoint , corresponding to fds signaling . it can be appreciated that since the upstream and downstream signaling schemes are symmetric , one need only maximize the data rate in one direction of transmission . then , realizing that the residual echo affects performance in a manner similar to next , the total channel capacity in the upstream direction can be written as c u = b 2 ๎ข ln ๎ข ( 2 ) ๎ข { ln ๎ข [ 1 + ฮฑ ๎ข 2 ๎ข pn b ๎ข hn nn + ( 1 - ฮฑ ) ๎ข 2 ๎ข pn b ๎ข xn + ฮฑ ๎ข 2 ๎ข pn b ๎ข fn + ( 1 - ฮฑ ) ๎ข 2 ๎ข pn b ๎ข en ] + ln ๎ข [ 1 + ( 1 - ฮฑ ) ๎ข 2 ๎ข pn b ๎ข hn nn + ฮฑ ๎ข 2 ๎ข pn b ๎ข xn + ( 1 - ฮฑ ) ๎ข 2 ๎ข pn b ๎ข fn + ฮฑ ๎ข 2 ๎ข pn b ๎ข en ] } ( 6 ) taking the derivative of equation ( 6 ) with respect to cc produces equation ( 7 ) that is written as ๏ c u ๏ ฮฑ = g n ๎ข ( 2 ๎ข ฮฑ - 1 ) ๎ข { 2 ๎ข ( [ x n + e n ] ๎ข - f n ) + g n ๎ข ( [ x n + e n ] 2 - f n 2 ) - h n ๎ข ( 1 + g n ๎ข f n ) } ๎ข l = 0 ( 7 ) since the function c u ( a ) is monotonic in the interval ฮฑฮต [ 0 . 5 , 1 ], a single stationary point at ฮฑ = 0 . 5 can be scrutinized to determine if it is a maximum . then , if the single stationary point at ฮฑ = 0 . 5 is a maximum , it is optimal to use eqpsd for the two directions of transmission . it can be shown that for all ฮฑ & gt ; 0 . 5 , 2 ([ x n + e n ]โ f n )+ g n ([ x n + e n ] 2 โ f n 2 )โ h n ( 1 + g n f n )& lt ; 0 ( 8 ) g n & lt ; h n - 2 ๎ข [ x n + e n - f n ] ( x n + e n ) 2 - f n 2 - h n ๎ข f n ( 9 ) g n & gt ; h n - 2 ๎ข [ x n + e n - f n ] ( x n + e n ) 2 - f n 2 - h n ๎ข f n ( 10 ) g n = 2 ๎ข p n n n ๎ข b ๎ข & gt ; eqpsd ๎ข h n - 2 ๎ข [ x n + e n - f n ] ( x n + e n ) 2 - f n 2 - h n ๎ข f n ( 11 ) g n = 2 ๎ข p n n n ๎ข b ๎ข & lt ; fds ๎ข h n - 2 ๎ข [ x n + e n - f n ] ( x n + e n ) 2 - f n 2 - h n ๎ข f n ( 12 ) if ( x n + e n ) 2 โ f n 2 โ h n f n & lt ; 0 , and with the inequalities reversed , if ( x n + e n ) 2 โ f n 2 h n f n & lt ; 0 . these test conditions can then be used to find the regions of the spectrum that will surely use eqpsd and fds signaling . it can then be shown that all bins to the left of crossover bin m e use eqpds signaling and that all bins to the right of crossover bin m f use fds signaling . the signaling schemes for the bins in the region ( m e , m f ) cannot be determined using these same test conditions ; and the true optimal crossover point from eqpsd to fds signaling , m e2f , lies somewhere in between . in order to determine the true optimal crossover point m e2f , the present inventors first applied waterfilling techniques described herein below in association with the eqpds and fds regions . since both upstream and downstream spectra are using the same frequency band in this region , echo , next and fext , along with gaussian noise , limit the channel performance . to determine the best possible distribution of power over frequency in this region , the present inventors considered the capacity formula for parallel independent channels written as c = โ n = 1 n ๎ข w 2 ๎ข n ๎ข ln ๎ข ( 1 + p n ๎ข h n w n + p n ๎ข f n + p n ๎ข x n + p n ๎ข e n ) ( 13 ) where p n is the input power within a particular subchannel , h n is the power transfer gain , x n and f n are the self - next and self - fext transfer functions , and e n is the echo ( as a fraction of the input power . the power distribution importantly must also conform to the power constraint defined by equation ( 14 ) that is written as maximizing the channel capacity can then be determined as an optimization problem wherein the above power constraint can be incorporated with a lagrange multiplier in a fashion familiar to those skilled in the art of optimization theory and techniques . the process begins by writing the functional j as j = โ n = 1 n ๎ข w 2 ๎ข n ๎ข ln ๎ข ( 1 + p n ๎ข h n w n + p n ๎ข f n + p n ๎ข x n + p n ๎ข e n ) - ฮป ๎ข ( โ n = 1 n ๎ข p n - p tot ) ( 15 ) differentiating equation ( 15 ) with respect to p n then produces ๏ j ๏ p n = w 2 ๎ข n ๎ข h n ๎ข w n [ w n + p n ๎ข ( f n + x n + e n + h n ) ] ๎ข [ w n + p n ๎ข ( f n + x n + e n ) ] - ฮป = 0 ( 16 ) p n = s n ๎ข w 2 ๎ข n ( 17 ) w n = ฯ 2 ๎ข w 2 ๎ข n ( 18 ) b = ฯ 2 [ 2 ( f n + x n + e n )+ h n ], ( 20 ) c = ฯ 2 ๎ข ( ฯ 2 - h n ฮป ) ( 22 ) solving the quadratic equation ( 19 ) using equations ( 20 )-( 22 ) is accomplished by first choosing a value for the lagrange multiplier , ฮป . the power in each bin is then determined according to the quadratic equation ( 19 ). a check is then made to determine if the total power constraint defined by equation ( 14 ) is violated . if the total power constraint is not met , the lagrange multiplier , ฮป , is readjusted and the process is repeated until the power constraint condition is met . when the power constraint condition is met , the power distribution in the eqpsd region is then also met . this process , however , requires that each s n be positive . it may , therefore , not always be possible to find a solution in the quadratic form . in these cases , the optimization process can be set up to include the inequality constraints set forth herein before , and then using the well - known karush - kuhn - tucker ( kkt ) conditions to verify that each s n is positive . waterfilling in the fds region is done in a similar manner as described above for the eqpsd region . in this case however , since upstream and downstream signals are using disjoint frequency bands , self - next is completely eliminated . echo in this case is also not an issue , since fds signaling is used . determining optimal power distribution in this case can then begin by considering the equation for parallel gaussian channels that is written as c = โ n = 1 n ๎ข w 2 ๎ข n ๎ข ln ๎ข ( 1 + p n ๎ข h n w n + p n ๎ข f n ) , ( 23 ) and then proceeding in a manner similar to that described herein before in association with distribution of power in the eqpsd region . with reference now to fig2 , a method is illustrated that employs the psd estimation , sure - region computation and waterfilling techniques discussed herein before in order to determine the true optimal crossover point from eeqpsd to fds signaling such that power can be distributed to achieve optimal channel capacity according to one embodiment of the present invention . the method begins by first setting up equispaced bins w ( hz ) over the transmission bandwidth b of the channel as depicted in step 10 . next , the interference psds associated with noise , dsin - next and dsin - fext are estimated and lumped into a single psd as shown in step 12 . using the test conditions defined by equations ( 11 ) and ( 12 ), the sure - eqpsd region ( all bins to the left of bin m e ) and the sure - fds region are computed as depicted in step 14 . next , an initial estimate of the true optimal crossover point , m e2f is chosen as illustrated in step 16 . subsequent to the estimate of the true optimal crossover point , m e2f , and initial estimate is made regarding the amount of power ( p e ) that goes into the eqpsd region , and how much power ( p f = p tot โ p e ) goes into the fds region as seen in step 18 . with the foregoing information , use waterfilling techniques to distribute p e and p f optimally to compute overall channel capacity as depicted in step 20 . following optimal distribution of p e and p f to compute overall channel capacity , p e and p f are re - estimated as shown in step 22 and then used to again perform step 20 . steps 20 and 22 are the repeated for a range of powers in search of the maximum channel capacity as seen in step 24 . once the maximum channel capacity is found , m e2f is re - estimated and used to repeat steps 18 - 26 described herein above as shown by step 28 . the bin number having the overall highest channel capacity as determined via steps 10 - 28 above is then selected as the true optimal crossover point m e2f . [ 0060 ] fig4 simply illustrates a typical downstream psd waveform and a typical upstream psd waveform for a conventional adsl system . as stated herein before , conventional adsl systems use a fixed spectra that do not vary with noise and interference . fig5 - 8 illustrate optimal spectra obtained for various interference combinations . it can be seen that the spectra are not unique . they vary significantly from one another , as the interference combination in each case differ . [ 0062 ] fig9 illustrates the advantage optimal spectra have over fixed ones , as they employ knowledge of the noise environment when distributing power . shown in this figure is the sum of upstream and downstream data rates achieved in the presence of 24 ti next interferers and 24 self - next interferers , when using the fixed spectra of fig4 and the optimal spectra ( for the instant case ) shown in fig6 . it can be seen that a significant performance gain is achieved in terms of data rates using the joint optimization techniques discussed herein before . fig1 - 19 are graphs illustrating the differences in upstream and downstream data rate performance versus loop length between the present optimization method and one known method of spectral optimization in the presence of crosstalk as disclosed by r . gaikwad and r . baraniuk , spectral optimization and joint signaling techniques for communication in the presence of crosstalk , tech . rep . 9806 , rice university , electrical and computer engineering department , houston , tex ., jul . 1998 . the present inventors computed optimal spectra using the present method as well as the method taught by gaikwad et al . the resulting optimal spectra were then tested in a realistic setting , by checking the performance of both systems using various values for the residual echo ( after echo cancellation ). the spectra of adsl modems with 39 interferers was optimized for the first comparison . table 1 illustrates the m e2f crossover point found by the optimization method discussed herein above . the last row of the table shows the values of m e2f that are achieved by the algorithm of gaikwad et al , that does not factor in echo in the optimization process . fig1 - 14 are graphs illustrating the performance of the inventive optimization method discussed herein before as contrasted with the method of gaikwad et al , and when factoring in imperfect equalization . the figures are seen to plot overall datarate ( upstream and downstream ) versus loop length , for values of residual echo ranging from 20 db to 60 db . a second comparison between the two methods was next performed . in this case , the present inventors optimized the spectra of adsl modems with 10 self interferers and 10 hdsl next interferers . shown in table 2 is the m e2f crossover point that the optimization routine discussed herein before yields . again , the last row of the table shows the values of m e2f achieved by the method of gaikwad et al ., and when not factoring in echo in the optimization process . fig1 - 19 illustrates the performance of the optimization scheme discussed herein before versus the scheme of gaikwad et al , when factoring in imperfect equalization . the figures can be seen to plot overall datarate ( upstream and downstream ) versus loop length , for values of residual echo ranging from 20 db to 60 db . in summary explanation , a power distribution scheme for optimization channel capacity significantly outperforms the scheme taught by gaikwad et al ., when the imperfect echo cancellation capabilities of practical xdsl systems are factored into the scheme . the reason for this is straightforward . both optimization techniques choose between eqpsd and fds signaling in a fashion that maximizes overall datarate . in regions where self - next is high , capacity is greater by cutting the bandwidth in half , and using fds signaling , rather by using the full bandwidth and using eqpsd signaling . generally , the shorter the loop length , the smaller the effect of self - next , and hence the less need for fds signaling . the spectra of xdsl environments with shorter loop lengths are characterized by larger eqpsd regions than those with longer loop lengths . this is clearly seen by the data in the last rows of both tables 1 and 2 . it can also be clearly seen that generally , the eeqpsd to fds crossover point occurs at higher tones for shorter loop lengths . finally , it can be seen that when the echo becomes increasingly small , both techniques converge to the same spectra . this is due to the fact that echo has a smaller effect on system performance here , and does not adversely affect performance as much as it normally would in the eqpsd regions . as shown herein before , the residual echo in the system acts in a manner similar to self - next . when considering , for example , a region having low self - next , but in which the echo is high ( relative to signal power ), this is similar to a region in which there is high self - next for the present optimization scheme . as a result , rather than choosing eqpsd signaling ( since there is low self - next ), the present optimization scheme chooses fds signaling . the scheme taught by gaikwad et al ., however , does not factor in echo into the optimization process ; and in the same situation , it sees a region with small self - next and more inaccurately chooses eqpsd signaling . as demonstrated herein before , for shorter loop lengths , the performance of the scheme taught by gaikwad et al . falls far from the scheme discussed herein in association with the present invention . this is because the echo cancelled region is much larger than it should be ( hence the system sees much more echo noise ). looking again at tables 1 and 2 , it can be seen that when the residual echo is less than 40 db smaller than the signal power , the optimal spectra solely consist of an fds region . the examples set forth herein before demonstrate that at 50 db , an eqpsd region becomes noticeable using the present scheme ( in reality , it becomes noticeable somewhere in between the 40 db and 50 db range ). this transition point occurs when the residual echo becomes roughly the same magnitude as the self - next transfer function ( which for adsl , at the frequencies close to zero is roughly 10 โ 6 ). when the echo is much larger than this , it swamps out the self - next and forces the system to choose an fds solution . this observation is important since it provides some insight into system design . in situations , for example , when echo canceller performance is poor enough to swamp out the self - next transfer function , an fds solution would almost entirely be seen . in this situation then , it would not make sense to include the extra hardware on the modem for echo cancellation capability ( when it would not provide any increased gain performance to the system ), therefore providing reduced system costs . the optimal solution for this situation is simply the modified waterfilling solution described herein before ( rather than the fixed psd masks used by present systems ). in view of the foregoing discussion of the preferred embodiments of the optimal power distribution methods in the presence of crosstalk and imperfect echo cancellation , it can be seen that knowledge of the optimal solution when factoring echo canceller performance is of great use . when echo canceller performance is poor and the echo swamps out the self - next transfer function , for example , an fds solution results exclusively , and has significantly better performance than a combined eqpsd and fds solution that would result using the scheme taught by gaikwad et al . this knowledge can then be used to implement systems that do not have an echo canceller if it is known that echo rejection would be poor . in situations when echo rejection is moderate ( i . e . the residual echo is roughly the same order of magnitude as self - next ), the present technique provides a solution using both eqpsd and fds signaling . this solution also provides better performance than that provided using the scheme of gaikwad et al ., as it used eqpds signaling more sparingly to keep echo noise limited , while still using eqpsd enough to maximize capacity . the optimization techniques set forth herein before in association with particular embodiments of the present invention , function with excellent echo canceller performance to provide a solution that converges to the same as that provided by the gaikwad et al . scheme , which is expected as the effect of echo becomes increasingly negligible . in view of the above , it can be seen the present invention presents a significant advancement in the art of power distribution methods for communication systems . further , this invention has been described in considerable detail in order to provide those skilled in the xdsl and wireless communication arts with the information needed to apply the novel principles and to construct and use such specialized components as are required . in view of the foregoing descriptions , it should be apparent that the present invention represents a significant departure from the prior art in construction and operation . however , while particular embodiments of the present invention have been described herein in detail , it is to be understood that various alterations , modifications and substitutions can be made therein without departing in any way from the spirit and scope of the present invention , as defined in the claims which follow . | 7 |
in one aspect the invention is directed to the crystalline anhydrous form ii of the compound structural formula a in another aspect , the invention is directed to the crystalline anhydrous form ii of the compound structural formula a characterized by diffraction peaks obtained from the x - ray powder diffraction pattern corresponding to d - spacings of 7 . 7 , 4 . 9 and 3 . 9 angstroms . within this aspect , is the genus wherein the crystalline anhydrous form ii of the compound structural formula a further characterized by diffraction peaks obtained from the x - ray powder diffraction pattern corresponding to d - spacings of 5 . 3 , 4 . 6 and 3 . 9 angstroms . within this aspect is the genus wherein the crystalline anhydrous form ii of the compound structural formula a further characterized by diffraction peaks obtained from the x - ray powder diffraction pattern corresponding to d - spacings of 4 . 2 , 3 . 8 and 2 . 8 angstroms . in another aspect , the invention is directed to the crystalline anhydrous form ii of the compound structural formula a characterized by the x - ray powder diffraction pattern of fig6 . in another aspect , the invention is directed to the crystalline anhydrous form ii of the compound structural formula a characterized by a solid - state fluorine - 19 mas nuclear magnetic resonance spectrum showing signal at โ 60 . 4 , โ 63 . 4 , and โ 115 . 3 ppm , in another aspect the invention is directed to the crystalline anhydrous form ii of the compound structural formula a characterized by the solid - state fluorine - 19 mas nuclear magnetic resonance spectrum of fig8 . in another aspect , the invention is directed to the crystalline anhydrous form ii of the compound structural formula a within this aspect , the invention is further characterized by a peak temperature of 220 . 3 ยฐ c . within this aspect the invention is further characterized by an enthalpy change of 71 . 7 j / g . freebase of compound of structural formula a can exist in two anhydrous crystalline forms , form i and form ii . form i and form ii are enantiotropic with form i thermodynamically more stable at temperatures below 72 ยฐ c . and form ii thermodynamically more stable at temperatures above 72 ยฐ c . fig1 is a characteristic x - ray diffraction pattern of the crystalline anhydrous freebase form i of compound a . fig2 is a carbon - 13 cross - polarization magic - angle spinning ( cpmas ) nuclear magnetic resonance ( nmr ) spectrum of the crystalline anhydrous freebase form i of compound a . fig3 is a fluorine - 19 magic - angle spinning ( mas ) nuclear magnetic resonance ( nmr ) spectrum of the crystalline anhydrous freebase form i of compound a . fig4 is a typical dsc curve of the crystalline anhydrous freebase form i of compound a . fig5 is a typical thermogravimetric ( tg ) curve of the crystalline anhydrous freebase form i of compound a . fig6 is a characteristic x - ray diffraction pattern of the crystalline anhydrous freebase form ii of compound a . fig7 is a carbon - 13 cross - polarization magic - angle spinning ( cpmas ) nuclear magnetic resonance ( nmr ) spectrum of the crystalline anhydrous freebase form ii of compound a . fig8 is a fluorine - 19 magic - angle spinning ( mas ) nuclear magnetic resonance ( nmr ) spectrum of the crystalline anhydrous freebase form ii of compound a . fig9 is a typical dsc curve of the crystalline anhydrous freebase form ii of compound i . fig1 is a typical thermogravimetric ( tg ) curve of the crystalline anhydrous freebase form ii of compound a . table : major peaks for form i from fig1 are as shown below ( wavelength cu kalpha ). major peaks for form ii from fig6 are as shown below ( wavelength cu kalpha ): x - ray powder diffraction studies are widely used to characterize molecular structures , crystallinity , and polymorphism . the x - ray powder diffraction patterns of the crystalline anhydrous freebase of the present invention were generated on a philips analytical x &# 39 ; pert pro x - ray diffraction system with pw3040 / 60 console . a pw3373 / 00 ceramic cu lef x - ray tube k - alpha radiation was used as the source . fig1 shows the x - ray diffraction pattern for the crystalline anhydrous freebase form i of compound ai . the crystalline anhydrous freebase form i exhibited characteristic reflections corresponding to d - spacings of 10 . 4 , 5 . 5 , and 4 . 1 angstroms . the crystalline anhydrous freebase form i was further characterized by reflections corresponding to d - spacings of 9 . 9 , 9 . 2 and 5 . 0 angstroms . the crystalline anhydrous freebase form i was even further characterized by reflections corresponding to d - spacings of 3 . 9 , 3 . 6 , and 3 . 5 angstroms . in addition to the x - ray powder diffraction patterns described above , the crystalline anhydrous freebase of compound a was further characterized by solid - state carbon - 13 nuclear magnetic resonance ( nmr ) spectra . the solid - state carbon - 13 nmr spectra were obtained on a bruker dsx 500wb nmr system using a bruker 4 mm h / x / y cpmas probe . the carbon - 13 nmr spectra utilized proton / carbon - 13 cross - polarization magic - angle spinning with variable - amplitude cross polarization , total sideband suppression , and spinal decoupling at 100 khz . the samples were spun at 10 . 0 khz , and a total of 1500 scans were collected with a recycle delay of 5 seconds . a line broadening of 10 hz was applied to the spectra before ft was performed . chemical shifts are reported on the tms scale using the carbonyl carbon of glycine ( 176 . 03 p . p . m .) as a secondary reference . the crystalline forms were further characterized by solid state fluorine - 19 nmr . the solid - state fluorine - 19 nmr spectra were obtained on a bruker dsx 500wb nmr system using a bruker 4 mm h / f / x cpmas probe . the fluorine - 19 nmr spectra utilized a simple puse - acquire pulse program . the sample was spun at 15 . 0 khz , and a total of 64 scans were collected with a recycle delay of 5 seconds . a line broadening of 10 hz was applied to the spectrum before ft was performed . chemical shifts are reported using poly ( tetrafluoroethylene ) ( teflon ยฎ) as an external secondary reference which was assigned a chemical shift of โ 122 ppm . fig2 shows the solid - state carbon - 13 cpmas nmr spectrum for the crystalline anhydrous freebase form i of compound a . the crystalline anhydrous freebase form i exhibited characteristic signals with chemical shift values of 27 . 5 , 44 . 6 , and 147 . 1 p . p . m . further characteristic of the crystalline anhydrous freebase form i are the signals with chemical shift values of 32 . 9 , 83 . 7 , and 161 . 8 p . p . m . the crystalline anhydrous freebase form i is even further characterized by signals with chemical shift values of 53 . 9 , 75 . 0 , and 136 . 2 p . p . m . fig3 shows the solid - state fluorine - 19 mas nmr spectrum for the crystalline anhydrous freebase form i of compound a . the crystalline anhydrous freebase form i exhibited characteristic signal with chemical shift value of โ 61 . 3 , โ 63 . 1 , and โ 112 . 2 p . p . m . dsc data were acquired using ta instruments dsc 2910 or equivalent instrumentation was used . between 1 and 6 mg sample was weighed into an open pan . this pan was then placed at the sample position in the calorimeter cell . an empty pan was placed at the reference position . the calorimeter cell was closed and a flow of nitrogen was passed through the cell . the heating program was set to heat the sample at a heating rate of 10 ยฐ c ./ min to a temperature of approximately 250 ยฐ c . the heating program was started . when the run was completed , the data were analyzed using the dsc analysis program contained in the system software . the melting endotherm was integrated between baseline temperature points that are above and below the temperature range over which the endotherm was observed . the data reported are the onset temperature , peak temperature and enthalpy . thermogravimetric ( tg ) data were acquired using a perkin elmer model tga 7 or equivalent instrumentation . experiments were performed under a flow of nitrogen and using a heating rate of 10 ยฐ c ./ min to a maximum temperature of approximately 300 ยฐ c . after automatically taring the balance , 5 to 20 mg of sample was added to the platinum pan , the furnace was raised , and the heating program started . weight / temperature data were collected automatically by the instrument . analysis of the results was carried out by selecting the delta y function within the instrument software and choosing the temperatures between which the weight loss was to be calculated . weight losses are reported up to the onset of decomposition / evaporation . fig4 shows the differential calorimetry scan for the crystalline anhydrous freebase form i of compound a . the crystalline anhydrous freebase form i exhibited an endotherm due to melting with an onset temperature of 216 . 6 ยฐ c ., a peak temperature of 217 . 8 ยฐ c ., and an enthalpy change of 90 . 9 j / g . fig5 shows a characteristic thermogravimetric analysis ( tga ) curve for the crystalline anhydrous freebase form i of compound a . tga indicated a weight loss of about 0 . 1 % from ambient temperature to about 228 ยฐ c . fig6 shows the x - ray diffraction pattern for the crystalline anhydrous freebase form ii of compound a . the crystalline anhydrous freebase form ii exhibited characteristic reflections corresponding to d - spacings of 7 . 7 , 4 . 9 , and 4 . 8 angstroms . the crystalline anhydrous freebase was further characterized by reflections corresponding to d - spacings of 5 . 3 , 4 . 6 , and 3 . 9 angstroms . the crystalline anhydrous freebase form ii was even further characterized by reflections corresponding to d - spacings of 4 . 2 , 3 . 8 , and 2 . 8 angstroms . fig7 shows the solid - state carbon - 13 cpmas nmr spectrum for the crystalline anhydrous freebase form i of compound a . the crystalline anhydrous freebase form i exhibited characteristic signals with chemical shift values of 28 . 2 , 81 . 6 , and 129 . 8 p . p . m . further characteristic of the crystalline anhydrous freebase form i are the signals with chemical shift values of 74 . 5 , 149 . 1 , and 201 . 0 p . p . m . the crystalline anhydrous freebase form i is even further characterized by signals with chemical shift values of 43 . 7 , 100 . 4 , and 129 . 8 p . p . m . fig8 shows the solid - state fluorine - 19 mas nmr spectrum for the crystalline anhydrous freebase form ii of compound a . the crystalline anhydrous freebase form ii exhibited characteristic signal with chemical shift value of โ 60 . 4 , โ 63 . 4 , and โ 115 . 3 p . p . m . fig9 shows the differential calorimetry scan for the crystalline anhydrous freebase form ii of compound a . the crystalline anhydrous freebase form ii exhibited an endotherm due to melting with an onset temperature of 218 . 0 ยฐ c ., a peak temperature of 220 . 3 ยฐ c ., and an enthalpy change of 71 . 7 j / g . the compounds of the present invention are useful in the prevention and treatment of a wide variety of clinical conditions which are characterized by the presence of an excess of tachykinin , in particular substance p , activity . thus , for example , an excess of tachykinin , and in particular substance p , activity is implicated in a variety of disorders of the central nervous system . such disorders include mood disorders , such as depression or more particularly depressive disorders , for example , single episodic or recurrent major depressive disorders and dysthymic disorders , or bipolar disorders , for example , bipolar i disorder , bipolar ii disorder and cyclothymic disorder ; anxiety disorders , such as panic disorder with or without agoraphobia , agoraphobia without history of panic disorder , specific phobias , for example , specific animal phobias , social phobias , obsessive - compulsive disorder , stress disorders including post - traumatic stress disorder and acute stress disorder , and generalized anxiety disorders ; schizophrenia and other psychotic disorders , for example , schizophreniform disorders , schizoaffective disorders , delusional disorders , brief psychotic disorders , shared psychotic disorders and psychotic disorders with delusions or hallucinations ; delerium , dementia , and amnestic and other cognitive or neurodegenerative disorders , such as alzheimer &# 39 ; s disease , senile dementia , dementia of the alzheimer &# 39 ; s type , vascular dementia , and other dementias , for example , due to hiv disease , head trauma , parkinson &# 39 ; s disease , huntington &# 39 ; s disease , pick &# 39 ; s disease , creutzfeldt - jakob disease , or due to multiple aetiologies ; parkinson &# 39 ; s disease and other extra - pyramidal movement disorders such as medication - induced movement disorders , for example , neuroleptic - induced parkinsonism , neuroleptic malignant syndrome , neuroleptic - induced acute dystonia , neuroleptic - induced acute akathisia , neuroleptic - induced tardive dyskinesia and medication - induced postural tremour ; substance - related disorders arising from the use of alcohol , amphetamines ( or amphetamine - like substances ) caffeine , cannabis , cocaine , hallucinogens , inhalants and aerosol propellants , nicotine , opioids , phenylglycidine derivatives , sedatives , hypnotics , and anxiolytics , which substance - related disorders include dependence and abuse , intoxication , withdrawal , intoxication delerium , withdrawal delerium , persisting dementia , psychotic disorders , mood disorders , anxiety disorders , sexual dysfunction and sleep disorders ; epilepsy ; down &# 39 ; s syndrome ; demyelinating diseases such as ms and als and other neuropathological disorders such as peripheral neuropathy , for example diabetic and chemotherapy - induced neuropathy , and postherpetic neuralgia , trigeminal neuralgia , segmental or intercostal neuralgia and other neuralgias ; and cerebral vascular disorders due to acute or chronic cerebrovascular damage such as cerebral infarction , subarachnoid haemorrhage or cerebral oedema . tachykinin , and in particular substance p , activity is also involved in nociception and pain . the compounds of the present invention will therefore be of use in the prevention or treatment of diseases and conditions in which pain predominates , including soft tissue and peripheral damage , such as acute trauma , osteoarthritis , rheumatoid arthritis , musculo - skeletal pain , particularly after trauma , spinal pain , myofascial pain syndromes , headache , episiotomy pain , and burns ; deep and visceral pain , such as heart pain , muscle pain , eye pain , orofacial pain , for example , odontalgia , abdominal pain , gynaecological pain , for example , dysmenorrhoea , and labour pain ; pain associated with nerve and root damage , such as pain associated with peripheral nerve disorders , for example , nerve entrapment and brachial plexus avulsions , amputation , peripheral neuropathies , tic douloureux , atypical facial pain , nerve root damage , and arachnoiditis ; pain associated with carcinoma , often referred to as cancer pain ; central nervous system pain , such as pain due to spinal cord or brain stem damage ; low back pain ; sciatica ; ankylosing spondylitis , gout ; and scar pain . tachykinin , and in particular substance p , antagonists may also be of use in the treatment of respiratory diseases , particularly those associated with excess mucus secretion , such as chronic obstructive airways disease , bronchopneumonia , chronic bronchitis , cystic fibrosis and asthma , adult respiratory distress syndrome , and bronchospasm ; inflammatory diseases such as inflammatory bowel disease , psoriasis , fibrositis , osteoarthritis , rheumatoid arthritis , pruritis and sunburn ; allergies such as eczema and rhinitis ; hypersensitivity disorders such as poison ivy ; ophthalmic diseases such as conjunctivitis , vernal conjunctivitis , and the like ; ophthalmic conditions associated with cell proliferation such as proliferative vitreoretinopathy ; cutaneous diseases such as contact dermatitis , atopic dermatitis , urticaria , and other eczematoid dermatitis . tachykinin , and in particular substance p , antagonists may also be of use in the treatment of neoplasms , including breast tumours , neuroganglioblastomas and small cell carcinomas such as small cell lung cancer . tachykinin , and in particular substance p , antagonists may also be of use in the treatment of gastrointestinal ( gi ) disorders , including inflammatory disorders and diseases of the gi tract such as gastritis , gastroduodenal ulcers , gastric carcinomas , gastric lymphomas , disorders associated with the neuronal control of viscera , ulcerative colitis , crohn &# 39 ; s disease , irritable bowel syndrome and emesis , including acute , delayed or anticipatory emesis such as emesis induced by chemotherapy , radiation , toxins , viral or bacterial infections , pregnancy , vestibular disorders , for example , motion sickness , vertigo , dizziness and meniere &# 39 ; s disease , surgery , migraine , variations in intercranial pressure , gastro - oesophageal reflux disease , acid indigestion , over indulgence in food or drink , acid stomach , waterbrash or regurgitation , heartburn , for example , episodic , nocturnal or meal - induced heartburn , and dyspepsia . tachykinin , and in particular substance p , antagonists may also be of use in the treatment of a variety of other conditions including stress related somatic disorders ; reflex sympathetic dystrophy such as shoulder / hand syndrome ; adverse immunological reactions such as rejection of transplanted tissues and disorders related to immune enhancement or suppression such as systemic lupus erythematosus ; plasma extravasation resulting from cytokine chemotherapy , disorders of bladder function such as cystitis , bladder detrusor hyper - reflexia , frequent urination and urinary incontinence , including the prevention or treatment of overactive bladder with symptoms of urge urinary incontinence , urgency , and frequency ; fibrosing and collagen diseases such as scleroderma and eosinophilic fascioliasis ; disorders of blood flow caused by vasodilation and vasospastic diseases such as angina , vascular headache , migraine and reynaud &# 39 ; s disease ; and pain or nociception attributable to or associated with any of the foregoing conditions , especially the transmission of pain in migraine . the compounds of the present invention are also of value in the treatment of a combination of the above conditions , in particular in the treatment of combined post - operative pain and post - operative nausea and vomiting . the compounds of the present invention are particularly useful in the prevention or treatment of emesis , including acute , delayed or anticipatory emesis , such as emesis induced by chemotherapy , radiation , toxins , pregnancy , vestibular disorders , motion , surgery , migraine , and variations in intercranial pressure . for example , the compounds of the present invention are of use optionally in combination with other antiemetic agents for the prevention of acute and delayed nausea and vomiting associated with initial and repeat courses of moderate or highly emetogenic cancer chemotherapy , including high - dose cisplatin . most especially , the compounds of the present invention are of use in the treatment of emesis induced by antineoplastic ( cytotoxic ) agents , including those routinely used in cancer chemotherapy , and emesis induced by other pharmacological agents , for example , rolipram . examples of such chemotherapeutic agents include alkylating agents , for example , ethyleneimine compounds , alkyl sulphonates and other compounds with an alkylating action such as nitrosoureas , cisplatin and dacarbazine ; antimetabolites , for example , folic acid , purine or pyrimidine antagonists ; mitotic inhibitors , for example , vinca alkaloids and derivatives of podophyllotoxin ; and cytotoxic antibiotics . particular examples of chemotherapeutic agents are described , for instance , by d . j . stewart in nausea and vomiting : recent research and clinical advances , eds . j . kucharczyk et al , crc press inc ., boca raton , fla ., usa ( 1991 ) pages 177 - 203 , especially page 188 . commonly used chemotherapeutic agents include cisplatin , dacarbazine ( dtic ), dactinomycin , mechlorethamine , streptozocin , cyclophosphamide , carmustine ( bcnu ), lomustine ( ccnu ), doxorubicin ( adriamycin ), daunorubicin , procarbazine , mitomycin , cytarabine , etoposide , methotrexate , 5 - fluorouracil , vinblastine , vincristine , bleomycin and chlorambucil [ r . j . gralla et al in cancer treatment reports ( 1984 ) 68 ( 1 ), 163 - 172 ]. a further aspect of the present invention comprises the use of a compound of the present invention for achieving a chronobiologic ( circadian rhythm phase - shifting ) effect and alleviating circadian rhythm disorders in a mammal . the present invention is further directed to the use of a compound of the present invention for blocking the phase - shifting effects of light in a mammal . this reaction gives consistently high yield and high purity of material . no major side products have been identified . the final product is an oil ( typically clear or slightly yellow ) and is isolated with the above purity profile from the crude work up . a 100 l extractor equipped with a reflux condenser , and a base scrubber was charged with toluene ( 49 . 2 l , kf โฆ 100 ppm ) and 4 - fluorophenylacetic acid ( 1 ) was added ( 5 . 0 kg ). this solution was heated to 70 ยฐ c . once 70 ยฐ c . was reached the dmf ( 48 ml , kf โฆ 150 ppm ) was added and thionyl chloride ( 2 . 8 l ) was slowly added over 3 hours . batch temperature will decrease while thionyl chloride is added . typical temperature changes range from 6 - 10 ยฐ c . when all thionyl chloride has been added and off - gassing has ceased ( typically 30 min . after addition is complete ) an aliquot of the batch was quenched into excess methanol for hplc analysis as the methyl ester . next the reaction was cooled to 5 - 10 ยฐ c . the weinreb amine - hcl ( 4 . 75 kg ) was added to the batch at this point . slow addition of naoh ( 32 . 5 l ) was begun at this point . this base was added at a rate that maintained the batch temperature at or below 10 ยฐ c . with a typical addition time of 3 hours . once this addition was done an aliquot of the batch was quenched into meoh and assayed by hplc to check for complete consumption of the acid chloride . complete consumption of the acid chloride ( in the form of the methyl ester after this quench ) should be seen . additional base can be added if the acid chloride is still present . the biphasic solution was separated at between 5 ยฐ c . and room temperature and the organic phase was washed with 15 wt . % nacl ( aq ) ( 2 ร 32 . 5 l ). the organic phase was concentrated to a 50 wt . % solution ( typical kf โฆ 500 ppm ). this reaction is very sensitive to the quality of the grignard reagent and the quench method . major side products have been identified ( a , b , c ), and are shown above . the product is unstable when concentrated to an oil , and has moderate stability in solution . the final toluene solution should be kept cold and used in the next step without delay . a 3 l round bottom flask equipped with an addition funnel was charged with the weinreb amide 2 as a 61 % wt solution in toluene ( 262 g tot mass ; 157 . 2 g 2 , 105 g toluene ). this solution was diluted to a 0 . 5 m solution of amide 2 in toluene by addition of 1 . 32 l of toluene ( kf of solution & lt ; 150 ppm ). this solution was cooled to โ 30 ยฐ c ., and vinyl magnesium chloride was slowly added . during the addition of vinyl magnesium chloride the batch temperature is maintained at โ 30 ยฐ c . typical addition time is around 60 minutes . after the vinyl grignard addition was complete the reaction was allowed to age at โ 30 ยฐ c . for 60 minutes . the reaction was checked by hplc after this 60 minute age . acetic anhydride ( 151 ml ) was then slowly added to the reaction . batch temperature is maintained at โ 30 ยฐ c . during this addition to avoid impurities . typical time is 30 minutes . assay of the reaction at the end of this addition typically shows approximately 0 . 5 % lcap of impurity b when compared to product . in a separate 5 l 3 - neck round bottom flask a 2 . 5 wt % solution of nh 4 cl in water ( 1 . 29 l ) was cooled to 10 ยฐ c . the batch at โ 30 ยฐ c . was cannulated to this vigorously stirred ammonium chloride solution . the final temperature of the batch is typically around 12 - 13 ยฐ c . when the batch had reached ambient temperature the aqueous and organic layers were cut . the organic layer was then washed with water ( 1 . 3 l ). the organic layer was dried with mgso 4 powder (ห 100 - 200 g ) until the kf of this solution reached at or below 1000 ppm . the solids were filtered away and washed with dry mecn ( 4 ร 50 ml ) to provide a solution of the product in thf / mecn / toluene (ห 2 . 0 l , kf ห 970 ppm , 1 . 80 kg , 7 . 29 wt %, 131 g of 3 , 100 % yield ) which was used directly in the next step . the impurity profile shows 1 . 5 lcap of impurity b and 9 . 1 lcap of impurity c . to 90 . 8 g of the 7 . 29 wt % enone 3 solution in thf / mecn / toluene obtained from step 2 at rt was added more dry mecn ( 18 ml ) and ipr 2 net . tescl was then added slowly while maintaining rt . the solution was stirred at rt until lc revealed complete conversion (ห 16 h ). the reaction was quenched with 2 wt % aq nh 4 cl ( 70 ml ). the organic layer was separated and washed with water ( 70 ml ). it was then concentrated and flushed with toluene to ห 37 wt % with a kf of ห 200 ppm . assay yield : 8 . 64 g , 77 %. nmr shows & lt ; 5 % of the e - isomer . to a 3 - neck flask was charged toluene ( 500 ml ) and (โ)- menthol ( 157 . 8 g ). the solution was cooled to โ 20 ยฐ c . and fumaryl chloride ( 80 . 5 g of 95 %) was charged with 80 ml toluene flush ( no exotherm was observed ). i - pr 2 net ( 191 ml ) was added over 30 min ( fuming ) with 20 ml toluene flush at โ 20 ยฐ c . dmap was added immediately afterwards . the dark slurry was then allowed to warm to 21 ยฐ c . over ห 60 min to give a dark solution , which showed complete conversion by hplc . at room temperature , a mild exotherm caused the temperature to rise to ห 30 ยฐ c . it will be desirable to age at โ 20 to 0 ยฐ c . for 1 - 2 h before warming up to rt . 600 ml of aqueous 3 % nacl was added . the aqueous layer (ห 800 ml ) was cut away and the organic layer was washed with 800 ml aqueous 0 . 15 n hcl containing 5 wt % nacl . the dark organic layer (ห 800 ml , 710 g ) showed 93 % assay yield ( 182 g , 0 . 464 mol product in 98lcap ) and was concentrated to 378 g ( 48 wt %) for direct use in the diels - alder reaction . 1 h nmr showed non - detectable menthol . the toluene solutions of diene 4 ( 23 . 4 g , 37 wt %) and dimenthylfumarate 5 ( 30 . 4 g , 48 wt %) were combined and cooled to 0 ยฐ c . diethylaluminum chloride solution in toluene ( 1 . 8 m , 29 . 3 ml ) was added over 45 min , keeping the temperature below 5 ยฐ c . ( exothermic addition ). the dark orange solution was aged at 0 ยฐ c . for 18 h (ห 90 % conversion ), and then at 21 ยฐ c . for 6 h when it reached & gt ; 95 % conversion . if the desired conversion was not achieved , more lewis acid ( and dimenthyl fumarate if necessary ) could be added at any point of the reaction . the reaction mixture was carefully quenched with aqueous 3 n hcl ( 8 ml ) over & gt ; 60 min while keeping the temperature at 15 - 25 ยฐ c . it is important to add this first portion of hcl very slowly without any bursts . although the batch is not very sensitive to heat , rapid off - gassing and foaming upon addition of hcl could result in a disastrous overflow of the batch . the foaming needs to be watched very closely . the remaining hcl ( 3n , 44 . 7 ml ) was added slowly while keeping temperature at 15 - 25 ยฐ c ., and the resulting mixture was aged for 30 min at rt . the aqueous layer was removed , and the organic layer was washed with 1 n aq hcl ( 2 ร 50 ml ) and 0 . 5 n aq naoh ( 50 ml ). the toluene solution was used directly in the next step any e - isomer of the diene (& lt ; 5 %) which is present does not react in the diels - alder reaction . a small amount of deprotected products 7 could form in the organic layer during the work - up . the toluene solution from step 5 was concentrated to remove all solvents , flushed with acetonitrile , to give 210 ml slurry in acetonitrile . aqueous 6 n hcl ( 6 . 2 ml ) was added . the slurry was stirred at room temperature for ห 2 h , at which point hplc indicated that the reaction was complete . the desilylation initially gave a mixture of 2 , 3 - cis and 2 , 3 - trans ketones , which , driven by crystallization of desired 7 , isomerized to predominantly trans . after aging , filtration followed by 3 ร 51 . 4 ml ( 3 . 5 volumes ) acetonitrile slurry washes and drying in vacuo overnight at 60 ยฐ c . yields a white solid ( 15 . 3 g , 98 . 6 wt %, 87 % yield ). add 22 l thf to a 100 l rbf with an inert atmosphere . cool the flask to โ 40 ยฐ c . and add li ( o - tbu ) 3 alh . charge ketone 1 as a solid with a thf ( 3 l ) rinse while keeping temp & lt ;โ 25 ยฐ c . stir at โ 30 to โ 35 ยฐ c . until & lt ; 5 % starting material remains ( all solid dissolves ), approximately 2 - 3 hours . the trans / cis ratio is typically ห 25 . warm the reaction mixture to หโ 20 ยฐ c . and add lialh 4 . allow the batch warm up to ห 10 ยฐ c . and apply cooling to keep the temperature & lt ; 30 ยฐ c . stir the reaction mixture at room temperature until observing complete reduction to the triol (& lt ; 0 . 5 % desired diol 1 b left ), & gt ; 3 hours . cool the batch to ห 0 ยฐ c . and reverse quench slowly into 6 . 0 n hcl ( 23 . 5 l ) while keeping the temperature & lt ; 40 ยฐ c . use 2 l thf to rinse the reaction vessel . caution ! significant h 2 off - gassing and exotherm will occur over the entirety . two clear layers should form if settling occurs . concentrate the quenched solution to ห 30 l ( 4 . 3v ) ( water starts to condense at this point ). add heptane ( 35 l ) followed by 6 . 0 l 6 . 0 n hcl and 8 . 9 l 12 . 0n hcl to dissolve a rag layer . cut and keep the aqueous layer (ห 40 l ) ( org layer ห 43 l ), being certain to keep any rag (& lt ; 250 ml ) with the aqueous . assay each layer to ascertain the menthol distribution , which should show & lt ; 2 % remaining in the aqueous . charge the aq layer back to the extractor with 1 l water rinse . titrate to ph ห 1 . 5 - 2 with ห 14 l 10n naoh while keeping temperature & lt ; 30 ยฐ c . ( charge 12 l first , followed by 0 . 5 l portions ; ph is ห 0 after 13 l is charged ; it could take ห 10 - 15 min for ph meter to give a stable ph reading .). add 39 l etoac and stir vigorously for 30 min . make sure ph is ห 1 . 5 - 2 , otherwise add 10 n naoh or conc hcl in 250 ml portions to adjust the ph . allow 1 - 2 h for the emulsion layer to break up . cut and keep the aqueous ( 50 l ), which should show ห 14 % product remaining . drum off the organic ( 41 l ) followed by addition of collidine ( 35 ml ) to adjust to ph ห 4 - 4 . 5 . repeat the extraction once more with 39 l etoac ( faster settling this time ). the aqueous layer should show ห 2 % product remaining and is discarded . a ph of โ 0 . 4 would result in slow decomposition of the triol , possible to acetate at ห 0 . 1 %/ h . a higher ph to ห 1 . 8 - 2 . 0 reduces the aq solubility of triol , but too high a ph would result in gel formation ( al ( oh ) 3 ?). the triol solution in etoac is stable at ph 1 . 4 - 5 at rt and at ph 4 - 5 at 45 ยฐ ( 8 days ). concentrate the combined organic layers and flush with etoac to ห 9 l with a kf & lt ; 1000 ppm . drum off with an inline filter with 3 l mecn rinse . expected yield : 2 . 91 kg of trans - triol ( 91 % y ), 3 . 02 kg total triols ( trans / cis ห 25 ). the resulting solution is stable at rt for & gt ; 9 days and at 50 ยฐ c . for & gt ; 4 days . charge the triol solution ( containing 4 . 34 kg active triol + 0 . 23 kg of other triols and ห 8 . 7 l etoac + 4 l mecn , kf ห 2000 ppm , equiv 10 mol % h 2 o ), mecn ( 14 l ) and n - prso 2 cl to a 100 l extractor . cool the solution to 15 ยฐ c . and add collidine all in one portion . apply cooling to keep the reaction temperature at 18 - 21 ยฐ c . a slurry forms within 30 min . monitor the reaction by lc every hour after 2 h mark until no starting material and & lt ; 2 . 5 % of the mono - sulfonates 2a + b are left ( typically 4 - 6 hours ). leaving the reaction run for longer leads to more tri - sulfonate c formation . after 230 min ( 2a + b : 120 min โ 14 . 4 a %, 180 min โ 4 . 6 a %, 210 min โ 1 . 4 a %, non - sm related peaks - collidine , etoac , n - prso 2 cl โ are not integrated ), quench the reaction with 1 n hcl ( 21 . 6 l ) and add 14 l more etoac the quench is slightly endothermic to ห 15 ยฐ c . and then back to ห 18 ยฐ c . cut away the bottom aqueous layer (ห 34 l ). wash the organic layer with 10 % nacl ( 38 l ) combined with 50 % v / v hcl ( 6 . 0 n , 0 . 50 l ) to remove any residual collidine . cut away the bottom aq layer (ห 41 l ) and add naoh ( 1 n , 30 l , removing prso 2 cl ) to the organic layer while keeping temperature & lt ; 27 ยฐ c . stir for 15 min and let the layers settle . cut away the aq layer (ห 36 l ) and wash the organic layer , which should show & lt ; 2 mol % of n - prso 2 cl left , with 6 % nacl ( 20 l ). cut away the aq layer (ห 24 l ) and collect the organic layer ( 25 . 6 kg ) with 1 l etoac rinse and assay for yield ( 6 . 80 kg 3 , 85 %). it is then concentrated to an oil , flushed with 20 l cyclohexane to an oil and then with 30 l ch 2 cl 2 to ห 10 l ( transfer the solution to a new flask via an inline filter after 15 l ch 2 cl 2 is used and then continue the distillation ), when kf should be & lt ; 250 ppm and etoac & lt ; 8 mol % by lc . to a 100 liter flask containing 27 l of a 4 : 1 mixture of cyclohexane / ch 2 cl 2 was added 8 . 0 kg of ( s )- btba as a solid and the sides of the flask were rinsed with an additional 10 . 3 l of 4 : 1 mixture of cyclohexane / ch 2 cl 2 . to the resulting slurry was added 4 . 92 kg ( 3 . 42 liters ) of trichloroacetonitrile followed by 92 . 2 ml of dbu . the reaction mixture was aged at rt for 5 . 5 h and assayed for completion . the reaction mixture was then transferred to a 100 liter extractor rinsing the reaction flask with cyclohexane . the mixture was washed with 27 liters of water and then with 27 liters of brine . the organic layer was then filtered over a small plug of solka floc and azetropically distilled under reduced pressure ( 24 mmhg , internal temp & lt ; 35 ยฐ c .) and a final volume of ห 15 liters and a kf & lt ; 200 . assay yield = 12 . 00 kg ( 96 . 2 %). charge the ch 2 cl 2 solution of the cyclohexanol 3 ( containing 6 . 73 kg active 3 +ห 0 . 78 kg of related other alcohols and ห 6 l ch 2 cl 2 , kf & lt ; 250 ppm , equiv & lt ; 1 . 2 mol % h 2 o ) to a 100 l extractor . charge the imidate solution (ห 850 g / l in cyclohexane , ห 11 l , containing ห 2 l cyclohexane ) followed by additional cyclohexane ( 8 . 0 l ). the mixture turns cloudy due to 3 oiling out . add more ch 2 cl 2 ( 2 l ) to dissolve the oil . cool to โ 17 ยฐ c . ( oiling out at ห 0 ยฐ c .) and add more ch 2 cl 2 ( 1 . 3 l ) to dissolve the oil . the kf at this point should be & lt ; 110 ppm (& lt ; 1 . 5 mol % water ). add 0 . 17 equiv of hbf 4 ( 0 . 339 l ) in one portion , resulting in temperature rising to โ 16 ยฐ c . the slightly cloudy mixture is aged at โ 16 ยฐ c . it turns clear in ห 40 min and a slurry starts to form and thickens as the reaction proceeds to generate poorly soluble trichloroacetamide a . after aging at โ 16 ยฐ c . for 18 hours , lc assay reveals ห 82 % conv and a 5 / 5a ratio of ห 6 . for slightly higher conversion , 0 . 11 equiv more hbf 4 ( 0 . 219 l ) is added following by aging at โ 16 ยฐ c . for 4 h . the reaction is then warmed to 5 ยฐ c . and aged for 1 h before being quenched with naoh ( 2 n , 16 l ). the exotherm brings the temperature to 18 ยฐ c . after aging at rt for ห 15 min , the layers are allowed to settle . the bottom aqueous layer (ห 18 l ) is cut away and the organic layer is washed with 18 l of water . the cloudy bottom organic layer is collected ( assay yield of 5 : ห 74 %), concentrated to ห 20 l , and flushed with ipa ( 90 l ) while keeping batch temperature at ห 40 ยฐ c . and volume at ห 50 - 60 l to enable stirring as the product crystallizes out . a final volume of ห 70 l is reached and the thick slurry is aged at rt until mother liquor shows & lt ; 11 g / l loss ( 5 / 5a & lt ; 0 . 55 ). the product is then filtered , washed with ipa ( 35 l ), and dried . 7 . 07 kg , 98 a %, 96 wt %, 6 . 82 kg corrected , 67 % yield . the reaction vessel was charged with ipa ( 27 l ), allylamine ( 3 . 74 l , 50 . 0 moles ), and bis - propylsulfonate ( 6 . 79 kg , 9 . 61 moles ). at room temperature , the mixture was a very thick ( pasty ) mixture that was difficult to stir . the reaction mixture loosens up upon heating and became completely homogeneous at + 55 - 60 ยฐ c . note that allylamine was boiling at + 53 ยฐ c . the mixture was heated to + 75 - 80 ยฐ c . for 4 h , and was cooled to + 40 ยฐ c . to room temperature . one half volume of water ( 13 . 5 l ) was added and the batch was seeded ( ca . 35 g , 0 . 5 wt %). the batch may crystallize without seed but seeding gave more consistent results . the batch was aged for 30 min and the remainder of water ( 29 . 5 l ) was added over a couple hours . it was filtered , washed with 65 / 35 h2o / ipa ( 12 l ). product was dried at + 40 ยฐ c . for 24 hours under a stream of nitrogen to give 4 . 9 kg of product ( 95 % yield ). the reaction vessel was charged with thf ( 25 . 8 l ), allylamine protected pyrrolidine ( 5 . 16 kg , 10 . 0 moles ), and thiosalicylic acid ( 1 . 62 kg , 10 . 5 moles ). the reaction mixture was degassed and dppb ( 4 . 3 g , 0 . 01 mol ) was added followed by pd 2 ( dba ) 3 ( 4 . 6 g , 0 . 005 mol ) under nitrogen . the mixture was stirred at + 40 ยฐ c . for 4 h , cooled to r . t and was reverse added into a stirred biphasic mixture made of mtbe ( 41 l ) and 1 n aqueous naoh solution ( 25 . 8 l ). layers were separated and the organic was washed with water ( 2 ร 23 l ). the organic solution was concentrated under vacuum with feeding of mtbe ( in - line filtration ) with a constant volume of ca . 45 l to lower the kf to less than 5000 ppm . the mixture ( ca . 8 - 10 l mtbe / kg ) is heated to ca . + 50 ยฐ c . and acetic acid ( 10 vol %, 62 . 9 ml ) was added and the batch was seeded ( 0 . 1 wt %, 5 g ) to initiate the crystallization . it was aged at + 50 ยฐ c . for 30 minutes and remaining acetic acid ( 535 . 5 ml ) was added over ca . 1 h at + 50 ยฐ c . the salt crystallizes as a quite thick slurry but remains stirrable . it loosens up upon aging . alternatively , acetic acid can be added as an mtbe solution ( ca . 1 m ). after aging at + 50 ยฐ c . for 2 h the batch was cooled to room temperature and aged for another 2 h , it was filtered , washed with mtbe ( 8 l ) and dried at + 40 ยฐ c . under vacuum for 24 h to give 5 . 14 kg of the product ( 96 % yield ). pd was ca . 25 ppm . a 100 liter flask was charged with ipa ( 26 l ). to this was added the acetic acid salt ( 7 . 5 kg ) followed by 1 , 3 - cyclopentanedione ( 1 . 51 kg ). the sides of the flask were washed with ipa ( 4 l ) and the mixture is heated to + 75 ยฐ c . for 1 h at which point hplc indicated that the reaction was complete . to the reaction mixture was then added โ
volume of water ( 10 l ) keeping the temperature at + 60 ยฐ c . the batch was seeded ( 2 . 00 g , 0 . 02 wt %) to initiate crystallization . after aging at 50 - 60 ยฐ c . for 30 min , the mixture was cooled to 40 ยฐ c . the remaining water ( 26 l ) was added over a period of 1 . 25 h and the slurry was aged for 12 hours at rt . the batch was filtered and the wet - cake was washed with 2 bed volumes of 2 : 1 water / ipa and then 1 bed volume of water and dried overnight under vacuum / n 2 sweep . the resulting wet cake was transferred to a vacuum over and further dried at 45 ยฐ c . under vacuum with a sweep of nitrogen for 24 h to give 7 . 45 kg of api ( 98 % yield ). to a solution containing 4 . 11 g ( 8 . 64 mmol ) of crude amine starting material in 65 ml of toluene was added 1 . 02 g ( 10 . 04 mmol ) of 1 , 3 - cyclopentane dione and 164 mg ( 0 . 864 mmol ) of p - toluenesulfonic acid hydrate . the resulting mixture was heated to reflux for 3 h , cooled to rt , and concentrated under reduced pressure . to the residue was 100 ml of etoac and 100 ml of sat . nahco 3 , the layers mixed , and allowed to settle . the organic layer was dried over mgso 4 , filtered over a pad of solka floc , and the solvent removed under reduced pressure . the resulting solid was re - dissolved in 125 ml of etoac and hexane was added to a final volume of 500 ml . the resulting crystalline solid was filtered to give 2 . 84 g ( 59 %) of form ii of compound a which was characterized by physical measurements . | 2 |
referring to the accompanying drawings , certain preferred embodiments of the present invention will be explained in detail . fig3 shows a circuit for the essential portions of a memory according to a first embodiment of the present invention . the numeral 30 denotes a memory cell of the memory . the memory cell 30 includes a pair of nmos transistors 31 and 32 having cross - coupled drain to gate connections and a pair of high resistance resistors 33 and 34 which function as load resistors connected to the drain electrodes of the transistors . the other terminals of resistors 33 and 34 are connected to a suitable biasing source . the memory cell 30 also includes access transistors 35 and 36 which are connected to the drain electrodes of the nmos transistors 31 , 32 respectively , and are selected by means of a word line wl . the drain of nmos transistor 31 is connected to a bit line bl 1 through the nmos transistor 35 , while the drain of nmos transistor 32 is connected to a bit line bl 2 through the nmos transistor 36 . while other memory cells are not shown , it is to be understood that the memory cell 30 is one of a number of such memory cells connected together to form a matrix , such that a plurality of memory cells 30 are provided between a first pair of adjacent bit lines bl 1 and bl 2 in the longitudinal direction . another set of longitudinally arranged memory cells are provided between another pair of bit lines located adjacent to the first pair of bit lines . at the terminal ends of bit lines bl 1 and bl 2 associated with these memory cells 30 are pmos transistor 37 and 38 , respectively . the pmos transistors 37 and 38 serve as the variable resistors . the source sides of the pmos transistors 37 and 38 are each connected to a source voltage v dd while drain sides of the pmos transistors 37 and 38 are connected to the bit lines bl 1 and bl 2 . the gate electrodes of pmos transistors 37 and 38 are connected to a bit line load drive circuit 39 . the same applies for the other columns of the matrix ( not shown ), such that the gate electrodes of the pmos transistors are connected in common to the bit line load drive circuit 39 . a read / write signal r / w is input to the bit line load drive circuit 39 , which outputs a signal switchable between a low ( l ) level and a mid level ( m ). the levels produced depend upon the level of the r / w signal received . the bit line load drive circuit 39 may utilize , for example , a diode drop for realizing the middle or intermediate ( m ) level . referring now to fig4 the operation of the memory of the present embodiment will be explained . during the read - out time , the read / write signal r / w is brought to the low ( l ) level , that is , to the ground ( gnd ) level . the output signal of the bit - line load drive circuit 39 is then brought to the low ( l ) level , and it is applied as the pmos transistors 37 and 38 gate voltage v g , so that the pmos transistors 37 and 38 ( as the variable resistors ) are brought to the low impedance state . with the pmos transistors 37 and 38 in the low impedance state , the potential at the bit lines bl 1 and bl 2 , is raised and sense amplifiers ( not shown ) connected to these bit lines bl 1 and bl 2 are able to sense the state of memory cell 30 . the current flowing , during this time , through the pmos transistors 37 and 38 is determined by the channel conductance of the drive transistors 31 and 32 of the memory cell 30 which determines the state of the cell . during the write time , the read / write signal r / w is brought to a high ( h ) level . the output signal of the bit - line load drive circuit 39 is then set to a mid ( m ) level between the high level ( or source voltage v dd ) and a low level . as a result , the gate voltage v g is at the m level , so that the pmos transistors 37 and 38 are brought to an intermediate impedance state between the low and high impedance states . the currents flowing through pmos transistors 37 and 38 are determined by the values of the channel conductances of transistors 37 and 38 . the middle level of the gate voltage v g may be set to a level which increases the impedance of the pmos transistors 37 and 38 for reducing the power consumption during the write time . on the other hand , when the above impedance is lowered , a so - called rush current at the transition time from writing to read - out may be reduced . since the bit lines bl 1 and bl 2 are connected to the drain sides of the pmos transistors 37 and 38 , no problems will arise in the circuit operation or performance . that is , there is no voltage drop at the bit lines such as is caused with the use of the nmos transistors as in the prior art memory discussed above . it is therefore possible to prevent destruction of the memory cell data caused by a voltage drop at the bit line . fig5 shows a first embodiment of the bit line load drive circuit 39 of the present invention . the gate voltage v g supplied to the gates of the pmos transistors 37 and 38 is determined by the diode configured nmos transistors 51 and 52 which are connected in series to the circuit ground through an nmos transistor 53 . the read / write ( r / w ) signal is applied to the gate of the nmos transistor 53 for turning it on or off in a controlled manner . the second embodiment is shown in fig6 . the memory cell 60 is constructed similar to memory cell 30 . the memory cell 60 is also connected between the bit lines bl 1 and bl 2 . as with the memory illustrated in fig1 it is to be understood that although only one memory cell 60 is illustrated , a number of such memory cells 60 are connected together to form a matrix . a plurality of memory cells 60 are provided between a given pair of adjacent bit lines bl 1 and bl 2 in the longitudinal direction . similarly , other memory cells 60 are also provided in the longitudinal direction between other pairs of bit lines . the drain electrodes of pmos transistors 67 and 68 are each connected to the terminal ends of bit lines bl 1 and bl 2 respectively , associated with memory cells 60 . the source sides of the pmos transistors 67 and 68 are each connected to a source voltage v gg . the gate electrodes of the pmos transistors 67 and 68 are connected to a control circuit 69 . although not shown , the other bit lines are similarly associated with pmos transistors , as the variable resistor means , each pmos transistor having its gate electrode connected to a control circuit 69 . the control circuit 69 is composed of a series circuit of a pmos transistor 61 and a constant current source 62 , which is also a pmos transistor . the pmos transistor 61 has its gate and drain electrodes connected in common and has its gate electrode connected to the gate electrodes of the pmos transistors 67 and 68 , so that a current mirror circuit is formed by the pmos transistors 61 , 67 and 68 . the pmos transistor 62 forming the constant current source 62 has its drain and gate electrodes connected to the ground ( gnd ) level . the constant current source 62 is connected in series with the drain electrode of the pmos transistor 61 for limiting the current flowing in the pmos transistor 61 . the current flowing through the pmos transistor 67 is designated i 67 ( and is equal to the current flowing through transistor 68 ) and the current flowing through the pmos transistor 61 is designated i 61 . the current flowing from the source voltage v dd to the ground voltage gnd in the control circuit 69 is controlled by the constant current source 62 such that the current i 61 ( flowing through the pmos transistor 61 ) has a magnitude which is determined by the constant current source 62 . since the pmos transistor 67 constitutes a current mirror circuit with the pmos transistor 61 , the magnitude of the current i 67 is proportional to i 61 . in particular , the proportion is determined by the ratio of the value of the channel conductance of the pmos transistor 61 to the value of the channel conductance of the pmos transistor 67 . the result is that the d . c . operating current at the time of writing is determined by the current value of the pmos transistor 61 of the current mirror circuit , which in turn is determined by the magnitude of the current of the constant current source 62 . in this manner , the d . c . operating current during writing can be adjusted easily by controlling the value of the constant current of the constant current source 62 and thus the ratio of the values of channel conductance of the transistors 67 and 61 making up the current mirror circuit . in the current mirror circuit arrangement , the gate size of the constant current source ( transistor ) 62 increases and results in a lowered rate of fluctuations in the parameters ascribable to manufacturing tolerances of the constant current source 62 . therefore , even when the pmos transistors 67 and 68 , serving as the variable resistor , are reduced in size , fluctuations in the current values of the pmos transistors 67 and 68 can be suppressed by virtue of the above described relation of proportionality so that a stable circuit operation is assured . the variable resistor transistors 67 and 68 and the transistor 61 are pmos transistors and are produced by the same production process . thus , the transistors 67 , 68 and 61 gate sizes , such as the gate length or width , or the fluctuations in their threshold voltage vth , during the course of the adjustment process , all exhibit the same tendencies . therefore the memory is produced in such a manner that the d . c . operating current is insensitive to manufacturing tolerances . the memory of this embodiment is a more concrete and practical version of the preceding , second embodiment . referring to fig7 the memory includes a memory cell 70 connected to a pair of bit lines bl 1 and bl 2 . as with the memory cells 60 of the preceding second embodiment , a number of the memory cells 70 are connected in a matrix to form a memory cell array . pmos transistors 77 and 78 which serve as the variable resistor means are connected to the terminal ends of bit line bl 1 and bl 2 , respectively . a source voltage v dd is supplied to the source sides of the pmos transistor 77 and 78 , while the drain sides of the pmos transistors 77 and 78 are connected to the bit lines bl 1 and bl 2 . a control circuit 79 includes pmos transistors 71 , 72 and 73 and an nmos transistor 74 . the pmos transistors 71 , 72 , 73 are connected in series between the source voltage v dd and the ground voltage gnd , and the nmos transistor 74 is connected in parallel with the pmos transistor 73 between the drain electrode of transistor 72 and the circuit ground gnd . the pmos transistor 71 constitutes a current mirror circuit with the pmos transistors 77 and 78 . the pmos transistors 77 and 78 have their gate electrodes connected in common , and their source electrodes connected to the source voltage v dd . the pmos transistor 71 has its drain and gate electrodes connected to the source electrode of the pmos transistor 72 . the pmos transistor 72 is a switching element , and its gate is supplied with the read / write signal r / w . the pmos transistor 72 has its drain electrode connected to the gates of the pmos transistors 77 and 78 , the source electrode of the pmos transistor 73 , and the drain electrode of the nmos transistor 74 . the pmos transistor 73 acts as a constant current source . the ground voltage gnd is supplied to both the gate and drain of the pmos transistor 73 . the read / write signal r / w is also supplied to the gate of the nmos transistor 74 . the nmos transistor 74 has its source connected to the ground voltage gnd . the above described memory of the present embodiment operates in the following manner . during the read - out time , the read / write signal r / w is set to a high ( h ) level so that the pmos transistor 72 is turned off while the nmos transistor 74 is turned on . the gate voltage of the pmos transistors 77 and 78 is then about equal to the ground voltage gnd such that the pmos transistors 77 and 78 acting as the loads , are brought to a low impedance state . during writing , the read / write signal r / w is set to the low ( l ) level so that the pmos transistor 72 is turned on and the nmos transistor 74 is turned off . the current then flows from the source voltage v dd to the ground voltage gnd via the pmos transistors 71 to 73 . the current flow causes the pmos transistors 77 and 78 to go to the high impedance state . at this time , the magnitude of the current flowing in the pmos transistor 71 is determined by the pmos transistor 73 acting as a constant current source . similarly , the current flowing in the pmos transistors 77 and 78 is determined by the pmos transistor 71 , since the pmos transistors 77 and 78 and the pmos transistor 71 make up the current mirror circuit . therefore , the impedance values of the pmos transistors 77 and 78 are dependent upon the constant current source formed by transistor 73 so that they are stabilized . also , as was the case with the preceding second embodiment , the d . c . operating current during writing is determined by the ratio of the value of the channel conductance of the pmos transistor 73 to the values of the current conductance of the transistors 71 , 77 , 78 constituting the current mirror circuit . hence the d . c . operating current can be adjusted easily . also , during writing , the pmos transistors 77 and 78 , as the variable resistors , can be brought to an intermediate state between the low and high impedance states . also , by increasing the size of the pmos transistor 73 as compared to the other elements , the rate of fluctuations of the parameters caused by manufacturing tolerances can be lowered so that a stable circuit performance is assured . in addition , the pmos transistors 77 and 78 and the pmos transistor 71 tend to be uniform in manufacturing tolerances , so that it becomes possible to suppress fluctuations in the d . c . operating current . the present fourth circuit embodiment , in which the nmos transistor dependency is increased , is illustrated in fig8 . the fourth circuit , illustrated in fig8 is a modification of the previously described third embodiment illustrated in fig9 . comparing the fourth circuit embodiment with the third circuit embodiment shown in fig7 the fourth circuit embodiment substitutes the pmos transistor 73 with an nmos transistor 83 ; and the nmos transistor is used as the constant current source . the remainder of the circuit elements are unchanged . therefore , they are indicated by the same reference numerals as those used in fig7 and the accompanying corresponding description is omitted here for simplicity . using an nmos transistor 83 , as the current source , allows the manufacturing tolerances of the nmos transistor 83 to be reflected in the current values of the constant current source . in turn , by having the tolerances reflected in the current values results in the memory being insensitive not only to the manufacturing tolerances of the pmos transistor but also to the manufacturing tolerances of the nmos transistor as well . in the memory of the present embodiment , control of the transistors 77 and 78 of the variable resistor means can be accomplished in a stable manner , similar to the memory of the previously described second and third embodiments , while the memory is also insensitive to manufacturing tolerances since the nmos transistor 83 is increased in size . it should be noted that the memory of the present invention is not limited to the above described first through fourth embodiments , but various modifications can be made thereto without departing from the purpose of the invention . | 6 |
fig1 - 22 illustrate an apparatus and methods according to the present invention for photogrammetrically orienting two - dimensional ultrasound image slices of an object into a three - dimensional view of the image slices , thereby enabling three - dimensional visualization of the object . referring first to fig1 and 2 , an apparatus 30 for photogrammetric orientation of ultrasound images according to the present invention may be seen to include an image acquisition apparatus 50 . as shown in fig2 image acquisition apparatus 50 according to the present invention includes a visual imaging device 51 which is capable of recording a sequence of optical images . thus , imaging device 51 may be a still photographic film camera such as a 35 mm camera or film motion picture camera . preferably , however , imaging device 51 is of a type which produces real - time electronic representations of an optical image , rather than one such as a film camera which requires photographic processing of film and subsequent electro optical scanning of film images to obtain electronic images . thus , imaging device 51 is preferably a digital camera or camcorder . alternatively , imaging device 51 may consist of a video camera that outputs an electronic image signal which is recorded on an external electronic memory such as a computer hard disk , floppy disk , or the like . referring still to fig2 it may be seen that imaging device 51 is used to form an image 52 at the focal plane 53 of the device . as shown in fig2 imaging device 51 is fixed with respect to a stationary object , such as a hospital bed ( not shown ), and has a field of view which encompasses an ultrasonic imaging transducer wand 54 located in proximity to a subject such as a patient lying on a hospital bed . wand 54 has affixed thereto a target plate 55 which has contrasting visual features of a predetermined size and shape . in the example embodiment of image acquisition apparatus 50 shown in fig2 ultrasonic imaging transducer wand 54 has a bulbous shape similar to that of an egg cleaved along a vertically disposed medial plane parallel to the long axis of the egg to form a flat front surface 56 . this type of transducer emits an ultrasonic energy beam which is directed in a generally conically - shaped scan pattern having a triangular trace in a plane generally perpendicular to front surface 56 of the transducer , and produces a similarly shaped ultrasound image field pattern , as shown in fig4 and 5 . referring still to fig2 it may be seen that target plate 55 , which is preferably mounted flush with and parallel to front face 56 of ultrasonic transducer wand 54 , has a generally rectangular , preferably square shape , and has a rectangular central area 57 concentric with the perimeter 58 of the target plate . central area 57 of target plate 56 is preferably of a different color or darkness than the remainder of the target plate . thus , as shown in fig2 central area 57 of target plate 55 may be of a light color , such as while , while the remainder of the target plate may be of a darker color , such as black . referring still to fig2 it may be seen that apparatus 30 includes an ultrasonic imaging apparatus 58 which is connected by an electrical cable 59 to ultrasonic imaging transducer wand 54 . ultrasonic imaging apparatus 58 is of a conventional type , such as a general electric brand logi q 500 model number . the construction and function of typical ultrasonic imaging apparatus of this type is described in havlice and taenzer , โ medical ultrasonic imaging : an overview of principles and instrumentation ,โ proc . ieee , vol . 67 , pp . 6200 - 641 , april 1979 . ultrasonic imaging apparatus 58 contains electronic circuitry for producing electrical signals of ultrasonic frequency which drive a piezoelectric or magnetostrictive ultrasonic transducer in wand 54 , and cause the transducer to emit a beam of energy directed to an object of interest , such as a fetus or other internal biological feature ( ibf ). typically , the ultrasonic energy beam emitted by the transducer in wand 54 is mechanically or electronically scanned to form a generally fan - shaped pattern , i . e ., in the shape of a truncated isosceles triangle with the vertex located at the transducer , as shown in fig2 and 5 . this type of scan format is referred to as a sector scan . during a period when ultrasonic drive energy to the transducer within transducer wand 54 , is interrupted , the transducer functions in a receive mode , converting ultrasound signals reflected from an ibf into electrical information signals . the latter are used to form an image 60 of a region scanned , the image being displayed on the screen of a lcd , crt or other display device monitor 61 . image 60 appears on monitor 61 within an active display area 60 a shaped similarly to the scan pattern of the ultrasonic energy beam transmitted by transducer wand 54 . in this display , referred to as a b - scan or brightness mode scan , the angular coordinate position of an object feature in the scanned image field 60 a is indicated by the angular position of radial display lines corresponding to the instantaneous directions of an ultrasonic energy beam emitted by the transducer . radial coordinate positions of an object from the common vertex of ultrasound energy beam scan lines , which intersect at the transducer , are determined by measuring the time delay between the emission of an ultrasonic energy pulse , and a return signal reflected from a feature and received by the transducer . the radial coordinates of object features in display area 60 a of monitor 61 are displayed at a proportional distance from the vertex of the display area , and the strength of the reflected signals are indicated by modulating the brightness of display pixels . ultrasound imaging apparatus 58 also includes electronic memory means 62 for storing a sequence of ultrasound images 60 , referred to as monograms . referring now to fig1 it may be seen that apparatus 30 according to the present invention includes components functionally interconnected with visual image acquisition apparatus 50 and ultrasonic imaging apparatus 58 shown in fig2 and described above , to perform a photogrammetric orientation of ultrasound images according to the method of the present invention . as shown in fig1 apparatus 30 includes a computer 64 . as will be described in greater detail below , computer 64 is utilized to precisely determine the instantaneous location and orientation of ultrasonic imaging wand 54 relative to a fixed imaging device 51 for each two - dimensional image slice or sonogram in a sequence of sonograms obtained by changing the orientation and / or location of the wand relative to an internal biological feature ( ibf ) or other feature of interest . this step is performed by forming an oblique view image of target plate 55 with imaging device 51 , and transforming and scaling the oblique image into a correctly scaled normal view image of the target plate using the method described in detail in u . s . pat . no . 5 , 967 , 979 , the entire disclosure of which is hereby incorporated by reference into the present specification . since target plate 55 is fixed to ultrasound scanning wand 54 , precisely determining the orientation and location of target plate 55 precisely determines the orientation and location of the ultrasound scanning wand . therefore , the method described in the &# 39 ; 979 patent enables determination of the precise orientation of the scanned ultrasound energy beam relative to a feature of interest , and therefore the location and orientation of sonogram slices obtained of the feature . according to the present invention , the precise orientation and location of each sonogram slice relative to a fixed coordinate reference frame , e . g ., one in which a patient and imaging device 51 are fixed , is used to construct an assembly of correctly scaled and oriented three - dimensional views of ultrasound image slices of the object , using software such as voxelview , version 1 . 0 , obtainable from vital images , inc ., 3300 penbrook avenue north , plymouth , minn . 55447 , or idl , version 3 , also obtainable direction from vital images . this enables the object to be visualized in three dimensions . referring still to fig1 it may be seen that apparatus 30 according to the present invention includes means for inputting into computer 64 electronic image signals of wand 54 and target plate 55 obtained by imaging device 51 , the computer being used to compute instantaneous normal view images of the target plate and wand . apparatus 30 also includes means for inputting into computer 64 a sequence of electronic image frames , one for each sonogram that represents a two - dimensional image slice of an internal biological features . as shown in fig1 apparatus 30 includes a first , visual image frame grabber 65 which converts each visual image signal 66 obtained by optical imaging device 51 into a separate frame of image data for each of a sequence of images . operation of visual image frame grabber 65 is controlled by a system control electronic module 67 , which issues a command signal , timing signal , and frame identification signal when it is desired to capture and store a particular image frame input to the frame grabber by optical imaging device 51 . each optical image frame thus captured and stored is electronically identified with a sonogram obtained simultaneously with the optical image of transducer wand 54 and target plate 55 , thus recording the precise orientation and location of the wand during the sonogram scan . frame capture command signals may be issued at predetermined times by system control module 67 , or manually by an external command instruction issued by the ultrasonographer . although system control module 67 is shown in fig1 to be separate from computer 64 , functions of the system control module could of course be performed by the computer with appropriate interface electronics and software , as will be understood by those skilled in the art . as shown in dashed lines in fig1 imaging device 51 could optionally be replaced by a photographic still camera 51 a . in this case , a separate photographic film image 52 a is made of ultrasonic wand 54 and target plate 55 for each sonogram obtained using the wand . the exposed film must then be processed in a conventional manner to develop the latent photographic images on the film , the developed film images scanned using an optical scanner 68 and an analog - to - digital ( a / d ) converter 69 used to convert the analog two - dimensional film image into a digital image , which is input into computer 64 in place of electronic images output from frame grabber 65 . however , because of the difficulty of synchronizing real - time sonograms with subsequently processed photographic film image , electronic imaging by video camera 51 is a preferred method . alternatively , camera 51 a could be a digital camera , in which case scanner 68 and a / d converter 69 would be replaced by a digital memory means such as a flash memory card . referring still to fig1 it may be seen that apparatus 30 includes a second , ultrasound image from grabber 75 which converts electronic ultrasound image signals 60 e corresponding to sonograms 60 obtained by ultrasonic imaging apparatus 58 into a separate frame of image data for each of a sequence of sonograms showing separate image slices of an internal biological feature . each ultrasound image frame 60 e corresponding to a separate sonogram 60 is stored electronically along with a timing code and identification code that associates each sonogram with an optical image frame of the transducer wand 54 and target plate obtained simultaneously with the particular sonogram . as described above computer 64 of apparatus 30 performs on each optical image 66 of wand 54 and target plate 55 a coordinate transformation which determines the precise orientation and location of the wand at the time a sonogram 60 associated with the optical image is formed . since the ultrasonic fan beam emitted by transducer wand 54 to form a sonogram image bears a fixed geometric relationship to the transducer , determining the precise location and orientation of the wand determines the exact trajectory of the image - forming beam relative to a fixed reference frame . in a typical example embodiment of the present invention , an ultrasound beam 76 is emitted in a plane perpendicular to front face 56 of the transducer wand , with the vertex of the beam located behind the front face and centered on a longitudinally disposed , vertical medial plane of the wand , as shown in fig2 . construction of a three - dimensional assembly of two - dimensional sonograms taken at different orientations of ultrasound beam 76 is performed by apparatus 30 in the following manner . referring again to fig1 it may be seen that transformed normal view images 77 of ultrasound wand 54 and target plate 55 are input to a computer 78 , which may be part of computer 64 . the transformed normal view images are used to indicate the relative spacing between ultrasound wand 54 and an object of interest , and the orientation of the wand relative to the object , for each sonogram obtained of the object . using this information , computer 78 constructs in a three - dimensional image space 79 three - dimensional images of a sequence of two - dimensional sonogram image slices , in the manner shown in the following example . referring now to fig4 a solid cone a is shown as an example object of interest to be visualized using the method and apparatus 30 according to the present invention . as shown in the example of fig4 cone a , which could as well be a fetus or other internal biological feature of interest to an ultrasonographer , is scanned by a beam 76 emitted by ultrasound wand 54 having a first location and orientation to form a first sonogram . the position and orientation of the want relative to cone a during the first scan are determined by calculating the size and orientation of visual features on target plate 55 , using the coordinate transformation described in u . s . pat . no . 5 , 967 , 979 and cited above . as shown in fig4 the orientation of front face 56 of transducer wand 54 is parallel to the central , vertically orientated axis b of cone a . with this arrangement , ultrasound image beam 76 lies in a horizontal plane which intersects cone a a short distance below the vertex c of the cone . thus , a first sonogram of cone a , as shown in fig5 consists essentially of a circular area having a first diameter , d 1 . using the voxelview reconstruction software described above , a first image slice is therefore reconstructed which is a circle of a first diameter , d 1 , scaled in a ratio k to d 1 , and in a three - dimensional image space 79 , shown in fig6 a perspective view of circle d 1 , is constructed . next , as shown in fig7 of the present example , ultrasonic imaging wand 54 is relocated to a second position , e . g ., a position lower than that shown in fig4 and the wand tilted obliquely upwards with respect to its orientation shown in fig4 . at this second location and orientation , a second sonogram is made of cone a , with fan beam 76 of wand 54 intersecting the cone at an oblique angle . thus , as shown in fig8 a second sonogram of cone a consists essentially of an elliptically shaped area having a major axis e , and a minor axis f . using the voxelview reconstruction software , a reconstruction of the second sonogram image slice in three - dimensional image space 79 , as shown in fig9 is therefore an ellipse having a major axis e , and a minor axis f that are scaled in the same ratio k used to scale each sonogram into three - dimensional image space 79 . [ 0062 ] fig1 of the present example shows ultrasonic imaging want 54 oriented to a third position intermediate in height between positions 1 and 2 shown in fig4 and 7 , but inclined obliquely downward from a horizontal plane . at this third location , a third sonogram is made of cone a , with fan beam 76 of wand 54 intersecting the surface d and base e of the cone at an oblique angle . thus , as shown in fig1 , a third sonogram of cone a consists essentially of a semi - elliptical area having a major axis g , and a truncating chord h . using the voxelview reconstruction software , a reconstruction of the third sonogram slice in three - dimensional image space 79 as shown in fig1 , is therefore a semi - ellipse having a major axis g , and a truncating chord h , that are scaled in the ratio k used to scale each sonogram into three - dimensional space 79 . [ 0063 ] fig1 a shows a three - dimensional image space 79 in which the transforms of sonogram images shown in the example fig4 - 12 have been assembled together in a properly arranged and scaled and oriented relationship . fig1 b shows a surface 80 which is constructed using the rendering portion of the voxelview program , visually , for example , by mentally extending a plurality of directrix lines 81 through the perimeters of a stack of substantially planar image transforms . as shown in fig1 b , surface 80 formed by directrix lines 81 defines a conical transferred image object a , having an altitude b 1 and a base e 1 which is a correctly scaled and proportioned representation of the object cone scanned by ultrasound fan beam 76 . referring now to fig1 - 21 , it may be seen how apparatus 30 according to the present invention is used to form a three - dimensional visualization of an actual object of interest using the method shown in fig4 - 13 and described above . thus , as shown in fig1 , ultrasonic imaging wand 54 is located in a first position and at a first orientation relative to the abdomen j of a patient k . at this first position and orientation of transducer wand 54 , a first sonogram 82 - 1 , shown in fig1 , is obtained of an internal biological feature ( ibf ) such as a fetus l . in an exactly similar manner , additional sonograms 82 - 2 through 82 - 4 are obtained of fetus l , as shown in fig1 - 231 . using the transformation method described above , a three - dimensional representation of fetus 80 l is then visually constructed in image space 79 . three - dimensional images 80 , such as that of fetus 80 l may be displayed on a system monitor 83 , and electronically stored for future access . the process used to position the ultrasound image slices in 3d space to thereby enable three - dimensional visualization of an object scanned by an ultrasound beam is described in somewhat greater detail below : there is understood to be a coordinate system , xyz , based on the camera &# 39 ; s point of view , with the following characteristics : there is also a coordinate system , xyz , for each ultrasound frame based on the target rectangle attached to the ultrasound wand , with the following characteristics ( assuming that the wand is pointing downward as we look at the target plate with its y - axis pointing to : the origin ( o , o , o ) t is the lower left corner of the target rectangle the positive - x axis extends to the right along the bottom edge of the rectangle within a target &# 39 ; s coordinate system , each image pixel &# 39 ; s location can be calculated , knowing the following : xyz position of the top - center point of the acquired image ( given in cm as , for example , ( u . 0 ,โ 3 . 0 ,โ 1 . 0 )) size of a pixel in x and y direction ( for example , each equal to 0 . 025 cm ) the method of the present invention utilizes placement of the pixel data from each frame into a single 3 - d space based on the camera &# 39 ; s view . this requires transformation from each target &# 39 ; s coordinate system to the camera &# 39 ; s coordinate system . a 4 ร 4 transformation matrix may be used to represent any combination of the translation , rotation and scaling of a 3 - dimensional coordinate system . thus , the matrix describes translation of the origin , rotation of xyz axes to another orientation , and optionally , change in scale ( although re - scaling is not required in this application ). any number of separate translation and rotation steps can be combined into a single transformation matrix , which will contain the result of all steps performed in sequence . target rectangle measurement data from vision system ; i . e ., position , aim , rotation the target - to - camera coordinate system transformation matrix is calculated for an ultrasound frame from the position , aim and rotation values for the frame . the image pixel data for this frame is then transformed into the camera &# 39 ; s coordinate system by multiplying each pixel &# 39 ; s xyz location in the target &# 39 ; s coordinate system by this transformation matrix . referring now to fig2 , the 4 ร 4 target - to - camera transformation matrix can be determined from these given values : p 3 - element floating - point vector ( xyz ) t giving the position of the camera in the target &# 39 ; s coordinate system . a 3 - element floating - point vector ( xyz ) giving the position of a point directly ahead of the camera in the target &# 39 ; s coordinate system ( this defines the - z - axis of the camera &# 39 ; s coordinate system ). r a floating - point scalar giving the angle between bottom edge of the photograph and the line where the plane of the photograph intersects the plane of the target plate . ( in radians .) to generate the transformation matrix , the camera coordinate system axis vectors xyz c are calculated with respect to the target coordinate system with axes xyz t : z has a direction from point a to point p ( opposite the aim vector ). the direction l is calculated ; i . e ., the direction of the line of intersection of the xy plane and the xy plane ( z ). l is equal to the cross product of the normal to the xy plane ( z ) and the normal to xy plane ( z ). vector l is rotated by r radians on the xy plane : rotations qy and x around y are then calculated to bring vector z to point along z - axis vector l is rotated by r radians on the xy plane . opposite rotations โ qy and โ qx are applied to bring rotated vector l to point within the xy plane , giving final x vector . x and z are combined together , and rotations iz , iy , ix ( around z , y , x ) needed to bring them to match x and z calculated . point โ p is transformed to calculate the target origin point in camera coordinate system the translation of that point is added to the transform to complete the matrix having calculated the transformation matrix , each pixel point is multiplied by this matrix to determine its position in camera space . | 8 |
with reference now to the various figures , one embodiment of the holding assembly 10 is shown in fig1 . here , holding assembly 10 is shown holding a camera 40 . the holding assembly 10 is preferably formed of an adjustable rigid support , which in the preferred embodiment is a telescopic rod 12 , shown in fig1 . the telescopic rod has telescopic units 12 a , 12 b . . . 12 n which may be locked in various positions of length adjustment . the telescopic rod has a first end distal from a second end . as shown in fig1 , the first end has telescoping unit 12 a , which is of the largest diameter , and is connected to a handle 14 . the second end 12 n is provided with removable ball - joint assembly 15 . in the embodiment shown in fig1 a camera 40 is secured to the ball - joint assembly 15 . to attach holding assembly 10 to a generally horizontal support surface , as shown in fig1 , a c - shaped hook 16 , which may be formed from sheet metal , plastic , or the like , may be removably attached to the handle 14 of the support 10 by a screw or attachment means known to one of skill in the art . alternatively , the c - shaped hook 16 may be secured to the ball - joint assembly 15 as shown in fig2 . the c - shaped hook 16 has a first vertically extending section 16 a provided with a lower horizontal tab portion 16 b which may be secured to the first end of the rigid telescoping sections which first end will become the upper end when the support is placed in its normal operating position . a ball - joint b may be used to attach camera mount to telescopic rod 12 . as shown in fig3 , the c - shaped hook 16 is also provided with an upper transverse section 16 c , and a downwardly extending section 16 d secured to the upper transverse section and spaced away from the and generally parallel to the vertically extending section 16 a . the downwardly extending section 16 d is provided with an elongated lower contact surface 16 e which is angled toward the support when in the normal operating position as shown in fig3 . elongated lower contact surface 16 e may be placed on virtually any horizontal structure to hold the support of the device of the present disclosure . the tail of the hook in elongated lower contact surface 16 e is very important ; where narrower shapes are more effective , as elongated lower contact surface 16 e has to grip mortar on brick walls and behind narrow spaces , and thus lower contact surface 16 e may have a chisel shape . in the embodiment show in fig2 the handle 14 is used to grip the holding assembly , pushing the apparatus skyward and unhooking it from the overhead support surface . in the embodiment of fig1 , the camera 40 or the ball - joint assembly 15 is grasped by the user to push the holding assembly 10 upwardly to release the c - shaped hook 16 from the surface to which it is engaged . fig1 shows the holding assembly 10 having a camera 40 secured to a ball - joint assembly 15 which in turn is secured to one end of telescopic rod 12 . the other end of the support may carry a c - shaped hook 16 , which in turn may engage various surfaces , such as the top surface of a board as shown in fig1 . as illustrated in fig2 , telescopic rod 12 is formed of telescoping segments 12 a , 12 b . . . 12 n which may be locked in various length positions . the telescopic rod 12 has first and second ends , each of which is preferably provided with screw threaded apertures which may receive various fasteners , such as a stud carried by the ball - joint assembly 15 . the ball - joint assembly 15 may be of differing designs , particularly one adapted to receive camera 40 as shown in fig1 , or alternatively smartphones as shown in fig2 and 4 . each ball - joint assembly 15 includes a first portion which is secured to an end of the rigid support as for example via a stud which is received in a threaded aperture at the end of the rigid support . the ball - joint assembly is also provided with a second portion which may be locked in various positions of adjustment via knob 22 . the second portion is provided with a mirror 20 so the user can see what the camera or smartphone will capture as an image . fig2 shows the manner in which the support for a picture taking device can be mounted on a relatively flat surface . in this view , elongated lower contact surface 16 e engages to top surface of a brick in a brick wall . while not shown , elongated lower contact surface 16 e may engage a variety of other surfaces , such as tree bark , wall and car moldings , etc . fig4 shows the c - shaped hook 16 engaging the top of a picture frame โ p โ which may above a mantle โ m โ over a fireplace โ f โ. in fig5 , c - shaped hook 16 is shown engaging a gutter โ g โ below a roof โ r โ. fig6 shows a holding assembly where the telescopic rod 12 with telescopic units 12 a , 12 b . . . 12 n has latches โ l โ which are used to secure the telescopic units 12 a , 12 b . . . 12 n from sliding . this variation is desired when using a heavy picture taking device such as a dslr . one embodiment of c - shaped hook 16 , as shown in fig7 and 8 , will have hinges to allow the hook to fold for transport . thus there will be a first hinge 32 between sections 16 a and 16 c , and a second hinge 34 between sections 16 c and 16 d . to fold the c - shaped hook 16 for transport , section 16 a will initially be folded onto section 16 c , and then section 16 d will be folded under section 16 c as shown in fig8 . the holding assembly 10 can further be used to provide near instantaneous mounting , without damage to any surface , of a camera 40 for surveillance and / or monitoring of an area or for personal viewing of a video , such as one might do on a train , by mounting the apparatus on the back of the seat in front of the person using it . this feature is shown in fig9 which , to a certain extent , corresponds to fig2 , except that , in fig9 , there is no requirement for the rigid support to have and adjustable length , nor is there a requirement for the upper ball - joint assembly 15 . fig1 shows an alternative embodiment of the present disclosure , wherein the holding assembly 100 has two sections , a camera attachment section 102 and a support attachment section 104 . from the view in fig1 , camera attachment surface 106 is visible , whereas the support attachment surface 142 ( shown in fig1 ) is facing away from the viewer in fig1 . the support attachment surface 142 is on the opposite side of holding assembly 100 when in the open position , and can be seen in fig1 , where the two panels are separated along hinge 140 . the hinge 140 may allow the two sections to rotate away from each other beyond 180 degrees to allow for attachment to a wide variety of surfaces , while having the camera remain vertically positioned . fig1 shows a post for screw holes 112 and rigid serrated grip 114 . rigid serrated grip 114 provides a significant advantage , in terms of holding power and stability , when combined with the adhesive means of attachment on the support attachment surface 142 . rigid serrated grip 114 , in the preferred embodiment , extends below the camera attachment section 104 and curves toward a support on the support side of camera attachment section 104 , extending beyond the vertical plane of the support side of camera attachment section 104 and gripping the support with teeth 116 , shown in fig1 , at its lower end . the teeth 116 of rigid serrated grip 114 contact the support and may form an angle of approximately 90 degrees with the support , as illustrated in fig2 b , although this angle may vary in some embodiments . the angle formed between the teeth 116 and the region of the support directly above the teeth 116 will generally be between approximately 10 and 90 degrees , such that the teeth 116 may grip the support to provide additional holding power to holding assembly 100 . fig1 shows a front view of holding assembly 100 when in the closed position . a tab 122 is included having an aperture 124 to accept additional means attaching holding assembly 100 to a support , such as tether 110 . teeth 116 are shown attached to the lower portion of camera attachment section 104 for gripping a support . fig1 shows a convex mirror 130 . the mirror 130 may be of various shapes and sizes . fig1 shows a hinge 140 having a hinge rod , which in alternative embodiments may be a ball - joint type hinge , for opening the holding assembly 100 . support attachment surface 142 is shown . the support attachment surface 142 may be an adhesive in the preferred embodiment . the adhesive is preferably washable and will not leave a significant residue on the support or camera . the adhesive may be gk - 22 , produced by northstar polymers . fig1 illustrates a j - hook 150 connected to holding assembly 100 through aperture 124 . fig1 shows cover plate 162 . fig1 shows convex mirror 130 and the j - hook 150 supporting holding assembly 100 through attachment to a tree branch . horizontal camera 170 , which may be a smartphone , is attached to the camera attachment surface 106 . fig1 shows vertical camera 180 and j - hook 150 . fig1 shows a holding assembly 110 combined with telescopic rod 12 attached to a flat support . fig2 a shows an embodiment of the present disclosure having a plurality of magnets 200 in the camera attachment section 104 . the magnets 200 allow attachment of a camera 40 , which may be a smartphone , to the camera attachment surface 106 without the use of adhesives or other means of attachment . alternatively adhesives and other means of attachment may be used in combination with magnets 200 . fig2 b illustrates a side cross - sectional view of holding assembly 100 showing magnets 200 along with cover plate 204 . fig2 b provides a side view of rigid serrated grip 114 , which adds stability to holding assembly 10 when in use . additionally , tab 122 can be seen in fig2 b . fig2 shows holding assembly 100 attached to an uneven surface , such as a mountainside , for support . vertical camera 180 is attached to the holding assembly 100 . while preferred embodiments of this disclosure has been described above and shown in the accompanying drawings , it should be understood that applicant does not intend to be limited to the particular details described above and illustrated in the accompanying drawings , but intends to be limited only to the scope of the disclosure as defined by the following claims . in this regard , the term โ configured โ as used in the claims is intended to include not only the designs illustrated in the drawings of this application and the equivalent designs discussed in the text , but it is also intended to cover other equivalents now known to those skilled in the art , or those equivalents which may become known to those skilled in the art in the future . | 5 |
illustrated in fig1 is a combination schematic circuit diagram and block diagram of a self checking temperature sensor system in accordance with the present invention . thereshown is a temperature sensing circuit 100 having a first electrical circuit terminating means or node 110 and a second node 120 . a first series circuit 112 is connected between the first and second nodes 110 and 120 , and comprises a ptc resistive temperature sensing component identified as zt1 . a second series circuit 114 in parallel with the first series circuit 112 is also connected between the first and second nodes 110 and 120 , and includes the series combination of ntc resistive temperature sensing component zt2 , resistor r1 , and diode d1 . as illustrated in fig1 the anode of diode d1 is electrically connected to node 120 , and the cathode is electrically connected to node 110 through resistor r1 and zt2 . therefore , when node 120 is more positive than node 110 , a current may pass through both the first and second series circuits -- into node 120 and out node 110 . in contrast , when node 110 is more positive than node 120 , current may only pass only through the first series circuit 112 -- into node 110 and out of node 120 . in the preferred embodiment of the invention resistor r1 is intended to be a 1 % precision metal film resistor , and diode d1 may be a 1n4148 manufactured by itt of california , usa , and have a forward voltage of 1 . 0v at 10 ma . temperature sensing component zt1 is intended to have a positive temperature coefficient , and zt2 is intended to have a negative temperature coefficient . an exemplary choice for zt1 is a silicon temperature sensor manufactured by u . s . sensor corp ., of california , usa , having a nominal resistance of 3000 ohms and a positive temperature coefficient in the order of 25 ohms per degree centigrade . an exemplary choice for zt2 is a thermistor manufactured by fenwal electronic inc . having a nominal resistance value 10 , 000 ohms at 25 ยฐ c . and a non linear negative temperature coefficient in the order of - 200 ohms per degree centigrade . exemplary temperature characteristics for zt1 and zt2 are illustrated in fig3 and 2 , respectively . before proceeding , it should be noted that in the preferred embodiment of the invention , for the condition that node 110 has a more positive potential relative to node 120 , current will flow into node 110 substantially only through zt1 , and out of node 120 . therefore , in these circumstances , the effective impedance of the temperature sensing circuit means 100 is the impedance of only zt1 -- i . e ., the positive temperature coefficient resistive temperature sensing component having a nominal value of 3000 ohms . in contrast , for the condition that 120 has a more positive potential relative to node 110 in excess of the forward diode breakover voltage , current will flow into node 120 and out of node 110 . in these circumstances , the temperature sensing circuit means 100 exhibits an effective impedance , herein referred to as r net being substantially the impedance of zt1 in parallel with the sum of the impedances of zt2 and resistor r1 . by proper selection of these latter three components , the effective impedance can be forced to have a somewhat flat temperature characteristic over a selected temperature range as particularly illustrated in fig4 and 5 . fig4 illustrates the temperature characteristic of the aforesaid effective impedance over temperature range of - 40 to + 280 degrees fahrenheit for those nominal values of the components of the temperature sensing circuit as aforesaid . fig5 shows in more detail the temperature characteristic illustrated in fig4 over a temperature range between + 70 and + 250 degrees fahrenheit . as may be seen particularly in fig5 the effective impedance between + 70 and + 250 degrees fahrenheit is at times positive and negative and is approximately 2875 ohms plus or minus 25 ohms . as will be discussed below , it is this &# 34 ; flat &# 34 ; characteristic which provides for the ability of a self checking temperature sensing circuit in accordance with the present invention which may be employed in heating plant high limit control circuits and provide a fail - safe failure mode -- i . e ., all failure modes of either sensor result in a safe failure mode as will be subsequently described . further illustrated in fig1 is an application of a common rc charging circuit employing the temperature sensing circuit in accordance with the present invention . node 110 is electrically connected to pole p of switch sw2 through limit resistor r4 . one electrode of capacitor c1 is electrically coupled to node 120 through a limit resistor r2 , to pole p of switch sw1 through precision resistor r3 , and to input means 22 of comparator 20 . the other electrode of capacitor c1 is electrically coupled to electrical ground . the output of comparator 20 is presented as an input to signal processor 50 . switches sw1 and sw2 are controlled by switch control 40 having outputs for controlling switches sw1 and sw2 respectively . switch control 40 is operative for independently controlling switches sw1 through signal line 44 , and sw2 through signal line 42 to cause either switch pole p of switches sw1 and sw2 to be in an open condition as illustrated , electrically connected to contact a which is electrically connected to the positive polarity of en electric potential v 0 , or electrically connected to contact b which is electrically connected to electrical ground . switch control 40 receives an input signal from signal processor 50 on signal line 52 for determining the state of switches sw1 and sw2 . the operation of the rc circuitry of fig1 will now be described with reference to the following table : __________________________________________________________________________ sw1 sw2 diode d1 capacitor timecondition position position state state constant__________________________________________________________________________a a open inoperative charging t1 = r3 ร c1b open b forward discharging t2 = r . sub . net ร c1 biasedc open a reversed charging t3 = zt1 ร c1 biasedd b open inoperative discharging t4 = r3 ร c1__________________________________________________________________________ in accordance with the present invention , consider the application of the temperature sensing circuit means for hot water heating systems employing a boiler . in these circumstances , it is intended to detect the occurrence of a temperature exceeding a high limit value , for example 200 degrees fahrenheit , and where the normal water temperature is in excess of 70 degrees fahrenheit . in these circumstance r net will exhibit the &# 34 ; flat &# 34 ; characteristic over the desired temperature range of interest as illustrated in fig5 -- namely , r net will be in the range between 2850 and 2900 ohms . consider the alternate situations where c1 discharges through switch sw1 in position b , or discharges through switch sw2 in position b . in accordance with the above table , in the just mentioned temperature range , the time constant ratio t2 : t4 will be proportional to the ratio r net : r3 which is designed to be substantially a constant having a variation only dependent upon any variation of the flatness of the empirically determined resistance range -- namely a total variation of 50 ohms . this is so since r3 is substantially a constant and r net is substantially a constant . for a 3 . 3 microfarad capacitor , the time constant range due to variations only in r net would be in the order of 9 . 570 to 9 . 405 msec ( 9 . 4875 ยฑ 0 . 87 % msec ). now consider the alternate situations where c1 is charged through either switch sw2 in position a , or through switch sw1 in position a . then from the above table , in the just mentioned temperature range , the time constant ratio t3 : t1 will be proportional to the ratio zt1 : r3 since r3 is substantially a constant , this ratio will vary directly proportional to the value of the ptc resistance of zt1 , and , corresponding temperature sensed by zt1 as exemplified by the temperature characteristic illustrated in fig3 . the aforementioned time constants particularly depicted in the above table may be easily monitored and measured by a variety of schemes well known in the art . one example , without detail , is illustrated in fig1 . thereshown is the employment of comparator 20 for monitoring the output voltage of capacitor c1 . comparator output signal on signal line 24 is presented to signal processor 50 . comparator 20 compares the capacitor output voltage with a reference voltage and causes the comparator output to indicate that the capacitor output voltage is above or below a reference voltage . in turn , signal processor 50 may be configured to control the action of switches sw1 and sw2 depending upon the timing ratio which is desired to be determine . from the timing ratio information obtained by signal processor 50 , signal processor 50 may provide an output on signal line 58 representative of the temperature sensed by zt1 -- diode d1 reversed biased ; and / or provide a high limit signal on signal line 60 indicative of the temperature of the boiler exceeding a preselected value . it should be noted that a single signal line alternatively could be used , or the like , for subsequent system control . as aforesaid , if all is functioning properly over the desired operating range of the boiler , r net will be substantially a constant thereby self checking the condition of both temperature sensing components zt1 and zt2 . if , on the other hand , the resistance values of either zt1 or zt2 drift away from their nominal values , the ratio t2 : t4 will be observed to fall outside predetermined limits . in turn signal processor may provide a &# 34 ; failure &# 34 ; signal command on output signal line 60 . such a failure signal would also occur if either zt1 or zt2 electrically shorts or opens . at the same time , if the temperature sensing circuit is functioning properly , a high limit temperature sensed by zt2 may be detected by monitoring the ratio t3 : t1 . since this ratio increases with increasing temperature due to zt1 impedance increasing with increasing temperature ( ptc ), a high limit signal may be issued upon the ratio exceeding a pre - selected value . it should be noted , of course , that zt1 failing open would indicate a high temperature -- a fail safe failure . the block diagram of the switch control 40 and signal processor 50 is of course only exemplary . these functional blocks are particularly suitable for being incorporated in a micro - processor based system for achieving the intended control , monitoring and detection functions as should be appreciated by those skilled in the art . it should be appreciated by those skilled in the art that the behavior of the impedance characteristics of temperature sensing circuit 100 may monitored by other means than rc circuitry where charging and discharging time constants are monitored . the principal in accordance with the present invention is the behavior of the effective impedance between nodes 110 and 120 for the two conditions of polarity : ( 1 ) when node 110 is more positive than 120 , and ( 2 ) when node 120 is more positive than node 110 and in excess of the forward breakover voltage drop of diode d1 . the addition of the rectifying means , diode d1 , brings about the polarity sensitive effective impedance r net . that is , as already described , in one polarity the effective impedance of the temperature sensing circuit is the impedance value of zt1 , and in the other polarity is the effective impedance r net . when the intended application of the temperature sensing circuit means in accordance with the present invention is for a limit function , it is intended that r net be characteristically flat over the desired temperature operating range . the characteristic flatness of temperature versus resistance is of course dependent upon the nominal resistance values of zt1 and zt2 , as well as choice of resistor r1 , and as such is either empirically or mathematically determined . there are , of course many combinations , all of which are intended to be within the true spirit and scope of the present invention . the foregoing description of the invention is necessarily detailed so as to provide understanding of the invention &# 39 ; s best mode of practice . it is to be understood , however , that various modifications of detail , rearrangement , addition , and deletion of components may be undertaken without departing from the invention &# 39 ; s spirit , scope , or essence . in particular , the polarity of diode d1 may be reversed thereby affecting the polarity of the operative conditions of the temperature sensing circuit means as described . further , resistor r1 may also be located in a different series order than shown in fig1 . of course , other circuit components may be added or removed , all of which are intended to be within the scope of the present invention . | 6 |
fig1 schematically illustrates an exemplary embodiment of a device for implementing the method according to the invention . the device 1 includes as a heat source a laser 10 , for example a diode - pumped โ nd : yag โ ( neodymium - doped ) laser . its frequency is doubled using a nonlinear ktp ( potassium titanyl phosphate ) crystal , not shown in fig1 . to clarify , in a practical embodiment , the wavelength is 532 nm , with a typical pulse duration of 90 ns . the laser 10 operates at a high firing rate , preferably at a frequency of 10 khz , but can be within a typical range of 1 khz to 30 khz . to this end , conventional electronic circuits 11 generate control pulses i c , which are transmitted to the laser 10 . advantageously the laser beam is injected into a multimode optical fiber 12 , making it possible to homogenize the spatial profile of the optical intensity . via an output , the optical fiber 12 is coupled with one or more optical lenses , only one of which 13 is shown in fig1 . the lens 13 is disposed so as to make it possible to obtain , on the surface of a block of material 14 , an incident beam f li of homogeneous intensity , focused on an area to be heated z th whose surface area typically varies between 0 . 2 and 5 mm 2 , with a fluency of between 0 . 01 and 4 j / cm โ 2 . the incident laser beam f li makes it possible to heat the surface of the block of material 14 . this block of material 14 whereof predetermined thermophysical properties need to be known is composed of at least two layers : a superficial layer 140 , of small thickness , and a substrate 141 of large thickness compared to that of the superficial layer 140 . the thickness of the layer 140 is typically within a range of 0 . 1 ฮผm to 900 ฮผm . without going beyond the scope of the invention , the block of material 14 can comprise several superposed superficial layers of small thickness . the temperature measurement is performed using a sensor that is sensitive in a range of thermal radiation wavelengths , thus making it possible to obtain enough signal , yet this range is different enough from the wavelength emitted by the laser 10 so that the latter does not interfere with the measurement . moreover , this sensor 15 has response time that is much shorter than the time between two consecutive shots . this sensor 15 converts the thermal radiation into electrical output signals v s transmitted to a signal acquisition and processing system 18 . the signal acquisition and processing system 18 makes it possible to deduce the temperature using methods known to the person skilled in the art . in the embodiment described in fig1 , the sensor 15 is coupled with an optical fiber 16 , itself coupled via an input to one or more optical lenses , only one of which 17 is shown . the optical lens 17 collects the radiation emitted by the surface of the block 14 . in an additional embodiment ( not illustrated ), the โ sensor 15 โ signal acquisition and processing system 18 โ combination can be replaced by a pyrometer . in a practical exemplary embodiment , a kleiber ยฎ c - lwl pyrometer , which is sensitive in a wavelength range of between 1 . 58 and 2 . 2 ฮผm , is used . this measuring device is equipped with a lens for collecting part of the radiation emitted by the material under test . in a preferred embodiment , the signal acquisition and processing system 18 is embodied by means of a computer system with a stored program , comprising specific acquisition cards that receive the signals converted by the sensor 15 and associated with the labview ยฎ (โ laboratory virtual instrument engineering workbench โ) software . this type of operating mode is intrinsically well known to the person skilled in the art and there is no need to describe it further . in a preferred embodiment , the temperature analysis can be performed using specialized software , for example the matlab ยฎ interactive calculation software available on the market , which makes it possible to perform numerical simulations based on numerical analysis algorithms . in the context of the invention , this software makes it possible to solve the heat equation in the medium under test in question , taking into account an internal heat source representing the laser pulse heating . thermophysical parameters such as the thickness of the layer , the thermal resistance between the two layers , the thermal diffusivity , the absorption coefficient and / or the density of the material are variables , and can be adjusted based on experimental results . creating a calculation program using software of this type is an operation that is intrinsically within the capability of the person skilled in the art . here again , there is no need to describe it in further detail . in a preferred embodiment , the heating and the radiation measurement are carried out in a controlled atmosphere , for example in a nitrogen , argon or vacuum atmosphere . in an additional variant of embodiment ( not illustrated ), a gas jet can be sprayed onto the surface of the material ( the superficial layer 140 ) in order to prevent any influence of the ambient atmosphere on the heated surface . in another embodiment , in order to obtain a mapping of the thermophysical properties of the superficial layer , the heating of the material can also be obtained using a laser beam scanned over the surface under the control of a galvanometric scanning device , for example comprising a motor 19 mechanically coupled with an array of optical elements 13 ( mirrors and lenses ) disposed on a rotating shaft . in this embodiment , the optical lens 17 for collecting the thermal radiation must be moved so as to continuously collect the thermal radiation issuing from the area heated by the laser . in another embodiment , in order to obtain a mapping of the thermophysical properties of the superficial layer , the surface of the material 14 is moved past the array of optical lenses 13 . we will now describe a first example of the results obtained using the method of the invention , in reference to fig2 . it is assumed that the high - frequency pulsed laser beam generated by the laser 10 in fig1 is projected onto a block of material 14 comprising two layers , a superficial layer 140 and a substrate 141 . it is also assumed that the superficial layer 140 of small thickness is composed of a material that is highly absorbent of the electromagnetic radiation of the beam generated by the laser 10 and not very thermally diffusive on the surface . the experiment is repeated for superficial layers 140 of various thicknesses , i . e . 2 , 3 and 4 ฮผm in the example described ( curves c 1 through c 3 , respectively ). the material is heated by laser pulses of very short duration ( 90 ns ) emitted at a high firing rate ( 10 khz ). as mentioned above , according to one of the important features of the invention , this choice of frequency makes it possible to accumulate heat , shot after shot , because the superficial material 140 does not have time to cool completely between pulses . it is assumed in the example in fig2 that the salvo of shots comprises ten successive shots ( laser pulses ) tir 1 through tir 10 , repeated after a time interval of 0 . 1 ms ( the horizontal time axis t , graduated from 0 to 1 ms ). the laser pulses , synchronized with the instants 0 through 0 . 9 ms on the time axis t of fig2 , cause sudden temperature increases , with the successively reached temperatures culminating in values tmax i ( typically between 3 , 000 and 3 , 500 ยฐ c . : the vertical axis t of temperatures from 0 to 3500 ยฐ c .) which increase steadily from one shot to the next . when a laser pulse stops , the temperature of the superficial layer of material 140 decreases , but much more slowly than it increased during the temperature increase ( natural cooling ), so as to reach minimum values tmin i ( typically between 250 and 500 ยฐ c .) that increase steadily from one shot to the next . it is easy to see in fig2 that the evolution of the temperature in a single shot ( the first shot , tir 1 ) does not make it possible to distinguish any notable differences in behavior between the various layer thicknesses ; the curves c 1 through c 3 are practically the same . on the other hand , the accumulation of heat , shot after shot , makes it possible to distinguish a clear difference between the various layer thicknesses . in the example described in fig2 , this difference between the curves c 1 through c 3 becomes completely perceptible beginning with the third pulse , tir 3 . an additional series of experiments was conducted , this time no longer varying the thickness of the superficial layer 140 , but choosing a thin layer of material that was highly conductive and not very diffusive on the surface , disposed on a highly thermally diffusive material forming a thick substrate 141 . to conduct these experiments , three different thermal contact values were selected . the thermal contact values were divided into three classes , with two extremes : โ perfect โ thermal contacts and โ no contact ,โ respectively . an โ intermediate โ thermal contact value was also chosen . the respective curves c โฒ 1 , c โฒ 3 and c โฒ 3 in fig3 correspond to the three aforementioned classes . as before , the horizontal axis is graduated in time units t ( from 0 to 1 ms ), the vertical axis in temperature units t ( from 0 to 4 , 500 ยฐ c . ), and the salvo of shots comprises ten pulses , t 1 through t 10 , repeating every 0 . 1 ms and having a duration equal to 90 ns . the successively reached temperatures culminate in values t โฒ max i ( typically between 2 , 500 and 4 , 500 ยฐ c .) which increase steadily from one shot to the next . in the same way as in the preceding case , when are laser pulsing stops , the temperature decreases , but much more slowly than it increases during the temperature increase , so as to reach minimum values t โฒ min i ( typically between 250 and 750 ยฐ c .) that also increase steadily from one shot to the next . here again , it is not possible to see differences between the thermal contacts of different classes with a single shot ( the first pulse tir 1 ). the curves c โฒ 1 through c โฒ 3 are practically the same . on the other hand , the accumulation of heat , shot after shot , makes it possible to reveal the difference in behavior between the various classes of contacts , here again beginning with the third pulse tir 3 , in the example described in fig3 . moreover , this differentiation becomes greater and greater , again in the example described , between the โ no contact โ class ( curve c โฒ 3 ) and the other two classes ( curves c โฒ 1 and c โฒ 3 ). in the two exemplary experiments described above , it is possible to obtain a set of predetermined information on the superficial layer 140 by analyzing predetermined heating and cooling time regimes of said material ( 140 ). the analysis focuses on all or some of the following regimes : the measurement of the average increase in its temperature , the time evolution of the temperature during the heating in each thermal cycle or selectively for predetermined thermal cycles , the average temperature value reached at saturation , the maximum temperature value ( tmax i ) reached for each thermal cycle or selectively for predetermined thermal cycles , the temperature value reached just before each laser pulse or selectively before predetermined laser pulses , the temperature value in one or more predefined time intervals between two laser pulses as compared to the previous laser pulse , the - time evolution of the temperature between two laser pulses , the time evolution of the temperature after the end of said salvo of laser pulses and / or the temperature value reached in one or more predetermined periods after said salvo of laser pulses ( not illustrated in fig2 and 3 ). the main steps of the method according to the invention will now be described in detail . a first step consists of heating the surface of a block of material 14 comprising at least two different layers , a superficial layer 140 of small thickness , typically on the order of one micrometer , disposed on a thick ( in comparison with the thickness of the superficial layer 140 ) substrate 141 . however , the thickness of the superficial layer 140 can be greater or less than one micrometer without going beyond the scope of the invention . the heating is performed using a laser 10 , pulsed at a high firing rate so the material absorbs the laser radiation , heats up and partially cools between two shots . in essence , the firing rate , i . e . the repetition frequency of the pulses delivered by the laser 10 , is chosen so as to be high enough so that the maximum temperature tmax i reached cannot fall back ( tmin i ) to the initial temperature . the number of shots applied to the block of material 14 can be high enough so that the average temperature increase reaches saturation and remains substantially constant , but it can also be lower , depending on the type of measurement to be performed . the energy of the laser pulses must be high enough so that the thermal signal can be measured with a sufficient signal - to - noise ratio . since the measurement must be non - destructive , it is understood that this energy must also be low enough not to damage the material . a second step consists of collecting all or part of the thermal radiation emitted by the surface of the material . the collection and transport of the radiation can be performed using optical lenses 17 and an optical fiber 16 . a third step consists of measuring at least part of this collected thermal radiation using a sensor 15 whose spectral sensitivity range is adapted to the radiation emitted by the target and converting it into electrical signals . the measurement can be performed , for example , using a pyrometer , advantageously a multi - channel pyrometer in order to eliminate the emissivity specific to the material . in that case , the second and third steps can be combined into a single step , since the pyrometer is normally provided with a lens that collects the radiation emitted by the material under test . a fourth step consists of analyzing predetermined heating time regimes of the material , i . e ., in particular , the average increase in the temperature , the time evolution of the temperature during the heating with each shot ( i . e ., with each laser pulse ) or selectively for predetermined shots , the average maximum temperature value , the maximum temperature value tmax i reached for each shot or selectively for predetermined shots , the temperature value reached just before each shot , t โฒ min i , or selectively before predetermined shots , the temperature value in one or more time intervals between two shots as compared to the previous shot , the time evolution of the temperature between two shots , the time evolution of the temperature after the salvo of shots , and / or the temperature value reached in one or more predetermined periods after the salvo of shots . a fifth step consists of comparing the values of the measurements performed and acquired with theoretical values given by the heat equation adapted to the block of material under test , these theoretical values being obtained using a numerical modeling process , and of matching up these two series of values by varying one or more physical parameters of the material , such as the thickness of the superficial layer , the thermal conductivity of the superficial layer , the absorption coefficient of the superficial layer and / or the density of the superficial layer . the numerical modeling can be obtained , as indicated above , using calculation software that is available on the market , such as the aforementioned matlab ยฎ or any similar software . preferably , the theoretical calculation of the heating takes into account the effects of the roughness of the surface of the material , nonhomogeneous heating of the material ( for example , either due to an intrinsic nonhomogeneity of the material or due to a nonhomogeneity of the intensity of the laser beam ), interference with the beam in the superficial layer , the thickness at which the temperature is measured , etc . in light of the description given above , it is easy to see that the invention achieves the objects set forth . it offers a number of advantages , particularly in that it makes it possible both to obtain a very good โ signal - to - noise โ ratio and to heat the material to a sufficient depth for the entire thickness of the thin superficial layer and / or the thermal contact between two layers to actually be involved . it is not , however , limited to the exemplary embodiments explicitly described , particularly in reference to fig1 through 3 . likewise , precise numerical examples have been given only in order to better demonstrate the essential features of the invention and are merely the result of a technological choice that is intrinsically within the capability of the person skilled in the art , in accordance with a specific intended application . they do not limit the scope of the invention in any way whatsoever . | 6 |
in a first aspect , the present invention provides a process for preparing a polymer latex comprising polymerizing one or more ethylenically unsaturated aromatic monomers and one or more conjugated diene monomers in the presence of hydroperoxide chain transfer agent and sulfur - containing chain transfer agent , wherein the sulfur - containing chain transfer agent is added after the hydroperoxide chain transfer agent . the hydroperoxide chain transfer agent used in the invention can be hydrogen peroxide or an organic hydroperoxide having the general structure rooh , wherein r is an organic residue . examples of useful organic hydroperoxides are tert - amyl hydroperoxide , tert - butyl hydroperoxide , cumene hydroperoxide , diisopropylbenzene hydroperoxide and pinane hydroperoxide . tert - butyl hydroperoxide is preferably used as the hydroperoxide chain transfer agent in the present invention . in the invention , two or more hydroperoxides may be used in combination as the hydroperoxide chain transfer agent . the hydroperoxide chain transfer agent is typically used in a total amount of 0 . 5 to 10 parts by weight , preferably 0 . 5 to 8 parts by weight , more preferably 0 . 5 to 4 parts by weight , based on 100 parts by weight of the total amount of monomers . the sulfur - containing chain transfer agent used in the invention can be a mercaptan compound , especially an alkyl mercaptan such as methyl mercaptan , ethyl mercaptan , tert - butyl mercaptan , benzyl mercaptan , tert - nonyl mercaptan , n - octyl mercaptan , n - dodecyl mercaptan and tert - dodecyl mercaptan , a thioglycolic acid or thioglycolic acid ester , such as iso - octyl thioglycolate and 2 - ethylhexyl thioglycolate , thiopropionic acid such as iso - octyl mercaptopropionic acid or a dithio compound such as 1 , 8 - dimercapto - 3 , 5 - dioxaoctane . tert - dodecyl mercaptan is preferably used as the sulfur - containing chain transfer agent in the present invention . in the invention , two or more sulfur - containing compounds may be used in combination as the sulfur - containing chain transfer agent . the sulfur - containing chain transfer agent is typically used in a total amount of 0 . 1 to 10 parts by weight , preferably 0 . 1 to 5 parts by weight and more preferably 0 . 1 to 2 parts by weight , based on 100 parts by weight of the total amount of monomers . a combination of tert - butyl hydroperoxide and tert - dodecyl mercaptan is a preferred combination of chain transfer agents used in the present invention . the polymer latex of the present invention is prepared from a monomer mixture which contains one or more ethylenically unsaturated aromatic monomers and one or more conjugated diene monomers , and which may optionally contain further polymerizable monomers ( also referred to as comonomers ) such as monofunctional or multifunctional acrylic and methacrylic acids and corresponding acrylate and methacrylate monomers . the one or more ethylenically unsaturated aromatic monomers are typically used in a total amount of 10 to 90 wt %, more preferably 25 to 75 wt %, even more preferably 30 to 70 wt %, based on the total amount of monomers ( including comonomers ). representative ethylenically unsaturated aromatic monomers include , for example , styrene , ฮฑ - methyl styrene , p - ethyl styrene , p - methyl styrene , tert - butyl styrene , vinyl toluene and c 1 - 4 alkyl , chloro and bromo derivatives thereof . a particularly preferred ethylenically unsaturated aromatic monomer is styrene . the one or more conjugated diene monomers are typically used in a total amount of 10 to 80 wt %, more preferably 20 to 80 wt %, even more preferably 20 to 70 wt %, even more preferably 25 to 60 wt %, based on the total amount of monomers . representative conjugated diene monomers include , for example , 1 , 3 - butadiene , isoprene , 2 - methyl - 1 , 3 - butadiene , 2 , 3 - dimethyl - 1 , 3 - butadiene and chlorinated butadiene . a particularly preferred conjugated diene monomer is 1 , 3 - butadiene ( also abbreviated as butadiene ). a combination of styrene and butadiene is a preferred combination of monomers in the present invention , preferably used in the respective amounts as indicated to be preferred above . further polymerizable monomers ( comonomers ) may be used as monomers to be polymerized in the preparation of the polymer latex of the present invention . two or more of such further comonomers may be used in combination . examples of such comonomers include acrylate monomers , and two or more acrylate monomers may be used in combination . representative examples of the acrylate monomers include , for example , n -, iso - and tent - alkyl esters of acrylic or methacrylic acid , wherein the alkyl group has from 1 to 20 carbon atoms . additionally , acrylate monomers can include acids , esters , amides of the ( meth ) acrylic acid , and substituted derivatives thereof . generally , preferred acrylate monomers are c 1 - c 20 alkyl ( meth ) acrylates and c 1 - 10 alkoxy c 1 - c 10 alkyl ( meth ) acrylates , more preferably c 1 - c 8 alkyl ( meth ) acrylates and c 1 - c 8 alkoxy c 1 - c 8 alkyl ( meth ) acrylates . examples of such acrylate monomers include n - butyl acrylate , sec - butyl acrylate , ethyl acrylate , hexyl acrylate , cert - butyl acrylate , 2 - ethylhexyl acrylate , iso - octyl acrylate , 4 - methyl - 2 - pentyl acrylate , 2 - methylbutyl acrylate , methyl methacrylate , butyl methacrylate , n - butyl methacrylate , isobutyl methacrylate , ethyl methacrylate , isopropyl methacrylate , hexyl methacrylate , cyclohexyl methacrylate , and cetyl methacrylate , methoxyethyl methacrylate , ethoxyethyl methacrylate , methoxyethyl acrylate , ethoxyethyl acrylate , butoxyethyl methacrylate , methoxybutyl acrylate and methoxyethoxyethyl acrylate . preferred acrylate monomers are n - butyl acrylate , butyl methacrylate , 2 - ethylhexyl acrylate , methyl acrylate and methyl methacrylate , with methyl methacrylate and n - butyl acrylate being especially preferred . typically , the amount of acrylate monomer ( if used ) will be from 0 to 70 wt %, preferably from 0 to 60 wt %, even more preferably from 0 to 50 wt %, based on the total amount of the monomers . further examples of such comonomers include ethylenically unsaturated mono - and di - carboxylic acid monomers such as ( meth ) acrylic acid , fumaric acid , maleic acid and itaconic acid , nitrile monomers such as acrylonitrile , vinyl ester monomers , hydroxyalkyl -( meth ) acrylate monomers , alkoxyalkyl ( meth ) acrylate monomers , and ( meth ) acrylamide monomers . a particularly preferred comonomer is acrylonitrile , preferably used in an amount of at least 2 wt %, more preferably at least 3 wt %, even more preferably at least 4 wt %. in terms of ranges , preferred amounts are 2 to 25 wt %, more preferably 3 to 20 wt %, even more preferably 4 to 12 wt %. it has been found that acrylnonitrile has a particularly profound effect on the effectiveness of the combined , sequential use of the charge transfer agents in the process of the present invention and on the properties of the resulting polymer latex . further comonomers useful in the present invention are crosslinkers and include crosslinkable monomers , such as multi - ethylenically unsaturated monomers . exemplary crosslinkers include n - methylol acrylamide , n - methylol methacrylamide , glycidyl acrylate , glycidyl methacrylate , ethylene glycol dimethacrylate , allyl methacrylate , diallyl maleate , propylene glycol dimethacrylate , divinylbenzene ; and acryloxy alkylsilanes , such as , for example , ฮฑ - acryloxypropyl trimethoxysilane . preferred crosslinkable monomers for use in the present invention are allyl methacrylate , glycidyl methacrylate , and acryloxy alkylsilanes . these crosslinkable monomers , if used , are typically employed at levels of from 0 . 05 to 10 , preferably 0 . 05 to 5 wt %, more preferably 0 . 05 to 2 wt %, based on the total amount weight of monomers . in one preferred embodiment of the present invention , the polymer latex is prepared from at least styrene , butadiene and acrylonitrile , preferably used in the respective amounts as indicated to be preferred above . initiators useful in the practice of the present invention include water - soluble and / or oil - soluble initiators which are effective for purposes of polymerization . representative initiators are well - known in the art and include , for example , thermal initiators that are oil - soluble , such as higher alkyl peroxides or azo compounds or thermal initiators which are water - soluble such as persulfate ; redox pairs including sodium sulfite , sodium bisulfite , sodium metabisulfite or sodium formaldehyde sulfoxylate and persulfate salt , ferrous ions and a peroxide ( fenton &# 39 ; s reagent ), cuprous ions and peroxide , and ferrous ions and sodium persulfate wherein the peroxides can include benzoyl peroxide , hydrogen peroxide , or t - butyl peroxide . examples of oil - soluble thermal initiators are azobisisobutyronitrile and t - butyl peroctoate . the initiator is employed in an amount sufficient to initiate the polymerization reaction at a desirable rate . in general , the amount of initiator will range from 0 . 05 to 5 , preferably 0 . 1 to 4 wt %, more preferably from 0 . 1 to 3 wt %, based on the total amount of the monomers . in a preferred embodiment , the process of the present invention does not employ a redox pair as an initiator . surfactants or emulsifiers suitable for use in the present invention include those conventional surface active agents typically known in the art for polymerization processes . the surfactant ( s ) can be added to the aqueous phase and / or monomer phase . an effective amount of surfactant in a seeded process is that amount selected to assist in stabilizing the particle as a colloid , minimizing contact between the particles and preventing coagulation . in an unseeded process , an effective amount of surfactant will be that amount selected to influence the particle size . representative surfactants include saturated and ethylenically unsaturated sulfonic acids or salts thereof , including , for example , hydrocarbon sulfonic acids , such as , vinyl sulfonic acid , allyl sulfonic acid , and methallyl sulfonic acid , and salts thereof ; aromatic hydrocarbon - sulfonic acids , such as , for example , p - styrene sulfonic acid , isopropenyl benzene sulfonic acid , and vinyloxybenzene sulfonic acid , and salts thereof ; sulfoalkyl esters of acrylic acid and methacrylic acid , such as , for example , sulfoethyl methacrylate and sulfopropyl methacrylate and salts thereof ; and 2 - acrylamido - 2 - methylpropanesulfonic acid and salts thereof ; alkylated diphenyl oxide disulfonates , sodium dodecyl benzene sulfonates and dihexyl esters of sodium sulfosuccinic acid , ethoxylated alkyl phenols and ethoxylated alcohols ; and sulfosuccinate ester salts , alkylethoxylated sulfate and alkylethoxylated sulfonate salts , alkyl ( poly ) phosphate salts , and alkyl sulfate and alkyl sulfonate salts . the type and concentration of surfactant is typically dependent on the polymer solids level and latex particle size . a higher polymer solids level and a low particle size will generally increase the need for surfactant . typically , surfactants are employed in a total amount of from 0 . 05 to 20 , preferably from 0 . 05 to 10 , more preferably from 0 . 05 to 5 , parts by weight , based on the total weight of the monomers . various protective colloids may also be used in place or in addition to the surfactants described above . suitable colloids include partially acetylated polyvinyl alcohol , casein , hydroxyethyl starch , carboxymethyl cellulose , hydroxyethyl cellulose , hydroxypropyl cellulose and gum arabic . the preferred protective colloids are carboxymethyl cellulose , hydroxyethyl cellulose and hydroxypropyl cellulose . in general , these protective colloids are used at total amounts of 0 to 10 , preferably 0 to 5 , more preferably 0 to 2 parts by weight , based on the total amount of the monomers . various other additives and ingredients known to those skilled in the art can be incorporated to prepare the latex polymer or latex polymer composition of the present invention . such additives include , for example , metal chelating agents , ph buffering agents , anti - foaming agents , wetting agents , thickeners , plasticizers , fillers , pigments and antioxidants . known anti - foaming agents include silicon oils , polysiloxane oils , acetylene glycols , mineral oils and paraffinic oils and formulated compounds . common known wetting agents include alkylphenol ethoxylates , alkali metal dialkyl sulfosuccinates , acetylene glycols and alkali metal alkyl sulfates . typical thickeners include polyacrylates , polyacrylamides , xanthan gums , modified celluloses or particulate thickeners such as silicas and clays . typical plasticizers include mineral oil , liquid polybutenes , liquid polyacrylates and lanolin . zinc oxide , titanium dioxide , aluminum hydrate , calcium carbonate , and clay are typically employed fillers . in the present invention , the polymerization for producing the polymer latex is preferably started in the presence of hydroperoxide chain transfer agent , and sulfur - containing chain transfer agent is added as the polymerization proceeds . for example , the monomer mixture can be added to the hydroperoxide chain transfer agent or combination of hydroperoxide chain transfer agents , or vice versa . alternatively , hydroperoxide chain transfer agent can be added to the polymerizing monomer mixture as the polymerization proceeds , preferably in the period of from 3 to 8 % of the total polymerization time . in such case , hydroperoxide chain transfer agent is preferably added in the form of an aqueous solution . the sulfur - containing chain transfer agent or combination of sulfur - containing chain transfer agents is added after the hydroperoxide chain transfer agent , as the polymerization proceeds . the expression โ added after the hydroperoxide chain transfer agent โ is intended to mean an addition after substantially all of the hydroperoxide chain transfer agent has been introduced in the process , in particular after at least 80 wt %, more particularly at least 90 wt %, even more particularly at least 95 wt %, or at least 99 wt %, or 100 wt % of the hydroperoxide chain transfer agent has been introduced in the process . the sulfur - containing chain transfer agent or combination of sulfur - containing chain transfer agents is preferably added continuously over at least 20 % of the total polymerization time , more preferably over at least 40 % of the total polymerization time , even more preferably over at least 60 % of the total polymerization time , even more preferably over the total polymerization time . the total polymerization time , as referred to in this specification , represents the time from contacting the monomer mixture , or a part thereof , with initiator until the desired degree of polymerization is achieved . for example , in case the monomer mixture is continuously added to the reaction as the polymerization proceeds , the total polymerization time represents the time from beginning of the addition until termination of the addition , including the time of subsequent addition of initiator to achieve the desired degree of polymerization . in general , the polymer latex of the present invention can be prepared by polymerization processes which are known in the art , and particularly by the known latex emulsion polymerization processes , including both seeded and unseeded latex polymerization , provided the addition of the specific chain transfer agents is carried out as described above . representative processes include those described in u . s . pat . no . 4 , 478 , 974 , u . s . pat . no . 4 , 751 , 111 , u . s . pat . no . 4 , 968 , 740 , u . s . pat . no . 3 , 563 , 946 , u . s . pat . no . 3 , 575 , 913 , de 1 905 256 and wo 2011 / 079011 . such processes can be adapted as necessary to polymerize the monomer mixture used in the present invention . the method of introduction of the monomer mixture and other ingredients , such as polymerization aids , is not particularly critical , except for the addition of the chain transfer agents . the polymerization is then carried out under conventional conditions until the desired degree of polymerization is achieved . preferably , the polymerization is carried out at a temperature of from 50 to 95 ยฐ c ., more preferably from 70 to 90 ยฐ c ., crosslinkers and the well - known latex polymerization aids such as initiators , ph buffering agents , surfactants and emulsifiers can be used as needed . the following examples are given to illustrate the invention and should not be construed as limiting it in any way . unless stated otherwise , all parts and percentages are given by weight . a series of latexes is prepared by emulsion polymerizing a monomer composition of styrene , butadiene , itaconic acid , acrylic acid and acrylonitrile , in the additional presence of surfactant and persulfate and varying amounts and types of chain transfer agents . the polymerization is carried out as a seeded radical emulsion polymerization with a particle size range of 120 to 140 nanometers ( nm ) at a temperature of 90 ยฐ c ., similar to the method described in example 1 of wo 2011 / 079011 . gel % test measures gel content and optionally swelling index . the gel content measures the solvent - insoluble fraction of the polymer . the swelling index measures the amount of solvent absorbed by the solvent - insoluble fraction of the polymer . for polymer partly or completely insoluble in solvent ( so that the molecular weight cannot be measured by gel permeation chromatography ), this technique allows a comparative measure of both molecular weight and crosslinking density of the tested polymers . the higher the gel %, the higher the crosslinking density network and corresponding molecular weight . when the polymer is produced by emulsion polymerization reaction in which one or more chain transfer agent types are present and when this is the only parameter modified , a high sell value indicates a low chain transfer efficiency . for the determination of gel content of the polymer latexes of the present invention , toluene is used as the solvent . dry films are made from the latexes adjusted to ph 8 . a dry latex film having a weight ( a ) is swollen for 24 hours with toluene . the toluene - insoluble wet gel is then separated by filtration . after drying the wet gel , the weight of the dry gel is determined as ( c ). gel % is calculated as : elongation at break and force at break reflect polymer film tensile strength . high gel % polymers ( highly crosslinked , with high molecular weight ) show a reduced elongation at break and high force at break when subjected to an elongational force . low sell polymers films ( low crosslinked , with low molecular weight ) have the ability to deform under stress but will break at a lower stress . tensile strength is tested on film samples of 75 mm length , 10 mm width , with a center part width of 5 mm . the punch press is a naef 22 / 028 . tensile tests are performed according to astm d2370 - 92 using a houndfield 5000 extensiometer with a crosshead speed of 100 mm / minute . 4 - phenylcyclohexene ( 4 - pch ) is a by - product formed by diels - alder side reaction competing with emulsion polymerization reaction . the higher the 4 - pch amount , the lower the polymerization reaction conversion and consequently the more diels - alder by - products are likely to be formed . in the present invention , the higher the 4 - pch amount , the more the chain transfer agent acts as a polymerization retarder . a given weight of wet latex is extracted for one hour with isooctane . the isooctane extract is injected in a gas chromatography column previously calibrated with standards . results are given as ppm of impurities based on wet latex . examples 1 to 4 ( comparative ) and 5 to 8 ( in accordance with the invention ): example 1 is prepared in the same manner as described above with 1 . 7 wt % of tert - dodecyl mercaptan being added continuously over the monomer total feed time . example 2 is prepared in the same manner as described above with 4 wt % of tert - butyl hydroperoxide being added continuously over the first 44 . 5 % of the monomer total feed time . example 3 is prepared in the same manner as described above with 0 . 85 wt % of tert - dodecyl mercaptan and 1 . 4 wt % of tert - butyl hydroperoxide both being added continuously over the monomer total feed time . example 4 is prepared in the same manner as described above with 0 . 85 wt % of tert - dodecyl mercaptan being added continuously during the first 50 % of the monomer total feed time and 1 . 4 wt % of tert - butyl hydroperoxide being added continuously over the last 50 % of the monomer total feed time . example 5 is prepared in the same manner as described above with 0 . 85 wt % of tert - dodecyl mercaptan being added continuously during the monomer total feed time and 1 . 4 wt % of tert - butyl hydroperoxide being added at the start of the emulsion polymerization reaction . example 6 is prepared in the same manner as described above with 0 . 85 wt % of tert - dodecyl mercaptan being added continuously during the monomer total feed time and 1 . 87 wt % of tert - butyl hydroperoxide being added at the start of the emulsion polymerization reaction . example 7 is prepared in the same manner as described above with 1 . 13 wt % of tert - dodecyl mercaptan being added continuously during the monomer total feed time and 1 . 4 wt % of tert - butyl hydroperoxide being added at the start of the emulsion polymerization reaction . example 8 is prepared in the same manner as described above with 0 . 85 wt % of tert - dodecyl mercaptan being added continuously during the first 74 % of the monomer total feed time and 1 . 4 wt % of tert - butyl hydroperoxide being added at the start of the emulsion polymerization reaction . * measurement duplicate for example 1 and from a separate measurement series for example 3 and 4 compared to the others the latex polymers of examples 1 to 8 are formulated into an 80 parts of calcium carbonate and 20 parts of clay formulation at 70 wt % solids and ph 8 . 5 . 8 and 10 wt % of binder levels are used . each formulation is coated onto a base paper having a weight of 85 g / m 2 at a coating weight of 12 g / m 2 . the coated papers are evaluated in terms of binding strength as measured by the number of passes to fail in the ink piling test . the ink piling test simulates coated paper surface picking due to ink tack built up from multiple ink splitting events as paper goes through multiple printing station units during industrial offset printing . coated paper surface picking results in particles being transferred back to the blanket and printing cylinder where they agglomerate and disturb the printing process and final visual printing appearance . paper strips of 4 . 5 ร 26 centimeters are printed on a prufbau lab printing unit with two printing rolls with a 10 seconds interval between each roll . this allows proper ink deposit on the paper sample . the printing rolls have been previously prepared with a calibrated and controlled standardized huber ink amount which is uniformly applied on each roll . the paper sample is visually inspected for surface picking and further passed through a vulcanized disk every 5 seconds until picking occurs . the number of passes under the vulcanized disk until picking failure is recorded as the number of passes to fail . the evaluation of the coated papers is summarized in fig1 . | 2 |
as best shown in fig8 a vault 20 according to this invention comprises a body 21 , a lid 22 , a clip 23 and a fastener 24 . when the lid is brought down onto the body and the fastener is fastened to the clip , the joinder and assembly are exemplified in fig8 and 9 when the vault is assembled , it forms an enclosed region 25 within which connections ( not shown ) can be placed and accessed through the top end 30 . conventionally the conduits , cables , or valves being connected are brought into the region through the open bottom end 31 of the body . customarily the body is buried in a surrounding region , such as soil , or abutted by gravel or concrete poured around it to stabilize it in place . the upper end of the body will be placed where , when the lid is attached , the upper surface of the lid will be at grade . the peripheral wall 32 of the body is a quadrilateral frustum , sloping upwardly from the bottom end . if preferred , the bottom end could be the larger end , but structural consideration will prefer the illustrated shape over the reverse , or from a prismatic shape ( which could also be used ). circular vaults are also in this scope of this invention , but quadrilaterals are generally preferred . the illustrated shape is well - suited to manufacture by injection molding processes , which is an advantage in the reduction of cost . it is also amenable to rotational molding . the lower end includes an upwardly extending peripheral skirt 33 . attention is called to buttresses 34 which are integral with ( or attached to ) the inside of the skirt and the outside of the peripheral wall . these provide strong support for the skirt , which in turn provides significant rigidity to the lower end so that side forces are less likely to distort the shape of the body . a rim 40 is formed at the top end of the body , where a seat 41 is formed by a re - entrant wall 42 that terminates in an inwardly - extending flange 43 . a lip 44 is formed as an inward extension from flange 43 , with a hole 45 therethrough for a purpose to be described . buttresses 46 fit between the outer surface of wall 42 and the inner surface of the peripheral wall . these buttresses may be molded as part of the body or later cemented or solvent welded in as preferred . however , it will be noted that all elements of the body as shown are suitable for molding in a single operation , perhaps drilling the hole as a second operation . in the event that a positive lock for the lid is not necessary a rise 49 , which may be one or more dimples , or a circumferential band , is formed on the inside of the re - entrant wall . it will frictionally engage to the lid to be described , and require extra force to remove the lid . lid 22 is best shown are fig5 - 7 . it includes a top plate 50 with an upper surface 51 and an optional shoulder 52 that extends around the edge of the lid . the underside of the lid is formed as a plug 53 which is intended to fit in seat 41 , bearing against re - entrant wall 42 and , depending on preference , with shoulder 52 bearing on the rim or the lower end of the plug bearing on flange 43 , or both . to reduce its weight and cost , the bottom is relieved by a honeycombing with intersecting plates 53 forming voids between them . rise 49 will engage the lid , and perhaps slightly indent into it . as best shown in fig9 a recessed opening 55 is formed through the lid near its edge . it has a shoulder 56 around the edge of the opening . a second opening 57 through the opposite edge of the lid is provided to facilitate removal of the lid from the body . lock means 60 comprise clip 23 and fastener 24 . if desired , an e - ring 61 can be placed on the fastener at a spacing from the head . the e - ring can be removed with difficulty . while it is in place it will hold the fastener to the lid , but permit substantive axial movement of the fastener . as best shown in fig9 clip 25 is pressed over lip 44 , where it overhangs hole 45 . fastener 24 , which is a threaded , headed bolt , carries a washer 62 and passes through opening 55 , bearing against the lid as shown . the e - ring can be used if ready separation of the bolt from the lid is not desired . the bolt is threaded into the clip , and the lid is locked in place . the lid can be removed after the - bolt is unthreaded from the clip . as a security measure , the head of the fastener may be coded in shape so as to require a special wrench to engage it . the conventional means for this is to provide an array of curving surfaces which is non - symmetrical . basically this means avoiding parallel driving surfaces , or not providing any array at all , for example a circular head . a pentagonal array is a suitable example . clip 23 is uniquely advantageous to this vault , because it can readily be pushed onto the lip where it will retain itself even when not engaged by the fastener . furthermore it can readily and inexpensively be manufactured from a strip of suitably strong metal , usually a stainless steel . as shown in fig1 - 14 , the clip has a pair of arms 70 , 71 which are joined by a bight 72 . the arms confront one another . installation of the clip is facilitated by oppositely directed bends 73 , 74 at the tips of the arms . upper arm 70 has an opening 75 therethrough with a partial circumference 76 from which a retainer 77 has been punched . the retainer has a complete hole 78 therethrough , and is formed as a catch , angled inwardly from its base area 70 . in side view the retainer has a small bend 80 which enables the retainer to slide over the lip without digging into the plastic as a sharp end would . after installation , the retainer exerts a strong retentive force that may indent into the lip . lower arm 71 has a pair of catches 81 , 82 punched in from the outside , further to retain the lip . a neck 85 is formed on the lower arm , extending outwardly from the clip . it has a tubular wall 86 with an internal thread 87 . the thread and the hole in the upper arm are aligned , and when the clip is installed these will be aligned with hole 45 in the lip , and with the fastener . the assembly with the lid is best shown in fig9 . the neck may be made separately and fastened to the arm if desired . however , it is an advantage of the clip that it can be made from a single strip of metal by successive operations . the neck may readily be formed by impact extrusion , in which metal is deformed from the plane of the strip and extruded to form the neck . the free end of the neck will be squared off , and the inside threaded . the retainer can be formed in a single or double blow , forming the hole in it , and then severing the metal around only part of the retainer while bending it to shape . the folds at the end of the bight are made by a simple folding operation . the organic plastic material for the body and lid may be any suitable for the intended purpose . high density polyethylene or polypropylene family is one suitable example . this invention provides a vault made up from a number of unique and readily manufactured parts . the parts themselves are economically made by routine procedures . this invention is not limited by the embodiment shown in the drawings and described in the description , which is given by way of example and not of limitation , but only in accordance with the scope of the appended claims . | 4 |
to enable the objects , features and advantages of the present invention to be readily understood , the present invention will be described in more detail via the preferred embodiments with reference to the accompanying drawings . referring to fig3 , an lcd having a conducting film according to a first embodiment of the present invention is depicted therein . an lcd panel 20 comprises a first conducting high polymer film 21 formed on an upper surface of the lcd panel 20 and a second conducting high polymer film 22 formed on a lower surface of the lcd panel 20 . the first and the second conducting high polymer films 21 , 22 are each formed by spin - coating a solution of papsa ( poly ( aniline - co - n -( 4 - sulfophenyl ) aniline )) copolymer , having a suitable concentration , with water as a solvent or other organic solvents , wherein the first and the second conducting high polymer films 21 , 22 each have a conductivity of 0 . 0035 s / cm per unit area . then , an upper polarizer 100 and a lower polarizer 100 are then bonded onto the upper and lower conducting high polymer films 21 , 22 respectively . as such , charges produced when the polarizers 100 are bonded to the panel 20 is apt to be rapidly eliminated through the first and the second conducting high polymer films 21 , 22 , and thus ics and tft devices in the panel is exempted from damage . referring to fig4 , an lcd having a conducting film according to a second embodiment of the present invention is depicted therein . an lcd panel 30 comprises a first conducting high polymer film 31 formed on an upper surface of the lcd panel 30 and a second conducting high polymer film 32 formed on a lower surface of the lcd panel 30 . the first and the second conductive high polymers 31 , 32 are each formed by spin - coating a solution of a psa ( poly ( n -( 4 - sulfophenyl ) aniline )), having a suitable concentration , with water as a solvent or other organic solvents , wherein the first and the second conducting high polymer film 31 , 32 each have a conductivity of 0 . 006 s / cm per unit area . then , an upper polarizer 200 and a lower polarizer 200 are bonded onto the first and the second conducting high polymer films 31 , 32 , respectively . as such , charges produced when the polarizers 200 are bonded to the panel 30 is apt to be rapidly eliminated through the first and the second conducting high polymer films 31 , 32 , and thus ics and tft devices in the panel is exempted from damage . referring to fig5 , an lcd having a conducting film according to a third embodiment of the present invention is depicted therein . an lcd 40 comprises a first conducting high polymer film 41 formed on an upper surface of the lcd panel 40 and a second conducting high polymer film 42 formed on a lower surface of the lcd panel 40 . the first and the second conducting high polymer films 41 , 42 are each formed by spin - coating a solution of papsah ( poly ( aniline - co - n - propanesulfonic acid aniline )), having a suitable concentration , with water as a solvent or other organic solvents , wherein the first and the second conductive high polymers 41 , 42 each has a conductivity of 0 . 01 s / cm per unit area . then , an upper polarizer 300 and a lower polarizer 300 are bonded onto the first and second conductive high polymers 41 , 42 , respectively . as such , charges produced when the polarizers 300 are bonded to the panel 40 is apt to be rapidly eliminated through the first and the second conductive high polymers 41 , 42 , and thus ics and tft devices in the panel is exempted from damage . referring to fig6 , a flowchart illustrating a method of manufacturing an lcd panel having a conductive polymer is depicted therein . the method comprises the following steps . at first , an lcd panel is provided ( step 100 ). then , a conductive polymer solution capable of eliminating charges is prepared , the solution being formed by using conductive polymer powder dissolved in water or other organic solvents ( step 200 ). next , the conductive polymer solution is coated on an upper surface as a first conductive polymer and a lower surface as a second conductive polymer of the lcd panel by a spin - coating method ( step 300 ). thereafter , the conductive polymer solution on the lcd panel is to bake at a temperature of 100 ยฐ c . after the water content in the solution is removed , the conductive film in a form of the conductive polymers is obtained ( step 400 ). since the conductive polymer provides a specific conductivity , the accumulated charge on the surface of the polarizer occurred when the polarizer is bonded to the lcd panel may be conducted away or rapidly eliminated through the conductive polymers . as such , the tft devices and ics in the lcd panel may be exempted from damage . further , the conductivity of each of the conductive polymers may be high up to 0 . 01 s / cm , near to those of conductors . in addition , the conductive polymer is slight in weight and easy to be processed . in conclusion , since the accumulated charges produced when the polarizer is bonded onto the panel may be eliminated by the inventive conductive polymer formed on the lcd panel , the pricy discharge polarizer may not be necessary and thus cost of the lcd panel may be reduced . while embodiments and applications of this invention have been shown and described , it would be apparent to those skilled in the art having the benefit of this disclosure that many more modifications than mentioned above are possible without departing from the inventive concepts herein . the invention , therefore , is not to be restricted except in the spirit of the appended claims and their equivalents . | 8 |
fig1 illustrates in flow form the method and steps for utilizing the inventory control system . thus , the inventory control system 10 serves to aid the owner or operator of business 12 while providing complete and continual control of stock inventory . it is now contemplated that business 12 will be any of various types of retail outlet , but the system is applicable at any sales level . first institutions of the inventory control system have been with the automobile parts business and , as may be seen from fig2 certain descriptions will be so oriented . the user or business 12 will first take inventory of his store to enable production of his particularly required store of optical bar code tickets 14 as shown in fig2 . the optical bar code tickets are of an attachable type wherein a central ticket 16 includes the bar code 18 , part description 20 , stock number 22 and , if desired , current price 24 . the central ticket 16 of bar code ticket 14 has no gummed backing as this is only applied on the rear side of perforated tabs 26 and 28 . thus , the user can stick on the code identifier 14 , on the merchandise it applies to , while on the shelf and then tear - off the central ticket 16 upon sale for subsequent accounting procedure , as will be further described . referring again to fig1 once the user has decided to use the system and has listed the pertinent data relative to his inventory , the bar code tickets 14 are printed out at the ticket custom user &# 39 ; s supply 30 , and supplied to the user for marking all of his merchandise with the appropriate tickets 14 . at the same time , the digital data compiled in marking up the optical bar code tickets for user 12 is suitably stored as by magnetic tape recording or the like for introduction via line 32 to the central computer 34 . central computer 34 is a general purpose type having the requisite peripheral recording 36 and user readout devices 38 as required in accordance with volume of data , number of users , etc . thus , inventory data in accordance with digital bar code from business 12 is also in storage relative to central computer 34 once the business 12 is on system and marking merchandise with bar code tickets 14 . in present installation , the central computer 34 is a centurion iv as commercially available from warrex computer corporation of dallas , tex . this computer includes disk drive , central processing unit , video terminals and printer . the processor has a memory capacity which is expandable up to 65 k - bytes , mos random access , memory parity and real time clock . user readout 38 may be effected at the central video terminal of the computer system , or it may be printed out for dispatch to the user location as business operations prefer . moving again to business 12 , the user will tear - off center ticket 16 of each bar code ticket 14 ( fig2 ) upon sale of each item with deposit of the center ticket 16 in a safe place for periodic delivery of all tickets to the processing station as indicated by ticket delivery stage 40 . upon delivery of the tickets they are then sorted and read in ticket processing apparatus 42 , as shown in fig3 et seq ., with output of optically read bar code data from ticket reader 44 via line 46 to the central computer 44 . the optical ticket reader 44 may be any of several commercially available devices , and one presently utilized is known as the scanmark available from markem corporation of keene , n . h . this ticket reader reads out the optical bar code in proper digital format for direct application and acceptance by the central computer 34 . after ticket reading , the center tab 16 operates in a ticket depository 48 wherein used tickets may be saved for reasons peculiar to the business , but record is retained of their existence and purpose in any event . fig3 illustrates the sorting / reading device 42 as it includes a hopper 50 for receiving incoming ticket center tabs 16 for sorting and alignment conveyance along a separating track 52 that leads to an optical reading station 54 and deposit conveyor 56 . the hopper 50 consists of an inclined portion 58 having opposite angular sides 60 and 62 which direct ticket tabs to a central throat portion 64 . also positioned at the throat portion 64 as mounted on frame 66 is a variable speed sorting motor 68 extending rotary shaft 70 and relatively stiff rubber fingers 72 into the sorting area . rubber fingers 72 when rotated tend to move the centered ticket tabs 16 onto the separating conveyor 74 for further separation and movement toward optical reading station 54 . the speed of motor 68 can be varied by the operator in accordance with the volume of input tickets , greasy or sticking conditions and the like . the separator conveyor 74 , as shown in enlargement in fig4 consists of a suitable resilient , rubberized belt 76 having transverse strips 78 bonded thereon in uniform spacing 80 which is slightly larger than the length of a center ticket 16 . thus , as tickets proceed along the separating conveyor 74 they tend to fall individually into one of the spacings 80 between two adjacent overlay strips 78 . also aiding in the ticket separation function along separation conveyor 74 are a plurality of individually adjustable separating finger assemblies 82 , as will be further described . separated tickets then arrive at optical reading station 54 whereupon they pass over optics plate 84 , are digitally read out with data transmission to the central computer , and are then carrier by deposit conveyor 56 to ticket depository 48 . a drive motor 86 operating through a variable gear box 88 provides primary power to the sorter assembly 42 . in present design , a dayton 1 / 2 horespower motor , model 2m145 , is employed and the variable gear box 88 is controllable between 25 and 200 revolutions per minute . rotational output from variable gear box 88 is then applied via rotary linkage 90 to drive deposit conveyor 56 . at the opposite end of conveyor 56 , the same rotational drive is taken off via rotary linkage 92 and applied to a suitable rotary drive transfer 94 for re - application by rotary linkage 96 to drive the separator conveyor 74 . as shown more particularly in fig5 the rotary drive elements are supported by a commercially available self - aligning bearing , borg - warner type lp - 112 , and bearings 98 and 100 support the deposit conveyor 56 for rotation as well as transmission of rotary drive , while bearing 102 and 104 support the separator conveyor 74 . the bearings 98 - 104 are simply secured under the frame apron panel 106 in proper position , and four additional bearings of the same type are similarly located on the other side as supported beneath frame panel 108 ( see fig3 ). referring now to fig6 the two opposite sides of frame 66 ( fig3 ) are formed of right angular structures consisting of top panel 108 and side panel 110 on one side and top panel 106 and vertical side panel 112 opposing . a transverse support plate 114 is then secured as by welding between side panels 110 and 112 along the length of frame 66 in order to support the conveyor belt 74 along the extent . as also shown in fig6 the plurality of separating finger assemblies 82 are each adjustably secured on a support rod 116 as supported between blocks 118 and 120 which are secured as by welding to the respective frame side panels 108 and 106 . the finger assembly 82 is rotationally supported by a block portion 122 supported on rod 116 and which can be rigidly affixed by means of a securing screw 124 . the details of separating finger assembly 82 are also evident in fig7 and 8 where it can be seen that the block portion 122 extends a lever arm 126 to which are affixed a securing pad 128 maintaining a rubber brush 130 in operative alignment with the upper surface of separator conveyor 74 . the rubber fingers 130 are merely made up of a section of rubber as secured between securing pad 128 and the end of finger 126 with the lower extending portion repeatedly slit to provide a brushing action as against center tab tickets 16 passing along separator conveyor 74 . there are included seven such separating finger assemblies 82 in series and this has proven to be a number satisfactory for efficiently separating all center tab tickets 16 entering into separator conveyor 74 . that is , when one , two or more tickets may enter the conveyor in stacked array , their passing through the successive separating finger elements 82 tend to arrange and maintain but a single ticket 16 lying between respective transverse strips 78 with a very high degree of reliability . in this manner , it is extremely reliable that each and every center tab ticket will be read with appropriate digital output to the central computer . in practice the individual separator finger assemblies 82 are adjusted by respective set screws 124 so that securing pads 128 are successively closer to the upper moving surface of separator conveyor 74 as you progress along the conveyance , and such adjustment results in an alignment whereby the last separator finger assembly 82 at position 132 is set so that the securing pad 128 will barely allow clearance of the separator conveyor 74 and transverse strips 78 . also shown in fig7 is the interior pulley arrangement showing transverse pulleys 134 and 136 moving deposit conveyor 56 , the pulley 134 receiving input rotational drive as applied from rotational link 90 ( fig3 ). similarly , drive transfer is affected from pulley 136 with transfer input to a pulley 138 which , in concert with a pulley 140 provides driven support for the separator conveyor 74 . as tickets are moved past the optical reading station 54 across optical plate 84 they are read out by a commercially available form of optical reader . fig9 illustrates one form of ticket reader 44 wherein alternative output is enabled so that no matter which way the center tab 16 progresses across optical plate 84 , it will be read . that is , since digital bar code is only printed on one side of the ticket 16 , the machine has the capability of reading either side as it passes through the optical field of view . the reading station 54 requires merely a standard form of uniform light source 142 and suitable directing optics 144 , to direct the light through the support optics 84 and the printed bar code on ticket 16 to the sensor apparatus 146 within ticket reader 44 . the structure and operation of such optical ticket reading apparatus is well - known in the art and commercially available , as before described , and the equipment utilized in the present invention provides data output on lead 46 which is properly formatted for entry and acceptance at the central computer 34 for processing and storage of pertinent data . in operation , the present invention enables an efficient and economical way for numerous types of small business retail outlets to maintain continual record of inventory and updated accounting of business conditions . a central agency supplying the central computer service can supply the bar code tickets in customized manner to account for all retail sales items of the particular business . after the business user labels his goods and maintains diligent center tab ticket collection for submission to the central agency , the business user has the capability of continually updating his inventory information , and he can also obtain printed readout showing such conditions . initially , the business user need only take inventory of his store merchandise and thereafter attach a bar code inventory control ticket ( fig2 ) to each and every piece of merchandise in accordance with proper identification . when a piece of merchandise is sold , the ticket is removed and dropped in a lock box or other repository subject to periodic removal and dispatch to the central sorting and computing agency . using the ticket 16 data , the central processing agency can enter customer cost , stock numbers and other numerical data in the memory of the computer to enable the business user to receive a printout indicating gross profit on all sales at the end of selected periods of time , e . g ., weekly or monthly . the central agency can control retail sales only , if so desired , and thereafter give the user business an exact list of all merchandise sold by listing manufacturer and stock number ; or the agency can control all inventory in and out by receiving packing slip information . the latter course can be accounted for by either the business user or the central agency by entering the pertinent information on cassette as may be keyed from the computer terminal . the central agency can pick up ticket information and deliver new substitute tickets for like merchandise by courier or mail , and this service can be rendered either daily , weekly or at any period as depends upon the needs of the user . further , after a history of inventory movement and replacement is established , the central computer is able to write orders for the business user and rapidly furnish such written orders within hours . the present system in simplest form is able to control movement by merely having a starting inventory and thereafter recording movement of merchandise . a small business user then has at hand the information needed to dispose of merchandise which is not selling and is therefore able to place his investment in merchandise that sells . in effect , the central computer radout provides a picture of all merchandise , that which is sold as well as that which is not sold . at periodic intervals , for example year end or the like , the central computer can provide a printout of complete inventory , thus obviating the necessity for time consuming manual inventory of the user business . the inventory can be cost extended and priced if so desired , and it will be correct and up to date to the extent that cursory sport check or shelf count will indicate any possible shrinkage figure . additionally , the present inventory control system will apply to either a fifo or lifo procedure and give exact inventory figures . still further , the central computer can offer complete accounting figures with entry of payment or disbursement data on cassette tape as keyed for input to the computer . such information for each individual business user can be periodically entered on disks for that particular user , and such further capability multiplies the capacity of the computer and reduces the cost to individual business users . changes may be made in the combination and arrangement of procedures as heretofore set forth in the specification and shown in the drawings ; it being understood that changes may be made in the embodiment disclosed without departing from the spirit and scope of the invention as defined in the following claims . | 6 |
a machine for producing packaging ( not shown ) processes a material or a flat substrate . in this case , it is a substrate in the form of a continuous web , for example of flat cardboard . as shown in fig1 , the machine comprises a converting unit for a substrate 1 in order to convert the web 2 . the direction of feed or of unwinding ( arrow f in fig1 ) of the web 2 and of the converted web following the longitudinal direction indicates the upstream direction and the downstream direction of the unit 1 . the positions front and rear are defined with regard to the cross direction , as being the driver or operator side and the side opposite the driver or operator side respectively . the machine can have a web unwinder , units such as printing units , means for controlling the quality and the register of the print , a web guiding means and yet other units which are positioned upstream of the unit 1 . the converting unit 1 is a unit for embossing , creasing and cutting . the web 2 arrives in the unit 1 through the upstream transverse side thereof , at a constant speed . an infeed group comprising drive rollers and return rollers for the web 2 is provided at the input to the unit 1 . the unit 1 converts the web 2 , gradually by embossing it , creasing it and cutting it . the unit 1 delivers repeats or converted boxes 3 , being as a result in embossed , creased and cut flat cardboard . the boxes 3 leave the unit 1 through the downstream transverse side thereof , at the same constant speed . the boxes 3 , prepared in the unit 1 , are then separated laterally and longitudinally from one another in a separating station then are received in a receiving station ( not shown ). the unit 1 first comprises a first arrangement for providing the embossing 4 , arranged upstream , i . e . at the input to the unit 1 . the embossing arrangement 4 is provided with the top rotary embossing tool 6 , positioned parallel to a bottom rotary embossing tool 7 . in the exemplary embodiment , an embossing cassette 8 comprises the embossing arrangement 4 . the unit 1 comprises a second arrangement for providing the creasing 9 , disposed downstream of the embossing arrangement 4 . the creasing arrangement 9 is provided with a top rotary creasing tool 11 , positioned parallel to a bottom rotary creasing tool 12 . in the exemplary embodiment , a creasing cassette 13 comprises the creasing arrangement 9 . the unit 1 comprises a third arrangement providing the cutting 14 , disposed downstream of the creasing arrangement 9 , i . e . at the output of the unit 1 . the cutting arrangement 14 is provided with a first top rotary cutting tool 16 , positioned parallel to a second bottom rotary cutting tool 17 . in the exemplary embodiment , a cutting cassette 18 comprises the cutting arrangement 14 . the arrangements 4 , 9 and 14 , and thus the cassettes 8 , 13 and 18 , are placed following one another so that each one realizes its respective conversion , by embossing , creasing and cutting the web 2 . a waste stripping tool in the form of a cylinder provided with stripping needles can also be provided in place of the bottom rotary cutting tool 17 . other combinations are possible such as a top cylinder forming both a cutting tool and a creasing tool . the rotational axis of each of the tools for embossing 6 and 7 , creasing 11 and 12 and cutting 16 and 17 is oriented transversely with respect to the unwinding direction f of the web 2 . the rotational direction ( arrow rs in fig2 ) of the top tools for embossing 6 , creasing 11 and cutting 16 is reversed with respect to the rotational direction ( arrow ri in fig2 ) of the bottom tools for embossing 7 , creasing 12 and cutting 17 . the cassettes for embossing 8 , creasing 13 and cutting 18 are capable of being introduced into a supporting structure 19 of the unit 1 , of being fixed to the supporting structure 19 , of producing , then conversely , are capable of loosened from the positive connection with the supporting structure 19 and of being extracted from the supporting structure 19 . the unit 1 thus comprises three transverse housings provided in the supporting structure 19 for each of the three cassettes 8 , 13 and 18 . the cassettes 8 , 13 and 18 are introduced vertically , from above , with respect to the supporting structure 19 into the transverse housings . conversely , the cassettes 8 , 13 and 18 can be removed vertically with respect to the supporting structure 19 , out of their respective transverse housings . the cutting arrangement 14 , and therefore the cutting cassette 18 , comprises ( see fig2 ) the first top cylindrical rotary tool 16 which is provided with cutter threads ( not shown ) machined or built on its circumference in terms of the configuration of the boxes to be realized . the second bottom cylindrical rotary tool or anvil 17 has a smooth circumference . the web 2 unwinds f in the radial gap 20 between the top tool 16 and the anvil 17 . the top tool 16 is arranged so as to cooperate with the anvil 17 in order to convert , i . e . cut the web 2 . the top tool 16 is provided at its front end with a first front top rolling ring 21 . the top tool 16 is provided at its rear end with a second rear top rolling ring 22 . the anvil 17 is provided at it front end with a third front bottom rolling ring 23 . the anvil 17 is provided at its rear end with a fourth rear bottom rolling ring 24 . all the rings 21 , 22 , 23 and 24 have a truncated form . the top rings 21 and 22 thus have an inside curved surface laid flat against the curved surface of the top tool 16 . the bottom rings 23 and 24 have an inside curved surface laid flat against the curved surface of the anvil 17 . the top rings 21 and 22 of the top tool 16 contact , bear on and roll on the opposite bottom rolling rings 23 and 24 , respectively of the anvil 17 . this results in the front top ring 21 having an outside conical surface which abuts against an outside conical surface of the front bottom ring 23 and the rear top ring 22 having an outside conical surface which abuts against an outside conical surface of the rear bottom ring 24 . in the exemplary embodiment , the two top rings 21 and 22 of the top tool 16 are laterally displaceable ( arrow l in fig2 ). when the operator displaces laterally l a ring 21 and 22 with respect to its opposite ring 23 and 24 , for example by a few tenths of a millimeter , their respective conical surfaces are not positioned in the same place . the overall accumulated thickness of the front ring 21 of the top tool 16 and of the front ring 23 of the anvil 17 , or of the rear ring 22 of the top tool 16 and of the rear ring 24 of the anvil 17 vary compared to one another . this results in a variation in the radial space , i . e . in the radial gap 20 , between the top tool 16 and the anvil 17 . the cutting arrangement 14 , and therefore the cutting cassette 18 , comprises a first top front bearing 26 and a second top rear bearing 27 , which hold the first tool , i . e . the top tool 16 , by its rotational axis 28 for rotation . the cutting arrangement 14 , and therefore the cutting cassette 18 , comprises a third bottom front bearing 29 and a fourth bottom rear bearing 31 which hold the second tool , i . e . the anvil 17 , by it rotational axis 32 for rotation . the base of the two bottom bearings 29 and 31 rests on the supporting structure 19 when the cutting cassette 18 is inserted into the unit 1 . the cutting arrangement 14 , and therefore the cutting cassette 18 , comprises driving means , in the form of a gear wheel arrangement ( not shown in the figures ), intended to rotate the two tools 16 and 17 . when the cassette 18 is inserted into the supporting structure 19 , the gear wheel arrangement meshes with the teeth of a gear wheel combined with an electric motor for rotational movement . the first top front bearing 26 of the top tool 16 is fixed to the third bottom front bearing 29 of the anvil 17 , and the second top rear bearing 27 of the top tool 16 is fixed to the fourth bottom rear bearing 31 of the anvil 17 , so as to constitute the cutting cassette 18 . to hold the cassette 18 all in one unit , tightening elements , in the form of four ties , front upstream and front downstream 33 , and rear upstream and rear downstream 36 , in a vertical manner cross the top front bearing 26 and the top rear bearing 27 , on both sides of the rotational axis 28 of the top tool 16 . the bottom end of each of the four ties , front 33 and rear 36 , is threaded and is screwed into a female thread of the bottom front bearing 29 and of the bottom rear bearing 31 respectively . four nuts , front upstream and front downstream 34 , and rear upstream and rear downstream 37 , are screwed onto the top end of the four ties , front 33 and rear 36 , respectively . the nuts 34 and 37 block the ties 33 and 36 by bearing on a top face of the top front bearing 26 and of the top rear bearing 27 respectively and allowing the bearings to be prestressed in twos . the cutting cassette 18 , as well as the embossing cassette 8 and the creasing cassette 13 , comprise two gripping lugs 38 each provided on the top face of the top front bearing 26 and of the top rear bearing 27 . the two lugs 38 are intended for cooperating with the lifting means in order to raise the cassette 18 , 8 and 13 vertically and transport it outside of the supporting structure 19 . so as to be able to carry out an adjustment of the radial gap 20 between the top tool 16 and the anvil 17 , just one top ring or more often the two top rings 21 and 22 have to be displaced along their tool 16 . to do this , the top tool 16 is moved vertically away from the anvil 17 , and the rings 21 , 22 , 23 and 24 are thus freed from any constraint of support . according to the invention , the cutting arrangement 14 , and therefore the cutting cassette 18 , comprises first translation means 39 in order to move the first bearing 26 vertically away ( arrow u in fig3 and 4 ) from the third bearing 29 , and conversely in order to move the first bearing 26 vertically closer ( arrow d in fig3 and 5 ) to the third bearing 29 . the cutting arrangement 14 , and therefore the cutting cassette 18 , comprises second translation means in order to move the second bearing 27 vertically away from the fourth bearing 31 , and conversely in order to move the second bearing 27 vertically closer to the fourth bearing 31 . the first and second means of translation 39 move the first bearing 26 and the second bearing 27 respectively along a predetermined distance . the means of translation 39 have two positions ( fig4 and 5 ). consequently , the first and second bearings 26 and 27 have the same two positions and , consequently , the top tool 16 and the anvil 17 have the same two positions . in a first position moved closer , the two tools 16 and 17 are arranged with respect to one another with an optimum radial gap 20 , and cooperate to realize the cutting function . in a second position moved away , the two tools 16 and 17 have a space between them and are capable of being modified by displacement of their rings 21 and 22 respectively . the translation means 39 are advantageously disposed between the first lateral bearing 26 and the third lateral bearing 29 so as to lift up the first lateral bearing 26 . the translation means 39 are advantageously disposed between the second lateral bearing 27 and the fourth lateral bearing 31 so as to lift up the second lateral bearing 27 . to do this , the translation means 39 , in a preferred manner , are in the form of a first front device 41 , in order to move the first bearing 26 away from the third bearing 27 by lifting , and conversely in order to move the first bearing 26 closer to the third bearing 27 by lowering . the translation means 39 , in a preferred manner , are in the form of a second rear device , in order to move the second bearing 27 away from the fourth bearing 31 by lifting , and conversely in order to move the second bearing 27 closer to the fourth bearing 31 by lowering . in the embodiment , the device 41 comprises a cylindrical rod 42 which is vertical , approximately parallel to the front ties 33 and centered with respect to the rotational axis 28 of the top tool 16 and with respect to the rotational axis 32 of the anvil 17 . the rod 42 is capable of sliding along a rectilinear vertical movement u and d , between the position moved closer and the position moved away and conversely between the position moved away and the position moved closer . the rod 42 carries out a maximum run ( e in fig4 ) of sliding u . the rod 42 thus reaches a high point which corresponds to the desired and necessary gap between the top tool 16 and the anvil 17 so as to carry out the displacement of the two top rings 21 and 22 . one end or one top face 43 of the rod 42 abuts in an overall manner against a bottom face 44 of the first bearing 26 . a first obstructed , vertical , cylindrical housing 46 is arranged in a bottom part of the first bearing 26 and opens out at the bottom face 44 of said first bearing 26 . the bottom part of the rod 42 with the top end 43 is thus inserted into the first housing 46 . in a preferred manner , the device 41 comprises an eccentric 48 , positioned at the third bearing 29 . in order to obtain the sliding movement u and d , an end or a bottom face 47 of the rod 42 can bear on the eccentric 48 . a second cylindrical housing 49 is arranged in a top part of the third bearing 29 and opens out at the top face 51 of said third bearing 29 . the bottom part of the rod 42 with the bottom end 47 is inserted into the second housing 49 . the eccentric 48 is inserted to the bottom of the second housing 49 . the rod 42 is capable of being actuated manually , by rotating the eccentric 48 . the eccentric 48 is capable of turning ( arrows tu and td in fig4 and 5 ) in a perpendicular manner with respect to the rod 42 and to the third bearing 29 , i . e . in this case horizontally . the device 41 comprises means for manually actuating the rod 42 . said means comprise a shaft which is appreciably horizontal and extends the eccentric 48 and a rotary actuating knob 52 which is provided with a finger 53 , extending out of the outside face 54 of the third bearing 29 , and fixed to the shaft of the eccentric 48 . the rear device comprises the same constituent parts . according to the invention , a method for adjusting a radial gap 20 existing between two converting tools , the top tool 16 and the anvil 17 , in the converting arrangement , i . e . for cutting 14 the web 2 , comprises several successive stages . in a first stage , the operator releases the prestress by loosening the tightening elements , i . e . in this case the nuts 34 and 37 . the operator actuates the actuating knobs 52 by turning them pu clockwise by half a turn and the eccentric 48 turns tu in a corresponding manner ( see fig4 and 6 ). this causes the rod 42 to slide u upward and the first bearing 26 is directly pushed away along the predetermined distance , i . e . the gap e . in said second stage , the first bearing 26 is pushed away u from the third bearing 29 and the second bearing 27 is pushed away from the fourth bearing 31 along a predetermined distance e . the stage consisting in pushing the first bearing 26 away from the third bearing 29 and the second bearing 27 away from the fourth bearing 31 is implemented with two positions , one position moved closer in which the two tools 16 and 17 cooperate for the converting function , and one position moved away in which the lateral position of the ring or rings 21 and 22 is modifiable . the displacement u of the first bearing 26 thus creates the gap e between the top tool 16 and the anvil 17 so as to allow the radial gap 20 to be adjusted by subsequent displacement of one ring or of the rings 21 and 22 . in a third stage , the operator modifies a lateral position of one ring or of the two rings 21 and 22 . the operator actuates the actuating knob 52 by turning it pd anticlockwise by half a turn ( see fig5 and 6 ), and the eccentric 48 turns td in a corresponding manner . this causes the rod 42 to slide d downward , and the first bearing 26 to move closer . in a fourth stage , the first bearing 26 is moved closer to the third bearing 29 and the second bearing 27 is moved closer the fourth bearing 31 . said displacement u of the first bearing 26 thus moves the top tool 16 closer to the anvil 17 , in order to allow the cutting function with the optimum radial gap 20 to be re - established . in a fifth and last stage , the operator re - establishes a prestress by retightening the tightening elements , i . e . the nuts 34 and 37 . the present invention is not limited to the embodiments described and illustrated . numerous modifications can be realized without in any way departing from the framework defined by the scope of the set of claims . | 1 |
in fig1 a plant for producing coverings such as , for example , rubber - based floorings , is generally indicated 1 . the term โ rubber โ as used in the present description and in the following claims , is intended in general to define any elastomer which can be vulcanized / cross - linked and which can be used for the manufacture of coverings such as floorings . a material of this type may adopt the appearance of fragments or particles ( for example , granules ) and can be termed โ cohesible โ in that it can be rendered cohesive so as to form , for example , a sheet or a layer . typical examples of this type are artificial or synthetic rubber ( for example , the synthetic rubbers known by the names sbr ( styrene - butadiene - rubber ), nrje ( nitrile - butadiene - rubber ), and epdm ( ethylene - propylene - diene - monomer )), natural rubber , and mixtures thereof . the invention can thus be applied to the processing of materials which can be vulcanized / cross - linked and hence , in general , which are โ curable โ and , most preferably but not exclusively , materials which are initially in the form of granules . the term โ fragmented material โ used in the claims , however , indicates , in general , any material in pieces and , as such , also includes particular morphologies such as pellets , flattened or rod - shaped granules , threads , strips , etc ., or shavings such as those produced by the scraping or shaving operation described in u . s . pat . no . 5 , 217 , 554 . with further reference to the diagram of fig1 an extruder , generally indicated 2 , has an inlet opening 3 to which the , basic material for producing the covering is supplied . the extruder 2 may be any commercially available extruder which can process materials such as those indicated - above . in the embodiment considered in detail below , which is described by way of example , it will be assumed that the material in question is constituted by synthetic rubber ( typically styrene - butadiene rubber which has not yet been vulcanized ) which is supplied to the opening 3 of the extruder 2 in the form of continuous and / or discontinuous strips , for example with a thickness of a few millimeters and a width of a few centimeters . in particular , when a covering with a non - uniform appearance is to be produced , the strips are taken from an assortment of strips having two or more different colors . however , the invention may also be used to produce coverings of substantially uniform surface appearance . the material supplied to the opening 3 is passed through the barrel of the extruder 2 until it reaches a die 4 having one or more extrusion openings , each of which can produce a thread , for example , of variegated color if the input strips are of different colors . the thread in question may have diametral dimensions of a few millimeters ( for example 4 - 6 mm ). in the region of the die 4 , on the path along which the material is output from the extruder 2 , there is a granulating head 5 ( for example , in the form of a rotary blade ) which divides the material in thread form emerging from the die 4 into individual granules substantially comparable to disk - shaped pellets having , for example , a diameter of 4 - 6 mm and a thickness of the order of 0 . 5 - 1 mm . the granulated material m thus produced , which is usually collected in a container 6 , is supplied , possibly after storage indicated schematically by a block s shown in broken outline in fig1 to the input of a compacting unit 7 . it is pointed out once more that the particular form of fragmentation may vary widely within the scope of the invention . in particular , the scraping / shaving technique described in u . s . pat . no . 5 , 217 , 554 may advantageously be used to produce the fragmented material . the unit 7 is intended basically to compact the material m so as to give rise , precisely owing to the properties of cohesiveness of the fragments thereof , to a substantially continuous laminar layer or sheet l . this avoids giving rise to the stretching phenomena intrinsically connected with a calendering operation . in the embodiment shown , the unit 7 is configured substantially as a so - called continuous or isostatic press . presses of this type are known in the art , for example , from the production of isopress presses by the company hymmen gmbh ( germany ). basically , the unit 7 is composed of two endless , motor - driven belts 8 , 9 of which mutually facing passes 8 a , 9 a define a compacting chamber 10 in which controlled pressure and temperature conditions can be maintained ( in accordance with known criteria ). the fragmented material m is deposited at the input of the unit 7 by means of a metering device 11 ( for example of the hopper type ) so as to define a substantially continuous bed or mat having , for example a thickness of from about 2 to about 10 mm , with currently - preferred values of about 4 - 6 mm . it will be appreciated , in this connection , that the aforementioned deposition may take place either directly onto the lower belt 9 of the press or onto an interposed laminar substrate . this substrate may be constituted by a substrate from which the fragmented material has been produced in accordance with the solution described in u . s . pat . no . 5 , 217 , 554 . limited temperatures , typically of from about 60 ยฐ c . to about 100 ยฐ c . with preferred values of approximately 80 ยฐ c . are maintained in the unit 7 . the pressure values may be between about 2 and about 5 mpa . as it advances through the unit 7 , the bed of fragmented material m is compressed between the two belts 8 and 9 ( possibly with the interposition of the deposition substrate , if one is present ), and is compacted to form a sheet l which is rendered mechanically coherent by the cohesion of the granules of the material m . this sheet , which is compacted but not yet vulcanized , and is hence constituted by โ raw โ, cohesive material may be removed from the unit 7 to go on to other processes , possibly after storage / transportation . the sheet l therefore clearly constitutes , according to the invention , an intermediate product with an independent character . the precision and / or intensity of the compacting are increased by the capability for precise control of the compacting pressure offered by isostatic presses . without wishing in any way to be restricted to any specific theory in this connection , the applicant has reason to believe that the way in which the above - described compacting of the material m is performed avoids the typical longitudinal stretching effect of calendering processes precisely because of the substantially isostatic distribution of the stresses induced locally in the material m . this effect can be attributed , in the embodiment described , to the presence of the belts 8 , 9 , and hence to the fact that the compression effect is distributed over an extensive surface area with a direction of action perpendicular to the surface . this contrasts with what occurs in normal calenders , in which the compression of the calendered material is concentrated in the narrow regions in which the rollers cooperate and , in any case , has components directed along the plane of the calendering product . moreover , it should not be forgotten that , in most calenders , an at least marginal differentiation of the peripheral velocities of the rollers is deliberately aimed for ; clearly , this factor induces significant stretching in the material subjected to calendering . similarly , it will be understood that the desired effect , compacting by compression with a substantial absence of stretching stresses along the sheet l , can be achieved in various ways with the same final result ; a linear press which compresses portions of the bed or mat successively supplied to the press may be mentioned by way of practical example . the sheet or layer of material l may then be supplied to apparatus 12 in which the material l is subjected to a cross - linking treatment by the application of pressure and / or heat . for example , this may be the treatment currently defined by the trade name โ rotocure โ. typical parameters for performing a treatment of this type ( with reference to a starting material constituted by synthetic rubber ) are represented by temperatures of between 150 ยฐ c . and 190 ยฐ c . and pressures of between 0 . 5 and 2 mpa . in accordance with wholly conventional techniques , the rotocure treatment may be implemented in a manner such that the appearance of the opposite flat surfaces of the resulting product f is completely smooth or , particularly in the case of the outer or upper surface of the covering , slightly marbled or rough , for example , with an anti - slip function , when the final product f is intended for use as flooring , in substantially the same manner as is normal for coverings intended for this use . finally , the product emerging from the unit 12 may be subjected to various finishing or grinding operations , to the application of protective layers , to cutting into strips or tiles , etc . these operations , which are performed in accordance with known criteria , are collectively indicate 13 . the final product f may typically have the appearance of a flooring tile p , as shown schematically in fig2 . the most distinctive aspect both of the final product f and of the intermediate product l of the covering produced in accordance with the invention is the intrinsically , non - directional ( isotropic ) nature of its characteristics . this relates both to its physical and mechanical characteristics and to its aesthetic characteristics , at least with regard to the appearance of the outer or upper layer . in particular , the applicant has performed various tests on samples of floorings produced according to the invention from sbr rubber . the flooring in question had a thickness of about 2 mm . samples s 1 , s 2 , s 3 ( see fig2 ) in the form of 27 cm ร 7 cm rectangles were cut from the flooring in a longitudinal direction ( s 1 ), in a transverse direction ( s 2 ), and in a diagonal direction at 45 ยฐ to the longitudinal direction ( arrow of fig2 ) ( s 3 ), respectively , from the strip f produced by the continuous process shown in fig1 . visual inspection of the upper face ( the walking surface ), even at short distance , consistently showed that the samples of the three types s 1 , s 2 and s 3 did not differ from one another . this characteristic is important , particularly when the flooring is being laid , since it enables joints which are not perceptible from a normal observation height to be formed between sheets and / or tiles , regardless of the orientation of the sheets and of the tiles . flexibility tests ( en 435 โ method a ) and dimensional stability tests ( en 434 ) within the scope of the standard en 1817 ( march 1998 version ) were carried out on longitudinal strips s 1 and transverse strips s 2 of the dimensions given above , produced from a covering according to the invention , with homogeneous structure throughout its thickness . breaking load / extension tests ( din 53504 ) and tear - resistance tests ( din 53515 ) were also carried out . naturally , the principle of the invention remaining the same , the details of construction and forms of embodiment may be varied widely with respect to those described and illustrated , without thereby departing from the scope of the present invention . | 4 |
referring now in detail to the drawings , more specifically fig1 the reference numeral 20 denotes generally a vehicular automatic occupant sensing anti - carjacking system constructed in accordance and embodying theinvention . the automatic occupant sensing anti - carjacking system 20 contains an electronic command control unit 7 , mounted in a hidden location within a motor vehicle 64 , in fig5 . the command control unit 7 is configured for communication with an array of sensors 21 . as will be observed from fig1 the command control unit 7 is operatively connected to a combination keypad - monitor 6 for user programming includingbypass and override functions . such programming may include a selection of available options such as , sensor selections , audible warning devices , timers , light flashers etc . an array of sensors 21 are operatively connected to a command control unit 7 . the sensors may include pressure sensors , infra red sensors , motion detectors , ignition sensors , shift lever position sensor , rpm sensors etc . these are all conventional sensorswhich are used in conjunction with other existing vehicular protection systems and are well known in the market . selected system carjacking responses are actuated by signal from the command control unit 7 to an array of interfaced relays 22 . the relays 22 are strategically positioned at various locations throughout the vehicle 64 and with each adapted to serve a dedicated function . among the relays 22 are an ignition disable relay 10 , starter disable relay 11 , fuel disable relay 12 , audible device relay 14 , lighting relay 13 . internal and external audible devices 19 are operatively connected to the audible device relay 14 within the vehicle 64 for the purposes of providing internal audible functions to drive the carjacker out of the vehicle 64 , as well as , external audible functions to provide an audible alert to draw attention to the vehicle 64 and the carjacker . the combination keypad - monitor 6 may be employed to program the command control unit 7 to recognize only certain of the sensors 21 and which of the relays 22 will be actuated under specific circumstances and in which sequence the relays 22 will be activated . for example , the authorized occupant can program the operator &# 39 ; s seat pressure sensor 61 , referring to fig5 this sensor 61 employs a low cost versatile pressure transducer 43which will allow the authorized occupant to program a specific voltage signal to the command control unit 7 . any of the pressure actuated sensors1 may be variable , sensor 61 was chosen for simplicity . the voltage signal will be relative to the amount of pressure that the authorized occupant exerts on the sensor 61 while sitting in the authorized occupant &# 39 ; s seat 56 . this will allow an authorized operator to program a specific voltage signal from sensor 61 in the memory of the command control unit 7 allowingonly an authorized occupant to operate the vehicle 64 within the parametersstored in the memory of the command control unit 7 . the keypad - monitor 6 may also provide on screen verification of all programming activities through its liquid crystal diode monitor and keypad . additionally , the keypad - monitor 6 may be employed to program the command control unit 7 to appropriately adjust sensitivity of sensors 21 , as well as , appropriately actuating the relays 22 . the automatic occupant sensing anti - carjacking system 20 includes an ignition sensor 2 which determines when ignition is on as an additional input to command control unit 7 . ignition sensor 2 is preferably a wire connected to the vehicle 64 &# 39 ; s ignition circuit ( not shown ) for producing avoltage signal when the ignition is on and no voltage signal when the ignition is off . the automatic occupant sensing anti - carjacking system 20 also includes an engine rpm or revolutions per minute sensor 3 which determines when the engine is running as an additional input to the command control unit 7 . rpm sensor 3 is preferably a wire connected to thevehicle 64 &# 39 ; s ignition circuit ( not shown ) for providing a voltage signal when the engine is running and for providing no voltage signal when the engine is not running . the automatic occupant sensing anti - carjacking system 20 also includes an shift lever position sensor 4 which determines what position the vehicle 64 &# 39 ; s shift lever ( not shown ) is in as an additional input to the command control unit 7 . shift lever position sensor 4 is preferably a wire connected to the vehicle 64 &# 39 ; s neutral safety switch ( not shown ) for providing a voltage signal when the shift lever ( not shown ) is in the reverse or any forward drive selection e . g . first , second , third and overdrive on equipped automatic transmissions and for providing no voltagewhen the shift lever is in the neutral or park position . in vehicle 64 &# 39 ; s with manual transmissions a clutch pedal sensor ( not shown ) is used to signal the command control unit 7 of vehicle 64 movement . however , other sensing devices for determining whether the vehicle 64 is in neutral , drive , or reverse or whether the vehicle 64 is moving or not moving would be realized by one having ordinary skill in the art as providing the same purpose . auxiliary sensors 5 such as , motion sensors , infra red sensors , and pressure sensors may also be used . the automatic occupant sensing anti - carjacking system also includes pressure sensors 1 used to determine if a seat or other monitored area inside vehicle 64 is occupied or unoccupied as an additional input to the command control unit 7 . thus this is what is referred to as the occupant sensing aspect of the present invention . these sensors 1 which are pressure sensitive and are strategically located in the interior seating and floor area of the vehicle 64 . referring to fig5 which is a top viewof a block diagram of vehicle 64 shows one of many possible , strategic installations of pressure sensors . the reference numerals 51 , 55 , 62 and 63 denote fixed signal pressure sensors which detect pressure on the floorarea of the vehicle 64 . sensor 51 is located in the floor of the rear cargoor trunk area . sensor 55 is located in the floor area of the rear seats . sensors 62 and 63 are located in the floor area of the front seats . the reference numeral 52 denotes the rear seat of vehicle 64 . the reference numeral 53 denotes a fixed signal pressure sensor located in the backrest cushion of the rear seat 52 of vehicle 64 . the reference numeral 54 denotes a fixed signal pressure sensor located in the seat cushion of the rear seat 52 of vehicle 64 . the reference numeral 56 denotes the front seat of vehicle 64 . the reference numerals 57 and 58 denote fixed signal pressure sensors located in the backrest cushion of the front seat 56 of vehicle 64 . the reference numerals 59 and 60 denote fixed signal pressure sensors located in the passenger side of the seat cushion of the front seat 56 of vehicle 64 . the reference numeral 61 denotes the authorized operator variable signal pressure sensor , referring to fig5 located in the seat cushion of the operator &# 39 ; s seat 56 of the vehicle 64 . this sensor 61 responds to the seat pressure that the operator exerts on the operator &# 39 ; s seat . the advantage here is that is unlikely that different operators will have the same voltage signal identification . this allows the command control 7 to identify the authorized occupant by monitoring the output signal 45 of the pressure sensor module 48 . the command controlunit 7 continuously monitors the vehicle 64 sensors 21 automatically . the pressure transducer 43 can be easily modified to fit almost any application including the present invention . referring to fig4 the pressure sensor 42 comprises a low cost capacitive type versatile pressuretransducer 43 which is an electrical pressure transducer which is operatively connected to a pressure sensing pad 44 or other sensing apparatus to transmit the pressure signal to the pressure transducer 43 via rubber or plastic tubing . the pressure transducer contains a sensor module 48 providing an output signal 45 indicative of fluid pressure effective thereon to the command control unit 7 which also sends an input signal 46 to the pressure sensor 42 pressure transducer 43 as well as a ground connection at 47 . the flexible plastic or rubber sensing pad 44 andplastic or rubber tubing are readily available on the market . a well known manufacturer and supplier of such products is b . f . goodrich of akron , ohio . although a specific manufacturer and materials for the flexible liquid filled sensing pad 44 have been disclosed there are other well known manufacturers and materials which may be used . a liquid filled pressure sensing pad 44 is operatively connected to a pressure transducer 43 . although fig4 shows the components separately the pressure transducer and pressure sensing pad may be an integral unit . the command control unit 7 is operatively connected to the pressure transducer 43 . thepressure sensing pad 44 contains a liquid that has the properties of any well known ethylene glycol based solution . one such solution is peak antifreeze and coolant manufactured by old world industries inc ., northbrook , ill . although a specific solution has been disclosed it is well understood that numerous other liquid solutions may be used as well . the pressure transducer 43 accordingly reacts quickly to changes in the amount of pressure applied to the pressure sensing pad 44 as the authorized operator or occupant occupies a pressure sensor 42 monitored seat in the vehicle 64 . when a seat is occupied the liquid pressure sensing pad 44 senses the pressure of the occupant as they occupy the seatsurface ( not shown ) this results in a change in pressure of the liquid inside the pressure sensing pad 44 . this change in pressure is received bythe pressure transducer 43 which transmits an output signal 45 of the sensor 42 which is monitored by the command control unit 7 . the output signal 45 is analyzed as a report of an occupied seat . the sensor 42 monitors the input pressure signal 49 while the seat is occupied . these input pressure signals 49 are analyzed and compared with those stored in the memory of the command control unit 7 . the output signal 45 of the sensor 42 therefore will vary depending on the input pressure signal 49 which is relative to how much pressure is applied to the pressure sensing pad 44 . when the seat is vacated the pressure transducer furnishes a constant output signal 45 for example a 0 - value . this output signal 45 is recognized by the command control unit 7 as an unoccupied seat . intentional or unintentional movements of the seated occupant ( s ) on the pressure sensing pad 44 are recognized by the command control unit 7 and would not interfere with the normal system operation . a transducer performing this function is the model number p155 manufactured by kavlico corporation , moorpark , calif . although a specific pressure transducer has been disclosed , it is well understood that numerous other pressure transducers can be used to convert the input pressure signal 49 into an output electrical signal 45 to the command control unit 7 . a pressure switch ( not shown ) may be used to turn on the command control unit 7 when the ignition is not on . this prevents unecessary voltage drainon the system battery 8 and the vehicle battery 9 . thus , when the ignition is not on the pressure activated switch ( not shown ) will provide battery power to the command control unit 7 when any monitored seat in the vehicleis occupied . the pressure switch ( not shown ) may be seperate or incorporated into the pressure sensor 42 . the output signal 45 of the authorized occupant is stored in the memory of the command control unit 7 and is constantly compared with the output signal 45 of the pressure sensor 42 . any unprogrammed or unauthorized signals will activate the disablement sequence at 33 in fig3 . this sensor 42 allows an authorized occupant to easily operate the system 20 while making it virtually impossible for an unauthorized occupant to operate the vehicle 64 . the authorized occupant can , after programming thecommand control unit 7 operate the vehicle 64 without the need for transmitters , buttons or switches or other manual devices to operate its carjacking functions . the command control unit 7 receives inputs from ignition sensor 2 , pressuresensors 1 , shift lever position sensor 4 , engine rpm sensor 3 and auxiliarysensors 5 , as well as , a determination of a connection to vehicle 64 battery 9 and command control unit 7 battery 8 . the command control unit processes these inputs and if necessary , controls system 20 devices , 15 , 16 , 17 , 18 , 19 by controlling corresponding relays 10 , 11 12 , 13 and 14 located in strategic locations in vehicle 64 . command control unit 7 circuitry includes any suitable microprocessor , for example , an intel microcontroller chip such as , 8031 or 8096 , or a motorola microcontroller chip such as a 68332 together with appropriate memory and interfacing . relays 22 are normally open and their operation are described below in conjunction with the operational flow charts shown in fig2 and 3 . otherwell - known signal conditioning circuitry can be used between command control unit 7 and the system devices 23 , including but not limited to , power resistors , as well as appropriate isolation circuitry such as capacitive filters etc . command control unit 7 is designed to operate the automatic occupant sensing anti - carjacking system 20 as shown by the flow chart of fig2 to provide automatically operated anti - carjacking protection . to a vehicle 64operator desiring automatically operable anti - carjacking protection in any carjacking scenario . this system offers anti - carjacking protection regardless whether the authorized occupant is inside or outside of the vehicle 64 , regardless whether the ignition is on or off in vehicle 64 , regardless whether the engine is running or not running in the vehicle 64 , regardless whether the vehicle 64 is attended or unattended , regardless whether the carjacker attempts to take the authorized occupant hostage andforce the authorized occupant to drive the vehicle 64 , regardless whether the carjacker attempts to take the authorized occupant hostage by forcing the authorized occupant into the trunk of the vehicle 64 and other likely scenarios . other than the programming of the command control unit 7 there are no manually operated buttons or switches needed to activate carjacking protection functions . the authorized occupant need not be concerned with turning it on or off as it works automatically requiring no further authorized occupant activation . appropriate indicators such as a chirp speaker or led indicators may be used to indicate system 20 status to the authorized occupant . the command control unit 7 retrieves the stored input , at 25 in fig2 from the array of sensors 21 . the command control unit 7 then begins to compare all signal inputs , at 30 in fig2 with those stored in the memory of the command control unit 7 . if any signals are not within programmed parameters the command control unit 7 activates the anti - carjacking disabling sequence at 33 in fig3 automatically . during the disablement sequence the command control continues to check sensor inputs at 34 , the hazard lights 18 at fig1 flash continuously for a pre - determined amount of time at 35 in fig3 before engine disablement at 36 , 37 and 38 to allow the operator time to safely drive the car out of traffic prior to engine disablement , at 36 , 37 and 38 , by the command control unit 7 . at the expiration of this pre - determined time the hazard lights 18 will continue to flash and the audible devices 19 , infig1 will begin to sound at 39 after disablement at 36 , 37 and 38 . audible devices included for use in the anti - carjacking disablement sequence are interior and exterior audible devices 19 . there are numerous types of well known sirens , speakers , and horns which may be used for thispurpose . the command control unit 7 includes a timing device for controlling both audible devices 19 and hazard flashers 18 so that they operate for a maximum time period and then automatically shut off . unless enabled by an authorized operator the engine will remain disabled at 36 , 37 and 38 and the hazard flasher 18 and audible devices 19 , referring to fig1 will stop after 15 minutes or other pre - determined amount of time . the system 20 will continue to monitor sensors 21 at 40 and continue disabling at 41 until the appropriate input parameters are received by thecommand control unit 7 . if there are no input signals the command control unit 7 will automatically disable vehicle 64 at 27 in fig2 . for increased anti - carjacking protections the command control unit 7 checksfor disablement status at 29 , in fig2 the engine can only be enabled , at28 , once disabled , at 36 , 37 and 38 in fig3 by an authorized occupant sitting and occupying the operator &# 39 ; s seat 56 , in fig5 of the vehicle 64where pressure sensor 61 will send a signal to the command control unit 7 that there is an authorized occupant in the vehicle 64 . the command control unit 7 will then enable the vehicle &# 39 ; s 64 engines at 29 in fig2 and deactivate hazard lights 18 and deactivate audible devices at 19 and return the system 20 to monitor mode at 24 . the vehicle 64 can also be enabled by an authorized operator using the reset and override functions of the monitor - keypad 6 . a carjacker would not be able to prevent disablement at 36 , 37 and 38 as the array of sensors 21 would signal the command control unit 7 of an unauthorized occupancy . the command control unit 7 monitors the system 20 at 24 , it then retrieves the signal at 25 , identifies the signal at 26 , checks the parameters of the signals at 30 and since the carjackers signal would be identified as unauthorized at 31 the command control unit 7 would activate the disabling sequence at 32 . another method the thief may attempt is to disconnect the vehicle 64 battery 9 and the system 20 battery 8 in an attempt to enable the system 20 . since all relays 22 in the system 20 are normally open and must be energized by the command control unit 7 disconnection of the batteries at 8 and 9 will only serve to put the system 20 in the disablement mode at 27in fig2 . it is important that the anti - carjacking prevention features be automatically initiated , prior art devices which utilize remote transmitters and hidden switches are not reliable as the carjacker may force coerce the operator to give up the transmitter , the operator may forget to carry the transmitter , the operator may be coerced prior to entering or shortly after exiting their vehicles the operator may be injured by the carjacker and be unable to use the transmitter or activate any hidden switches . also prior art devices using remote transmitters onlyprotect the vehicle from carjacking while the engine is running and the operator is in the vehicle . they offer no protection if the operator failsto activate the transmitter , forgets the transmitter , the vehicle exceeds transmitter signal range prior to the operation of the transmitter signal or the carjacker obtains the transmitter . the present invention as herein described makes it virtually impossible foran carjacker to obtain the vehicle 64 during an attempted carjacking in anyscenario . to illustrate the capabilities of the present invention , several scenarios are described below which demonstrates the unequalled protection afforded by the automatic occupant sensing anti - carjacking system 20 of the presentinvention : assume the operator drives vehicle 64 to the grocery market and turns the engine off and leaves the vehicle unoccupied . the array of sensors 21 willsend signals to the command control unit 7 that the vehicle 64 is unoccupied . the command control unit will then automatically initiate ignition , fuel and starter disablement at 27 in fig2 until enabled by an authorized occupant . the authorized operator returns to vehicle 64 and occupies the operator &# 39 ; s seat 56 the array of sensors 21 will send a signalto the command control unit 7 that an authorized occupant is in the vehicle64 and the command control unit 7 will automatically enable at 28 the vehicle 64 systems 23 . additionally , if an unauthorized operator enters the unoccupied vehicle 64 the array of sensors 21 will send signals to thecommand control unit 7 that an unauthorized occupant is in the vehicle 64 . the command control unit 7 will then automatically initiate the anti - carjacking disablement sequence at 33 in fig3 . in another scenario , the authorized operator is stopped waiting for a traffic light to change when a carjacker appearing at the window points a gun at the authorized operator and demanding the vehicle 64 . to end this scenario and the possibility of injury , the authorized operator merely complies with the carjacker &# 39 ; s demands knowing that the vehicle 64 will not get more than a pre - determined amount of time away , for example 60 seconds . the pressure sensor 61 , in fig5 sends a signal to the command control unit 7 that an unauthorized operator has entered vehicle 64 . the command control unit 7 will than automatically initiate the anti - carjacking disablement sequence at 33 in fig3 . additionally , the vehicle 64 hazard lights 18 will flash continuously , at 35 notifying the authorized operator that the anti - carjacking disablement sequence has begun and the carjacking attempt will be foiled . at a pre - determined time after the hazard lights 18 began flashing , at 35 , for example , 60 seconds later the carjacker will then decide to abandon the carjacking , compelled by the painful sound of the interior audible device at 39 in fig3 . it is likely that the carjacker will be observed as vehicle 64 is abandoned because the sound of exterior audible device at 39 , in fig3 draws the attention of onlookers or passerbys or others at the scene . in yet another scenario , an operator is approaching their car in a parking lot or pumping gas at a gas station , when a carjacker demands the car threatening the operator with a gun . the operator wisely turns over the keys and lets the carjacker occupy the operator &# 39 ; s seat at 56 in the vehicle 64 . at this times the occupancy sensor at 61 , in fig5 will senda signal to the command control unit 7 that an unauthorized occupant is in the vehicle 64 . the command control unit 7 will then automatically initiate the anti - carjacking sequence at 32 in fig2 and the hazard lights at 18 will began to flash continuously at 35 notifying the operatorthe carjacking attempt will be foiled in the same manner as described above . in a different scenario , the operator is stopped waiting for a traffic light to change when a carjacker forces his way by gunpoint into the passenger seat of the vehicle 64 and demands that the operator drive the vehicle or forces the operator into the trunk of the vehicle 64 the operator merely complies with the carjackers demand knowing that the vehicle 64 will be disabled at 32 , in fig2 as the pressure sensors at 57 , 61 , and 63 in fig5 send a signal to the command control unit 7 that an unauthorized occupant has entered the vehicle 64 . the command control unit 7 will then automatically initiate the anti - carjacking disabling sequence at 33 in fig3 . at this time the hazard lights 18 will begin to flash at 35 , in fig3 and after a pre - determined amount of time , for example , 60 seconds the vehicle 64 will be disabled at 36 , 37 and 38 and audible devices 19 will sound at 39 compelling the carjacker from the vehicle 64 . still another scenario is where the vehicle 64 is occupied by two authorized occupants . one at sensor 59 and one at sensor 61 . both sensors 59 and 61 , in fig5 are of the pressure sensor type illustrated in fig4 . both sensors 59 and 61 are programmed into the memory of the command control unit 7 . the authorized occupants stop at a late night party store at 1 : 30 a . m . the occupant at 59 exits the vehicle 64 to go into the party store . leaving the occupant at 61 in the vehicle . pressure sensor 60 is set to sense an unauthorized occupancy . while the authorized occupant at pressure sensor 59 is in the party store an unauthorized occupant enters the vehicle 64 at sensors 59 and 60 and attempts to make the occupant at sensor 61 drive the vehicle at gunpoint . within seconds after the unauthorized occupant enter the vehicle 64 the pressure sensors at 59 and 60 send signals to the command control unit 7 that an unauthorized occupant is in the vehicle 64 . the command control unit 7 automatically initiates the disabling sequence , at 33 in fig3 which prevents the vehicle 64 from leaving the scene and prevents a possible hostage scenariowhere the authorized occupant may have been forced to drive their own vehicle to some isolated location where the carjacker may do harm to an authorized occupant and go unnoticed . in yet another scenario , a carjacker watches and stalks a potential victim leave their vehicle 64 and go into the supermarket to shop . as the potential victim returns to and is sitting in their vehicle . the carjackerapproaches the vehicle preparing to attempt the carjacking . as the carjacker approaches the vehicle he notices an emblem obviously displayingthe fact the vehicle 64 is equipped with the present invention . the carjacker realizing that he will not be able to drive away with vehicle 64aborts his attempt and seeks another vehicle not so equipped . finally , referring to fig1 the command control unit 7 responds to sensorinputs by controlling actuators or relays 22 according to programmed instructions . the sensors 21 provide input to the command control unit 7 about vehicle occupancy , engine and vehicle conditions and the command control unit 7 initiates the appropriate response . by way of example , if the ignition sensor 2 indicates that the ignition is on and the shift lever position sensor 4 indicates a parked condition , the pressure sensors1 indicate a no occupancy condition and the rpm sensor 3 indicates the engine is running the command control unit 7 will allow an authorized operator to idle the engine for purposes of warming the engine in necessary weather conditions . the authorized operator need not be in the vehicle 64 for the engine to idle . upon initial startup the pressure sensor 61 , in fig5 sends a signal to the command control unit 7 that anauthorized occupant is in the vehicle . thus , after startup the authorized occupant may exit the vehicle 64 and the vehicle 64 will continue to idle . however , if the carjacker attempts to enter the vehicle while it is idling and the authorized occupant is not in the vehicle the pressure sensor 61 will send a signal to the command control unit 7 that an unauthorized occupant is in the vehicle 64 and will automatically initiate the disablement sequence at 33 in fig3 . thus it will be demonstrated that there is a vehicular automatic occupant sensing anti - carjacking system which achieves the various objectives , features and considerations of the present invention and which is well adapted to meet the conditions of mass production and practical usage . as various changes might be made in the exemplary embodiments above described and shown without departing from the spirit of the invention andas various changes might be made in the embodiment set forth , it is to be understood that all matter herein described or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense . the spirit and scope of the present invention are to be limited only by theterms of the appended claims . | 1 |
referring first to fig1 it can be seen that an analog input signal 10 is to be converted into a digital signal in parallel form . to that end , a comparator 12 is provided , with the analog signal 10 being introduced to one input of the comparator 12 . the output of the comparator 12 is connected to the data input of a successive approximation register 14 which is clocked by a clock 16 . the successive approximation register 14 has a plurality of output terminals 16 , of which the output 18 represents the most significant bit ( msb ) and of which output 20 represents the least significant bit ( lsb ). all these output terminals are connected to a digital - to - analog converter 22 , which produces a reference signal 24 that is routed to another input of the comparator 12 . in use , the analog input signal 10 is compared with the then - current reference signal 24 in the comparator 12 . each such comparison takes place every time that the clock 16 produces a clock pulse . initially , the reference signal 24 is set to equal a value equal to one - half the maximum value which can be assumed by the analog input signal 10 . in the event that the analog input signal 10 is equal to or greater than the initial value of the reference signal 24 , output terminal 18 is made logically high , and in the event that the analog input signal 10 is lesser than the value of the reference signal 24 , output terminal 18 is logically low . upon the receipt by the successive approximation register 14 of the next clock pulse generated by clock 16 , the analog input signal 10 is compared to a reference signal 24 which is either three - fourths or one - fourth the above - mentioned maximum value , depending upon the results of the first comparison described above . if , for example , the analog input signal 10 is greater than one - half of this maximum value , it will be next compared with a reference signal 24 which is scaled by the digital - to - analog converter 22 so as to next be compared with a reference signal 24 that is equal to three - fourths the above - mentioned maximum value . in the event that the analog input signal 10 is still greater than this increased reference signal 24 , then the adjacent output terminal 16 will be brought logically high , and will be logically low otherwise . on the other hand , in the event that the analog input signal 10 was originally less than the initial reference signal 24 , it will next be compared with a reference signal 24 which is adjusted to have a value equalling one - fourth of the above - mentioned maximum value , to produce a 37 1 &# 34 ; or a 37 0 &# 34 ; at the immediately adjacent output terminal 16 , depending upon the results of this next comparison . this process is then repeated as many times as there are outputs 16 of the successive approximation register 14 , until output terminal 20 is either brought logically low or logically high depending upon the results of the comparison to which it corresponds . at this point , the logical statuses of all the outputs 16 ( including of course outputs 18 and 20 ) can be described by a binary number in which a &# 34 ; 1 &# 34 ; represents a logically high state and in which a &# 34 ; 0 &# 34 ; represents a logically low state . for example , if all the outputs of the successive approximation register 14 have the logical values shown below , they will correspond to analog input signals 10 having that fraction of the maximum expected value of the analog input signal 10 : ______________________________________digital data word fraction of full scale______________________________________00000000 000000001 1 / 25600000010 1 / 12800000011 1 / 128 + 1 / 256 = 3 / 25600000100 1 / 64 ...... 01000000 1 / 4 ... 01100000 1 / 4 + 1 / 8 = 3 / 8 .... 10000000 1 / 2 ... 11000000 1 / 2 + 1 / 4 = 3 / 4 ... 11111111 255 / 256______________________________________ it may thus be seen that using an analog - to - digital conversion system of this sort , a data output in parallel form can generate a digital data word with as many places as there are output terminals of the successive approximation register 14 . systems of this sort are already known , and therefore this system will not be further described . in fig2 a photocell 26 or other suitable light - responsive semiconductor device ( such as a phototransistor , photodiode and the like ) is located inside a modern photographic camera ( not shown ) so as to measure the intensity of the ambient light in which the camera is being utilized . for the purposes of this discussion , the photocell 26 may view the scene to be photographed either through the lens ( not shown ) of the camera or not . it is only important for the purposes of this discussion to know that the output of photocell 26 will have some correspondence to the intensity of the ambient light in which the camera is to be used . photocell 26 is a photocell or other suitable semiconductor device ( such as a phototransistor , photodiode or other suitable semiconductor element ) which delivers an analog input signal 28 into an analog - to - digital converter 30 such as is disclosed herein . this converter 30 converts the analog input signal 28 to a digital output signal 32 , which is routed to an integrator 34 which operates to provide a time - integral of the intensity of the analog input signal 28 by means of repeated additions . these repeated additions take place as the progressively increasing sum is clocked into and out of clocked memory 36 by a clock 38 . once an accurate time - integral has been produced by this series of repeated additions , the information is routed to an exposure calculated 40 into which information such as film speed can be introduced in order to allow parameters such as lens setting and shutter speed to be adjusted . exposure calculator 40 produces a control signal 42 which , after amplification in amplifier 44 , can be used to drive suitable exposure servos 46 such as the shutter and the elements which control the opening of the lens utilized on the camera . methods which produce time - integrals of signals such as analog input signal 28 are already known . it will be understood by one skilled in the art that the heart of such a system that has just been disclosed resides in the analog - to - digital converter 30 . in order to understand how this invention operates , it is helpful to visualize an eighteen place binary number which can represent the entire dynamic range in which incident light as received by the photocell 26 is represented . such a number takes the form of : in which the x to the far left represents one - half the full - scale light intensity to be expected , the next x to the right represents one - fourth of this full scale number , and the remaining places represent smaller and smaller fractions of this full - scale value in which the denominators increase as successive powers of 2 . modern cameras can operate over such a dynamic range , but differences in light intensity of less than 7 % cannot be detected by such a camera , since such differences correspond to less than 1 / 10 of a photographic stop . a four place binary number is accurate to 1 / 16 , or slightly more than 6 %, which is below this 7 % figure . thus , in the even that 9 four bit group containing 1 &# 39 ; s is detected in such an eighteen place binary number , the number represented by these four bits will be sufficiently accurate in order to allow the exposure of such a camera to be accurately set . as an example , if the number representing the ambient light intensity in which the camera is utilized is it is unnecessary to consider anything after the four 1 &# 39 ; s since the rest of the components of this eighteen place binary number will not amount to a difference of more than 7 %. thus , once such a digital data word is detected , only the first four figures are significant , and the rest can safely be ignored since the other digits will not result in increased exposure accuracy . those skilled in the art will readily understand that the 0 &# 39 ; s to the left of the 1 &# 39 ; s must be considered while the remaining digits are , as before , irrelevant . without considering the left - hand string of 0 &# 39 ; s in this latter number , the significance of the number thus represented cannot be ascertained . hence , it is possible to divide such a number into groups , and to look at the groups thus formed to see if they contain any 1 &# 39 ; s . supposing , for example , that this latter number were divided into groups of five , and each group scanned for the existence of a 1 , a scanner of this latter number would first see a group which was composed of all 0 &# 39 ; s . thus , this would mean that whatever digits were to the right of the first group scanned , the number represented could not exceed 1 / 32 of the full - scale value of the maximum expected light intensity . in the event that the next five digits were all 0 , it would follow that , regardless of the number of digits after the tenth digit in the series , the entire number would have to be less than 1 / 1024 of full scale . hence , by dividing this eighteen digit data word into groups and looking for the first one in any group , it would be possible to assign a weight to the first &# 34 ; 1 &# 34 ; found by keeping track of the groups that had been examined . in this second example given , a &# 34 ; 1 &# 34 ; would be detected within the second group of five digits , or bits , which was scanned . however , it will be immediately apparent to one skilled in the art that in order to achieve the desired level of accuracy , the mere detection of this first &# 34 ; 1 &# 34 ; in the tenth place will not suffice . a productive way in which a string of bits such as the ones illustrated above can be examined to achieve the necessary accuracy is to divide the string of bits into groups of five , to check for the existence of at least one &# 34 ; 1 &# 34 ;. in the event that within any group of five bits , there is at least one &# 34 ; 1 &# 34 ;, only this group of five bits and the following ( three ) bits of the register will be considered or read . the register runs to its last bit . the a / d conversion is then stopped . however , in the event that there is at least one &# 34 ; 1 &# 34 ; in this group of five bits , the possibility exists that the only such &# 34 ; 1 &# 34 ; in existence is the &# 34 ; 1 &# 34 ; in the fifth bit in the group . in this case , more information is necessary since , as in the case listed above , the first four bits in any five bit group must be known and thus the ninth and tenth bit in the second data word shown above does not provide sufficient information . hence , when the third , fourth or fifth bit in any five bit group is a &# 34 ; 1 &# 34 ;, more information is needed . fig3 is a flow chart showing a method that can be used in order to examine data words and to stop such examination when an accuracy of better than 7 % has been achieved . first , a group of five bits is examined . the group is then examined as a whole , to see if any of the bits in the group are 1 &# 39 ; s so as to determine whether or not the analog signal under examination falls within 1 / 16 of full scale . in the event that no such &# 34 ; 1 &# 34 ; is detected , it is known that not only is there a sufficiently small analog quantity so that the analog signal is below 1 / 16 of full scale , but is also less than 1 / 32 of full scale . in the event that no such 1 &# 39 ; s are detected , then it is known that the analog signal corresponds to a portion of the dynamic range which is less intense that the portion under examination . in this case , the previous examination of five bits is noted and a subsequent group of five bits then examined . this process of examination can occur until such time as at least one &# 34 ; 1 &# 34 ; is detected . assuming that a &# 34 ; 1 &# 34 ; is so detected in any five - bit - group , i . e . the third or fourth bit of this group , the register does not stop at the fifth bit . it runs to the last of the following bits of the register , which register then will be stopped . in the event that the third bit is &# 34 ; 1 &# 34 ; the digital word consists of the third bit up to the eighth bit of the register . that means the accuracy of the digital word is six bits . in case that the fifth bit is &# 34 ; 1 &# 34 ; the digital word consists of the fifth up to the eighth bit of the register . that means the accuracy equals four bits which is the lowest possible accuracy for a data word . these digital words form a data word in parallel form , which can be used for subsequent computational purposes . finally , the possibility exists that the analog - to - digital conversion to be performed is taking place at the lowest end of the dynamic range with no illumination at all . in this case , which corresponds to the fourth group of five bits ( because , of course , there are only eighteen bits required in order to express the entire usable dynamic range ), the absence of 1 &# 39 ; s is noted and the next digital data word can be read . the flow chart shown in fig3 has been discussed as if the eighteen bit digital data word already existed in toto prior to this reading process . in fact , this eighteen bit digital data word is actually constructed in a sequential fashion , depending upon the results of comparisons formed by a comparator such as is always used in an analog - to - digital conversion system which uses a successive approximation register . in fact , as can be seen from the schematic diagram shown in fig4 to which reference may now be had , the data word constructed in the analog - to - digital conversion may have as few a eight bits or may have as many as twenty - three bits , depending upon the magnitude of the analog signal to be converted . in fig4 a photocell 48 ( or other suitable semiconductor device such as a phototransistor , a photodiode , or other suitable element ) is connected across the input terminal of comparator 50 . the output of comparator 50 is routed to the digital input of a successive approximation register 52 . a suitable successive approximation register for this application is manufactured by motorola semiconductor products , inc ., under number mc14559 . the successive approximation register 52 has eight parallel data outputs 54 , 56 , 58 , 60 , 62 , 64 , 66 and 68 . parallel data output 54 is that output which corresponds to the most significant bit ( msb ), while parallel data output 68 corresponds to the least significant bit ( lsb ). every time that a clock pulse generated by clock 70 is received at the clock terminal c of the successive approximation register 52 , the analog signal 72 which passes through the photocell 48 is compared with a reference signal 74 . in the event that analog signal 72 is equal to or greater than reference signal 74 , comparator 50 produces a logically high output which is reflected at data input d of the successive approximation register 52 . this comparison can occur because digital - to - analog converter 76 is connected to all of the parallel data outputs 54 - 68 , and generates an appropriate electrical current which , after scaling in scaling network 78 , can be converted into an appropriate reference signal 74 . it will be noted that , except for the scaling network 78 just described , the other elements are connected together in an entirely conventional fashion . the successive approximation register 52 is of a type which can be so connected that unwanted and unnecessary parallel data outputs may remain unused . for this purpose , feed forward terminal ff is provided on the successive approximation register 52 . in the event that it is desired to read only the first five parallel data outputs 54 - 62 , the feed forward terminal ff can be connected directly to parallel data output 64 . in other words , when the successive approximation register 52 is to be used to produce an output of n bits , where n is less than eight , the ( n + 1 ) th parallel data output will be connected to feed forward terminal ff . however , in the event that all eight parallel data outputs 54 - 68 are to be utilized , feed forward terminal ff is simply brought logically low . successive approximation register 52 also has a serial output terminal s out . whenever any of the parallel data outputs 54 - 68 is brought logically high during the operation of the successive approximation register 52 , s out will also be brought momentarily high , with the next clock pulse , so that the data emerging from the successive approximation register 52 in parallel form on parallel data outputs 54 - 68 will also be reflected at terminal s out in serial form . start convert terminal sc of the successive approximation register 52 is pulsed when it is desired to cause the successive approximation register 52 to begin to execute a conversion sequence . finally , the end of convert terminal eoc of successive approximation register 52 will go logically high upon the registration of a logically low or logically high state at the parallel data output to which feed forward terminal ff is connected . when a conversion sequence is to be performed , flip - flop 78 &# 39 ; and counter 80 are initially reset so that flip - flop 78 &# 39 ; has a logically low output and counter 80 begins to count at &# 34 ; 0 &# 34 ;. output 4 of counter 80 is logically low . all parallel data outputs 54 to 68 will be logically low . the nor - gate 88 subsequently brings the input sc of successive approximation register 52 on logically high . when a clock pulse generated by the clock 70 is received at clock terminal c of the successive approximation register 52 its output 54 becomes logically high and the analog signal 72 is compared with a reference signal 74 which at that moment corresponds to one - half of full scale . in the event that the analog signal 72 is less than the reference signal 74 , the comparator 50 will produce a logically low output at data input terminal d of the successive approximation register 52 and parallel data output 54 will be reset to logically low with the following clock pulse . simultaneously the output 56 of the register 52 will be brought logically high so as to produce a reference signal 74 which corresponds to one - fourth of full scale . the reference signal 74 is once again compared with the analog signal 72 . in the event that the analog signal 72 is still less than the reference signal 74 , the comparator 50 once again produces a logically low output and parallel data output 56 is reset to logically low . assuming for the moment that the analog signal 72 is sufficiently low so that the first four comparisons ( which are performed in an entirely conventional manner ) result in the generation of four successive 0 &# 39 ; s , the first four parallel data outputs 54 - 60 will be brought logically low . upon the performance of a fifth comparison by comparator 50 , parallel data output 62 will be brought logically low . parallel data output 64 is connected to one of the inputs of and - gate 82 . the output of and - gate 82 is connected to the feed forward terminal ff of the successive approximation register 52 . as was mentioned above , this connection causes the successive approximation register 52 to recycle back to parallel data output 54 upon the next conversion performed , regardless of the logical status of parallel data output 64 . the reason for such recycling is , of course , that feed forward terminal ff is connected to parallel data output 64 through and - gate 82 and that the second ( inverted ) input of the and - gate 82 is on logically low . when the parallel data output 64 is brought logically low or logically high , end of convert terminal eoc is momentarily brought logically high . this causes counter 80 to count up to 1 . since the contents of counter 80 are transmitted to scaling network 78 via lines 84 , the scaling network 78 can cause an appropriate reference signal 74 to be scaled so that it has the same value it would have had in a normal analog - to - digital conversion process wherein the successive approximation register 52 would bring parallel data output 64 logically low or logically high in conventional fashion . thus , five comparisons have been performed by comparator 50 , and since the results of each such comparison resulted in the generation of a &# 34 ; 0 &# 34 ;, the 0 &# 39 ; s appear on parallel data outputs 54 - 62 and the output of counter 80 registered on line 84 can be used to assign a weight to these 0 &# 39 ; s , so that subsequent apparatus can utilize the data appearing at the parallel data outputs 54 - 62 in connection with an appropriate weighting factor . assuming that the next five comparisons performed by the comparator 50 results in the generation of five 0 &# 39 ; s , these 0 &# 39 ; s will be reflected , as before , on parallel data outputs 54 - 62 , a momentary pulse will appear at end of convert terminal eoc , and the counter 80 will count to 2 . an appropriate weighting factor thus appears on lines 84 , the scaling network 78 is scaled , an appropriate reference signal 74 is generated , and five subsequent comparisons are performed . after the twentieth comparison performed by comparator 50 , the end of convert terminal eoc will be momentarily pulsed once more , and the counter 80 will count to 3 . at this point , it is known that the entire dynamic range of analog signal 72 has been exhausted , and no further comparisons are necessary . in physical terms , this condition corresponds to a situation in which a modern motion picture camera is being utilized in insufficiently bright illumination . because counter 80 has counted to 3 , line 86 is brought logically high . line 86 is connected to one of the inputs of nor - gate 88 , and the output of nor - gate 88 is connected to start convert terminal sc . thus , start convert terminal sc at that time is brought logically low to cause the successive approximation register 52 to run to the last of the three bits of the register 52 . the a / d conversion is stopped until a further reset - pulse will start a new a - d conversion . this reset pulse will be produced by an appropriate reset circuit ( not shown ). however , assume that there is sufficient light available for the camera to be used . in this case , one of the comparisons performed by comparator 50 will produce a logically high output at the output of comparator 50 . this logically high output will be reflected at the data input terminal d of the successive approximation register 52 , and a logically high condition will be registered at one of the parallel data outputs 54 - 62 . at this point , a pulse appears at the serial output terminal s out and the output of flip - flop 78 will be brought logically high . because the output of flip - flop 78 is connected to the second ( inverse ) input of the and - gate 82 , the feed forward terminal ff will be brought logically low . in this situation , the connection between parallel data output 64 and the feed forward terminal ff is severed , so that the successive approximation register 52 can continue to register the results of the next comparison on parallel data output 66 . it will be noted that this will be the case regardless of which of the parallel data outputs 54 - 62 is brought logically high as a result of a logically high output of comparator 50 . for example , if the first comparison performed by comparator 50 results in a logically high state of parallel data output 54 , the flip - flop 78 will have a logically high output , feed forward terminal ff will be locked , and the comparison process will continue to the last ( eighth ) bit of the successive approximation register 52 . as the output of flip - flop 78 is connected with one of the inputs of nor - gate 88 the transition of the output of flip - flop 78 from logically low to logically high brings the input sc of the successive approximation register 52 logically low . as a result no further a / d conversion will start after the eighth bit of the a / d conversion just on run has been reached or read . the successive approximation register 52 remains stopped until a further reset pulse will come from the appropriate reset circuit ( not shown ). for example , if the first comparison performed by comparator 50 results in a logically high state of parallel data output 54 , the data word will appear with sufficient accuracy of eight bit on parallel data outputs . if the fifth comparison performed by comparator 50 results in a logically high state of parallel data output 62 , the data word will appear with a sufficient accuracy of four bits . the high state of parallel data output 62 is the ultimate possible high state of the conversion just on run to have a sufficient accuracy of at least 4 bits . the data weight of these eight or four bits will appear on parallel data outputs 54 to 60 . the digital data word on parallel data outputs 54 to 60 will be transmitted to an integration circuit ( not shown ). this integration circuit produces a reset pulse which is transmitted to flip - flop 78 and to counter 80 . a new a / d conversion begins as described above . the integration circuit is operated or influenced by the parallel data outputs 54 to 68 and by the lines 84 , which characterize the data weight ( weighting data out ). alternatively the integration circuit may be operated or influenced by output s out i . e . serial data output of successive approximation register 52 ( serial data out ). in this case only data output s out is connected to the integration circuit . the number of clock pulses on the input c of the successive approximation register 52 characterizes the data weight of the serial data pulses . the data weight of serial data pulses is characterized by the time sequence of the data pulse on output s out of the successive approximation register 52 beginning with the start of a / d conversion . those skilled in the art will readily appreciate that as the magnitude of the reference signal 74 and the analog signal 72 decreases , longer and longer comparison times are necessary in order to allow the comparator 50 to discriminate between the values of reference signal 74 and analog signal 72 and to produce an appropriate output signal . thus , it is desirable to slow down the comparison rate after the first five comparisons performed by comparator 50 indicate that no 1 &# 39 ; s exist . to that end , a switch 94 and a frequency divider 96 are interposed between the clock 70 and the clock terminal c of the successive approximation register 52 . the switch 94 is connected to the output of counter 80 , and can deliver the clock pulses generated by clock 70 either directly to clock terminal c or indirectly to this terminal , via frequency divider 96 . after the first series of five comparisons are made and no 1 &# 39 ; s have been detected , the switch can route the clock pulse generated by clock 70 through the frequency divider 96 so as to effectively make the successive approximation register 52 receive clock pulses at a lower rate . this will slow down the sampling rate applied to analog signal 72 , giving the comparator 50 a greater time in which to compare the reference signal 74 and the analog signal 72 . as can be seen in fig5 a decoder 98 composed of four and - gates is connected to lines 84 , so as to decode the output of the counter 80 . each of the and - gates can , using suitable switching circuitry known to those skilled in the art , close one of the corresponding switches 100 that are all connected together at one side to the output of the digital - to - analog converter 76 . the switches 100 feed into a resistor network 102 that is connected across the photocell 48 . it will be obvious to those skilled in the art that by suitably closing one of these switches , the output of digital - to - analog converter 76 can be scaled by the resistor network 102 so as to progressively decrease the voltage that appears at the anode of photocell 48 . thus , the scaling network 78 can scale the output signal from the digital - to - analog converter 76 in accordance with the count to which counter 80 has counted . when the clock 70 operates at a frequency of 512 khz and the frequency divider 96 divides by a factor of 4 , it will require approximately 200 microseconds for the successive approximation register as well to register the first five comparisons made by comparator 50 as to accomplish the integration in the integration circuit ( not shown ). thus , for intense levels of light , the system disclosed herein can accomplish its desired task very quickly . at lower - intensity light levels , approximately 1 millisecond may be required in order to accurately accomplish the conversion . the speed of this system results in the main from the absence of capacitors in the system . after each conversion has been accomplished , the data appearing at the parallel data outputs and the logical status of lines 84 can be used in subsequent time integration apparatus ( not shown ) such as was mentioned above . alternatively , the serial data appearing at the serial data output can be used in order to accomplish the same result . thus , it can be seen that by utilizing the system disclosed herein , the successive approximation register 52 is caused to operate in a first mode ( parallel digital words ) and in a second mode ( serial digital words ). when the successive approximation register 52 operates in the first mode , the usable data required for subsequent time integration will appear on parallel data outputs 54 - 60 . however , when the successive approximation register 52 operates in the second mode , the usable data will appear at serial data output s out of the successive approximation register 52 . in both cases the accuracy of the digital data words is at least four bits and at most eight bits . although a successive approximation register having only eight bits is utilized the total dynamic range of the successive approximation register 52 is 23 bits . thus , there is ample capacity to completely cover a dynamic range of as many as twenty - three bits , even though the successive approximation register can hold only eight simultaneously . in this fashion , all the objectives of the invention are achieved . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention . | 7 |
exemplary embodiments will be described below with reference to the accompanying drawings . preliminary content as a base will be described prior to the description of the embodiments . fig1 is a cross - sectional view illustrating preliminary content . as shown in fig1 , a core substrate 120 made of a glass epoxy resin or the like is disposed at the middle portion of a wiring substrate 100 according to the preliminary content in a thickness direction of the wiring substrate . through electrodes te , which pass through the core substrate 120 in the thickness direction of the core substrate , are formed in the core substrate 120 . first wiring layers 200 , which are connected to each other by the through electrodes te , are formed on both surfaces of the core substrate 120 . further , interlayer insulation layers 300 in which via holes vh reaching the first wiring layers 200 are formed are formed on both surfaces of the core substrate 120 . second wiring layers 220 , which are connected to the first wiring layers 200 through the via holes vh , are formed on the interlayer insulation layers 300 that are formed on both surfaces of the core substrate 120 . in addition , a solder resist 320 , where opening portions 320 a are formed on connection pads p of the second wiring layer 220 , is formed on the upper interlayer insulation layer 300 . further , the solder resist 320 , where opening portions 320 a are formed on connection portions of the second wiring layer 220 , is formed on the lower interlayer insulation layer 300 . external connection terminals 240 are connected to the lower second wiring layer 220 . furthermore , solder bumps 420 of a semiconductor chip 400 are flip - chip connected to the connection pads p , which are formed on the upper surface of the wiring substrate 100 , by reflow heating . the coefficient of thermal expansion of the wiring substrate 100 ( interlayer insulation layers ( resin )/ wiring layers ( copper ) and the like ) is larger than that of the semiconductor chip 400 ( silicon ). for this reason , the wiring substrate 100 expands or warps more than the semiconductor chip 400 due to the heating that is performed for the flip - chip connection between the semiconductor chip 400 and the wiring substrate 100 . as a result , the positions of the connection pads p are shifted . in particular , if the pitch of the solder bumps 420 of the semiconductor chip 400 is reduced to 100 ฮผm or less , the connection pads p of the wiring substrate 100 are disposed to be shifted from the solder bumps 420 of the semiconductor chip 400 . accordingly , it is difficult to reliably mount the semiconductor chip 400 . further , the second wiring layers 220 ( connection pads p ) are formed on the interlayer insulation layers 300 ( resin ) by a semi - additive method . in detail , after seed layers ( not shown ) are formed on the interlayer insulation layers 300 first , plating resists ( not shown ) including opening portions formed at portions where the second wiring layers 220 are to be disposed are formed . after that , metal plating layers are formed by electrolytic plating where the seed layers are used as plating power - supply paths . furthermore , after the plating resists are removed , the seed layers are etched while the metal plating layers are used as masks . since relatively large irregularities are formed on the surfaces of the interlayer insulation layers 300 ( resin ), considerable over - etching is needed so that residues are not formed during the etching of the seed layers . for this reason , undercut occurs on the seed layers and the patterns of the metal plating layers are apt to become thin . accordingly , when the โ line : space โ of the second wiring layers 220 ( connection pads p ) particularly becomes โ 10 : 10 ฮผm โ or less , the width of a finished line becomes considerably small and deviates from design specifications . eventually , the width of the line becomes small , so that the adhesion between the wiring layer and the interlayer insulation layer is reduced and the second wiring layers 220 are partially detached from the surfaces of the interlayer insulation layers 300 . as described above , it is difficult to form a wiring layer , of which the โ line : space โ is โ 10 : 10 ฮผm โ or less , on a resin layer , which has irregularities , with high yield by a semi - additive method . when it is difficult to reduce the pitch of the wiring layer , it is necessary to cope with this by increasing the number of build - up wiring layers to be laminated . for this reason , the thickness of the wiring substrate is increased , so that it is difficult to cope with the demand for the reduction in size and thickness . further , for the suppression of warpage of the whole core layer 120 of the wiring substrate 100 , the thickness of the core layer 120 of the wiring substrate 100 is set to be relatively large , that is , in the range of 400 to 800 ฮผm . furthermore , the diameter of each of the through electrodes te passing through the core layer 120 is set to about 200 ฮผm . as described above , the through electrodes te , which are considerably thicker and longer than the first and second wiring layers 200 and 220 or the via holes vh ( via conductors ), formed in the core layer 120 . for this reason , since signals are apt to be reflected by the through electrodes te on high - frequency signal transmission lines of the wiring substrate 100 , there is a concern about the degradation of high - frequency characteristics . it is possible to solve the above - mentioned problems by using wiring substrates according to embodiments to be described below . fig2 to 4 are cross - sectional views illustrating a method of manufacturing a wiring substrate according to a first embodiment , and fig5 is a cross - sectional view of the wiring substrate according to the first embodiment . in the method of manufacturing the wiring substrate according to the first embodiment , a glass substrate 10 a having a thickness of 0 . 3 to 1 mm is prepared first as shown in fig2 a . aluminoborosilicate glass , such as e - glass or t - glass , is used as an example of the glass substrate 10 a . t - glass is glass of which component ratios of sio 2 and al 2 o 3 are higher than those of e - glass . after that , first holes h 1 are formed from the upper surface of the glass substrate 10 a so as not to pass through the glass substrate 10 a as shown in fig2 b . the first holes h 1 are formed by laser , a drill , a blast method , etching , or the like . for example , the diameter of an opening end of the first hole h 1 , which is opened to the surface of the glass substrate 10 a , is about 50 ฮผm and the depth of the first hole h 1 is about 100 ฮผm . further , the cross - sectional shape of the first hole h 1 is a tapered shape where the diameter of an upper portion is larger than that of a bottom . after that , as shown in fig2 c , a first wiring layer 20 is formed on the upper surface of the glass substrate 10 a including the first holes h 1 . the first wiring layer 20 is formed so as to fill the first holes h 1 . the first wiring layer 20 is formed by , for example , a semi - additive method . in detail , first , a seed layer ( not shown ) made of copper or the like is formed on the upper surface of the glass substrate 10 a and the inner surfaces of the first holes h 1 by electroless plating or a sputtering method . then , a plating resist ( not shown ), which includes opening portions at a portion where the first wiring layer 20 is disposed , is formed . in addition , a metal plating layer made of copper or the like is formed at the opening portions of the plating resist by electrolytic plating where the seed layer is used as a plating power - supply path . at this time , the first holes h 1 of the glass substrate 10 a are filled with the metal plating layer . after that , after the plating resist is removed , the seed layer is etched while the metal plating layer is used as a mask . accordingly , the seed layer and the metal plating layer form the first wiring layer 20 . subsequently , a first interlayer insulation layer 30 , which covers the first wiring layer 20 , is formed on the glass substrate 10 a as shown in fig3 a . the first interlayer insulation layer 30 is obtained by attaching a resin film , which is made of a thermosetting epoxy resin , a thermosetting polyimide resin or the like , and heating and pressing the resin film with a vacuum press or the like . alternatively , in order to obtain the first interlayer insulation layer 30 , liquid thermosetting resin , such as epoxy or polyimide , may be applied and cured by heating . moreover , first via holes vh 1 reaching the first wiring layer 20 are formed by laser machining that is performed on the first interlayer insulation layer 30 . alternatively , the first interlayer insulation layer 30 may be made of a photosensitive resin and the first via holes vh 1 may be formed by photolithography . after that , as likewise shown in fig3 a , a second wiring layer 22 , which is connected to the first wiring layer 20 through the first via holes vh 1 ( via conductors ), is formed on the first interlayer insulation layer 30 by the same method as the method of forming the first wiring layer 20 . after that , as shown in fig3 b , a second interlayer insulation layer 32 in which second via holes vh 2 reaching the second wiring layer 22 are formed is formed on the first interlayer insulation layer 30 by the same method as the method of forming the first interlayer insulation layer 30 . in addition , as likewise shown in fig3 b , a third wiring layer 24 , which is connected to the second wiring layer 22 through the second via holes vh 2 ( via conductors ), is formed on the second interlayer insulation layer 32 through the repetition of the same machining as described above . subsequently , as shown in fig3 c , a third interlayer insulation layer 34 in which third via holes vh 3 reaching the third wiring layer 24 are formed is formed on the second interlayer insulation layer 32 through the repetition of the same machining as described above . in addition , as likewise shown in fig3 c , a fourth wiring layer 26 , which is connected to the third wiring layer 24 through the third via holes vh 3 ( via conductors ), is formed on the third interlayer insulation layer 34 through the repetition of the same machining as described above . then , a solder resist 36 , where opening portions 36 a are formed on connection portions of the fourth wiring layer 26 , is formed . after that , a contact layer is formed by sequentially forming a nickel plating layer and a gold plating layer on the connection portions of the fourth wiring layer 26 from below as necessary . since the glass substrate 10 a has sufficient rigidity , the glass substrate 10 a functions as a support that prevents warpage in the steps of manufacturing the build - up wiring layers ( the second to fourth wiring layers 22 , 24 , and 26 ). subsequently , as shown in fig4 a , a structure shown in fig3 c is turned over and the thickness of the entire structure is reduced by machining that is performed in the thickness direction on the surface of the glass substrate 10 a opposite to the surface of the glass substrate 10 a on which the first holes h 1 are formed . accordingly , a glass substrate layer 10 of which the thickness is reduced to the range of 100 to 300 ฮผm is obtained . polishing such as cmp , dry etching , wet etching , blasting , or the like may be used as a method of machining the glass substrate 10 a . as described below , in this embodiment , through holes are formed by making the first holes h 1 , which are formed from one surface of the glass substrate layer 10 , communicate with second holes that are formed from the other surface of the glass substrate layer 10 . for this reason , the thickness of the glass substrate 10 a is reduced so that the glass substrate layer 10 remains on the first wiring layer 20 in the first hole h 1 . after that , as shown in fig4 b , second holes h 2 reaching the first wiring layer 20 formed in the first holes h 1 are formed by machining that is performed on portions of the glass substrate layer 10 formed on the first holes h 1 . in an example of fig4 b , the diameter of an opening end of the second hole h 2 , which is opened to the surface of the glass substrate layer 10 , is set to about 50 ฮผm and the depth of the second hole h 2 is set to about 100 ฮผm . in the process shown in fig4 b , after forming the second hole h 2 , an exposed surface of the first wiring layer 20 formed in the first hole h 1 is roughened by laser irradiation . the cross - sectional shape of the second hole h 2 is a tapered shape where the diameter of an upper portion is larger than that of a bottom . in this way , the first and second holes h 1 and h 2 are disposed symmetrically to a middle portion of the glass substrate layer 10 in the thickness direction of the glass substrate layer as the axis of symmetry . subsequently , as shown in fig5 , connection pads p , which are connected to the first wiring layer 20 so as to fill the second holes h 2 , are formed on the upper surface of the glass substrate layer 10 from the inside of the second holes h 2 . the connection pads p may be disposed so as to be isolated in the shape of an island , and may be disposed at end portions of lines that are formed so as to be led from the second holes h 2 to the upper surface of the glass substrate layer 10 . the connection pads p are made of copper or the like , and a contact layer may be formed on the surfaces of the connection pads by sequentially forming a nickel plating layer and a gold plating layer from below as necessary . the connection pads p are formed on the glass substrate layer 10 , of which the surface is smooth , by a semi - additive method that has been described in the step of forming the first wiring layer 20 . for this reason , when the seed layer is etched by a semi - additive method , it is possible to considerably reduce the amount of over - etching as compared to a case where a seed layer is formed on a resin layer having large irregularities . as a result , it is possible to form connection pads p that has a small pitch where the โ line : space โ is โ 10 : 10 ฮผm โ or less . as described above , a wiring substrate 1 according to the first embodiment is obtained . as shown in fig5 , in the wiring substrate 1 according to the first embodiment , the first holes h 1 are formed from the lower surface of the glass substrate layer 10 to the middle portion of the glass substrate layer 10 in the thickness direction and the second holes h 2 are formed from the upper surface of the glass substrate layer 10 to the middle portion of the glass substrate layer 10 in the thickness direction . the cross - sectional shape of the first hole h 1 is an inverted tapered shape where the diameter of a lower portion ( opening end ) is larger than that of an upper portion ( bottom ). further , the cross - sectional shape of the second hole h 2 is a tapered shape where the diameter of an upper portion ( opening end ) is larger than that of a lower portion ( bottom ). the first and second holes h 1 and h 2 communicate with each other at the middle portion of the glass substrate layer 10 in the thickness direction . in this way , the first and second holes h 1 and h 2 are disposed symmetrically to each other in the thickness direction of the glass substrate layer 10 , so that through holes th passing through the glass substrate layer 10 are formed . in addition , the first wiring layer 20 is formed on the lower surface of the glass substrate layer 10 from the first holes h 1 so as to fill the first holes h 1 . further , the connection pads p are formed on the upper surface of the glass substrate layer 10 from the second holes h 2 so as to fill the second holes h 2 . the first wiring layer 20 and the connection pads p form the through electrodes te that pass through the glass substrate layer 10 . as described above , in the first embodiment , the first and second holes h 1 and h 2 are formed from both surfaces of the glass substrate layer 10 , respectively , so that the through holes th are obtained . when through holes having a diameter of 50 ฮผm and a depth of 200 ฮผm are formed from one surface of the glass substrate layer 10 unlike this embodiment , an aspect ratio is large , that is , 4 ( depth / diameter ). accordingly , it is not easy to form the through holes , so that there is a concern about the reduction in production yield . moreover , when the aspect ratio of the through hole is large , voids are formed when the through hole is to be filled with the metal plating layer in the above - mentioned semi - additive method . for this reason , yield is apt to deteriorate . however , in this embodiment , the first and second holes h 1 and h 2 having a diameter of 50 ฮผm are formed from both surfaces of the glass substrate layer 10 with a depth of 100 ฮผm , and the through holes th are formed by making the first and second holes h 1 and h 2 communicate with each other . for this reason , since the aspect ratio ( depth / diameter ) of each of the first and second holes h 1 and h 2 is small , that is , 2 ( depth / diameter ), it is easy to form the through holes . accordingly , it is possible to improve production yield . in addition , even when the first and second holes h 1 and h 2 are to be filled with the metal plating layer , the formation of voids or the like is avoided since the aspect ratio is small . accordingly , it is possible to reliably form the wiring layer or the connection pads . it is preferable that the first and second holes h 1 and h 2 be connected to each other at the middle position of the glass substrate layer 10 in the thickness direction . in this case , the aspect ratios of the first and second holes h 1 and h 2 are reduced . for this reason , since the formation of voids is prevented when the first and second holes h 1 and h 2 are to be filled with the metal plating layer , it is preferable that the first and second holes h 1 and h 2 be connected to each other at the middle position of the glass substrate layer 10 in the thickness direction . however , there is no problem even though the first and second holes h 1 and h 2 are connected to each other while being vertically shifted from the middle position of the glass substrate layer 10 in the thickness direction by a distance corresponding to about ยฑ 20 % of the thickness of the glass substrate layer 10 . further , when the bottom of one hole of the first and second holes h 1 and h 2 and the bottom of the other hole thereof are connected to each other , there is no problem even though the center of the bottom of the other hole is horizontally shifted from the center of the bottom of one hole by a distance corresponding to about ยฑ 20 % of the diameter of one hole . the same applies to the case where a silicon substrate layer is used instead of the glass substrate layer 10 as in a second embodiment to be described below . the first interlayer insulation layer 30 in which the first via holes vh 1 reaching the first wiring layer 20 are formed is formed beneath the first wiring layer 20 that is formed on the lower surface of the glass substrate layer 10 . further , the second wiring layer 22 , which is connected to the first wiring layer 20 through the first via holes vh 1 ( via conductors ), is formed beneath the first interlayer insulation layer 30 . likewise , the second interlayer insulation layer 32 in which the second via holes vh 2 reaching the second wiring layer 22 are formed is formed beneath the second wiring layer 22 . furthermore , the third wiring layer 24 , which is connected to the second wiring layer 22 through the second via holes vh 2 ( via conductors ), is formed beneath the second interlayer insulation layer 32 . likewise , the third interlayer insulation layer 34 in which the third via holes vh 3 reaching the third wiring layer 24 are formed is formed beneath the third wiring layer 24 . moreover , the fourth wiring layer 26 , which is connected to the third wiring layer 24 through the third via holes vh 3 ( via conductors ), is formed beneath the third interlayer insulation layer 34 . in addition , the solder resist 36 , where the opening portions 36 a are formed on the connection portions of the third wiring layer 24 , is formed beneath the third interlayer insulation layer 34 . the connection pads p and the respective wiring layers 20 , 22 , 24 , and 26 include portions that fill the holes h 1 and h 2 or the via holes vh 1 to vh 3 , and wiring pattern portions that are formed on the glass substrate layer 10 or the interlayer insulation layers 30 , 32 , and 34 , respectively . in an example of fig5 , three build - up wiring layers connected to the first wiring layer 20 are laminated beneath the glass substrate layer 10 . however , the number of build - up wiring layers , which are connected to the first wiring layer 20 , may be arbitrarily set to n ( n is an integer of 1 or more ). next , a method of flip - chip connecting a semiconductor chip to the wiring substrate 1 according to this embodiment will be described . as shown in fig6 , solder bumps 42 of a semiconductor chip 40 are disposed on the connection pads p of the wiring substrate 1 of fig5 and are subjected to reflow heating . accordingly , the solder bumps 42 of the semiconductor chip 40 are flip - chip connected to the connection pads p of the wiring substrate 1 . in addition , external connection terminals 28 such as solder balls are formed on the fourth wiring layer 26 . a gap between the semiconductor chip 40 and the wiring substrate 1 may be filled with an underfill resin . as a result , a semiconductor device 5 according to the first embodiment is obtained . in this case , the mounting surface of the wiring substrate 1 on which the semiconductor chip 40 is to be mounted is formed of the glass substrate layer 10 of which the coefficient of thermal expansion is similar to the coefficient of thermal expansion of the semiconductor chip ( silicon ), and the connection pads p are formed on the glass substrate layer 10 . the coefficient of thermal expansion of each of the glass substrate layer 10 and the semiconductor chip 40 is in the range of 3 to 6 ppm /ยฐ c . further , the coefficient of thermal expansion of the glass substrate layer 10 is in the range of about ยฑ 30 % of the coefficient of thermal expansion of the semiconductor chip 40 . for this reason , a problem that the wiring substrate 1 expands or warps more than the semiconductor chip 40 due to the heating performed for the flip - chip connection of the semiconductor chip 40 is solved . accordingly , even if the pitch of the solder bumps 42 of the semiconductor chip 40 is reduced to 100 ฮผm or less , it is possible to accurately dispose the solder bumps 42 of the semiconductor chip 40 on the connection pads p of the wiring substrate 1 . further , as described above , the through holes th of the glass substrate layer 10 are obtained by making the first and second holes h 1 and h 2 , which are formed from both surfaces of the glass substrate layer 10 , communicate with each other . the diameter of the through hole th is set to about 50 ฮผm and the depth of the through hole th is set in the range of about 100 to 300 ฮผm . for this reason , it is possible to make the diameter and length of the through electrode te be smaller than those of the through electrode te ( diameter : 200 ฮผm , length : 400 to 800 ฮผm ) that is formed in the core substrate 120 of the wiring substrate 100 described in the preliminary content . accordingly , since signals are not easily reflected by the through electrodes te on high - frequency signal transmission lines of the wiring substrate 1 the degradation of high - frequency characteristics is prevented . moreover , since the glass substrate layer 10 having high rigidity is used as a substrate , it is possible to prevent the occurrence of warpage of the wiring substrate 1 even though thermal stress is generated in the wiring substrate 1 . further , since it is possible to reduce the thickness of the glass substrate layer 10 , which functions as a substrate , to the range of 100 to 300 ฮผm , it is possible to make the entire wiring substrate 1 be thinner than the wiring substrate 100 of the preliminary content . a wiring substrate 1 a according to a modification of the first embodiment is shown in fig7 . as shown in fig7 , when connection pads are formed in second holes h 2 of a glass substrate layer 10 , concave connection pads px may be formed on the inner surfaces of the second holes h 2 so that the second holes h 2 are not filled and holes remain in the second holes h 2 . the concave connection pads px are made of copper ( cu ) or gold ( au ). in a method of forming the concave connection pads px , first , a thin metal layer made of copper or gold is formed on the upper surface of the glass substrate layer 10 and the inner surfaces of the second holes h 2 by a sputtering method or the like . after that , the metal layer is patterned by photolithography and etching so that the concave connection pads px remain on the inner surfaces of the second holes h 2 . accordingly , the concave connection pads px where the metal layer is formed along the inner surfaces of the second holes h 2 are obtained . alternatively , the concave connection pads px may be formed by a semi - additive method or electroless plating . in the wiring substrate 1 a according to the modification , a first wiring layer 20 and the concave connection pads px form through electrodes te . when the wiring substrate 1 a according to the modification is employed , a semiconductor chip 40 including metal bumps 44 made of copper ( cu ) or gold ( au ) is used . further , as shown in fig8 , the metal bumps 44 of the semiconductor chip 40 are fitted and connected to the concave connection pads px of the wiring substrate 1 a . the metal bumps 44 of the semiconductor chip 40 and the concave connection pads px of the wiring substrate 1 a are electrically connected to each other by copper - copper or gold - gold metal bonding . furthermore , external connection terminals 28 are formed by mounting solder balls on the fourth wiring layer 26 . as a result , a semiconductor device 5 a according to the modification of the first embodiment is obtained . fig9 to 12 are cross - sectional views illustrating a method of manufacturing a wiring substrate according to a second embodiment , and fig1 is a cross - sectional view of the wiring substrate according to the second embodiment . the second embodiment is characterized in that a silicon substrate is used instead of the glass substrate of the first embodiment . the detailed description of the same steps and elements as those of the first embodiment will be omitted in the second embodiment . in the method of manufacturing the wiring substrate according to the second embodiment , a silicon substrate 50 a having a thickness of 0 . 3 to 1 mm is prepared first as shown in fig9 a and first holes h 1 are formed from the upper surface of the silicon substrate 50 a by the same method as the method , which is used in the first embodiment , so as not to pass through the silicon substrate 50 a . then , an insulation layer 52 formed of a silicon oxide layer is formed on both surfaces of the silicon substrate 50 a and the inner surfaces of the first holes h 1 as shown in fig9 b by thermally oxidizing the silicon substrate 50 a . alternatively , a silicon oxide layer or silicon nitride layer may be formed on the surface of the silicon substrate 50 a , on which the first holes h 1 are formed , by a cvd method and may be used as the insulation layer 52 . next , as shown in fig9 c , a first wiring layer 20 is formed on portions of the insulation layer 52 , which include the first holes h 1 of the silicon substrate 50 a , by the same method as the method used in the first embodiment . the first wiring layer 20 is formed so as to fill the first holes h 1 . subsequently , as shown in fig1 a , three build - up wiring layers ( second , third , and fourth wiring layers 22 , 24 , and 26 ) connected to the first wiring layer 20 are formed by performing the same steps as the steps of fig3 a to 3c of the first embodiment . subsequently , as shown in fig1 b , a structure shown in fig1 a is turned over and the thickness of the entire silicon substrate 50 a is reduced by machining that is performed on the insulation layer 52 and the silicon substrate 50 a in the thickness direction . accordingly , a silicon substrate layer 50 of which the thickness is reduced to the range of about 100 to 300 ฮผm is obtained . at this time , as in the first embodiment , the silicon substrate 50 a is subjected to machining so that the silicon substrate layer 50 remains on the first wiring layer 20 . after that , as shown in fig1 a , second holes h 2 reaching the first wiring layer 20 are formed by machining that is performed on portions of the silicon substrate layer 50 and the insulation layer 52 formed on the first holes h 1 . moreover , as shown in fig1 b , an insulation layer 54 is obtained by forming a silicon oxide layer or a silicon nitride layer on the upper surface of the silicon substrate layer 50 and the inner surfaces of the second holes h 2 by a cvd method . next , as shown in fig1 a , a resist 56 in which opening portions 56 a are formed at the portions corresponding to the second holes h 2 is patterned by photolithography . for example , a dry film resist is attached to the insulation layer and exposure and development are performed , so that the resist 56 including the opening portions 56 a is obtained . in addition , the insulation layer 54 , which is formed at the bottoms of the second holes h 2 , is etched and removed by anisotropic dry etching that is performed through the opening portions 56 a of the resist 56 . after that , the resist 56 is removed . as a result , as shown in fig1 b , the insulation layer 54 remains on the upper surface of the silicon substrate layer 50 and the side walls of the second holes h 2 and the first wiring layer 20 is exposed to the bottoms of the second holes h 2 . in this way , the through holes th passing through the silicon substrate layer 50 are obtained from the first and second holes h 1 and h 2 . meanwhile , besides the method of patterning the insulation layer 54 by photolithography and etching , the insulation layer 54 may be formed of a photosensitive insulating resin layer . in this case , a liquid or paste photosensitive insulating resin is applied on the silicon substrate layer 50 of fig1 a . then , the insulating resin applied on the bottoms of the second holes h 2 is removed by exposure and development , and the photosensitive insulating resin is cured by heating . accordingly , likewise , it is possible to form the insulation layer 54 so that the first wiring layer 20 is exposed to the bottoms of the second holes h 2 . a phenol photosensitive resin , a polyimide photosensitive resin , a polybenzoxazole photosensitive resin , and the like may be used as the photosensitive insulating resin . the thickness of the insulation layer 54 depends on the diameter or depth of the second hole h 2 , but is set in the range of , for example , 2 to 50 ฮผm . subsequently , as shown in fig1 , as in the first embodiment , connection pads p electrically connected to the first wiring layer 20 are formed on portions of the insulation layer 54 that include the second holes h 2 of the silicon substrate layer 50 . the connection pads p are formed so as to fill the second holes h 2 . as a result , a wiring substrate 2 according to the second embodiment is obtained . as shown in fig1 , in the wiring substrate 2 according to the second embodiment , the silicon substrate layer 50 is used instead of the glass substrate layer 10 of the wiring substrate 1 according to the first embodiment . further , as in the first embodiment , through holes th are formed by making the first and second holes h 1 and h 2 , which are formed from both surfaces of the silicon substrate layer 50 , communicate with each other . the insulation layers 52 and 54 are formed on both surfaces of the silicon substrate layer 50 and the inner surfaces of the through holes th . furthermore , the first wiring layer 20 is formed on the insulation layer 52 of the lower surface of the silicon substrate layer 50 from the first holes h 1 so as to fill the first holes h 1 . moreover , the connection pads p connected to the first wiring layer 20 are formed on the insulation layer 54 of the upper surface of the silicon substrate layer 50 from the second holes h 2 so as to fill the second holes h 2 . the first wiring layer 20 and the connection pads p form the through electrodes te that pass through the silicon substrate layer 50 . in addition , as in the first embodiment , three build - up wiring layers ( second , third , and fourth wiring layers 22 , 24 , and 26 ) connected to the first wiring layer 20 are formed under the silicon substrate layer 50 . the wiring substrate 2 according to the second embodiment has the same advantages as the advantages of the wiring substrate according to the first embodiment . further , as shown in fig1 , as in the first embodiment , solder bumps 42 of a semiconductor chip 40 are flip - chip connected to the connection pads p of the wiring substrate 2 by reflow heating . furthermore , external connection terminals 28 are formed by mounting solder balls on the fourth wiring layer 26 . as a result , a semiconductor device 6 according to the second embodiment is obtained . in this case , the mounting surface of the wiring substrate 2 on which the semiconductor chip 40 is to be mounted is formed of the silicon substrate layer 50 of which the coefficient of thermal expansion is the same as the coefficient of thermal expansion of the semiconductor chip 40 ( silicon ), and the connection pads p are formed on the silicon substrate layer 50 . the coefficient of thermal expansion of each of the silicon substrate layer 50 and the semiconductor chip 40 is in the range of 3 to 6 ppm /ยฐ c . further , the coefficient of thermal expansion of the silicon substrate layer 50 is in the range of about ยฑ 30 % of the coefficient of thermal expansion of the semiconductor chip 40 . for this reason , a problem that the wiring substrate 2 expands or warps more than the semiconductor chip 40 due to the heating performed for the flip - chip connection of the semiconductor chip 40 is solved . accordingly , even if the pitch of the solder bumps 42 of the semiconductor chip 40 is reduced to 100 ฮผm or less , it is possible to accurately dispose the solder bumps 42 of the semiconductor chip 40 on the connection pads p of the wiring substrate 2 . further , as in the case where the glass substrate layer 10 of the first embodiment is used , it is possible to form the connection pads p having a small pitch by a semi - additive method since the surface of the silicon substrate layer 50 is smoother than the surface of the insulation layer made of a resin . furthermore , since it is possible to make the diameter and length of the through electrode te , which is formed in the silicon substrate layer 50 , be small as in the case where the glass substrate layer 10 of the first embodiment is used , the degradation of high - frequency characteristics is prevented . even in the wiring substrate 2 according to the second embodiment , concave connection pads may be formed on the inner surfaces of the second holes h 2 and the metal bumps of the semiconductor chip may be fitted to the concave connection pads as in the wiring substrate 1 a according to the modification of the first embodiment . fig1 and 16 are cross - sectional views illustrating a method of manufacturing a wiring substrate according to a third embodiment , and fig1 is a cross - sectional view of the wiring substrate according to the third embodiment . in the first and second embodiments , the first and second holes are formed from both surfaces of the glass substrate layer and the silicon substrate layer , and the through holes are formed by making the first and second holes communicate with each other . accordingly , the formation of the holes and filling the holes with the metal plating layer are facilitated by the reduction of the aspect ratio of each of the holes . a case where holes are formed from only one surface of a substrate layer to form through holes for the reduction in cost when through holes formed in a glass substrate layer or a silicon substrate layer have a relatively large diameter will be described in the third embodiment . the detailed description of the same steps and elements as those of the first embodiment will be omitted in the third embodiment . in the method of manufacturing the wiring substrate according to the third embodiment , a glass substrate 10 a is prepared first as shown in fig1 a as in the first embodiment , and holes h are formed from the upper surface of the glass substrate 10 a by machining so as not to pass through the glass substrate 10 a . in the third embodiment , the diameter of each of the through holes , which are finally formed in a glass substrate layer , is about 100 ฮผm and is set to be considerably larger than the diameter ( 50 ฮผm ) of each of the through holes of the glass substrate layer and the silicon substrate layer of the first and second embodiments . the diameter of the through holes means the diameter of an end of through hole that is opened to the surface of the glass substrate 10 a . accordingly , if the diameter of the hole h is set to 100 ฮผm and the depth of the hole h is set to 200 ฮผm , the aspect ratio ( depth / diameter ) of the hole h becomes 2 . accordingly , even though the holes h are formed from only one surface of the glass substrate 10 a , the formation of the holes h is facilitated . the cross - sectional shape of the hole h is set to a tapered shape where the diameter of an upper portion is larger than that of a bottom . after that , as shown in fig1 b , as in the first embodiment , a first wiring layer 20 is formed on portions of the glass substrate 10 a including the holes h so as to fill the holes h . subsequently , as shown in fig1 a , three build - up wiring layers ( second , third , and fourth wiring layers 22 , 24 , and 26 ) connected to the first wiring layer 20 are formed by performing the same steps as the steps of fig3 a to 3c of the first embodiment . after that , as shown in fig1 b , a structure shown in fig1 a is turned over and the glass substrate 10 a is made thin by machining that is performed on the exposed surface of the glass substrate 10 a until the first wiring layer 20 formed at the bottoms of the holes h is exposed to the outside . accordingly , a thin glass substrate layer 10 is obtained and the first wiring layer 20 is exposed to the upper surface of the glass substrate layer 10 . further , the holes h are changed into through holes th passing through the glass substrate layer 10 , and the first wiring layer 20 functions as through electrodes te that fill the through holes th . after that , as shown in fig1 , connection pads p electrically connected to the first wiring layer 20 are formed on the upper surface of the glass substrate layer 10 from the upper portions of the holes h ( first wiring layer 20 ). as a result , a wiring substrate 3 according to the third embodiment is obtained . as described above , in the third embodiment , first , the tapered holes h are formed from one surface of the glass substrate 10 a by laser or the like so as not to pass through the glass substrate 10 a . in addition , after the first wiring layer 20 is formed in the holes h , the glass substrate 10 a is made thin by machining that is performed on the other surface of the glass substrate 10 a until the first wiring layer 20 is exposed to the outside . as a result , the through holes th are obtained . for this reason , in the wiring substrate 3 according to the third embodiment , the inverted tapered through holes th each of which has the diameter of an upper portion smaller than that of a lower portion are formed in the glass substrate layer 10 . the first wiring layer 20 is formed on the lower surface of the glass substrate layer 10 from the inside of the through holes th so as to fill the through holes th . moreover , the connection pads p connected to the first wiring layer 20 are formed on the upper surface of the glass substrate layer 10 . further , as in the first embodiment , three build - up wiring layers ( second , third , and fourth wiring layers 22 , 24 , and 26 ) connected to the first wiring layer 20 are formed under the glass substrate layer 10 . furthermore , as shown in fig1 , as in the first embodiment , solder bumps 42 of a semiconductor chip 40 are flip - chip connected to the connection pads p of the wiring substrate 3 by reflow heating . in addition , external connection terminals 28 are formed by mounting solder balls on the fourth wiring layer 26 . as a result , a semiconductor device 7 according to the third embodiment is obtained . the wiring substrate 3 according to the third embodiment has the same advantages as the advantages of the wiring substrate according to the first embodiment . moreover , the third embodiment is useful when the through holes th having a relatively large diameter are formed in the glass substrate layer 10 . in this case , since the number of steps is smaller than the number of steps of each of the first and second embodiments , it is possible to reduce cost . fig1 is a cross - sectional view of a wiring substrate according to a fourth embodiment . the fourth embodiment is characterized such that a silicon substrate layer is used instead of the glass substrate layer of the third embodiment . the detailed description of the same steps and elements as those of the first embodiment will be omitted in the fourth embodiment . as shown in fig1 , in a wiring substrate 4 according to the fourth embodiment , the glass substrate layer 10 of the wiring substrate 3 according to the third embodiment shown in fig1 is substituted with a silicon substrate layer 50 . further , as in the third embodiment , inverted tapered through holes th , each of which has the diameter of an upper portion smaller than that of a lower portion , are formed in the silicon substrate layer 50 . in the fourth embodiment , insulation layers 52 and 54 are formed on both surfaces of the silicon substrate layer 50 and the inner surfaces of the through holes th . further , opening portions 54 a are formed in the insulation layer 54 on the first wiring layer 20 that are formed in the through holes th . connection pads p are connected to the first wiring layer 20 through the opening portions 54 a of the insulation layer 54 . when the wiring substrate 4 according to the fourth embodiment is manufactured , a silicon substrate is used in the step of the third embodiment shown in fig1 a and holes h are formed . then , the insulation layer 52 is formed on the upper surface of the silicon substrate and the inner surfaces of the holes h by thermal oxidation or a cvd method . moreover , after the step shown in fig1 b , the insulation layer 54 is formed on the upper surface of the silicon substrate layer 50 by a cvd method . the insulation layer 54 may be patterned to form the opening portions 54 a on the first wiring layer 20 . further , as shown in fig2 , as in the first embodiment , solder bumps 42 of a semiconductor chip 40 are flip - chip connected to the connection pads p of the wiring substrate 4 by reflow heating . furthermore , external connection terminals 28 are formed by mounting solder balls on the fourth wiring layer 26 . as a result , a semiconductor device 8 according to the fourth embodiment is obtained . the wiring substrate 4 according to the fourth embodiment has the same advantages as the advantages of the wiring substrate according to the first embodiment . moreover , like the third embodiment , the fourth embodiment is useful when the through holes th having a relatively large diameter are formed in the silicon substrate layer 50 . in this case , since the number of steps is smaller than the number of steps of each of the first and second embodiments , it is possible to reduce cost . while the present invention has been shown and described with reference to certain exemplary embodiments thereof , other implementations are within the scope of the claims . it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . | 7 |
an invention for chemical mechanical polishing ( cmp ) end - point detection systems and methods for implementing such systems are disclosed . in the following description , numerous specific details are set forth in order to provide a thorough understanding of the present invention . it will be understood , however , to one skilled in the art , that the present invention may be practiced without some or all of these specific details . in other instances , well known process operations have not been described in detail in order not to unnecessarily obscure the present invention . fig3 a shows a cmp system 300 including an end - point detection system , in accordance with one embodiment of the present invention . the end - point detection system is designed to include sensors 310 a and 310 b positioned near a location that is proximate to a carrier 308 . as is well known , the carrier 308 is designed to hold a wafer 301 and apply the wafer 301 to the surface of a pad 304 . the pad 304 is designed to move in a pad motion direction 305 around rollers 302 a and 302 b . the pad 304 is generally provided with slurry 306 that assists in the chemical mechanical polishing of the wafer 301 . in this embodiment , the cmp system 300 also includes a conditioning head 316 that is connected to a track 320 . the conditioning head is designed to scrub the surface of the pad 304 either in an in - situ manner or an ex - situ manner . as is well known , the conditioning of the pad 304 is designed to recondition the surface of the pad 304 to improve the performance of the polishing operations . the sensors 310 a and 310 b are designed to be fixed over a location of the pad 304 , while the carrier 308 rotates the wafer 301 over the surface of the pad 304 . accordingly , the sensors 310 a and 310 b will not rotate with the carrier 308 , but will remain at a same approximate location over the platen 322 . the sensors 310 a and 310 b are preferably temperature sensors which sense the temperature of the pad 304 during a cmp operation . the sensed temperature is then provided to sensing signals 309 a and 309 b which are communicated to an end - point signal processor 312 . as shown , the carrier 308 also has a carrier positioner 308 a which is designed to lower and raise the carrier 308 and associated wafer 301 over the pad 304 in the direction 314 . fig3 b shows a top view of a portion of a pad 304 that is moving in the motion direction 305 . as shown , the carrier 308 is lowered by the carrier positioner 308 a onto the pad 304 . the sensors 310 a and 310 b are also lowered toward the pad 304 as shown in fig3 c and 3d . the sensors 310 a and 310 b , as described above , do not rotate with the carrier 308 , but remain at the same relative position over the pad 304 . accordingly , the sensors 310 a and 310 b are designed to be fixed , however , may move in a vertical direction toward the pad 304 and away from the pad 304 synchronously with the carrier 308 . thus , when the carrier 308 is lowered toward the pad 304 , the sensors 310 a and 310 b will also be lowered toward the surface of the pad 304 . in another embodiment , the carrier 308 can move independently from the sensors 310 a and 310 b . in a preferred embodiment of the present invention , the sensors 310 a and 310 b are designed to sense a temperature emanating from the pad 304 . because the wafer , during polishing , is in constant friction with the pad 304 , the pad 304 will change in temperature from the time the pad 304 moves from the fixed position of sensor 310 a and sensor 310 b . typically , the heat is absorbed by the wafer , the pad material , outgoing slurry and process by - products . this therefore produces differences in temperature that can be sensed . thus , the sensed temperature for sensor 3 a will be a temperature โ in โ ( tin ) and the temperature sensed at sensor 310 b will be a temperature โ out โ ( tout ). a temperature differential ( ฮดt ) will then be measured by subtracting tin from tout . the temperature differential is shown as an equation in box 311 of fig3 b . fig3 c illustrates a side view of the carrier 308 applying the wafer 301 to the pad 304 . as shown , the carrier 308 applies the wafer 301 that is held by a retaining ring 308 b against the pad 304 over the platen 322 . as the pad 304 moves in the motion direction 305 , the sensor 310 a will detect a temperature tin that is communicated as a sensing signal 309 a to the end - point signal processor 312 . the sensor 310 b is also configured to receive a temperature tout and provide the sensed temperature over a sensing signal 309 b to the end - point signal to processor 312 . in one embodiment , the sensors 310 are preferably positioned proximately to the pad 304 such that the temperature can be sensed accurately enough and provided to the end - point signal processor 312 . for example , the sensors are preferably adjusted such that they are between about 1 millimeter and about 250 millimeters from the surface of the pad 304 when the carrier 308 is applying the wafer 301 to the surface of the pad 304 . the sensor 310 a shown in fig3 d , in a preferred embodiment , is positioned such that it is about 5 millimeters from the surface of the pad 304 . in th is preferred embodiment , the sensors 310 are prefer ably infrared sensors that are configured to sense the temperature of the pad 304 as the pad moves linearly in the pad motion direction 305 . one exemplary infrared temperature sensor is model no . 39670 - 10 , which is sold by cole parmer instruments , co . of vernon hills , ill . in another embodiment , the sensors 310 need not necessarily be directly adjacent to the carrier 308 . for instance , the sensors can be spaced apart from the carrier 308 at a distance that is between about โ
of an inch and about 5 inches , and most preferably positioned at about ยผ inch from the side of the carrier 308 . preferably , the spacing is configured such that the sensors 310 do not interfere with the rotation of the carrier 308 since the sensors 310 are fixed relatively to the pad while the carrier 308 is configured to rotate the wafer 301 up against the pad surface 304 . fig4 a shows a cross - sectional view of the dielectric layer 102 , the diffusion barrier layer 104 , and the copper layer 106 . the thicknesses of the diffusion barrier layer 104 and the copper layer 106 can vary from wafer - to - wafer and surface zone - to - surface zone throughout a particular wafer being polished . however , during a polishing operation , it will take an approximate amount of time to remove the desired amount of material from over the wafer 301 . for instance , it will take up to about a time t 2 to remove the diffusion barrier layer 104 , up to a time t 1 to remove the copper 104 down to the diffusion barrier layer 104 relative to a time to , which is when the polishing operation begins . for illustration purposes , fig4 b provides a temperature differential versus time plot 400 . the temperature differential versus time plot 400 illustrates a temperature differential change over the pad 304 surface between the sensors 310 a and 310 b . for instance , at a time t 0 , the temperature differential state 402 a will be zero since the polishing operation has not yet begun . once the polishing operation begins on the copper material , the temperature differential 402 b will move up to a temperature differential ฮดt a . this temperature differential is an increase relative to he off position because the temperature of the pad 304 increases as the frictional tresses are received by the application of the wafer 301 to the pad 304 . the temperature differential ฮดt a also increases to a certain level based on the type of material being polished . once the copper layer 106 is removed from over the structure of fig4 a , the cmp operation will continue over the diffusion barrier layer 104 . as the diffusion barrier layer material begins to be polished , the temperature differential will move from 402 b to 402 c . the temperature differential 402 c is shown as ฮดt b . this is an increase in temperature differential due to the fact that the diffusion barrier layer 104 is a harder material than the copper layer 106 . as soon as the diffusion barrier layer 104 is removed from over the dielectric layer 102 , more dielectric material will begin to be polished thus causing another shift in the temperature differential at a time t 2 . at this point , the temperature differential 402 d will be produced at ฮดt c . the shift between ฮดt b and ฮดt c will thus define a target end - point temperature differential change 404 . this target end - point temperature differential change 404 will occur at about a time t 2 . in order to ascertain the appropriate time to stop the polishing operation to ensure that the diffusion barrier layer 104 is adequately removed from over the dielectric layer 102 , an examination of the transition between 402 c and 402 d is preferably made . as shown in fig4 c , the target end - point temperature differential change 404 is shown in magnification wherein tests were made at several points p 1 , p 2 , p 3 , p 4 , p 5 , p 6 , and p 7 . these points span the temperature differential ฮดt b and ฮดt c . as shown , time t 2 actually spans between a time t 2 ( p 1 ), and a time t 2 ( p 7 ). to ensure the best and most accurate end - point , it is necessary to ascertain at what time to stop within time t 2 . the different points p 1 through p 7 are preferably analyzed by polishing several test wafers having the same materials and layer thicknesses . by examining the different layers being polished for different periods of time as well as the thicknesses of the associated layers , it is possible to ascertain a precision time at which to stop the polishing operation . for instance , the polishing operation may be stopped at a point p 5 405 instead of a point p op 407 , which defines an over - polish time . the over - polishing technique is typically used in the prior art when it is uncertain when the diffusion barrier layer or any other layer being polished has , in fact , been removed from over the base layer ( e . g ., dielectric layer ). however , by inspecting the transition between time differential 402 c and time differential 402 d , it is possible to ascertain the proper time to stop the polishing operation ( thus detecting an exact or nearly exact end - point ) within a window that avoids the aforementioned problems of dishing and other over - polishing damage than can occur to sensitive interconnect metallization lines or features . fig5 a illustrates a top view diagram of another embodiment of the present invention in which a plurality of sensors 1 through 10 and a pair of reference sensors r are arrange around and proximate to the carrier 308 . however , it should be understood that any number of pairs of sensors can also be used . in this embodiment , the sensors are divided into five zones over the wafer being polished . as the pad rotates in the direction 305 , temperature differentials are determined between sensors 9 and 10 , 5 and 6 , 1 and 2 , 3 and 4 , and 7 and 8 . each of these temperature differentials ฮดt 1 through ฮดt 5 define zones 1 through 5 , respectively . for each of these zones , there is a determined target temperature differential for ascertaining end - point . by calibrated tests , it may be determined that target temperature differentials or each zone may vary as shown in fig5 b . for instance , zones 1 and 5 may have a target temperature differential of 15 , zones 2 and 4 may have a temperature differential target about 20 , and zone 3 may have a temperature differential of about 35 . by examining the temperature differentials in each of the zones , it is possible to ascertain whether the proper end - point has been reach for the different zones of the wafer being polished in fig5 a . accordingly , the embodiments of fig3 through 4 are equally applicable to the embodiment of fig5 a and 5b . however , by analyzing different zones of the wafer surface , it is possible to ascertain more precise end - point over the different zones of a given wafer . of course , more or less sensors may be implemented depending upon the number of zones desired to be monitored . fig6 illustrates a schematic diagram of the sensors 1 through 10 shown in fig5 a . the sensors 1 through 10 ( e . g ., such as sensors 110 a and 110 b of fig3 are arranged in a position that is proximate to the pad but in a stationary position that does not rotate as does the carrier 308 . by determining the temperature at the different locations over the pad 304 as a polishing operation is in progress , the temperature differentials ฮดt 1 through ฮดt 5 can be ascertained at the different relative locations of the pad 304 . the sensed signals 309 are then communicated to the endpoint signal processor 312 . the end - point signal processor 312 is configured to include a multi - channel digitizing card 462 ( or digitizing circuit ). multi - channel digitizing card 462 is configured to sample each of the signals and provide an appropriate output 463 to a cmp control computer 464 . the cmp control computer 464 can then process the signals received from the multi - channel digitizing card 462 and provide them over a signal 465 to a graphical display 466 . the graphical display 466 may include a graphical user interface ( gui ) that will illustrate pictorially the different zones of the wafer being polished and signify when the appropriate end - point has been reached for each particular zone . if the end - point is being reached for one zone before another zone , it may be possible to apply appropriate back pressure to the wafer or change the polishing pad back pressure in those given locations in which polishing is slow in order to improve the uniformity of the cmp operation and thus enable the reaching of an end - point throughout the wafer in a uniform manner ( i . e ., at about the same time ). as can be appreciated , the end - point monitoring of the present invention has the benefit of allowing more precision cmp operations over a wafer and zeroing on selected regions of the wafer being polished to ascertain whether the desired material has been removed leaving the under surface in a clean , yet unharmed condition . it should also be noted that the monitoring embodiments of the present invention are also configured to be non - destructive to a wafer that may be sensitive to photo - assisted corrosion as described above . additionally , the embodiments of the present invention do not require that a cmp pad be altered by pad slots or the need to drill slots into a platen or a rotary table that is positioned beneath a pad . thus , the monitoring is more of a passive monitoring that does not interfere with the precision polishing of a wafer , yet provides very precise indications of end - point to precisely discontinue polishing . while this invention has been described in terms of several preferred embodiments , it will be appreciated that those skilled in the art upon reading the preceding specification and studying the drawings will realize various alterations , additions , permutations and equivalents thereof . for example , the end - point detection techniques will work for any polishing platform ( e . g . belt , table , rotary , orbital , etc .) and for any size wafer or substrate , such as , 200 mm , 300 mm , and larger , as well as other sizes and shapes . it is therefore intended that the present invention includes all such alterations , additions , permutations , and equivalents that fall within the true spirit and scope of the invention . | 1 |
reference is now made to the drawings wherein like numerals refer to like parts throughout . in fig1 , a child seat cover 10 is preferably fabricated using a one or multi - layer protective cover material 14 of substantially rectangular sheetform configuration . although depicted in fig1 as of woven construction , the present invention is not so limited , and the use of non - woven materials is also contemplated in fabricating the child seat cover 10 . a pair of dorsal slits 18 extend inwardly in a substantially vertical manner from an upper periphery 22 of the cover material 14 , forming a back panel 26 of generally rectangular configuration . in a similar manner a pair of ventral slits 32 extend inwardly from a lower periphery 36 of the cover material 14 , forming a seat panel 42 . the ventral slits 32 are preferably formed on a bias , and in a particularly preferred embodiment , on a substantially 45 - degree bias relative to the lower periphery 36 . while the pair of ventral slits 32 extend inward without intersecting the pair of dorsal slits 18 , the combination of both cooperate to form a first lateral wing panel 46 and a second lateral wing panel 48 within the cover material 14 . in combination , the back panel 26 , the pair of lateral wing panels 46 , 48 , and the seat panel 42 appear to form an angel outline in the cover material 14 , inspiring the trademark for the commercial product : seat angel โข. a plurality of fastening pairs are provided adjacent each of the slits , in fig1 a plurality of pairs of hook and loop fasteners 52 a , 52 b are attached adjacent one - another on opposite sides of both the dorsal slits 18 and the ventral slits 32 . it is to be understood and appreciated that the present invention is not to be interpreted as limited to this one type of paired fasteners . the present child seat cover 10 is intended primarily for use in motor vehicle child seats , and the majority of those offer a 5 - point restraint system . in fig1 a buckle notch 56 is formed at a central location in the seat panel 42 , substantially corresponding to the location of a seatbelt buckle extending through the seat area of child seats utilizing the 5 - point system . the buckle notch 56 permits this centrally - located seatbelt buckle to extend through the cover material 14 . fig2 illustrates a vehicle safety seat 62 that utilizes such a 5 - point harness system . in such systems a common buckle 64 , normally attached to a crotch strap 66 , is used to attach together at a central location a first shoulder strap 68 , a second shoulder strap 72 , a first side strap 74 and a second side strap 76 , which together securely hold the child in proper position within the vehicle safety seat 62 . there are several different manufacturers of vehicle safety seats , some of the more well known might include graco children &# 39 ; s products , inc ., of exton , pa ., dorel juvenile group , inc ., of columbus , ind ., peg - perego , of fort wayne , ind ., and evenflo company , inc ., of piqua , ohio . additionally , most manufacturers have several different models , for example britax child safety , inc ., of charlotte , n . c ., presently offers eleven different seat models , ranging from the companion ยฎ to the vervet โข. the present invention is designed to provide a โ universal fit โ regardless of style and structural peculiarities of these various models . in addition , the present inventive seat cover can be used for three - point harness seats , safety seats anchored to grocery shopping carts , and specialized safety seats for the physically challenged . although the seat structures may vary from model to model and between manufacturers , the vehicle safety seat 62 is believed to be illustrative of the majority of such structures . this โ generic โ seat will be utilized hereinafter to generally illustrate the manner by which child seat cover is securely received by and covers such safety seats . a seat area 82 and a back support surface 84 are located between side wings 86 , forming a protective , padded area for the child . an outer perimeter 88 extends about the vehicle safety seat 62 , separating the seat front from the seat back . in fig3 the child seat cover 10 is shown secured upon the vehicle safety seat 62 ( shown in phantom ); with the cover material 14 extending beyond the outer perimeter 88 thereof ( also see fig4 in this regard ). the first and second lateral wing panels 46 , 48 each extend from a back panel seam of attachment 92 a , 92 b to a seat panel seam of attachment 94 a , 94 b . this manner of attachment permits the various harness belts to extend from the vehicle safety seat 62 yet have the cover material 14 extend over and protect the entire front surface thereof . to assist in this regard , an elastic cord 98 is utilized along the outer seam of the cover material 14 , as is best shown in fig5 . the cover material 14 is also shown as consisting of a three - ply construction , a top layer 104 that may consist of a twill or decorative fabric , a middle layer 106 of armofleece , which adds body and structure without making it stiff , and an inner layer 108 of a polyester material . as mentioned previously , the cover material 14 can consist of multiple layers , including a material providing flame retardant properties , or a single layer without departing from the scope of the present invention . the cover material 14 can also consist of a disposable construction , permitting a user to discard instead of washing when the child seat cover 10 becomes soiled . additionally , although the elastic cord 98 is utilized in a presently preferred embodiment , a drawstring or similar structure can also be used , permitting the periphery of the cover material 14 to be drawn around the outer perimeter 88 helping to secure the child seat cover 10 to the vehicle safety seat 62 . the manner of installing the child seat cover 10 after securely anchoring the vehicle safety seat 62 is depicted in sequential fig6 - 9 . in fig6 the child seat cover 10 is placed over / on top of the vehicle safety seat 62 with the back panel placed over the headrest part of the vehicle safety seat 62 . the common buckle 64 and attached crotch strap 66 are pulled up and through the buckle notch 56 . turning now to fig7 , the first lateral wing panel 46 is next placed under and through the first shoulder strap 68 . the first lateral wing panel 46 is then stretched in the direction of arrow a to overlap and engage with the back panel 26 , utilizing the hook and loop fasteners 52 a , 52 b , forming the back panel seam of attachment 92 a ( see fig8 and 9 ). in a similar manner , the first lateral wing panel 46 is stretched in the direction of arrow b to overlap and engage with the seat panel 42 , forming the seat panel seam of attachment 94 a ( fig8 and 9 ). in fig8 the second lateral wing panel 48 is being drawn under and through the second shoulder strap 72 , with a portion drawn up in the direction of arrow c to overlap and engage with the back panel 26 , forming the second back panel seam of attachment 92 b . another portion of the second lateral wing panel 48 is drawn in the direction of arrow d , to a location of overlap and engagement with the seat panel 42 , forming the second seat panel seam of attachment 94 b . the seat panel 42 is then smoothed to complete its positioning within the seat area 82 . the elastic periphery of the cover material 14 is drawn around the outer perimeter 88 of the vehicle safety seat 62 , completing the installation of the child seat cover 10 . removal of the child seat cover 10 is substantially the reverse of the preceding steps . the child seat cover 10 of the present invention is preferably fabricated out of the three separate materials : the top layer 104 consisting of a twill or decorative fabric ; the middle layer 106 of armofleece ; and the inner layer 108 , a polyester . each of the above materials is cut from a respective supply roll of fabric to measure 1ยฝ yards ( 56 inches ) by 1ยผ yards ( 45 inches ). the plies of fabric are placed in the following order as the cover is sewn โ inside out โ: armofleece ; inner layer ; and top layer . the left , top , and right sides are sewn together at 1 inch and 2 inches from the edge of the plies , creating a chamber within the layers to receive the elastic cord or drawstring . the fabric is then repositioned , inside in , with fabric now in the appropriate order . the dorsal and ventral slits are now cut into the 3 plies , with a hem sewn 1ยฝ inches from the edge of the slits . the hook and loop fasteners are now attached , preferably the loop pieces to the top , cotton layer and the hook pieces to the inner , polyester layer , adjacent to the slits to form the fastening pairs . an imaginary crease of the seat is approximately located 22 inches from the bottom edge of the fabric plies , and a 3ยผ inch long buckle notch is cut through all layers approximately 14ยฝ inches from the bottom edge of the fabric . a reinforcing seam is stitched around the buckle notch . the elastic cords or drawstrings are then placed within each chamber and sewn in , after first ensuring that the fabric is sufficiently โ bunched โ to secure the cover when received by the vehicle safety seat . my invention has been disclosed in terms of a preferred embodiment thereof , which provides a child seat cover that is of great novelty and utility . various changes , modifications , and alterations in the teachings of the present invention may be contemplated by those skilled in the art without departing from the intended spirit and scope thereof . it is intended that the present invention encompass such changes and modifications . | 1 |
hereinbelow , the embodiments in accordance with the present invention will be described based on the drawings . [ 0063 ] fig1 a and 1b show one embodiment of a resonant element 1 in accordance with the present invention , together with a vibration adjustment system for characterizing the resonant element . in the descriptions of this embodiment , the same components as the above described examples of previous resonant elements are identified by the same reference numerals , and repeated explanations of the common components are omitted . the resonant element 1 shown in fig1 a and 1b can be used as an acceleration sensor , angular velocity sensor , pressure sensor , filter , or the like . the resonant element 1 has substantially the same construction as the proposed resonant element shown in fig6 but this embodiment is characterized in that a detecting electrode 40 which is an excitation deflection detecting means is disposed on the top surface 2 a of the fixed substrate 2 so as to be opposed to and spaced from the vibrator 5 . since the vibrator 5 is formed of polysilicon and has electric conductivity , it is possible , by forming the above - mentioned detecting electrode 40 , to detect , by the detecting electrode 40 , variation in the spacing between the top surface 2 a of the fixed substrate 2 and the vibrator 5 , that is , the vibration ( deflection ) of the vibrator 5 in the z - direction , as a variation in the electrostatic capacity , when the resonant element 1 is used as an angular velocity sensor , for example , the detecting electrode 40 similar to the above - described one , is formed on the top surface 2 a of the fixed substrate 2 as z - direction vibration detecting means , in order to detect the vibration amplitude of the vibrator 5 in the z - direction due to a coriolis force . in such a case , the z - direction vibration detecting means ( detecting electrode 40 ) also serves as excitation deflection detecting means . the characteristic vibration adjusting system in this embodiment shown in fig1 is arranged to perform a vibration adjustment with respect to the resonant element 1 having the above - described excitation deflection detecting means ( detecting electrode 40 ), and comprises a first dc voltage applying means 41 , a second dc voltage applying means 42 , capacity - voltage converting means 43 , an amplifier 44 , and driving means 45 . the first and second dc voltage applying means 41 and 42 are conductively connected to conductive layers 20 and 21 , respectively , and have a capability of applying dc voltages to the respective conductive layers 20 and 21 and of changing the magnitude of the dc voltages to be applied . the capacity - voltage converting means 43 comprises fet 46 and a source resistor 47 . as shown in fig1 the gate - side of the fet 46 is conductively connected to the detecting electrode 40 , one end side of the source resistor 47 is connected to the source - side of the fet 46 , and the other end side of the source resistor 47 is grounded . in the capacity - voltage converting means 43 , the voltage corresponding to the electrostatic capacity between the vibrator 5 and the detecting electrode 40 occurs at the connection point p between the source - side of the fet 46 and the source resistor 47 . in other words , the capacity - voltage converting means 43 converts the electrostatic capacity between the vibrator 5 and the detecting electrode 40 into a voltage and outputs the voltage from connection point p . the amplifier 44 is connected to the connection point p and amplifies and outputs the voltage corresponding to the electrostatic capacity between the vibrator 5 and the detecting electrode 40 . in the vibration adjusting system in this illustrated embodiment , since the capacity - voltage converting means 43 converts the electrostatic capacity detected by the detecting electrode 40 into a voltage , the vibration ( deflection ) of vibrator 5 in the z - direction can be detected as a voltage variation . the driving means 45 comprises an ac power source 48 and a phase inversion portion 49 . one of the fixed - side comb electrodes 11 a and 11 b of the resonant element 1 is conductively connected to the ac power source 48 directly , and the other is conductively connected to the ac power source 48 via the phase inversion portion 49 . by this driving means 45 , ac voltages which are different in phase from each other by 180 ยฐ are applied respectively to the fixed - side comb electrodes 11 a and 11 b of the resonant element 1 , and thereby the vibrator 5 can be subjected to an excitation in the x - direction . a vibration adjusting method for the resonant element 1 may include , for example , conductively connecting an oscilloscope ( not shown ) to the output - side of the amplifier 44 and then subjecting the vibrator 5 to an excitation vibration in the x - direction , while viewing the waveform of the voltage output by the amplifier 44 is viewed on the screen of the oscilloscope . in some cases , even though no angular velocity around the y - axis is applied during the excitation vibration of the vibrator 5 , a voltage waveform as indicated by a solid line a in fig2 is viewed with the oscilloscope , the voltage waveform varying in response to the excitation vibration of the vibrator 5 in the x - direction . in such a case , since deflection in the z - direction arises during the excitation vibration of the vibrator 5 , a vibration adjustment for the vibrator 5 is performed . for example , while viewing the voltage waveforms shown up on the screen of the oscilloscope , the dc voltages to be each applied to the conductive layers 20 and 21 are varied by controlling the first dc voltage applying means 41 or the second dc voltage applying means 42 . the applied voltages for the conductive layers 20 and 21 at the time when the voltage waveform on the screen of the oscilloscope becomes a waveform wherein substantially no vibration amplitude can be seen and wherein the voltage converges into a given voltage , as indicated by the dotted line b in fig2 i . e ., at the time when the variation in the detected electrostatic capacity by the detecting electrode 40 disappears , or is substantially removed , is detected as the voltage optimum for the vibration adjustment for the vibrator 5 . for example , when a voltage waveform indicated by the solid line a in fig2 is viewed on the screen of the oscilloscope , for example , in the state wherein the conductive layer 20 of the resonant element 1 is maintained at a given voltage ( 0 volt for example ), the applied voltage for the conductive layer 21 is varied by variably controlling the second voltage applying means 42 while viewing the voltage waveform on the screen of the oscilloscope . the voltage at the time when the voltage waveform on the screen of the oscilloscope converges into a waveform wherein substantially no vibration amplitude can be seen , as indicated by the dotted line b in fig2 is detected as the optimum voltage for the conductive layer 21 . this detected optimum voltage for the conductive layer 21 , and the fixed voltage ( 0 volt for example ) of the above - described conductive layer 20 are detected as the voltages optimum for the vibrator 5 . conversely , of course , the applied voltage for the conductive layer 20 may be varied in the state wherein the conductive layer 21 is maintained at a given voltage ( 0 volt for example ), and the voltage at the time when the voltage waveform on the screen of the oscilloscope converges into a vibration amplitude wherein substantially no vibration amplitude can be seen , as indicated by the dotted line b in fig2 may be detected as the optimum voltage for the conductive layer 20 , whereby the voltage optimum for the vibration adjustment for the vibrator 5 is detected . or , the voltage optimum for the vibration adjustment for the vibrator 5 may be detected by individually varying the applied voltages for the conductive layers 20 and 21 and thereby obtaining the optimum voltages to the conductive layers 20 and 21 . as described above , by performing the vibration adjustment for the vibrator 5 through controlling the applied voltage to the conductive layers 20 and 21 , the vibrator 5 can be caused to be subjected to an ideal excitation vibration substantially without deflection in the z - direction . the above - described effect has been verified in experiments by the present inventor . in these experiments , the present inventor has built the resonant element 1 having a characteristic construction in this embodiment into the vibration adjusting system shown in fig1 and in the state wherein the conductive layer 20 is fixed at a given voltage ( 0 volt for example ), the inventor has investigated as to how the voltage waveform output by the connection point p of the above - described capacity - voltage converting means varies as the applied voltage v 21 to the above - described conductive layer 21 is varied . [ 0080 ] fig3 is a graph illustrating the experimental results . in fig3 the horizontal axis designates the applied voltage to the conductive layer 21 , and the vertical axis designates the amplitude of the voltage waveform output by the connecting point p of the capacity - voltage converting means 43 . in the above - described experiments , the detecting electrode 40 has dimensions of 0 . 5 ร 0 . 5 mm , and the interval between the detecting electrode 40 and the vibrator 5 is 2 mm . the vibrator 5 is caused to be subjected to an excitation vibration in the x - direction under the frequency of 7 . 623 khz . as shown in fig3 as the applied voltage v 21 to the above - described conductive layer 21 is varied , the amplitude of the voltage waveform output by the connection point p of the capacity - voltage converting means 43 varies , and the amplitude of the voltage waveform at the connection point p is minimized at the point q ( at this point , the applied voltage v 21 is 9 . 34 v ). in accordance with the investigated movement of the vibrator 5 in the x - z plane , the vibrator 5 exhibited loci as shown in fig8 b . that is , as illustrated in fig1 c , the vibrator 5 was being subjected to an excitation vibration horizontally in the x - direction along the plane of the fixed substrate in the x - y plane direction , and substantially without deflection in the z - direction . as shown in these experimental results , by performing the vibration adjustment for the vibrator 5 so that the variation in the detected electrostatic capacity by the detecting electrode 40 is canceled , the vibrator 5 can be caused to be subjected to an excitation in the x - direction . [ 0083 ] fig4 shows one example of a main circuit configuration of the sensor device 50 into which a resonant element 1 as an angular velocity sensor has been built . in the sensor device 50 , the vibrator 5 is caused to be subjected to an excitation vibration in the x - direction by applying ac voltages which are different in the phase from each other by 180 ยฐ to the fixed - side comb electrodes 11 a and 11 b , respectively , of the resonant element 1 by driving means 45 . at the same time , a coriolis force is applied to the vibrator 5 due to the angular velocity around the y - axis . variation in the electrostatic capacity with respect to the vibrator 5 resulting from vibration of the vibrator 5 in the z - direction is output by the detecting electrode 40 , and the electrostatic capacity is converted into a voltage by the capacity - voltage converter 43 . the voltage after the conversion is amplified by the amplifier 44 , and is applied to a phase detection portion 53 via a bpf ( band - pass filter ) 51 and a phase shifter 52 . the phase detection portion 53 takes in the ac voltage output by an ac power source 48 as a reference signal , and performs a phase detection with respect to the voltage applied by the phase shifter portion 52 utilizing the reference signal . the signal obtained by this phase detection is output as a detecting signal for angular velocity around the y - axis via a lpf ( low - pass filter ) and the amplifier 55 . as shown in fig4 the angular velocity sensor 50 has the first and second ac voltage applying means 41 and 42 , the capacity - voltage converting means 43 , the amplifier 44 , and the driving means 50 which constitute the vibration adjusting system shown in fig1 . therefore , when performing a vibration adjustment for the resonant element 1 as an angular velocity sensor , it is possible , after building the resonant element 1 into the sensor device 50 , to utilize , for vibration adjustment , the above - described first and second ac voltage applying means 41 and 42 , the capacity - voltage converting means 43 , the amplifier 44 , and the driving means 50 to perform a vibration adjustment for the resonant element 1 . in accordance with this embodiment , since the resonant element 1 is constituted so as to have a detecting electrode 40 , and to detect the deflection of the vibrator 5 in the z - direction by this detecting electrode utilizing the variation in the electrostatic capacity , the vibration adjustment can be performed by the simple vibration adjusting system shown in fig1 without the need to use a large - scale vibration measuring system , such as the system shown in fig7 . since the vibration adjustment for the vibrator 5 can be easily performed , the time required for the vibration adjustment for the vibrator 5 can be reduced , and the adjustment cost can be reduced . also , since this embodiment is constituted so that the deflection of the vibrator 5 in the z - direction is detected utilizing the variation of the electrostatic capacity , the deflection of the vibrator 5 in the z - direction can be detected with a much higher accuracy than the case where the deflection of the vibrator 5 in the z - direction is detected utilizing laser rays as described above . this results in an improvement in the accuracy of the vibration adjustment for the vibrator 5 . furthermore , in addition to having a simple construction , the characteristic vibration adjusting system in this embodiment has features , as described above , such as to detect the deflection of the vibrator 5 in the z - direction utilizing the variation in the electrostatic capacity , to convert the electrostatic capacity into a voltage , and to detect the variation in the electrostatic capacity based on the variation in the voltage . therefore , the automation of the vibration adjustment wherein the optimum value of the applied voltages for the above - described conductive layers 20 and 21 are obtained utilizing the variation in the voltage in response to the deflection of the vibrator 5 in the z - direction , can be easily achieved . moreover , in the case of an angular velocity sensor , since there is provided z - direction vibration detecting means ( detecting electrode 40 ) for detecting the vibration of the vibrator 5 in the z - direction due to a coriolis force , the z - direction vibration detecting means can be caused to do double duty as excitation deflection detecting means for vibration adjustment . thereby , the vibration adjustment can be performed easily and with a high accuracy as describe above without the need to change the design . in addition , since the units constituting the vibration adjusting system shown in fig1 are incorporated in the sensor device 50 into which the resonant element 1 as an angular velocity sensor is to be built , the vibration adjustment of the angular velocity sensor can be performed in the state wherein the angular velocity sensor has been built into the sensor device 50 . this make it possible to prevent the occurrence of the problem that , even though vibration adjustment has been performed , the stresses within the support beams 7 of the vibrator 5 change when the resonant element 1 is built into the sensor device 50 , and the optimum applied voltages to the conductive layers 20 and 21 change with the result that the vibrator 5 of the angular velocity sensor cannot be appropriately caused to be subjected to an excitation vibration without deflection in the z - direction . the present invention is not limited to the above - described embodiment , but various embodiments may be adopted . for example , in the above - described embodiment , the detecting electrode 40 is disposed on the fixed substrate 2 , but , for example , when there is a cover member covering the upper side of the vibrator 5 with an interval interposed , the detecting electrode 40 may be disposed at the area opposed to the vibrator 5 on the cover member . or , the detecting electrodes 40 may be provided on both of the fixed substrate 2 and the cover member . the same goes for the conductive layers 20 and 21 . that is , the conductive layers 20 and 21 may be provided not only on the fixed substrate 2 , but also on the above - mentioned cover member , or may be provided on both of the fixed substrate 2 and the cover member . also , the detecting electrode 40 is disposed so as to be opposed to the central area of the vibrator 5 with a gap interposed . however , the detecting electrodes 40 may be , for example , disposed so as to be opposed to both edge areas of the vibrator 5 with a gap in the x - direction therebetween . also , the configuration of the resonant element 1 is not limited to that of the embodiment illustrated . the present invention can be applied to resonant elements 1 having various configurations . for example , the present invention can be applied to the resonant element 1 as shown in fig5 a and 5b . in fig5 a and 5b , a cavity ( depression ) 57 is formed in the top surface 2 a which is a plane in the x - y plane direction of the fixed substrate 2 which is made of glass . the bottom surface 57 a ofthis cavity 57 , like the top surface 2 a , forms a plane in the x - y plane and a planar vibrating body 6 is disposed so as to be opposed to the bottom surface 57 a with a gap interposed in the z - direction . the planar vibrating body 6 shown in fig5 a and 5b is a combined body wherein a weight 9 is connected to the inside of a frame body 60 by four connection beams ( detecting beams ) 61 . the weight 9 has a square shape , and each of the connection beams has a l - letter shape . the tips of the shorter sides 62 of the l - letter shaped connection beams 61 each communicates with and are connected to the four corners of the weight 9 . the longer sides 63 of the l - shaped connection beams 61 are each extended from the shorter sides 62 along the sides of the frame body 60 via a gap , and the tips of the extension portions thereof each communicates with and are connected to the comers of the frame body 60 . a plurality of fixing portions 8 ( four fixing portions in the figure ) is each fixedly disposed on the fixed substrate 2 with gaps therebetween so as to surround the planar vibrating body 6 , and the planar vibrating body 6 is fixedly supported by hooked - claw shaped support beams ( driving beams ) 7 so as to be vibratable in the x - direction . on both right and left sides ( as viewed in fig5 a ) of the planar vibrating body 6 , movable - side comb electrodes 10 ( 10 a and 10 b ) are formed outwardly in the x - direction , and fixed - side comb electrodes 11 ( 11 a and 11 b ) are each extended from the fixing portion 64 so as to be interdigitated with the above - mentioned movable - side comb electrodes 10 with a gap interposed . these movable - side comb electrodes 10 and fixed - side comb electrodes 11 make up exciting means . the resonant element 1 of fig5 a and 5b , similarly to the embodiment shown in fig1 is provided with conductive layers 20 and 21 , and detecting electrode 40 which is excitation deflection detecting means for detecting the deflection of the weight 9 ( planar vibrating body 6 ) in the z - direction . by performing vibration adjustment in the same manner as vibration adjustment is performed for the embodiment of fig1 the weight 9 ( planar vibrating body 6 ) can be caused to be subjected to an ideal excitation vibration . as explained above , in accordance with the present invention , since the resonant element 1 is provided with excitation deflection inhibiting means , as well as the resonant with excitation deflection detecting means , the deflection of the vibrating body in the z - direction during the excitation vibration thereof in the x - direction can be detected , and the deflection of the vibrating body in the z - direction can be inhibited by the above - described excitation deflection inhibiting means , without the need for large - scale equipment for measuring the vibrating conditions of the vibrating body . thereby , the vibrating body can be caused to be subjected to an ideal excitation vibration in the x - direction without deflection in the z - direction , and hence it is easy to improve characteristics of the resonant element . in the resonant element constituting an angular velocity sensor , since it is possible to make the z - direction vibration detecting means do double - duty as excitation vibration deflection detecting means , a resonant element having superior characteristics can be provided without a large change in design . in the excitation vibration deflection detecting means constituted of detecting means for the variation in the electrostatic capacity with respect to the vibrating body in response to the vibration thereof in the z - direction , since the deflection of the vibrating body in the z - direction can be detected with a high accuracy by a very simple construction , it is possible to inhibit more surely the deflection of the vibrating body in the z - direction during the excitation vibration thereof in the x - direction , which provides a resonant element having more excellent characteristics . the invention is applicable to a vibrating body which is a planar vibrating body disposed so as to be opposed to the plane in the x - y plane direction and supported by a fixed substrate so as to be vibratable in the x - direction . more specifically , since the deflection of the vibrating body in the z - direction during the excitation vibration thereof in the x - direction has a significant adverse effect on characteristics of the resonant element , it is very effective to provide the above - described constructions characterizing the present invention . in accordance with the present invention , it is possible to perform a vibration adjustment for the vibrating body without the need for large - scale equipment , thereby reducing adjustment cost . further , in accordance with the present invention , it is possible to further increase the accuracy of vibration adjustment for the vibrating body , and to easily perform a vibration adjustment for the vibrating body , which leads to a reduction in the time required for the vibration adjustment for the vibrating body . in the resonant element in accordance with the present invention wherein the resonant element constitutes an angular velocity sensor , and wherein the z - direction vibration detecting means and the capacity - voltage converting means incorporated in the sensor device into which the angular velocity is to be built , also serve a function of vibration adjustment , since the vibration adjustment for the vibrator can be performed in the state wherein the vibrator has been built in the sensor device , it is possible to prevent the occurrence of the problem that the deflecting state of the vibrating body in the z - direction after assembly becomes different from that at the time of vibration adjustment , and that the deflection of the vibrating body in the z - direction during the excitation vibration thereof in the x - direction occurs despite the performed vibration adjustment . while preferred embodiments of the invention have been disclosed , various modes of carrying out the principles disclosed herein are contemplated as being within the scope of the following claims . therefore , it is understood that the scope of the invention is not to be limited except as otherwise set forth in the claims . | 6 |
referring to the drawing , the reference numeral 10 refers in general to a fluidized bed combuster of the present invention consisting of a front wall 12 , a rear wall 14 , and two sidewalls , one of which is shown by the reference numeral 16 . the upper portion of the combustor 10 is not shown for the convenience of presentation , it being understood that it consists of a convection section , a roof and an outlet for allowing the combustion gases to discharge , in a conventional manner . a bed of particulate material , shown in general by the reference numeral 18 , is disposed within the combustor 10 and rests on a perforated grate 20 extending horizontally in the lower portion of the boiler . the bed 18 can consist of a mixture of discrete particles of inert material and fuel material such as bituminous coal . an air plenum chamber 22 is provided immediately below the grate 20 and an air inlet 24 is provided through the rear wall 14 in communication with the chamber 22 for distributing air from an external source ( not shown ) to the chamber . a pair of air dampers 26 are provided in the inlet 24 for controlling the flow of air into the chamber 22 . the dampers 26 are suitably mounted in the inlet 24 for pivotal movement about their centers in response to actuation of external controls ( not shown ) to vary the effective openings in the inlet and thus control the flow of air through the inlet and into the chamber 22 . since the dampers 26 are of a conventional design they will not be described in any further detail . a bed light - off burner 28 is mounted through the front wall 12 immediately above the grate 20 for initially lighting off the bed 18 during startup and a bed tap , or drain pipe 29 extends from a corresponding opening formed in the grate 20 to a position below the chamber 22 for discharging the spent materials from the bed 18 . a separator , shown in general by the reference numeral 30 , is located externally of the boiler 10 and is adapted to receive particulate fuel material , such as coal , of a relative large particle size range from an external source ( not shown ), such as coal crusher , via a duct 32 . the separator 30 adapted to separate the fuel material in a conventional manner , such as by the use of a screen or screens , into relatively coarse and relatively fine particles . the relatively coarse particles are passed from the separator 30 via a duct 34 and the relatively fine particles are passed from the separator via a duct 36 . as an example , the separator 30 can be adapted to separate particles greater than 1 / 16 of an inch in diameter from those less than 1 / 16 of an inch and pass the former to the duct 34 and the latter to the duct 36 . an agglomerator , shown in general by the reference numeral 38 , receives the fine particles from the duct 36 and is designed to agglomerate the particles into coarser particles by any conventional technique . for example , if the particles contain any moisture , they can be agglomerated by pelletizing in a disc pelletizer , such as the series 7000 pellet mill manufactured by the california pellet mill co . alternatively , if the fine particles are relatively dry they can be agglomerated on a roll briquetter or an extruder of a conventional type . a duct 39 connects the output of the agglomerator 38 to a distributor , shown in general by the reference numeral 40 , which also receives the coarse particles from the duct 34 . the distributor 40 is mounted relative to the upper portion of the front wall 12 and operates to distribute the mixture of course particles from the duct 34 and the agglomerated particles from the duct 39 onto selected areas across the upper surface of the bed 18 . the distributor 40 includes an inlet pipe 42 for receiving the coarse coal particles from the duct 34 and the agglomerated material from the duct 39 where they are mixed and fed , by gravity , onto a distributor tray 44 which extends immediately below the outlet end of the pipe 42 and into the interior of the combustor 10 . the tray 44 is pivotally mounted relative to an actuating lever 46 for controlling the angular position of the tray relative to the upper surface of the bed as shown , for example , by the one position represented by the solid lines and the two positions represented by the dashed lines . a control unit for the lever 46 is shown in general by the reference numeral 48 and operates in a conventional manner to control the pivotal movement of the tray 44 . the distributor 40 also includes an air distributor unit , shown in general by the reference numeral 50 , for distributing pressurized air at a selected rate through a plurality of vanes , one of which is shown by the reference numeral 52 , located immediately above the tray 44 , to inject the air across the coal particles on the tray . as a result , the coal particles are distributed to selected areas extending across the upper surface of the bed 18 which are determined by the position of the tray 44 under the control of the lever 46 and the unit 48 . for example , in the uppermost position of the free end of the tray 44 as viewed in the drawing , the particles falling onto the tray from the pipe 42 would be propelled by the air from the unit 50 towards the rear wall 14 , and would fall onto the rear portion ( i . e ., the right hand portion as viewed in the drawings ) of the upper surface of the bed 18 . similarly , in the lowermost position of the tray 44 as shown in the drawings , the particles would be distributed onto the front portion ( i . e ., the left hand portion as viewed in the drawing ) of the upper surface of the bed 18 . since the tray 44 can be pivoted to an infinite number of angular positions relative to the upper surface of the bed 18 under control of the lever 46 and the control unit 48 , it can be appreciated that an accurate control of the precise location of the particulate feed across the upper surface of the bed can be achieved . in operation , the bed 18 is started up by opening the dampers 26 associated with the air inlet 24 to distribute air upwardly through the compartment 22 , through the perforations in the grate 20 and into the bed 18 . this loosens the particulate material in the bed 18 and reduces material packing and bridging . the separator 30 and the agglomerator 38 are activated , and operate as discussed above , to feed coarse and agglomerated particulate fuel material , via the ducts 34 and 39 , respectively , to the inlet pipe 42 . the light - off burner 28 is then fired to heat the material in the bed 18 until the temperature of the material reaches a predetermined level , at which time the distributor 40 is activated to distribute the mixture of coarse and agglomerated particulate fuel from the inlet pipe 42 onto selected areas extending across the upper surface of the bed 18 as determined by the position of the tray 44 , to insure a uniform distribution across the upper surface . after the bed 18 has been fluidized and has reached a predetermined elevated temperature , the light - off burner 28 is turned off while the distributor 40 continues to distribute the particulate fuel across the upper surface of the bed 18 in accordance with predetermined feed rates . it is understood that if the combustor is used for the purpose of steam generation , a pluraity of heat exchange tubes carrying the fluid to be heated , such as water , may be routed through the interior of the combustor in a conventional manner , with these tubes being omitted in the drawing for the convenience of presentation . in the event that the combustor is used for other purposes , such as gasification , or the like , the water walls and tubes may be omitted and conventional refractory construction used to contain the fluid bed can be added . a latitude of modification , change and substitution is intended in the foregoing disclosure and in some instances some features of the invention will be employed without a corresponding use of other features . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the spirit and scope of the invention herein . | 5 |
reference is first made to fig1 of the drawings , which illustrates an sst in accordance with one embodiment of the present invention in the form of an atm 10 . in this example , the atm 10 includes many of the features of a conventional atm , namely an interface means in the form of a user panel 12 including a card reader slot 14 ( which is shown having means for identifying the user in the form of an identification card 15 partially inserted therein ), a key pad 16 for entering the user &# 39 ; s personal identification number ( pin ) and transaction details , a cash dispenser slot 18 through which bank notes are dispensed to a user , a display screen 20 for providing information to the user , additional keys 21 disposed at opposite sides of the screen 20 for enabling the user to select preset functions displayed on the screen 20 and aligned with the additional keys 21 , and a receipt printer slot 22 through which a receipt for a transaction may be delivered to a user at the end of a transaction . in addition , the atm 10 of the present invention includes a loudspeaker 30 and a microphone 32 , which allow the atm 10 and the user to communicate primarily or solely using natural speech , as described below . reference is now also made to fig2 of the drawings , which is a block diagram of the atm 10 of fig1 . fig2 shows a user interface module block 40 including the loudspeaker 30 , a speech generation module 31 , the microphone 32 and a speech processing and recognition module 33 . the block 40 also includes the other elements found in a conventional atm user interface , that is a card reader module 42 , the key pad 16 , the display 20 , and a receipt printer module 44 . the card reader module 42 and the receipt printer module 44 are associated with the respective slots 14 and 22 of the user panel 12 of the atm 10 . fig2 also shows a cash dispenser module 46 which is associated with the cash dispenser slot 18 . the atm 10 further comprises processor means in the form of a controller unit 50 which communicates with components of the user interface module block 40 , with an operator panel 52 mounted inside of the atm 10 , and with the cash dispenser module 46 . the operator panel 52 contains circuitry for enabling an authorized operator to interact with the atm 10 . standard operator panels 52 are used on a commercially available atms and are well known in the art . similarly , the cash dispenser module 46 will not be described herein as it is a standard feature of a conventional atm . the controller unit 50 includes a processor unit 54 and a non - volatile memory 56 . the processor unit 54 and memory 56 may be implemented by a micro - computer having non - volatile ram ; suitable computers and memories are readily available commercially . in use , the user inserts their card 15 into the card reader slot , and identification data encoded on the card ( typically in a magnetic strip located on one side of the card ) is read by the card reader module 42 . by doing this the user is claiming an identity . for using this example of an atm 10 , the user will have previously identified a preference for the manner in which the user communicates with atms 10 : in the conventional manner via the screen display 20 and the keypad 16 and keys 21 ; or , where available , by natural speech via the loudspeaker 30 and microphone 32 . in the latter case , the user is requested , by appropriate actuation of the speech generation module 31 and loudspeaker 30 , to state their identification number ( pin ) or a code word to verify the claimed identity , that is to verify that the person in possession of the card 15 is the authorized card owner . the user then speaks into the microphone 32 , the speech recognition module 33 processing the speech sounds . if the user &# 39 ; s identity is verified by recitation of the correct pin or code word , the user is permitted to access the facilities provided by the atm 10 and a menu of the various transactions available to the user is described via the loudspeaker 30 : the speech generation module 31 may be controlled to run through a sequence of options and to prompt a particular response if a particular option is to be selected , for example : atm : โ if you wish to withdraw cash , please say โ one โ into the microphone ; or if you wish to hear your account balance ; please say โ two โ.โ this โ conversation โ continues until the transaction has been completed , or is interrupted . it will be apparent to those of skill in the art that the atm 10 described above may be utilized without difficulty by users with reading difficulties and users who are visually impaired . further , it is anticipated that many other users would prefer to converse with a terminal , particularly as the voice generation module 31 may be configured to issue instructions in a particular voice , accent or dialect : for example , the atm 10 may converse with a user with a woman &# 39 ; s voice , with a local accent and in local dialect . other users may choose other voices , or the voice may be selected by the atm operator : a user whose account is overdrawn may be advised , in a stern male voice , to immediately contact the relevant financial institution . also , the voice may be varied during a transaction , for example one voice may be used to issue instructions and prompts , and another voice used to describe other services not related to the transaction in progress . similarly , the speech recognition module 33 may be configured to expect instructions and prompts from the user in different voices , accents and dialects . users may be reluctant to converse with a terminal within earshot of others , particularly where security sensitive information , such as a pin or code word , is being relayed to the terminal . accordingly , terminals in accordance with the invention may be enclosed , partially enclosed , or otherwise arranged to minimize the possibility of the conversation between the terminal and the user from being overheard by third parties . alternatively , or in addition , the terminal may be provided with sensors 58 for determining the location of the user , and directional loudspeakers and microphones , such that the speech volume may be kept at a relatively low level , and to assist in eliminating background noise . to obviate the requirement for the user to state an identification number ( pin ) or the like , terminals in accordance with the invention may utilize biometric sensing means for identifying or verifying the identity of the user . such biometric sensing means are known and may use one or more of a variety of biometric patterns , including iris patterns , fingerprints , palm prints , voice patterns , finger geometry , or other physical traits or characteristics . the embodiment described above incorporates many of the features of a conventional atm , however it is of course possible to provide a terminal in accordance with the invention which may omit , for example , the keypad 16 , display screen 20 and keys 21 , with a corresponding saving in costs , and providing greater flexibility in the design and configuration of the terminal . in other embodiments , the sst may take a different form from that illustrated and described , for example a kiosk for issuing flight tickets . | 6 |
the process of the invention allows active ingredients ( solid or liquid on solid carrier ) to be formed into extrudates with a small quantity of a dissolvable , polymeric lubricant / binder , an amount of solvent that is sufficient to dissolve at least some of the polymeric lubricant / binder , and an optional anti - caking agent . the high lubricity of the dissolved polymeric component reduces frictional forces ( interparticle friction and friction at the edge of the die orifice ) that would conventionally produce heat and expose the active ingredient to detrimentally high temperatures . the high lubricity of the dissolved polymeric component of the present invention allows the solids in the extruder mixture to slide past one another more easily and thereby reduce frictional heating without reducing the desirable compaction effects of an extruder . frequently , the lubricity of the dissolved polymeric component is sufficient to allow extrusion without the need for temperature control or coolant introduction systems at the extrusion die . if desired , the extruded form can be cut to length and used without further processing or shaped into granules . unless otherwise noted , all percentages are by weight and are based on total weight . the active ingredients that can be granulated in accordance with the invention can be selected from a wide variety of materials . preferably , the active ingredients are solid particulates or liquids that are carried by inert or additionally active solid particulates . those active ingredients that are sensitive to heat are well suited for extrusion according to the present invention . exemplary active ingredients are useful as pharmaceutical drugs , biologic agents ( beneficial bacteria , inert viruses , and the like ), and agrochemicals ( agriculturally effective active ingredients with activity as herbicides , plant growth regulators , insecticides , fungicides , and essential plant minerals ), detergents , and similar chemical compounds or formulations . agrochemicals are particularly well suited for granulation according to the present invention . herbicides that can be extruded according to the invention include the triazines ( e . g ., atrazine ), the ureas , glyphosate , sulfosate , glyfosinate , and sethoxydim . plant growth regulators that can be extruded include plant growth hormones such as at least one of the 84 identified gibberillins with ca 3 , ga 4 , ga 5 , ca 7 and ga 9 being preferred ; cytokinins ( e . g ., zeatin , kinetin , benzyladenine , dihydrozeatin , and isopentenyl adenine ); auxins ( e . g ., indolacetic acid ( iaa ), indolebutyric acid ( iba ), and naphthalenacetic acid ( naa )); sodium ortho - nitrophenolate ; sodium para - nitrophenolate ; sodium 5 - nitro - guaicolate ; and polyhydroxycarboxylic acids of 2 , 4 , 5 , and 6 carbon structures ; ethephon ; chlormequat chloride ; mepiquat chloride ; and fertilizers . such plant growth regulators affect and alter plant metabolic processes to enhance or retard plant growth . insecticides that can be extruded according to the present invention include materials and biological agents that control a target insect population through lethal ingestion , sterilization , or other interference with the insect life cycle . exemplary insecticides include solid and liquid forms of the carbamates ( e . g ., carbaryl , aldicarb , methomyl , carbofuran , bendiocarb , oxamyl , thiodicarb , trimethylcarb ); organophosphates ( e . g ., phorate , terbufos , fonophos , isofenphos , ethoprop , fenamiphos , disulfoton , malathion , parathion , demeton , dimethoate , chlorpyrifos , diazinon , and phosmet ); compounds which break down the insect &# 39 ; s digestive tract tissue including fluorine compounds ( cryolite ), zinc , and mercury ; nicotine ; rotenone ; neem oil or azadiractin ; natural or synthetic pyrethrins ; petroleum oils ; the halogenated hydrocarbons ( e . g ., endrin , aldrin and its epoxide , dieldrin , heptachlor , ddt , bhc , lindane , chlordane , methoxychlor , ddd , tde , and the polychlorinated biphenyls ); and microbials ( e . g ., bacillus thuringiensis and entomopathic viruses such as insecticidal viruses such as the bacculo viruses ). fungicides that will benefit from the mixtures of the invention 1 include tridemorph , metalaxyl , iprodione , fosetyl - aluminum , thiophanate , benomyl , triadimefon , carboxin , oxycarboxin , carbendazim , thiabendazole , thiophanate , ethirimol , bupirimate , dimethirimol , captan , any of the ebdcs ( e . g ., mancozeb , maneb , niram , metiram , zineb , and ferbam ), chlorothalonil , iprodione , ziram , copper salts ( e . g ., copper sulfate and copper oxychloride ), and sulfur . the invention is particularly well suited for encapsulating captan in particles having 55 โ 80 wt % captan therein . other systemic agents for plants that benefit from the present invention include , inter alia , aldicarb , carbofuran , dimethoate , phorate , and terbufos , and the phosphoroamido ( di ) thioates . the phosphoroamido ( di ) thioates that can be used in the invention include insecticidally active compounds having the general formula : r 1 and r 2 individually are an alkyl , alkenyl or alkynyl group containing up to 6 carbon atoms , r 5 is hydrogen , an alkyl group containing 1 to 18 carbon atoms , a cycloalkyl group containing 3 to 8 carbon atoms , an alkenyl group containing 2 to 18 carbon atoms or an alkynyl group containing 3 to 18 carbon atoms , r 4 is hydrogen or an alkyl group containing 1 to 6 carbon atoms , and y is oxygen or sulfur . acephate is a particularly preferred insecticide for use in the present invention . it is commercially available in a technical grade solid of at least 97 wt % purity and is used in granules of the present invention in an amount of at least 92 wt %, preferably at least 94 wt %, and most preferably in an amount of at least 95 wt % based on total weight of the dried granule . the acephate is preferably milled before granulation . details of the milling process are described in my copending application ser . no . 60 / 279 , 433 . essential plant minerals that can be encapsulated according to the invention include any of the minerals known to the art to effect plant growth in conventional amounts . some examples include elemental and soluble salt forms of boron , nitrates , calcium , potassium , phosphates , iron , magnesium , sulfur , manganese , molybdenum , zinc , and copper . the dissolvable polymers for use with the present invention are soluble in a solvent ( e . g ., water , dimethylsulfoxide , emulsions , alcohol - water azeotropes , or mixtures of these ), solid at ambient temperatures , inert toward the active ingredient , and provide lubricity to the extrusion mixture upon at least partial dissolution in the inert solvent . suitable dissolvable polymers for use in the present invention include one or more of the poly ( alkylene oxides ) ( e . g ., poly ( ethylene oxide ), poly ( propylene oxide ), and poly ( butylene oxide )) with poly ( ethylene oxide ) being particularly preferred . a particularly preferred lubricant / binder component for the present invention is poly ( ethylene oxide ) having an average molecular weight of less than about 50 , 000 . a preferred average molecular weight is within the range from about 15 , 000 to about 35 , 000 . such materials are dry , free - flowing powders , completely soluble in water and certain organic solvents , and have crystalline melting points within the range of 63 ยฐ to 67 ยฐ c . useful amounts of the polymeric lubricant / binder is generally within the range from about 0 . 1 โ 5 wt %, preferably 0 . 2 โ 3 wt %, and more preferably 0 . 25 โ 2 wt % based on total weight of the composition . when used in an amount within the range of 0 . 2 โ 0 . 75 wt %, an extrudable mixture is formed that can be readily extruded through a 3 mm opening with a temperature rise of no more than a 4 ยฐ c ., and usually less than about 1 โ 2 ยฐ c . an anticaking agent can be added , if desired , in an amount sufficient to prevent clumping and caking of the dried extrudates . generally , anticaking agent is used in an amount within the range of 0 . 01 โ 1 . 5 wt % is needed . silica powder in an amount within the range of 0 . 5 โ 1 . 25 wt % is particularly useful . an amount of solvent is used that is sufficient to form an extrudable mixture of ingredients . generally , the solvent is used in an amount sufficient to dissolve the polymeric binder and form a lubricious liquid . this lubricious liquid mixture of solvent and dissolved polymer for the active ingredient and any additives used in the formulation . it is believed that the high lubricity of the dissolved polymer acts to reduce the interparticle friction forces and heat that are characteristic of prior extrusion processes . when the solvent is removed , the polymer acts as a structural binder that enhances the structural integrity of the extrudate . use of a polymer that is soluble in water can help to speed release of the active ingredients following application of the dried particles . preferably , the solvent is water , an alcohol - water azeotrope , organic solvents , e . g . : acetonitrile ; ethylene dichloride ; trichloroethylene ; methylene dichloride ; benzene ; dimethylformamide ; tetrahydrofuran ; alcohols that are liquid at temperatures within the range of 10 ยฐโ 100 ยฐ c . such as methanol , isopropanol , and butanol ; ketones such as methyl ethyl ketone , toluene , xylene , acetone and methyl isobutyl ketone ; dimethylsulfoxide ( dmso ); mono - and dialkyl ethers of ethylene glycol and their derivatives sold under the name cellosolve ยฎ by union carbide including derivative forms such as cellosolve ยฎ acetate , dimethyl cellosolve ยฎ, butyl cellosolve ยฎ, and diethyl cellosolve ยฎ; anisole ; 1 , 4 - dioxane ; ethyl acetate ; ethylenediamine ; mono - and dialkyl ethers of diethylene glycol and their derivatives sold under the name carbitol ยฎ by union carbide , and butyl acetate ), or a mix of these in an amount of less than 5 wt % based on the total formulation weight . the preferred solvents for use with the preferred polymers , poly ( alkylene oxides ), are nonaqueous ( where the active ingredient is susceptible to hydrolysis ) and selected from the group consisting of dmso , alcohols liquid at 10 ยฐโ 100 ยฐ c ., and alcohol - water azeotropic mixtures . the solvent for the polymeric binder can be used in an amount within the range of 0 . 5 โ 4 wt % and more preferably within the range of 1 โ 3 wt %. some adjustments up or down may be needed to accommodate ambient humidity within the extrusion facility , i . e ., high relative humidity may use added water solvent in the lower ranges ( e . g ., 0 . 25 โ 2 wt %) while low relative humidity may find it beneficial to use relatively more added water ( e . g ., 2 โ 5 wt %) to account for evaporation during manufacture . it is desirable , however , to use as little added solvent or water as possible . preferably , the polymeric lubricant / binder is dissolved in the solvent at a concentration within the range of 10 โ 20 wt % polymeric solids and sprayed onto the surface of the active ingredient and other granule solids . spraying enhances distribution of the polymeric lubricant / binder onto the surface of the solids without incurring the energy costs needed to achieve an equivalent distribution with a mixer blade . in the manufacturing process , an extrudable mixture of active ingredient solids , polymeric lubricant / binder , optional anticaking agent , and a small amount of added solvent is passed through an extrusion die having a suitable diameter , e . g ., within the range from about 1 โ 10 mm . the mixture is then extruded into granules . while the present invention reduces the frictional heat thru the die and extrusion can be performed at any desired temperature , the extrusion process is preferably performed at ambient temperatures ( e . g ., 15 ยฐ to 25 ยฐ c .). even more preferably , the extrusion is performed in the absence of controlled cooling or heating of the extrusion die and without the introduction of coolant liquid into the formulation . in the present invention , only so much solvent is added as is needed to render the polymeric component lubricious for the extrusion process and effective as a binder in the final granular product . the extrudate exiting from the extrusion die can be sliced or cut to length before entering a drier to remove excess solvent . suitable driers include convention ovens , fluidized beds , and the like . use of a fluidized bed operating at a temperature less than the melting point of the technical grade of active ingredient is particularly preferred . for example , acephate has a melting point within the range of 63 ยฐโ 67 ยฐ c ., so operation of the drier at a temperature of less than 60 ยฐ c . is preferred when granulating acephate . extrudates are often dried to a residual solvent content of less than 1 wt %, preferably to a residual solvent content within the range of 0 . 01 โ 0 . 5 wt %, and even more preferably within the range from about 0 . 01 โ 0 . 3 wt % based on total weight of the dried extrudate . usually , no more than about 2 โ 5 minutes is required for adequate drying . if the extrusion solvent is water and the active ingredient in the granule is sensitive to water or subject to hydrolysis upon storage , it is desirable to dry the extrudate to a residual moisture content of 0 . 5 wt % or less . it may also be preferable to avoid the use of water altogether and employ a nonaqueous solvent for the polymeric binder to provide adequate lubricity in the extrusion process . | 1 |
fig1 shows an embodiment of the method for selecting the focus setting . the steps of the method comprise acquiring a first image with a first focus setting 100 , acquiring a second image with a second focus setting 102 , divide a first image into a first grid of macroblocks 104 , divide a second image into second grid of macroblocks 106 , determine the first zone in a first grid of macroblocks and determine a second zone in second grid of macroblocks 108 , calculate the macroblock shift 110 , calculate first value of figure - of - merit for the first image and calculate the second value of figure - of - merit for the second image 112 , and select the focus setting 114 . typical autofocus support hardware provides a low resolution grid of focus information . each grid location corresponds to a fixed area of the sensor and the stores accumulated focus data relevant to that location . the focus data can be one or more focus metrics resulting from the accumulated magnitude of the focus filter or filters over the neighborhood of the grid element plus an accumulated green sum or average for the same grid location . the image regions covered by each grid location are fixed throughout the focus process and are many pixels on a side . for example , a grid of 16 ร 12 or more pixels can be used . thus it is not possible to modify the location of the focus zone , which now corresponds to a contiguous sub - rectangle of grid points , more precisely than the grid size of the hardware . this level of granularity in the placement of the focus zone is not accurate enough to implement in the aforementioned method . referring to the accumulated figure - of - merit and green sum data for each grid location as a macroblock , as it corresponds to a rectangular sub - array of pixels ; a sub - macroblock estimate of the motion 110 is found for a focus zone defined in the macroblock grid between subsequent frames of macroblock data for the focus sequence . the zone is chosen so as not to incorporate edge macroblocks in the grid and can therefore be any size up to ( n โ 2 )ร( m โ 2 ) macroblocks where n is the horizontal dimension of the macroblock grid and m is the vertical dimension . it is possible that a motion signal can be estimated directly in hardware for each element of the macroblock grid . this could then be accumulated over the macroblocks that constitute the focus zone in order to get a best estimate for the motion of the zone itself . however if such a signal is not available then it is possible to estimate the sub - macroblock motion from the green sum data of the macroblock grid . sum squared distance computations followed by quadratic surface fitting produce reasonable estimates of sub - macroblock motion . the quality and robustness of the motion estimate is further improved if the process of macroblock accumulation involves some degree of anti - aliasing ( that is the values accumulated in each macroblock arise from a region substantially larger than the macroblock grid element itself so that macroblock support regions considerably overlap ). this is an important design criteria for hardware solutions . using the sub - macroblock motion estimate it is possible to generate a motion compensated estimate of the changing figure - of - merit for the focus zone between any pair of subsequent frames . this is done by using a modified gaussian windowing function to accumulate the figure - of - merit data from the macroblocks that constitute the zone and a one macroblock border around the zone . this is why we the border macroblocks of the grid was not used to define the zone in the first place . a windowing function is often used to lessen the effects of exact location when accumulating data . rather than having a sharply defined boundary a windowing function transforms smoothly from full accumulation to zero accumulation . a 2d gaussian ( symmetric or asymmetric ) is a popular shape for a windowing function though other possibilities exist . it has the advantage that it is separable and can be composed from a pair of 1d gaussian functions . the window functions can be modified to allow for the measured estimate of the motion of the macroblocks between frames . this is described below . alternatively the embodiment of the method shown in fig1 can be implemented using specialized hardware . the first image 100 is acquired and then the second image 102 is acquired . the division of the first image into grid of macroblocks 104 and the division of the second image into a grid of macroblocks can be determined by the type of image . for instance for a landscape photograph , the most or all of the image can be divided into macroblocks . for a portrait the focus can be determined by dividing only the central portion of the image into macroblocks . the determination of the first zone of macroblocks and the second zone of the macroblock 108 and the calculation of the macroblock shift 110 can be implemented using algorithms used for mpeg image coding . the calculation of the figures - of - merit for the first and second images 112 and the select focus setting 114 can be performed as in the case where the green sum was used to calculate the macroblock shift . fig2 shows an embodiment of a digital imaging acquisition appliance . there is a housing 220 which encloses a ccd array 226 . on the housing there is also mounted actuators 224 which are used for actuating a lens 222 . the lens is adapted for being moved to different focal lengths with respect to the ccd array 226 . the primary goal of the present invention is to determine the proper focus setting or essentially the proper distance between the lens 222 and the ccd array 226 . the actuators 224 move the lens 222 into different positions , and images are acquired with the ccd array 226 . there is a connection between the ccd array 228 and the electronics assembly 230 . the electronics assembly 230 can comprise integrated circuits and it can also comprise micro - controllers or microprocessors adapted for performing calculations . the electronics assembly comprises a ccd array controller 232 , an image division element 234 , a macroblock shift calculation element 236 , a focus metric calculation element 238 , a figure - of - merit calculation element 242 , a focus setting selection element 246 , and a zone determination element 248 . these various elements could be implemented in hardware or they could be implemented as computer executable instructions that are performed by a micro - controller or a microprocessor . there can also be a mix between specialized integrated circuits and between elements that are implemented as machine executable instructions . in this figure the figure - of - merit calculation element 242 and the focus metric calculation element 238 are shown as being integrated into one specialized integrated circuit 244 . other elements that comprise the macroblock shift that comprise the electronics assembly could also be integrated into this or other specialized chips . the focus metric calculation element comprises a window function element 240 . the window of function element is used to average over a spatial group of macroblocks . this allows the measured motion estimate to be compensated accurately . fig3 shows a digital image 350 . the digital image 350 is comprised of individual pixels . a region of the digital image 350 has been divided into a grid of macroblocks 352 . within the grid of macroblocks 352 is located a zone 354 . the zone 354 is the region for which the figure - of - merit is calculated . the zone can be moved within the grid of macroblocks to find the optimal place to determine the figure - of - merit . the task is to choose a zone 354 of macroblocks that can be tracked accurately to give an overall figure - of - merit estimate that is relevant and robust to motion . when choosing a zone 354 , saturated and dark regions of the image should be avoided . each possible zone 354 location is considered , allowing a one macroblock border for tracking . the primary selection criterion for the first zone 354 is the number of saturated macroblocks in the zone 354 and in a one macroblock border around zone 354 . secondary selection criteria for the first zone 354 include : absolute value of the green sum gradient ( horizontal and vertical ), the figure - of - merit divided by the green sum , and selecting the zone with a maximum sum of squares difference ( ssd ) and / or sum of absolute difference ( sad ) over its eight neighbors . fig4 shows a group of macroblocks 452 . these macroblocks are labeled c 0 through c 8 . each of these locations indicates a position where a similarity metric is calculated . a least squares fit can be used to fit a quadratic surface to the similarity metric . c 0 is in the center and corresponds to the unshifted location and each of the surrounding macroblocks c 1 through c 8 correspond to a one macroblock shift . the similarity metric for each of these is calculated in each of the spots . a =(( c 1 + c 2 + c 8 + c 4 + c 5 + c 6 )โ 2 *( c 0 + c 3 + c 7 ))/ 6 ; b =(( c 2 + c 3 + c 4 + c 6 + c 7 + c 8 )โ 2 *( c 0 + c 1 + c 5 ))/ 6 ; where c 0 through c 8 corresponds to the value of the similarity metric at that position . the macroblock similarity metric is calculated using a sum of squares difference ( ssd ) or using a sum of absolute difference ( sad ) over its nearest neighbors . the metric is accumulated over the set of macroblocks that comprise the selected focus zone . it is computed using the green sum value for the individual macroblocks . fig5 shows an example of a quadratic surface 660 constructed with a lease squares fit for a similarity metric between the first zone and the second zone in the following image . the minimum of this surface is the sub - macroblock shift . the offset of the minima of the quadratic with respect to the centre of the macroblock labeled c 0 is at location dx and dy ( in macroblock sized units ) given by the following formula : however , there is a systematic bias due to the natural shape of the quadratic that fits through the data . this systematic bias can be compensated for by subtracting the offset determined by fitting a quadratic through a similarity metric of the first zone with its self from the estimate derived using the first and the second zones . fig6 shows the plot of a quadratic surface 660 fit to the similarity metric of the first zone with the macroblocks surrounding the first zone . the small systematic offset of the minima of this surface 660 is subtracted from the location of the minima in 560 . fig7 shows a graph demonstrating the correlation between macroblock motion and pixel motion as calculated by an offline simulation using real image data . the comparison of sub - macroblock motion against pixel motion for image zones collected over a 98 frame motion sequence with a mean frame to frame motion of 5 . 9 pixels . the mean euclidian error is 1 . 6 pixels ( rms 1 . 99 pixels ). the macroblocks were 16 ร 12 pixels . the line 770 shows the axle macroblock shift in relation to pixel motion . using the method of an embodiment of the invention , the x component 772 and the y component 774 of the calculated macroblock shift are highly correlated as can be seen in fig7 . fig7 demonstrates that the method allows for a reasonable estimate of the macroblock shift in relation to pixel motion . fig8 shows bar chart shows how the relative error of the figure - of - merit is reduced as the quality of motion compensation is improved . four different methods are compared : the first is no compensation 882 , the second is a gaussian window 884 , the third is a gaussian compensation 886 and the fourth is pixel tracking 888 . each of these had been performed for three different situations , one for a fast move which corresponds to an average of 5 . 9 pixels per frame , for a slow motion 894 which corresponds to 2 . 6 pixels and for no motion at all 896 . the no compensation 882 , gaussian window 884 , and gaussian compensation 886 are based on a macroblock figure - of - merit calculation and macroblock tracking while pixel tracking 888 uses pixel tracking and figure - of - merit accumulation . the gaussian window 884 method uses a fixed window and does not utilize macroblock motion estimate , while the gaussian compensation method 886 does . the figure - of - merit relative error is reduced as the quality of the motion compensation is improved . the relative error 890 is shown in comparison to four different methods . fig9 show a one - dimensional illustration of how a windowing function can be modified to compensate for sub - macroblock motion . in the top portion 908 of this figure a standard gaussian windowing function 900 is used to calculate the figure - of - merit for macroblocks 902 beneath it . the gaussian windowing function can be calculated as : g ( x )= exp (โ x 2 / ฯ 2 ), where x is the position coordinate , and ฯ is the standard deviation of the gaussian function and must be chosen to allow the function to approach zero over the extent of the zone over which the function - of - merit is being calculated . each macro block of the one - dimensional grid is multiplied by the value of the windowing function at its location or the average value of the window over the width of the macroblock . the figure - of - merit can be calculated as : where fom is the value of the function - of - merit , b is the value of the focus metric for a macroblock , i is an index used to reference all macroblocks , and gauss window is the value of the gaussian window function at the macroblock . a representative value of the window function can be chosen , or the gaussian function can be averaged over the macroblock . the final quantized window function gausswindow [ i ] can be normalized so that it sums to 1 . 0 over all possible values of i to make the method more numerically convenient . using a window function in this way has the advantage that edge effects on the function - of - merit are greatly reduced and hence some degree of tolerance to motion is introduced directly . however , the tolerance to motion can be increased further . the bottom portion 910 of fig9 illustrates that the location of the windowing function can be itself be modified to account for the sub - macro block shifts in the data accumulated into the macro - blocks themselves . the original gaussian windowing function 900 and a modified gaussian function 904 shifted by ฮด 906 are shown . to implement this , a windowing function must be calculated accounting for the sub - macro block shift . the shifted one - dimensional gaussian windowing functions are computed according to the function : where x is the position coordinate , ฯ is the standard deviation of the gaussian function and must be chosen to allow the function to approach zero over the extent of the zone over which the function - of - merit is being calculated , and ฮด is the sub - macroblock shift . the figure of merit is calculated as which is identical to gauss window except uses h ( x ) to replace g ( x ) as the windowing function . again gauss windowshifted [ i ] can be normalized so that it sums to 1 . 0 over all possible values of i . the quantized shifted windowing function gauss windowshifted [ i ] can be implemented , by calculating the window function each time it is used with calculated value of ฮด . however , this would be computationally intensive , and this can be avoided by precalculating the window function for preselected values of ฮด . the values of ฮด can be chosen so that the difference between values is determined by a preselected accuracy of the motion estimate . for example , if it is assumed the sub - macro block step up to the โ
a macro block is measurable , then we need only store 8 versions of the gaussian function need be computed ( and appropriately normalized ) ahead of time . each of these 8 functions corresponds to a different estimate of the motion shift . the gaussian is symmetrical so motion in the other direction can be computed from the same coefficients for the two - dimensional case . since the 2d gaussian window function is separable we only need store 2 sets of one - dimensional profiles . if the zone is square it would only be necessary to store a single set . | 6 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.